text
stringlengths 699
822k
| summary
stringlengths 205
4.34k
|
|---|---|
You are an expert at summarizing long articles. Proceed to summarize the following text:
revascularization with vein graft is a mandatory method for the treatment of dissecting or pseudoaneurysms of the internal carotid artery . saphenous vein harvesting is a difficult technique because of the close relation with patency and complication . we report the necessity for an air vent from the vein graft , and explain its method of use in two cases of external carotid artery middle cerebral artery bypass surgery . a 45-year - old male presented with subarachnoid hemorrhage ( hunt and kosnik grade iii ) . the exploration disclosed a dissecting aneurysm of the right internal carotid artery with a red - colored vascular wall . neck clipping was performed , but left hemiparesis followed because of a lacunar infarction in the right internal capsule . two weeks later , the subarachnoid hemorrhage recurred , and angiographic studies demonstrated the regrowth of an aneurysm on the right internal carotid artery . the frontal and parietal branches of the superficial temporal artery were anastomosed to the right middle cerebral artery to prevent cerebral infarction after trapping the right internal carotid artery . however , blood flow through the right superficial temporal artery was relatively poor , and the right middle cerebral artery was spastic . therefore , neck clipping was performed again instead of trapping the right internal carotid artery . thirty - eight days after the onset , the aneurysm s recurrence was found by an angiographic study ( fig . consequently , the right internal carotid artery was trapped after a high - flow bypass was made between the right external carotid artery and the m2 segment of the right middle cerebral artery , using a great saphenous vein . right carotid angiography , lateral view . angiographic study demonstrated recurrence of non - branching aneurysm ( ) in right internal carotid artery . after anastomosis was completed in both distal and proximal sides , temporary clip ( ) was applied to vein graft ( ) at distal portion ( ) of branch . after inflow pathway of vein graft was opened and ligation of branch was loosened , air vent could be done through the branch ( ) of vein graft . multiple air bubbles and a large quantity of white microemboli were discharged through this branch . patency of vein graft ( ) was verified . during the harvest of the vein graft , the accessory branch of the great saphenous vein was also found around the junctional region with a femoral vein , and was temporarily ligated . during the anastomosis on both the distal and proximal sides , a distal temporary clip was applied on the vein graft just proximal to the branch . a proximal temporary clip was also applied just distal to the anastomosed site to an external carotid artery . after anastomosis was completed on both the distal and proximal sides , the distal temporary clip on the vein graft was repositioned to the distal portion of the branch ( fig . after the proximal side of the vein graft was opened and the ligation of the branch was loosened , an air vent could be made through the branch of the vein graft . multiple air bubbles and a large quantity of white microemboli were discharged through this branch . after red blood passed through the branch , an aneurysmal clip was used to occlude it temporarily . subsequently , an internal carotid artery was trapped and the vein graft was recanalized by opening its distal clip . ultimately , the branch was occluded with a small titanium vascular clip . the postoperative course was uneventful , and the patency of the vein graft was also verified on angiography ( fig . a 60-year - old man had presented with an acute hemorrhage from his right external auditory meatus , after puncturing it with an ear pick . the patient developed repeated hemorrhages several times thereafter . he showed sudden onset of massive right aural bleeding and was admitted to the department of otology . bone window computed tomography showed a destroyed petrous bone around the right internal carotid artery . enhanced computed tomography scan showed that the internal carotid artery was exposed to the right middle ear with a pseudoaneurysm . investigation by right carotid angiography revealed that a pseudoaneurysm arose from the internal carotid artery , coursing through the middle ear ( fig . dissection occurred in the origin of the right vertebral artery , and right cerebellar and occipital infarctions followed . the patient showed ataxia in his right extremities , but he recovered enough to be able to do his daily work without assistance . this pseudoaneurysm at the petrous portion of the right internal carotid artery was supposed to be infectious following the chronic otitis media . right carotid angiography revealed pseudoaneurysm ( ) arising from internal carotid artery coursing through middle ear . distal end of saphenous vein graft ( ) , anastomosed to the right middle cerebral artery ( ) , is shown . although the branch ( ) existed around the distal end of vein graft , air vent was omitted to shorten ischemia . an temporary clip on vein graft proximal to branch ( ) postoperative three - dimensional computed tomography angiography confirming the patent vein graft ( ) . two weeks after the onset , the right internal carotid artery was trapped with an external carotid artery middle cerebral artery bypass surgery using a vein graft . at first , the distal end of the vein graft was anastomosed to the right middle cerebral artery , and its proximal end was anastomosed to the right external carotid artery later on . next , coil embolization of a distal internal carotid artery was performed using intraoperative angiography , followed by ligation of a proximal internal carotid artery . while opening the vein graft , the migrated air in the vein graft was observed moving to the middle cerebral artery . computed tomography scan demonstrated brain infarction , and dysarthria occurred postoperatively , although it recovered several weeks after the incident ( fig . 2c ) . three - dimensional computed tomography angiography confirmed the placement of the patent vein graft ( fig . a 45-year - old male presented with subarachnoid hemorrhage ( hunt and kosnik grade iii ) . the exploration disclosed a dissecting aneurysm of the right internal carotid artery with a red - colored vascular wall . neck clipping was performed , but left hemiparesis followed because of a lacunar infarction in the right internal capsule . two weeks later , the subarachnoid hemorrhage recurred , and angiographic studies demonstrated the regrowth of an aneurysm on the right internal carotid artery . the frontal and parietal branches of the superficial temporal artery were anastomosed to the right middle cerebral artery to prevent cerebral infarction after trapping the right internal carotid artery . however , blood flow through the right superficial temporal artery was relatively poor , and the right middle cerebral artery was spastic . therefore , neck clipping was performed again instead of trapping the right internal carotid artery . thirty - eight days after the onset , the aneurysm s recurrence was found by an angiographic study ( fig . consequently , the right internal carotid artery was trapped after a high - flow bypass was made between the right external carotid artery and the m2 segment of the right middle cerebral artery , using a great saphenous vein . right carotid angiography , lateral view . angiographic study demonstrated recurrence of non - branching aneurysm ( ) in right internal carotid artery . after anastomosis was completed in both distal and proximal sides , temporary clip ( ) was applied to vein graft ( ) at distal portion ( ) of branch . after inflow pathway of vein graft was opened and ligation of branch was loosened , air vent could be done through the branch ( ) of vein graft . multiple air bubbles and a large quantity of white microemboli were discharged through this branch . patency of vein graft ( ) was verified . during the harvest of the vein graft , the accessory branch of the great saphenous vein was also found around the junctional region with a femoral vein , and was temporarily ligated . during the anastomosis on both the distal and proximal sides , a distal temporary clip was applied on the vein graft just proximal to the branch . a proximal temporary clip was also applied just distal to the anastomosed site to an external carotid artery . after anastomosis was completed on both the distal and proximal sides , the distal temporary clip on the vein graft was repositioned to the distal portion of the branch ( fig . after the proximal side of the vein graft was opened and the ligation of the branch was loosened , an air vent could be made through the branch of the vein graft . multiple air bubbles and a large quantity of white microemboli were discharged through this branch . after red blood passed through the branch , an aneurysmal clip was used to occlude it temporarily . subsequently , an internal carotid artery was trapped and the vein graft was recanalized by opening its distal clip . ultimately , the branch was occluded with a small titanium vascular clip . the postoperative course was uneventful , and the patency of the vein graft was also verified on angiography ( fig . a 60-year - old man had presented with an acute hemorrhage from his right external auditory meatus , after puncturing it with an ear pick . the patient developed repeated hemorrhages several times thereafter . he showed sudden onset of massive right aural bleeding and was admitted to the department of otology . bone window computed tomography showed a destroyed petrous bone around the right internal carotid artery . enhanced computed tomography scan showed that the internal carotid artery was exposed to the right middle ear with a pseudoaneurysm . investigation by right carotid angiography revealed that a pseudoaneurysm arose from the internal carotid artery , coursing through the middle ear ( fig . dissection occurred in the origin of the right vertebral artery , and right cerebellar and occipital infarctions followed . the patient showed ataxia in his right extremities , but he recovered enough to be able to do his daily work without assistance . this pseudoaneurysm at the petrous portion of the right internal carotid artery was supposed to be infectious following the chronic otitis media . right carotid angiography revealed pseudoaneurysm ( ) arising from internal carotid artery coursing through middle ear . distal end of saphenous vein graft ( ) , anastomosed to the right middle cerebral artery ( ) , is shown . although the branch ( ) existed around the distal end of vein graft , air vent was omitted to shorten ischemia . an temporary clip on vein graft proximal to branch ( ) postoperative three - dimensional computed tomography angiography confirming the patent vein graft ( ) . two weeks after the onset , the right internal carotid artery was trapped with an external carotid artery middle cerebral artery bypass surgery using a vein graft . at first , the distal end of the vein graft was anastomosed to the right middle cerebral artery , and its proximal end was anastomosed to the right external carotid artery later on . next , coil embolization of a distal internal carotid artery was performed using intraoperative angiography , followed by ligation of a proximal internal carotid artery . while opening the vein graft , the migrated air in the vein graft was observed moving to the middle cerebral artery . computed tomography scan demonstrated brain infarction , and dysarthria occurred postoperatively , although it recovered several weeks after the incident ( fig . 2c ) . three - dimensional computed tomography angiography confirmed the placement of the patent vein graft ( fig . air vent of a graft is essential in extracranial - intracranial bypass surgery , because air bubbles or microthrombi can easily cause cerebral infarction . in the vein graft , air bubbles or microthrombi the valve has the complex figure to trap air bubbles and complicated characteristic features to generate microthrombi . it was reported that the valves opened and closed in each cardiac cycle at reduced flow ( 30 to 10 ml / min ) , and that the flow was stagnant for a considerable portion of the cardiac cycle . the trapped air bubbles and microthrombi generated in the vein graft can only be washed out antegradely , because the valve does not allow a retrograde flow through the graft . in case 2 , the air vent was omitted to shorten ischemia after the coil embolization of the distal internal carotid artery and ligation of the proximal internal carotid artery , although the branch existed in the outflow pathway of the vein graft . soon after flow was established in the vein graft , the migrated air bubbles , there was no ischemic event in case 1 after an adequate air vent was made . an air vent is easy to make if a branch of the vein graft exists in the outflow pathway , because intraluminal air or thrombus can be washed out through the branch at the final stage of surgery . this technique was mentioned only in one report insofar as we know ; therefore we consider that it should be stressed further in the future . 53.5% of them have a lateral accessory branch of the great saphenous vein , and 16.5% have a medial accessory branch , but no major branches were detected in 30% . if there is no vein graft branch in the outflow pathway , an air vent must be made in a different way . this method leaves only a small hole in the vein graft , and stenosis can be prevented by suturing the hole in a longitudinal direction of vein graft . anastomosis is performed in the external carotid artery at first , and the air vent is made during the second anastomosis in the middle cerebral artery . however , occlusion of the middle cerebral artery tends to take longer in that case , because many steps must be continuously performed as follows : loosening of temporary clips in two sites of vein graft , air vent , re - clipping of vein graft , tightening of suture in vein graft - middle cerebral artery anastomosis , and loosening of two clips of the middle cerebral artery . occlusion of the middle cerebral artery , on the other hand , is necessary only during the vein graft - middle cerebral artery anastomosis if the anastomosis is performed in the middle cerebral artery at first , and the air vent can be made through a branch of the vein graft later . another ischemia just happens later for a short duration between the ligation of an internal carotid artery , and the loosening of a clip on the outflow pathway of the vein graft . therefore , an air vent through the branch of vein graft is a useful technique for shortening the occlusion of middle cerebral arteries . this graft has no valve , so air bubbles or microthrombi tend to be trapped in the graft less frequently than with a vein graft . furthermore , an air vent can be easily arranged in retrograde fashion through the site of anastomosis in the arterial graft - external carotid artery . however , we selected the saphenous vein graft for fear of causing an inadequate blood flow to the forearm in the two current cases . | abstractrevascularization with a vein graft is a mandatory method for treatment of dissecting or pseudoaneurysms of the internal carotid artery .
we report the necessity for an air vent from the vein graft and explain its use in our two cases . in case 1 , we searched for a great saphenous vein around its junction with a femoral vein during the harvest of vein graft .
an accessory branch of that great saphenous vein was also found around the junctional region with a femoral vein , and was temporarily ligated . at first
, anastomosis was completed on both the distal and proximal sides .
after the proximal side of a vein graft was opened and the ligation of the branch was loosened , an air vent could be made through the branch of the vein graft .
multiple air bubbles and a large quantity of white microemboli were discharged through this branch .
the postoperative course was uneventful . in case 2
, the air vent was omitted to shorten ischemia . during the opening of the vein graft , the migrated air
was observed to move to the middle cerebral artery .
a computed tomography scan demonstrated that brain infarction and dysarthria occurred postoperatively .
the air vent of the vein graft is essential in extracranial - intracranial bypass surgery , because the air bubbles or microthrombi are easily trapped around the valve and cause cerebral infarction .
an air vent can be easily made if the branch of a vein graft exists in the outflow pathway , because intraluminal air or thrombus can be washed out through the branch at the final stage of surgery . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in the last decade , great progress was made in the use of grafts in dentistry with
the development of the biomaterials that became indispensable for professionals in
the areas of bucomaxillofacial surgery , paraendodontic surgery , orthognathic and
implants surgery . bone loss
owing to trauma or disease is not only a major socio - economic burden on world
healthcare systems , but also results in a reduced quality of life for the patient . current strategies for repair include bone autograft and allograft , both of which
have inherent limitations such as limited supply , increased morbidity , and disease
transmission potential . in this scenario , calcium phosphate ( ca - p ) porous ceramics had gained acceptance and
these are used in medical - dentistry fields in order to promote bone regeneration ,
increase , or substitution . calcium phosphate materials can be found in nature ( coralline hydroxyapatite ) or can
be synthesized by precipitation methods using chemical reagents . hydroxyapatite
( ha ) , ca10(po4)6(oh)2 , is the well - known
and widely studied ca - p . in both
medical and dental routine , the term " hydroxyapatite " is sometimes used to describe
any ca - p material . synthetic ca - p grafts may be the material of choice , especially
when large defects need to be filled . it is generally accepted that these
bioceramics are only osteoconductive ( have the ability to support tissue growth and
bone formation ) and non - osteoinductive , i.e. , they do not have the ability to form
new bones when implanted in non - osseous sites . based on their physic - chemical properties , the bone - graft material may be either
resorbable or non - resorbable , with respect to the extent of dissolution of ca - p
materials . the factors affecting the dissolution properties are similar to those
affecting biodegradation or bioresorption . among other physicochemical characteristics , ha crystallinity and ca / p molar ratio have been reported to affect its solubility , protein adsorption , and osteoblast
attachment , possibly
compromising biological responses . however , no in vivo data are
available in the literature . in order to achieve this point , the aim of this work is
to analyze the tissue response of two ha granules with different physicochemical
properties in critical - size calvaria rat defects . the ha ( ha-1 and ha-2 ) granules ( 250 - 1000 m ) were obtained from the ha powder ,
produced from reactive calcium phosphates at room temperature , in the
biomaterials laboratory , coppe , federal university of rio de janeiro ( rio de
janeiro , rj , brazil ) . previous analysis showed that ha-1 granules presented a
ca / p molar ratio of 1.6 and 28% crystallinity , while the ha-2 granules had a
ca / p molar ratio of 1.67 and 70% crystallinity , as determined by chemical
analysis and x - ray diffraction ( xrd ) , respectively ( figure 1 ) . morphological characterization of the materials
was carried out with the help of scanning electron microscopy ( zeiss , model dsm
940a , oberkochen , baden - wrttemberg , germany ) operating at 20 kv of electron
acceleration . to identify the crystalline phases in the biomaterials , an x - ray
diffractometer ( drx - miniflex , rigaku , tokyo , japan ) was used , which operated at
30 kv , 15 ma , and cuk radiation . the crystallinity of the materials was
determined from the drx patterns according to the methodology proposed by landi ,
et al . ( 2000 ) . ha-1 and ha-2 x - ray diffraction ( xrd ) the ethics committee of bauru school of dentistry , university of so paulo ( usp )
approved the protocol of the surgical intervention ( ceepa - n 18/2004 ) . all the
procedures were followed under rules of brazilian college of animal
experimentation ( cobea ) . forty - five adult rattus norvegicus ( 250 g body weight ) were
submitted to skull surgery under general anesthesia with intramuscular
administration of xylazine / ketamine ( v : v , agribrands ltda ,
paulinia , sp , brazil ) . briefly , after local trichotomy of the frontoparietal
region and vigorous disinfection with iodoform alcohol , the surgical area was
isolated and a half moon - shaped incision was made in the lining epithelium of
the skull with a # 10 surgical knife . the flap was then raised backwards with a
molt spatula , thus widely exposing the bone surface of the skull . using a
surgical trephine ( 8 mm in diameter ) , a perforation was made in the parietal
bone , under abundant and continuous irrigation with saline solution to avoid any
thermal injury , crossing the entire diploe and exposing the dura mater at the
bottom of the defect . the defects were filled with blood clot , ha-1 , and ha-2 in
15 animals each . nylon sutures ( ethicon , johnson & johnson , so
jos dos campos , sp , brazil ) were employed to close the reposed flap of each
animal . the rats were killed by an overdose of the anesthetic agent after 1 , 3 , and 6
months of surgery . the skullcaps with overlaying skin were collected and fixed
in 10% phosphate buffered formalin for one week , demineralized in morse solution
( 50% formic acid and 20% sodium citrate , 1:1 ) for 40 days , dehydrated in
ethanol , cleared with xylene , and embedded in histosec ( merck ,
darmstadt , germany ) . hematoxylin - eosin stained 5-m thick semi - serial section
was used for descriptive and histomorphometric analysis . using an axioscop ( carl zeiss , darmstadt , germany ) , we evaluated the
presence of blood clots and inflammatory infiltrates , the intensity of
angiogenesis , formation of fibrous tissues , resorption of graft material ,
reorganization of the periosteum , and bone formation and remodeling . we determined the volume density of connective tissue , neoformed bone , and
biomaterial on non - superposed digital images of the total area of the bone
defect obtained using sony cyber - shot ( p-83 , tokyo , japan ) digital camera
coupled to a microscope ( jenaval - zeiss , darmstadt , germany ) under 20 objective
( n.a . segmentation allowed
determination of the total image area and relative area of the connective
tissue , biomaterial , and neoformed bone . kruskall - wallis or mann - whitney tests
determined the existence of significant differences ( if
p<0.05 ) among the volume density of each parameter . the ha ( ha-1 and ha-2 ) granules ( 250 - 1000 m ) were obtained from the ha powder ,
produced from reactive calcium phosphates at room temperature , in the
biomaterials laboratory , coppe , federal university of rio de janeiro ( rio de
janeiro , rj , brazil ) . previous analysis showed that ha-1 granules presented a
ca / p molar ratio of 1.6 and 28% crystallinity , while the ha-2 granules had a
ca / p molar ratio of 1.67 and 70% crystallinity , as determined by chemical
analysis and x - ray diffraction ( xrd ) , respectively ( figure 1 ) . morphological characterization of the materials
was carried out with the help of scanning electron microscopy ( zeiss , model dsm
940a , oberkochen , baden - wrttemberg , germany ) operating at 20 kv of electron
acceleration . to identify the crystalline phases in the biomaterials , an x - ray
diffractometer ( drx - miniflex , rigaku , tokyo , japan ) was used , which operated at
30 kv , 15 ma , and cuk radiation . the crystallinity of the materials was
determined from the drx patterns according to the methodology proposed by landi ,
et al . the ethics committee of bauru school of dentistry , university of so paulo ( usp )
approved the protocol of the surgical intervention ( ceepa - n 18/2004 ) . all the
procedures were followed under rules of brazilian college of animal
experimentation ( cobea ) . forty - five adult rattus norvegicus ( 250 g body weight ) were
submitted to skull surgery under general anesthesia with intramuscular
administration of xylazine / ketamine ( v : v , agribrands ltda ,
paulinia , sp , brazil ) . briefly , after local trichotomy of the frontoparietal
region and vigorous disinfection with iodoform alcohol , the surgical area was
isolated and a half moon - shaped incision was made in the lining epithelium of
the skull with a # 10 surgical knife . the flap was then raised backwards with a
molt spatula , thus widely exposing the bone surface of the skull . using a
surgical trephine ( 8 mm in diameter ) , a perforation was made in the parietal
bone , under abundant and continuous irrigation with saline solution to avoid any
thermal injury , crossing the entire diploe and exposing the dura mater at the
bottom of the defect . the defects were filled with blood clot , ha-1 , and ha-2 in
15 animals each . nylon sutures ( ethicon , johnson & johnson , so
jos dos campos , sp , brazil ) were employed to close the reposed flap of each
animal . the rats were killed by an overdose of the anesthetic agent after 1 , 3 , and 6
months of surgery . the skullcaps with overlaying skin were collected and fixed
in 10% phosphate buffered formalin for one week , demineralized in morse solution
( 50% formic acid and 20% sodium citrate , 1:1 ) for 40 days , dehydrated in
ethanol , cleared with xylene , and embedded in histosec ( merck ,
darmstadt , germany ) . hematoxylin - eosin stained 5-m thick semi - serial section
was used for descriptive and histomorphometric analysis . using an axioscop ( carl zeiss , darmstadt , germany ) , we evaluated the
presence of blood clots and inflammatory infiltrates , the intensity of
angiogenesis , formation of fibrous tissues , resorption of graft material ,
reorganization of the periosteum , and bone formation and remodeling . we determined the volume density of connective tissue , neoformed bone , and
biomaterial on non - superposed digital images of the total area of the bone
defect obtained using sony cyber - shot ( p-83 , tokyo , japan ) digital camera
coupled to a microscope ( jenaval - zeiss , darmstadt , germany ) under 20 objective
( n.a . segmentation allowed
determination of the total image area and relative area of the connective
tissue , biomaterial , and neoformed bone . kruskall - wallis or mann - whitney tests
determined the existence of significant differences ( if
p<0.05 ) among the volume density of each parameter . the procedures were well tolerated by all experimental animals and no complications
were observed after surgery . in summary , all groups presented fibrous connective tissues fulfilling the
critical - size defect and sparse neoformed bone areas were observed in all the
animals , mainly at the edge of defect . no significant difference was noticed
between ha-1 and ha-2 and dense connective tissues surrounded the biomaterials
granules except for some particles where a directed bone apposition to ha
occurred . tissue response to biomaterials , irrespective of crystallinity and
ca / p molar ratio , presented foreign body reaction with multinucleated and
macrophage - like cells , occasionally observed in contact with the
biomaterials . animals from control group , one month after surgery , presented a typical chronic
inflammatory infiltrate with a few polymorphonuclear leucocytes close to the
blood vessels and mononuclear cells ( macrophages - like cells ) , as showed in the
figure 2a . the presence of
polymorphonuclear cells and mast cells was similar in ha-1 , ha-2 and control
groups ( figure 2c ) . the macrophages were
more abundant surrounding the ha granules , it being multinucleated giant cells
( figure 2c ) . a )
control group ( blood clot ) , 1 month ; the interface between old bone ( ob )
and new bone ( nb ) presents a line ( arrow ) ; asterisk ( * ) shows the
connective tissue . b ) control group , 6 months ; the old bone ( ob ) and new
bone ( nb ) separated by connective tissue ; interestingly , an animal of
five presented endochondral ossification in the center of the bone
defect ( inner figure ) . c ) ha-1 group , 1 month ; presence of new bone ( nb )
and multinucleated giant cells ( arrows ) and connective tissue ( * ) were
observed surrounding ha particles and new bone ( nb ) ; d ) after 6 months ,
a fibrous connective tissue ( fct ) was enriched by newly - formed blood
vessels ( arrows ) and multinucleated giant cells in contacting ha
particles ( circle ) . e ) section showing the border of the bone defect
presenting old bone ( ob ) new bone ( nb ) interface ( straight line ) and
ha-2 particles ( * ) surrounded by fibrous connective tissue ( fct ) close
to the border and at the center of critical size defect . magnifications :
40x ( a , c , d , inner figure in b ) ; 12.5x ( b , e ) the intensity of the inflammatory infiltrate decreased after 3 months of
implantation , particularly concerning the presence of macrophages , but with
increased incidence of multinucleated foreign body giant cells in both ha-1 and
ha-2 groups ( not shown ) . the inflammatory infiltrate disappeared in control group , it being that just an
animal ( from group of five ) showed new bone in the center of the defect after
six months ( figure 2b ) . in both ha-1 and
ha-2 groups the microscopic aspects were similar to previous period , presenting
mononuclear cells scattered through the dense connective tissue and
multinucleated foreign body giant cells around both types of ha particles ( figure 2d and e ) . throughout the experimental periods ( table
1 ) , the volume density of connective tissue in the control group was
almost twice greater than ha-1 and ha-2 groups ( p=0.012 , student - newman - keuls
test ) . the volume density of bone between tested groups did not change
significantly at any experimental period remaining around 30% after six months . temporal analysis from one to three months for volume density of connective
tissue , bone and ha-1 and ha-2 showed no significant difference ( table 1 ) . mean percentage ( standard deviation ) of the volume density of bone ,
fibrous connective tissue and residual biomaterial at 1 , 3 , and 6 months
after implantation in critical size bone defect ( anova and tukey test if
p<0.05 ) in summary , all groups presented fibrous connective tissues fulfilling the
critical - size defect and sparse neoformed bone areas were observed in all the
animals , mainly at the edge of defect . no significant difference was noticed
between ha-1 and ha-2 and dense connective tissues surrounded the biomaterials
granules except for some particles where a directed bone apposition to ha
occurred . tissue response to biomaterials , irrespective of crystallinity and
ca / p molar ratio , presented foreign body reaction with multinucleated and
macrophage - like cells , occasionally observed in contact with the
biomaterials . animals from control group , one month after surgery , presented a typical chronic
inflammatory infiltrate with a few polymorphonuclear leucocytes close to the
blood vessels and mononuclear cells ( macrophages - like cells ) , as showed in the
figure 2a . the presence of
polymorphonuclear cells and mast cells was similar in ha-1 , ha-2 and control
groups ( figure 2c ) . the macrophages were
more abundant surrounding the ha granules , it being multinucleated giant cells
( figure 2c ) . a )
control group ( blood clot ) , 1 month ; the interface between old bone ( ob )
and new bone ( nb ) presents a line ( arrow ) ; asterisk ( * ) shows the
connective tissue . b ) control group , 6 months ; the old bone ( ob ) and new
bone ( nb ) separated by connective tissue ; interestingly , an animal of
five presented endochondral ossification in the center of the bone
defect ( inner figure ) . c ) ha-1 group , 1 month ; presence of new bone ( nb )
and multinucleated giant cells ( arrows ) and connective tissue ( * ) were
observed surrounding ha particles and new bone ( nb ) ; d ) after 6 months ,
a fibrous connective tissue ( fct ) was enriched by newly - formed blood
vessels ( arrows ) and multinucleated giant cells in contacting ha
particles ( circle ) . e ) section showing the border of the bone defect
presenting old bone ( ob ) new bone ( nb ) interface ( straight line ) and
ha-2 particles ( * ) surrounded by fibrous connective tissue ( fct ) close
to the border and at the center of critical size defect . magnifications :
40x ( a , c , d , inner figure in b ) ; 12.5x ( b , e ) the intensity of the inflammatory infiltrate decreased after 3 months of
implantation , particularly concerning the presence of macrophages , but with
increased incidence of multinucleated foreign body giant cells in both ha-1 and
ha-2 groups ( not shown ) . the inflammatory infiltrate disappeared in control group , it being that just an
animal ( from group of five ) showed new bone in the center of the defect after
six months ( figure 2b ) . in both ha-1 and
ha-2 groups the microscopic aspects were similar to previous period , presenting
mononuclear cells scattered through the dense connective tissue and
multinucleated foreign body giant cells around both types of ha particles ( figure 2d and e ) . throughout the experimental periods ( table
1 ) , the volume density of connective tissue in the control group was
almost twice greater than ha-1 and ha-2 groups ( p=0.012 , student - newman - keuls
test ) . the volume density of bone between tested groups did not change
significantly at any experimental period remaining around 30% after six months . temporal analysis from one to three months for volume density of connective
tissue , bone and ha-1 and ha-2 showed no significant difference ( table 1 ) . mean percentage ( standard deviation ) of the volume density of bone ,
fibrous connective tissue and residual biomaterial at 1 , 3 , and 6 months
after implantation in critical size bone defect ( anova and tukey test if
p<0.05 ) synthetic and natural ca - p - based materials may be a suitable alternative to
autogenous graft . with various
bone grafting options available to the surgeons , one must carefully match the
clinical problem with the capabilities of graft material . sintering process provides
strength to a finished material , but when applied to bone , decreases remodeling and
resorption capability of the biomaterial . among several
factors , chemical composition , particles size , and crystallinity are likely to
affect the ceramic solubility , which can be adjusted for the desired
purpose . different applications require materials with
different resorption rates , which can be regulated by the mixture of several ca - p
phases . crystallinity is
highly dependent on the sintering temperature - the high sintering temperature
results in more perfect crystal , and thus , the degradation rate is lesser . on the other hand , more extensive
interconnected porosity of materials permits faster bone growth , but it becomes the
material weaker ; the ideal pore size is considered to be between 150 and 500
microns , like those ones naturally designed . industrially , the degree of
microporosity depends on the compaction process of the starting powder and the
temperature for producing engineered materials . the presence of pores in the
granules increases the surface area in the biomaterials , favoring osteoconduction ,
and also enabling bone growth in the pores . the ha granules , from both ha-1 and ha-2 groups ,
presenting different crystallinity ( 28 and 78% , respectively ) and ca / p molar ratio
( 1.60 and 1.67 , respectively ) should present differential biological response . thus ,
the positive hypothesis was that less crystalline and calcium - deficient
hydroxyapatite ( ha-1 ) presents bigger degradability than others . despite many in vivo models available for biocompatibility assay critical size defect varies in relation to the
animal species , localization and animal age ; in rat calvaria bone defect of 5
mm and 8 mm have been widely used . based on our
results , this work supports previous studies that concluded that bone defects of 8
mm diameter did not allow self regeneration up to six months . the lack of membrane over the biomaterial for guided bone regeneration ( gbr ) may
explain the high amount of fibrous tissues in the defects . as
discussed in the current literature , the different densities of fibrous tissues
among the experimental groups and control group were related to the ha granules in
the defect of the experimental groups . gbr has been
recognized as a predictable and effective method for enhancing bone healing over a
decade , and both animal and human models have illustrated its efficacy . it has been shown that the use of absorbable membrane
alone was able to fully regenerate a critical size defect . the experimental groups did not show greater bone formation than the control group ,
and the results are similar to previous studies in humans ( table 2 ) . it is worthwhile to mention that in
the current literature , synthetic and natural hydroxyapatite promoted similar levels
of new bone . the residual bone graft biomaterial in the experimental groups
increased the mineral content inside the bone defects and did not interfere with the
bone formation , acting as an osteoconductor biomaterial . however , the present work
is the first evidence comparing in vivo synthetic hydroxyapatites
with low ( 28% ) and high ( 70% ) crystallinity and distinct ca / p ratio content , showing
that intensity of bone repair was independent of these parameters . an explanation of
this statement is that one published recently ; their results revealed key steps of the mechanism for the
bioactivity of hydroxyapatite , which are the solubilization of hydroxyapatite and
the equilibrium that is formed on the surface . these processes modify the
hydroxyapatite surface , whose composition is changed to a new calcium phosphate
compound with the chemical formula of cahpo4 . a clear description of the
transformations that occur on the surface of hydroxyapatite and of the interplay
between these transformations and cell activity are two fundamental aspects of
processes in which hydroxyapatite takes part , such as bone substitution , bone
remodeling , osteoporosis and caries . percentage of bone , fibrous tissue and biomaterial observed in the present
and related studies in conclusion , the different characteristics of ha granules did not affect the bone
formation in the critical - size defect of rats , despite their biocompatibility . it is
known that sintered biomaterials lead to products virtually not absorbable and ,
thus , developing new strategies to produce absorbable material tend to improve its
efficacy . taken together , these results guide the material engineer for producing
biphasic materials containing beta - tcp and non - sintered hydroxyapatite as a
potential material to provide bone growth . another challenge is the production of
mechanically stable scaffolds to support the forces applied during surgical
procedures . | objectivethe physicochemical properties of hydroxyapatite ( ha ) granules were observed
to affect the biological behavior of graft materials . the aim of this work
was to analyze the tissue response of two ha granules with different
crystallinity and ca / p ratio in vivo .
material and methodsthe ha granules were produced in the biomaterials laboratory ( coppe / ufrj ) .
the testing materials were ha granules presenting a ca / p molar ratio of 1.60
and 28% crystallinity ( ha-1 ) , and a ca / p molar ratio of 1.67 and 70%
crystallinity ( ha-2 ) .
both has were implanted into a critical - size calvaria
rat defects .
resultsto note , in the control group , the bone defects were filled with blood clot
only .
descriptive and histomorphometric analyses after 1 , 3 , and 6 months
postoperatively showed mild inflammatory infiltrate , mainly comprising
macrophage - like and multinucleated giant cells , and an increase in the
volume density of the fibrous tissues ( p<0.05 ) , which was in contrast to
the similar volume density of the newly formed bone and biomaterials in
relation to the control group .
conclusionthus , we concluded that ha-1 and ha-2 are biocompatible and non - degradable ,
and that crystallinity does not affect bone repair of critical size
defects . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
toe grip is a complex motion that involves several muscles , similar to hand grip . the
muscles involved in toe grip include the flexor pollicis brevis , flexor pollicis longus , the
lumbricals , flexor brevis , and flexor longus1 . toe grip strength can be increased by training2 , 3 , which can decrease
the risk of falls1 , 4 , 5 . therefore , interventions
targeting toe grip strength are effective ; however , the mechanisms behind toe grip strength
have not been sufficiently investigated . murata et al.6 reported that toe grip
strength is affected by three factors : body weight , foot flexibility , and foot- arch height . moreover , uritani et al.7 reported that
toe grip strength is affected by four factor : age , gender , height , and weight . recently ,
souma et al.8 , 9 measured toe grip strength using surface electromyography ( emg ) . they reported that the crural muscles help the ankle joint by co - contracting during toe
grip , and that the activity of the tibialis anterior muscle plays a specific and important
role . souma et al.10 performed a
kinematic analysis of angular changes in the ankle joint and compared the results with the
percentage of integrated electromyography ( % iemg ) of the leg muscle activities during toe
grip . they reported that the mean change in the ankle angle in dorsiflexion from a neutral
position was 3 , and a positive correlation was found between this angle and toe grip
strength . moreover , the activities of the tibialis anterior muscle and the medial head of
the gastrocnemius muscle demonstrated positive correlations with toe grip strength . some
studies have reported that a change in the angle of ankle dorsiflexion during toe - grip
actions , and the activities of the tibialis anterior muscle and the medial head of the
gastrocnemius muscle are related to toe grip strength . accordingly , this study aimed to
determine the main factor influencing toe grip strength among these factors . the purposes of this study were to examine the relationship between toe grip strength and
the factors suggested to have a relationship with toe grip strength in previous studies ,
aiming to clarify the factors influencing toe grip strength in healthy women . their age , height ,
and body weight ( mean standard deviation ) were 21.2 0.4 years , 159.6 3.7 cm , and 51.5
4.8 kg , respectively . the present study was approved by the ethics committee for human
research of tohoku fukushi university ( rs160103 ) , and all subjects provided their informed
consent prior to participation . as described by murata6 , uritani7 and souma8,9,10,11 , the toe grip strength of
the dominant foot , angular changes in the ankle joint during toe grip , maximum voluntary
contraction ( mvc ) activities of the rectus femoris , biceps femoris , tibialis anterior , and
medial head of the gastrocnemius muscles , toe curl ability , foot - arch height ratio , and
weight were measured . toe grip strength was measured using a toe - grip dynamometer ( t.k.k.3360 ; takei co. , ltd . , the subjects were instructed to sit with their trunk in a vertical
position , to place their hip and knee joints at 90 , and to keep their ankle joints in the
neutral position7,8,9,10 . after a sufficient number of training trials and adequate rest ,
the toe grip strength was measured twice , and the maximum force was used in the analysis . in
all subjects , the right toe , which was defined as the toe used to kick a ball , was
dominant . scottsdale , az , usa ) was attached to the inside
of the lower leg over the center line , and the plantar surface of the toe was used10 . when achieving maximum voluntary
isometric contraction of the rectus femoris , biceps femoris , tibialis anterior , and medial
head of the gastrocnemius muscles , the level of exertion of muscular activity may vary
depending on each joint angle . therefore , the maximum muscular strength at a specific angle
was measured at each joint angle at the time of the toe grip strength measurement . to
measure the mvc activities of the tibialis anterior and medial head of the gastrocnemius
muscles , each subject was instructed to sit on a chair with the ankle joint in the neutral
position , and to exert maximal force of plantar flexion and dorsiflexion in isometric
contraction in order to resist the force applied by the examiner in the direction of
dorsiflexion and plantar flexion . to measure the mvc activity of the rectus femoris and
biceps femoris muscles , each subject was instructed to sit on a chair with the hip and knee
joints at 90 and to exert maximal isometric force of knee extension and flexion in
isometric contraction in order to resist the force applied by the examiner in the direction
of flexion and extension . muscular activity was measured using a surface emg apparatus ( telemyog2 ; noraxon inc . , after adequate skin preparation ( skin resistance of < 5 k ) ,
electrodes ( blue sensor ; ambu inc . ballerup , denmark ) were attached to the tibialis
anterior , medial head of the gastrocnemius , rectus femoris , and biceps femoris muscles , as
described by peroto11 . to measure the
tibialis anterior muscle , electrodes were attached at four fingerbreadths from the tibial
tuberosity and one fingerbreadth from the tibial crest . for the medial head of the
gastrocnemius muscle , electrodes were attached five fingerbreadths from the popliteal fossa
crease in the medial belly . for the rectus femoris muscle , an electrode was attached to the
midpoint between the superior edge of the patella and the anterior superior iliac spine . for
the long head of the biceps femoris muscle , an electrode was attached to the skin at the
midpoint between the head of the fibula and ischial tuberosity10 . the
segment of emg signal that was selected and integrated ( iemg ) for analysis was the middle
1 s of the entire 3-s duration of continuous maximal toe grip exertion . the muscular activity used for the analysis was
based on the data of the maximum toe grip strength . to measure the toe curl ability , the foot length , which was defined as the length between
the tip of the big toe and heel , and the flexed foot length , which was defined as the length
between the tip of the big toe and heel while placing the fulcrum in the calcaneal region
and bending the toe , were measured . the toe curl ability was calculated as the flexed foot
length minus the foot length , divided by the foot length6 , 7 . the toe curl ability is
used as an indicator of flexibility , and greater toe curl ability values indicate greater
toe and foot flexibility and mobility6 , 7 . to measure the foot - arch height ratio , the navicular height , which was defined as the
height between the navicular tuberosity and floor , was measured . the foot - arch height ratio
was calculated as the navicular height divided by the foot length . the foot - arch height
ratio is used as an indicator of the degree of the medial longitudinal arch of the foot , and
greater foot - arch height ratio values indicate a higher medial longitudinal arch of the
foot6 , 7 ,
12 , 13 . chicago , il , usa ) was used for the
statistical analysis . the relationship between toe grip strength and each measured value thereafter , stepwise multiple regression
analyses ( step - down procedure ) were performed , with toe grip strength as the dependent
variable , and weight , foot flexibility , foot - arch height percentage , angular changes in the
ankle joint during toe grip , and % iemg of the rectus femoris , biceps femoris , tibialis
anterior , and medial head of the gastrocnemius muscles as the independent variables , in
order to find factors that influenced toe grip strength . table 1table 1.mean and standard deviations of the measured values ( n=12)meanstandard deviationtoe grip strength ( kg)15.94.3toe curl ability ( cm)2.90.8foot - arch height ratio ( cm)19.92.3weight ( kg)51.54.8angular changes in the ankle joint ( )3.22.0rectus femoris muscle ( % iemg)3.11.6long head of the biceps femoris muscle ( % iemg)31.920.8tibialis anterior muscle ( % iemg)35.319.3medial head of the gastrocnemius muscle ( % iemg)20.919.2%iemg : percentage of integrated electromyography shows the average and standard deviations of the measured values of the 12
subjects . based on spearman s correlation coefficient , in higher order of correlation , toe
grip strength was significantly positively correlated with foot - arch height ratio ( r=0.69 ,
p<0.05 ) , % iemg of the tibialis anterior muscle ( r=0.67 , p<0.05 ) , toe curl ability
( r=0.66 , p<0.05 ) , % iemg of the medial head of the gastrocnemius muscle ( r=0.61 ,
p<0.05 ) , and angular changes in the ankle joint ( r=0.60 , p<0.05 ) ( table 2table 2.correlation between toe grip strength and each measured value during toe grip
strength exertion ( n=12)toe grip strengthweighttoe curl abilityfoot - arch height ratioangular changes in the ankle jointrectus femoris muscle ( % iemg)long head of the biceps femoris muscle ( % iemg)tibialis anterior muscle ( % iemg)weight0.30toe curl ability0.660.05foot - arch height ratio0.690.010.83angular changes in the ankle joint0.603.950.460.25rectus femoris muscle ( % iemg)0.010.120.120.190.40long head of the biceps femoris muscle ( % iemg)0.42.40.370.290.020.58tibialis anterior muscle ( % iemg)0.670.440.310.280.530.250.05medial head of the gastrocnemius muscle ( % iemg)0.610.030.340.670.310.540.060.63pearson s correlation coefficient . * p<0.05 ; * * p<0.01 ) . however , toe grip strength was not correlated with weight , % iemg of the
rectus femoris muscle , and biceps femoris muscle . * p<0.05 ; * * p<0.01 variables with significant differences were subjected to multiple regression analysis with
toe grip strength as the dependent variable . the predictors in the resulting model were the
foot - arch height ratio ( =0.54 , p<0.01 ) and % iemg of tibialis anterior
muscle ( =0.51 , p=0.01 ) . the present study examined the relationship between toe grip strength and each factor by
measuring weight , toe curl ability , foot - arch height ratio , angular changes in the ankle
joint during toe grip , and % iemg of the rectus femoris muscle , biceps femoris muscle ,
tibialis anterior muscle , and the medial head of the gastrocnemius muscle . these factors
were suggested to have relationships with toe grip strength in previous studies , and the aim
of this study was to clarify the factors influencing toe grip strength in healthy women . in the present study , single correlation analysis found toe grip strength had significant
positive correlations with five factors : toe curl ability , foot - arch height ratio , angular
changes in the ankle joint , and the % iemg of the tibialis anterior muscle and the medial
head of the gastrocnemius muscle . these five factors were also reported as having
significant positive correlations with toe grip strength in previous studies6 , 10 . thus , the present study confirmed these correlations . the correlation coefficient of toe
grip strength and the foot - arch height ratio was the highest among the measured items . the
foot - arch height ratio is often used as an indicator of the medial longitudinal arch of the
foot12 , 13 . the structure of the medial longitudinal arch of foot includes the
flexor pollicis longus and flexor longus , which exert toe grip strength . furthermore , the present study demonstrated that
when the tibialis anterior and medial head of the gastrocnemius muscle have greater % iemg
values , the toe curl ability and ankle angle increase , and toe grip strength are
correspondingly greater . it is our opinion , that % iemg of the tibialis anterior muscle
reflects muscle activity stabilizing the ankle joint . because the ankle is a talocrural
joint14 , and the crural articular
surface has a concave shape , ankle joint stability can be attained in dorsiflexion or in the
neutral position , but not in plantar flexion . the medial head of the gastrocnemius muscle ,
flexor hallucis longus and flexor digitorum longus are considered to be agonist muscles of
toe grip strength . they are commonly involved in ankle plantar flexion action , similar to
the medial head of the gastrocnemius muscle . thus , it is our opinion that the % iemg of the
medial head of the gastrocnemius muscle reflects mutual interaction with the tibialis
anterior while working to stabilize the ankle joint . toe grip strength is measured by
placing the fulcrum in the calcaneal region , grasping a bar with the toe , and bending the
toe . thus , as the angle of flexion in the toe joint increase through bending of the toe
while the heel makes contact with the ground , the angle of dorsiflexion in the ankle joint
also increases . murata et al.6 showed that
greater toe grip strength can be exerted by more flexible feet ; thus , the findings of the
present study , greater toe grip strength can be exerted with greater dorsiflexion of the
ankle , is consistent with the results of murata et al . these findings suggest that the
greater toe grip strength of healthy young people arise not only from the strength of the
toe flexor muscles , but also from the flexibility of the feet , particularly the muscle
activity of the crural muscles , and that the strength of the tibialis anterior muscles is
important . the predictors in the resulting model derived from multiple regression with toe grip
strength as the dependent variable were foot - arch height ratio and % iemg of the tibialis
anterior muscle . this indicates that when the % iemg of the tibialis anterior muscle and
foot - arch height ratio values are high , toe grip strength is correspondingly greater . the
medial part the of the longitudinal arch of the foot house complex connections among many
bones and ligaments of the tibialis anterior muscle , tibialis posterior muscle , flexor
pollicis longus , flexor digitorum longus , and abductor pollicis muscles15 . the flexor pollicis longus and flexor digitorum longus
are agonist muscles of toe grip strength , and the tibialis anterior muscles , which is
important for toe grip strength exertion . these findings suggest significant relationships
between foot - arch height ratio and toe grip strength , with reciprocal interaction ,
indicating that the risk of falls by the elderly could be decreased by enhancing toe grip
strength by inserting an insole to raise a low foot - arch as shown by hayashi et al16 . first , we were unable to avoid various common problems
that negatively affect surface emg , such as resistance of the skin , artifacts , and the
effects of proximal muscles . second , only healthy young women participated ; thus , it is
difficult to extrapolate our findings to the general population . | [ purpose ] this study examined the relationship between toe grip strength and its
associated factors by focusing on factors that were suggested to have a relationship with
toe grip strength in previous studies , aiming to clarify the factors influencing the toe
grip strength of healthy women . [ subjects and methods ] twelve healthy young women were
selected for this study .
their toe grip strength , angular changes in their ankle joint
during toe grip , maximum voluntary contraction activities of the rectus femoris , biceps
femoris , and tibialis anterior muscles , and the medial head of the gastrocnemius muscles
were measured using electromyography .
their toe curl ability , foot - arch height ratio , and
weight were also measured .
[ results ] multiple regression analysis demonstrated that the
predictors of toe grip strength in the resulting model were foot - arch height ratio and the
percentage of integrated electromyography ( % iemg ) of the tibialis anterior muscle , as the
dependent variables .
this reveals that women whose tibialis anterior muscle % iemg values
and foot - arch height ratio are high have greater % iemg values have greater toe grip
strength .
[ conclusion ] these findings suggest a significant relationship between foot - arch
height ratio and toe grip strength , with a reciprocal interaction .
these findings further
indicate that the risk of falls by the elderly could be decreased if toe grip strength
were enhanced , by increasing the height of a low foot - arch with the help of an inserted
insole . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
thrombotic thrombocytopenic purpura ( ttp ) is a rare clinical syndrome of unknown etiology and characterized by the presence of microangiopathic hemolytic anemia , thrombocytopenic purpura , neurologic abnormalities , fever and renal dysfunction . ttp associated with systemic lupus erythematosus ( sle ) has been described on other occasions , but mostly the diagnosis of sle preceded or coincided with that of ttp . we report a case of sle that developed 2 years after the complete resolution of ttp , emphasizing the unusual sequence and the chronological separation of the two diseases . he was in good health until 1 week before admission when he developed a sore throat , fever up to 38c and global aphasia one day prior to admission . the past medical history was unremarkable but his cousin was diagnosed to have systemic lupus erythematosus . on examination , blood pressure was 140/90 mmhg , heart rate was 120/min , respiration rate 22/min and temperature 38.0c . laboratory data revealed a hemoglobin level of 10.8 g / dl , hematocrit 32.5% , white blood cell count 4,600/mm with 62% segmented neutrophils , 23% lymphocytes , 9% monocytes , 4% metamyelocytes and 2% band neutrophils . the urinalysis showed 1+protein , 13 white cells and moderate blood cells / high power field . the fasting blood sugar was 96 mg / dl , the urea nitrogen 16 mg / dl , the creatinine 1.5 mg / dl , the total protein 7.4 g / dl and the albumin 4.6 g / dl . the total bilirubin was 3.4 mg / dl and direct bilirubin 0.6 mg / dl , lactate dehydrogenase was 1,020 prothrombin time was 70% ( 1.21 inr ) , partial thromboplastin time 28.9 s ( control 28.9 s ) , fibrinogen 435 mg / dl ( normal 200400 mg / dl ) , fibrin split product 10 ( normal<10 ) and d - dimer was negative . direct and indirect coombs tests were negative , serum complement levels were within normal range . anti - ds - dna antibody was 4.5 iu / ml ( normal<7 iu / ml ) . on the 3rd day of admission , bone marrow aspiration and biopsy showed endothelial cell proliferation of vessels and microthrombi in the lumen consistent with the diagnosis of ttp ( fig . 2 ) . treatment with oral prednisolone ( 60 mg / day ) and plasmapheresis started on the 3rd day . aphasia gradually improved , and after 21 sessions of plasmapheresis lasting 36 days ( 1020 units of fresh frozen plasma replacement per session ) he fully recovered from neurologic deficit and became afebrile ( fig . 3 ) . at discharge , laboratory findings showed hemoglobin 14.0 g / dl , hematocrit 41.1% , wbc 9,300/mm , platelets 339,000/mm , reticulocyte count 2.0% , serum creatinine 0.3 mg / dl , total bilirubin 0.3 mg / dl and lactate dehydrogenase 406 two years after his first admission , the patient presented with fever of one month duration and generalized tonic - clonic seizure that developed one day prior to admission . he also complanined of 14 kg weight loss for the preceding 5 months , headache , alopecia , oral ulceration and vomiting . laboratory findings showed hemoglobin 9.7 g / dl , hematocrit 27.6% , wbc 3,800/mm with 72% segmented neutrophils , 23% lymphocytes , 3% monocytes and 1% eosinophils , platelet count 196,000/mm , erythrocyte sedimentation rate 35 mm / h , creatinine 1.0 mg / dl , the total protein 6.7 g / dl , the albumin 3.0 g / dl , bilirubin 0.4 mg / dl and ldh 449 iu / l . c3 level was 44 ( normal 85193 ) , c4 less than 8 ( normal 1236 ) , and total hemolytic complement ( ch50 ) was 28 ( normal 100300 ) . fana test was positive at a titer of 1:640 with a speckled pattern , and anti - rnp and anti - sm anti - bodies were also positive . spinal puncture disclosed a normal opening pressure and lymphocytosis of 35/mm , with clear fluid ; ph 8.2 ; glucose 47 mg% ; protein 59 mg% . intravenous methylprednisolone ( 500 mg / day for 3 days ) was given without improvement in fever and neurologic symptoms and , subsequently , cyclophosphamide ( 500 mg / day for 1 day ) was initiated in conjunction with oral prednisolone 30 mg / day . however , he still complained of confusion and intermittent fever . on the 15th day after admission , after 3 sessions in 4 days , the patient improved with no fever and no neurologic abnormality ( fig . ttp first described by moschowits in 1924 has overlapping clinical features with sle on both clinical and anatomical grounds . levine and stearn reviewed 151 cases of ttp and found evidence of sle in 35 , although their observations were based solely on postmortem pathologic findings that can not be considered diagnostic . in the revew or 271 cases of ttp by amorosi and ultmann , 7 patients had positive le preps and 13 had clinical findings suggestive of sle . the preliminary criteria for the classification of sle were not developed at the time of publication . cecere reported a young woman with systemic lupus who developed ttp as a terminal event . in this patient , elevated levels of immune complexes were associated with periods of active lupus but were not detectable at the time she developed ttp . in later series of ridolfi and bell of 250 patients with thrombotic thrombocytopenic purpura , only three met the presently accepted criteria for sle . finally , rothfield reported that , in a series of 433 patients with sle , 2 patients developed ttp . although the association of ttp in patients with sle is frequently mentioned , the pathogenesis of ttp in these patients is not well understood . hemolytic anemia , thrombocytopenia , fever , central nervous system manifestation and renal disease are common findings not only in ttp but in sle . however , the blood smear in patients with sle shows no fragmented red cells except in some cases of lupus related vasculitis . skin biopsy in sle shows inflammation around blood vessels , which is typically absent in ttp . the hemolytic anemia is generally coombs test positive in sle but negative in ttp . in ttp , immunologic markers ( antibodies to dna , complement , ena ) are negative , although non - sle associated positive antinuclear antibodies have been found in some patients . the characteristic pathologic feature of ttp is the hyaline thrombi that occlude capillaries and precapillary arterioles demonstrated in the pancreas , adrenal glands , heart , brain , bone marrow and kidneys which are rarely found in sle . to establish a pathogenic relation between ttp and sle , the possible etiologic factors are immunologic injury of endothelial cells , production of antiendothelial antibody or platelet aggregating factors and , in some cases , the presence of anticardiolipin antibody or lupus anticoagulant . on the other hand , many immunologic disorders have antedated the development of ttp , including rheumatoid arthritis , ankylosing spondylitis , sjgren s syndrome , polymyositis , polyarthritis , graves disease and immune thrombocytopenic purpura . in our case , on the first admission , the manifestation was compatible with ttp . classic pentad ( microangiopathic hemolytic anemia , thrombocytopenia , neurologic manifestation , aphasia , renal disease , fever ) was observed simultaneously and bone marrow biopsy revealed hyaline thrombi occluding capillaries which is a characteristic pathologic feature of ttp . two years later , he was readmitted . at that time , among the 1982 american rheumatism association ( ara ) criteria for the classification of sle , he showed renal disorder ( proteinuria ) , neurologic disorder ( seizure ) , hematologic disorders ( hemolytic anemia and leukopenia ) , immunologic disorders ( positive anti - ds - dna and anti - sm antibody ) and antinuclear antibodies . he was treated with high dose steroid therapy , cyotoxic agent ( cyclophosphamide ) and , finally , with plasmapheresis and recovered . however , there was no clinical and laboratory evidence of sle in our patient when he presented with ttp . after 2 years of complete remission , the patient developed a typical case of cns lupus without evidence of ttp . in early reports , there were only three patients in whom the diagnosis of thrombotic thrombocytopenic purpura preceded the development of sle . however , clinical information and serologic data are insufficient for the ara 1982 revised criteria for the diagnosis of sle in those patients . their evidence of sle was the pathologic finding ( libman - sacks endocarditis , glomerulosclerosis , periadventitial splenic fibrosis ) which suggested a lupus - type disease . the strict application of the present criteria places the diagnosis in doubt . in 1990 , jonsson reported a patient diagnosed as sle two weeks after the diagnosis of ttp . however , at the time of first presentation , direct coombs test , fana and anti - ds - dna were positive , so when he was diagnosed as ttp , maybe he was also suffering from sle . they reported a 30-year - old woman admitted with sle nine years after developing ttp . when she was first diagnosed as ttp , several reports documented that the level of immune complex was elevated when lupus was active , but immune complex was not detectable at the time the patient developed ttp . however , in several associated cases of sle and ttp , ttp developed when sle was inactive , sugesting that ttp can develop during the subclinical period of lupus . so , it was postulated that vasculitis from sle triggered ttp , with the other manifestation of sle appearing later . we believe that our patient differs from others previously reported , not only in the unusual chronolgical sequence of presentation , but also in the difficulty encountered in establishing a correlation between ttp and sle , given the long period of time in which the partient was asymptomatic . | we describe a 17-year - old male who presented with thrombotic thrombocytopenic purpura ( ttp ) and 2 years thereafter developed central nervous system lupus and nephritis .
the association of ttp and systemic lupus erythematosus has been described , but the unusual sequence and chronological separation is very rare . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
hepatitis c virus ( hcv ) is a common hepatotropic rna virus , which has been estimated to infect about 170 million people worldwide ( 1 ) . the hcv infection progresses to chronicity in nearly 80% of cases , and chronic hepatitis c ( chc ) infection is associated with the development of cirrhosis , end - stage liver disease , hepatocellular carcinoma , liver transplantation and associated complications in western countries ( 2 ) . differences in chc prevalence , clinical profile and histological severity between different ethnic groups suggested a genetic contribution ( 3 ) . thus , in earlier candidate gene studies , several single nucleotide polymorphisms ( snps ) within host genes and gene regions coding for the human leukocyte system , keratin , or coagulation factors were shown to be associated with progression of hcv - induced liver fibrosis ( 4 ) . among these , an independent genome - wide association study that identified a non - synonymous sequence variation ( rs738409 c > g ) , encoding an isoleucine - to - methionine substitution at position 148 in the adiponutrin / patatin - like phospholipase domain - containing 3 ( pnpla3 ) gene , has recently attracted much interest ( 5 ) . the g allele of the rs738409 variant leads to triglyceride ( tg ) accumulation in hepatocytes . steatosis can promote inflammatory mediators and oxidative stress and has been shown to favor hepatocyte apoptosis in chc ( 6 ) . steatosis is also closely associated with metabolic syndrome and insulin resistance , a well - established cause of fibrosis progression in hepatitis c ( 7 ) . the association of steatosis and chc has been well described , and shown to occur in up to 66% of cases ( 6 , 8) . steatosis accelerates the progression of chc and is independently associated with stage iii / iv hepatic fibrosis ( 8) . single nucleotide polymorphisms ( snps ) have also been reported to be associated not only with elevated liver enzymes in healthy subjects , but also with disease severity , portal inflammation , lobular inflammation , steatosis , fibrosis , and hepatocellular carcinoma ( 9 ) . more recently , the g allele of the rs738409 variant has been reported to be associated with the occurrence of chc ( 10 ) . in view of the uncertain association of the i148 m variant of pnpla3 in chc , we conducted a meta - analysis to comprehensively assess the overall performance of the i148 m variant of pnpla3 for the presence of chc , and to analyze the heterogeneity between available studies before its wide application in clinical practice . the aim of this study was to evaluate the association of the i148 m variant of pnpla3 and the presence of chc across various populations . the objective of our search was to identify published genetic association studies evaluating the gene polymorphisms of pnpla3 and chc in humans , written in all languages , between years 2000 to june 2015 . an electronic search was completed using pubmed , embase , the cochrane library , scopus , index copernicus , doaj , ebsco - cinahl , and the china national knowledge infrastructure . the search term was based on combinations of the following key words ; patatin like phospholipase domain containing 3 or pnpla3 or adiponutrin , and chronic hepatitis c or chc or hcv , and was not restricted by period . in addition , authors of gray literatures and studies containing relevant information , yet lacking the data necessary for this analysis , were contacted directly . unpublished data were also accepted if an abstract was available and further information was obtained from the authors . in this meta - analysis , two independent investigators reviewed and searched the following types of studies : 1 ) an independent case - control study ; 2 ) studies with similar purpose and statistical methods ; 3 ) studies providing enough information to calculate an odds ratio ( or ) ; 4 ) stratified outcomes according to the pnpla3 genotype ; 5 ) studies with diagnosis of chc based on the detection of both hcv antibodies and hcv rna for at least six months in the presence of signs of chronic hepatitis , and elevated aminotransferases or histology ; and 6 ) studies with genotyping performed with a validated molecular method . because the variation seemed to follow an undefined model of inheritance in some of the outcomes , to avoid choosing any a priori model , it was decided to compare extreme genotypes , namely , homozygous cc ( 148 i / i ) versus homozygous gg ( 148 m / m ) reported by a previous study ( 11 ) . in addition , in order to address which genetic model best explains the effect of rs738409 snp on the susceptibility to develop chc , an evaluation of risks associated with heterozygosity of the variant ( heterozygous cg versus homozygous cc , the reference group ) was also included . for each phenotype the exclusion criteria were : 1 ) incomplete raw data ; 2 ) non - human data ; 3 ) repetitive reports ( if more than one version of the same study was retrieved , only the most recent was used ) ; 4 ) other potential causes of liver disease ( including alcohol , non - alcoholic fatty liver disease ( nafld ) , other viral infections such as hepatitis b virus and human immunodeficiency virus , previous treatment , and the use of drugs ) ; and 5 ) materials and methods not well - described or reliable . although assessment of the study quality is considered important for systematic reviews and meta - analyses , scoring methods have been considered problematic ( 12 ) , and may not accurately assess the quality measures of interest ( 13 ) . therefore , the reliability of patient selection , molecular typing method , hcv genotyping , and statistical analysis methods were used as quality variables . the investigators assessed the risk of bias in the included studies using a risk - of - bias tool . the following studies were considered as low - bias risk trials , those that had an adequate handling of incomplete outcome data , were free of selective reporting , included an adequate intervention description , had appropriate criteria for participant recruitment and included an adequate outcome explanation . studies with one or more unclear or inadequate quality component were considered high - bias risk trials . two investigators ( zhang hy and xin yn ) independently evaluated study eligibility , graded quality , and extracted outcome data . disagreements were resolved by consensus . for each study , the following information were recorded : demographic information ( age , sex and ethnicity ) , authors , publication year , journal , publication type and language , pnpla3 genotyping method , allele genotype , number of cases and controls , definitions used for chc , and chc sample description . furthermore , the healthy group was defined as the control group to minimize confounding factors . the main features of the trials included in the meta - analysis are shown in table 1 . abbreviations : pnpla3 : patatin - like phospholipase domain - containing 3 ; chc : chronic hepatitis c ; na : not available . the authors were not blinded to the names of the studies authors , journals and results . any disagreements were resolved through discussion among the authors until consensus was reached ( kappa coefficient : 78% ) . homogeneity was evaluated by cochran s q test ( = 0.05 ) and the i2 statistic . if the results of the test had no significant heterogeneity , the mantel - haenszel fixed - effect model ( peto method ) was used for the combined data . if the results of the test had significant heterogeneity , the dersimonian - laird random - effects model ( dl method ) was used for the combination of data ( 19 ) . an i2 value of 0% indicated no heterogeneity , and if i2 was < 50% , the test was considered uniform with no statistically significant heterogeneity , while larger values showed an increasing heterogeneity . a pooled or was presented as a standard plot with 95% confidence intervals ( cis ) . in the absence of heterogeneity , the two methods provided identical results . as a measure of association between chc and pnpla3 alleles , ors with 95% cis , stratified by gene subtypes of patients and controls in a study , were combined . a sensitivity analysis was performed to assess the stability of the results by sequential omission of individual studies . all the objective of our search was to identify published genetic association studies evaluating the gene polymorphisms of pnpla3 and chc in humans , written in all languages , between years 2000 to june 2015 . an electronic search was completed using pubmed , embase , the cochrane library , scopus , index copernicus , doaj , ebsco - cinahl , and the china national knowledge infrastructure . the search term was based on combinations of the following key words ; patatin like phospholipase domain containing 3 or pnpla3 or adiponutrin , and chronic hepatitis c or chc or hcv , and was not restricted by period . in addition , authors of gray literatures and studies containing relevant information , yet lacking the data necessary for this analysis , were contacted directly . unpublished data were also accepted if an abstract was available and further information was obtained from the authors . in this meta - analysis , two independent investigators reviewed and searched the following types of studies : 1 ) an independent case - control study ; 2 ) studies with similar purpose and statistical methods ; 3 ) studies providing enough information to calculate an odds ratio ( or ) ; 4 ) stratified outcomes according to the pnpla3 genotype ; 5 ) studies with diagnosis of chc based on the detection of both hcv antibodies and hcv rna for at least six months in the presence of signs of chronic hepatitis , and elevated aminotransferases or histology ; and 6 ) studies with genotyping performed with a validated molecular method . because the variation seemed to follow an undefined model of inheritance in some of the outcomes , to avoid choosing any a priori model , it was decided to compare extreme genotypes , namely , homozygous cc ( 148 i / i ) versus homozygous gg ( 148 m / m ) reported by a previous study ( 11 ) . in addition , in order to address which genetic model best explains the effect of rs738409 snp on the susceptibility to develop chc , an evaluation of risks associated with heterozygosity of the variant ( heterozygous cg versus homozygous cc , the reference group ) was also included . for each phenotype , the exclusion criteria were : 1 ) incomplete raw data ; 2 ) non - human data ; 3 ) repetitive reports ( if more than one version of the same study was retrieved , only the most recent was used ) ; 4 ) other potential causes of liver disease ( including alcohol , non - alcoholic fatty liver disease ( nafld ) , other viral infections such as hepatitis b virus and human immunodeficiency virus , previous treatment , and the use of drugs ) ; and 5 ) materials and methods not well - described or reliable . although assessment of the study quality is considered important for systematic reviews and meta - analyses , scoring methods have been considered problematic ( 12 ) , and may not accurately assess the quality measures of interest ( 13 ) . therefore , the reliability of patient selection , molecular typing method , hcv genotyping , and statistical analysis methods were used as quality variables . the investigators assessed the risk of bias in the included studies using a risk - of - bias tool . the following studies were considered as low - bias risk trials , those that had an adequate handling of incomplete outcome data , were free of selective reporting , included an adequate intervention description , had appropriate criteria for participant recruitment and included an adequate outcome explanation . studies with one or more unclear or inadequate quality component were considered high - bias risk trials . two investigators ( zhang hy and xin yn ) independently evaluated study eligibility , graded quality , and extracted outcome data . disagreements were resolved by consensus . for each study , the following information were recorded : demographic information ( age , sex and ethnicity ) , authors , publication year , journal , publication type and language , pnpla3 genotyping method , allele genotype , number of cases and controls , definitions used for chc , and chc sample description . furthermore , the healthy group was defined as the control group to minimize confounding factors . the main features of the trials included in the meta - analysis are shown in table 1 . abbreviations : pnpla3 : patatin - like phospholipase domain - containing 3 ; chc : chronic hepatitis c ; na : not available . the authors were not blinded to the names of the studies authors , journals and results . any disagreements were resolved through discussion among the authors until consensus was reached ( kappa coefficient : 78% ) . homogeneity was evaluated by cochran s q test ( = 0.05 ) and the i2 statistic . if the results of the test had no significant heterogeneity , the mantel - haenszel fixed - effect model ( peto method ) was used for the combined data . if the results of the test had significant heterogeneity , the dersimonian - laird random - effects model ( dl method ) was used for the combination of data ( 19 ) . an i2 value of 0% indicated no heterogeneity , and if i2 was < 50% , the test was considered uniform with no statistically significant heterogeneity , while larger values showed an increasing heterogeneity . a pooled or was presented as a standard plot with 95% confidence intervals ( cis ) . in the absence of heterogeneity , the two methods provided identical results . as a measure of association between chc and pnpla3 alleles , ors with 95% cis , stratified by gene subtypes of patients and controls in a study , were combined . a sensitivity analysis was performed to assess the stability of the results by sequential omission of individual studies . all eight eligible studies were identified for evaluation . ultimately , three studies were excluded for having insufficient data . thus , our final dataset for the meta - analysis ( figure 1 ) included five studies ( 14 - 18 ) . the main features of the studies , included in the meta - analysis , are shown in table 1 . the genotype distributions of rs738409 polymorphism of pnpla3 among included studies are shown in table 2 . a total of 2535 subjects were included ( 1692 patients and 843 healthy controls ) . two of these studies were conducted in italy ( 15 , 17 ) , and one in bonn and berlin ( 14 ) , japan ( 16 ) and morocco ( 18 ) . all of the five studies were hospital - based case - control studies ( 14 - 18 ) . hepatitis c virus genotyping was performed using the taqman assay in three studies ( 15 , 16 , 18 ) . all studies scored well in terms of adequate descriptions of selection criteria and availability of clinical data . abbreviations : pnpla3 : patatin - like phospholipase domain - containing 3 ; chc : chronic hepatitis c ; cc : homozygous cc ; gg : homozygous gg . the comparison between cases and controls showed that chc was significantly associated with the gg genotype . in the meta - analysis , the overall frequency of the gg genotype distribution was 20.4% ( 205/1005 ) in chc , and 10.23% ( 53/518 ) in controls . the heterogeneity test indicated that the variation of trial - specific ors was not statistically significant ( = 4.22 , p = 0.38 ) ; the fixed - effect method was used to combine the results . the combined or was 2.20 ( 95% ci : 1.56 - 3.11 ) and was statistically significant ( p < 0.00001 ) . in the sensitivity analysis , statistics calculated for studies assessing the association between gene polymorphisms of pnpla3 and chc when comparing homozygous gg and homozygous cc , are shown in the forest plot ( figure 2 ) . the analysis of the heterozygosity for the variant showed that chc was significantly associated with the rs738409 g allele when the reference heterozygous cg was compared with homozygous cc , again suggesting an additive genetic effect ( details in figure 3 ) . the heterogeneity test indicated that the variation of trial - specific ors was not statistically significant ( = 5.86 , p = 0.21 ) ; the fixed - effect method was used to combine the results . the combined or was 1.26 ( 95% ci : 1.04 - 1.51 ) and was statistically significant ( p = 0.02 ) . in the sensitivity analysis , the exclusion of individual studies did not change this significant result . the current meta - analysis revealed that there was an association between gene polymorphisms of pnpla3 and chc . funnel plots to detect publication bias of studies on pnpla3 tended towards an asymmetrical shape ( figures 4 and 5 ) , suggesting that publication bias might have affected the findings of our meta - analysis . specific ors was not statistically significant ( = 3.42 , p = 0.18 ) when the gg genotype was compared with the cc genotype . the fixed - effect method was used to combine the results . the combined or was 2.51 ( 95% ci : 1.60 - 3.95 ) , which was statistically significant ( p < 0.0001 ) ( figure 6 ) . the same result was also found when the reference genotype cg was compared with the cc genotype ( details in figure 7 ) . the heterogeneity test indicated that the variation of trial - specific ors was not statistically significant ( = 1.17 , p = 0.56 ) ; the fixed - effect method was used to combine the results . the combined or was 1.33 ( 95% ci : 1.07 - 1.65 ) and was statistically significant ( p = 0.01 ) . the subgroup analyses of ethnicity revealed a remarkable association between gene polymorphisms of pnpla3 and chc in caucasians . patatin - like phospholipase domain - containing 3 , also called adiponutrin , encodes a 481-amino acid protein with a molecular mass of approximately 53 kda that , in humans , is mainly expressed in intracellular membrane fractions in hepatocytes ( 21 ) . furthermore , pnpla3 is induced in the liver after feeding and during insulin resistance by the master regulator of lipogenesis steroid regulatory element binding protein-1c ( 22 ) . wild - type ( 148i ) pnpla3 has lipolytic activity towards tg ( 21 ) . the 148 m mutation determines a critical amino acid substitution next to the catalytic domain , likely reducing access of substrates and the pnpla3 enzymatic activity towards glycerolipids , thereby leading to the development of macrovesicular steatosis ( 23 ) . the presence of steatosis has been associated with more aggressive histological features , faster progression of fibrosis , and poorer response to therapy . as for the mechanisms of lipolytic activity of pnpla3 , there is another study has reported on lipogenic function associated with the 148 m variant , which would acquire the ability to synthesize phosphatidic acid from lysophosphatidic acid ( 24 ) . the functional consequences of the i148 m polymorphism is therefore still powerfully debated , and it may be hypothesized that pnpla3 has additional physiological substrates . human studies have also suggested a possible direct or indirect influence of pnpla3 genotype on adipose . in contrast to studies on both nonalcoholic fatty liver disease ( nafld ) and alcoholic liver disease ( ald ) , liver damage ( steatosis and fibrosis ) related to pnpla3 in chc appears to primarily involve the homozygote g allele carriers , as reported by previous studies ( 10 ) . among the first to demonstrate the impact of the pnpla polymorphism in patients with hcv infection were the studies of valenti et al . they analyzed large cohorts of hcv patients in europe and almost simultaneously reported the g allele of rs738409 snp to be associated not only with the presence of histologically - determined liver steatosis , but also with the presence of cirrhosis and accelerated fibrosis progression . further expanded these findings by reporting on an increased rate of hepatocellular carcinoma development in patients with the gg genotype of rs738409 in a cohort of 222 hcv patients ( 26 ) . indeed , by multivariate analysis , the gg genotype was found to be an independent factor associated with hcc development carrying a 2.23 or . taken together , these data rather unequivocally demonstrate a correlation between the g allele of the pnpla3 snp and a worse prognosis of chc . there are some points about the pnpla3 snp genotype that might explain its association with the progression of chc . first , steatosis is known to negatively impact the natural history of hcv infection as it accelerates progression to cirrhosis ( 27 ) . second , liver steatosis has been shown to be a negative moderator of treatment outcome to interferon - based therapies . patients with fatty liver had low sustained virological response rates across all hcv genotypes ( 28 ) . steatosis can promote inflammatory mediators and oxidative stress and has been shown to favor hepatocyte apoptosis in chc ( 29 ) . in addition to the effects on tg , the pnpla3 genotype inhibits inflammation and fibrogenesis in the presence of severe liver fibrosis . adiponectin resistance may modify the interaction between genotype and environmental factors , which may increase the risk of developing chc . an increased risk for addictive behavior , anemias requiring transfusions , percutaneous contact with infected blood , injection drug use , and tissue donations account for most hcv infections worldwide , which could influence the risk of having chc . whether the pnpla3 genotype affects these factors is not known , and the exact mechanism behind this association remains poorly understood . furthermore , pnpla3 does not appear to have any direct association with hcv , as there is no known effect on viral load or treatment response . it is possible that this association is simply related to confounders , such as increased fibrosis from concomitant alcohol abuse or metabolic syndrome , among patients with the pnpla3 gg genotype . in subgroup analyses of ethnicity , the heterogeneity test indicated that the variation of trial- the results of our meta - analysis showed that the g allele of the pnpla3 rs738409 g > c snp was associated with the presence of chc . individuals with the gg genotype had approximately a two - fold higher risk of having chc when compared to individuals with the cc genotype . the gc heterozygous genotype was also associated with a smaller , but still significant risk . to our knowledge , this is the first published meta - analysis to comprehensively investigate the association between gene polymorphisms of pnpla3 and chc . in the current study meta - analytical research , on 29 meta - analyses , investigating language bias has provided evidence that the or estimated in meta - analyses from non - english publications were on average 0.8-fold ( 95% ci , 0.7 - 1.0 ) the or estimates from english - written publications ( 30 ) . for this reason , even if non - english publications had not been searched , this might have introduced only a small bias in the overall findings . however , the shape of the funnel plot seemed to be asymmetrical , suggesting that publication bias might have affected our findings . first , most studies to date were conducted on homogenous caucasian populations from europe or the united states . studies among racially and ethnically diverse cohorts , including hispanics , african americans and other ethnicities are needed . second , because the information used in the current research was based on data from observational studies , the characteristics of each study population and the different methodologies of these studies should be taken into account when interpreting the results of our analysis . for example , different inclusion criteria for selection of the participants might have influenced the results of this research . in the current study , four studies only concerned adults ( 14 , 15 , 17 , 18 ) , four studies ( 14 , 15 , 17 , 18 ) considered the proportion of females , while the remaining studies ( 16 ) did not take into account age or gender ratios . differences in age distribution and gender ratio could also be potential causes of variation in the results . additionally , although we tried to maximize our efforts to identify all relevant published studies in peer - reviewed journals , it is possible that some escaped our attention . data on body mass index and diabetes were not included in this analysis due to a lack of association with the presence of chc . although false hcv positivity related to the pnpla3 genotype was considered , there have been no reports of this association in the literature . control group selection may affect the findings and interpretation of this research , and the use of different control groups could produce inconsistent results . the exclusion of nafld patients as controls in the current study precluded analysis of the contribution of steatosis independent of pnpla3 status . further meta - analysis on the nafld patient control subgroup with a larger sample size will be required in the future . it is assumed that a combined analysis based on studies with large samples can provide more accurate conclusions . in conclusion , our analysis showed an association between gene polymorphisms of pnpla3 and the presence of chc ; at least in caucasians . this association had indications of possible publication bias , some heterogeneity , and less pronounced associations in prospective studies than in retrospective studies . homogeneity of the methods for evaluating the degree of chc , common gender , age and ethnicity would be critical to confirm the absence of association and , therefore , the lack of a causal role of gene polymorphisms of pnpla3 in patients with chc . furthermore , the probable association of pnpla3 polymorphism with the natural history of hepatitis c , such as spontaneous clearance of hcv acute infection , maybe another hypothesis for explanation of the difference in distribution of pnpla3 genotypes in chc and the control group . given the importance of this issue , further prospective rigorous studies are required to confirm our results and to evaluate the potential of pnpla3 to serve both as a predictor and a therapeutic target in chc . | context : the objective of the current study was to evaluate the association between the i148 m variant of patatin - like phospholipase domain - containing protein 3 ( pnpla3 ) and the presence of chronic hepatitis c ( chc ) across different populations.evidence acquisition : this study was a meta - analysis of all relevant researches published in the literature from year 2000 to 2015 .
the odds ratios ( ors ) of pnpla3 allele distributions in chc patients were analyzed and compared with healthy controls .
the meta - analysis revman 5.2 software was applied for investigating heterogeneity among individual studies and for summarizing all the studies .
the meta - analysis was carried out according to the cochrane reviewers handbook recommendations .
a total of 120 clinical trials or reports were retrieved , yet only five trials met the study selection criteria.results:five hospital - based case - control studies were included in the final analysis .
the overall frequency of pnpla3 gene polymorphisms was 20.4% ( 205/1005 ) in chc and 10.23% ( 53/518 ) in controls .
the summary odds ratio for the association of gene polymorphisms of pnpla3 with the risk for chc was determined as 2.20 ( 95% ci : 1.56 -3.11 ) and was statistically significant ( p < 0.05).conclusions : the current meta - analysis showed an association between frequency of gg genotype of pnpla3 and the risk of development of chc in various populations throughout the world . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
patient - doctor relationship has been defined as a meaningful therapeutic interaction between the patients and their doctors and is considered as the seventh element of healthcare quality . meaningful therapeutic interaction between patients and doctors includes both patient - doctor communication and trust . an effective patient - doctor communication consists of explaining patient 's illnesses and treatments , spending adequate time , managing uncertainty , and developing rapport [ 35 ] . patient - doctor trust is high when the doctor is technically competent , is thorough and careful in examining the patient , has good listening capabilities , and has complete understanding of patient 's illnesses and treatments [ 610 ] . effective communication has been found to enhance patient 's engagement in care , satisfaction with care , and treatment adherence . effective communication has also been found to improve health outcomes [ 14 , 15 ] . among older patients with diabetes , patient - doctor communication has been found to be associated with lower blood pressure , lower anxiety , and better quality of life . similarly , high trust in the doctor has been found to be associated with lower hassles in self - care , better ability to perform diabetes care activities , and satisfaction with the doctor . effective patient - doctor communication and trust become especially important in managing patients with two or more chronic conditions ( i.e. , multimorbidity ) . multimorbidity affects elderly population disproportionately and is projected to increase from 34,835 million in 2000 to 81,999 million by 2050 . elderly individuals with multimorbidity account for 98% of hospital readmissions , incur 93% of total medicare spending , and experience higher rates of preventable hospitalizations as compared to those without multimorbidity . multimorbidity also affects care coordination and leads to poor management of cooccurring conditions due to the focus on one dominant chronic condition . therefore , policymakers , providers , and researchers have emphasized the need for meaningful interactions between patients and doctors in managing the burden of multimorbidity [ 2326 ] . an effective communication and high trust with the doctor can improve the care of the elderly with multimorbidity . a special case of multimorbidity presence of mental health condition in addition to chronic physical conditions can be very challenging for disease management [ 2730 ] . effective communication and trust have been shown to improve outcomes for not only individuals with chronic physical conditions but also those with a mental health condition . for example , effective communication decreased the patient health questionnaire ( phq-9 ) scores among adults with depression from baseline to one - month follow - up , indicating an improvement in the severity of depression . however , a survey sponsored by the national depressive and manic - depressive association ( dmda ) found that ineffective communication exists between primary care physicians and patients with depression . for example , the survey found that even though doctors thought that they explained the potential adverse effects of antidepressant medications , the patients felt a lack of information on certain adverse effects such as sexual dysfunction , weight gain , and insomnia . also , trust in the doctor is important for patients with mental illness to maintain the confidentiality of their mental illness due to its associated social and personal stigma . there is a lack of research on the impact of having a mental health condition in addition to multiple chronic physical illnesses on communication and trust with the doctor among elderly individuals . we could only find two studies ( one in the us and one in germany ) , which evaluated the relationship between number of chronic conditions and patient - doctor relationship [ 35 , 36 ] . in the us , a study among noninstitutionalized adults aged 18 years or older from 12 metropolitan communities analyzed the relationship between number of chronic conditions and scores on patient - doctor communication scale . the study found a small but significant relationship between higher number of chronic conditions and ineffective patient - doctor communication . another study among the german adults examined the factors associated with patient - doctor relationship which was measured using the german version of the patient - doctor relationship questionnaire ( pdrq-9 ) . the study found that individuals with lower number of chronic physical and mental comorbidities reported higher scores on the pdrq-9 , indicating the higher quality of patient - doctor relationship . therefore , the primary objective of this study is to examine patient - doctor communication and trust among the elderly who had both chronic mental and physical conditions as compared to those having multiple physical conditions without any mental condition . we hypothesized that elderly patients having both mental and physical conditions will be more likely to have ineffective communication and have low trust with the doctor as compared to those having multiple physical conditions without any mental health condition . according to the previous studies , factors other than multimorbidity can affect meaningful therapeutic interactions between the patients and their doctors . these may include age , gender , race / ethnicity [ 37 , 38 ] , socioeconomic status , health status , and length of the visit . therefore , we utilized the theoretical model of patient - doctor relationship by gabay ( 2015 ) to guide the selection of independent variables used in our study . according to this model , patient - doctor relationship is influenced by ( a ) sociodemographic factors such as patient 's age , race / ethnicity , gender , education , insurance , and metropolitan area ; ( b ) health condition factors including multimorbidity and body mass index ; ( c ) health status such as perceived general health status and functional health status ; and ( d ) patient 's satisfaction with care . we adopted a cross - sectional study design using data from a nationally representative survey of medicare beneficiaries . we utilized data from the access to care module of the medicare current beneficiary survey ( mcbs ) 2012 . the mcbs is a continuous multipurpose survey of a nationally representative sample of medicare beneficiaries conducted by the centers for medicare & medicaid services [ 42 , 43 ] . the mcbs is conducted among all medicare beneficiaries who are above 65 years of age or who are disabled . the survey is conducted through computer - assisted personal interviews ( capi ) with the beneficiaries . the person level survey data is released in two modules : access to care ( ac ) and cost and use ( cu ) . we utilized the ac module of the mcbs that uses valid and reliable survey questions to assess patients ' experiences with care received from their provider . the ac module represents the population of individuals who were always enrolled in the medicare during the calendar year . it contains deidentified information on each participant 's access to health care , usual source of care , and satisfaction with care . the ac module also includes demographic , health insurance , health status , and functioning data . the mcbs is a longitudinal panel survey , where individuals are interviewed three times a year for a maximum of four years . the participants are selected from the medicare enrollment file using a multistage and stratified sampling design to be representative of the medicare population . the multistage and stratified sampling design is commonly used in large national surveys to feasibly conduct survey , reduce bias , and produce nationally representative survey results . in the multistage design it avoids the sampling of all the units which can be expensive and time consuming . in stratified sampling design , the beneficiaries are divided into seven strata based on age : 0 to 44 , 45 to 64 , 65 to 69 , 70 to 74 , 75 to 79 , 80 to 84 , and 85 or older . the sampling units are then selected from each stratum so that the results can be representative of the total population . we included community - dwelling elderly medicare beneficiaries who were aged 65 years or older , had at least one chronic physical condition , and had a usual source of care in our study . yes to the question is there a particular medical person or a clinic you usually go to when you are sick or for advice about your health ? further , we excluded the individuals with missing data for chronic health conditions , communication , or trust variables . we utilized the participants ' responses to the survey questions from 2012 ac module of the mcbs in this study . a survey item in the mcbs asked about the specialty of participants ' doctor . about 90% of beneficiaries answered family practice , general practice , or internal medicine . thus , most beneficiaries referred to their primary care physician while responding to the survey items about communication and trust with their doctor . an effective patient - doctor communication consists of discussing patient 's illness and treatment , spending adequate time , building rapport , and managing patient 's uncertainty [ 3 , 5 ] . we used the following six survey items from the mcbs which assessed these components of communication with the doctor to construct a patient - doctor communication scale ( table 1 ) : ( a ) your doctor tells you all you want to know about your condition and treatment , ( b ) your doctor often does not explain your medical problems to you , ( c ) you often have health problems that should be discussed but are not , ( d ) your doctor often seems to be in a hurry , ( e ) your doctor often acts as though he was doing you a favor by talking to you , and ( f ) your doctor answers all questions . the response scale ranged from one to four ( 1 : strongly agree , 2 : agree , 3 : disagree , and 4 : strongly disagree ) . we reverse coded the survey items ( a ) and ( f ) to make their scores consistent with other items . the sum of scores of these six survey items ranged from 6 to 24 and was highly skewed . thus , we dichotomized the total score on communication scale by using median split method to create a binary response variable . the elderly with total communication score equal to or above the median value ( 18 ) were categorized as having effective communication with the doctor while those with scores below median value were considered to experience ineffective communication . patient 's trust in the doctor is influenced by technical skills of the doctor , thorough examination of the patient , and complete understanding of patient 's medical conditions [ 610 ] . we utilized the following five survey items from the mcbs which measured these components of trust to construct patient - doctor trust scale : ( a ) your doctor is very careful to check everything when examining you , ( b ) your doctor is competent and well - trained , ( c ) your doctor has a good understanding of your medical history , ( d ) your doctor has a complete understanding of the things that are wrong with you , and ( e ) you have great confidence in your doctor . the response scale ranged from one to four ( 1 : strongly agree , 2 : agree , 3 : disagree , and 4 : strongly disagree ) . the sum of scores of these five survey items ranged from 5 to 20 and was highly skewed . hence , we dichotomized the total score on trust scale by using median split method to create a binary response variable . the elderly with a total score equal to or above median value ( 17 ) were categorized as having high trust in the doctor while those with scores below median value were considered to have low trust in the doctor . we utilized participants ' having been told by a doctor that they have a chronic condition to assess the presence of multimorbidity . we selected chronic conditions based on the conceptual framework by goodman and colleagues for defining and measuring chronic conditions for research , policy , program , and practice . the chronic physical conditions included arthritis ( osteoarthritis or rheumatoid arthritis ) , cancer ( skin or any other cancer ) , diabetes ( type 1 or type 2 ) , heart disease ( angina pectoris , myocardial infarction , or any other heart condition ) , hypertension , osteoporosis , and respiratory diseases ( asthma , chronic obstructive pulmonary disease , or emphysema ) . the mental health conditions consisted of depression or any other mental or psychiatric disorder . based on the presence of these chronic physical and mental health conditions , we defined three multimorbidity categories : ( a ) no mm ( no multimorbidity , that is , only one physical condition ) , ( b ) mm - pi ( two or more physical conditions but no mental illness ) , and ( c ) mm - pi&mi ( both physical and mental health conditions ) . we also included patient 's body mass index ( underweight / normal , overweight , and obese / morbid obese ) as a health condition factor . the sociodemographic factors included beneficiaries ' age , sex , race / ethnicity , marital status , education level , annual personal income , supplemental insurance ( medicaid ) and type of insurance ( hmo / ffs ) , and external environmental characteristics ( metro status and region of residence ) . we measured patient 's self - perceived general health status as compared to others of the same age ( excellent / very good , good , or fair / poor ) . we also measured functional health status by examining participants ' self - reported difficulty with activities of daily living ( adl ) including difficulty in walking , eating , bathing , dressing , getting in or out of bed or chair , or using the toilet [ 4750 ] . we classified participants ' difficulty with adl in three categories : ( a ) no adl , ( b ) 1 - 2 adl , and ( c ) 36 adl . patient 's satisfaction with care constitutes an important factor which can affect patient - doctor communication and trust . we used participants ' responses to the survey item please tell me how satisfied you have been with the overall quality of the health care you have received over the past year to assess patient 's satisfaction with care [ 5154 ] . dissatisfied or very dissatisfied were considered dissatisfied with the quality of care . we analyzed the validity of patient - doctor communication and trust scales using factor structure by the principal component analysis with promax rotation and internal consistency ( a measure of reliability ) by cronbach 's alpha coefficient . the principal component analysis yielded single factor for both patient - doctor communication and trust scales . the single factor accounted for 98% of variance for the communication scale and 100% of variance for the trust scale . the alpha coefficient value for the communication scale was 0.87 and for the trust scale was 0.92 , which indicated high reliability for both the scales . we used chi - square tests to examine the unadjusted associations of patient - doctor communication and trust with theoretically derived predictor variables ( e.g. , patient 's sociodemographic characteristics , health status , health condition , and patient 's satisfaction factors ) . then , correlations were used to assess multicollinearity , resulting in the removal of patient 's health status ( self - perceived general health and functional status ) from further analysis . multivariable logistic regressions were conducted to examine the relationship between multimorbidity and patient - doctor relationships , after adjusting for patient 's sociodemographic factors , health condition , and satisfaction with care . we used survey procedures with statistical analysis system ( sas ) software to account for the complex survey design . among 9,867 medicare beneficiaries included in this study ( table 1 ) , the majority were white ( 78.5% ) , lived in a metro region ( 77.4% ) , did not have limitations in activities of daily living ( 66.2% ) , were either overweight or obese ( 64.6% ) , and were satisfied with quality of care ( 97.4% ) . also , 56.6% elderly beneficiaries were women , 57.2% were married , 45.4% had more than high school education , 35.1% were enrolled in hmo , 12.3% had medicaid insurance , 19.6% had fair or poor general health status , and 58.6% were past or current smokers ( table 1 ) . more than two - thirds of beneficiaries had mm - pi ( 72.0% ) and 12.1% had mm - pi&mi , constituting 84.1% of beneficiaries with either type of multimorbidity . from the unadjusted analysis , mm - pi&mi was present among a higher percentage of women than men ( 14.5% versus 9.0% ) , current smokers than nonsmokers ( 20.2% versus 11.3% ) , those aged 6569 years than 7579 years ( 14.3% versus 10.6% ) , those having less than high school education than more than high school education ( 15.2% versus 10.9% ) , having < $ 20,000 annual income than > $ 50,000 income ( 16.5% versus 8.5% ) , and having medicaid insurance ( 20.6% versus 11.0% ) ( table 1 ) . an overwhelming majority of the elderly strongly agreed or agreed that their doctor tells them all that they want to know about their condition and treatment ( 95.7% ) and ( 97.5% ) . also , a majority of beneficiaries strongly disagreed or disagreed that they often have health problems that should be discussed but are not ( 92.2% ) , and often acts as though he was doing them a favor by talking to them a lower percentage of the elderly with mm - pi&mi ( 80.1% ) had effective communication with the doctor as compared to those with mm - pi ( 84.2% ) and no mm ( 89.7% ) ( table 3 ) . a majority of beneficiaries agreed or strongly agreed that they have great confidence in their doctor ( 99.1% ) , is very careful to check everything when examining them ( 95.4% ) , has a good understanding of their medical history ( 97.7% ) , and has a complete understanding of the things that are wrong with them ( 96.6% ) ( table 2 ) . from the unadjusted analysis , there was no significant difference in trust in the doctor among the elderly with different multimorbidity categories ( table 3 ) . from the adjusted multivariate analysis , type of multimorbidity had a significant association with patient - doctor communication . after adjusting for patient 's sociodemographic characteristics , patient 's health condition , and patient 's satisfaction with care , medicare beneficiaries with mm - pi&mi were significantly less likely to have effective communication with the doctor ( adjusted odds ratio [ 95% confidence interval ] = 0.80 [ 0.68 , 0.96 ] ) , as compared to those with mm - pi ( table 4 ) . further , the elderly with no mm were significantly more likely to have effective communication with the doctor ( 1.48 [ 1.21 , 1.82 ] ) , as compared to those with mm - pi . other factors significantly associated with effective communication with the doctor were higher education and higher satisfaction with the quality of care . further , those living in the west were less likely to have efficient communication with the doctor as compared to those living in the northeast ( table 4 ) . the multimorbidity did not have a significant association with elderly patient 's trust in the doctor ( mm - pi&mi versus mm - pi : 0.98 [ 0.84 , 1.15 ] ) . other variables significantly associated with high trust in the doctor included female sex , higher education , higher personal income , and higher satisfaction with the quality of care ( table 4 ) . the elderly above 80 years of age compared to 6569 years , those who are african american or other race compared to white race , and those living in a metropolitan area compared to nonmetropolitan area were less likely to have high trust in the doctor ( table 4 ) . with multimorbidity being a norm in the us elderly population , policy focus has recently shifted towards the better illness management of these individuals [ 58 , 59 ] . elderly patients with multimorbidity need care that is responsive to the interactions between multiple conditions and treatments and is tailored to their individual needs . an effective communication and high trust between the patient and doctor are necessary for improving the care of these patients . to our knowledge , this is the first study to examine the association between multimorbidity with or without a mental condition and patient - doctor communication and trust among a nationally representative population of the elderly in the us . our results suggest that a majority of elderly medicare beneficiaries experience effective communication and have high trust in their doctor . however , the elderly who had a mental health condition in addition to chronic physical conditions were less likely to have effective communication as compared to the elderly who had multiple physical conditions without any mental condition . these results are consistent with a previous study that found an ineffective communication between doctor and patient with a single chronic mental condition . the elderly with a mental condition have been found to have different communication needs from individuals without any mental condition . for example , nonverbal communication activities such as gesture and facial activity are impaired among patients with a mental condition . the elderly with both mental and physical chronic conditions may also have social and internal stigma due to mental condition which might affect their communication with the doctor as compared to those with multiple physical conditions without mental condition . our results suggest that clinicians need to pay additional attention for an effective communication and higher trust when treating patients with concurrent physical and mental conditions . nearly fifteen percent of elderly beneficiaries with both chronic physical and mental conditions agreed or strongly agreed that their doctor is often in a hurry . a study by quirk et al . found that doctor 's appearing to be in a hurry during the visit is perceived as an uncaring attitude by the patients . patients place importance on having a doctor who talks at a slow pace and allows the patient to take his / her time . it is especially critical for an elderly patient with multiple chronic conditions because elderly patients and their families have to take care of all the cooccurring physical and mental health conditions at the same time and may want to talk about all of their diagnoses and comprehend numerous prescribed drugs and treatments . it is important for the clinicians not to hurry during consultation with an elderly patient having multimorbidity and allow the patient to take his / her own time to understand their multiple diagnoses and treatments . multimorbidity presents a challenge to primary care providers for addressing the competing demands of multiple physical and mental conditions in busy outpatient settings . discussion of multiple illnesses and treatments within a short visit may leave some patients feeling that the doctor did not discuss or provide all the information regarding their conditions and treatments , which we observed in our study . physicians who are treating patients with chronic physical and mental conditions may want to explore some alternative solutions to improve the discussion of illnesses and treatments such as the use of printed materials or internet , patient self - care , and use of physician assistants or nurse practitioners in primary care which can improve communication and trust . while we recognize the limitations of self - reported measures of mental illness , it should be noted that survey data has been routinely used for surveillance of mental illness and its associated health and cost burden . also , the mcbs utilizes computer - assisted interview procedures to improve the quality of the survey data . the participants are surveyed at relatively short intervals and the collected information is verified from medical claims to minimize errors . it is possible that patients who reported multiple chronic physical and mental conditions had more critical assessments of their interaction with their provider . also , communication and trust are container concepts and comprise several different domains [ 33 , 66 ] . patients ' perceived communication and trust with the doctor might be influenced by several other factors such as the severity of patient 's chronic condition , differences in patient and providers ' culture and communication styles , and organizational factors . multimorbidity is , therefore , one of the many factors that affect patient - doctor communication and trust . the study sample included elderly individuals who had at least one chronic physical condition . by excluding patients who have no comorbidities , any differences in communication and trust observed among the three groups were likely due to the presence of multimorbidity only . we did not compare patients with and without chronic conditions as this has been covered in the literature . further , we did not use a continuous variable for multimorbidity such as number of chronic conditions because we wanted to examine the association of type of multimorbidity with communication and trust . therefore , we categorized the patients into three groups according to the presence of multiple chronic physical and mental conditions . the strengths of our study include the use of a comprehensive list of survey items from mcbs ac module to measure specific components of patient - doctor communication and trust , which has been lacking in existing studies . we used a nationally representative dataset with a large sample size , and our study results can be generalized to elderly noninstitutionalized medicare beneficiaries throughout the us . also , our study used mcbs , which is a valid multipurpose survey and one of the first to use capi for data quality . the majority of elderly medicare beneficiaries experienced effective communication and high trust with their primary care doctors . the elderly with both chronic physical and mental health conditions had ineffective communication with their doctor as compared to those with multiple physical illnesses only . doctor being often in a hurry and doctor often not explaining illnesses were the two most significant communication issues reported by those with multimorbidity . in the absence of evidence - based clinical guidelines , better patient - doctor communication is required to overcome the challenges of managing multiple chronic conditions . it is important to examine and explain the multiple medical conditions and treatments among patients with multimorbidity . | background . effective communication and high trust with doctor are important to reduce the burden of multimorbidity in the rapidly aging population of the us .
however , the association of multimorbidity with patient - doctor communication and trust is unknown . objective .
we examined the relationship between multimorbidity and patient - doctor communication and trust among the elderly .
method .
we used the medicare current beneficiary survey ( 2012 ) to analyze the association between multimorbidity and patient - doctor communication and trust with multivariable logistic regressions that controlled for patient 's sociodemographic characteristics , health status , and satisfaction with care .
results .
most elderly beneficiaries reported effective communication ( 87.597.5% ) and high trust ( 95.499.1% ) with their doctors .
the elderly with chronic physical and mental conditions were less likely than those with only physical conditions to report effective communication with their doctor ( adjusted odds ratio [ 95% confidence interval ] = 0.80 [ 0.68 , 0.96 ] ) .
multimorbidity did not have a significant association with patient - doctor trust .
conclusions .
elderly beneficiaries had high trust in their doctors , which was not affected by the presence of multimorbidity .
elderly individuals who had a mental condition in addition to physical conditions were more likely to report ineffective communication .
programs to improve patient - doctor communication with patients having cooccurring chronic physical and mental health conditions may be needed . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the australian diabetes , obesity and lifestyle ( ausdiab ) study baseline methods and response rates have been described in detail elsewhere ( 13 ) . in brief , it is a national , population - based survey of 11,247 adults aged 25 years in 1999 to 2000 . a stratified cluster sample was drawn from 42 randomly selected census collector district clusters across australia . information was collected using a brief household interview , followed by a biomedical examination . of the eligible adults , 70% completed the household interview , and 55% ( n = 11,247 ) of these completed the baseline biomedical examination ( 14 ) . all participants provided written consent . in 2004 to 2005 , all living eligible participants were invited to attend follow - up . those who were considered ineligible included those who refused further contact ( n = 128 ) , were deceased ( n = 310 ) , had moved overseas or into a nursing facility classified for high care , or had a terminal illness ( n = 21 ) . among those eligible , 6,537 returned for the 5-year follow - up during which baseline assessment was repeated ; the response rate was 60.6% . compared with nonresponders , attendees were significantly less likely to be hypertensive , to have a lower level of education attainment , or to be smokers , and they had lower 2-h plasma glucose ( 2hpg ) , glycated hemoglobin , and smaller waist circumferences at baseline . all participants , except for those currently receiving treatment for diabetes or who were pregnant , underwent a standard 75-g oral glucose tolerance test ( 14 ) . only those people with normoglycemia at baseline were included in these analyses ( 1,575 with baseline agm and an additional 143 with missing data were excluded ) . the outcome category of incident agm comprised the pooled categories of ifg , igt , and diabetes at 5-year follow - up . glucose tolerance status at baseline and follow - up was based on plasma glucose results , using the 1999 world health organization diabetes classification ( 15 ) . diabetes was classified on the basis of fasting plasma glucose ( fpg ) 7.0 mmol / l or 2hpg 11.1 mmol / l or current treatment with insulin or oral hypoglycemic agents . < 7.0 mmol / l and 2hpg 7.8 mmol / l but < 11.1 mmol / l indicated igt , fpg 6.16.9 mmol / l and 2hpg < 7.8 mmol / l indicated ifg , and both fpg < 6.1 mmol / l and 2hpg < 7.8 area ses was measured using an aggregate measure of individual - level data called the index of relative socioeconomic disadvantage ( irsd ) . the irsd , one component of the socioeconomic indexes for areas ( 16 ) , characterizes the general ses of census collection districts ( the smallest geographic area defined in the australian standard geographical classification , comprising an average of 225 dwellings ) in australia . it is developed by the australian bureau of statistics ( 16 ) to create a summary measure from a group of 20 variables ( related to education , income , employment , family composition , housing benefits , car ownership , ethnicity , english language proficiency , and residential overcrowding ) that display dimensions of social disadvantage . principal components analysis determined the importance of each of the 20 characteristics depending on their interrelationships , and these relationships are used to create a weight for each characteristic ( see supplementary tables 1 and 2 for further details about socioeconomic indexes for areas , as well as full list of irsd variables included in the index and their individual weighting ) . the irsd has been shown to have excellent construct validity , tested against other large health and economic datasets and through stringent examination by an external expert panel ( more information about the irsd construction and validation process can be found elsewhere ) . for these analyses , the irsd scores were based on the 2001 census , and the data were divided into quartiles . at baseline and follow - up , the physical examination included blood samples , anthropometric measurements , and questionnaires . details on the glucose and lipid assays used between studies can be found in detail elsewhere ( 13 ) . bmi was calculated as weight ( kg ) divided by the square of the height ( m ) . blood pressure was measured using dinamap or a standard mercury sphygmomanometer with appropriate adjustments made as previously described ( 13 ) . individual - level ses data ( education and total household income ) were collected by an interviewer - administered questionnaire , as was information on health behaviors . education was classified into four categories , based on the highest educational qualifications received : 1 ) secondary school education ; 2 ) trade / technical certificates ; 3 ) associate degree , undergraduate diplomas , and nursing / teaching qualifications ; and 4 ) bachelor 's degree and postgraduate qualifications . total household income per week was assessed by a question asking the participant to choose the closest income band for their total household income before tax . total leisure - time physical activity was measured using the active australia questionnaire ( 18 ) . sedentary behavior was measured using self - reported television viewing as used previously ( 19 ) ; this determined the total time spent watching television or videos in the preceding week . smoking history ( current smoker , past smoker , or never smoked ) was collected using a previously validated instrument ( 20 ) . diet was measured using the self - administered anti - cancer council of victoria food frequency questionnaire ( 21 ) , and an overall index of diet quality was created using a scale of 1100 ( with 100 indicating high diet quality ) ( 22 ) . alcohol data were also obtained from the anti - cancer council of victoria food frequency questionnaire , as a continuous measure expressed in grams of ethanol per day . the total score ranged from 0 to 1 ; these scores were then categorized into quartiles . baseline demographic , socioeconomic , behavioral , and biochemical characteristics across the four categories of area ses were analyzed using complex survey methods to allow for the clustered design in the survey . differences in proportions presented in table 1 were analyzed with pearson tests , whereas differences in means were tested using analyses of variance . baseline characteristics ( means and percentages ) of the sample according to area ses categories to allow for the fact that individuals living within clusters were more likely to be similar to each other compared with others from different clusters and to accommodate the collinearity between the clusters and area disadvantage , generalized linear mixed models ( using the binomial distribution with the logit link function ) were employed to examine the relationship between area disadvantage and agm . because area ses is defined at the collection district level , all members of a cluster had the same area ses level ; therefore , collection district was included as the random effects term to correct for the design effects . collinearity between fixed - effects variables was assessed using bivariate correlations ; none were observed . the fixed effects for model 1 were age , sex , and area ses ( the area with the lowest area disadvantage was used as the reference category ) . interaction terms were included to detect any interactions among age and sex and area ses . no interaction effects were identified , and therefore , these terms were omitted from the analyses . age- and sex - stratified analyses were performed , and similar relationships were observed across sex and age categories ( results not shown ) . model 2 included the other upstream variables , individual markers of ses , education , and household income as potential confounding variables , with model 3 incorporating the midstream health behaviors of physical activity , sedentary behavior , and smoking as possible mediators . missing data for diet quality ( n = 145 ) and alcohol consumption ( n = 289 ) meant these variables could not be included in main models ; however , sensitivity analyses tested their inclusion , and the same results for model 3 were observed . models 4 and 5 assessed the roles of stress ( perceived stress ) and central adiposity ( waist circumference ) , respectively , as possible mid- and downstream mediators of the relationship between area ses and agm ( respectively ) . the final fully adjusted model ( model 6 ) included all previous covariates , as well as the baseline metabolic syndrome components of systolic blood pressure ( sbp ; defined according to 10-mmhg intervals ) , triglycerides , and hdl cholesterol . potential mediation by mid- and downstream variables was inferred by attenuation of the odds ratio ( or ) for area ses on agm in relevant models . to test for trend , the models were reanalyzed , with area ses ( irsd ) included as a continuous variable in separate generalized linear mixed models . analyses were performed using spss version 19 ( ibm ) , with a significance level of p < 0.05 . the australian diabetes , obesity and lifestyle ( ausdiab ) study baseline methods and response rates have been described in detail elsewhere ( 13 ) . in brief , it is a national , population - based survey of 11,247 adults aged 25 years in 1999 to 2000 . a stratified cluster sample was drawn from 42 randomly selected census collector district clusters across australia . information was collected using a brief household interview , followed by a biomedical examination . of the eligible adults , 70% completed the household interview , and 55% ( n = 11,247 ) of these completed the baseline biomedical examination ( 14 ) . all participants provided written consent . in 2004 to 2005 , all living eligible participants were invited to attend follow - up . those who were considered ineligible included those who refused further contact ( n = 128 ) , were deceased ( n = 310 ) , had moved overseas or into a nursing facility classified for high care , or had a terminal illness ( n = 21 ) . among those eligible , 6,537 returned for the 5-year follow - up during which baseline assessment was repeated ; the response rate was 60.6% . compared with nonresponders , attendees were significantly less likely to be hypertensive , to have a lower level of education attainment , or to be smokers , and they had lower 2-h plasma glucose ( 2hpg ) , glycated hemoglobin , and smaller waist circumferences at baseline . all participants , except for those currently receiving treatment for diabetes or who were pregnant , underwent a standard 75-g oral glucose tolerance test ( 14 ) . only those people with normoglycemia at baseline were included in these analyses ( 1,575 with baseline agm and an additional 143 with missing data were excluded ) . the outcome category of incident agm comprised the pooled categories of ifg , igt , and diabetes at 5-year follow - up . glucose tolerance status at baseline and follow - up was based on plasma glucose results , using the 1999 world health organization diabetes classification ( 15 ) . diabetes was classified on the basis of fasting plasma glucose ( fpg ) 7.0 mmol / l or 2hpg 11.1 mmol / l or current treatment with insulin or oral hypoglycemic agents . < 7.0 mmol / l and 2hpg 7.8 mmol / l but < 11.1 mmol / l indicated igt , fpg 6.16.9 mmol / l and 2hpg < 7.8 mmol / l indicated ifg , and both fpg < 6.1 mmol / l and 2hpg < 7.8 area ses was measured using an aggregate measure of individual - level data called the index of relative socioeconomic disadvantage ( irsd ) . the irsd , one component of the socioeconomic indexes for areas ( 16 ) , characterizes the general ses of census collection districts ( the smallest geographic area defined in the australian standard geographical classification , comprising an average of 225 dwellings ) in australia . it is developed by the australian bureau of statistics ( 16 ) to create a summary measure from a group of 20 variables ( related to education , income , employment , family composition , housing benefits , car ownership , ethnicity , english language proficiency , and residential overcrowding ) that display dimensions of social disadvantage . principal components analysis determined the importance of each of the 20 characteristics depending on their interrelationships , and these relationships are used to create a weight for each characteristic ( see supplementary tables 1 and 2 for further details about socioeconomic indexes for areas , as well as full list of irsd variables included in the index and their individual weighting ) . the irsd has been shown to have excellent construct validity , tested against other large health and economic datasets and through stringent examination by an external expert panel ( more information about the irsd construction and validation process can be found elsewhere ) . for these analyses , the irsd scores were based on the 2001 census , and the data were divided into quartiles . at baseline and follow - up , the physical examination included blood samples , anthropometric measurements , and questionnaires . details on the glucose and lipid assays used between studies can be found in detail elsewhere ( 13 ) . bmi was calculated as weight ( kg ) divided by the square of the height ( m ) . blood pressure was measured using dinamap or a standard mercury sphygmomanometer with appropriate adjustments made as previously described ( 13 ) . individual - level ses data ( education and total household income ) were collected by an interviewer - administered questionnaire , as was information on health behaviors . education was classified into four categories , based on the highest educational qualifications received : 1 ) secondary school education ; 2 ) trade / technical certificates ; 3 ) associate degree , undergraduate diplomas , and nursing / teaching qualifications ; and 4 ) bachelor 's degree and postgraduate qualifications . total household income per week was assessed by a question asking the participant to choose the closest income band for their total household income before tax . total leisure - time physical activity was measured using the active australia questionnaire ( 18 ) . sedentary behavior was measured using self - reported television viewing as used previously ( 19 ) ; this determined the total time spent watching television or videos in the preceding week . smoking history ( current smoker , past smoker , or never smoked ) was collected using a previously validated instrument ( 20 ) . diet was measured using the self - administered anti - cancer council of victoria food frequency questionnaire ( 21 ) , and an overall index of diet quality was created using a scale of 1100 ( with 100 indicating high diet quality ) ( 22 ) . alcohol data were also obtained from the anti - cancer council of victoria food frequency questionnaire , as a continuous measure expressed in grams of ethanol per day . the total score ranged from 0 to 1 ; these scores were then categorized into quartiles . all participants , except for those currently receiving treatment for diabetes or who were pregnant , underwent a standard 75-g oral glucose tolerance test ( 14 ) . only those people with normoglycemia at baseline were included in these analyses ( 1,575 with baseline agm and an additional 143 with missing data were excluded ) . the outcome category of incident agm comprised the pooled categories of ifg , igt , and diabetes at 5-year follow - up . glucose tolerance status at baseline and follow - up was based on plasma glucose results , using the 1999 world health organization diabetes classification ( 15 ) . diabetes was classified on the basis of fasting plasma glucose ( fpg ) 7.0 mmol / l or 2hpg 11.1 mmol / l or current treatment with insulin or oral hypoglycemic agents . < 7.0 mmol / l and 2hpg 7.8 mmol / l but < 11.1 mmol / l indicated igt , fpg 6.16.9 mmol / l and 2hpg < 7.8 mmol / l indicated ifg , and both fpg < 6.1 mmol / l and 2hpg < 7.8 area ses was measured using an aggregate measure of individual - level data called the index of relative socioeconomic disadvantage ( irsd ) . the irsd , one component of the socioeconomic indexes for areas ( 16 ) , characterizes the general ses of census collection districts ( the smallest geographic area defined in the australian standard geographical classification , comprising an average of 225 dwellings ) in australia . it is developed by the australian bureau of statistics ( 16 ) to create a summary measure from a group of 20 variables ( related to education , income , employment , family composition , housing benefits , car ownership , ethnicity , english language proficiency , and residential overcrowding ) that display dimensions of social disadvantage . principal components analysis determined the importance of each of the 20 characteristics depending on their interrelationships , and these relationships are used to create a weight for each characteristic ( see supplementary tables 1 and 2 for further details about socioeconomic indexes for areas , as well as full list of irsd variables included in the index and their individual weighting ) . the irsd has been shown to have excellent construct validity , tested against other large health and economic datasets and through stringent examination by an external expert panel ( more information about the irsd construction and validation process can be found elsewhere ) . for these analyses , the irsd scores were based on the 2001 census , and the data were divided into quartiles . at baseline and follow - up , the physical examination included blood samples , anthropometric measurements , and questionnaires . details on the glucose and lipid assays used between studies can be found in detail elsewhere ( 13 ) . bmi was calculated as weight ( kg ) divided by the square of the height ( m ) . blood pressure was measured using dinamap or a standard mercury sphygmomanometer with appropriate adjustments made as previously described ( 13 ) . individual - level ses data ( education and total household income ) were collected by an interviewer - administered questionnaire , as was information on health behaviors . education was classified into four categories , based on the highest educational qualifications received : 1 ) secondary school education ; 2 ) trade / technical certificates ; 3 ) associate degree , undergraduate diplomas , and nursing / teaching qualifications ; and 4 ) bachelor 's degree and postgraduate qualifications . total household income per week was assessed by a question asking the participant to choose the closest income band for their total household income before tax . total leisure - time physical activity was measured using the active australia questionnaire ( 18 ) . sedentary behavior was measured using self - reported television viewing as used previously ( 19 ) ; this determined the total time spent watching television or videos in the preceding week . smoking history ( current smoker , past smoker , or never smoked ) was collected using a previously validated instrument ( 20 ) . diet was measured using the self - administered anti - cancer council of victoria food frequency questionnaire ( 21 ) , and an overall index of diet quality was created using a scale of 1100 ( with 100 indicating high diet quality ) ( 22 ) . alcohol data were also obtained from the anti - cancer council of victoria food frequency questionnaire , as a continuous measure expressed in grams of ethanol per day . the total score ranged from 0 to 1 ; these scores were then categorized into quartiles . baseline demographic , socioeconomic , behavioral , and biochemical characteristics across the four categories of area ses were analyzed using complex survey methods to allow for the clustered design in the survey . differences in proportions presented in table 1 were analyzed with pearson tests , whereas differences in means were tested using analyses of variance . baseline characteristics ( means and percentages ) of the sample according to area ses categories to allow for the fact that individuals living within clusters were more likely to be similar to each other compared with others from different clusters and to accommodate the collinearity between the clusters and area disadvantage , generalized linear mixed models ( using the binomial distribution with the logit link function ) were employed to examine the relationship between area disadvantage and agm . because area ses is defined at the collection district level , all members of a cluster had the same area ses level ; therefore , collection district was included as the random effects term to correct for the design effects . collinearity between fixed - effects variables was assessed using bivariate correlations ; none were observed . the fixed effects for model 1 were age , sex , and area ses ( the area with the lowest area disadvantage was used as the reference category ) . interaction terms were included to detect any interactions among age and sex and area ses . no interaction effects were identified , and therefore , these terms were omitted from the analyses . age- and sex - stratified analyses were performed , and similar relationships were observed across sex and age categories ( results not shown ) . model 2 included the other upstream variables , individual markers of ses , education , and household income as potential confounding variables , with model 3 incorporating the midstream health behaviors of physical activity , sedentary behavior , and smoking as possible mediators . missing data for diet quality ( n = 145 ) and alcohol consumption ( n = 289 ) meant these variables could not be included in main models ; however , sensitivity analyses tested their inclusion , and the same results for model 3 were observed . models 4 and 5 assessed the roles of stress ( perceived stress ) and central adiposity ( waist circumference ) , respectively , as possible mid- and downstream mediators of the relationship between area ses and agm ( respectively ) . the final fully adjusted model ( model 6 ) included all previous covariates , as well as the baseline metabolic syndrome components of systolic blood pressure ( sbp ; defined according to 10-mmhg intervals ) , triglycerides , and hdl cholesterol . potential mediation by mid- and downstream variables was inferred by attenuation of the odds ratio ( or ) for area ses on agm in relevant models . to test for trend , the models were reanalyzed , with area ses ( irsd ) included as a continuous variable in separate generalized linear mixed models . analyses were performed using spss version 19 ( ibm ) , with a significance level of p < 0.05 . table 1 presents the unadjusted baseline characteristics of the sample , divided according to the four categories of area socioeconomic disadvantage . people living in the more disadvantaged areas reported having lower educational achievement and receiving significantly lower weekly incomes compared with the people in the least disadvantaged area . in general , there were significant behavioral and biological differences between the areas , with people living in the more socially disadvantaged areas more likely to report smoking , physical inactivity , and lower quality of diet , as well as having unhealthier cardiovascular disease risk profiles ( according to anthropometric , lipid , and glucose levels ) at baseline compared with people in the area with the least disadvantage . a total of 478 participants had developed agm after 5 years ( 143 with ifg , 277 with igt , and 58 with type 2 diabetes ) . as shown in table 2 , area ses was a significant predictor of agm at follow - up in this sample , after controlling for age and sex ( p = 0.002 ) . this was a graded relationship with people living in the areas with greater social disadvantage being more likely to develop an impairment of glucose metabolism compared with those living in areas with lesser disadvantage . the test for trend showed that ses , as a continuous variable , was significantly related to agm ( p = 0.006 ) . adjustment for individual ses did not substantially attenuate the associations between area ses and agm ( model 2 ) , with area - level disadvantage remaining a significant predictor of incident agm ( or 1.53 ; 95% ci 1.072.18 ) . with the inclusion of physical activity , sedentary behavior , and smoking in model 3 , physical inactivity this adjustment for health behaviors mildly attenuated the estimates of the relationship between area ses and agm ( 1.46 ; 1.022.08 ) . adjustment for perceived stress in model 4 did not affect the association between area ses and agm ( 1.52 ; 1.052.20 ) risk of incident abnormal glucose metabolism , according to level of socioeconomic disadvantage the inclusion of waist circumference in model 5 attenuated the associations , such that elevated risk of agm in individuals living in the most disadvantaged , compared with the least disadvantaged , areas were no longer statistically significant , although there remained a trend toward increased risk of agm in the most deprived area ( or 1.27 , 95% ci 0.901.79 ) . model 6 made adjustments for the potential confounders of education and income , the possible mediators of physical activity , sedentary behavior , smoking , stress , and waist circumference , as well as the metabolic syndrome components of sbp , triglycerides , and hdl cholesterol . in this model , only age ( 1.02 ; 1.011.03 ) , waist circumference ( 1.03 ; 1.021.04 ) , sbp ( 1.13 ; 1.051.21 ) , and triglycerides ( 1.28 ; 1.161.42 ) were shown to predict incident agm . area - level ses was no longer significantly associated with an increased risk of developing glucose metabolism dysfunction ( 1.28 ; 0.881.87 ) . table 1 presents the unadjusted baseline characteristics of the sample , divided according to the four categories of area socioeconomic disadvantage . people living in the more disadvantaged areas reported having lower educational achievement and receiving significantly lower weekly incomes compared with the people in the least disadvantaged area . in general , there were significant behavioral and biological differences between the areas , with people living in the more socially disadvantaged areas more likely to report smoking , physical inactivity , and lower quality of diet , as well as having unhealthier cardiovascular disease risk profiles ( according to anthropometric , lipid , and glucose levels ) at baseline compared with people in the area with the least disadvantage . a total of 478 participants had developed agm after 5 years ( 143 with ifg , 277 with igt , and 58 with type 2 diabetes ) . as shown in table 2 , area ses was a significant predictor of agm at follow - up in this sample , after controlling for age and sex ( p = 0.002 ) . this was a graded relationship with people living in the areas with greater social disadvantage being more likely to develop an impairment of glucose metabolism compared with those living in areas with lesser disadvantage . the test for trend showed that ses , as a continuous variable , was significantly related to agm ( p = 0.006 ) . adjustment for individual ses did not substantially attenuate the associations between area ses and agm ( model 2 ) , with area - level disadvantage remaining a significant predictor of incident agm ( or 1.53 ; 95% ci 1.072.18 ) . with the inclusion of physical activity , sedentary behavior , and smoking in model 3 , physical inactivity this adjustment for health behaviors mildly attenuated the estimates of the relationship between area ses and agm ( 1.46 ; 1.022.08 ) . adjustment for perceived stress in model 4 did not affect the association between area ses and agm ( 1.52 ; 1.052.20 ) risk of incident abnormal glucose metabolism , according to level of socioeconomic disadvantage the inclusion of waist circumference in model 5 attenuated the associations , such that elevated risk of agm in individuals living in the most disadvantaged , compared with the least disadvantaged , areas were no longer statistically significant , although there remained a trend toward increased risk of agm in the most deprived area ( or 1.27 , 95% ci 0.901.79 ) . model 6 made adjustments for the potential confounders of education and income , the possible mediators of physical activity , sedentary behavior , smoking , stress , and waist circumference , as well as the metabolic syndrome components of sbp , triglycerides , and hdl cholesterol . in this model , only age ( 1.02 ; 1.011.03 ) , waist circumference ( 1.03 ; 1.021.04 ) , sbp ( 1.13 ; 1.051.21 ) , and triglycerides ( 1.28 ; 1.161.42 ) were shown to predict incident agm . area - level ses was no longer significantly associated with an increased risk of developing glucose metabolism dysfunction ( 1.28 ; 0.881.87 ) . using population - based data , we have shown that people living in areas with greater socioeconomic disadvantage were significantly more likely to develop agm compared with those in areas with less disadvantage . this finding indicates that area - level factors are relevant to the development of diabetes , beyond their relationship with individual socioeconomic characteristics . although one s choice of residential neighborhood is clearly patterned by individual factors , such as income and ethnicity , it has been demonstrated that measurement of individual ses does not capture a person s complete socioeconomic experience ( 11 ) . understanding the different levels of factors that influence the progression of diabetes is essential if we are to successfully reduce the escalating rates . most importantly , the findings from this study identify people s environmental circumstances as an important focus for interventions to prevent diabetes and its progression , in addition to the current focus on interventions directed primarily at individual level factors . to our knowledge , this is the first study to use objective markers of glucose tolerance to explore the relationship between area - level socioeconomic characteristics and the development of agm . previous studies have included select populations with self - report diabetes outcomes ( 79 ) . there is some evidence that undiagnosed diabetes is associated with lower ses ( 10 ) , a finding supported by unpublished ausdiab data . therefore , the investigation of socioeconomic predictors of diabetes using self - report doctor - diagnosed diabetes may bias the association between area ses and incident diabetes to the null . this is also the first study , of which we are aware , to investigate the role of mid- and downstream mediators of the association between area ses and agm . the inclusion of the health behaviors , in particular physical activity , in these analyses caused partial attenuation of the impact of area disadvantage on agm ( missing data for diet quality meant that this behavior was not included in the analyses ; however , separate analyses indicate that its inclusion would not have affected the relationships observed ) , suggesting that aspects of the environment patterned by area ses may influence health behavior patterns and thus impact the risk of diabetes . this partial mediation of health behaviors on the relationship between area ses and diabetes has been observed previously ( 7 ) . the multi - ethnic study of atherosclerosis has found that neighborhoods characterized by greater physical activity resources and availability of healthy food had a 38% lower incidence of diabetes ( 24 ) . other work has observed a socioeconomic gradient in the density of fast food options ( 25 ) and food - purchasing behavior , with people living in low ses areas in australia significantly less likely to buy healthy food options ( 26 ) . although other evidence supporting such findings is equivocal ( 27,28 ) , these results suggest there may be area - level differences in the availability and accessibility of these resources and that the differences are not solely due to individual level factors such as choice and affordability . the inclusion of perceived stress in our analyses as a potential midstream - mediating variable did not influence the relationship between area ses and agm . previous research has not explicitly examined this relationship , although greater levels of psychosocial adversity , such as stress and depression , have been reported in areas of low ses ( 29,30 ) . it is possible that the single time - point assessment in this study may not have been sensitive enough to measure the cumulative impact of long - term exposure to psychosocial disadvantage ( 31 ) . other psychosocial factors , such as the safety of an area , are also crucial to encourage people to participate in exercise , and people living in areas with lower ses are more likely to report feeling unsafe ( 32 ) . furthermore , other perceptions of one s environment , such as perceived access to attractive public areas , may affect residents physical activity behavior ( 33 ) . we have shown that the downstream variable of adiposity , determined in these analyses by the central adiposity measure of waist circumference , explained a large proportion of the relationship between area ses and agm . black women s health study , which found that the association between neighborhood ses and incidence of self - reported diabetes was attenuated by the inclusion of bmi in the model and therefore likely to be a key mechanism in the pathway linking ses and diabetes ( 7 ) . for these analyses , we used the category of agm as the incident outcome measure instead of diabetes alone . for this , the categories of ifg , igt , and diabetes were combined , because they share the common pathophysiological mechanisms of insulin resistance and -cell dysfunction ( 34,35 ) . given the short follow - up period of 5 years , we chose to use a binary classification system indicating a wide spread of hyperglycemia and disordered carbohydrate metabolism . the national , population - based nature of this sample and the quality of the glucose tolerance data are significant strengths of our study , and therefore , the results may be generalizable to other populations of similar ethnicity and socioeconomic range . however , there are also some limitations to be considered . this study was not able to assess whether these results are generalizable across all ethnic groups ; the ausdiab sample included limited ethnic group variation ( 97% spoke english as a first language , and only 0.7% were of aboriginal or torres strait island origin ) . the inclusion of language and ethnicity in the analyses did not influence the results presented ( data not shown ) . differences observed between responders and nonresponders mean that the sample may be subject to selection bias , the effects of which can not be fully ascertained . however , lower ses recorded in nonresponders ( according to education levels ) could indicate that our results have underestimated the strength of the relationship between ses and agm . the single time - point assessment of area disadvantage also limits the measurement of social mobility across time . the origins of socioeconomic and behavioral risk factors track back to the early years of life , even in utero ( 36 ) . although education was the earliest indicator of ses available , we did adjust for birth weight as a marker of possible early life exposure ( results not shown ) . this did not affect the predictive impact of area ses on incident agm , and therefore , the socioenvironmental factors that influence early development and promote disease later in life did not appear to moderate the relationships observed . the self - reported behavioral data in this study means that the contributions of these variables may not be accurate , and this may partly explain why the inclusion of behavioral variables had a small effect on the socioeconomic gradient in agm . it is possible that the adjustment for individual ses in the analyses may introduce methodological issues since the measurement of area ses comprised an aggregation of the socioeconomic characteristics of its residents ( 11 ) . this is , however , an accepted method of determining the effects attributable to the individual- and area - level contexts ( 7,24,26 ) . although we adjusted for education and income , it is possible that residual confounding remained , and we were not able to take into account the full estimate of these individual effects . ( 37 ) , adjustment for the individual characteristics may represent an overadjustment , because these variables may act as mediators in the relationship between area ses and agm . more work should focus on the extent to which individual characteristics moderate or mediate the relationship between area - level disadvantage and health ( 38 ) . we acknowledge that the inclusion of upstream and downstream factors in our final model makes the parameter estimates difficult to interpret . our findings confirm the socioeconomic gradient in the development of agm and extend our understanding of the influence of area - level socioeconomic characteristics . the results indicate that mid- and downstream variables of health behaviors and central adiposity partially mediate this relationship . as discussed by turrell ( 39 ) , to reduce socioeconomic disparities in society , policies are needed that focus on upstream determinants . however , interventions at each level of the disease process are likely to have the greatest impact ( 39 ) . therefore , designing community - level programs that target these individual risk factors may help address the socioeconomic gradient in chronic disease risk . furthermore , our findings also have significant policy implications for neighborhood and area planning ( 40 ) and the allocation of resources to lower socioeconomic areas for the prevention of diabetes . | objectiveto examine the role of area - level socioeconomic status ( ses ) on the development of abnormal glucose metabolism ( agm ) using national , population - based data.research design and methodsthe australian diabetes , obesity and lifestyle ( ausdiab ) study is a national , population - based , longitudinal study of adults aged 25 years . a sample of 4,572 people provided complete baseline ( 1999 to 2000 ) and 5-year follow - up ( 2004 to 2005 ) data relevant for these analyses .
incident agm was assessed using fasting plasma glucose and 2-h plasma glucose from oral glucose tolerance tests , and demographic , socioeconomic , and behavioral data were collected by interview and questionnaire .
area ses was defined using the index of relative socioeconomic disadvantage .
generalized linear mixed models were used to examine the relationship between area ses and incident agm , with adjustment for covariates and correction for cluster design effects.resultsarea ses predicted the development of agm , after adjustment for age , sex , and individual ses .
people living in areas with the most disadvantage were significantly more likely to develop agm , compared with those living in the least deprived areas ( odds ratio 1.53 ; 95% ci 1.072.18 ) .
health behaviors ( in particular , physical activity ) and central adiposity appeared to partially mediate this relationship.conclusionsour findings suggest that characteristics of the physical , social , and economic aspects of local areas influence diabetes risk .
future research should focus on identifying the aspects of local environment that are associated with diabetes risk and how they might be modified . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
glaucoma is currently recognized as a multifactorial neurodegenerative disorder with complex pathogenesis , affecting 60 million people worldwide in its most common forms . elevated intraocular pressure ( iop ) is a major risk factor for glaucoma ; however , traditional strategies of lowering intraocular pressure have been shown to be unable to prevent progressive vision loss in some glaucoma patients , so the focus of glaucoma research has shifted toward neuroprotection . neuroprotection for glaucoma can be considered an additional therapeutic strategy , independent of and complementary to iop - lowering treatment , directly targeting retinal ganglion cells ( rgcs ) and neurons of the higher visual centers . one such strategy is pharmacological neuroprotection , in which a drug is administered to interact with neuronal or glial elements within the retina / optic nerve head and thereby facilitate the survival of rgcs . two recent parallel clinical trials of oral memantine , an n - methyl - d - aspartate ( nmda ) antagonist , in patients with chronic progressive open angle glaucoma , were unsuccessful . the results of industry - supported trials have not yet been published , but the sponsor of these trials has provided press releases . currently , no drug with claimed neuroprotective activity has been identified or approved for the treatment of glaucoma . multiple mechanisms lead to ganglion cell death in glaucoma , suggesting that a neuroprotectant that has a single mode of action , like memantine , would have a limited positive effect at slowing down ganglion cell death . conversely , simultaneously targeting several factors may be the most likely therapeutic approach to improve outcome . in recent years , there has been a rapidly expanding interest in multifunctional drugs as an approach to the treatment of central nervous system neurodegenerative disorders with complex pathological mechanisms . increasing evidence shows that numerous similarities exist between glaucomatous neurodegeneration and other central nervous system neurodegenerative diseases . excitotoxicity triggered by elevated glutamate , excess concentrations of amyloid peptide and excessive oxidant damage by reactive oxygen species have been implicated in the development of neurodegenerative process of glaucoma , as they have in alzheimer 's disease . additionally , there is a growing trend toward using existing neuroprotective strategies in central nervous system neurodegenerative diseases for the treatment of glaucoma . the incidence of neurodegenerative diseases has increased steadily worldwide owing to the extended life expectancy brought about by better health care . these neurodegenerative diseases include alzheimer 's disease , parkinson 's disease , amyotrophic lateral sclerosis , multiple sclerosis , huntington 's disease , and multiple system atrophy , as well as diseases originating from an acute initial insult such as traumatic brain injury and stroke . glaucoma is a neurodegenerative disease , and the incidence of neurodegenerative diseases tends to increase with aging , as is also observed in glaucoma . a considerable body of evidence shows that the pathogenesis of these diseases is extremely complex and heterogeneous , resulting in significant comorbidity and that they are therefore unlikely to be mitigated by any drug acting on a single pathway or target . the one - target one - drug paradigm has been the dominating drug discovery approach since the early 1990s . this paradigm attempts to identify a single chemical entity that binds to a single target . for instance , memantine , an nmda receptor ( nmdar ) channel antagonist , was developed for the treatment of moderate - to - severe alzheimer 's disease in 2003 . however , owing to disappointing clinical results , the effectiveness of this paradigm has been questioned . recent large - scale genomics studies have confirmed significant redundancy in proteinaceous drug targets , suggesting that drugs directed toward single pathophysiological mechanisms may have more limitations than multifunctional drugs . when an undesired pharmacologic action occurs at therapeutic doses , this is not a multifunctional drug , but a dirty drug . more recently , a new paradigm that addresses disease etiological complexity using a multi - target - directed ligand approach has gained increasing acceptance . novel compounds are specifically designed to target the multiple mechanisms underlying the etiology of a specific disease , and these have shown superior efficacy and safety profiles . these agents offer the promise of preventing , arresting , or slowing decline through disease modification . thus , the major drug discovery paradigm is shifting from a one - drug one - target strategy to a one - drug - multiple - targets strategy ( figure 1 ) . the drug discovery strategy for complex pathologies such as those found in neurodegenerative disease has undergone a paradigm shift from the design of one - molecule - one - target agent to the design of multifunctional drugs . in 2006 , rasagiline ( n - propagrgyl-1r - aminoindan ) was approved as the first once - daily oral treatment for parkinson 's disease by the u.s . it was also the first parkinson 's disease treatment to receive the label disease - modifying . the development of rasagiline provides an excellent example to support the validity of the multi - target - designed ligand approach to searches for effective medicines combating neurodegenerative diseases . glaucoma is a leading cause of irreversible world vision loss and is characterized by progressive rgc death . although the exact mechanism underlying glaucoma remains uncertain , much progress has been made in identifying potential pharmacological targets . the development of animal models of chronic glaucoma has enhanced our understanding of many of the pathological processes occurring in glaucoma and , in doing so , has suggested logical targets for pharmacological intervention . glutamate is a major excitatory neurotransmitter in the central nervous system , including the retina . glutamate - mediated excitotoxicity , primarily through nmdars , may be an important cause of rgc death in glaucoma . pharmacological inhibition of nmdars has been advocated to be an important strategy for neuroprotection in glaucoma . memantine , an nmda antagonist , has undergone phase 3 clinical trials for glaucoma progression , but the drug did not show significant efficacy in preserving visual function . it has been suggested that excessive nitric oxide is involved in the optic neuropathy associated with glaucoma , and that it is most likely made by reactive astrocytes and microglia in the optic nerve heads . nitric oxide is generated by the action of nitric oxide synthase ( nos ) , which has three different forms , namely , neuronal nos ( nnos ) , endothelial and inducible . in a rat model of chronic glaucoma , nnos expression was significantly increased and a non - specific nos inhibitor reduced rgc loss . another investigation showed that inducible nitric oxide synthase did not mediate optic neuropathy and retinopathy in the dba/2j glaucoma model . thus , it has been suggested that pharmacological inhibition of nnos represents a novel strategy for the treatment of glaucoma . it is commonly believed that intracellular calcium is a major mediator of neuronal cell death in ischemia , in which high levels of released glutamate can produce overstimulation of ionotropic glutamate receptors , leading to neuronal cell death triggered by a large influx of ca into cells mainly via nmdars and secondary opening of voltage - dependent ca channels . furthermore , l - type voltage - dependent ca channels also appear to play a major role in controlling the release of glutamate in the retina . therefore , it has been hypothesized that ca channel antagonists would be effective neuroprotectants in glaucoma . it has been hypothesized that oxidative stress plays a role in rgc death in glaucoma by damaging the trabecular meshwork , the optic nerve head , and the retina . the term oxidative stress , refers to a cell 's state characterized by excessive production of reactive oxygen species and/or a reduction in the antioxidant defenses responsible for their metabolism . reactive oxygen species are not only involved in direct cytotoxic consequences leading to rgc death , but may also play roles in the cell death signaling pathway by acting as second messengers and/or modulating protein function by redox modifications of downstream effectors through enzymatic oxidation of specific amino acid residues . the use of antioxidant therapy may offer unique opportunities for neuroprotective interventions aimed at the effective treatment of glaucoma . amyloid peptide is constitutively produced by proteolysis of -amyloid precursor protein and is intricately involved in the neuropathology of alzheimer 's disease . amyloid peptide has recently been reported to be implicated in the development of rgc apoptosis in glaucoma , and induces rgc apoptosis in vivo in a dose- and time - dependent manner . it is likely that drugs targeting different components of the amyloid peptide pathway would provide a therapeutic avenue for glaucoma management . the neurotrophin deprivation hypothesis suggests that the obstruction of retrograde transport at the lamina cribrosa causes the deprivation of neurotrophic support to rgcs in glaucoma . the neurotrophin family includes nerve growth factor , brain - derived neurotrophic factor , neurotrophin-3 and neurotrophin-4/5 . brain - derived neurotrophic factor enhances survival of rgcs in a model of excitotoxic injury . nerve growth factor was identified as being neuroprotective in the morrison 's glaucoma model by reducing rgc apoptosis through topical application . neurotrophic factor delivery may be a key approach in the development of potential neuroprotective glaucoma treatments . gene therapy involves delivery of a gene to targeted cells to cure or slow the progression of diseases . it has become a highly accessible approach for glaucoma because the trabecular meshwork , ciliary body , ciliary epithelium , mller cells and rgcs are all appropriate target structures for gene therapy . in addition , heat shock proteins and caspase-3 are involved in the mechanisms believed to initiate the apoptotic cascade in glaucoma , thereby providing potential targets to rescue rgcs . owing to the complex etiology of glaucoma , an innovative approach to neuroprotection or neurorescue may entail the use of multifunctional pharmaceuticals that target an array of pathological pathways , each of which is believed to contribute to the cascade that ultimately leads to neuronal cell death . epigallocatechin gallate , a catechin - base flavonoid derived from green tea , possesses diverse pharmacological properties all of which contribute to its neuroprotective properties . besides being a powerful antioxidant moreover , it blocks the activation of nuclear factor - kappa b , thus preventing nos-2 induction and consequent cytotoxic damage . epigallocatechin gallate has a protective effect on injured neurons in neurodegenerative disease , such as alzheimer 's disease and parkinson 's disease . it protects rgcs from oxidative stress and ischemia / reperfusion , and its protective effect against retinal ischemia reperfusion damage is independent of any action upon iop . bis(7)-tacrine is a promising anti - alzheimer 's dimer derived from tacrine ( figure 2a ) . it was originally designed as a highly potent , selective , and low cost bifunctional acetylcholinesterase inhibitor utilizing computer modeling of ligand docking with target proteins . this unique compound possesses multiple physiological activities working through a multitude of mechanisms including concurrent inhibition of nmdars , nnos , l - type voltage - dependent calcium channels , acetylcholinesterase , and the amyloid precursor protein/-amyloid cascade . our results confirmed that bis(7)-tacrine has neuroprotective effects against glutamate - induced rgc damage in vitro and in vivo , possibly through the drug 's anti - nmdar effects . in glaucoma , rgcs are exquisitely sensitive to the effects of both glutamate and amyloid precursor protein , which produces a dose - dependent cell - loss both in vivo and in vitro . we postulate that bis(7)-tacrine protects rgcs via concurrent blockade of nmdars , voltage - dependent ca channels and nnos in glaucomatous neurodegeneration ( figure 2b ) . proposed mechanism of action of bis(7)-tacrine in glaucoma neuroprotection through concurrent blockage of n - methyl - d - aspartate receptors ( nmdars ) , voltage - dependent ca channels ( vdccs ) and neuronal nitric oxide synthase ( nnos ) . ( b ) synergistic neuroprotection by bis(7)-tacrine via concurrent blockade of nmdar , vdccs and nnos . when retinal ganglion cells are exposed to glutamate and amyloid precursor protein at toxic concentrations , excessive calcium influx mediates the subsequent biochemical events leading to neurotoxicity . currently , decreasing iop is the only established medical treatment for glaucoma with elevated iop , which was previously implicated as a possible primary insult in the disease . ocular or systemic administration of iop - lowering drugs is usually the first step in glaucoma management . for patients with established open - angle glaucoma ( defined by the presence of optic nerve damage ) , reduction of iop is effective and always recommended , irrespective of whether iop is abnormal . lowering of iop is accomplished by daily eye drops , laser treatment to the trabecular meshwork , or surgical treatment . pharmacological reduction of iop is achieved by topical -adrenoceptor blockers , topical prostaglandin analogues , topical 2-adrenoceptor agonists , topical cholinergic agonists and topical or systemic carbonic anhydrase inhibitors . however , it is clear that iop - lowering , although significantly reducing neuronal loss , does not prevent the progression of disease , because the loss of rgcs may continue , even after the iop has been reduced . it is therefore believed that treatment modalities that directly target both primary and secondary degeneration of the rgcs are required . until now , there has been no neuroprotective agent indicated for the treatment of glaucoma . in the future , combination treatments targeting both iop and neuronal injury will offer the best potential for halting the progression of rgc loss . future preclinical experiments in animal models of glaucoma will improve our understanding of the molecular mechanisms of action of multifunctional drugs and will reveal the potential for these drugs in clinical settings . it is probable that administration of multifunctional drugs will form an adjunct to iop - lowering drugs in the treatment of this debilitating disease . | glaucoma , the leading cause globally of irreversible blindness , is a neurodegenerative disease characterized by progressive retinal ganglion cell death . to date , no drug has been shown to prevent the retinal ganglion cell loss associated with glaucoma .
multiple mechanisms lead to ganglion cell death in glaucoma , suggesting that a neuroprotectant that has a single mode of action , like memantine , would have a limited positive effect at slowing down ganglion cell death .
conversely , simultaneously targeting several factors may be the best therapeutic approach to improve outcomes .
multifunctional drugs are fast gaining acceptance as a strategy for the treatment of complex disorders of the central nervous system , such as parkinson 's disease , alzheimer 's disease and other progressive neurodegenerative diseases . in this paper
, we review the current literature on multifunctional drugs and propose a rationale for the use of multifunctional drugs in glaucomatous optic neuropathy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
postmenopause is a period characterized by hormonal and organic changes caused by ovarian
failure . women are considered to be in this phase when they experience 12 months of
amenorrhea ( menopause ) . this period is divided into an early phase characterized by high fsh
levels and a decline in serum estradiol levels and a late phase characterized by
stabilization of hormone levels at around 6 months after menopause1,2,3 . hypoestrogenism , characteristic of this phase of a woman s life , is related to pelvic floor
muscle ( pfm ) weakening due to progressive musculoaponeurotic and conjunctive atrophy . estrogen acts on the tonus of these muscles by increasing the number and sensitivity of
alpha - adrenergic receptors , urethral vascularization , and periurethral connective tissue ,
stimulating fibroblasts to produce collagen . thus , estrogen plays an important role in the
continence mechanism , since it increases urethra mucosa tropism and its decline may cause
changes in the muscle complex resulting in pelvic floor dysfunction , such as urinary
incontinence ( ui ) , pelvic organ prolapse ( pop ) , and sexual problems4 . in addition to hormonal disorders inherent to this period , other factors during a woman s
life , such as parity , type of delivery , use of anesthesia during delivery , newborn weight ,
menopause , gynecological surgeries , smoking , chronic diseases , intestinal constipation ,
physical activity , hereditariness , use of drugs , and consumption of irritating
substances5 , have been associated with
changes in the pfm in young women . it has been reported that women with one or more
deliveries or vaginal and/or multiple pfm lacerations are more likely to develop
dysfunctions in this muscle group6 , 7 . kim et al.8 observed lower pfm pressure in young women who had normal deliveries
when compared with their nulliparous counterparts , but there was no difference in pfm
function between women with a history of normal deliveries and those who underwent
cesareans . a study conducted with 27,900 women showed that the correlation between parity
and pfm function is strong in women of reproductive age ; however , there are uncertainties
regarding repercussions in other periods of the female cycle6 , 9 , 10 . another factor that seems to be associated with pfm dysfunctions is engaging in physical
activity . reflex pelvic floor muscle contraction occurs simultaneous to the increase in
abdominal pressure resulting from physical exercise , which may promote better functioning in
individuals engaging in physical activity11 . however , the effects of physical activity on the pfm of
postmenopausal women remain controversial due to uncertainties about the repercussion of
exercises at different intensities in different modalities12 , 13 . in reproductive - age
women or during specific phases of the reproductive cycle , the literature shows that
variables such as parity and vaginal delivery seem to have a negative influence on pfm
function6 , 7 ,
9 , 10 . furthermore , a number of studies demonstrate that both high - impact
exercise and sedentary behavior have harmful effects on the function of these muscles12 , 13 . however , in postmenopausal women doubts remain concerning the effect
on this muscle group . it is known that postmenopausal women undergo hormonal changes caused by hypoestrogenism
and that these changes may provoke a decrease in pfm activity as well as the emergence of
pelvic dysfunctions that compromise quality of life . however , uncertainties remain regarding
the influence of factors before menopause on pfm function . thus , the aim of this study was
to investigate whether parity , type of delivery , and physical activity level influence pfm
function in postmenopausal women , as well as to compare pfm function in accordance with
menopausal status . the sample was
composed of 100 women aged between 45 and 65 years being treated at the janurio cicco
maternity school in northeastern brazil and was divided into three groups according to the
type and time of menopause3 . the
hysterectomized group ( ght ) was comprised of hysterectomized women , the early
postmenopausal group ( g(<6 ) ) was comprised of women in the early
postmenopausal phase , defined as a maximum time of 6 years , and the late postmenopausal
group ( g(>6 ) ) was comprised of women in the late stage of postmenopause , which
was considered to be more than 6 years after the onset of menopause3 . the inclusion criteria were as follows : being in postmenopause3 , not undergoing hormone replacement therapy , no previous
physical therapy for pelvic dysfunction , and not engaging in specific exercises for pelvic
floor muscles . the exclusion criteria were as follows : not submitting to physical
examination , having an infection , exhibiting a stage iii or iv prolapse , or complaining of
unbearable pain during a muscle strength test or perineometry . data collection occurred in three stages : ( 1 ) in the first satge , an assessment chart was
used to collect information on sociodemographic data , pre - existing diseases , and urological ,
gynecological , and obstetric history . ( 2 ) in the second stage , a physical examination was
performed to assess anthropometric measures , pelvic floor muscle function using a muscle
strength test ( mst ) , and perineometry . ( 3)in the third satge , the international physical
activity questionnaire ( ipaq ) was applied to assess physical activity level . the ipaq
classifies individuals as very active , active , irregularly active , and sedentary14 . those that complied with the following
recommendations were classified as very active : a ) vigorous activity : 5 days / week and 30
minutes per session or b ) vigorous activity : 3 days / week and 20 minutes per session +
moderate or walking 5 days / week and 30 minutes per session . those that complied with the
following recommendations were classified as active : a ) vigorous activity : 3 days / week and
20 minutes per session , moderate activity or walking 5 days / week and 30 minutes per
session , or c ) any added activity 5 days / week and 150 hours / week ( walking + moderate +
vigorous ) . those who engaged in physical activity but insufficiently to be classified as
active were classified as irregularly active , since they did not comply with recommendations
regarding frequency or duration . the frequency and duration of different activities ( walking
+ moderate + vigorous ) were totaled to determine whether subjects should be classified as
irregular active . those who did not engage in any physical activity for at least 10
continuous minutes per week were classified as sedentary14 . for functional assessment of the pelvic floor , participants remained in the lithotomy
position ( dorsal decubitus with the hips and knees flexed , thighs apart , and feet in
stirrups ) . first , the subject was instructed to contract their pfm as if they were holding
in their urine . at this time , the examiner looked for objective contraction , use of
accessory muscles , execution of the valsalva maneuver , or hip retroversion and if necessary ,
corrected the movement15 . next , bidigital
vaginal palpation was performed , asking subjects once again to contract their pfm , and
strength was measured using the modified oxford scale16 . this scale classifies strength from 0 to 5 , where 0 is the
absence of muscle response , 1 is unsustained flicker , the probe , lubricated with preservative and gel , was introduced into the
vagina . subjects were asked to perform three maximum voluntary contractions 30 seconds
apart17 . during the examination , the arithmetic
mean of the values from three maximum voluntary contractions was used as the pressure
value18 . questionnaire application and physical assessment were conducted by two physiotherapist
examiners specialized and experienced in urogynecological physiotherapy , who alternated
according to the days of the week . the ibm spss 20.0 software ( ibm corp , armonk , ny , usa ) was used for statistical analysis ,
with the significance level set at 5% in all statistical procedures . the kolmogorov - smirnov
test was applied to analyze data normality , anova was used to compare intergroup means , and
the kruskal - wallis test to compare strength medians . multiple regression was used to
determine the influence of delivery type , parity , and physical activity on the pelvic floor . the intraclass correlation coefficient ( icc ) was also applied to assess interexaminer
reliability of perineometry . the study was approved by the research ethics committee of the
federal university of rio grande do norte ( protocol no . 2 were excluded because they did not
undergo the physical examination . of the remaining 98 women , 13.3% ( n=13 ) were unable to
successfully undergo perineometry , with 61.5% of them ( n= 8) unable because of a lack of
coordinated pfm contraction and 38.5% ( n=5 ) unable because ir was impossible to introduce
the probe due to complaints of pain during the procedure . the three groups were homogeneous in terms of sociodemographic characteristics , except for
age , the mean of which in g(>6 ) was significantly higher than that in
g(<6 ) ( p=0.000 ) . anthropometric measures , such as body mass index and waist
circumference , showed no intergroup difference ( p=0.34 and p=0.33 , respectively ) . analysis
of obstetric history revealed homogeneity between the three groups in relation to
pregnancies and number and type of deliveries . with respect to age at menopause , the
hysterectomized patients ( ght ) entered menopause at an earlier age than those who
experienced natural menopause ( g(<6 ) and g(>6 ) ) ( p = 0.000 )
( table 1table 1.the sample s sociodemographic , anthropometric , gynecologic , and obstetric
characteristicsghtg(<6)g(>6)(n=26)(n= 33)(n=26)age ( years)*56.12 4.1353.21 3.8858.95 3.96marital status ( % ) single7.7 ( n=02)12.1 ( n=04)7.7 ( n=02 ) single with stable union11.5 ( n=03)12.1 ( n=04)11.5 ( n=03)married38.5 ( n=10)51.5 ( n=17)65.4 ( n=17)widow7.7 ( n=02)12.1 ( n=04)7.7 ( n=02)divorced30.8 ( n=08)9.1 ( n=03)7.7 ( n=02)religion ( % ) catholic53.8 ( n=14)51.5 ( n=17)76.9 ( n=20)evangelical23.1 ( n=06)36.4 ( n=12)11.5 ( n=03)spiritism3.8 ( n=01)6.1 ( n=02)0 ( n=00)without religion0 ( n=00)3.0 ( n=01)3.8 ( n=01 ) unknown 19.2 ( n=05)3.0 ( n=01)7.7 ( n=02)family income ( r$ ) 2,811.92 3,433.172,183.54 1,660.613,042.10 2,589.48income per capita ( r$ ) 1,271.83 1,748.97585.47 466.671,120.03 952.58weight ( kg)67.8 10.969.2 11.672.5 17.2height ( m)1.54 0.051.55 0.051.54 0.06bmi ( kg / m)28.41 4.0428.50 4.4630.27 6.53bmi ( % ) normal26.9 ( n=07)15.6 ( n=05)26.9 ( n=07)overweight50.0 ( n=13)53.1 ( n=17)26.9 ( n=07)obese23.1 ( n=06)31.3 ( n=10)46.2 ( n=12)waist circumference ( cm)89.5 11.392.8 10.795.2 12.8pregnancies2.92 1.493.03 1.70 2.92 2.07mode of delivery ( % ) vaginal delivery30.8 ( n=08)43.8 ( n=14)38.5 ( n=10)cesareansection38.5 ( n=10)25 ( n=08)26.9 ( n=07)vaginal delivery + cesareansection15.3 ( n=04)21.9 ( n=07)15.4 ( n=04)forceps 11.5 ( n=03)9.4 ( n=03)3.8 ( n=03)nulliparous3.8 ( n=01)0 ( n=04)15.4 ( n=03)number of deliveriesvaginal delivery1.46 1.471.88 1.831.85 2.24cesareansection0.96 0.990.67 0.890.64 0.91age at menopause ( years)*41.48 6.949.92 3.7947.38 4.62time of menopause ( years)*14.63 8.173.28 1.5811.57 4.62*p * p < 0.05 in anova ; averages with the same letters are statistically different in relation to assessment of pfm function , there was no difference between the muscle
strength test ( mst ) values and those of perineometry in postmenopausal women . the mean value
obtained in perineometry was 35.9 23.6 cmh2o , and the mean value in the mst was
3 ( q25 2 q75 4 ) ( table 2table 2.measures of strength and pressure of the pfmtotal(n=85)ght(n=26)g(<6)(n= 33)g(>6)(n=26)pressure ( cmh2o)35.9 23.635.7 26.535.2 22.537.1 22.9strength ( modified oxford ) 3 ( 24)3 ( 1.754)3 ( 24)3 ( 24)comparative analysis of ght , g ( < 6 ) and g ( >
6 ) ) . comparative analysis of ght , g ( < 6 ) and g ( >
6 ) multivariate regression analysis showed that type of delivery , parity , and physical
activity level exhibited no linear relation with pfm pressure in the postmenopausal women
( p=0.794 ) . the icc for perineometry obtained a cronbach s alpha value of 0.98 ( p=0.000 ) . the present study assessed the influence of parity , type of delivery , and physical activity
level in postmenopausal women , obtaining important data regarding lifelong care in relation
to factors that can influence pfm function . unlike other investigations , this study
evaluated pfm function directly using an mst and perineometry , making the results more
reliable in terms of muscle function . furthermore , the present study analyzed the different
natural postmenopausal phases and surgical menopause , enabling a more precise assessment of
the influence of menopausal status on the decline of pfm function in postmenopausal
women . this
value is in line with that observed in women from this age group with good pfm function ,
which varied in other studies between 28.00 and 48.00 cmh2o19,20,21 . in the present study , strength and pfm pressure in early and this is the first study to evaluate pfm function in accordance with
time of menopause , and it demonstrated that menopausal status seems not to be related to the
decline in pfm function . previous studies carried out with postmenopausal women did not
assess pfm function with respect to the phase of postmenopause19,20,21 . a number of authors have
demonstrated the negative influence of high - impact physical exercise on the pfm in women and
athletes18 , 22 , 23 . the intense activities
engaged in adolescence may have a negative effect on urinary loss symptoms exhibited by
women over the age of 50 years24 . studies
conducted by virtuoso et al.25 and
vinsnes et al.26 in women with mean ages
of 60 and 65 years , respectively , found that individuals with higher levels of physical
activity showed higher pfm pressures when compared with those who had lower levels of
activity . the former also exhibited a decline in urinary loss27 . even though previously published data shows that physical activity
level in this phase could have a positive influence on pelvic floor muscles , the studies did
not take into account the previous life of the participants , nor did they categorize their
samples in relation to type and intensity of physical activity , which may have interfered on
their results . parity and type of delivery had no influence on pfm function in the postmenopausal women . we hypothesized that the presence of aging factors in this population is the primary reason
for the decline in this muscle group . a prospective analysis of young women revealed that damage to the
pfm is caused by their first delivery and that from their second delivery onward , there are
no major changes in the biomechanics or integrity f the levator ani and , therefore , in
vesical support27 . this same author
reported that there is no difference in bladder neck mobility or levator hiatus size in
women with normal or cesarean deliveries . likewise , a retrospective study with women aged
between 45 and 85 years found that the number of deliveries had no direct influence on pfm
strength . that study suggests that the functional decline in pfm in the present study could
be associated with the aging process28 . in contrast to these data , zdemr et al.29 observed that women who had 13 deliveries displayed better pfm
pressure than those with 46 deliveries . moreover , women with 13 deliveries were significantly younger , and the
percentage of participants in postmenopause was lower when compared with the other groups . the present study also showed no difference between women with 46 vaginal deliveries and
those with more than 6 vaginal deliveries . the results could have been different if the
sample had been assessed for age and menopausal status . yang et al.30 demonstrated an
association between a decline in pfm function and age , parity , and postmenopausal status ,
with age being the primary impact factor . corroborating this hypothesis , eogan et al.31 concluded , based on analysis of the
influence of type of delivery and age on pfm function in climacteric women , that age also
seems to exert greater influence over these muscles , regardless of the type of delivery . histological analysis of cadavers showed that pelvic floor tissue of the elderly was more
rigid and less elastic , irrespective of previous trauma suffered32 . as observed in the present study , parity , type of delivery , and physical activity level do
not seem to have an effect on pelvic floor muscles in postmenopausal women . it is believed
that the functional decline in this population is due to hormonal changes and the natural
female aging process . the muscle mass loss process starts around the age of 40 years and is
accompanied by reduction in the cross - sectional area , diminished strength , and changes in
muscle composition caused by fat deposition , resulting in diminished functionality known as
sarcopenia . in women , this occurs simultaneous to changes in menopausal status , making it
more difficult to differentiate between the purely hormonal influence and the influence of
the aging process33 , 34 . moreover , changes in estrogen levels and a decline in physical
activity have been strongly associated with the physiopathology of sarcopenia . it is known
that there is a positive correlation between the systemic levels of estrogen and indicators
of muscle quality and strength34 . this
was also observed by micussi et al.35 in
a study of young women with regular menstrual cycles . electromyography showed a strong
positive correlation between tonus and maximum voluntary contraction in the pfm and an
increase in estradiol level . histological analysis revealed that during the sarcopenia process there is preferential
loss of type ii muscle fibers and conversion of type ii fibers into type i , causing a
negative impact on muscle strength and power33 . these muscle changes would therefore be responsible for the
decline in pfm function in postmenopausal women , as opposed to previous obstetric factors
such as parity and type of delivery . the present study had a number of limitations , including the absence of an investigation
regarding physical exercise during adolescence and early adulthood . furthermore , physical
activity level was measured with the ipaq , which does not categorize subjects according to
the type of activity performed . we also experienced difficulty with respect to the current
literature , which makes no distinction between physical activity and physical exercise . the
type and intensity of exercise may have a different effect on the pfm when compared with
physical activity level . we therefore suggest that longitudinal studies should be performed
to assess physical activity level , the type and intensity of exercise engaged in from
adolescence to postmenopause , and the number and types of deliveries in order to obtain more
reliable data about the influence of these variables on the pfm of postmenopausal women . it was concluded that parity , type of delivery , and physical activity level seem to have no
influence on pelvic floor muscle function in postmenopausal women . it was also observed that
in terms of type and time of menopause , there was no difference between women who had
artificial or natural menopause or between those in early and late postmenopause . there are
strong indications that advancing age is associated with a decline in pfm function and that
this is common to all women , regardless of previous obstetric conditions . by confirming the hypothesis that the number of deliveries , vaginal delivery , and a
sedentary lifestyle have no negative influence on pelvic floor muscle function in
postmenopausal women , this study shows that the aging process seems to be the primary factor
for the emergence of changes in pfm function , underscoring the importance of physical
exercises as a means of preventing pelvic floor disorders . it is important to consider that
the population is aging and the most women will experience the consequences of hormonal
decline and muscle aging , irrespective of their personal history . | [ purpose ] the aim of the present study was to assess the influence of parity , type of
delivery , and physical activity level on pelvic floor muscles in postmenopausal women .
[ subjects and methods ] this was an observational analytic cross - sectional study with a
sample of 100 postmenopausal women , aged between 45 and 65 years , divided into three
groups according to menopausal stage : hysterectomized and early and late postmenopause .
patients were assessed for sociodemographic and gyneco - obstetric factors and subjected to
a muscle strength test and perineometry .
descriptive statistics , anova , kruskal - wallis and
multiple regression were applied .
[ results ] the results showed homogeneity in
sociodemographic and anthropometric characteristics .
there was no difference in pelvic
floor muscle function among the three groups .
type of delivery , parity and physical
activity level showed no influence on muscle function .
[ conclusion ] the findings
demonstrate that parity , type of delivery , and physical activity level had no influence on
pelvic floor muscle pressure in postmenopausal women .
one hypothesis to explain these
results is the fact that the decline in muscle function in postmenopausal women is related
to the female aging process . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
wegener s granulomatosis ( wg ) , first described by friedrich wegener in stuttgart in 1936 , is multi - system disease characterized by a necrotizing granulomatous arteritis of the upper and lower respiratory tract and a necrotizing crescentic glomerulonephritis . vasculitis may also affect other organs such as the eyes , skin , joints , heart and the nervous system . upper respiratory tract manifestations particularly sinusitis , ulcerations of the nasal mucosa and epistaxis are common and debilitating presentations . subglottic stenosis ( sgs ) and tracheal stenosis ( ts ) , however , are potentially life threatening presentations of wg . sgs has been found to occur in approximately 1623% in patients carrying a diagnosis of wg [ 2 , 3 ] . this narrowing of the upper airway at the level of cricoid cartilage and/or upper tracheal rings presents a management dilemma . dilatation tracheoscopy ( dt ) is one of the possible options for treatment of sgs and ts . the long - term effects of dt in patients with wg have never been reported . it can be used for elective and emergency intervention in patients with subglottic and tracheal stenosis . dikkers , dilatation tracheoscopy in treatment of subglottic and tracheal stenosis , submitted for publication ) . patients suffering from wg present differences ( age , sex , response to treatment ) compared to other aetiologies , which justifies separate publication . the objective of this study is therefore to evaluate the effect of the treatment of sgs and ts by dt in patients with wg . we retrospectively identified all patients from our institution that underwent a dt between february 2001 and september 2005 . the total cohort of benign , grade ii ( myer - cotton ) subglottic or tracheal stenosis consisted of patients with a history of posttraumatic tracheal stenosis , thermal tracheal stenosis , posttracheotomy cicatricial stenosis , tracheal rupture , postintubation stenosis , and wg , amongst others . as stated before , the cohort is described elsewhere . from the cohort we identified a total of nine wg patients . these nine patients had been diagnosed with wg between may 1990 and august 2003 . during this period a total of 195 patients in our institution were diagnosed as having wg ( including the nine patients who underwent dt ) . from this cohort , three other patients were diagnosed with relatively mild sgs or ts that did not necessitate dt . the reference group for the comparison of demographic and serological data consisted of the total cohort , minus the patients who underwent dt and minus the three patients with mild tracheal stenosis who did not undergo dt . differences in age between the dt group and the reference group were tested with the mann whitney u test ; differences in the male / female ratio and antineutrophil cytoplasmatic autoantibodies ( anca ) specificity were tested with chi - square test . although this was a retrospective study , the clinical , serological and histopathological data of both the dt group and the control group had been prospectively collected by a standardised protocol starting at the time of the diagnosis of wegener s granulomatosis . sera from all patients were assayed for the presence of antibodies against proteinase 3 ( pr3anca ) , myeloperoxidase ( mpo anca ) and elastase as described previously . dt was performed when patients complained of progressive dyspnoea in combination with decrease of peak flows . an intubation laryngoscope , a groningen optical dilatation tracheoscope ( karl storz 1033r ) ( fig . 1 ) , telescope and suction tubes are required for this procedure . the proximal end of the tracheoscope is designed in such a way that customary ventilation tubes and a 30 cm hopkins straight forward telescope ( karl storz 27005aa ) can be connected . the distal end of the instrument contains numerous lateral tiny openings , which enable air to come through in the centre of the stenosis . the appropriate size of the instrument is determined by the size of the patient s larynx and the healthy portion of the trachea . 1groningen dilatation tracheoscope groningen dilatation tracheoscope the intervention is carried out under general anaesthesia . following the administration of the anaesthesia , with ventilation taking place via an anaesthesia mask , the dilatation tracheoscope is introduced under endoscopic control . the stenosis is then visible through the vocal cords ( fig . 2 ) . the bevelled design of the tip , which can be advanced forward through the stenosis , ensures that the ventilation is maintained during the process . the conical construction of the tip enables the instrument to be advanced up to the wider section of the tracheoscope ( fig . 3 ) , after which the tracheoscope remains in place for 5 to 10 min . parts of the tissue protrude through the tiny distal openings of the tracheoscope patient nr 9 pre dilatation . during laryngotracheoscopy parts of the tissue protrude through the tiny distal openings of the tracheoscope the constellation of the tracheoscope is suitable for most grade ii ( myer - cotton ) subglottic or tracheal stenosis . the intervention can be repeated after any time interval . typically , no antibiotics or corticosteroids are used . the use of mitomycin - c was considered in each case , but it was never used , because mitomycin - c should be used in fresh wounds . peakflows were measured three times ( respironics healthscan inc . , cedar groove , nj , usa ) in an upright position . the total cohort of patients who underwent dt because of sgs and ts was 25 . the causes in these 16 patients were posttraumatic , postintubation , idiopathic , post tracheotomy and post thermal injury . the mean age of the patient group at first presentation of wg was 41.6 11.2 years ( table 1 ) . the interval between the presentation of wg and the first symptoms of laryngeal and tracheal stenosis varied between 0 and 122 months ( mean 48.9 44.1 ) . the average age at of the time of presentation of the stenosis was 45.6 11.9 years ( table 1 ) . table 1patient characteristics of nine patients with wegener s granulomatosis ( wg ) and subglottic stenosis ( sgs ) or tracheal stenosis ( ts ) . clinical and laboratory findings . anca antineutrophil cytoplasmatic autoantibodies , pr3 proteinase 3 , mpo myeloperoxidasepatient no.sexage at presentation of wgorgans involved at first presentation of wganca specificitynumber of relapses of wgorgans involved at first relapse of wgfollow - up after diagnosis of wg ( years)age at first presentation of sgs or tsinterval between diagnosis of wg and first treatment of ts or sgs ( months)1m44jointspr312joints , skin1751922f26lungs , tracheapr31lungs , kidney142603f43tracheampo1lungs124304f57jointspr32ear , eye , kidney , joints12671225f26tracheapr31kidney , eye1131606f51mastoidpr32nose ( concha inferior ) , mastoid1058817f42ear drumatypical0lung , ear drum845358f52nosepr31nose ( septum and concha ) , joints , eye756489f33nasal vesselspr30vessels4332 patient characteristics of nine patients with wegener s granulomatosis ( wg ) and subglottic stenosis ( sgs ) or tracheal stenosis ( ts ) . anca antineutrophil cytoplasmatic autoantibodies , pr3 proteinase 3 , mpo myeloperoxidase at diagnosis , all wg patients had additional organ involvement outside the otorhinolaryngologic area . the skin was affected once ( table 1 ) . as shown in table 1 , the number of relapses of wg varied between 0 and 12 . there was no relation between the number of relapses and the occurrence of ts or sgs . in only one of the dt procedures there was endoscopic and/or histopathological evidence of vasculitis activity . the ts or sgs occurred in 95% in periods where the disease appeared to be less active . in table 2 the patient characteristics of the 9 patients who underwent dt for sgs or ts are compared with those patients who were diagnosed with wg in the same time frame but who did not have evidence of sgs or ts . in the dt group , 89% were female whereas 43% of patients in the reference group were female ( p < 0.01 ) . in the dt group the age at diagnosis of wg was significantly lower in comparison with the reference group ( p < 0.05 ) . table 2patient characteristics of nine patients with wegener s granulomatosis who underwent dt for sgs or ts compared with the reference group of 182 patients who were diagnosed with wg in the same period without evidence of sgs or tswg patients who underwent dt ( n = 9)wg patients without evidence of sgs or ts ( n = 182)p valuemale/ female number ( % ) 1/8 ( 11%/89%)104/78 ( 57%/43% ) < 0.01age at diagnosis of wg ( years , mean sd)41.6 11.253.3 17.0<0.05anca specificitypr3-anca : n = 8 ( 89%)mpo - anca : n = 1 ( 11%)pr3-anca : n = 160 ( 88%)mpo - anca : n = 13 ( 7.1%)hne - anca : n = 1 ( 0.5%)anca - negative : n = 8 ( 4.4%)not significantwg wegener 's granulomatosis , dt dilatation tracheoscopy , sgs subglottic stenosis , ts tracheal stenosis , anca antineutrophil cytoplasmatic autoantibodies , pr3 proteinase 3 , mpo myeloperoxidase , hne human neutrophil elastase patient characteristics of nine patients with wegener s granulomatosis who underwent dt for sgs or ts compared with the reference group of 182 patients who were diagnosed with wg in the same period without evidence of sgs or ts wg wegener 's granulomatosis , dt dilatation tracheoscopy , sgs subglottic stenosis , ts tracheal stenosis , anca antineutrophil cytoplasmatic autoantibodies , pr3 proteinase 3 , mpo myeloperoxidase , hne human neutrophil elastase in the nine patients identified with sgs or ts due to wg , a total of 22 dt s were performed ( table 3 ) . the mean follow - up after treatment was 25.4 14.1 months ( table 3 ) . two patients ( numbers 7 and 8) did not experience a recurrence of significant stenosis . six patients ( numbers 1 , 2 , 3 , 4 , 6 , 9 ) required a second dt without recurrence of local disease activity after the second dt . one of these patients ( patient number 6 ) had acute wg in the trachea , proven by biopsy ( fig . she was treated with high dose prednisolone ( intravenous methylprednisolone 1000 mg on three consecutive days ) and intubation for a week . one patient ( number 5 ) developed a cricoid stenosis 5 years after the diagnosis of wg . initially the stenosis was treated with two dt s . during a pregnancy after pregnancy she was treated with a co2 laser and three dt s . unfortunately , however , she required a definitive tracheostomy . one patient ( number 2 ) became respiratory insufficient at diagnosis of wg and had a tracheotomy for 3 months . she subsequently developed a cicatricial sgs , but she has enough lumen to live without a tracheostomy ( table 3 ) . table 3follow - up after last dtpatient numberlocation of stenosisnumber of dtsfollow - up after last treatment ( months)tracheotomy required1subglottic219no2subglottic221yes , temporary3trachea243no4trachea214no5cricoid812yes6subglottic216no7subglottic154no8subglottic126no9subglottic224nofig . the picture was taken one week after fig . 4 follow - up after last dt patient nr 6 with acute wg during biopsy of a subglottic stenosis patient nr 6 after pulse therapy and intubation . 4 the effect of dt on peakflows was evaluated in five patients . in these patients the mean ( sd ) peakflow increased from 164 45.7 l / min before dt to 226 69.6 l / min after dilatation . an example of the effect of dt on the peakflow is shown in fig . two months after this patient had been diagnosed with wg she developed complaints of dyspnoea . after treatment with high - dose corticosteroids she had a regression of the wg activity . fourteen and 28 months after first diagnosis of sgs a dilatation tracheoscopy was performed successfully . the arrows indicate the dt procedures peak flow measurements after dilatation of patient number 9 . the total cohort of patients who underwent dt because of sgs and ts was 25 . the causes in these 16 patients were posttraumatic , postintubation , idiopathic , post tracheotomy and post thermal injury . the mean age of the patient group at first presentation of wg was 41.6 11.2 years ( table 1 ) . the interval between the presentation of wg and the first symptoms of laryngeal and tracheal stenosis varied between 0 and 122 months ( mean 48.9 44.1 ) . the average age at of the time of presentation of the stenosis was 45.6 11.9 years ( table 1 ) . table 1patient characteristics of nine patients with wegener s granulomatosis ( wg ) and subglottic stenosis ( sgs ) or tracheal stenosis ( ts ) . clinical and laboratory findings . anca antineutrophil cytoplasmatic autoantibodies , pr3 proteinase 3 , mpo myeloperoxidasepatient no.sexage at presentation of wgorgans involved at first presentation of wganca specificitynumber of relapses of wgorgans involved at first relapse of wgfollow - up after diagnosis of wg ( years)age at first presentation of sgs or tsinterval between diagnosis of wg and first treatment of ts or sgs ( months)1m44jointspr312joints , skin1751922f26lungs , tracheapr31lungs , kidney142603f43tracheampo1lungs124304f57jointspr32ear , eye , kidney , joints12671225f26tracheapr31kidney , eye1131606f51mastoidpr32nose ( concha inferior ) , mastoid1058817f42ear drumatypical0lung , ear drum845358f52nosepr31nose ( septum and concha ) , joints , eye756489f33nasal vesselspr30vessels4332 patient characteristics of nine patients with wegener s granulomatosis ( wg ) and subglottic stenosis ( sgs ) or tracheal stenosis ( ts ) . anca antineutrophil cytoplasmatic autoantibodies , pr3 proteinase 3 , mpo myeloperoxidase at diagnosis , all wg patients had additional organ involvement outside the otorhinolaryngologic area . the skin was affected once ( table 1 ) . as shown in table 1 , the number of relapses of wg varied between 0 and 12 . there was no relation between the number of relapses and the occurrence of ts or sgs . in only one of the dt procedures there was endoscopic and/or histopathological evidence of vasculitis activity . the ts or sgs occurred in 95% in periods where the disease appeared to be less active . in table 2 the patient characteristics of the 9 patients who underwent dt for sgs or ts are compared with those patients who were diagnosed with wg in the same time frame but who did not have evidence of sgs or ts . in the dt group , 89% were female whereas 43% of patients in the reference group were female ( p < 0.01 ) . in the dt group the age at diagnosis of wg was significantly lower in comparison with the reference group ( p < 0.05 ) . table 2patient characteristics of nine patients with wegener s granulomatosis who underwent dt for sgs or ts compared with the reference group of 182 patients who were diagnosed with wg in the same period without evidence of sgs or tswg patients who underwent dt ( n = 9)wg patients without evidence of sgs or ts ( n = 182)p valuemale/ female number ( % ) 1/8 ( 11%/89%)104/78 ( 57%/43% ) < 0.01age at diagnosis of wg ( years , mean sd)41.6 11.253.3 17.0<0.05anca specificitypr3-anca : n = 8 ( 89%)mpo - anca : n = 1 ( 11%)pr3-anca : n = 160 ( 88%)mpo - anca : n = 13 ( 7.1%)hne - anca : n = 1 ( 0.5%)anca - negative : n = 8 ( 4.4%)not significantwg wegener 's granulomatosis , dt dilatation tracheoscopy , sgs subglottic stenosis , ts tracheal stenosis , anca antineutrophil cytoplasmatic autoantibodies , pr3 proteinase 3 , mpo myeloperoxidase , hne human neutrophil elastase patient characteristics of nine patients with wegener s granulomatosis who underwent dt for sgs or ts compared with the reference group of 182 patients who were diagnosed with wg in the same period without evidence of sgs or ts wg wegener 's granulomatosis , dt dilatation tracheoscopy , sgs subglottic stenosis , ts tracheal stenosis , anca antineutrophil cytoplasmatic autoantibodies , pr3 proteinase 3 , mpo myeloperoxidase , hne human neutrophil elastase in the nine patients identified with sgs or ts due to wg , a total of 22 dt s were performed ( table 3 ) . the mean follow - up after treatment was 25.4 14.1 months ( table 3 ) . two patients ( numbers 7 and 8) did not experience a recurrence of significant stenosis . six patients ( numbers 1 , 2 , 3 , 4 , 6 , 9 ) required a second dt without recurrence of local disease activity after the second dt . one of these patients ( patient number 6 ) had acute wg in the trachea , proven by biopsy ( fig . she was treated with high dose prednisolone ( intravenous methylprednisolone 1000 mg on three consecutive days ) and intubation for a week . one patient ( number 5 ) developed a cricoid stenosis 5 years after the diagnosis of wg . initially the stenosis was treated with two dt s . during a pregnancy the patient required an emergency tracheotomy because of a threatened airway . after pregnancy she was treated with a co2 laser and three dt s . unfortunately , however , she required a definitive tracheostomy . one patient ( number 2 ) became respiratory insufficient at diagnosis of wg and had a tracheotomy for 3 months . she subsequently developed a cicatricial sgs , but she has enough lumen to live without a tracheostomy ( table 3 ) . table 3follow - up after last dtpatient numberlocation of stenosisnumber of dtsfollow - up after last treatment ( months)tracheotomy required1subglottic219no2subglottic221yes , temporary3trachea243no4trachea214no5cricoid812yes6subglottic216no7subglottic154no8subglottic126no9subglottic224nofig . the picture was taken one week after fig . 4 follow - up after last dt patient nr 6 with acute wg during biopsy of a subglottic stenosis patient nr 6 after pulse therapy and intubation . 4 the effect of dt on peakflows was evaluated in five patients . in these patients the mean ( sd ) peakflow increased from 164 45.7 l / min before dt to 226 69.6 l / min after dilatation . an example of the effect of dt on the peakflow is shown in fig . two months after this patient had been diagnosed with wg she developed complaints of dyspnoea . after treatment with high - dose corticosteroids she had a regression of the wg activity . fourteen and 28 months after first diagnosis of sgs a dilatation tracheoscopy was performed successfully . the arrows indicate the dt procedures peak flow measurements after dilatation of patient number 9 . there are multiple causes of benign laryngeal or tracheal stenosis , the most common being traumatic . however , if there is no prior history of tracheal trauma , the aetiology of the stenosis may be obscure and difficult to determine , necessitating a systematic approach to make the diagnosis . excluding trauma , the differential diagnosis of ts can be subdivided into four categories : congenital , neoplastic , infectious , and inflammatory . congenital ts is really quite rare and is often the result of posterior fusion of the tracheal rings , thereby forming complete rings . other causes of congenital stenosis include vascular rings and other congenital cardiovascular anomalies such as an anomalous subclavian artery primary benign tumours of the trachea such as chondromas , fibromas , squamous papillomas , hemangiomas , and granular cell tumours are also unusual causes of stenosis . in addition , extrinsic compression of the trachea can occur by thyroid neoplasms and goiters . fungal infections such as histoplasmosis and blastomycosis should always be considered when the aetiology of the stenosis is unclear . non - infectious , inflammatory causes of ts include sclerosing mediastinitis , primary amyloidosis , and sarcoidosis . wg and relapsing polychondritis can also cause ts , but they are almost always seen in combination with other , more classic hallmarks of these diseases . a laryngeal or tracheal stenosis is optimally diagnosed via tracheal visualization , which is generally performed by an otorhinolaryngologist . indirect and fiberoptic laryngoscopy are non - invasive examination techniques that can be performed in the office , but usually do not show the entire trachea . a subglottic stenosis is not always visible , therefore direct rigid tracheoscopy in general anaesthesia is indicated in cases suspect of wg . patients with wg who develop laryngotracheal disease have usually already been diagnosed as such because of the presence of disease in other organs at the same time or at a previous occasion . isolated involvement of the subglottic larynx is conspicuously rare only a few cases have been reported in the literature [ 2 , 7 , 8 ] . in our series , however , three patients had sgs or ts as presenting symptom of their wg . this contrasts significantly with the male / female ratio in the reference group that consisted of wg patients that were diagnosed in the same period as the dt group but who did not have evidence of sgs or ts . anatomically the female airway is narrower than the male , making it more prone for post - intubation stenosis . more research in larger series has to be performed to explain this phenomenon . in cases where the diagnosis of wg is suspected , anca testing should be part of the routine laboratory evaluation . c - anca has been shown to be a specific marker for wg with rare false - positive results ; p - anca testing is much less specific . only the particular laboratory findings of c - anca reacting with pr3 and p - anca reacting with myeloperoxidase ( mpo ) are specific for the autoimmune vasculitides [ 9 , 10 ] . notably , seven of our nine patients that underwent dt were pr3-anca positive and one patient was mpo - anca positive . the disease presented as a stenosis , and laryngotracheoscopy revealed the size and site of the lesion . organs involved showed no pattern in which there should be additional suspicion for the development of sgs or ts . there was no relation between the number of relapses and the development of ts or sgs . the ts or sgs occurred more often in periods where the disease appeared to be less active . remarkably , ts or sgs predominantly became manifest in periods in which wg appeared to be inactive . interestingly , seven out of our nine patients who developed ts or sgs had not been diagnosed previously with tracheal involvement of wg , neither at first presentation nor at relapse(s ) . we speculate that during active disease a subclinical tracheal involvement occurs which may subsequently heal with scar formation . to examine this hypothesis in patients , elective tracheoscopy should be performed in all patients with wg . the time interval between presentation of clinical stenosis in these seven patients ( mean 63 months , median 60 , range 2122 ) dt with the groningen dilatation tracheoscope is a safe , minimally invasive procedure for the treatment of cotton - myer grade ii subglottic or tracheal stenosis of various origin . it is an elegant , self - standing surgical intervention , where no additional interventions are needed . for an overview of the effect of dt the reader dikkers , dilatation tracheoscopy in treatment of subglottic and tracheal stenosis , submitted for publication ) . nowadays , mitomycin - c , an alkylating agent that inhibits cell division , protein synthesis , and fibroblast proliferation , is increasingly used as adjuvant treatment in the management of selected cases of laryngeal and tracheal stenosis , for example luminal obstruction in fresh circular sutured wounds . however , the laryngeal and tracheal stenoses of wg patients are almost always of older age and display advanced scarring at the time of diagnosis . however , this damage is considerably different from granulomatous scarification in sutured lumina and , therefore , we do not expect an additional favourable response to mitomycin . therefore , we have not applied mitomycin - c in our wg patient cohort . in cases where ts or sgs develops , there is always the question whether or not to intervene , and the question of timing of the intervention . one might see this as a two - by - two table , with complaints on the x - axis , and peakflow values on the y - axis . progressive complaints and progressive decline of peakflow values ( + /+ ) indicate intervention by dt . absence of progressive complaints with decline of peakflow values ( /+ ) need to be addressed when the values reach a critical level , in which it can be expected that a common cold might lead to severe stenosis of the airways . finally , progressive complaints with unchanged peakflow values ( + / ) indicate that pulmonary function tests should be performed , and , if negative , indicate that the patient has an incorrect perception of his physical potentials . unfortunately , in only five of the nine patients in this retrospective study , we have peak flow measurements . a variety of surgical techniques has been used to treat sgs or ts of other aetiologies [ 12 , 13 ] . the success of these surgical techniques in upper airway stenosis related to wg has been variable [ 3 , 14 ] . in our series two out of nine patients were treated once for upper airway stenosis with dilatation without any re - stenosis because of wg . one was temporary , but one patient needed a permanent tracheotomy ( 11% ) : this was the pregnant woman needing an emergency procedure . wg as such is a rare disease , and sgs and ts are rare symptoms in patients with wg . patient complaints and monitoring of peakflow values offer simple tools for the decision whether or not to intervene . | wegener s granulomatosis ( wg ) frequently involves the subglottis and trachea and may compromise the upper airway .
the objective of this study is to evaluate retrospectively the effect of treatment of subglottic stenosis ( sgs ) and tracheal stenosis ( ts ) by dilatation tracheoscopy ( dt ) in patients with wg .
we performed a cohort study on all patients who underwent dt between february 2001 and september 2005 in our institution . from this cohort
we identified a total of nine wg patients . in all patients ,
clinical , serological and histopathological data had been prospectively collected by a standardized protocol from the time point of diagnosis . in the nine patients that were identified with sgs or ts due to wg ( eight women and one man ) ,
a total of 22 dt s were performed .
two patients needed a tracheostoma ( one temporarily ) .
the mean follow - up after the first dt was 25.4 14.1 months .
two patients did not experience a recurrence of sgs or ts .
six patients required a second dt without recurrence of local disease .
the remaining patient underwent 8 dt 's in a 4-year period .
dt can offer a simple and repeatable solution to sgs and ts due to wg .
seven of the nine patients required more than one dilatation and some patients experience a functional restriction .
one patient has a definitive tracheostoma . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
to preserve the homeostasis and health of the organism cells are constantly responding to changes in the physical and chemical properties of the environment by altering many of their cellular functions . the activation of mitogen activated protein kinases ( mapks ) is involved in the transduction of most extracellular signals , and it is one of the major signal transduction mechanism by which the cell adapts to changes in the surrounding medium . in mammalian cells there are four well - characterised mapk families : erk1/2 , erk5 , jnk , and p38mapk , which are serine / threonine kinases that catalyze the reversible phosphorylation of proteins . the p38mapk family comprises four members , p38 , p38 , p38 , and p38. the isoform p38 was identified in 1994 by four groups as a 38 kda polypeptide that is activated in response to endotoxin treatment , cell stress , or cytokines . two to three years later , three additional isoforms were described : p38 [ 24 ] , p38 [ 5 , 6 ] , and p38 [ 7 , 8 ] . these kinases share highly similar protein sequences ; p38 and p38 are 75% identical , whereas p38 and p38 are 62% and 61% identical to p38 , respectively . in turn , p38 , and p38 the four p38mapk isoforms are widely expressed , although p38 , p38 and p38 expression appear to be higher in specific tissues ; for example , p38 is abundant in brain , p38 in skeletal muscle , and p38 in endocrine glands [ 1 , 9 ] . in general , all p38mapks are strongly activated by a wide variety of environmental and cellular stresses or by inflammatory cytokines and are poorly activated by serum or growth factors . the p38mapk family can be further divided into two subsets based on sequence homology , substrate specificities , and sensitivity to chemical inhibitors , with p38 and p38 in one group and p38 and p38 in the other . in this paper , we provide an overview of the less known p38mapk isoforms , the p38 and p38 mapk pathways , which are strongly activated by stress , but also play important roles in tissue regeneration , differentiation , metabolic diseases , and cancer . human p38 and p38 isoforms are serine / threonine protein kinase of 367 and 365 amino acids with a predicted molecular mass of 4245 kda and are encoded by different genes located on chromosomes 22q13.3 and 6p21.31 , respectively [ 1 , 7 , 10 ] . it was first described by three independent studies as either a mapk involved in myoblast differentiation , a stress - activated protein kinase ( sapk ) highly expressed in skeletal muscle , or a new member of the p38mapk family . p38 , also known as sapk4 and mapk13 , was cloned as the fourth member of the p38mapk family by two different groups [ 7 , 8 ] . the structure of doubly phosphorylated , active p38 in complex with an atp analog has been determined by x - ray crystallography . the global structure of p38 is similar to other enzymes of the mapk family and is characterized by two domains separated by a deep channel where potential substrates might bind . the dually phosphorylated p38mapk goes through characteristic global conformational changes that alters the alignment of the two kinase halves ( n - terminal and c - terminal domains ) of the folded protein and enhances access to substrate . in addition , the interaction between mapks and their upstream activators seems to work allosterically to make the mapks activation loop available for processing by kinases and phosphatases , which further increases enzymatic activity [ 1214 ] . although the conformation of p38 activation loop is almost identical to that observed in the structure of activated erk2 , contrary to erk2 , the crystal structure of activated p38 exists as a monomer , suggesting that not all activated mapks form dimers . a feature that makes p38 unique among other mapks is its short c - terminal sequence - ketxl , an amino acid sequence which docks directly to pdz domains of proteins , such as 1-syntrophin , sap ( synapse - associated protein ) 90/psd ( postsynaptic density ) 95 and sap97/hdlg ( human disc large ) , and phosphorylation of these proteins by p38 is dependent on its binding to the pdz domains [ 1517 ] . the information about p38 and p38 biological role is limited compared to the extensive knowledge of p38 and p38 functions . this is at least in part due to the lack of specific inhibitors for p38 and p38. in vitro and in vivo assays demonstrated that only p38 and p38 are inhibited by certain compounds , such as sb203580 and other pyridinyl imidazoles , whereas p38 and p38 are completely unaffected by these drugs [ 7 , 18 , 19 ] . this is mainly due to the differences , between p38 and p38 compared to p38 and p38 , in the amino acid sequence of the atp - binding pocket , the site where most protein kinase inhibitors bind and directly compete with atp . the canonical activation of p38mapks occurs via dual phosphorylation of tyrosine and threonine residues in a conserved tgy motif , located in the activation loop of kinase subdomain viii . phosphorylation of p38mapks is catalysed by the dual specificity kinases ( mkk or map2ks ) , mkk3 and mkk6 , which are in turn activated upon phosphorylation of serine / threonine residues by phosphorylation by a mapk kinase kinase ( map3k ) ( figure 1 ) . the map3k responsible for activating the p38mapk pathways appears to be cell type and stimulus specific . several map3ks have been implicated in the regulation of p38mapk signalling , these include mlks ( mixed - lineage kinases ) , ask1 ( apoptosis signal - regulating kinase-1 ) , tao ( thousand and one amino acid ) 1 and 2 , tak1 ( tgf -activated kinase 1 ) , and some members of the mekk ( mapk / erk kinase kinase ) family . the diversity of map3ks and their ability to activate also other mapks provide a mechanism to respond to many stimuli and to integrate different signalling pathways . it has been shown that map3k of the p38mapk pathway are regulated by binding to low molecular weight gtp - binding proteins , ubiquitination or phosphorylation by ste20 family members [ 1 , 20 ] . the major mkk required for the activation of specific p38mapk may be determined by several factors : one is the cell type as the level of expression varies [ 21 , 22 ] ; another is the nature and also the strength of the stimuli . since mkk6 can activate all p38 isoforms in vitro , it has been suggested that the pattern of downstream p38mapk activation in the particular response may be determined by the level of mkk6 activity triggered by a given stimulus . moreover , there are two important structural requirements for selective activation of p38mapk isoforms by mkks : docking sequences in the n - terminus of the mkk and isoform - specific sequences of the p38mapk isoforms within the activation loop [ 13 , 24 , 25 ] . using mkk - targeted gene disruption and small interfering rna ( sirna ) approaches , it has been shown that , in response to most stimuli , mkk3 and mkk6 are the main p38 activators but , in some circumstances , such as ultraviolet radiation , mkk4 , an activator of jnk , may contribute to p38 activation . moreover , although it has been shown that in vitro experiments mkk4 also phosphorylates and activates p38 and p38 [ 7 , 27 ] , studies utilizing mouse embryonic fibroblasts lacking mkk3 and/or mkk6 indicate that activation of distinct p38mapk isoforms is regulated by the selective and synchronized action of the two mkks , in response to cell stress . thus , both mkk3 and mkk6 are essential for p38 activation induced by environmental stresses , whereas mkk6 is the major p38 activator in response to the cytokine tumour necrosis factor- ( tnf ) . on the other hand , mkk3 is the major kinase responsible for p38 activation by ultraviolet radiation , hyperosmotic shock , tnf or by the protein synthesis inhibitor anisomycin ( figure 1 ) . supporting this is the finding that endogenous p38 activation in response to tgf1 is impaired in glomerular mesangial cells from mkk3-deficient mice . nonetheless , the relative contribution of mkk3 and mkk6 to p38 and p38 activation might strongly depend not only on the nature and strength of the stimulus , but also on the cell type . the magnitude and duration of p38mapk signal transduction are critical determinants of its biological effects . termination of p38 kinase catalytic activity involves the activity of several phosphatases that target the activation loop threonine and tyrosine residues . in mammalian cells there are good in vivo pieces of evidence for p38 activity downregulation by several protein phosphatases , including protein serine / threonine phosphatases ( pps ) [ 28 , 29 ] , protein tyrosine phosphatases ( ptps ) , and dual - specificity phosphatases ( dusps , also known as mapk phosphatases ( mkps ) ) . however , their role in p38 and p38 dephosphorylation has not been extensively studied , and therefore very little is known about physiological p38 and p38 protein phosphatases . recently , it has been shown in one study that p38 interacts through its c - terminal binding pdz motif with the single pdz domain of the protein tyrosine phosphatase ptph1 . moreover , ptph1 can dephosphorylate p38 , but not p38 , in vitro and in overexpression experiments in cells . this specificity seems to be determined by both p38 c - terminal pdz - binding sequence and the conserved tgy motif within the kinase subdomain . p38mapk family members have overlapping substrate specificities , and the genetic ablation of specific p38mapk family members has also demonstrated the existence of functional redundancy . however , there are some differences , with particular substrates being better phosphorylated by p38 and p38 than p38 and p38 or vice versa . for example , mapk - activated protein kinase 2 ( mk2 ) and mk3 are very good substrates for p38 and p38 , but can not be phosphorylated by other p38mapk isoforms . the lack of specific inhibitors for p38 and/or p38 has slowed down the identification of their in vivo substrates and the elucidation of their biological roles . nonetheless , this problem can be partly solved by the use of p38 knockout mouse models . p38 and p38 and double p38/p38 knock - out mice have been generated , which are viable and fertile . moreover , the diaryl urea compound birb796 is not only a potent inhibitor of p38 and p38 , but also inhibits p38 and p38 at higher concentrations in cell - based assays providing a new tool for identifying physiological roles of these two p38mapk isoforms [ 19 , 33 ] . several physiological substrates for p38 mapk isoform have been described in the past years ( figure 1 ) . a feature that makes p38 unique among all mapks is its short c - terminal sequence ideal for binding pdz domains in proteins . p38 binds to the pdz domain of a variety of these proteins , such as 1-syntrophin , sap90/psd95 , and sap97/hdlg , and under stress conditions is able to phosphorylate them and modulate their activity [ 1517 ] . one valuable tool used in the identification of p38 substrates has been the cell permeant peptide tatsapk3c which contains the last nine residues of p38 fused to the cell - membrane transduction domain of the human immunodeficiency virus - type 1 ( hiv-1 ) tat protein . this peptide blocks the phosphorylation of pdz domain - containing proteins by p38 in intact cells by preventing the association of the kinase with the pdz domain of the substrate [ 16 , 17 ] . these pdz domain - containing proteins are scaffold proteins usually targeted to the plasma membrane cytoskeleton at specialised sites such as the neuromuscular junction and gap junctions through protein - protein interactions . in the case of sap97/hdlg its phosphorylation by p38 provides a mechanism of dissociating it from the cytoskeleton , which indicates a role of this p38mapk isoform in modulation of cytoskeletal organization . sap97/hdlg is the mammalian homologue of the drosophila tumour suppressor dlg , a scaffold protein that forms multiprotein complexes with a variety of proteins and is targeted to the cytoskeleton by its association with guanylate kinase - associated protein ( gkap ) . the p38-catalysed phosphorylation of sap97/hdlg triggers its dissociation from gkap and therefore releases it from the cytoskeleton ( figure 2 ) . this is likely to regulate the integrity of intercellular complexes , cell shape , and volume as an adaptive mechanism to changes in the environment . sap97/hdlg also localizes in the nucleus where it forms a complex with the proteins polypyrimidine tract - binding ( ptb ) protein - associated splicing factor ( psf ) and p54 , and with various rnas , . psf and p54 are nucleic acid - binding proteins that associate in vivo and regulate transcription , pre - mrna processing , nuclear retention of defective rna , as well as dna unwinding and repair . p38 regulates hdlg - psf complex dissociation in the nucleus independently of hdlg phosphorylation by displacing psf from hdlg , since both proteins , p38 and psf , bind to pdz1 of hdlg . p38 accumulates in the nucleus after hyperosmotic stress ( figure 2 ) , but not following other p38-activating stimuli such as uv irradiation . this indicates that the nature of the stimulus determines p38 distribution and that some signals could release p38 from docking molecules that retain it in the cytosol . moreover , the nuclear accumulation of p38 might be a response mechanism to some stimuli facilitating phosphorylation of p38 targets in the nucleus . a nuclear role for p38 , including functional interaction with sap97/hdlg , would not exclude its distinct cytoplasmic role in modulating the sap97/hdlg - cytoskeleton complex . indeed , through its ability to shuttle between cytoplasm and nucleus , p38-sap97/hdlg might provide a connection between two processes critical for adaptation to environmental changes : gene expression and cytoskeletal reorganization . this has been shown using cells from knockin mice expressing an endogenous inactive p38 mutant in combination with cells from mice lacking p38 . similarly , experiments in rat intestinal epithelial cells also suggest a phosphorylation - independent role for p38 in k - ras transformation , although the precise mechanism for this regulation remains unknown . p38mapks act normally by direct phosphorylation of substrates on serine or threonine residues followed by proline . however , there are few examples showing that mammalian p38- and yeast p38mapk - related proteins such as spc1 or hog1 may also have kinase - independent roles ( reviewed in ) . like p38 , p38 seems to have a kinase - independent function by associating to protein targets and modulating their function in the absence of phosphorylation . p38 substrates that do not require pdz domain - binding interactions are the mitochondrial protein sab and the transcription factor myod , whose phosphorylation by p38 results in a decrease in its transcriptional activity . some p38 substrates are proteins involved in the regulation of microtubule dynamics , suggesting that this p38mapk may play a role in cytoskeletal remodelling . thus , the protein stathmin and the neuronal microtubule - associated protein tau are phosphorylated by p38 in vitro and in transfected cells [ 3942 ] . tau function is modulated by phosphorylation , and its ability to bind and stabilise microtubules correlates inversely with its phosphorylation which may facilitate its self - assembly . tau is a good in vitro p38 and p38 substrate , and its phosphorylation by these two kinases results in a reduction in its ability to promote microtubule assembly [ 39 , 40 ] . using a sirna approach , p38 has been reported to be the major tau kinase in neuroblastoma in response to osmotic shock . p38 phosphorylates endogenous tau at residue threonine-50 ( tau - t50 ) , which is phosphorylated in filamentous tau from alzheimer 's disease brain . surprisingly , this phosphorilation causes an increase in the ability of tau to promote microtubule assembly and help to the adaptive response of neurons to osmotic shock , whereas subsequent tau phosphorylation at additional sites by p38 or / and by other protein kinase(s ) may then instead induce the detachment of tau from the microtubule and destabilize the microtubule network . finally , it has been shown that p38 phosphorylates and inactivates the eukaryotic elongation factor 2 ( eef2 ) kinase and the protein kinase d1 ( pdk1 ) [ 4345 ] . pdk1 controls insulin exocytosis in pancreatic beta cells , which suggests that p38 plays a role in the regulation of insulin secretion . evidence from a number of studies carried out during the past few years suggests that many physiological functions of the p38mapk isoforms may overlap but may not necessarily be redundant and/or identical . thus , during the last few years , studies using knock - out mice have provided important information concerning p38- and p38-functions in vivo . contrary to p38 , whose constitutive deletion causes death during embryonic development [ 4648 ] , p38 and p38 deficient mice are viable and have not apparent phenotype . functional redundancy of all four p38mapks may contribute , at least in part , to the lack of evident phenotype of p38- and p38-deficient mice . nonetheless , there are recent reports showing the implication of p38 and p38 in tissue regeneration , cancer , and metabolic diseases , further strengthening the interest of these pathways for the development of new therapeutics strategies . thus , p38 seems to be a regulator of processes related to the pathogenesis of diabetes , such as insulin secretion and cells death . p38-deficient mice have improved glucose tolerance as a result of enhanced insulin exocytosis by pancreatic cells . correlating with this , p38-deficient mice show higher levels of active pkd1 , which is known to positively regulate secretion in neuroendocrine cells , as a result of the lack of p38-mediated inhibitory phosphorylation . in addition , p38 has been suggested as a potential therapeutic target for human diabetes , since p38-deficient mice are protected against the insulin resistance induced by a high - fat diet and the oxidative stress - mediated -cell failure . using mainly ectopic expression and knock - down model cell lines it has been shown that p38 and p38 pathway could be involved in the modulation of some processes implicated in cellular malignant transformation , such as proliferation , cell cycle progression , or apoptosis [ 1 , 10 , 49 , 50 ] indicating a potential oncogenic role of these kinases in cancer development and progression . in one study , p38 promotes the malignant phenotype of squamous cell carcinoma by regulating cell proliferation and invasion . in rat intestinal epithelial cells ( iecs ) and in human breast cancer , p38 rna and protein expression increases during ras - induced transformation [ 36 , 52 ] . p38 knock - down in iec blocks the ras transformation activity and results in the significant diminution of the oncogenic characteristics of breast cancer cells [ 5355 ] . additionally , one recent study shows that p38 mediates ras - induced senescence at least partly by stimulating the transcriptional activity of p53 through direct phosphorylation ; in contrast p38 appears to regulate senescence in a p53-independent manner . these results indicate that increased p38 gene expression is required for ras oncogene activity but the mechanism by which p38 may promote ras transformation is not clear . interestingly , p38 was recently shown to mediate 12-o - tetradecanoylphorbol-13-acetate- ( tpa- ) induced epidermal cell proliferation in mice , and mice lacking p38 show reduced susceptibility to the development of tpa - induced skin carcinomas . all these results indicate the oncogenic function of p38 and p38. contrary , there is one study that shows pieces of evidence indicating that p38 and p38 have a role in the suppression of tumor development using mouse embryonic fibroblasts derived from mice lacking p38 or p38 . lack of either p38 or p38 increases cell migration and metalloproteinase-2 secretion , whereas only p38 deficiency impairs cell contact inhibition . in addition , lack of p38 in k - ras - transformed fibroblasts leads to increased cell proliferation as well as tumorigenesis both in vitro and in vivo . these discrepancies between different studies could be due not only to the difference in the experimental model and approaches used , but also to the distinct nature of cell(s ) and process(es ) that is / p38 has been suggested to play an important role in inducing keratinocyte differentiation by regulating the expression of involucrin , which is a protein expressed during keratinocyte differentiation . it has been shown that activation of exogenously expressed p38 by differentiation - inducing agents correlates with increased involucrin promoter activity in keratinocytes [ 61 , 62 ] . this occurs in a p38/-independent manner , and what is more , p38 is poorly expressed in keratinocytes . more data supporting the idea that p38 may play a role in keratinocyte differentiation come from a study carried out in lesional psoriasis skin . it has been shown that the activity of p38 , p38 , and p38 is augmented in lesional psoriasis skin compared with nonlesional psoriasis skin . additionally , p38 may have a dual role in keratinocytes contributing not only to the differentiation process , but also to their apoptosis in a pkc-dependent manner , though the exact mechanisms by which p38 may regulate keratinocyte differentiation or apoptosis are still unknown [ 65 , 66 ] . it is important to notice that most of the pieces of evidence involving p38 in regulating keratinocyte differentiation or apoptosis are based in overexpression experiments and require verification using other tools to both inhibit the activity or the expression of different p38mapks . a possible p38 and p38 role in primary human erythroid cells differentiation has been suggested . analysis of the mrna expression pattern of each p38 isoform during erythroid differentiation of primary human erythroid progenitors shows that p38 and p38 are expressed in early and late stages , whereas p38 mrna is expressed only at terminal stages of differentiation , indicating a possible role of p38 in hematopoiesis and of p38 during the terminal phase of differentiation . since p38 expression is very high in skeletal muscle in comparison to other tissues , it is not surprising that it may play a fundamental role in skeletal muscle differentiation . thus , endogenous p38 protein level increases when myoblast differentiates into myotubes [ 68 , 69 ] . moreover , it has been shown that overexpression of p38 in skeletal muscle cells leads to differentiation from myoblast to myotubes and that a dominant - negative mutant of p38 prevented this differentiation process . recently , studies in p38 null mice reported that p38 plays a cardinal role in blocking the premature differentiation of skeletal muscle stem cells , the satellite cells that participate in adult muscle regeneration . p38 phosphorylates the transcription factor myod and promotes myod association to the histone methyltransferase kmt1a . this complex acts repressing transcription and the premature expression of myogenin this is in contrast with the essential role of p38 in muscle differentiation [ 1 , 70 ] . moreover , p38 is involved in muscle - specific exercise - induced skeletal muscle adaptation , and it seems to be required for the upregulation of pgc-1 ( peroxisome proliferator - activated receptor- ( ppar ) coactivator-1 ) in mitochondrial biogenesis and angiogenesis in response to exercise and nerve stimulation in mice . most of the studies to date have focused on the role of the p38 isoform and report the implication of this p38mapk isoform in numerous biological and physiological processes . however , the in vivo functions of other alternative p38 isoforms or the molecular mechanism by which these kinases regulate particular cell processes remain largely unknown , and several important questions remain to be answered to address why a variety of p38mapk isoforms is needed in mammalian cells are : for example , ( i ) how the p38mapk isoforms are differentially activated by certain stimuli to mediate specific nonredundant signals , ( ii ) the identification of specific physiological substrates and how they are modulated by each p38 isoform , and ( iii ) the elucidation of new in vivo roles . the use of a combination of genetically modified mice , such as mouse lacking one or more p38 isoforms , tissue - specific knock - out mice , and knock - in mice expressing inactive p38mapk will be a powerful tool to elucidate in vivo functions . furthermore , high throughput genomic and proteomic technologies will also help to answer these questions and to generate enough knowledge that hopefully could be translated in therapeutics strategies by targeting the alternative , p38 and p38 mapk isoforms . | the mammalian p38 mitogen - activated protein kinases ( mapks ) family is composed of four members ( p38 , p38 , p38 , and p38 ) , which are very similar in amino acid sequence but differ in their expression patterns .
this suggests that they may have specific functions in different organs . in the last years
most of the effort has been centred on the study of the function of the p38 isoform , which is widely referred to as p38 in the literature .
however , the role that other p38 isoforms play in cellular functions and their implication in some of the pathological conditions have not been precisely defined so far . in this paper
we highlight recent advances made in defining the functions of the two less studied alternative p38mapks , p38 and p38. we describe that these p38mapks show similarities to the classical p38 isoform , although they may play central and distinct role in certain physiological and pathological processes . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the burden on the families of the patients is not only emotional , but also a financial one . some of these patients , with affective symptoms and more schizophreniform symptoms as part of the primary diagnostic entity , may be helped by electroconvulsive treatment ( ect ) . this was already shown in a paper penetrating the medical records of the first series of patients treated by meduna in budapest , albeit with camphor . rabheru and persad reviewed the literature on continuation and maintenance electroconvulsive therapy in different patient groups in 1997 . the efficacy of maintenance ect has recently been shown in a study of major depression . they concluded that both continuation and maintenance electroconvulsive therapy were efficacious , safe , well tolerated , and also cost - effective for patients with major psychiatric disorders with depression . the procedure in itself is deemed extremely safe according to nuttal et al . who studied 2279 patients given 17,394 ect treatments . no deaths were observed , and only transient cardiac complications ( arrhythmias and one cardiac arrest ) in 9 patients . the adverse effects of ect are related to the anaesthesia , which today is very short and practically without any danger of mortality . headache and nausea occur in some patients , and transient memory impairment is usual during the time of a series of ects . the indications for ect around the world differ , although the main indication is severe depression , uni- or bipolar or as part of other mental illnesses . . thus it would be of interest to report on the treatment of a patient with severe mental illness , purportedly diagnosed as schizophrenia , given ect for more than seven years . we describe a patient with severe symptoms from the age of 20 . his illness started during military service in 1973 . the military doctor observed that he suddenly one day was sitting under military training staring , answering only yes or no . he was referred to the psychiatric asylum on chlorpromazine 50 mg twice daily . in the asylum his illness was described as catatonic episodes or a parkinsonistic crisis . shortly after arrival he had a general seizure and later minor seizures . after one week he responded to other people and after three weeks he was sent home on 4 mg haloperidol . for 12 years he lived a fairly normal life with work and non - resident contact with a psychiatrist . stay he had taken contact with hare krishna groups , giving him a state of incoherent speech and agitation . this time he was treated with the following medication : haloperidol 40 mg , levomepromazin 300 mg , perfenazin 32 mg and orfenadrin 200 mg per die . in 1995 he probably had neuroleptic malignant syndrome ( nms ) and was treated in a somatic department . 2006 he had several grand mal seizures and a new serious episode of nms . after this episode ect was started and already at the 6th treatment he was deemed to be normal . maintenance ect was not started and after some months he was again referred to the hospital and was in need of 10 ect treatments before he remitted . 2007 he started with regular ect at two weeks intervals , later the intervals have changed and before the latest referral he was on ect once weekly . he recently dropped out of the regular , scheduled ect for three weeks and he relapsed with involuntary movements and incoherent speech . a lorazapam challenging test with only 1 mg orally was given because the department did not have injectables . he was put on lorazepam 1 mg thrice daily and ect could again be given after two days . when asked about his memory he had no complaints after all these years with ect . ect is performed in dedicated rooms in the acute psychiatric department with an anaesthesiologist and anaesthetic nurse present . two eeg leads and pulse oxymeter readings are registered together with ecg and the calculated output from the thymatron device . most of his treatments have been as a non - resident patient coming to the hospital only for the sessions . the treatments have been given with right unilateral stimulating electrode placement with 90 - 100% stimulation level . ect is performed in dedicated rooms in the acute psychiatric department with an anaesthesiologist and anaesthetic nurse present . two eeg leads and pulse oxymeter readings are registered together with ecg and the calculated output from the thymatron device . most of his treatments have been as a non - resident patient coming to the hospital only for the sessions . the treatments have been given with right unilateral stimulating electrode placement with 90 - 100% stimulation level . the present case demonstrates the importance of a thorough clinical diagnosis in patients with changing stupor and mutism , florid megalomanic and muscular symptoms . the seizures as observed already by karl ludwig kahlbaum after 1863 may be a signal of the disease of catatonia in an early stage . the use of lorazepam is both a diagnostic tool and a treatment supplement besides ect when the patient suffers from catatonia . treatment with ect over many years may influence memory and cognition , but the severity differs greatly . his definite improvement would be a positive input in the vivid on - going discussion by lay people and psychologist / psychiatrists on cognitive deficits after ect . it is still disputed in the literature , less among clinicians , whether ect as a maintenance option is effective . the nice guidelines ( national institute of clinical excellence , technology appraisal 59 ) from 2003 are negative , but their conclusion is based on mostly retrospective reports , and not the following study . in a prospective , controlled study swoboda et al . studied a group of patients ( n=42 ) with affective or schizoaffective disorder . frequent maintenance ect , as in our patient , may keep the incumbent out of hospital . the nice guidelines conclusion may thus be irrelevant in these special patients as mentioned in the most recent textbook on ect . and in a case as the present , with catatonia , evidence for the positive effect of ect with or without the use of lorazepam is forthcoming . the outcome years after a series of ect may in many cases not be very different from other short - term treatment options as pharmacotherapy and/or psychotherapy for depressions . helping patients develop skills to cope with lifea and are necessary would be a task for other health professionals than those administering the treatment . in a small follow up study after ect some patients committed suicide long time after the end of the series . the patients had serious problems with coping in life as assessed by the sense of coherence test of antonovsky . long - term maintenance treatment may thus contribute to a lower mortality rate in severely depressed patients . the present patient finally got a proper diagnosis after experiencing nms twice and thus forcing his clinicians to offer him ect . | some patients with severe mental disorders are refractory to psychotherapeutic or psychopharmacological interventions .
we present a patient who at the age of 19 developed several schizophrenia - suspect symptoms .
soon inexplicable general seizures where observed .
he was treated with antipsychotics , but had two bouts of malignant neuroleptic syndrome .
electroconvulsive therapy ( ect ) gave some symptom relief and he continued on maintenance ect for years with weekly intervals .
interruption of this treatment pattern rapidly increased symptom load .
after seven years a lorazepam provocation test was performed as he had a new relapse after 3 weeks without ect . in the ensuing hours
his aggressiveness and nonsense speaking rapidly diminished .
kahlbaums observation of seizures as part of a catatonia was not understood in this case .
the publication of the new dsm - v diagnosis of catatonia may hopefully reduce the probability of treating a patient for schizophrenia for years without access to a more targeted medication and ect plan . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
for each imaging marker , separate base , rs , rw , and full models were fit to the population of hd participants and the population of healthy controls ( both from trackhd ) . here , hd participants are defined as subjects who have tested positively for the hd gene expansion . hd participants may be divided into two groups : participants who have not yet been diagnosed with hd based on characteristic motor symptoms of the disease ( called premanifest ) and participants who have been so diagnosed ( called manifest ) . for healthy controls the corresponding full model for hd participants ( including both manifest and premanifest participants ) has the following form :
( 3)yhdij = sc(ageij,c)+shd(capij,hd)+dhdi+hd1i+hd2i(ageijage0)+hdij(t)+hdij
where
ycij = logit(zcij ) is the logit transformation of the observation zcij of the volume of a brain region from healthy control i at visit j.
yhdij = logit(zhdij ) is a similar observation made on an hd participant . the logit transformation is defined as
logit(x)=log(p/(1p ) ) , where p = x100 . inverse logit transformations are applied to results from the models when estimates of zcij and zhdij are needed . this procedure is guaranteed to produce estimates of zcij and zhdij that are positive and bounded above by intracranial volume 100 . ageij and capij are the age and cap score of subject i at visit j
1 ( i.e. ,
capij = ageij(cagil)/k ) . where cagi is the cag length of subject i. l and k are constants . for each imaging biomarker , separate models are fit with cap scores defined with l = 30 and k=6.27 and with values of l and k that have been optimized for each biomarker . when l = 30 and k = 6.27 the cap score will be equal to 100 at the expected age of onset of motor symptoms . the above connection with expected age at motor onset will hold only approximately for optimized choices of l and k. details on the methods used to choose optimal values of l and k are given below . 12 ) that estimate normal aging effects and the toxic effect of mutant huntingtin , respectively . sc and shd are linear functions of the five dimensional parameter vectors c and hd but may be highly nonlinear functions of age and cap . 12 , the knots in sc and shd are placed at the 5th , 27.5th , 50th , 72.5th , and 95th percentiles of the age and cap score distributions , respectively . c is estimated in the population of healthy controls but held constant at its base model value when ref . the present models include site effects ( three dummy variables ) and a gender effect . c
1 , hd
1 are random intercept terms ( for healthy controls hd participants ) c
2 and hd
2 are corresponding random slope terms . the hd = ( hd
1 , hd
2 ) and c = ( c
1 , c
2 ) are twodimensional normal random variables with mean zero and covariance matrices hd and c . in tables , the sds and correlations of these random variables will be designated by (int ) , (slope ) , and cor(int , slope ) . the baseline constant age0 is taken to be 18.the
c and
hd are a normal residual error terms for the control and hd populations : they are assumed to have mean zero and sds
sd(c ) and
sd(hd ) , respectively . these sds will be designated as (error ) in the tables.the c(t ) and hd(t ) are realizations of continuous time rws ( technically wiener processes ) . these processes are assumed to be initialized to zero when subjects are 18 years of age . their sds are designated by (wc ) and (whd ) ( or simply (w ) if the context makes the reference population clear . following the definition of a wiener process , t years after initialization c(t ) will have an sd of
( t)(wc ) and hd(t ) will have an sd of
( t)(whd).the ,
, and terms are assumed to be mutually independent . note that the spline functions affect only the overall population trend . random intercepts , rss , and rws are simply added on to this overall trend . 12 ) that estimate normal aging effects and the toxic effect of mutant huntingtin , respectively . sc and shd are linear functions of the five dimensional parameter vectors c and hd but may be highly nonlinear functions of age and cap . 12 , the knots in sc and shd are placed at the 5th , 27.5th , 50th , 72.5th , and 95th percentiles of the age and cap score distributions , respectively . c is estimated in the population of healthy controls but held constant at its base model value when ref . the present models include site effects ( three dummy variables ) and a gender effect . c
1 , hd
1 are random intercept terms ( for healthy controls hd participants ) c
2 and hd
2 are corresponding random slope terms . the hd = ( hd
1 , hd
2 ) and c = ( c
1 , c
2 ) are twodimensional normal random variables with mean zero and covariance matrices hd and c . in tables , the sds and correlations of these random variables will be designated by (int ) , (slope ) , and cor(int , slope ) . the
c and
hd are a normal residual error terms for the control and hd populations : they are assumed to have mean zero and sds
sd(c ) and
sd(hd ) , respectively . these sds will be designated as (error ) in the tables . the c(t ) and hd(t ) these processes are assumed to be initialized to zero when subjects are 18 years of age . their sds are designated by (wc ) and (whd ) ( or simply (w ) if the context makes the reference population clear . following the definition of a wiener process , t years after initialization c(t ) will have an sd of
( t)(wc ) and hd(t ) will have an sd of
( t)(whd ) . the ,
, and terms are assumed to be mutually independent . random intercepts , rss , and rws are simply added on to this overall trend . the submodel in which c
2 and c(t ) both vanish is called the base model . the submodel in which c(t ) vanishes is called the rs model and the submodel in which c
2 vanishes is called the rw model . final models were fit in nonmem 7.3 using the first order conditional estimation method with interaction . graphics , data analysis , and data management were performed in r version 3.2.0.13 the base and rs models are random effects models of the kind that nonmem was designed to fit and their fitting is straightforward . the rw and full models , however , require special attention in order to estimate the sds of the random walks ( s ) . ( 2 ) and ( 3 ) above reveals them to be special cases of the eqs . 10 , the models of the current article reduce to a set of stochastic differential equations in which the measurement model is trivial ( i.e. ,
f(xit,i)=xij ) and system 's dynamics are of a particularly simple form ( i.e. , the integral of
g(xit , di,i ) is given , depends on t , but does not depend on xit ) . this leads to a simple kalman filter algorithm , which is iterated at each step of the nonmem optimization process and implemented through a userdefined $ pred script ( see the online supplementary material for details ) and nonmem code . in order to facilitate the estimation of nonlinear trends , the cap score enters into the model of ref .
3 as an argument to the spline function shd . this complicates the process of fitting models that will optimize the choice of l for each imaging biomarker . note that k is a normalizing constant that is useful in providing a consistent interpretation for the cap score models but which does not affect the model fit . to find optimal values of l , we set k = 1 and fit base models to ref .
3 for each integer value of l between 21 and 40 inclusive . the akaike information criterion ( aic ) values for these models ( subtracting off their minimum value ) are plotted in figure
1 for each of the 10 imaging biomarkers . an appropriate normalizing constant kopt can be computed from the formula :
( 4)kopt=6.2743lopt13
plots of akaike information criterion ( aic ) for the base model fitted with fixed values of l between 21 and 40 for all imaging biomarkers . the number 43 is a ( somewhat arbitrary ) centering constant , chosen because it is a very common value in the track dataset and in data from other observational studies . note that lopt = 30 implies kopt = 6.27 , which agrees with the values used in ref .
1 and produces a cap score that is equal to 100 at the expected age of motor onset . for any value of lopt we may define a corresponding version of the cap score as :
( 5)cap(lopt)=age(cagl)/kopt
we have the following :
( 6)cap(lopt)=rcap(30 )
where
( 7)r=1+cag4343lopt1+cag434330and cap(30 ) is the version of the cap score with l = 30 and k = 6.27 . if follows that cap(l ) = 100 r at the expected age of onset of motor symptoms . model fitting in this section was done using version 3.1 of the nlme package in r.14 additional details are in the online supplementary material . all models were fit to 10 structural magnetic resonance imaging markers from the 36month cutoff of the track data.2 the 36month track dataset contains annual observations on 366 subjects ( 45% men ) equally distributed between four sites in europe and north america . one third of the sample consisted of healthy controls . of the hd participants , half were premanifest and half were in early stages of manifest disease . all markers represent volumes of anatomic features of the brain expressed as fractions of the total intracranial volume . the markers selected for this analysis include five markers processed by the iowa center representing volumes of the thalamus , striatum , caudate nucleus , putamen , and whole brain . in addition , we consider five markers processed by the london center representing volumes of the caudate nucleus , whole brain , ventricle , cortical gray matter , and cortical white matter . the distinction between iowa and london markers is important because the london markers were obtained using either the boundary shift integral or voxelbased morphometry ( procedures that quantify annual changes in different locations of the brain within each individual ) . by contrast , the iowa variables are simple snapshots of each brain at each time point . for each imaging marker , separate base , rs , rw , and full models were fit to the population of hd participants and the population of healthy controls ( both from trackhd ) . here , hd participants are defined as subjects who have tested positively for the hd gene expansion . hd participants may be divided into two groups : participants who have not yet been diagnosed with hd based on characteristic motor symptoms of the disease ( called premanifest ) and participants who have been so diagnosed ( called manifest ) . for healthy controls the corresponding full model for hd participants ( including both manifest and premanifest participants ) has the following form :
( 3)yhdij = sc(ageij,c)+shd(capij,hd)+dhdi+hd1i+hd2i(ageijage0)+hdij(t)+hdij
where
ycij = logit(zcij ) is the logit transformation of the observation zcij of the volume of a brain region from healthy control i at visit j.
yhdij = logit(zhdij ) is a similar observation made on an hd participant . the logit transformation is defined as
logit(x)=log(p/(1p ) ) , where p = x100 . inverse logit transformations are applied to results from the models when estimates of zcij and zhdij are needed . this procedure is guaranteed to produce estimates of zcij and zhdij that are positive and bounded above by intracranial volume 100 . ageij and capij are the age and cap score of subject i at visit j
1 ( i.e. ,
capij = ageij(cagil)/k ) . where cagi is the cag length of subject i. l and k are constants . for each imaging biomarker , separate models are fit with cap scores defined with l = 30 and k=6.27 and with values of l and k that have been optimized for each biomarker . when l = 30 and k = 6.27 the cap score will be equal to 100 at the expected age of onset of motor symptoms . the above connection with expected age at motor onset will hold only approximately for optimized choices of l and k. details on the methods used to choose optimal values of l and k are given below . 12 ) that estimate normal aging effects and the toxic effect of mutant huntingtin , respectively . sc and shd are linear functions of the five dimensional parameter vectors c and hd but may be highly nonlinear functions of age and cap . 12 , the knots in sc and shd are placed at the 5th , 27.5th , 50th , 72.5th , and 95th percentiles of the age and cap score distributions , respectively . c is estimated in the population of healthy controls but held constant at its base model value when ref . the present models include site effects ( three dummy variables ) and a gender effect . c
1 , hd
1 are random intercept terms ( for healthy controls hd participants ) c
2 and hd
2 are corresponding random slope terms . the hd = ( hd
1 , hd
2 ) and c = ( c
1 , c
2 ) are twodimensional normal random variables with mean zero and covariance matrices hd and c . in tables , the sds and correlations of these random variables will be designated by (int ) , (slope ) , and cor(int , slope ) . the baseline constant age0 is taken to be 18.the
c and
hd are a normal residual error terms for the control and hd populations : they are assumed to have mean zero and sds
sd(c ) and
sd(hd ) , respectively . these sds will be designated as (error ) in the tables.the c(t ) and hd(t ) are realizations of continuous time rws ( technically wiener processes ) . these processes are assumed to be initialized to zero when subjects are 18 years of age . their sds are designated by (wc ) and (whd ) ( or simply (w ) if the context makes the reference population clear . following the definition of a wiener process , t years after initialization c(t ) will have an sd of
( t)(wc ) and hd(t ) will have an sd of
( t)(whd).the ,
, and terms are assumed to be mutually independent . note that the spline functions affect only the overall population trend . random intercepts , rss , and rws are simply added on to this overall trend . 12 ) that estimate normal aging effects and the toxic effect of mutant huntingtin , respectively . sc and shd are linear functions of the five dimensional parameter vectors c and hd but may be highly nonlinear functions of age and cap . 12 , the knots in sc and shd are placed at the 5th , 27.5th , 50th , 72.5th , and 95th percentiles of the age and cap score distributions , respectively . c is estimated in the population of healthy controls but held constant at its base model value when ref . the present models include site effects ( three dummy variables ) and a gender effect . c
1 , hd
1 are random intercept terms ( for healthy controls hd participants ) c
2 and hd
2 are corresponding random slope terms . the hd = ( hd
1 , hd
2 ) and c = ( c
1 , c
2 ) are twodimensional normal random variables with mean zero and covariance matrices hd and c . in tables , the sds and correlations of these random variables will be designated by (int ) , (slope ) , and cor(int , slope ) . the
c and
hd are a normal residual error terms for the control and hd populations : they are assumed to have mean zero and sds
sd(c ) and
sd(hd ) , respectively . these sds will be designated as (error ) in the tables . the c(t ) and hd(t ) these processes are assumed to be initialized to zero when subjects are 18 years of age . their sds are designated by (wc ) and (whd ) ( or simply (w ) if the context makes the reference population clear . following the definition of a wiener process , t years after initialization c(t ) will have an sd of
( t)(wc ) and hd(t ) will have an sd of
( t)(whd ) . the ,
, and terms are assumed to be mutually independent . random intercepts , rss , and rws are simply added on to this overall trend . the submodel in which c
2 and c(t ) both vanish is called the base model . the submodel in which c(t ) vanishes is called the rs model and the submodel in which c
2 vanishes is called the rw model . final models were fit in nonmem 7.3 using the first order conditional estimation method with interaction . graphics , data analysis , and data management were performed in r version 3.2.0.13 the base and rs models are random effects models of the kind that nonmem was designed to fit and their fitting is straightforward . the rw and full models , however , require special attention in order to estimate the sds of the random walks ( s ) . inspection of eqs . ( 2 ) and ( 3 ) above reveals them to be special cases of the eqs . 10 , the models of the current article reduce to a set of stochastic differential equations in which the measurement model is trivial ( i.e. ,
f(xit,i)=xij ) and system 's dynamics are of a particularly simple form ( i.e. , the integral of
g(xit , di,i ) is given , depends on t , but does not depend on xit ) . this leads to a simple kalman filter algorithm , which is iterated at each step of the nonmem optimization process and implemented through a userdefined $ pred script ( see the online supplementary material for details ) and nonmem code . in order to facilitate the estimation of nonlinear trends , the cap score enters into the model of ref .
3 as an argument to the spline function shd . this complicates the process of fitting models that will optimize the choice of l for each imaging biomarker . note that k is a normalizing constant that is useful in providing a consistent interpretation for the cap score models but which does not affect the model fit . to find optimal values of l , we set k = 1 and fit base models to ref .
3 for each integer value of l between 21 and 40 inclusive . the akaike information criterion ( aic ) values for these models ( subtracting off their minimum value ) are plotted in figure
1 for each of the 10 imaging biomarkers . an appropriate normalizing constant kopt can be computed from the formula :
( 4)kopt=6.2743lopt13
plots of akaike information criterion ( aic ) for the base model fitted with fixed values of l between 21 and 40 for all imaging biomarkers . the number 43 is a ( somewhat arbitrary ) centering constant , chosen because it is a very common value in the track dataset and in data from other observational studies . note that lopt = 30 implies kopt = 6.27 , which agrees with the values used in ref .
1 and produces a cap score that is equal to 100 at the expected age of motor onset . for any value of lopt we may define a corresponding version of the cap score as :
( 5)cap(lopt)=age(cagl)/kopt
we have the following :
( 6)cap(lopt)=rcap(30 )
where
( 7)r=1+cag4343lopt1+cag434330and cap(30 ) is the version of the cap score with l = 30 and k = 6.27 . if follows that cap(l ) = 100 r at the expected age of onset of motor symptoms . model fitting in this section was done using version 3.1 of the nlme package in r.14 additional details are in the online supplementary material . all models were fit to 10 structural magnetic resonance imaging markers from the 36month cutoff of the track data.2 the 36month track dataset contains annual observations on 366 subjects ( 45% men ) equally distributed between four sites in europe and north america . one third of the sample consisted of healthy controls . of the hd participants , half were premanifest and half were in early stages of manifest disease . all markers represent volumes of anatomic features of the brain expressed as fractions of the total intracranial volume . the markers selected for this analysis include five markers processed by the iowa center representing volumes of the thalamus , striatum , caudate nucleus , putamen , and whole brain . in addition , we consider five markers processed by the london center representing volumes of the caudate nucleus , whole brain , ventricle , cortical gray matter , and cortical white matter . the distinction between iowa and london markers is important because the london markers were obtained using either the boundary shift integral or voxelbased morphometry ( procedures that quantify annual changes in different locations of the brain within each individual ) . by contrast , the iowa variables are simple snapshots of each brain at each time point . table
1 presents aic statistics for comparing model fits of the base model to the rs , rw , and full models in the population of healthy controls . table
2 provides similar information for model fits in the hd population using optimal values of l from figure
1 . in both tables , table
3 compares models based on cap(30 ) with models based on the cap(lopt ) : here , values of aic less than zero indicate the superiority of the models based on cap(lopt ) . the aic statistic,15 is defined as
2log(lik)+2k , where
2log(lik ) is the objective function minimized by nonmem and k is the number of model parameters . it seems from these tables that the base model generally provides a better fit to the data for healthy controls than it does to the data for hd subjects . the largest improvements on the base model , in both the healthy control and the hd populations , are for the cortical grey and cortical white matter variables : these improvements seem , most likely , to be accounted for by rs mechanisms particularly in the hd population . by contrast , in the hd population , rw mechanisms seem to be more important than rs mechanisms in explaining the volumes of the striatum , caudate ( iowa only ) , putamen , whole brain ( london only ) , and the ventricle . even in cases in which rs mechanisms outperform rw mechanisms ( under the aic criterion ) , the rw mechanisms tend to show substantial improvement over the base model and the full model tends to show an improvement over the rs model . aic , akaike information criterion ; rs , random slope ; rw , random walk . entries in rows 24 represent the aic for the given model minus the aic for the base model . aic statistics for model comparisons in genepositive hd participants aic , akaike information criterion ; hd , huntington 's disease ; lopt , optimal l ; rs , random slope ; rw , random walk . entries in rows 35 represent the aic for the given model minus the aic for the base model . aic statistics for paired comparisons between models with optimal l and l = 30 aic , akaike information criterion ; lopt , optimal l ; rs , random slope ; rw , random walk . negative values indicate superiority of the model with optimal l. for the remainder of this section we focus on models for the striatum ( iowa ) , which is regarded as the focal point for hd pathology . global descriptive plots are sidebyside plots with information on healthy controls on the left and information on hd subjects in the center and right . the lefthand panel plots the logit transformation of each marker controlling for covariates ( y c dc ) against age for healthy controls . the center and righthand panels plot the logit transformation of the striatum controlling for covariates and normal aging (
yhdsc(age)dhd ) against cap(30 ) and cap(lopt ) . the center and righthand panels are very similar in appearance . however , the connection with ageatmotor onset is more direct in the center panel which is , therefore , recommended for routine use . each subject 's initial status ( control , premanifest , and manifest ) is indicated by color coding . the solid trend lines provide visual representations of sc(age ) ( left panel ) and shd(cap ) ( center and right panels ) . in particular , sc(age ) represents the effects of normal aging ( controlling for covariates ) and shd(cap ) represents diseaserelated effects ( controlling for covariates and normal aging ) . the spaghetti plots show that observations on each subject span a very limited portion of the complete time course of the disease . the solid lines are central to our approach to estimating the complete time courses . both normal aging and hd pathology show a pronounced and wellknown negative correlation with striatal volume . panel ( a ) :
y1=ydc vs. age in healthy controls ; panel ( b ) :
y2=ysc(age)dhd vs. cytosineadenine age product ( cap30 ) in huntington 's disease ( hd ) participants ; panel ( c ) :
y2=ysc(age)dhd vs. cap(lopt ) in hd participants . based on eqs . 2 and 3 . figure
3 shows the results of 50 simulated trajectories of striatal volumes under the base , rs , rw , and full models . the simulations assume cag lengths of 42 and plot trajectories for ages between 18 and 70 years . aic values from table
2 indicate that the rw model has the best fit . visually , figure
3 shows that the rw model displays the smallest deviation about the trend line . the rw model is also lacking in signs of agerelated heteroscedasticity that are particularly apparent in the base model . simulated trajectories for striatum ( iowa ) : huntington 's disease ( hd ) participants trajectories are simulated under the base , random slope ( rs ) , random walk ( rw ) , and full models in the population of hd participants . the simulations are based on 50 replicates and assume cytosineadenineguanine ( cag ) lengths of 42 . trajectories are simulated and plotted for ages starting at 18 years and ending at 70 years . simulated trajectories are for a male equally likely to be selected from any of the four sites . figure
4 presents scatter visual predictive checks for the full models of striatal volume . simulations were performed for healthy controls and genepositive hd subjects with cag lengths of 39 , 40 , 41 , 42 , 45 , 48 , 50 , and 59 . the restriction to subjects with the above cag lengths was made so that all results for each imaging marker could be presented on a single graph . in addition , to facilitate plotting on a single graph , all plotted data values include corrections for each subject 's covariates . simulations are based on 1,000 replicates for healthy controls and 1,000 replicates for hd subjects at each cag length . solid lines represent 5% , 50% , and 95% quantiles of the distribution of predicted observations from the rw model . the implied 90% predictive interval completely captures all observations from 75% of healthy controls and 80% of genepositive hd participants and captures some observations from 90% of healthy controls and 91% of genepositive hd participants . scatter visual predictive checks for striatum ( iowa ) : full model simulations use 1,000 replicates for healthy controls and genepositive huntington 's disease ( hd ) subjects with cytosineadenineguanine ( cag ) lengths of 39 , 40 , 41 , 42 , 45 , 48 , 50 , and 59 . solid black lines represent 5% , 50% , and 95% quantiles of the distribution of predicted observations . pathology in hd develops very slowly over many years . in the interest of understanding the dynamics of hd , considerable effort has been expended in collecting prospective data on individuals at various stages of the disease . at present , however , few subjects have been observed for the whole time course of the disease . as a consequence , if a complete disease progression model is wanted , there is a need to construct one by patching together many short time courses obtained from many different individuals and to adjust the resulting long time course estimate for covariates and changes that would be expected to occur in unaffected individuals . the current article aims to improve our understanding of hd by proposing a solution to this problem . our approach involves two novel methodological features : the use of rw error terms to model random aspects of disease dynamics and the use of the cap score to account for effects related to the length of the mutant cag expansion that lies at the root of hd . regarding the use of rw error terms , the framework is similar to that used in the stochastic differential equationbased approaches to the modeling of pharmacokinetic and pharmacodynamic.10 , 16 , 17 , 18 , 19 , 20 , 21 in the present study , the above framework is applied to the modeling of disease progression . in the case of hd , and perhaps more generally in the study of disease progression , our mechanistic understanding is not sufficiently developed to determine a specific differential equation that drives the pathological process . for this reason , we replace the differential equations used in pharmacokinetic / pharmacodynamic modeling with flexible regression splines . the regression splines are applied to the subject 's age at the time of observation for healthy controls and to the cap score in genepositive hd subjects . this has the effect of simplifying and streamlining the kalman filter algorithm of ref . regression splines were used because : ( 1 ) some clear nonlinear trends appear to be present in the data ; ( 2 ) the dynamics leading from excess cag length and/or aging to observed pathology are too complex to be modeled mechanistically at the present time ; and ( 3 ) we did not want to develop ad hoc empirical models for each of the dependent variables in our dataset . the introduction of rw error terms into disease progression modeling reflects a shift from a paradigm in which each subject 's disease progression is represented by a regression curve in twodimensional space , to a paradigm in which each subject 's progression is represented as a continuous time stochastic process measured with error at a discrete set of time points . stochastic processes of this sort are commonly used in the modeling of many natural and manmade phenomena from the trajectories of space vehicles to the movement of stock prices . a readable account of relevant applications and we feel that the stochastic process paradigm will , in time , demonstrate significant improvements over the simpler regression curve approach to disease progression modeling . future work will : ( 1 ) reproduce the work reported here on datasets that include longer time series of data for each subject . ( 2 ) apply the models developed here to other , noisier markers of the hd disease state . ( 3 ) extend the models developed here to multivariate contexts where two or more markers are analyzed simultaneously . ( 4 ) apply the modeling principles developed here to other neurodegenerative or trinucleotide repeat diseases . ( 5 ) investigate alternatives to the aic for models involving rw terms . although the use of rw error terms may be a general innovation that applies to a wide class of disease progression models , the cap score encapsulates many of the features that are specific to hd . as the name implies , the cap score is just a way of parameterizing the interactions between age and cag length that figure in our prediction formula . identical predictions could be obtained using more traditional parameterizations of the models in terms of main effects and interactions . from an interpretive point of view , however , the cap score ( 1 ) suggests a connection with mechanistic models based on the cumulative toxicity of mutant huntingtin ; ( 2 ) models the process by which increasing cag length accelerates the progression of pathology in hd ; ( 3 ) provides a connection with models that predict age at motor onset in hd ; and ( 4 ) allows for easier comparison between progression models for different imaging biomarkers . point 2 above although the role of cag length in accelerating the pathological process in hd is well established prior to motor onset , there remains some controversy regarding its role after motor onset . 4 found that the interval between motor onset and death is independent of cag length . the first interpretation suggests that the role of cag length as a driver of hd pathology diminishes as the disease progresses . the second interpretation posits two distinct cag length dependent processes one leading to motor onset and another leading to death . indeed , there is evidence that the role of cag length in disease progression is not so terminated.2 , 3 we are interested in understanding how the effect of cag length on disease progression changes over time . this issue is of more than academic interest as it may have implications for the efficacy of gene silencing therapies in the later stages of the disease . supporting information click here for additional data file . supporting information click here for additional data file . | we present a novel , general class of disease progression models for huntington 's disease ( hd ) , a neurodegenerative disease caused by a cytosineadenineguanine ( cag ) triplet repeat expansion on the huntingtin gene .
models are fit to a selection of structural imaging markers from the track 36month database .
the models are of mixed effects type and should be useful in predicting any continuous marker of hd state as a function of age and cag length ( the genetic factor that drives hd pathology ) .
the effects of age and cag length are modeled using flexible regression splines .
variability not accounted for by age , cag length , or covariates is modeled using terms that represent measurement error , population variability ( random slopes / intercepts ) , and variability due to the dynamics of the disease process ( random walk terms ) .
a kalman filter is used to estimate variances of the random walk terms . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
carotid body paraganglioma is a tumor arising from paraganglionic tissue at the bifurcation of the common carotid artery . the treatment of choice is surgical resection . in 1953 , linder classified the tumors of the carotid body and about 20 years later ( 1971 ) , shamblin et al . repeated the same classification based on the size and involvement of the carotid artery . however , surgery is very challenging for group 3 tumors that have an intimate adherent relationship to the entire circumference of the carotid bifurcation . we report a case of bilateral carotid body paragangliomas that were shamblin group 3 and 1 , respectively . a 33-year - old woman was referred to the department of vascular surgery for left side neck swelling . she was manifesting a non - tender , slightly movable , approximately 6 cm - sized , soft mass in the left side of her neck . she wanted to evaluate the mass because her voice had changed a year prior and the mass became a cosmetic problem . she was a non - smoker and had never been in high - altitude areas . blood pressure , pulse rate , body temperature and respiration rate were within the normal range . other neurologic examinations were unremarkable . her arterial blood gas analysis , serum electrolytes and other laboratory test were unremarkable at admission . on imaging evaluation , the computed tomogram ( ct ) scan showed a well enhanced , lobular contoured mass located at the left carotid bifurcation and also revealed a similar tumor at the right carotid bifurcation ( fig . 1 ) . magnetic resonance imaging revealed an enhanced mass with maximal diameter of 7.3 cm ( 7.3 5.6 5.4 cm ) encircling the ipsilateral common carotid artery ( cca ) , internal carotid artery ( ica ) and external carotid artery ( eca ) ( fig . the left side tumor was diagnosed as carotid body paraganglioma of shamblin group 3 and the right side tumor was group 1 . horner 's syndrome of the left side due to tumor encasement of the left vagus nerve was also suspected . digital subtraction angiography showed hypervascular lesions at both carotid bifurcations with multiple feeders from cca , ica and eca . the selective embolization for the left side tumor was impossible because we failed to select the feeder arteries ( fig . the left - side tumor was removed and involved eca segment , vagus nerve segment , and sympathetic nerve segment were also resected simultaneously . the tumor was attached tightly at carotid bifurcation , so some part of ica wall was removed with tumor and ica was reconstructed by remnant eca segment patch ( figs . 3 , 4 ) . transient shunt was not used during the ica reconstruction . swallowing difficulty developed with left - side tongue atrophy and horner 's syndrome four months after the surgery , she could swallow without aspiration by specific movement on swallowing and the difference in pupil size decreased . the right - side tumor was removed without any complication at 5 months after the first surgery ( figs . 5 , 6 ) . early excision is also mandatory because resection can be technically difficult or may result in neurovascular complications , especially for large size and shamblin group 3 tumors . in our case , with the left - side tumor , which was shamblin group 3 , swallowing difficulty persisted after surgery while the right - side tumor ( group 1 ) was removed without any complication . early detection of the small tumor is very difficult because of poor clinical symptoms during its small size phase . neurovascular symptoms and signs , such as hoarseness , vocal cord paralysis , otalgia , dysphasia , horner 's syndrome , pulsation , a thrill or a bruit , cerebral ischemia , or carotid sinus syndrome are present in large tumor or shamblin group 3 . in this case , the left side tumor had neurologic symptoms , hoarseness and horner 's syndrome but the right side tumor was detected incidentally . the histological appearance of a cbp is not reliable to differentiate for malignancy and the majority of authors agree that the only proof of malignancy is the presence of metastasis . needle biopsy to confirm diagnosis should be avoided because of high vascularity of the lesion . we tried selective embolization before surgery in order to reduce the size of tumor and bleeding complications but there are multiple arteries in tumor vascularization and many anastomoses between external and internal carotid arteries and tumor , thus we forfeited the pre - operative embolization . in huge cbps , such as our case , superselective embolization is very difficult , thus the incidence of stroke is increased . in surgical techniques , there are two areas needing special attention in dissection ; one is the carotid bifurcation and the other is the superior pole of the tumor . removal of cbps is most difficult in the posterior face of the carotid bifurcation where the glomus artery originates . among the post - operative complications , vascular insufficiency in the brain is the most serious complication so maintenance of cerebral blood flow is the most important thing during surgery and vascular reconstruction must be considered preoperatively . in our case , the left - side tumor was resected with part of posterior wall of carotid bifurcation and external carotid artery . the continuity from the common carotid artery to internal carotid artery was reconstructed by patch from a part of the external carotid artery . we prepared the transient shunt to maintain the cerebral blood flow but we did not have to use the shunt . another difficult area is the superior pole of the tumors . in our left - side tumor , control of internal carotid artery was difficult and the tumor had involved the vagus nerve and the cervical sympathetic trunk . after the left side surgery , the patient suffered from swallowing difficulty , aggravated horner 's syndrome and hoarseness . we applied this technique in our case but unfortunately could not prevent the neurologic complications . however , the right side tumor was removed completely without any complication . in conclusion , despite the development of surgical and endovascular treatment , huge carotid body paraganglioma can make pre- and post - operative sequalae . carotid body paraganglioma should be removed immediately upon detection . because even if the tumor is not pathologically malignant , it will continue to grow and can cause various complications and the tumor will become too difficult for a surgeon to remove without complications . | a 33-year - old woman was admitted to our hospital with a slow - growing mass in the left side of her neck .
the mass was found to be a huge ( 73 56 54 mm ) carotid body paraganglioma .
another 21 mm - size tumor was incidentally detected at the right carotid bifurcation .
she had hoarseness and horner 's syndrome of her left side .
both tumors were surgically removed .
there were no cerebrovascular complications but some neurologic complications occurred when the left tumor was removed . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
atrial tachycardia ( at ) resulting in cardiogenic shock requiring circulatory support is a rare entity . at originating from the right atrial appendage ( raa ) a 26-year - old woman in the 19th week of her first pregnancy presented with a chief complaint of palpitations . electrocardiogram ( ecg ) showed sustained at with heart rate ( hr ) of 180 bpm . the p wave morphology was positive in the inferior leads , and exhibited a negative to positive transition in leads v1 to v6 . transthoracic echocardiography revealed a structurally normal heart with global mild hypokinesis ; the left ventricular ejection fraction ( lvef ) was 50% . the at was resistant to beta - blockers , verapamil , and cardioversions . because the patient felt exertional dyspnea , we performed radiation - free catheter ablation at the 26th week of pregnancy . using the electroanatomical mapping system ( carto ) , the origin of at was identified in the apex of the raa where the local electrogram preceded the p wave onset by 32 ms . repeated ablation around the focus with both 4 mm tip and irrigated tip ablation catheters ( navi - star and navi - star thermocool , biosense webster , ca , usa ) prolonged the at cycle length , but failed to terminate the tachycardia . after the ablation , the patient remained hemodynamically stable despite at with hr of 140150 bpm . she continued her pregnancy and delivered a healthy baby at 39 weeks of pregnancy . at 1a ) . brain natriuretic peptide ( bnp ) was markedly elevated at 1839 pg / ml , and chest x - rays showed cardiomegaly ( cardiothoracic ratio=64% ) with pulmonary congestion . amiodarone and landiolol were carefully administered ; however , the patient experienced circulatory collapse unresponsive to catecholamines . with her circulation supported by percutaneous cardiopulmonary bypass ( pcpb ) and intraaortic balloon pump ( iabp ) , we attempted emergent repeat catheter ablation . 1b ) . the local electrogram at the earliest site of activation preceded the p wave onset by 34 ms and had a qs pattern in the unipolar electrogram ( fig . multiple rf applications with an 8 mm - tip catheter ( ablase , life line , japan ) with a power of 3040 w and target temperature of 55 c , and an open irrigation catheter ( navi - star thermocool , biosense webster , ca , usa ) with a power of 2540 w and target temperature of 43 c transiently accelerated the tachycardia without termination . contrast injection to the raa revealed a diverticulum around the site of earliest activation at the apex of raa ( fig . attempts to isolate the raa with encircling lesions also failed ; emergent surgery was performed with median sternotomy . pathologic examination of the resected raa revealed trabeculation of the pectinate muscles with heterogeneous fibrous scar formation from the first ablation ( fig . 2c ) . transmural lesions were rare , and the tip of the diverticulum was intact , explaining the difficulty of rf delivery in the raa and failure of endocardial ablation . with termination of at her circulation stabilized , allowing withdrawal of pcpb and iabp as her cardiac function gradually normalized . plasma bnp value decreased to < 2 pg / ml and lvef on transthoracic echocardiography improved to 67% at 3 months . atrial tachycardia originating from the raa is relatively rare with reported incidence of 3.88% of all focal ats , . an incessant form of tachycardia that may lead to tachycardia - induced cardiomyopathy is common . trabeculation of the pectinate muscles and low blood flow within the raa can cause the temperature and impedance of the ablation catheters to rise , which may prevent effective formation of ablation lesions . irrigated tip ablation catheters are reportedly more effective than non - irrigated tip ablation catheters . however , especially when the focus of at is located at the apex or the diverticulum of the raa , surgery or raa isolation with cryoballoon is sometimes necessary , . in the present case , at was refractory to ablation even using irrigated tip catheters , and surgical resection of raa was needed to terminate the at . pathological findings of the resected raa clearly explained the difficulty of delivering rf energy to the apex and the diverticulum of the raa . pregnancy may induce arrhythmias due to myocardial stretch from increased blood volume , increased sympathetic tone due to increased sensitivity of adrenergic receptors , and the effect of hormones such as estrogen and progesterone . in most cases of pregnancy - induced arrhythmia the main cause of decreased cardiac function in this case was thought to be tachycardia - induced cardiomyopathy considering the full recovery of cardiac function with termination of at and her uncomplicated subsequent pregnancy . however , requirement of circulatory support with tachycardia - induced cardiomyopathy is rare ; pathophysiology similar to that of peripartum cardiomyopathy may have coexisted and affected the clinical course . close follow - up after delivery and early aggressive intervention to the arrhythmia could have prevented the circulatory collapse in this patient . recent advances in ablation technologies and techniques such as epicardial ablation and cryoablation may improve the outcome of catheter treatment of ats originating in the raa . we report a case of failed catheter ablation for focal atrial tachycardia originating from the raa in a post - partum woman who developed cardiogenic shock requiring circulatory support . the anatomical features of the raa likely contributed to our inability to achieve effective ablation . the post - partum state of the patient might have affected her severe clinical course . | a 26-year - old woman in her first pregnancy presented with persistent atrial tachycardia ( at ) . at was resistant to medications , cardioversions , and the first attempt of catheter ablation .
two months after delivery she developed severe systolic dysfunction and circulatory collapse .
emergent catheter ablation was performed with the support of percutaneous cardiopulmonary bypass and intraaortic balloon pump .
the at originated in the apex of the right atrial appendage ( raa ) . repeated attempts at ablation were unsuccessful , prompting surgical raa resection , which terminated the tachycardia and improved the cardiac function .
histological examination of resected raa provided insights into mechanism of resistance to catheter ablation . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
telemedicine is the use of information and communication technology to provide health care services for people in remote areas where the health care providers are not available . telemedicine has been shown to be feasible and cost - effective [ 3 , 4 ] and to provide organizational benefits and to improve patients ' satisfaction . telecardiology , an application of telemedicine in cardiology , has been shown to improve the standard of cardiac care by providing diagnostic support for health professionals to safely manage their patients . studies have demonstrated that telecardiology improves the management of cardiac diseases in remote and rural populations in a cost - effective manner , reduces the number of unnecessary hospital referrals and admissions , results in avoidance of travel for patients in rural and remote areas , and improves health professionals ' knowledge base [ 711 ] . meta - analysis studies showed that telemedical monitoring of patients with chronic heart failure can improve overall survival by 17% to 47% during 6 to 12 months of follow - up [ 7 , 8 ] . moreover , some systematic reviews showed that telemedicine has a beneficial effect on health related quality of life among patients with heart failure [ 1214 ] . in jordan , many patients with cardiac diseases in the rural and remote locations receive cardiac care by general practitioners because of the scarcity of cardiologists in these areas . other patients need to travel to receive these services in tertiary hospitals in amman , the capital of jordan . because of geographic distance and costly travel , many patients find referral to a cardiologist very difficult . thus , provision of telecardiology services in remote areas in jordan could have its greatest impact . a telemedicine initiative was undertaken through the jordan healthcare initiative ( jhi ) to facilitate access to quality healthcare services for patients and clinicians from two remote hospitals in northern and southern regions in jordan to specialists at a tertiary hospital in amman . this study was conducted to assess the impact of live interactive telecardiology consultations on diagnosis and disease management and assess if telecardiology was associated with improvement in patients ' quality of life and time- and cost - savings . two teleclinics have been successfully implemented and are fully operational in two remote hospitals in north and south of jordan . the first clinic was launched in 2011 at mafraq governmental hospital ( mgh ) in the north of jordan and the second was launched in 2012 at queen rania hospital ( qrh ) in the south of jordan . the two clinics connect patients from the north and south of jordan with specialists at prince hamzah hospital ( phh ) in amman . a pretest - posttest one - group design was used to evaluate the process and outcomes of the teleconsultations that took place in the period between september 2013 and january 2014 . all consecutive patients who attended or referred to the teleclinics for suspected cardiac problems in both hospitals during the study period were included in the study . for each patient , the physician or the nurse in the remote hospitals filled the consultation request form and scheduled an appointment for the patient in the teleclinic within one week of the patient 's first visit . in the day of the visit to the teleclinic and at the end of consultation session , the study team ( two nurses in each hospital ) interviewed patients using face - to - face interview and filled all study questionnaires . the quality of life questionnaires were filled again after 8 weeks of the last visit to the clinic using phone interview . all efforts were made to ensure that the phone interview is conducted according to prespecified protocol and guidelines set by the principle investigator to ensure high data quality and to minimize the losses to follow - up . the sample size that was needed to detect a medium effect size in the change of quality of life for patients with cardiologic conditions after receiving the teleconsultation at a power of 80% and level of significance of 0.05 was calculated as 53 subjects . the ethical approval was obtained from the institutional review board at jordan university of science and technology . different aspects were assessed in the evaluation process . all questionnaires and forms used in this study english questionnaires were translated into arabic using a forward - backward translation method and were subsequently adapted to the jordanian culture . all nurses were trained on data collection methods including phone interview and face - to - face interview , on ethical aspects of research conduct , and on all study procedures . this form was filled for each patient during the initial visit by the physician or the trained nurse in the remote hospitals and a copy was sent to the specialists in the main hospital by fax or email . the form included information about the patient 's demographics , chief complaint , disease or condition category , medical history , current medications , and provisional diagnosis and treatment plan . all necessary and available documents such as lab results that may help to reach the diagnosis or the proper treatment and follow - up of the patient were sent to the specialist . this form was filled by the physicians or trained nurses in the remote hospitals at the end of the consultation . the record form included information about the final diagnosis and proper treatment plan as agreed upon by the physician and the specialist . one question was used to assess the physician perception about whether the communication with the specialist helped the physician to reach better diagnosis and/or treatment plan . a change in diagnosis was defined as whether the consultant cardiologist 's diagnosis was different from that of the referring physician 's diagnosis at the completion of the initial telecardiology consultation . a change in disease management was defined as whether the cardiologist recommended treatment plan that was different from what was recommended by the referring physician . a structured questionnaire was filled using face - to - face interview at the end of the teleconsultation session to assess the patients ' perception and satisfaction with the telemedicine application and determine its effect on the quality of care and health outcomes . the questionnaire consisting of 15 items was divided into different sections to give a complete picture on different domains including medical improvement , time- and cost - savings , the telemedicine preparation , proper case management , and diagnosis and treatment . likert scale of five responses was used to rate the individual items in each domain with higher scores indicating better satisfaction . the total satisfaction score was calculated by summing the responses of all individual items in the questionnaire and transformed to a score on 0100 scale . one generic quality of life questionnaire ( arabic version of the short form ( sf-8 ) questionnaire ) and selected questions from the minnesota living with heart failure questionnaire ( lihfe ) for patients with heart disease were used to assess the quality of life . the sf-8 was constructed to replace the sf-36 and sf-12 in population health surveys in the u.s . and internationally . accordingly , it has been translated and linguistically validated for use in more than 30 countries and languages including arabic language using iqola project methods . the lihfe has been translated into 33 languages including arabic language ( even though some of the translations may not have undergone a full linguistic validation methodology ) . the patients ' judgment was based on how much his / her heart condition influenced the specific activity over the last week . the questionnaires were filled in the same day of the teleconsultation using face - to - face interview method and the same questionnaires were filled 8 weeks later using phone interview method to assess the changes in the quality of life as a result of teleconsultation . sf-8 consists of eight items , each representing one health profile dimension : general health perception , physical functioning , role functioning - physical , bodily pain , vitality , social functioning , mental health , and role functioning - emotional . each item of sf-8 and lihfe was then scored on a 0 to 100 range so that the lowest and highest possible scores are 0 and 100 , respectively , with a high score of sf-8 and low score of lihfe defining a more favorable health state . the sf-8 scale score and lihfe score represent the average for all items in the scale that the respondent answered . improvement in quality of life after telemedicine application compared to the baseline was analyzed using paired t - test . a p value of less than 0.05 was considered statistically significant . a total of 76 patients ( 53.9% males and 46.1% females ) attended the telecardiology clinics in the two remote hospitals between september 2013 and january 2014 . the age of patients ranged from 18 to 93 years with a mean ( sd ) of 49.0 ( 13.4 ) year . less than one - third of patients ( 30.3% ) were younger than 45 years . the majority of telecardiology consultations were done in mgh and the majority of patients ( 81.6% ) were referred from outside clinic / center . approximately one - half of patients ( 51.3% ) had hypertension and one - third ( 33.3% ) had diabetes mellitus . about 71.1% of patients complained of chest pain and 53.3% complained of shortness of breath . establishing or helping in diagnosis or as perceived by the referring providers , final diagnosis was established as part of the telecardiology consultations in 71.1% of patients and changed from that of the referring provider in 17.1% of patients . the diagnosis remained the same as that of the referring provider in 11.8% of patients ( table 2 ) . the treatment plan was established for 77.3% of patients as part of the teleconsultations and changed from that of the referring provider for 16.0% patients . the referring providers perceived that the communication with the specialist helped them to reach the diagnosis and the treatment plan in all consultations . according to the final diagnosis , about half of patients ( 52.6% ) had ischemic heart disease , 35.5% had noncardiac problems , 5.3% had heart failure , 5.3% had cardiomyopathy , and 2.6% had valvular heart disease . as a result of teleconsultations , 24 ( 31.6% ) patients were treated locally in the same visit , 14 ( 18.4% ) were scheduled for a follow - up by the specialist via teleclinic and treated , 8 ( 10.5% ) were referred for outpatient diagnostics outside the region , 6 ( 3.9% ) were referred to specialized consultants outside the region for evaluation and treatment , and 24 ( 31.6% ) were referred for procedures and/or hospitalization . overall , patients ' travel was avoided for 38 ( 50.0% ) who were managed locally . while none of the patients perceived that it is easy to access the specialist clinic in amman , 98.7% of the patients stated that it was easy to access to the telecardiology clinic . the majority of patients perceived that the visit to the telecardiology clinic results in less travel time ( 96.1% ) , less waiting time ( 98.1% ) , and lower cost ( 100.0% ) when compared to visiting the specialist clinic in the referral hospital ( table 3 ) . when patients were asked about what they would do if the telecardiology was not available , 88.2% reported that they would travel to see the specialist , 10.5% will see a noncardiologist in the same hospital , and one patient reported that he would have done nothing about it . the mean ( sd ) waiting time in the teleclinic was 43.2 ( 24.7 ) minutes and the mean consultation time was 19.5 ( 12.8 ) minutes . the total satisfaction score of patients with the services received ranged from 65.4 to 100 with a mean ( sd ) of 94.6 ( 7.6 ) indicating a high level of satisfaction . a total of 50 patients had completed sf-8 and lihfe measurements at the baseline and follow - up . table 4 shows the changes in the quality of life after two months of telecardiology consultations . after two months of telecardiology consultations , the mean sf-8 score increased significantly from 40.7 to 62.4 ( p < 0.005 ) with a mean change from the baseline of 21.7 ( 95% confidence interval : 15.3 , 28.0 ) . this implies that the telecardiology consultations resulted in an improvement in the quality of life and resulted in a more favorable health state . all sf-8 domains had improved significantly after two months of telecardiology consultations except mental health domain . the highest improvements were seen in social functioning and role - emotional domains of sf-8 . moreover , the baseline mean lihfe score decreased significantly from 47.8 to 34.9 after two months of telecardiology consultations indicating that there had been a meaningful improvement in patient 's quality of life since the previous measurement of lihfe scores at the baseline . various medical specialties use telemedicine to provide care to remote populations , thereby minimizing travel and reducing costs . telemedicine has a promising application in the diagnosis and management of cardiac diseases in remote and rural areas . however , there is still a debate on the benefits and effectiveness of telemedicine . to be adopted into everyday practice , telemedicine should show improved access to healthcare , improved quality of life , and cost - savings . telemedicine enables the remote exchange of data between patients and healthcare professionals to facilitate diagnosis , monitoring , and management of conditions [ 17 , 18 ] . because of the shortage of cardiologists in remote and rural areas in jordan , the majority of patients with cardiac problems in these areas need to travel about 100300 kilometers to the tertiary hospitals in amman to receive the care . this study showed that such costly travels might be avoided for some patients as almost one - third ( 35.5% ) of patients who attended the teleclinic had noncardiac problems and 50.0% were treated locally without a need for traveling . besides , this study showed that the telecardiologists helped to establish the final diagnosis in 71.1% of patients . another option for patients in the absence of teleclinic is to receive the care by noncardiologists . this option has implications on the diagnosis and treatment . in about 17.1% of patients , telecardiology helped to establish the treatment plan for 77.3% of patients and it has been changed from that of the referring provider for 16.0% patients . therefore providing telecardiology care in remote areas of jordan would improve the access to health care and help to reach proper diagnosis and establish the treatment plan . avoidance of travel , by patients , their relatives , and health care professionals , is a major benefit of telecardiology . the majority of patients in this study perceived that the visit to the telecardiology clinic resulted in less travel time , reduced waiting time , and lower cost when compared to visiting the specialist clinic in amman . previous studies showed that telemedicine in remote areas may save costs by reductions in travel time [ 19 , 20 ] . showed that 75% of all analysed chronic chest pain referrals from gps to cardiologists were due to noncardiac causes , being either musculoskeletal or nonspecific in origin , and thus the travel can be avoided for a high percentage of patients . our study showed that telecardiology consultations resulted in a meaningful improvement in patient 's quality of life since the previous measurement of sf-8 and lihfe scores . another pre / poststudy of telemedicine found significant improvements in role - physical , bodily pain , and social functioning domains of quality of life . on the other hand , some other studies that actually measured health related quality of life found no difference between telephone support and usual care . systematic reviews that have examined the effect of telemedicine on health related quality of life in heart failure showed that telemedicine is beneficial [ 13 , 24 , 25 ] . this study was not intended to compare telecardiology to in - person cardiology care because telecardiology may still be superior to cardiologic care provided by nonspecialists . in conclusion , telecardiology care in remote areas of jordan would improve the access to health care , help to reach proper diagnosis and establish the treatment plan , and improve the quality of life . a study with a comparison group of patients who used the in - person cardiology care would provide stronger evidence on the effectiveness of telecardiology care . | objectives . to assess the impact of live interactive telecardiology on diagnosis and disease management , patients ' quality of life , and time- and cost - savings . methods .
all consecutive patients who attended or were referred to the teleclinics for suspected cardiac problems in two hospitals in remote areas of jordan during the study period were included in the study .
patients were interviewed for relevant information and their quality of life was assessed during the first visit and 8 weeks after the last visit . results .
a total of 76 patients were included in this study .
final diagnosis and treatment plan were established as part of the telecardiology consultations in 71.1% and 77.3% of patients , respectively .
patients ' travel was avoided for 38 ( 50.0% ) who were managed locally .
the majority of patients perceived that the visit to the telecardiology clinic results in less travel time ( 96.1% ) , less waiting time ( 98.1% ) , and lower cost ( 100.0% ) .
telecardiology consultations resulted in an improvement in the quality of life after two months of the first visit .
conclusions .
telecardiology care in remote areas of jordan would improve the access to health care , help to reach proper diagnosis and establish the treatment plan , and improve the quality of life . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
undernutrition is a global public health problem considered to be a principal cause of ill - health and premature morbidities . in the year 2012 , globally a total of 162 million and 99 million children aged < 5 years were stunted and underweight , respectively . malnutrition is responsible for 60% of the 10.9 million deaths occurring annually directly or indirectly , among children under five globally . in india , as per the national family health survey ( nfhs-3 ) report , 43% of children below 5 years of age were underweight and 15.8% were severely underweight . undernutrition can affect many aspects of children 's development such as retarding physical and mental development . undernutrition manifests itself in different forms in children such as wasting or stunting or underweight . various socioeconomic and sociodemographic variables such as sex , age , birth order , mother 's education , and mother 's occupation are the background factors for child 's undernutrition . all these factors affect the feeding practices , sanitation , and health seeking behavior , which have direct bearing with the nutrition of the child . these are in turn influenced by underlying determinants : food security , adequate care for mothers and children , and a proper healthy environment , which includes the availability of safe water , sanitation , healthcare , and environmental safety . according to the unicef , unhealthy household environment is one of three most common underlying factors which cause childhood malnutrition . environmental factors in addition to maternal health , demographic , and economic factors also have a significant effect on growth and well - being of the child suggesting the importance other factors on nutritional status of children but very few depicting the role of environmental factors . the present study , a rare of its kind , is an attempt to exclusively highlight the importance of macro- and micro - environmental factors on the nutritional status of the child . this was community based cross - sectional study conducted by community medicine department , pdu government medical college , rajkot , from august to december 2015 . the study was conducted in field practice area of community medicine department , namely primary health center ( phc ) area , community health center ( chc ) area , and urban health center ( uhc ) areas . as per nfhs-3 , the prevalence of undernutrition among children in gujarat was 45% . using 95% confidence levels and 10% allowable error , the calculated sample size was 488 . hence , a total of 165 children from each of the study areas were selected for study purpose . a maximum of 33 children of 36 years of age were selected from each of these anganwadi centers . the selected children were visited house - to - house , and informed consent from their mothers or concerned family members was obtained . the information regarding sociodemographic and environmental factors influencing the health of the child was collected using a predesigned , pretested , and semi - structured questionnaire . the weight of each child was compared with the who child growth standards 2006 , reference data for that particular age and sex to get weight for age indices . the sanitation status of the houses was classified as good ( score 1821 ) , fair ( score 1317 ) , and poor ( score 712 ) . the caring status of the child was classified as good ( score 1924 ) , fair ( score 1518 ) , and poor ( score 814 ) . this was community based cross - sectional study conducted by community medicine department , pdu government medical college , rajkot , from august to december 2015 . the study was conducted in field practice area of community medicine department , namely primary health center ( phc ) area , community health center ( chc ) area , and urban health center ( uhc ) areas . as per nfhs-3 , the prevalence of undernutrition among children in gujarat was 45% . using 95% confidence levels and 10% allowable error , the calculated sample size was 488 . hence , a total of 165 children from each of the study areas were selected for study purpose . a maximum of 33 children of 36 years of age were selected from each of these anganwadi centers . the selected children were visited house - to - house , and informed consent from their mothers or concerned family members was obtained . the information regarding sociodemographic and environmental factors influencing the health of the child was collected using a predesigned , pretested , and semi - structured questionnaire . the weight of each child was compared with the who child growth standards 2006 , reference data for that particular age and sex to get weight for age indices . the sanitation status of the houses was classified as good ( score 1821 ) , fair ( score 1317 ) , and poor ( score 712 ) . the caring status of the child was classified as good ( score 1924 ) , fair ( score 1518 ) , and poor ( score 814 ) . all data were entered in ms office excel . the trial version of the spss 19 ibm corp . , the age- and sex - specific distribution and prevalence of undernutrition among the children is depicted in table 1 . the proportion of malnutrition was highest in phc area ( 29.1% ) followed by chc area ( 23.0% ) and lowest in uhc area ( 18.2% ) . most ( 55.35% ) of the children were from 3 to 4 years of age group . age - specific mean weight was similar in both the sexes ( p > 0.05 ) , but the overall mean weight in boys was more ( p = 0.02 ) . almost similar proportion of undernutrition was present in both sexes across all age groups ( p > 0.05 ) , except for 34 years age group where boys had about 2.5 times more undernutrition ( p < 0.01 ) . the total prevalence of malnutrition in the 56 years of age was about two times higher ( 40% ) than that of age groups ( 21% ) . overall a quarter ( 24% ) of the children surveyed were found to be undernourished with boys ( 28% ) being significantly more affected than girls ( 19% ) ( p = 0.02 ) [ table 1 ] . age- and sex - specific mean weightstandard deviation and prevalence of undernutrition among the children table 2 shows the logistic regression analysis of various sociodemographic variables to the prevalence of undernutrition among children . male children and children aged more than 5 years had 1.6 and 2.2 times significantly higher odds of being undernourished ( p < 0.05 ) . children whose mothers and head of households who had less than secondary levels of education had 2.8 times ( p = 0.4 ) and 8.4 times ( p = 0.02 ) higher odds of being undernourished , respectively . the risk of undernutrition was 2.55 times ( p = 0.01 ) greater in children belonging to lower socioeconomic strata . however , children belonging to below poverty line ( bpl ) families had a slightly lower risk of undernutrition ( or = 1.5 , p = 0.08 ) . prevalence of undernutrition ( < 2 standard deviation ) among the children and profile of socioeconomic and sociodemographic variables the odds of being undernourished were higher in the following : children of birth order one or two ( or = 1.19 ) , belonging to urban areas ( or = 2.67 ) , unemployed mothers ( or = 2.3 ) , head of household employed in manual work ( or = 1.69 ) , muslim religion ( or = 1.27 ) , or from a nuclear family ( or = 1.25 ) . however , these differences were not statistically significant [ table 2 ] . table 3 shows the association of various sanitation - related factors to the occurrence of undernutrition among the children . children who drank unfiltered / unhygienic water and those whose mothers hands and clothes were insanitary had 2.2 and 1.8 times significantly higher risk of being undernourished . the prevalence of undernutrition ( < 2 standard deviation ) among the children and profile of environmental factors among children with ring well / pond as the source of drinking water ( or = 1.36 ) , infrequent hand washing by mothers before handling food ( or = 1.28 ) and presence of overcrowding in the house ( or = 1.12 ) , the risk of occurrence of undernutrition was higher . however , these differences were not statistically significant . nonuse of latrine facility for defecation by children had no effect on their nutrition status ( or = 1.006 , p = 0.9 ) [ table 3 ] . table 4 describes the association of sanitation standards and microenvironment standards with the prevalence of undernutrition among the children . children classified in fair or poor category for briscoe 's sanitation scale had 1.34 and1.92 times higher odds of being undernourished as compared to children classified in good category . however , this finding was statistically insignificant . similarly , children classified in fair or poor category for elizabeth 's microenvironment scale had 2.05 and 2.41 times higher odds of being undernourished as compared to children classified in good category . results of logistic regression analysis with the prevalence of undernutrition ( < 2 standard deviation ) among the children and sanitation scale and microenvironment scale the age- and sex - specific distribution and prevalence of undernutrition among the children is depicted in table 1 . the proportion of malnutrition was highest in phc area ( 29.1% ) followed by chc area ( 23.0% ) and lowest in uhc area ( 18.2% ) . most ( 55.35% ) of the children were from 3 to 4 years of age group . age - specific mean weight was similar in both the sexes ( p > 0.05 ) , but the overall mean weight in boys was more ( p = 0.02 ) . almost similar proportion of undernutrition was present in both sexes across all age groups ( p > 0.05 ) , except for 34 years age group where boys had about 2.5 times more undernutrition ( p < 0.01 ) . the total prevalence of malnutrition in the 56 years of age was about two times higher ( 40% ) than that of age groups ( 21% ) . overall a quarter ( 24% ) of the children surveyed were found to be undernourished with boys ( 28% ) being significantly more affected than girls ( 19% ) ( p = 0.02 ) [ table 1 ] . age- and sex - specific mean weightstandard deviation and prevalence of undernutrition among the children table 2 shows the logistic regression analysis of various sociodemographic variables to the prevalence of undernutrition among children . male children and children aged more than 5 years had 1.6 and 2.2 times significantly higher odds of being undernourished ( p < 0.05 ) . children whose mothers and head of households who had less than secondary levels of education had 2.8 times ( p = 0.4 ) and 8.4 times ( p = 0.02 ) higher odds of being undernourished , respectively . the risk of undernutrition was 2.55 times ( p = 0.01 ) greater in children belonging to lower socioeconomic strata . however , children belonging to below poverty line ( bpl ) families had a slightly lower risk of undernutrition ( or = 1.5 , p = 0.08 ) . prevalence of undernutrition ( < 2 standard deviation ) among the children and profile of socioeconomic and sociodemographic variables the odds of being undernourished were higher in the following : children of birth order one or two ( or = 1.19 ) , belonging to urban areas ( or = 2.67 ) , unemployed mothers ( or = 2.3 ) , head of household employed in manual work ( or = 1.69 ) , muslim religion ( or = 1.27 ) , or from a nuclear family ( or = 1.25 ) . however , these differences were not statistically significant [ table 2 ] . table 3 shows the association of various sanitation - related factors to the occurrence of undernutrition among the children . children who drank unfiltered / unhygienic water and those whose mothers hands and clothes were insanitary had 2.2 and 1.8 times significantly higher risk of being undernourished . the prevalence of undernutrition ( < 2 standard deviation ) among the children and profile of environmental factors among children with ring well / pond as the source of drinking water ( or = 1.36 ) , infrequent hand washing by mothers before handling food ( or = 1.28 ) and presence of overcrowding in the house ( or = 1.12 ) , the risk of occurrence of undernutrition was higher . however , these differences were not statistically significant . nonuse of latrine facility for defecation by children had no effect on their nutrition status ( or = 1.006 , p = 0.9 ) [ table 3 ] . table 4 describes the association of sanitation standards and microenvironment standards with the prevalence of undernutrition among the children . children classified in fair or poor category for briscoe 's sanitation scale had 1.34 and1.92 times higher odds of being undernourished as compared to children classified in good category . however , this finding was statistically insignificant . similarly , children classified in fair or poor category for elizabeth 's microenvironment scale had 2.05 and 2.41 times higher odds of being undernourished as compared to children classified in good category . results of logistic regression analysis with the prevalence of undernutrition ( < 2 standard deviation ) among the children and sanitation scale and microenvironment scale the finding of boys being more underweight than girls is consistent with that of chakraborty et al . but in contradiction with other studies [ table 1 ] . in the present study , older children in preschool age group had higher odds of being undernourished . this finding is supported by the studies of cheah et al . and choudhury et al . this could be explained by the fact that more attention is devoted to younger children while as they grow older , their nutritional requirement increases . at this time table 2 also highlights the importance of education in general and in particular of the girl child to reduce the problem of malnutrition . education is expected to influence the awareness of child malnutrition and to educate them more about nutrition . the risk of undernutrition being higher in lower socioeconomic class is proved by several studies . however , in the present study , children from bpl families had a slightly lower risk of being underweight . this was possibly due to various government sponsored incentives to the bpl families , which were not available to other families living in the same sociocultural environment but not classified under bpl status . in the present study , the history of regular hand washing by mother before handling food did not have any significant effect in reducing the risk of undernutrition in children . however , the observer findings regarding the appearance of mothers hands and clothes had a significant relation to undernutrition in children . there are several studies that have indicated the role of water , sanitation , and hygiene facilities to undernutrition . the above findings highlight the importance of safe drinking water , hand washing practices , and other sanitation measures to combat the problem of malnutrition in children . prolonged association with insanitary conditions exposes the children to fecal bacteria and other microbes leading to the chronic inflammatory reaction in the intestinal mucosa . this leads to villous atrophy , crypt hyperplasia , increased permeability , and inflammatory cell infiltrate , which causes malabsorption of essential nutrients from small intestines . this subclinical condition called environmental enteropathy leading to malnutrition has been described by certain authors . open defecation practices lead to frequent exposures of children to fecal bacteria and occurrence of malnutrition thereof . however , the present study did not find any significant association to the prevalence of undernutrition and use of toilet facility . this finding is consistent with that of tigga et al . and awoyemi et al . briscoe 's scale is a cumulative index for assessing standards of sanitation , which takes into consideration the drinking water quality , source of water , hand washing habits of mother , defecation by children , and general appearance of mother 's hands and clothes . similarly , elizabeth scale provides us with an idea about the overall caretaking of the child through assessment of maternal attitude toward child and role of family members and neighbors toward caring of the child . the results of classification of nutritional status of children according to briscoe 's sanitation scale reflected the role of sanitation in growth and development of child . the role of microenvironmental factors in the form of loving and caring for the child significantly reflected upon the nutrition status of the child . further strengthen the role of nonnutritive factors in predicting the nutrition status of child [ table 4 ] . since this was a cross - sectional study focusing only on environmental factors , the effect of other factors such as reproductive and child health , dietary factors , and cultural practices was not assessed . the study however did prove that several sociodemographic , macroenvironmental , and microenvironmental factors were important determinants of undernutrition in children . sociodemographic factors such as age and sex of the child and mother 's employment status ; environmental factors such as general cleanliness of mother 's hands and clothes , as well as drinking water quality , and microenvironmental factors in the form of caring and loving of the child were the significant predictors of undernutrition in children . | introduction : there are lots of studies focusing on the role of reproductive and child health factors and dietary factors on the nutrition status of the child . the present study is an attempt to highlight the role of macro- and micro - environmental factors in predicting the occurrence of undernutrition in children.methods:this was a cross - sectional study conducted in field practice area of community medicine department , pdu medical college , rajkot .
the nutrition status of children was assessed using the weight for age who reference standards , 2006 .
children below two standard deviation of the reference median ( weight for age ) were considered as malnourished .
data were collected for sociodemographic factors , sanitation , hygiene , and attitude of mother toward her child , etc .
, data were entered in ms excel , and logistic regression was used.results:analysis of 495 selected children showed 24% prevalence of undernutrition .
employment status of mothers ( adjusted odds ratio [ aor ] 1.65 ) , drinking water quality ( aor 1.53 ) , and cleanliness of mother 's hands and clothes ( aor 1.91 ) significantly affected the nutrition status of the child .
children classified in fair or poor category for briscoe 's sanitation scale had 1.34 and1.92 times higher odds of being undernourished ( p > 0.05 ) , respectively .
children classified in fair or poor category for elizabeth 's microenvironment scale had 2.05 and 2.41 times higher odds of being undernourished ( p < 0.05 ) , respectively.conclusions:water , sanitation , and hygiene - related factors , as well as microenvironmental factors , significantly affected the nutrition status of the children . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
type 2 diabetes mellitus ( t2 dm ) is a chronic disease characterized by insulin resistance and pancreatic islet beta cells dysfunction . the t2 dm pathogenesis represents the combined effects of genetics , nutrition , and lifestyle and involves both gene - gene and gene - environment interactions . over the past few decades , the correlation between the prevalence of t2 dm and obesity has been well demonstrated , as more than 80% of t2 dm patients are overweight or obese . it is now well known that white adipose tissue is not only serving as a long - term energy store but also as an active endocrine organ that secretes a number of bioactive molecules called adipokines . in addition to being important regulators of adipose tissue development and function , adipokines also have significant impacts on glucose metabolism in various tissues . abnormal expression and secretion of some adipokines in adiposity are strongly associated with the development and progression of insulin resistance and pancreatic islet beta cell dysfunction , which gradually and ultimately lead to the pathogenesis of t2 dm . c1q / tnf - related protein-3 ( ctrp3 ) is a novel adipokine with multiple effects as lowering glucose levels , inhibiting the glyconeogenesis in liver , and increasing angiogenesis and anti - inflammation . studies in vivo indicated that a modest 3-fold elevation of plasma ctrp3 levels by recombinant protein administration in normal and insulin resistant ob / ob mice is sufficient to lower glucose levels which may be mediated by up - regulating the protein kinase b ( pkb ) and inhibiting the expression of the gluconeogenic enzymes glucose-6-phosphatase and phosphoenolpyruvate carboxykinase in liver . a recent study showed that ctrp3 attenuated diet - induced hepatic steatosis by regulating triglyceride metabolism , indicating that ctrp3 may be an important regulator of lipid metabolism as well as glucose metabolism . ctrp-3 is expressed in subcutaneous and visceral adipocytes and is positively regulated by insulin and negatively regulated by chronic lipopolysaccharide ( lps ) exposure . one clinical research showed that circulating ctrp-3 concentrations were elevated in patients with t2 dm and metabolic syndrome ( ms ) , while another one reported that serum and omental adipose tissue ctrp3 were lower in women with polycystic ovary syndrome ( pcos ) and metformin treatment increased serum ctrp3 levels in these women and in omental adipose tissue explants . a study from korea showed that a 3-month combined exercise program significantly decreased ctrp-3 levels in obese korean women . although there has been some researches concerned the expression of ctrp3 and its modulation , little is known about its expression pattern at different stages of t2 dm which is a chronic and progressive disease . glucagon - like peptide-1 ( glp-1 ) receptor agonists are a new class of pharmacological agents that improve glucose homeostasis in many ways , including potentiation of glucose - stimulated insulin secretion , glucose - dependent inhibition of glucagon secretion , and reduction in gastric emptying , appetite , food intake , and body weight . exendin-4 ( ex-4 ) , a glp-1 receptor agonist that has been used as a drug injected subcutaneously for treatment of t2 dm , was shown to promote adiponectin secretion via the protein kinase a ( pka ) pathway in 3t3-l1 adipocytes and ameliorate insulin resistance . but it is unknown whether ex-4 might modulate the expression of ctrp3 in rats with t2 dm . so , in this report , we showed the gene and protein expression of ctrp3 in visceral adipose tissue of rats at different stages of t2 dm pathogenesis and the effects of ex-4 on it . seventy healthy male wistar rats , 8 weeks of age , were placed in a room with controlled lighting ( 12 hours light / dark cycle ) and regulated temperature ( 1825c ) and humidity . all rats were fed with regular chow ( protein 21% , carbohydrate 55% , fat 6% , and total energy 15.36 kj / g ) for 2 weeks to be adapted for the environment . twenty - four rats were randomly selected as normal control group ( nc ) and fed with regular chow throughout the study . the expression of ctrp3 in rats of nc group was detected at the beginning of the study ( marked as week 0 ) , week 10 and week 15 , respectively , and each of the detection sacrificed 8 rats . the remaining 36 rats were fed with high - fat diet which consisted of regular feedstuff , sucrose , lard , fresh egg , and milk power ( protein 16% , carbohydrate 38% , fat 46% , and total energy 20.54 kj / g ) according to one of our former studies . after 10 weeks high - fat diet feeding , twenty - four rats were selected randomly as insulin resistance group ( ir , n = 16 ) and ir + ex-4 group ( n = 8) which was given 10 g / kg ex-4 ( chempep ) administered by subcutaneous injection daily for 4 weeks . the expression of ctpr3 in rats of ir group was detected at week 10 and week 15 , respectively , and each of the detection also sacrificed 8 rats . the other 22 high - fat feeding rats were given an intraperitoneal injection of streptozotocin ( stz , 25 mg / kg ) in 0.1 mol / l citrate - buffered saline . one week later , random blood glucose of the rats were detected and rats with randomized blood glucose 16.7 mmol / l twice not in one day were considered as diabetic ones . there were 15 t2 dm rats who were divided randomly into dm group ( dm , n = 7 ) and dm + ex-4 intervention group ( dm + ex-4 , n = 8) treated as ir + ex-4 group . the expressions of ctrp3 in rats of ir + ex-4 group , dm group and dm + ex-4 group were also detected . rats of nc group , ir group , dm group , dm + ex-4 group , and ir + ex-4 group at week 15 were anesthetized with pentobarbitone ( 80 mg / kg ) after overnight fasting . both sides of femoral veins were exposed and inserted by a catheter for infusion of glucose and insulin , respectively . rats were kept quiet for 30 minutes , then a 120 minute hyperinsulinemic euglycemic clamp was performed . insulin was infused at a constant rate of 1.67 mu / kg per minute and the arterial blood glucose concentration was clamped at the basal fasting level by infusing glucose at variable rates . under the hyperinsulinemic conditions , the steady glucose infusion rate ( gir ) required to maintain euglycemia is a standard measure of the whole - body insulin sensitivity . fresh epididymis adipose tissue specimens were homogenised in rlt lysis buffer ( rneasy mini kit , qiagen , valencia , ca , usa ) using a rotator - stator , followed by a chloroform delipidation step . the upper aqueous phase was processed for total rna extraction using silica - based spin columns ( rneasy mini kit ) . the cdnas were reverse - transcribed with superscript iii ( invitrogen ) from 1 g of total rna according to the manufacturer 's protocol . pcr primers ( saibaisheng , shanghai , china ) used in the study were as follows : ( 1 ) ctrp3 sense 5-gcc ccc gta tca ggt gtg tat tt-3 ; antisense : 5-tga aga ctg tgt tgc cgt tgt gc-3 ; ( 2 ) -actin : sense 5-aca ccc gcc acc agt tcg c-3 ; antisense 5-tct ccc cct cat cac cca cat-3 . the (ct ) method was used to calculate the results for each control and experimental group . the cycle conditions were 50c for 2 min followed by 40 cycles at 95c for 15 s and 65c for 34 s. rats epididymis adipose tissue protein homogenates were prepared in tissue protein extraction buffer ( thermo scientific ) supplemented with protease inhibitors ( roche applied science ) and phosphatase inhibitors ( sigma ) . samples were boiled for 5 min in sds loading buffer and equal amounts ( 2550 g per sample ) of protein extracts were then separated by 812% of sds - page and electrotransferred onto pvdf membrane ( bio - rad ) . membranes were blocked with 5% non - fat skim milk in tris - buffered saline/0.1% tween20 ( tbs - t ) for 1 h , and then incubated with affinity - purified goat polyclonal primary antibodies were used at the following working dilutions : ctrp3 ( 1 : 1000 dilution , abcam ) and beta - actin : ( 1 : 1000 dilution , santa cruz ) . appropriate secondary antibodies conjugated to horseradish peroxidase were incubated with respective membranes for 1 h at room temperature . following five times intermittent washes with 1 tbs - t , the membranes was processed for autoradiography using enhanced chemiluminescence ( ecl , pierce chemical ) . data were expressed as mean se and were evaluated statistically using one - way anova with spss ( version 19.0 ) software . a value of p < 0.05 was considered to be statistically significant . the body weight of rats throughout study was shown in figure 1 . at the beginning of the study ( week 0 ) after high - fat diet feeding , the body weight of rats in ir group , dm group , ir + ex-4 group , and dm + ex-4 group increased faster than nc group . there were no significant differences in body weight among ir group , dm group , ir + ex-4 group , and dm + ex-4 group before the treatment of ex-4 . at the end of the study ( week 15 ) the body weight of rats in ir + ex-4 group was lower than that of ir group ( p < 0.01 ) , and dm + ex-4 group was lower than dm group statistically ( p < 0.01 ) . after the stz intraperitoneal injection in 22 high - fat diet feeding rats , there were 15 rats whose random glucose 16.7 mmol / l twice not in one day , being considered as t2 dm . not surprisingly , the fasting blood glucose ( fpg ) in rats of dm group and dm + ex-4 group was higher than that of nc group or ir group significantly ( all p < 0.01 ) , and the glucose level in dm + ex-4 group was decreased obviously compared to that of dm group ( p < 0.01 ) ( table 1 ) . the whole - body insulin sensitivity was assessed by gir . according to our previous study , high - fat diet feeding for 10 weeks may induce significant insulin resistance in wistar rats . so in this study the rats were given high - fat diet feeding for 10 weeks and then given stz intraperitoneal injection to conduct t2 dm model . at the end of study , the gir of ir group and dm group was ( 4.9 0.4 ) mgkgmin and 4.7 0.4 mgkgmin , respectively , both being significantly lower than that of nc group [ ( 7.2 0.5 ) mgkgmin ] ( all p < 0.01 ) . after the intervention with ex-4 , the gir in ir + ex-4 group and dm + ex-4 group were both increased significantly in comparison with that of ir and dm group accordingly ( all p < 0.01 ) ( table 1 ) . the relative expression of ctrp3 mrna in nc group at week 10 was increased significantly than that of week 0 ( p < 0.01 ) , but there was no significant different between week 10 and week 15 . ctrp3 mrna relative expression of ir group at week 15 was decreased significantly by 12.1% ( p < 0.01 ) than that of week 10 which was lower statistically than that of nc group at the same week ( p < 0.05 ) . compared to ir group at week 10 , the ctrp3 mrna relative expression in dm group at week 15 was decreased by 22.7% ( p < 0.01 ) . at week 15 , the ctrp3 mrna relative expression in ir group and dm group was decreased by 25.0% and 32.9% , respectively , in comparison with that of nc group ( all p < 0.01 ) . the difference of ctrp3 mrna expressions in dm group and ir group at week 15 was also significant ( p < 0.05 ) ( figure 2 ) . compared with nc group at week 0 , the relative expression of ctrp3 protein in nc group at week 10 there was no significant difference in ctrp3 protein expression of nc group between week 10 and week 15 . ctrp3 protein relative expression of ir group at week 15 was decreased significantly by 16.3% ( p < 0.01 ) than that of week 10 which was lower statistically than that of nc group at the same time ( p < 0.01 ) . compared to ir group at week 10 , the ctrp3 protein relative expression in dm group at week 15 was decreased by 24.8% ( p compared to nc group at week 15 , the ctrp3 protein relative expression of ir group and dm group was decreased by 31.6% and 38.6% , respectively ( all p < 0.01 ) . the difference of ctrp3 protein expression in dm group and ir group at week 15 was also significant ( p < 0.05 ) ( figure 3 ) . compared to ir group at week 15 , the relative expression of ctrp3 mrna and protein of ir + ex-4 group was increased by 15.5% ( p < 0.01 ) and 14.8% ( p < 0.05 ) , respectively . the relative expression of ctrp3 mrna and protein of dm + ex-4 group was increased by 20.6% ( p < 0.01 ) and 16.5% ( p < 0.05 ) , respectively , in comparison with that of dm group ( figures 2 - 3 ) . nowadays there are numerous animal models available for the study of t2 dm , but the pattern of disease development and progress in most of them is not equal to the clinical situation in human beings . many studies have shown that rats fed with high - fat diet develop insulin resistance but not frank hyperglycemia or diabetes , indicating that high - fat diet might be a good way to initiate insulin resistance which is one of the important features and motivators of t2 dm . stz is widely used to reproducibly induce diabetes mellitus by inducing pancreatic islet beta cells death through dna alkylation . it is well known that high - dose stz severely impairs insulin secretion , mimicking type 1 diabetes mellitus , and low - dose stz after high - fat diet feeding induces a mild damage to beta cells on the background of insulin resistance , which is similar to the features of t2 dm pathogenesis . our laboratory has used high - fat diet to induce insulin resistance model and high - fat diet plus low - dose stz intraperitoneal injection to conduct t2 dm model in wistar rats [ 13 , 17 ] . in this study , male wistar rats were fed with high - fat diet for 10 weeks to induce insulin resistance and then 22 of them were given low - dose stz ( 25 mg / kg ) intraperitoneal injection . one week later , the random glucose was detected and there were 15 rats whose glucose was 16.7 in addition to the detection of glucose , this study also measured gir though hyperinsulinemic euglycemic clamp to reflect the insulin sensitivity , and found that the gir of ir group and dm group was lower significantly than that of nc group . based on the results of glucose and gir , week 10 ( rats fed with high - fat diet for 10 weeks ) and week 15 ( rats fed with high - fat diet plus low - dose stz intraperitoneal injection ) were considered as different stages of t2 dm pathogenesis , that is insulin resistance and overt diabetes . recently , ctrp3 was described as a novel adipokine with glucose - lowering effects achieved by suppression of hepatic gluconeogenesis . schmid et al . used human subcutaneous and visceral adipocytes and murine 3t3-l1 adipocytes to analysis of ctrp-3 expression and function and found that ctrp-3 was expressed in subcutaneous and visceral adipocytes , being positively regulated by insulin and negatively by infection or inflammation - related factors . one study on women with pcos which is associated with obesity , insulin resistance , and diabetes reported that the levels of serum and omental adipose tissue ctrp3 were lower in women with pcos in comparison with control subjects . however , another study found that ctrp-3 concentrations were significantly higher in patients with t2 dm or pre - diabetes than the normal glucose tolerance group . the possible explanations for the diverges between the two studies might be the effects of medications taken by t2 dm patients , which may increase the expression of ctrp3 , and the different ethnic groups . although there have been some researches about the expression of ctrp3 under different status , the pattern of ctrp3 expression and its regulation at the different stages of t2 dm is widely unknown . this study detected the mrna and protein expression levels of ctrp3 in t2 dm rats at different pathogenic stages . in normal control rats , the expression of ctrp3 mrna and protein at week 10 ( aged 20 weeks ) was increased significantly than that of week 0 ( aged 10 weeks ) . although the expressions of ctrp3 mrna and protein were increased at week 15 ( aged 25 weeks ) in comparison with week 10 , the differences were not significant , indicating that the expression of ctrp3 in visceral adipose tissues of normal rats increased with their growth and came to a relative stable state at the age of 20 weeks . as to t2 dm rats , the expressions of ctrp3 mrna and protein at week 10 when they were at the stage of insulin resistance were lower than that of normal control rats at the same week , and decreased more at week 15 when they were at the stage of overt diabetes . to our knowledge , this is the first time to report the expression of ctrp3 in rats at different stages of t2 dm pathogenesis . these results resembled a report of ctrp3 expression in pcos women as mentioned above but were opposite to one study showing that ctrp3 expression was decreased in t2 dm patients in comparison with normal control subjects . the reasons may be the different species , the possible therapies in t2 dm patients , and other unknown factors . it is well known that inflammation is the common characteristic and mechanism of obesity , insulin resistance and t2 dm . our former studies in insulin resistance rats induced by high - fat diet and t2 dm rats induced by high - fat diet plus low - dose stz intraperitoneal injection found that there were obvious inflammation in such animals which were the same as that used in this study [ 20 , 21 ] . as some studies reported that ctrp3 expression in adipocytes were positively regulated by insulin and negatively by infection or inflammation - related factors , it is reasonable to infer that the relative low expression of ctrp3 in insulin resistance rats and t2 dm rats was due to the status of inflammation and insulin resistance in them . from recent decades , increasing the glp-1 activity has emerged as a useful therapeutic tool for the treatment of t2 dm . the actions of glp-1 on pancreatic islet beta cells and central nervous and digestive systems have been widely studied . the action of this peptide in adipose tissue , however , is still poorly defined . studies have shown the presence of glp-1 receptor in adipose tissue , and that the expression of glp-1 receptor mrna and protein was increased in visceral adipose depots from morbidly obese patients with a high degree of insulin resistance . furthermore , prospective studies carried out with patients that underwent biliopancreatic diversion surgery showed that subjects with high levels of glp-1 receptor expression in adipose tissue , which indicates a deficit of glp-1 in this tissue , were those whose insulin sensitivity improved after surgery , suggesting the potential relationship between glp-1 activity and insulin sensitivity . this study found that after the treatment with ex-4 for 4 weeks , gir of ir rats and t2 dm rats were increased significantly , indicating the sensitization of glp-1 in adipose tissue , which may be due to its activities in inhibiting inflammatory and regulating adipogenesis and lipid metabolism [ 25 , 26 ] . for the tight relationship between glp-1 and adiposity and its related diseases , more and more studies focused on the effects and mechanisms of glp-1 on adipose tissue which is the main source and target of adipokines that may be the key modulators in the pathogenesis of adiposity related diseases . glp-1 receptor agonist has been shown to increase the expression of such adipokines as adiponectin and visfatin that may increase the insulin sensitivity in adipose tissue . ctrp3 is a novel multifunctional adipokine and its expression modulated by glp-1 has never been studied before . this study , for the first time , reported that ex-4 treatment increased the mrna and protein expressions of ctrp3 in insulin resistance rats and t2 dm rats . kopp et al . reported that the recombinant ctrp3 dose - dependently inhibited the release of chemokines in monocytes and adipocytes in vitro and ex vivo , and inhibited monocyte chemoattractant protein-1 ( mcp-1 ) release in adipocytes , whereas small interfering rna ( si - rna)-mediated knockdown of ctrp-3 upregulated mcp-1 release , reduced lipid droplet size , and decreased intracellular triglyceride concentration in adipocytes , causing a dedifferentiation into a more proinflammatory and immature phenotype . these results indicated that ctrp3 has the effects of anti - inflammation , which may be one of the indirect mechanisms that glp-1 increased insulin sensitivity in insulin resistance rats and t2 dm rats as found in this study . in whole , this study found that the mrna and protein expressions of ctrp3 in visceral adipose tissue were progressively decreased at the pathogenic stages of insulin resistance and overt diabetes in a t2 dm rats model induced by high - fat diet plus low - dose stz intraperitoneal injection , while ex-4 , a glp-1 receptor agonist , increased the expression of ctrp3 in such animals and improved their insulin sensitivity . but the expression of ctrp3 at different stages of t2 dm pathogenesis in human beings , the factors that modulates the expression of ctrp3 in the pathogenesis of t2 dm and the mechanisms that glp-1 receptor agonists modulate the expression of ctrp3 are still largely unknown and need further research . | this study aimed to investigate the expression of c1q / tnf - related protein-3 ( ctrp3 ) in rats at different pathogenic stages of type 2 diabetes mellitus ( t2 dm ) and the impacts of glucagon - like peptide-1 ( glp-1 ) receptor agonist on it .
male wistar rats were fed with high - fat diet for 10 weeks to induce insulin resistance ( ir ) and then were given low - dose streptozotocin ( stz ) intraperitoneal injection to induce t2 dm .
exendin-4 ( ex-4 ) , a glp-1 receptor agonist , was subcutaneous injected to the ir rats and t2 dm rats for 4 weeks .
the expression of ctrp3 mrna and protein in epididymis adipose tissue of rats at the stage of ir was lower significantly than that of normal control ( nc ) rats and decreased more when they were at the stage of overt t2 dm ( all p < 0.05 or p < 0.01 ) .
after the treatment with ex-4 , the mrna and protein expressions of ctrp3 were increased by 15.5% ( p < 0.01 ) and 14.8% ( p < 0.05 ) , respectively , in ir rats and increased by 20.6% ( p < 0.01 ) and 16.5% ( p < 0.05 ) , respectively , in t2 dm rats .
overall , this study found that the expression of ctrp3 in visceral adipose tissue was progressively decreased in a t2 dm rat model from the pathogenic stage of ir to overt diabetes , while ex-4 treatment increased its expression in such animals . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
advances in biomedical science and technology have brought the hope of survival to more and more children and youth with complex needs . many of them now live into adulthood and function in the community . accordingly ; a growing interest has emerged in the children 's quality of psychosocial life in spite of the continuing or deteriorating limits to their physical and/or cognitive function . the psychosocial quality of life is the individual 's report of their age appropriate social and emotional participation in life in the context of the culture and value systems in which they live . the psychosocial well - being of children with complex needs , however , appears to be more strongly linked with child behaviour , parent and family impact variables . studies have shown that the psychological well - being of special needs children is associated with lower pain levels , lower parent distress , fewer symptoms of adhd , no comorbid psychiatric diagnoses , fewer behavioral difficulties , less receipt of rehabilitation and more accepting / autonomous parenting styles [ 69 ] . current thinking has moved from studies of simple univariate associations between variables to hypotheses that acknowledge the interplay among ecological and transactional multilevel factors within the child , parent , family , school , and health care provider(s ) . it is hypothesized that there are types of causalities ( potentialities and instigators ) and levels of multiple other associated factors within the child / parent / family / social and health service environments that interact to explain the quality of life in a child with complex needs . using the evolving bronfenbrenner and morris bio - ecological model of human development , the principal components and the dynamic interactive relationships among them can be described in relation to the child 's psychosocial health . the particular forms of interaction between the children and their environments that operate over time ( proximal processes ) are posited as the primary mechanisms producing human development . the power of such processes to influence development has been shown to vary substantially as a function of the characteristics of the developing , immediate and more remote environmental contexts , and the time periods in which the proximal processes take place . as stated by bronfenbrenner in ecological research the principal main effects are likely to be interactions . bronfenbrenner 's general hypothesis is that the developmental impact of proximal processes growing up in disadvantaged or disorganized environments is greater for outcomes reflecting developmental dysfunction . by contrast , for outcomes indicating developmental competence , proximal processes are posited as having likely greater impact in more advantaged and stable environments . specifically , children with complex needs experience a constellation of physical limitations and behaviours over time ( age ) and interact within their environment ( parent , family , school , social and health providers ) ( figure 1 ) . concurrently , parents may have their own social / emotional / physical issues yet they must respond to and live with the child 's behaviour in addition to physical limitations as the child develops ( this is the essence of parenting ) . family , school and treatment providers also respond to the child and parent involving them in a complex interplay of environmental factors . we hypothesize that the reciprocal influence between the child 's behavior , their immediate parenting / family environments , parent report of impact on the family , parent depression / anxiety and well - being , and family function influences the child 's psychosocial function . supportive and comprehensive processes of care from health care providers may help to influence child psychosocial function when parents exhibit poor physical or mental health , and family outcomes . a better understanding of the interplay among these variables would help highlight the emphasis to be taken in child and family rehabilitation if the objective is to maximize the child 's quality of life ( physical and psychosocial ) and promote the family 's ability to live with their child 's disability . further , an understanding of the service provider processes of care that influence the child 's psychosocial quality of life when the child , parent or family have additional psychosocial circumstances and behaviours would offer specific guidance to providers . as stated so clearly by koroloff and friesen family strength and family focused models and perspectives embraced by current service delivery demand new research approaches . the purpose of this paper is to test this conceptual framework of ecological factors within the child , parent , family , social and health services environment that could potentially interact to explain the quality of psychosocial life in a heterogeneous sample of children with complex needs . this descriptive study is part of a cohort study examining the effects and expenses of more and less integration of services that provide treatment and rehabilitation for children with complex needs . the cohort is enrolled in the newly modeled children 's treatment network ( ctn ) of simcoe / york counties in ontario . the ctn approach is unique in that it is based on the collaboration of numerous existing autonomous local service agencies utilizing the service co - ordination and electronic record functions of the ctn . ethics approval was obtained for the study by the research ethics board of mcmaster university . this was a cross - sectional survey of families with a special needs child enrolled in the ctn from may to december 2007 . families were deemed eligible if the child 's age was between 0 and 19 years , were residents of simcoe / york , and there were multiple needs within the family ( child 's special needs and/or families needs , for example , a parent 's medical or mental health problem ) . the consenting parent / guardian most knowledgeable ( pmk ) returned a signed consent form to mcmaster university indicating their willingness to participate . the pmk then completed a telephone interview ( 1 hour ) by one of three trained interviewers from mcmaster university . the shortened version consists of 15 items comprising three core scales and addresses the physical ( 5 items ) , emotional ( 4 items ) , social ( 3 items ) and school functioning ( 3 items ) . parent proxy report formats were used for children aging from 2 to 18 due to the inclusion of children with limited cognitive or communicative abilities . each item for ages from 8 to 18 asks how much of a problem it has been during the past month on a five point scale ( 0-never a problem to 4-almost always a problem ) . for children aged 5 to 7 , the scale is modified to 0-not a problem , 2-sometimes a problem and 4-a lot of a problem . items are reverse scored and linearly transformed to a 0100 scale so that higher scores indicate better quality of life . psychosocial quality of life ( psychql ) is computed as the sum of the emotional , social and school scale scores ( 10 items , range 0100 ) . behaviour was measured using the nlscy behaviour questionnaire for children aged from 0 to 19 . the questionnaire asks about how the child seems to feel or act regarding age - specific behaviours such as getting into fights , inability to sit still , and worrying . the parent is asked to rate the specific behaviour from 1-never to 3-often . behaviour subscales include hyperactivity / inattentive , prosocial , anxiety / emotional disorder , conduct disorder/ physical aggression , indirect aggression and property offence . items differ for age groups 0 - 1 years , 25 years and 619 years . specifically , questions pertaining to aggression , property offense and prosocial behaviour do not apply to the younger age groups . the kessler scale ( k10 ) measures pmk symptoms of depression and anxiety , a frequent accompaniment of depression . ten questions measure the frequency of feeling : sad , nervous , restless , hopeless , worthless , everything was an effort , tired for no good reason , so nervous that nothing could calm down , fidgety , so restless , could not sit still , or depressed during the past month . chronic aspects of distress in the past month are examined on a five point scale ( 1-all of the time to 5-none of the time ) . scores range from 1050 where scores 19 indicate no clinically important level of distress , 2024 indicates mild distress , 2529 moderate distress and 3050 severe distress . parents were asked to rate their mental , physical health and general life satisfaction on a five point scale ( 1-very satisfied or these questions were taken from the canadian community health survey ( cchs 2.2 ) . the impact on family ( iof ) parents respond on a four - point scale , to the degree that statements apply to their family ( 1-strongly agree to 4-strongly disagree ) . the revised iof scale ( 15 items ) has been validated [ 22 , 23 ] . statements cover four dimensions : financial burden , family / social impact , personal strain , and mastery ( e.g. , fatigue is a problem , see family and friends less , need to change plans at last minute , little desire to go out ) . the nlscy parenting scale was used and it consists of twenty - five questions adapted from the validated parenting practices scale . the following four parenting behaviours were measured : positive interaction ( praise , play ) , hostility ( anger , discipline ) , consistency ( follow through ) and punitive ( yelling , physical punishment ) . pmk rates each item ( e.g. , do something special with your child that he / she enjoys ) in terms of frequency from 0-never to 4-many times each day . the level of the social support of the pmk was assessed using an eight - item shortened version of the social provisions scale . different social support constructs were measured ; guidance , reliable alliance ( i.e. , feeling assured that others would be available to offer practical help ) , and attachment . pmk rates each item along a four point scale from 0-strongly disagree to 3-strongly agree . thirteen items from the nlscy population survey , based on a subscale of the mcmaster family assessment device were used to gather information on various aspects of family functioning ( problem solving , communication , roles , affective responsiveness , affective involvement , behaviour control ) . pmk rated each item ( e.g. , we avoid discussing our fears or concerns ) along a four point scale from 1-strongly agree to 4-strongly disagree . negatively oriented items are reverse scored so that higher scores represent greater family dysfunction . the measure of processes of care ( mpoc-20 ) is a 20-item , well - validated and reliable self - report measure of parents ' perceptions of the extent to which the services they and their child receive is family centered [ 27 , 28 ] . respondents use a seven - point scale to describe the extent to which they experience service provider behaviours across five domains with response options ranging from 1-never to 7-to a great extent . the five domains are : enabling and partnerships , providing general information , providing specific information , comprehensive and coordinated care and respectful and supportive care . includes child 's age , gender , grade and pmk report of the main medical and other important diagnoses . a standard form including spiritual or faith orientation , ethnicity and languages was selected from the canadian national longitudinal study on children and youth ( nlscy ) that also includes community dwelling disabled children . sociodemographic data were gathered on the pmk gender , age and educational level as well as on household income and family status . descriptive statistics ( numbers , percentages , means and standard deviations ) were calculated for all child and family variables . the prosocial behaviour scale items for children and youth from 6 to 19 years were different for children from 2 to 5 years . . the behaviour scales for different age groups were transformed using the interpolation technique where the mean of the behaviour scale scores for children from 2 to 5 years with fewer items were multiplied times the number of items for older children . , there were reports of two or three children with complex needs in the same family and only one report of parent variables . in these instances , the pmk was counted multiple times to ensure a matched number of children and parents in the analysis . ideally , hierarchical or multilevel modeling would be the most appropriate analytic approach because of testing within level variables ( e.g. , families nested within providers ; children nested within families ) . our data , however , are such that there is only one observation for each level . accordingly , regression was used to examine the associations of selected child , pmk , family and treatment variables ( i.e. , independent variables ) with the outcome child psychql ( i.e. , dependent variable ) , including 2-way interactions among the variables . the child , pmk , family and treatment variables for analysis were selected based on their theoretical relevance and on the contribution of the variables to the fit of the model . the fit of the model was assessed by the regression coefficient ( r ) , as it measured the percentage of variation of the dependent variable explained by the model . in the final model , all possible 2-way interactions of variables were tested , and nonsignificant interactions were removed using the forward stepwise selection technique , where the entry significant level and staying significant level were chosen to be 5% and 10% , respectively . the variables in the final model were centralized to adjust for possible multicolinearity . the normal plot was used to check the normality of the outcome ( psychql ) . the association between one variable and the outcome was plotted as a regression line under three conditions of the other variable . the three conditions were conventionally defined as : high ( any score more than 1 standard deviation above the mean ) , moderate ( any score within 1 standard deviation to the mean ) and low ( any score more than 1 standard deviation below the mean ) . table 1 shows the demographic characteristics of the participating families . the majority of pmk were mothers of the children ( 85% ) , born in canada ( 61% ) and spoke english ( 91% ) . the average pmk was 40 years , 90% were female , 85% were married / common - law , 68% were employed and the median household income was $ 60$69,000 . there was an even split between families residing in simcoe ( 52% ) and york ( 49% ) counties . the average child age at interview was 7.94 years with 67% of the sample being male . forty percent of the children were in preschool ( up to and including kindergarten ) , 35% in grades 15 ( elementary ) and 25% in grades 6 and up ( junior ) . sixty - one percent of children were receiving service from community care access centres and school boards at time of entry into the ctn . the top pmk reported diagnoses for the children ( table 2 ) were mental and behavioural disorders ( 78% ) , diseases of the nervous system ( 34% ) , autism ( 23% ) and congenital malformations , deformations and chromosomal abnormalities ( 20% ) . fifty one percent of children had more than one reported medical problem . in table 3 , it can be seen that the study sample included children with complex needs with low physical and psychosocial quality of life as indicated by the pmk . generally , this sample of children exhibits pro - social behaviour and low levels of anxiety , aggression and property offence behaviours . pmk positive interaction and consistency parenting practices were moderate to high in 92% and 78% of the cases , respectively . pmk hostile parenting and punitive parenting were generally low in this sample ( 81% and 67% scored in the low range , respectively ) . on average pmk report having social supports without family dysfunction and good overall life satisfaction . forty - three percent , however , were exhibiting mild to severe symptoms of depression and anxiety ( k10 > 19 ) . for measures of processes of care , respectful and supportive care received the highest rating and providing general information received the lowest rating by pmk . on average , junior school - aged children ( grade 6 & up ) had lower psychosocial scores by 4.4 points than younger children . child hyperactivity , conduct disorder , hostile parenting and punitive parenting were statistically significantly related to psychql , however , these main effects had small beta co - efficients ( range 1.25 to 0.66 ) . comprehensive and coordinated care was statistically significantly related to the child 's psychql as a main effect in this model . for every one point increase in ccc ( 07 ) there is a 2.33 point increase in child psychql . although statistically significant , many were deemed less clinically important due to low beta co - efficients . clinically important interactions expressed in the difference in the psychosocial quality of life scores for junior children were plotted in figure 2 through 4 . the difference in psychosocial function for younger children will show the same pattern , except that the younger children on average will have scores 4.4 points higher . the extent of ccc received was positively associated with the child 's psychql score when the parent 's physical health was moderate or good ( figure 2 ) . in the case of parents with moderate physical health , each unit increase in the ccc score was on average associated with a 2.33% higher child psychql score . in the case of good physical health , each unit increase in the ccc score was on average associated with a 6.57% higher child psychql score . ccc , however , was negatively associated with the child 's psychql score when the parent 's physical health was poor . in these situations , each unit increase in the ccc score was associated with 1.9% lower child psychql score . the extent of ccc received was also positively associated with the child 's psychql under any condition of parental mental health ( figure 3 ) . in the case of poor pmk mental health , each unit increase in the ccc score was on average associated with a 3.57% higher child psychql score . in the case of moderate mental health and good mental health , each unit increase in the ccc score was on average associated with 2.33% and 1.09% higher child psychql scores , respectively . the extent of rsc received was positively associated with the child 's psychql score when the pmk physical health was moderate or poor ( figure 4 ) . in the case of moderate pmk physical health , each unit increase in the rsc score was on average associated with a 0.94% higher child psychql score . in the case of poor pmk physical health , each unit increase in the rsc score was associated with a 4.03% higher child psychql score . rsc , however , was negatively associated with the child 's psychql score when the parent 's physical health was good and in that case each unit increase in rsc score was on average associated with a 2.2% lower child psychql score . this study provides original information about the psychosocial quality of life of children with complex needs and the associations and interactions of environmental influences . quality of life scores in this sample ( physical 55.77 , psychosocial 50.09 ) were much lower than reported mean scores for healthy children ( physical score 87.84 , psychosocial 81.87 ) . they were also lower than scores reported by 10 disease clusters ( physical score range 64.4085.89 , psychosocial range 67.4677.34 ) . the scores obtained in this multidiagnoses sample were comparable to reported scores for children with cerebral palsy attending a cp clinic in san diego ( physical 43.19 , psychosocial 55.91 ) . children in varni 's cp sample , however , were excluded if they were not able to self - report pedsql scores . generally the physical score in the cp group is lower likely because of the inclusion of children with quadriplegia while the psychosocial score is higher likely due to our inclusion of kids with mental and behavioural diagnoses . the low scores in this sample illustrate the multifaceted needs and issues faced by this heterogeneous group of children and youth with multiple diagnoses usually excluded from other studies . the lower psychosocial function among older children and youth could be the results of accumulating parent distress , less favorable parenting styles , child exclusion from peers and activities when in school or the possibility of discontinuities in what is measured at different ages . also , at the time of this study rehabilitation efforts were more targeted to younger children through early intervention programs . there are fewer formal treatment options for older youth and perhaps older children simply decide not to pursue further efforts to improve their quality of life once they achieve greater independence . finally , as the data is proxy reported , parent mental health expectations of their child at different ages may influence psychosocial child quality of life responses and thus overall scoring ( i.e. , parents of older children may have higher behavioral expectations and there are more environmental / peer influences for older children ) . child psychosocial function , as reported by parents , was also associated with negative child behaviour , reported adverse impact of the child 's situation on the family , parenting practices , parent health and processes of care . hostile and punitive parenting styles ( although the prevalence in this sample was generally low ) appear to be associated more with child psychosocial function than positive or consistent parenting styles . these findings are similar to previous reports in special needs populations of parent distress , negative child behaviour , and negative parenting practicing being associated with lower child psychql [ 69 ] . also , ccc and rsc had greater association with child psychosocial quality of life than other measures of processes of care . . similarly showed that processes of care are associated with the quality of life of children with neurological conditions . these findings justify the ctn emphasis on team coordination and added psychosocial resources for parents and children . this study also confirms that reports of simple associations between research outcomes do not give a comprehensive picture of the issues . a multitude of factors ( e.g. , child age , behaviour , parent mental and physical health , parenting practices , provider processes of care ) and interactions among these factors are simultaneously present ; therefore , care of these families requires a holistic approach that addresses all aspects of the child 's environment . in addition to working with the complex child on their physical needs , some parents need help with effective parenting strategies and their own mental health in order to maximize the child 's psychosocial health . also , service providers may need to tailor their treatment approaches to different family situations . specifically , it appears that in families receiving high comprehensive and coordinated care from service providers , the parent is in good physical health and the child 's psychql is high . in families receiving higher rsc , however , the parent is in poorer physical health and the child 's psychosocial function is high . on the whole , the general hypotheses of the child with complex needs being influenced by their environment ( parent , family and service provider behaviours ) was upheld and specified as child psychosocial quality of life varied for different environmental conditions . further research is needed to confirm these trends and to explore the direction of the associations across real time . this data informs the child rehabilitation literature by including the role service provider 's play in interaction with child and parent behaviours in explaining the psychosocial function of children with complex needs . results and findings are difficult to generalize outside of this study population because other contexts may differ . this study may be missing important information from working , lower educated , single parents and their children likely those with greater need . this study probably underestimates the effects . due to the cross - sectional nature of this research we do not understand the causation or directional influence of child , family and process of care variables on child 's psychosocial quality of life . longitudinal followup is needed to determine whether improvements in ccc , for example , can improve the psychosocial well - being of the child or if in fact providers need to engage actively those difficulties to reach families ( i.e. , families with low child psychql and poor parent mental health ) . these questions are also important in order that rehabilitation treatment efforts can be targeted and evaluated to include the needs of parents so that child quality of life can be maximized . sample size limitations did not allow the testing of interactions between all ecological factors and higher order interactions ( 3-way ) . also , quality of life data were parent - reported . generally , parents underestimate their child 's quality of life compared to child self reports . therefore , the associations and interactions may vary when child self report data are used . it was not feasible to obtain self - report data from this complex needs group due to the wide range of limitations present and budget constraints of the study . finally , clinically important change was difficult to quantify in this patient population . research to date has not determined the minimally important difference in a diverse group of children with complex needs . ecological factors explained 47% of the variance in child psychql in this complex needs child sample . it is not possible to fully understand child psychosocial quality of life in complex needs families by considering only simple associations between ecological factors . a multitude of environmental factors and interactions between these factors are simultaneously present and care of these families requires a holistic approach . further research is needed to confirm these trends particularly in special needs children of single parents with lower education levels , generally harder to reach . | purpose . to explore the associations and interactions among ecological factors and explain the psychosocial quality of life of children with complex needs
. methods . in this cross - sectional survey
consenting parents were identified by the children 's treatment network .
families were eligible if the child from 0 to 19 years , resided in simcoe / york , and there were multiple family needs .
regression analysis was used to explore associations and interactions .
n = 429 . results .
younger children , without conduct disorder , without hostile and punitive parenting and with low adverse family impact demonstrated the highest levels of psychosocial quality of life .
statistically significant interactions between processes of care and parent variables highlight the complexity of real life situations
. conclusions .
it is not possible to fully understand the child 's psychosocial quality of life in complex needs families by considering only simple associations between ecological factors .
a multitude of factors and interactions between these factors are simultaneously present and the care of these families requires a holistic approach . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
dentin makes up the bulk of the teeth along with other tissues such as enamel , cementum , and pulp . dental papilla cells differentiate to form dentin - pulp complex ; various types of cells are found in the dental pulp including odontoblasts , fibroblasts , and immune cells such as macrophages , granulocytes , and mast cells1 . the dental follicle can differentiate into cementoblasts , osteoblasts , and fibroblasts , which later produce cementum , alveolar bone , and periodontal ligament , respectively2 . strong nuclear factor i - c ( nfic ) expression was detected in the dental papilla and dental follicle during molar development in rats from postnatal day 5 to day 163 . nfic mice exhibited unique phenotypes , such as defective tooth root and incisors and decreased bone density and volume4 caused by aberrant odontoblast formation5 . the importance of nfi - c in tooth and bone formation was confirmed ; therefore , many studies have been conducted in order to elucidate the function of nfi - c and to determine how nfi - c plays a role in tooth and bone formation . this review will introduce several studies of signaling pathways and key factors correlated with the function of nfi - c in tooth and bone formation . the nuclear factor i ( nfi ) family of transcription factors plays pivotal roles in the development of the brain , lungs , muscles , and many other organs6 . nfi protein was first isolated from hela cell nuclear extract and was identified as a stimulator of adenovirus dna replication initiation7 and a transcription factor for many viral and cellular genes8 . five base pair spacer region in the middle regulates the nfi binding affinity9 and nfi proteins can bind to the ttggc and/or gccaa regions as a dimer or individually , with reduced binding affinity10 . by measuring the binding specificity of individual sites , nfi was found to be identical to the tggca - binding protein , which binds to chicken lysozyme 's enhancer region11 , and the caat box transcription factor , which binds to the caat box of the promoter region in multiple genes12 . subsequent studies found that nfi can also bind to the gene enhancer , promoter , and silence regions . in vertebrates , the nfi family of transcription factors consists of four members , nfi - a , nfi - b , nfi - c , and nfi - x813 . some of the features , such as high mortality rate and delayed glial and neuronal differentiation are commonly observed in mice deficient in nfi - a , nfi - b , and nfi - x141516 . nfi - b deficiency also causes defects in lung maturation17 , and nfi - x deficiency leads to skeletal defects18 . unlike other nfi family members , nfi - c nfi - c knockout mice showed reduced bone density and abnormal tooth formation , but no life - threatening defects were observed4 . odontoblasts are differentiated from the dental papilla cells that were derived from neural crest origin ectomesenchymal cells19 . epithelial - mesenchymal interaction induces the dental papilla cells to differentiate into odontoblasts during crown formation20 while hertwig 's epithelial root sheath ( hers ) cells drive the differentiation of the dental papilla cells into odontoblasts during root formation21 . when nfic mice were generated by removing the second exon of the nfic gene , which contains the binding and dimerization domain of the nfic gene , intriguing morphologies such as the formation of brittle and short mandibular incisors and abnormal maxillary incisors along with molars with no roots were observed4 . markedly different morphology of the nfic mice from that of the wild type mice in the root area suggested that the failure of hers formation may cause abnormal odontoblast differentiation in the nfic mice . however , during the tooth root formation , both groups of mice formed normal hers by the time crown formation was completed . aberrant , polygonal odontoblasts with no polarity were observed around the short and abnormal roots and labial crown analog of nfic mice . since crown formation occurs during the embryonic stage and root formation takes place postnatally , it was hypothesized that nfi - c plays a crucial role in odontoblast differentiation during postnatal tooth development and dentin formation during molar development , but not in hers5 . odontoblasts and dentin were observed in a more precise manner with electron microscopy to analyze the cause of defects in molars and incisors of nfic mice . compared to those of wild type mice , many of the aberrant odontoblasts of nfic - deficient mice were disorganized and round in shape . the cells were also trapped in an osteodentin - like mineralized tissue and showed no intracellular junctional complexes . these odontoblasts showed characteristics of apoptotic cells22 which can be defined as aggregated chromatin , formation of apoptotic bodies , and swollen mitochondria23 . localization and expression levels of several structural proteins , such as zonula occludens-1 ( zo-1 ) , occludin , e - cadherin ( e - cad ) , and connexin 43 ( cx 43 ) , which comprise the junctional complexes , were observed in vivo and in vitro . expression of zo-1 , occludin , and e - cad appeared to be decreased or absent , whereas that of cx 43 was observed consistently in both , wild type and nfic mice22 . zo-1 is a tight junction protein that can be found on the surface of cell membranes ; it acts as a scaffold protein for other tight junction strand proteins2425 . cx 43 , also called gap junction alpha-1 protein , composes gap junctions ( as the name suggests ) , allowing gap junction intercellular communication that regulates various cellular processes2627 . when e - cad ( a cell - adhesion glycoprotein ) is downregulated , cellular adhesion strength decreases and cellular motility increases , which then may help in the invasion of adjacent tissues ; this may result in cancer progression and metastasis2829 . this data suggested that nfi - c is involved in the formation of intercellular junctions , which occurs during the differentiation of odontoblasts from preodontoblasts30 . similar appearance of aberrant odontoblasts was observed in osteodentin , which is formed during dentin repair . when dentin is severely damaged and the odontoblasts are killed , the pulp cells differentiate into odontoblast - like cells to form reparative dentin2231 . since nfic mice and transforming growth factor 1 ( tgf-1 ) transgenic mice showed similar tooth morphologies , further investigation was conducted to identify the relationship between nfi - c and tgf- during odontoblast differentiation . the tgf- family consists of tgf- , activins , inhibins , and bone morphogenic proteins ( bmps)3233 . members of this family of growth factors contribute to various cellular processes such as proliferation , differentiation , embryonic development , and epithelial to mesenchymal interactions34 . one of the tgf- family members , tgf-1 , is known to promote cell growth arrest through the smad signaling pathway by activating the cyclin - dependent kinase inhibitor p213536 . in hela cells after tgf- treatment on the odontoblast - like cell line mdpc23 , nfi - c degradation increased in both , the cytosol and the nucleus . treatment with mg132 , a proteasome inhibitor , prevented the degradation of nfi - c by tgf-1 treatment . the increased mrna level and decreased protein level of nfi - c after the treatment with tgf-1 suggested that tgf- regulates nfi - c by degradation via 26s proteasome . in the primary pulp cells of nfic mice , the expression levels of tgf- , tgf- receptor type i ( tgf- ri ) , p - smad2/3 , and p21 appeared to be increased . overexpression of smad3 induced degradation of nfi - c , and silencing of smad3 inhibited the degradation of nfi - c by tgf-1 . when nfic was overexpressed , p - smad3 was dephosphorylated and lost its ability to form an nfi - c degradation complex with smad4 , inhibiting nfi - c degradation . therefore , smad ubiquitination regulatory factor ( smurf ) is an e3 ubiquitin - protein ligase that contributes to the degradation of smad protein , thereby negatively regulating tgf-/bmp signaling383940 . amongst several major mapk pathways , the jun n - terminal kinase ( jnk ) pathway is thought to be more likely involved in the interaction between nfi - c and smurf 1/241 since jnk inhibitor decreased the interaction , whereas p38 , another major mapk pathway , inhibitor did not affect the interaction between those two42434445 . in all , nfi - c is thought to be degraded by tgf-1 through the smad pathway with the aid of smurf 1/2 during early odontoblast differentiation . in the late stage of odontoblast differentiation and mineralization , nfi - c dephosphorylates p - smad2/3 in both the cytoplasm and the nucleus , and is translocated into the nucleus , binding its target gene 's promoter and regulating the gene expression42 . zinc deficiency also results in a similar tooth phenotype that is observable in nfic mice . zinc transporter slc39a13/zip13 transports zinc from the golgi apparatus to the cytosol , and therefore regulates intracellular zinc level . slc39a13/zip13-deficient mice were morphologically similar to nfic - deficient mice , in terms of skeletal disorders , reduced root dentin formation in the molars , and abnormal incisors46 . zinc is a trace element and regulates various processes in living organisms including cellular metabolism , growth , replication , and tissue repair47 . maintaining the appropriate zinc level is crucial since zinc deficiency causes impairment of brain functions and immune responses , while an excessive amount of zinc can cause apoptosis and neuronal death4849 . after zinc treatment of the mdpc23 cell line , the nuclear translocation of p - smad2/3 , metallothioneins ( mt-1 ) , and metal transcription factor-1 ( mtf-1 ) were increased , whereas no marked change was observed in nfi - c localization . when tpen , a zinc chelator , was used , translocation of nfi - c into the nucleus increased . mtf-1 is a transcription factor that contains six zinc fingers in the dna binding domain . when zinc is present , mtf-1 binds to dna motifs such as metal response elements ( mres ) in the promoter region of mt genes and increases the transcription of mt505152 . nfi - c is known to bind to overlapping regions of mre sites53 . during the early odontoblast differentiation period , adequate amount of zinc promotes nuclear translocation of mtf-1 and phosphorylation of smad2/3 in the cytoplasm in a dose dependent manner . mtf-1 , a transcriptional activator of mt-1 , increased mt-1 transcription and induced nfi - c degradation simultaneously through the tgf- pathway . during the late stage of odontoblast differentiation , nfi - c acts as a transcriptional repressor of mt-1 and enhancer of dentin sialophosphoprotein ( dspp ) promoter , accelerating differentiation and mineralization of odontoblasts54 . krppel - like factor 4 ( klf4 ) is a member of specificity protein / klf ( sp / klf ) transcription factor family55 . this family of transcription factors is characterized by three zinc finger motifs in the carboxyl terminal sequences56 . klf4 participates in various cellular processes such as cell proliferation , differentiation , cell growth , and maintenance of normal tissue homeostasis57 . several members , including klf17 and klf4 , are known to control epithelial - mesenchymal interactions58 . klf4 is also known to regulate odontoblast cell proliferation and differentiation via control of dentin matrix protein 1 ( dmp1 ) , dspp , and alkaline phosphatase ( alp ) expression5960 . nfi - c is also known to control dspp expression in odontoblasts ; klf4 expression and protein level decreased significantly in the nfic mice compared to the wild type mice . therefore , the relationship between nfi - c and klf4 during odontoblast differentiation was investigated . the binding of nfi - c to 980 region of klf4 promoter was confirmed , which lead to increased expression of klf4 , dmp1 , and dspp . when nfic was silenced , the expression of those genes decreased significantly . overexpressing or silencing klf4 affected only the expression levels of dmp1 and dspp , but klf4 binds to dmp1 promoter , and dmp1 binds to dspp promoter to increase its transcription61 ; therefore , the nfic - klf4-dmp1-dspp pathway was suggested62 . although odontoblasts are cells of mesenchymal origin , they exhibit epithelial cell - like characteristics as they differentiate . when mdpc-23 cells were transfected with nfic expressing vectors and cultured in osteogenic medium , they became tightly packed like patches of epithelial cells , and actin fibers rearranged to the outer surfaces of the cells . expression of e - cad , a mesenchymal - epithelial transition ( met ) marker , and n - cadherin , an epithelial - mesenchymal transition ( emt ) marker , were observed during the differentiation . expression of e - cad and nfi - c increased , and n - cad , tgf-1 , tgf- ri decreased as differentiation progressed , which corresponded to the result of the study that investigated the relationship between nfi - c and tgf-. combining all the studies , it was confirmed that nfi - c controls odontoblast differentiation and mineralization through the nfic - klf4-dmp1-dspp pathway , and also contributes to met induction via the nfic - klf4-e - cad cascade62 . osteoblasts and adipocytes differentiate from the same progenitor , bone marrow stromal cells ( bmscs ) . many proteins and signaling pathways are involved in the differentiation and cell fate determination of bmscs . proteins such as tgf- , bmp , hedgehog , runx2 , osterix ( osx ) , and -catenin are reported to contribute to osteogenesis . adipogenesis is regulated by many factors such as peroxisome proliferator - activated receptor gamma ( ppar ) , ccaat / enhancer - binding protein ( c / ebp) , and c / ebp. nfi - c serves as one of the critical factors for postnatal bone formation and osteogenic cell differentiation . the expression pattern of nfic in mice was observed from the embryonic stage until postnatal week 60 . significant increase in nfic mrna level was observed from postnatal day 16 ( p16 ) to 6 weeks , and then the mrna level gradually decreased from 6 weeks until 60 weeks . in vitro results from mice bmscs and mc3t3-e1 , a mouse osteoblast precursor cell line , also showed a similar pattern an increased level of nfic mrna during the early stages of osteoblast differentiation ( day 4 to day 10 ) and decreased nfic mrna level during the late stages of osteoblast differentiation and mineralization ( day 10 to day 21 ) . along with the delayed tooth root development , nfic mice showed reduced bone volume and thickness for both cortical and trabecular bones , and decreased bone mineral density compared with those of wild type mice . since prenatal bone development was not affected by nfic deficiency , it was suggested that nfi - c controls bone formation during the postnatal stages , and not in the prenatal stages . nfic mice showed decreased number of osteoblasts and proliferation rate , which possibly impaired osteoblast function during bone formation . in vitro studies suggested that the decrease was not due to the osteoclast activity , since in vivo results showed no difference in the number of osteoclast in nfic and wild type mice . in fact , the expression of receptor activator of nuclear factor kappa - b ligand ( rankl ) was decreased in nfic mice . when rankl binds to its receptor , rank , osteoclast activation and differentiation is induced . osteoprotegrin ( opg ) is secreted by osteoblasts , and binds to rank , inhibiting rankl from binding to its receptor and therefore inhibiting osteoclast formation . nfic mice showed normal opg but decreased rankl expression , suggesting that decrease in the number of osteoblasts and bone formation is not caused by osteoclast activation . on the other hand , in vitro results with nfic bmscs showed an increase in the number of oil red - o positive cells and increased expression of adipocyte differentiation marker , ppar. this coincides with the observation from bone sections of osteoporotic patients , which showed decreased nfic expression and increased number of adipocytes . nfic overexpression in nfic bmscs showed increased alp expression and mineralized nodule formation when cultured in odontogenic differentiation media . in adipogenic differentiation media , cells showed significantly decreased number of oil red - o positive cells along with the expression of ppar. to investigate whether nfi - c could rescue impaired bone formation , nfic - overexpressing bmscs were transplanted into femur cavities of nfic mice . increased trabecular bone volume and number and decreased bone marrow adiposity were observed , along with the osteoblast differentiation from the transplanted bmscs . when bmscs overexpressing osx were transplanted in the same manner , partial rescue of bone formation bmp-2 is known to regulate osteogenic transcription factors such as runt - related transcription factor 2 ( runx2 ) , dlx5 , msx2 , and osx , therefore modulating osteogenesis636465 . the results confirmed that nfic promoter had a binding motif for runx2 , and runx2 directly bound to that site in vitro . an in vivo study showed that nfic expression decreased through bmp-2 pathway in runx2 mice66 . results from in vivo and in vitro studies demonstrated that runx2 acts as an upstream regulator of nfic . age - related osteoporosis patients exhibit increased bone adiposity and decreased bone formation due to impairment in osteoblast activity and differentiation . in vitro results using nfic mice bmscs also showed decreased osteoblast differentiation and increased formation of oil red - o positive cells . since the osteoblasts and adipocytes differentiate from the same progenitor cell , bmscs , the formation of osteoblasts and adipocytes could be inversely proportional . finding a key factor or pathway that is capable of shifting bmsc differentiation toward the formation of osteoblasts rather than adipocytes could be a novel candidate for treatment of age - related osteoporosis66 . canonical wnt signaling pathway regulates mesenchymal cell fate67 . during adipocyte differentiation , c / ebp and c / ebp are upregulated , stimulating the expression of c / ebp and ppar that in turn promote the expression of adipocyte specific genes68 . c / ebp binds to the promoter region of wnt10b , one of the wnt ligands , inhibiting its expression . as a result , wnt10b suppresses the expression of c / ebp and ppar to shift the mesenchymal cell fate towards osteoblasts70 . therefore , wnt signaling needs to be suppressed during adipogenesis , and activated during osteogenesis7172 . -catenin is a protein with a dual function ; it is a cell adhesion molecule73 and a transducer within the canonical wnt pathway7475 . when wnt ligands bind to the receptor complex of frizzled and low - density lipoprotein receptor - related protein 5/6 , -catenin gets accumulated in the cytosol and translocated into the nucleus . in the nucleus , -catenin controls its target gene expression and cellular differentiation . tissue specific inactivation of -catenin in mice leads to the tooth phenotype that is very similar to that of nfic mice76 . in vitro studies also demonstrated that -catenin deficiency causes the shift of preosteoblast cell fate from osteoblast to adipocyte67 . in nfic mice , the level of -catenin expression decreased significantly , and the silencing of -catenin using sirna resulted in the decreased expression of nfic
in vitro ( unpublished data ) . a recent study suggested that nfi - c regulates adipocyte and osteocyte differentiation through the nfic - wnt - runx2-osx pathway77 however , further investigations should be conducted to explain a previous study that reported that changes in nfic expression have no effect on the runx2 expression level66 . the c / ebp family of transcription factors and nfi - c have the same binding motif , ccaat978 . c / ebp , , and are known to play important roles in adipocyte differentiation , and nfi - c inhibits adipogenesis ; therefore , it is also possible that competitive binding between c / ebp family members and nfi - c might determine the mesenchymal cell differentiation , thereby promoting or inhibiting osteoblast and odontoblast differentiation . even though nfi - c is one of the key transcription factors that induces odontoblast and osteoblast differentiation , its expression has to be precisely up- or down - regulated throughout the differentiation period in order to generate natural bone and tooth . the mechanism of maintenance of nfic expression at an appropriate level throughout the differentiation period is still unknown . further understanding of nfi - c and other factors of odontogenesis and osteogenesis will lead to the advancement of oral and maxillofacial regenerative therapies . | nuclear factor i - c ( nfi - c ) plays a pivotal role in various cellular processes such as odontoblast and osteoblast differentiation .
nfic - deficient mice showed abnormal tooth and bone formation .
the transplantation of nfic - expressing mouse bone marrow stromal cells rescued the impaired bone formation in nfic-/- mice .
studies suggest that nfi - c regulate osteogenesis and dentinogenesis in concert with several factors including transforming growth factor-1 , krppel - like factor 4 , and -catenin .
this review will focus on the function of nfi - c during tooth and bone formation and on the relevant pathways that involve nfi - c . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a 33-year - old black man was transferred to our hospital with acute chest pain , and suspicion of pulmonary embolism . his past medical history revealed severe uncontrolled essential hypertension associated with noncompliance with medication and appointments , severe left ventricular hypertrophy ( lvh ) , hypertensive nephrosclerosis with estimated glomerular filtration rate of 35 ml / min/1.73 m , mild ascending aorta ectasia ( up to 4.2 cm ) , sickle cell trait , and appendicectomy . he presented with moderately severe chest and upper abdominal pain radiating to the back , which had begun acutely a few hours before consulting . the pain was pleuritic on the right side of the chest and associated with mild shortness of breath . on physical examination , temperature and blood oxygen saturation were normal . blood pressure was 172/85 mmhg in left arm and 176/89 mmhg on the right side . heart rhythm was regular with a ii / vi diastolic murmur best heard at the lower right parasternal border . he had mild discomfort when palpating his upper abdomen , but it was soft without defense . lab results showed normal cardiac enzymes , slightly elevated white blood cell count , stable creatinine ( 290 mol / l or 3.28 mg / dl ) and marked positive d - dimer ( 4671 ng / ml ) . ekg showed signs of left ventricular hypertrophy ( lvh ) and nonspecific st - t wave changes . the first chest x - ray was read as normal by the radiologist except for cardiomegaly ( figure 1 ) . pulmonary embolism was the initial working diagnosis and a contrast computed tomography ( ct ) scan was ordered but then cancelled because of the risk of contrast - induced nephropathy . instead , a ventilation - perfusion pulmonary scintigraphy was performed and was negative for pulmonary embolism . on the second day in the hospital , a transthoracic echocardiography revealed severe left ventricular hypertrophy , normal left and right ventricular kinetics , mild to moderate aortic regurgitation , and no pericardial effusion . because of the upper abdominal pain , he was scheduled for an upper gastrointestinal tract endoscopy to rule out peptic ulcer disease . on the fifth day of hospitalization , the patient started to present a pericardial friction rub . a few hours later , the patient had increasing shortness of breath and a second chest x - ray showed mild bilateral pleural effusions ( figure 2 ) . the autopsy revealed a massive cardiac hemorragic tamponade from a ruptured retrograde aortic dissection that extended down to the iliac arteries and severe lvh . these findings suggested acute retrograde dissection and rupture in the pericardial space complicating a chronic antegrade aortic dissection associated with severe hypertension . we all know that aortic dissection ( aod ) is by far the most common and the most serious condition of the aorta . the associated mortality rate is about 1%3% per hour with 20%30% of deaths occurring in the first 24 hours and roughly 80% in 2 weeks.1 although it is very uncommon with an incidence estimated from 5 to 30 cases per million population yearly in the united states according to the international registry of aortic dissection ( irad ) , compared with an estimated 4400 cases per million yearly for acute myocardial infarction , it remains a critical medical condition that necessitates prompt diagnosis for proper life - saving treatment . chest pain is by far the most common presenting symptom , being present in 75% of patients . in 85% of patients , the pain is abrupt and severe.2,3 the classical description of tearing pain is only present for 51% of patients ; most describe it as sharp or stabbing.3 however , 5%15% of patients get to the emergency department without any pain.24 other clinical presentations include hypertension ( 32%49% ) , aortic regurgitation ( 32%45% ) , pulse deficit or limb ischemia ( 15%26% ) , syncope ( 9%13% ) , shock and/or tamponade ( 8%18% ) , hypotension without shock ( 8%14% ) , heart failure usually due to acute aortic regurgitation ( 6% ) , focal neurological deficits ( 5%8% ) and pericardial friction rub ( 2%).2,3 even fever of unknown origin has been described as the initial presentation of an aod.5 diagnosis is missed at presentation in up to 38% of patients and found at postmortem ( without any prior known or suspected cause of death ) in 28% of them.2,4 conditions associated with aod are hypertension ( 72% ) , male sex ( 65% ) , older age ( mean age : 63 years old ) , atherosclerosis ( 31% ) , known aortic aneurysm and previous cardiovascular surgery or aortic dissection ( < 20% ) , marfan syndrome ( 5% ) , vascular ehlers - danlos syndrome , loeys- dietz syndrome , turner syndrome , bicuspid aortic valve , familial form of aortic aneurysm / dissection , large vessel vasculitis , pregnancy , and cocaine use ( < 1%).2,3,6 recognizing this condition may be difficult , but clinicians can count on several tools to help them diagnose aod . some are easily available , such as chest x - ray and electrocardiogram ( ekg ) , but their specificity and sensitivity are very low . again , according to the irad and the american heart association ( aha ) guidelines , a chest x - ray was ordered in 100% of patients who were finally diagnosed with an aod , but 10%12% were normal and only 60% had the characteristic mediastinal widening ( figure 3).2,3 some nonspecific findings like abnormal aortic contour ( 50% ) and abnormal cardiac contour ( 26% ) may be noticeable on x - rays.2 thirty- one percent of ekgs were normal , 41% had nonspecific st - t changes , 26% had left ventricular hypertrophy , and 15% showed signs of ischemia.2 table 1 shows the imaging modalities that can be used to diagnose aod , with their reported sensitivity and specificity and appendix 1 shows the diagnostic algorithm ( adapted version ) for aod from the aha 2010 guidelines.2,3,7,8 ct scanning with iv contrast is the most frequent imaging modality used because of its availability , its lower reliance on operator skills , and its current improved accuracy and shorter acquisition time compared with the older ct scans , with good sensitivity and specificity.7 transthoracic echocardiography shows variable sensitivity possibly owing to operator skills . transesophageal echo shows very good sensitivity and specificity when available and does not require contrast agent . magnetic resonance imaging appears to be the best imaging study for aod , but is not widely available , needs a trained radiologist to interpret the images , and image acquisition is slower than in other diagnostic methods . aortography was once the gold standard imaging modality , but its invasiveness now makes it obsolete except in special circumstances . aod in young adults remains an unexpected cardiovascular catastrophe . according to irad study results , only 7% of all aod occurred in people < 40 years of age.9 of these , 50% had marfan syndrome ( compared with only 2% of the > 40 years cohort ) , 9% had bicuspid aortic valve ( 1% in the > 40 years cohort ) , 12% had prior aortic valve replacement , and 3% were women in the peripartum period.9 these risk factors were significantly more frequent than in the older age group.9 however , clinical presentations were similar in both groups , pain , blood pressure variation ( high or low ) and diastolic murmur being the most common clinical findings . the only noticeable difference is that older people experienced more hypertensive episodes than young people.9 surprisingly , there is no difference in survival rates between the two groups . mortality rate was 22% in young patients and 24% in older patients.9 tamponade ( 15% vs 12% ) , myocardial ischemia/ infarction ( 6% vs 9% ) and acute kidney injury ( 13% vs 18% ) were among the other complications of aod , without any significant difference between the two groups.9 an interesting finding of the irad database is that younger people were much more likely to have prior aortic dilation , without any known connective tissue disease.9 the measurements of several aortic parts showed a significantly more frequent dilation of these portions of the aorta prior to dissection , than in the older group.9 thus we should include aod in our differential diagnosis of young patients with chest pain and known aortic dilation ( even mild ) . an interesting concept is emerging in the approach to suspected aod and the use of d - dimer testing as a screening test for aod . the use of d - dimer testing is well known for excluding pulmonary embolism due to its high sensitivity , and every physician knows that elevated d - dimers should raise at least a mild suspicion for pulmonary embolism.10 some studies have been published on the use of d - dimer testing to rule out aod . reported sensitivity of d - dimer testing in the setting of suspected aod is 100% and its degree of elevation even showed a trend toward extension of the dissection but not with the outcomes.11,12 even if it is not in the actual guidelines of aod diagnostic algorithm , the use of d - dimer testing seems to be a good and reliable marker to rule out aod in our differential diagnosis for patients presenting with acute chest pain . further investigations with larger study populations should be done to assess the real utility of this biomarker , in ruling out this morbid condition . chest pain is by far the most common presenting symptom , being present in 75% of patients . in 85% of patients , the pain is abrupt and severe.2,3 the classical description of tearing pain is only present for 51% of patients ; most describe it as sharp or stabbing.3 however , 5%15% of patients get to the emergency department without any pain.24 other clinical presentations include hypertension ( 32%49% ) , aortic regurgitation ( 32%45% ) , pulse deficit or limb ischemia ( 15%26% ) , syncope ( 9%13% ) , shock and/or tamponade ( 8%18% ) , hypotension without shock ( 8%14% ) , heart failure usually due to acute aortic regurgitation ( 6% ) , focal neurological deficits ( 5%8% ) and pericardial friction rub ( 2%).2,3 even fever of unknown origin has been described as the initial presentation of an aod.5 diagnosis is missed at presentation in up to 38% of patients and found at postmortem ( without any prior known or suspected cause of death ) in 28% of them.2,4 conditions associated with aod are hypertension ( 72% ) , male sex ( 65% ) , older age ( mean age : 63 years old ) , atherosclerosis ( 31% ) , known aortic aneurysm and previous cardiovascular surgery or aortic dissection ( < 20% ) , marfan syndrome ( 5% ) , vascular ehlers - danlos syndrome , loeys- dietz syndrome , turner syndrome , bicuspid aortic valve , familial form of aortic aneurysm / dissection , large vessel vasculitis , pregnancy , and cocaine use ( < 1%).2,3,6 recognizing this condition may be difficult , but clinicians can count on several tools to help them diagnose aod . some are easily available , such as chest x - ray and electrocardiogram ( ekg ) , but their specificity and sensitivity are very low . again , according to the irad and the american heart association ( aha ) guidelines , a chest x - ray was ordered in 100% of patients who were finally diagnosed with an aod , but 10%12% were normal and only 60% had the characteristic mediastinal widening ( figure 3).2,3 some nonspecific findings like abnormal aortic contour ( 50% ) and abnormal cardiac contour ( 26% ) may be noticeable on x - rays.2 thirty- one percent of ekgs were normal , 41% had nonspecific st - t changes , 26% had left ventricular hypertrophy , and 15% showed signs of ischemia.2 table 1 shows the imaging modalities that can be used to diagnose aod , with their reported sensitivity and specificity and appendix 1 shows the diagnostic algorithm ( adapted version ) for aod from the aha 2010 guidelines.2,3,7,8 ct scanning with iv contrast is the most frequent imaging modality used because of its availability , its lower reliance on operator skills , and its current improved accuracy and shorter acquisition time compared with the older ct scans , with good sensitivity and specificity.7 transthoracic echocardiography shows variable sensitivity possibly owing to operator skills . transesophageal echo shows very good sensitivity and specificity when available and does not require contrast agent . magnetic resonance imaging appears to be the best imaging study for aod , but is not widely available , needs a trained radiologist to interpret the images , and image acquisition is slower than in other diagnostic methods . aortography was once the gold standard imaging modality , but its invasiveness now makes it obsolete except in special circumstances . aod in young adults remains an unexpected cardiovascular catastrophe . according to irad study results , only 7% of all aod occurred in people < 40 years of age.9 of these , 50% had marfan syndrome ( compared with only 2% of the > 40 years cohort ) , 9% had bicuspid aortic valve ( 1% in the > 40 years cohort ) , 12% had prior aortic valve replacement , and 3% were women in the peripartum period.9 these risk factors were significantly more frequent than in the older age group.9 however , clinical presentations were similar in both groups , pain , blood pressure variation ( high or low ) and diastolic murmur being the most common clinical findings . the only noticeable difference is that older people experienced more hypertensive episodes than young people.9 surprisingly , there is no difference in survival rates between the two groups . mortality rate was 22% in young patients and 24% in older patients.9 tamponade ( 15% vs 12% ) , myocardial ischemia/ infarction ( 6% vs 9% ) and acute kidney injury ( 13% vs 18% ) were among the other complications of aod , without any significant difference between the two groups.9 an interesting finding of the irad database is that younger people were much more likely to have prior aortic dilation , without any known connective tissue disease.9 the measurements of several aortic parts showed a significantly more frequent dilation of these portions of the aorta prior to dissection , than in the older group.9 thus we should include aod in our differential diagnosis of young patients with chest pain and known aortic dilation ( even mild ) . an interesting concept is emerging in the approach to suspected aod and the use of d - dimer testing as a screening test for aod . the use of d - dimer testing is well known for excluding pulmonary embolism due to its high sensitivity , and every physician knows that elevated d - dimers should raise at least a mild suspicion for pulmonary embolism.10 some studies have been published on the use of d - dimer testing to rule out aod . reported sensitivity of d - dimer testing in the setting of suspected aod is 100% and its degree of elevation even showed a trend toward extension of the dissection but not with the outcomes.11,12 even if it is not in the actual guidelines of aod diagnostic algorithm , the use of d - dimer testing seems to be a good and reliable marker to rule out aod in our differential diagnosis for patients presenting with acute chest pain . further investigations with larger study populations should be done to assess the real utility of this biomarker , in ruling out this morbid condition . we should always keep in mind that aod is a possible diagnosis even in the young population . although it is not frequent , assessing risk factors and high risk clinical features for that condition should be done promptly in a patient complaining of acute chest or abdominal pain in order to make the proper diagnostic exam , because of fatalities associated with that condition if not treated quickly . maybe d - dimer testing could be an interesting biomarker to rapidly and easily rule out this potentially fatal condition . | aortic dissection is often misdiagnosed , especially among young patients , and it is associated with a high mortality rate .
we present here a case of fatal acute aortic dissection in a young man who was misdiagnosed with pericarditis .
we reviewed the literature of acute aortic dissection in young people and we focused particularly on clinical presentations , outcomes and investigations of aortic dissection .
we report a case of a 33-year - old man with a history of uncontrolled hypertension with acute pleuretic chest pain who was transferred to our hospital for suspected pulmonary embolism and died of acute hemorragic pericardial effusion from an ascendant aortic dissection .
we should never rule out aortic dissection off our differential diagnosis on the sole basis of a patient s young age . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
most microbial pathogens , their vectors and host reservoir species are sensitive to climatic conditions , which impose limits on the geographic range , seasonality , and transmission efficiency of infectious disease . climate thus determines where and when a particular infectious disease could occur ; but a diversity of other , often localised , factors environmental , social , cultural , and technological factors , along with public health practices determine where the infectious disease will actually occur . outdoor workers are especially at risk of vector - borne disease and , as the global climate changes , they may be exposed to vector - borne diseases in areas and at times where transmission was previously not possible . in addition , changes in daily work activities due to increased heat , such as longer rest periods in the middle of the day and increased work at dawn and dusk , may coincide with the times when insect vectors are most active thus increasing the likelihood of disease transmission ( 46 ) . there is already suggestive scientific evidence that the geographic range and prevalence of some vector - borne diseases are changing in response to regional changes in climate , especially rises in temperature and changes in rainfall . in china , long a scourge of rural communities and farm - workers has recently re - emerged in areas where it was previously eradicated , thought to be associated with the spread of suitable habitats for the intermediate host snail oncomelania hupensis in response to regional warming ( 79 ) . schistosomiasis is predicted to spread northwards into currently non - endemic areas as the 01c isotherm moves further north due to climate change and , thus , expands the potential habitat range of the intermediate host snail ( 810 ) . domestic water buffalo and cattle are an important reservoir host for schistosomiasis and are commonly used for ploughing and carrying loads by farmers in china . the animals often forage freely in areas where schistosomiasis is endemic , so re - infection commonly occurs in treated animals , which then excrete the parasite back into the water for uptake by the snails . in most endemic areas , over 70% of the environmental contamination can be traced back to bovine defecation ( 11 ) . farmers , therefore , have an increased risk of exposure to schistosomiasis , via the parasite life - stage released by the snails in the water and soil of their paddocks , which is amplified by contamination of drinking water and irrigation supplies by their livestock . in japan , the distribution of aedes albopictus ( the mosquito species that transmits dengue fever ) has been advancing northwards over recent decades , thought to be associated with higher autumn mean temperatures that promote larvae development and warmer annual mean temperatures that encourage expansion of adult mosquitoes during summer ( 12 ) . meanwhile , dengue itself has been recently reported to be spreading in taiwan in association with local climatic trends ( 13 ) . the prevalence of leishmaniasis ( a sandfly - transmitted parasite with many animal reservoirs ) in colombia has been previously shown to differ by season , but more recently , prevalence has been shown to also vary between el nio and la nia events ( 14 ) . another recent observation is the presence of a tropical fungus , cryptococcus gattii , in the temperate pacific northwest region of north america a fungus that causes meningitis , pneumonia , and tumour - like lesions in humans with a reported case - fatality rate of 9% . analyses indicate that this was a case of emergence in a totally new geographic range for the fungus , suggesting that a warming climate may have created suitable conditions in a previously unsuitable habitat that have allowed the spores to persist and propagate ( 15 , 16 ) . local environmental conditions are important determinants of vector - borne disease distribution through their action on the host species , intermediate vertebrate hosts ( where applicable ) , and vector organisms , especially mosquitoes . as temperature rises , pathogens such as the malaria plasmodium and dengue virus mature more quickly within the mosquito , while the mosquitoes themselves breed more prolifically and feed more often , thus increasing the likelihood and speed of transmission to humans . vectorial capacity ( a measure of how fast an outbreak can spread ) also increases exponentially throughout the transmission season . therefore , a small change in temperature that brings forward the beginning of the transmission season or lengthening of the rainy season ( which is the breeding period for mosquitoes ) could have a great effect on mosquito numbers and , therefore , on the resultant risk of disease occurrence ( 17 ) . changes in the geographic ranges and seasonality of vector - borne infectious diseases will thus have important health and productivity consequences for many working populations . outdoor workers are already at a higher risk of vector - borne infections than most other workers because of their proximity to vector species and their habitats . the risk of transmission will also increase under climate change as the number of vectors increases and transmission becomes more efficient . vector - borne diseases are already responsible for considerable losses in economic productivity every year , primarily in those regions where a vector - borne disease is endemic such as malaria in africa . the impacts of endemic vector - borne disease begin with a workforce that is less healthy and less physically capable of working , increasing the number of work days lost to ill health . this reduces primary economic productivity , with flow - on effects on other important economic sectors such as tourism and trade at local , regional , and national scales . endemic vector - borne disease has been associated with substantial negative impacts on long - term economic development in many regions in africa and asia , with macroeconomic studies estimating the growth rate of the gross domestic product ( gdp ) in malaria - endemic regions to be 0.251.3% per year lower than regions without malaria . over 25 years this can amount to almost half of the per capita gdp in poor countries ( 18 ) . in addition , some vector - borne diseases have lingering health effects that will reduce the ability of an individual to work , and work productively , over extended timeframes ( perhaps permanently ) . in particular , childhood infection can often have major effects on health and well - being in adult life , with reduced physical and cognitive abilities that may further reduce the potential workforce size and thus future production . this ancient vector - borne disease is endemic to much of africa and has had a profound impact on local social and economic development . studies in sub - saharan africa have shown that , in addition to high mortality rates ( of around 20% ) , childhood malaria is also associated with long - term neurological and cognitive impairments in around 25% of those who survive ( 1921 ) , including physical handicaps , hearing loss , and impaired higher order cognitive functions ( such as planning and decision making ) ( 21 ) . further impairments may emerge later in life as a result of brain injury during early developmental stages . physical handicaps reduce a person 's ability to contribute to domestic tasks such as cooking , cleaning and planting crops , whilst increasing the burden on caretakers , and minor cognitive deficits may become increasingly profound as children mature and the tasks required of them become more complex and demanding ( 21 ) . furthermore , chronic infection , frequent illness , and malnutrition will exacerbate the negative impacts of childhood malaria , with additional loss of adult function and abilities ( 21 ) . in adults , chronic malaria results in anaemia , which markedly reduces worker productivity and output ( 18 , 22 ) . various mining , agriculture , and manufacturing industries have been seriously impaired by worker populations with a high disease burden . in addition , companies are wary of investing and working in areas where malaria is endemic ( for fear of catching the disease ) and when imported workers from malaria - free areas have no acquired immunity to the more severe effects of malaria ( 22 ) . beyond these immediate impacts ( including medical costs , lost incomes , and decreased productivity ) , malaria imposes economic effects via two other broad mechanisms . first , the social costs include high childhood mortality rates ( which leads to changes in the population - age structure ) , lower education levels ( including deficits in cognitive function ) , decreased personal accumulation of capital , and the potential for population migration . second , at the macroeconomic scale , malaria indirectly imposes substantial losses through decreased trade , tourism , and foreign investment . in turn , the health of the workforce at large is influenced by both of these impact pathways and , thus , the potential spread of malaria ( and other vector - borne diseases ) under future climate change poses a substantial threat to many developing nations around the globe . climatic conditions also affect the patterns of occurrence of many non - vector - borne infectious diseases . campylobacter infections , derivied from animal species and often then transmitted via contaminated water , show seasonal differences in transmission rates , with warmer winters advancing the spring transmission peak to earlier in the year ( 23 ) . climate - induced changes in water quality , availability , and salinity , as well as local temperature and humidity are also closely linked to the spatial and temporal patterns of vector - borne and water - borne diseases , and environmental changes may be reflected in changing epidemics and outbreaks of endemic diseases , such as cholera in india and bangladesh ( 24 ) and haemorrhagic fever with renal syndrome in china ( 25 , 26 ) . the prevalence of diarrhoeal diseases in developing countries is high and is responsible for an estimated 7% of all deaths in developing countries , second only to malnutrition ( 27 ) . diarrhoeal diseases are strongly linked to poor hygiene and sanitation practices , and lack of infrastructure , especially the contamination of food and water supplies through unregulated disposal of human excreta . environmental transmission is less common as many of these microorganisms are not robust enough to survive for long outside the host ( 28 ) . however , future climate change is likely to generate circumstances and events that markedly increase the transmission of disease . climate change is likely to affect the replication , survival , persistence , and transmission of various microorganisms that cause diarrhoeal disease . cholera , shigella , salmonella , campylobacter , noroviruses , enteroviruses , rotaviruses , cryptosporidium , and giardia often show seasonal infection patterns that strongly suggest underlying environmental influences that include rising temperatures , changing rainfall , and movements in the geographic ranges of host or reservoir species ( 29 ) . in addition , extreme weather events enhanced by climate change , such as widespread flooding , substantially increase the risks of drinking water and food crops being contaminated with human faecal matter . these circumstances are likely to pose risks particularly to working populations in low - income settings with minimal hygiene facilities . cholera is endemic in many developing countries and is especially sensitive to changes in aquatic environments ( water temperature , salinity , ph , and amount of rainfall ) , which are strongly affected by changes in local climate . rising temperatures are also important , as the optimal temperature for microorganism growth is 3040c ( 24 , 30 ) . outbreaks and endemic diarrhoeal disease are already a major source of lost work days , especially in developing countries . diarrhoeal disease imposes a significant financial impact on households through the direct costs of medical treatment and lost work days . furthermore , these costs are incurred regardless of which family member is sick , through the costs of health care , infection of other family members , and loss of income when caring for a sick child or relative ( 28 , 31 ) . morbidity and mortality from diarrhoeal disease is heavily focused on children . in south africa , approximately 70% of cases and 90% of deaths from diarrhoeal disease are infants and children ( 28 ) . typically , the household income is then reduced when parents stay home from work to care for sick children . the indirect costs of diarrhoeal disease include declines in long - term health and ability to work due to recurrent adult disease , physical and cognitive impairments associated with childhood infection and school absenteeism , rising household debt when loans are needed to pay for treatment , social disruption ( especially from high childhood mortality rates ) , and lost economic opportunities for household income from work , as well as macroeconomic costs from lost trade and tourism ( 27 , 28 , 31 ) . in the future , under conditions of climate change and especially if superimposed on persistent poverty , developing countries will continue to carry a high burden of unwell and poorly educated workers who are unable to contribute to their full potential . the potential threat from diarrhoeal diseases in developed countries ( with , currently , clean water supplies , good public hygiene , and sanitation infrastructure ) is also likely to be increased by future climate change . in particular , extreme weather events may be enhanced in frequency and/or severity by climate change , leading to the overload of municipal stormwater and sewage systems and to reduced public hygiene via , for example , the overflow of effluent into drinking supplies and recreational facilities such as pools , lakes , and rivers ( 32 ) . emergency response workers , especially those connected with sanitation and water infrastructure , are particularly at risk of infection due to their close proximity to the source and their immediate response to the emergency before testing for the presence of microbes is conducted . the removal of emergency response personnel from the workforce in emergency situations may have strong detrimental effects on the health and well - being of all residents and also increase the demand on public health sectors at a critical time . the impacts of extreme weather events on diarrhoeal diseases may not be confined to a single city . for example , following the evacuation of new orleans ( louisiana , usa ) during hurricane katrina , outbreaks of gastroenteritis were seen in evacuees and relief workers across four states ( not including louisiana ) ( 33 ) . furthermore , the interconnectedness of modern society means that diarrhoeal diseases from distant locations where pathogens thrive and there is minimal sanitation and hand - washing facilities for workers can be transmitted to unsuspecting populations elsewhere . for example , about 200 cases of escherichia coli across the united states were linked to bagged fresh spinach from a single farm , where unusual weather conditions had contaminated the groundwater ( which was used for crop irrigation ) with animal faeces ( 15 ) . it is estimated that 6080% of emerging pathogens are zoonotic in origin ( 3437 ) . the incidence of these events is often influenced by climate - related changes in the density and movement of reservoir animal species due to habitat disruption and population displacement . ongoing climate change may be accompanied by more frequent zoonotic infections as well as the emergence and spread of new zoonotic infections . many existing and emerging zoonotic diseases can be traced back to human - induced ecological disturbances . in particular , deforestation ( for crop and livestock farming ) , road construction , water control systems ( dams , irrigation systems , and reservoirs ) , and human settlements disrupt the ecological niches of infectious agents , their hosts , and vector species ( 38 ) . workers involved in these industries are particularly at risk of novel zoonotic infection as they are literally on the front line where contact , and conflict , between humans and wild animal species is most likely to occur . emerging zoonotic infections are also more likely in poor and refugee populations who may turn to bushmeat hunting for food and income ( 15 ) . although the links to climate change are indirect , the example of nipah virus is a strong warning of the potential for new zoonotic disease outbreaks as future climate change alters animal habitats and human activities intrude . the previously unknown nipah virus emerged in malaysia in the late 1990s after large tracts of rainforest were cleared for commercial forestry , agricultural crops , and large - scale intensive pig farming ( 39 ) . the outbreak infected more than 300 workers who had direct contact with infected pigs and more than 100 died . over one million pigs the most likely reservoir was discovered to be fruit bats or flying foxes from neighbouring forests that may have been displaced by some combination of human activities and unusually dry conditions during the severe el nio event of 19971998 , which also brought widescale forest fires ( 39 , 40 ) . projected increases in the frequency and severity of quasi - cyclical climatic events such as the el nio ( enso ) oscillation under future climate change conditions , with the associated changes in habitats and food supplies for animal species , may increase the risk of displaced animal populations coming into contact with human activities . livestock workers in regions close to wild animal habitats may be particularly at risk due to close contact with domestic animal hosts and contact with wild animal reservoir species . for example , wild elk and bison in yellowstone national park ( usa ) are reservoirs of brucellosis ( 41 ) , a highly contagious zoonotic infection that is transmitted through contact with , or consumption of , unsterilised milk and meat from infected animals . these wild animal populations are considered a potential threat to domestic cattle ( and their handlers ) , which are grazed at the park boundaries ( 41 ) . climate change may , in the future , influence some other categories of infectious disease risks in working populations in ways that , currently , seem marginal or uncertain . with changes in temperatures , wind patterns , water , and vegetation , the local flight paths and longer - distance migratory routes of birds and bats may alter . this could have implications for a range of viral diseases including influenza and various bat - borne viral zoonoses . the emergence of new influenza strains has already been accelerated by battery - fed production of poultry alongside intensified interspecies contacts in many asian backyards , villages , and local markets . initially , these new disease strains appeared in the workers and owners who had close contact with infected animals . influenza strain h5n1 ( avian flu ) likely evolved from flocks of chickens in hong kong , with the first human infections in 1997 . it has now spread to infect other poultry flocks as well as wild bird populations throughout southeast asia and human - to - human transmission has been documented in thailand ( 34 ) . the more recently identified influenza strain h1n1 ( swine flu ) belongs to a category that is usually species - specific and only infects pigs . in march 2009 , it was identified in people in mexico ( 42 , 43 ) . within days , hundreds of human cases were identified in mexico , the united states , canada , and costa rica , with high mortality rates ( especially in mexico , with 97 documented deaths from just over 5,000 cases ) ( 42 ) . these outbreaks resulted in the substantial loss of work days due to sickness , loss of income due to quarantined products , and severe restrictions on future production due to the culling of livestock ( to help stop the outbreaks ) . the rapid spread of these influenza strains beyond the livestock workers into the general population was enabled by high density human settlements with poor public sanitation and hygiene and the global interconnectedness created by air travel soon spread the diseases internationally . under future climate change conditions , there will therefore be heightened need to monitor livestock workers more closely for signs of emerging zoonotic infections . the recent outbreaks of avian and swine flu have already demonstrated the potential for a new zoonosis that is initially confined to occupationally exposed persons to rapidly become global . the global loss of economic productivity directly and indirectly associated with these two influenza strains alone is probably incalculable . workers should also be monitored for less common zoonotic diseases , some of which can be devastating to individual workers and specialised industries . in australia , cases of the deadly hendra virus ( also known as equine morbillivirus ) have , so far , been confined to equine handlers and veterinarians . hendra virus is related to rabies and is spread by infected bat urine that contaminates pasture and stock feed . climate change is predicted to increase weather variability , thereby bringing more frequent and more intense extreme weather events such as floods and hurricanes ( cyclones ) . during extreme weather events there are dramatic surges in demand on various sectors , especially in the medical , emergency response , and essential services sectors . these workers are expected to work harder , for extended periods , in difficult ( and often dangerous ) circumstances , and with limited resources . for example , during hurricane katrina ( usa in 2005 ) , emergency physicians were among the last to evacuate from a devastated new orleans ( 44 ) . lead nurses were expecting to work hard for several days and return home , hot and tired , to life as usual ( p. 9 ) ( 45 ) , not realising that the emergency situation would persist for weeks and months afterwards . hospital staff also faced unexpected challenges during katrina such as finding a space to rest in an overcrowded hospital , facing armed looters in the hospital pharmacy , and finding ways to feed patients when the hospital kitchen was not operational ( 45 ) . the significant stresses of these working conditions were exacerbated by the lack of communication with family and friends outside the workplace ( 45 ) . extreme events like katrina are likely to occur with increasing frequency in a future with climate change , and will represent life - changing experiences ( p. 9 ) ( 45 generally , planning for extreme weather events focuses on how to respond to the event . little consideration has been given to whether or not the necessary people are willing to work in such circumstances . studies have shown that health care workers and paramedics were reluctant to work during emergency situations if they perceived a threat to their own safety , that of their colleagues , and/or their families at home . further , willingness to work also decreased the longer an event continued ( 46 , 47 ) . the greatest barriers to their ability to work were personal illness and injury , communication problems , and difficulties in getting to and from the workplace ( due to infrastructure damage and disruption ) , and personal obligations to child care , elderly relatives , and pets ( 46 , 48 ) . requests to work longer hours , different shifts , with reduced breaks , and/or at a different location to the usual place of work also decreased the willingness and ability of people to work during an emergency ( 46 ) . emergency workers often place substantial psychological pressure on themselves to work in exceptional circumstances : this job comes with a responsibility to turn up, , paramedics quoted in ( 47 ) ) and put their own well - being at risk in the process . society also places high expectations on the willingness and ability of these workers to put their own needs and concerns aside , and work at maximum capacity for extended periods until services are restored and the emergency has subsided . the predicted increase in both frequency and severity of weather events under future climate change scenarios also poses a threat to the long - term well - being of these workers . the repeated trauma and stress of multiple emergency events and the ongoing management of the injured , ill , and displaced may leave these workers physically and emotionally fatigued and unable to contribute as strongly during later events . in addition to emergency responses , it is expected that a more variable climate will bring more frequent and larger surges in non - emergency / normal demands such as the amplification of patterns in weather - related diseases and injuries , including dehydration and heatstroke in summer , or broken bones after slipping on ice in winter . shifts in the geographic ranges of vector - borne diseases and zoonoses and the re - emergence of previously eradicated ( or well - controlled ) diseases may also challenge staff unfamiliar with those diseases . increased clinical workloads may also reduce disease surveillance activities so that new diseases or outbreaks are not detected as quickly . the identification of west nile disease in the united states in 1999 was initially hampered by a lack of capacity ( 15 , 44 ) . a changing climate may also place more clinical demands on specific medical specialities as human physiologies struggle to adapt , including psychiatry , infectious disease , urology , cardiovascular , and critical care sectors . furthermore , health care workers and the operation of health care facilities will face multiple challenges related to climate change mitigation and adaptation strategies . demands and pressures to reduce energy consumption , decrease greenhouse gas emissions , and increase building efficiency will place additional strain on an already stressed workforce ( 44 ) . farming is an inherently stressful occupation , given the perennial need to cope with unpredictable environmental conditions ( 4952 ) . agriculture is especially vulnerable to climate change , with significant risks of both short - term crop failures and long - term declines in productivity . in many agricultural regions , especially in mid - latitude ( subtropical ) regions , climate change will entail less rainfall and drying trends that are exacerbated by greater evaporation at higher temperatures . in many locations , the seasonal patterns of rainfall will change and rainfall events will often intensify . these changes will have significant effects not only on the success of the crops themselves ( and the implications for food supplies from those crops ) but on the ability to make a living on the land . this applies to both large - scale , modernised agricultural industries , as well as small - scale subsistence farmers with both micro- and macroeconomic ramifications . in subsistence cultures , the loss of agricultural productivity decreases the ability of a society to feed themselves and increases their reliance on external food supplies including international aid programmes . the loss of crops also reduces opportunities for agricultural trade , an important source of both food and income for many around the world . extended dry periods not only damage the landscape and render land unproductive , but the resulting loss of income translates into great psychological stress for the farmers whose livelihoods depend on the land . the impairment of mental health by long - term stressful events , like droughts , is often gradual and accompanied by pervasive feelings of weakness , despair , and hopelessness . climate - based stressors are particularly threatening due to their uncontrollable and unpredictable nature and the growing sense of uncertainty that they bring ( 49 , 53 , 54 ) . in many rural societies , a stoic nature in the face of adversity is a highly desirable trait , and many who are affected by mental health disorders keep their symptoms well hidden and do not seek treatment ( even if it is available ) ( 53 ) . mental health disorders are characterised by emotional distress and impaired cognitive function , which may lead to workplace accidents , aggression , substance abuse , eating disorders , anxiety , and depression , all of which impair one 's ability to work . rates of suicide mortality tend to increase in such circumstances ( 53 , 55 , 56 ) , as has been documented in the uk , europe , united states , canada , australia , japan , india , and kenya ( 4951 , 5759 ) . in australia , the suicide rate in male farmers is approximately triple the rate of suicide in urban males and 45 times the rate of suicide in women ( 52 , 53 , 60 ) . in india , these deaths were partly attributed to water shortages that decreased crop yields , but there were also significant additional stressors in this farming industry , including social inequality , debt accumulation , changing farming practices and crops , and government controls on crop prices and commodities trading ( 57 , 58 ) . more recently , there have been marked increases in suicide rates in east kenya after farmers were hit with unusual weather . a prolonged drought reduced crop yields and unseasonal rains during harvest led to widespread contamination of crops with a fungal toxin released by the wet grain . the toxin also remains in the soil afterwards , thus threatening future production as well . again , these factors combined to exacerbate debt levels , producing extreme psychological stress , and suicide rates in the last year have soared to around 2,000 deaths / year ( compared to the average rate of roughly 300 suicides / year ) ( 59 ) . furthermore , these numbers appear to be underestimates of the true suicide toll , as suicide is treated as a crime in india and kenya and so many deaths go unreported ( 58 , 59 ) . farming men tend to be more susceptible to extreme mental health issues such as suicide , but women and children are also negatively affected especially in developing countries due to gender inequalities ( 49 , 53 ) . as productivity becomes economically unviable , people may abandon the land in search of a more secure economic future , triggering the decline of rural communities and infrastructure . declines in both physical and social environments are important drivers of mental health problems ( 55 , 56 ) . in the face of long periods with little or no farm income , financial debt escalates ( causing further emotional distress ) , and many are forced to seek employment off the farm to provide some income . this burden tends to fall on the women , who are generally already most responsible for managing the farm finances , running the home , and raising children . off - farm employment that is close to home also becomes harder to obtain as the rural infrastructure declines due to population loss and economic stress ( 49 ) . more young people tend to leave the land as well , perceiving farming as a less appealing way of life ( 61 ) . the resultant loss of people , property , services , livelihoods , and history ( especially for those whose ancestors farmed the same land for generations before ) can trigger powerful feelings of chronic loss and fatigue , hopelessness , helplessness , despair , and generalised anxiety in those who remain and in those who are displaced . climate change will also affect seasonal and transient farm workers such as fruit pickers and sheep shearers . increasingly stressful environmental conditions when working outdoors and increasingly unpredictable crop yields will have major impacts on their livelihoods , especially if they are paid according to productivity . as farms cease production or change their crops , the availability of work will decrease . low farm incomes may also reduce hiring of short - term workers during busy periods in the farm cycle . many transient farm workers base their livelihoods around the synchronicity of different crops , moving from one crop to the next as each matures at different points in the season . climate change may seriously disrupt this synchronicity , with workers no longer able to sustain employment across the growing season . farming communities are often overlooked by government policies in response to climate change , which tend to focus on the preservation and enhancement of urban centres and their associated infrastructure . yet the products of agricultural industries such as food crops and building materials underpin many economies , and the implications of declining agricultural populations and productivity may have critical impacts on global food supplies and the nutrition status of billions of people . the impacts of declining agricultural activity may also be exacerbated by the looming threat of increasing livestock and crop diseases , many of which are linked to environmental changes and climate - sensitive vectors and pathogens ( 62 , 63 ) . in addition to the detrimental impacts on food production , nutrition and potential livestock - to - human disease transmission , a substantial threat to worker health from agricultural diseases may come from the increased use of pesticides and other agricultural chemicals in response to disease outbreaks . as such , ongoing climate change will pose a continuing and growing threat to the health of workers in the agricultural industry . the importance of nutrition in the determination of numerous health outcomes , particularly protein , carbohydrate , and micronutrient intake , has been well studied and clearly linked ( 64 ) . the ramifications of global food shortages and endemic malnutrition on working populations are not well understood and difficult to quantify , with significant short- and long - term consequences for both individuals and the societies they live in . scenario - based modelling consistently indicates that global food yields may be severely impaired by rising temperatures and drought conditions associated with climate change . it is projected that climate change will have a negative overall impact on global cereal grain yields . countries in the tropics and subtropics , where both warming and reduced rainfall are likely to occur , are at greatest risk . many studies indicate that south asia is particularly vulnerable and likely to experience declines in cereal grain yields of the order of 1020% by later this century ( 65 , 66 ) . the ipcc predicts that food yields in sub - saharan africa will decrease by about a third by the middle of the century ( 66 ) . water shortages and the cost , quantity , and quality of feed will impair livestock production , lowering milk yields , body weights , and fertility . this will have consequences for rural family incomes and for nutritional status , especially if protein intake in young children becomes inadequate for normal development . the spread of infectious diseases such as bluetongue virus and influenza will also decrease the overall health of livestock ( 43 , 67 , 68 ) . the world 's fisheries provide over 2.6 billion people with one - fifth of their average annual protein intake . on top of the documented decline in ocean fisheries by the international millennium ecosystem assessment ( 69 ) , a 2008 report by the world fish centre ( 70 ) concludes that climate shocks such as coral reef damage , warmer ocean waters , acidification ( due to the increasing uptake of carbon dioxide ) , and decreased river flows ( a crucial source of recycled nutrients for both freshwater and ocean fisheries ) will exacerbate the already serious problem of over - fishing . along with nutritional deprivation , as crop yields drop and prices rise , malnutrition will increase in the most vulnerable groups . again , the effects will not be equally distributed , with young children in developing countries most adversely affected . development in utero and during the first 3 years of life is especially vulnerable to nutritional deficiencies , and most survivors of childhood malnutrition continue to suffer from poor health as adults ( 71 ) . studies have shown that adults who survive childhood malnutrition are physically small with reduced muscle development and reduced aerobic capacity , resulting in decreased strength and endurance , and leading to less productive adult lives ( 71 , 72 ) . the food and agriculture organisation of the united nations ( fao ) now estimates that around one billion persons are currently undernourished a number that has actually increased by around 20% during this decade ( 73 ) . modelling by the international food policy research institute ( ifpri ) has predicted that by 2050 , worldwide , there will be approximately 138 million malnourished children under the age of five ( 65 ) . malnutrition will undermine the strength , health , and productivity of current and future working populations . they include physical deformity and weakness ; delayed motor , cognitive , and behavioural development ; increased susceptibility to infection and disease ; and premature mortality . these effects lead to less productive lives as adults and a reduction of the potential workforce in future years . malnutrition also reduces intellectual development and capacity so that children are less capable of benefitting from education ( even if it is available ) and , in the long - term , may result in declines in the skill and mental capacities of underfed populations in poorer countries ( 67 , 71 ) . outdoor workers will be strongly affected by current and future malnutrition as the physical demands of their jobs increase , but entire populations may be at risk if there are major food shortages as well as endemic malnutrition . climate change will also increase the already heavy workload of women in developing countries who tend to bear the burden of high fertility rates , childcare , and household tasks ( such as cooking ) , as well as contributing to farming activities . cultural influences may exacerbate the effects of climate change on women 's workloads , such as in the sahel and horn of africa , where men often migrate during droughts and leave women alone at home to continue raising the children , working the fields , tending to livestock , and managing the home . such demands will substantially decrease the ability of women on their own to provide proper care and nutrition to infants ( 74 ) . the potential impacts of climate change on working populations extend far beyond the more overt risks associated with direct exposure to greater extremes of heat . these non - heat - related impacts of climate change on working populations are many and varied with substantial impacts at all economic levels . adverse impacts may be observed in both developed and developing countries , although it is likely that the latter will bear more of the burden due to endemic poverty and disadvantage . increases in vector - borne diseases may be significant in one location , while another population experiences food shortages and malnutrition . elsewhere , some populations may be adversely affected by multiple non - heat - related challenges to worker health . non - heat - related impacts of climate change are wide - ranging and will often have serious health and economic consequences . they should be taken into account in the future planning of adaptive strategies in working populations . the authors have not received any funding or benefits from industry or elsewhere to conduct this study . | environmental and social changes associated with climate change are likely to have impacts on the well - being , health , and productivity of many working populations across the globe .
the ramifications of climate change for working populations are not restricted to increases in heat exposure .
other significant risks to worker health ( including physical hazards from extreme weather events , infectious diseases , under - nutrition , and mental stresses ) may be amplified by future climate change , and these may have substantial impacts at all scales of economic activity .
some of these risks are difficult to quantify , but pose a substantial threat to the viability and sustainability of some working populations .
these impacts may occur in both developed and developing countries , although the latter category is likely to bear the heaviest burden.this paper explores some of the likely , non - heat - related health issues that climate change will have on working populations around the globe , now and in the future .
these include exposures to various infectious diseases ( vector - borne , zoonotic , and person - to - person ) , extreme weather events , stress and mental health issues , and malnutrition . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
systemic lupus erythematosus ( sle ) is a chronic autoimmune disease characterized by loss of tolerance against nuclear autoantigens , lymphoproliferation , and multiorgan tissue inflammation . the majority of sle patients showed severe clinical manifestations such as urine proteinuria , hematuria , urinary cast , hemolytic anemia , arthritis , and cns involvement . the kidneys are major organs directly affected by sle resulting in end stage renal disease ( esrd ) in up to 50% of patients at onset of the sle and over 60% of patients during the disease process [ 1 , 2 ] . lupus nephritis - iv ( dpln ) is the most common , severe , and active form of nephritis ; the prognosis of these classes of patient is directly proportional to the period of diagnosis and initiation of effective therapy [ 3 , 4 ] . a recent large clinical study of ln has suggested that patients with ln - ii and ln - iii classes have favorable outcome whereas patients with ln - iv , ln - v , and ln - vi have poorer outcomes , which further emphasizes that early detection of active forms of ln is valuable fortitude to decrease the morbidity and mortality . presently , renal biopsy provides information on the level of renal tissue injury , pathological activity , and severity of renal disease . however , it is an invasive procedure , with some patients reluctant to have the procedure performed . activated t cells can release proinflammatory cytokines that promote the activation of neutrophils and macrophages . various studies have shown that active forms of ln were strongly associated with th1 , th2 , and th17 cells expression of peripheral cytokines and that they have strong positive correlations with sle disease activity index ( sledai ) [ 810 ] . different kinds of t cell expression in renal tissue are homogenous to the histological picture of ln classes in human . additionally , the ratios of th1/th2 cytokines are significantly elevated in sle and correlated with sledai , which further suggests that an imbalance of cytokines profile mediates the inflammatory response of renal tissue during the pathogenesis process . besides patients with lupus having abnormally high levels of il-17a along with ifn- are reported in previous studies which have shown that the increased levels of serum il-17a act as potent inflammatory responses [ 12 , 13 ] . nonetheless , renal biopsy is universally accepted procedure and is a gold standard method for the definitive diagnosis of ln . on the other hand , researchers are also debating on the repetitive use of renal biopsy to monitor the disease activity of ln , although it is an impracticable approach due to being an invasive procedure . thus , from a histological and morphological aspect , the essential role of th1 , th2 , and th17 cytokines together in ln may be standby for the diagnostic prediction . here , our study suggests that serum proinflammatory cytokines il-18 , il-18/il-4 , and il-17a / il-4 have a significant role for the development of ln - iv , and roc further suggests il-18 as a potential marker for ln - iv . thus , the use of serum cytokine profiling in sle patients may assist in the finding of histological type of ln earlier and therefore pursuing specific immunosuppressive therapy without delay , reducing the likelihood of the rapid development of esrd . the study included forty - nine ( 45 female and 4 male ) patients with newly diagnosed sle with nephritis , who were not treated with any immunosuppressive drugs agent such as methylprednisolone ( mp ) , cyclophosphamide ( ctx ) , and mycophenolate ( mmf ) . the selected patients were han chinese from inpatient department of nephrology during the year january 2013 to november 2015 . patients fulfilled the american college of rheumatology ( acr-1997 ) classification criteria for sle with no concurrent infections being recruited in this study . patients were diagnosed by renal biopsy according to the world health organization ( who-1995 ) classifications . they were divided into three groups , ln - iii mean age ( n = 12 , 41.58 5.66 ) , ln - iv ( n = 32 , 35.28 9.02 ) , and ln - v ( n = 5 , 41.20 14.34 ) , and healthy control volunteer ( n = 24 , 37.37 9.30 ) . a healthy control individual of the same age and sex was selected from the department of nephrology of the first affiliated hospital of xiamen university . renal histopathology data , detailed disease history , and total sle disease activity index ( sledai ) were obtained from patients . the study was approved by institutional research board ( irb ) of the first affiliated hospital of xiamen university . the written informed consents were obtained from all the participants : lupus nephritis patients and volunteers . in case the participants had impaired ability to provide consent , written consents were obtained from the next - of - kin or the care giver on their behalf . under aseptic techniques , early morning , fasting venous blood sample ( total 5 ml ) was drawn from each patient and put in a plain tube on the same day of renal biopsy . serum was isolated by centrifugation at 1000 g at 20c , but in some samples , due to the presence of high lipid content , centrifugation at 10,000 g for 10 minutes at 4c was conducted . disease activity is assessed by using a combination of clinical history , physical examination , organ specific functional tests , and serologic studies . total sledai score was measured on the day of serum sample collection and it was assessed clinically by an independent physician and crossmatched with our findings . often it is divided into three categories of scoring less than 5 and 510 , and more than 10 are considered as low , medium , and high disease activity , respectively . in our study the mean values of sledai were ln - iii ( 13.33 2.8717 ) , ln - iv ( 17.22 3.53 ) , and ln - v ( 15.8 2.49 ) . furthermore , renal involvement was assessed by using the renal items of the sledai 2000 representing the sum of four kidney - related parameters : hematuria ( > 5 cells / hpf ) , pyuria ( > 5 cells / hpf ) , proteinuria ( 0.5 gm / day ) , and renal casts . serum levels of ifn- , tnf- , il-2 , il-18 , il-4 , il-5 , il-6 , and il-13 were determined by using procartaplex multiplex immunoassays panels , affymetrix ( ebioscience , epx110 - 10810 - 901 ) , and luminex 100/200 . serum levels of il-17a and il-10 cytokines were analyzed by elisa kit ( human platinum elisa , ebioscience , an affymetrix ) according to the manufacturer 's instructions . similarly , the human lipocalin-2/ngal elisa ( biovendor , rd191102200r ) was used for quantitative detection of serum levels of ngal in all groups of the patients . each serum sample was tested in two magnetic bead wells in human procataplex panels , elsia for il-17a , il-10 , and ngal . the anti - il-18 , il-17a , and ifn- antibody was obtained from abcam ( cambridge , massachusetts ) . after deparaffinization and rehydration , the sections were treated with 3% h2o2 followed by blocking with 10% goat serum in pbs . the sections were then stained for il-18 , ifn- , and il-17a overnight at 4c , followed by biotin conjugated secondary antibody . the cytokines expressions in infiltrating mononuclear cells ( mncs ) of glomerulus were examined and assigned a value from 0 to 3 as follows : 0 , no staining , similar to that seen in negative control samples ; 1 , focal staining ; 2 , multifocal , intense mnc staining ; 3 , intense staining throughout the mncs . the score of a glomerulus was calculated with the following equation : total positive score = ( % mncs staining 0 ) + ( % mncs staining 1 ) + ( % mncs staining 2 ) + ( % mncs staining 3 ) . we have taken the important routine lab parameters to support the diagnosis of sle with nephritis patients . these parameters which were c3 , c4 ( nephelometer ) , cysc ( latex particle enhanced immunoturbidimetric method ) , 24-hour urine protein ( biuret colorometry ) , ana ( indirect immunofluorescence , iif ) , and dsdna ( crithidia luciliae ) were detected . spss statistical software , version 20.0 ( spss , chicago , il ) , was used for data analysis . quantitative variables were given as means sd , medians , and iqrs where appropriate . kruskal - wallis , one - way anova analysis of variance test was used to compare medians for the independent samples . in case of significant overall differences , cytokine levels in ln - iv were compared with other independent groups of variables of ln and healthy control by using a two - tailed mann spearmen correlation was applied to evaluate the correlations of serum cytokines levels with sledai score , routine lab parameters , and serum cytokines levels and ratios . receiver operating characteristics ( roc ) curves were used to determine the best cut - off points to predict ln - iv . the demographics of lupus nephritis patients and healthy controls are described in the table 1 . serum levels of th1 cytokines ( ifn- , il-18 , and il-12p70 ) and th17 cytokines ( il-17a and il-6 ) were significantly elevated in lupus nephritis - iv when compared with healthy control . moreover , all ln patients expressed the high level of ngal which suggests that the renal function of patients with ln was dysfunctional ( table 2 ) . furthermore , serum il-18 was compared individually in which significantly high level of il-18 was observed in ln - iv when compared with ln - iii ( p = 0.002 ) , ln - v ( p = 0.01 ) , and healthy control ( p < 0.0001 ) ( figure 1(a ) ) . in addition , only il18 and il6 were higher in class iv versus class iii lupus nephritis . serum levels of il-18 , ifn- , and il-12p70 were shown to be significantly positively correlated with sledai in ln - iv ( r = 0.37 ; p = 0.03 , r = 0.38 ; p = 0.02 , and r = 0.59 ; p = 0.0003 ) respectively , but il-18 with 24 hrs urine protein was not significantly correlated in ln - iv patients ( r = 0.26 ; p = 0.14 ) . however , th2 cells cytokines ( il-4 , il-5 , il-10 , and il-13 ) were not elevated in our ln patient 's groups when compared with healthy control . hereby , th1 and th17 cytokines have a critical role in the development of ln - iv whilst th2 cells cytokines in sle associated nephritis may not be very specific for ln - iv . the depositions of the th1 ( ifn- and il-18 ) and th-17 ( il-17a ) in paraffin embedded renal tissue were determined by the ihc . we have found that the considerable il-18 , ifn- , and il-17a antibodies were deposited in renal tissue of ln - iv compared to ln - iii and ln - v patients . however , only a significant difference of il-18 expression was observed among ln - iv , ln - iii , and ln - v patients ( figure 2 ) . although th2 cytokines were not changed in ln , more recent studies have been shown that th1 and th17 versus th2 imbalance have a critical role in the development of ln . as expected , the serum level of th1/th2 cytokines il-18/il-4 was significantly higher in ln - iv compared to other groups of lupus nephritis ln - iii ( p = 0.001 ) , ln - v ( p = 0.005 ) , and healthy control ( p < 0.0001 ) . similarly , the th17/th2 ratio was also calculated by dividing the levels of serum il-17a by those of il-4 ( if actual observed value of il-4 is out of range , then consider minimal sensitivity value according to protocol 1.5 ) ; il-17a / il-4 ratio was significantly higher in ln - iv than ln - iii and ln - v . however , no significant differences were observed in ln - iv when compared with ln - iii ( p = 0.69 ) and ln - v ( p = 0.11 ) in the ratio of ifn-/il-4 ( figure 3 ) . furthermore , we found that th1/th2 ratios , il-18/il-4 and ifn-/il-4 , were significantly correlated with sledai ( r = 0.37 ; p = 0.03 and r = 0.40 ; p = 0.02 ) , respectively ( figure 3 ) . however , there was no correlation with 24 hrs urine protein ( r = 0.05 ; p = 0.76 and r = 0.03 ; p = 0.83 ) , respectively . interestingly , we also analyzed the correlation between single cytokines , th1/th2 or th17/th2 ratio , and renal sledai . as expected , we found that ifn- , il-18 , il-17a , and th1/th2 ratios ( il-18/il-4 and ifn-/il-4 ) were significantly correlated with renal sledai , whereas no significant correlation between il-17a / il-4 and renal sledai was observed ( figure 5 ) . roc test was performed to determine the specificity and sensitivity of elevated cytokines for the diagnostic prediction of ln - iv ( table 3 and figure 4 ) . in short , these data showed that the crucial role of il-18 , il-17a , and il-18/il-4 ratios of the cytokines during the pathogenesis of ln - iv is highly remarkable . early diagnosis of lupus nephritis is a challenging job for clinical practitioners without having an evidence of renal biopsy since renal biopsies can not be performed routinely or may be delayed due to various technical issues in a hospital setting . the group of the cytokines triggered glomerular inflammation and eventually drove the irreversible renal damage . interestingly , t cells could reciprocally inhibit the functions of other sets of t cells ; cytokines produced by th1 cells could negatively regulate the function of th2 cells and vice versa . the local activation of proinflammatory cytokines expressed by t cells is usually increased to the plasma level and contemplates the renal tissue pathogenesis . furthermore , cell mediated immune reactions leading to proliferative glomerulonephritis in sle patients are predominantly mediated by th1 cells derived cytokines [ 11 , 20 ] . the balance among the th1 , th2 , and th17 peripheral blood cd4 cells in patients with lupus nephritis is the critical determinants for histopathology picture of ln [ 9 , 21 ] . interestingly , in our study we found that th1 , th2 , and th17 derived cytokines have a deleterious effect on the progression of different histopathological classes of ln . since il-18 is known as ifn- inducing cytokine factor , a novel proinflammatory cytokine endorses the polarization of the immune response towards the th1 cells and its level was markedly elevated in serum and prominent in glomerular tissue staining in ln - iv patients compared to ln - v . consistently , our findings evokes that increased serum level of il-18 was present in ln - iv patients compared to ln - iii ( p = 0.002 ) , ln - v ( p = 0.01 ) , and healthy controls ( p < 0.0001 ) . a previous study also suggested that the major site of il-18 expression in ln is the glomerulus , specifically in ln - iv which may be provided by activated glomerular infiltrating macrophages . histopathological active stage nephritic patients may have more chances to pile up these macrophages within the glomeruli and subsequent release into circulation as a defense mechanism . in such conditions , local expression of il-18 recruited inflammatory cells from peripheral blood into the glomeruli via il-18r and polarization of the immune response towards the th1 . this may be the reason for elevation of serum il-18 in our ln - iv patients . since a decade , the characterizations of il-18 and the therapeutic approach to sle are debatable despite its critical value for the development of ln [ 8 , 20 ] . recently , a mouse model study of ln has revealed that antroquinonol inhibited t cell activation / proliferation reduced the renal production of interleukin-18 . it had ameliorated the proteinuria , hematuria , impairment of renal function , and development of severe renal lesions , especially cellular crescent formation , neutrophil infiltration , and t cell proliferation in the glomerulus , as well as periglomerular interstitial inflammation . subsequently , th1 and th2 cytokines are in counterbalance state in glomeruli of dpln and shift towards ifn- and away from th2 cytokines [ 10 , 11 ] . however , ifn- and il-4 antagonize the th-17 pathway in a complex fashion . reciprocal interaction among ifn- , il-4 and , il-17a occurred , with il-17a expression characterizing an exceptional role of t helper cells to regulate the tissue inflammation . similarly , in our study we found that the ratios of cytokine th1/th2 and il-18/il-4 were profoundly elevated in ln - iv compared to ln - iii ( p = 0.001 ) , ln - v ( p = 0.005 ) , and healthy control ( p < 0.0001 ) and significantly correlated with sledai ( r = 0.37 ; p = 0.03 ) . consequently , ifn-/il-4 also significantly elevated in ln - iv in comparison to healthy control ( p < 0.0001 ) . hence , the ratios of th1 and th2 cytokines can reflect the cytokines homeostasis and point out the predominance of either th1 or th2 cells cytokines during the pathogenesis of lupus . although il-4 cytokine in the sera was not significantly elevated in our study , the ratios of th1/th2 cytokines were markedly increased particularly in ln - iv patients . it may be due to counterbalance characteristics of t cell subsets during inflammatory processes as t cells could reciprocally inhibit the functions of other subsets of t cells . cytokines produced by th1 cells could negatively regulate the function of th2 cells and vice versa during active inflammation . a previous study has also revealed that the th1/th2 ratio was higher in sle patients and positively correlated with sledai . in contrast , a study showed that th1/th2 ratio was significantly correlated with 24 hrs urine protein but not with sledai . however , in our study high ratio of th1/th2 was significantly correlated with sledai in ln - iv whereas it was not correlated with 24 hrs urine protein and other lab parameters . furthermore , our study also found that renal sledai - r was significantly correlated with single il18 , ifn- , il-17a , and th1/th2 ratio . consistently , previous study showed that , at the time of renal biopsy , sledai - r scores were significantly higher in ln - iv , superior to other indices to predict for renal injury in children with ln . the enhancement of proinflammatory reaction induced tissue injury is varied in renal tissue and exacerbation of sledai correlated with active stage of ln , especially ln - iv . th-17 is newly identified t helper subset cell and it became a hallmark of pathogenesis in various autoimmune diseases . recently , various studies have reported that il-17a level in sle is elevated when compared with healthy controls [ 2628 ] . localized prominent expression of il-17a and ifn- occurred in renal tissue of patients with ln - iii and ln - iv compared to ln - ii by ihc staining . as a result , th17 cells appeared to be responsible for tissue inflammation and damage [ 29 , 30 ] . different studies have shown that serum il-17a level was significantly elevated in ln patients in comparison to sle patient without nephritis and healthy controls , but it has no associations with clinical and laboratory parameters such as white blood cells , platelet , hematuria , dsdna , ana , c3 , and c4 . in contrast , il-17a and ifn- were significantly amplified in sle ; mainly il-17a acts as a powerful predictor cytokine because it was markedly correlated with disease activity and associated with more pyuria and proteinuria , whilst the serum level of ifn- was associated with more pyuria and hematuria . in our study , il-17a levels were significantly elevated in ln , especially with ln - iv compared to ln - v ( p = 0.003 ) and healthy control ( p = 0.001 ) . nonetheless , no significant correlation between serum il-17a levels and sledai was observed in ln patients , in keeping with similar finding from a previous study . it may be due to heterogeneity of sle with nephritis or a small sample size . previous studies have also shown that an enhanced th17 cell response that directly correlates with disease activity in patients with sle suggests the important role of il-17a in the pathogenesis of lupus . however , there was a balance mechanism between th1 ( ifn- ) and th17 ( il-17a ) regulation and aberrantly production of il-6 was present in sle , which is linked to an increased th17 cell response . therefore , patients with sle had an increased frequency of cd4 th17 cells compared with healthy controls , but it has altered the balance between th17 and th1 response in sle . wang et al . have shown that the il-17a expressing t cells predominantly infiltrated in glomerular and interstitial tissue . moreover , in contrast , a recent study showed that il-17a immune response plays no major role in the pathogenesis of ln in mrl / lpr and nzb / wf-1 mice , which concludes that the il-17a targeting therapy may not be supported . with such controversy , furthermore , it was noticed that serum il-17a cytokine is elevated in sle patients with cns involvement and raised th17/th2 ratio and it has correlated with sledai . it may be due to the fact that il-17a levels are produced by several cell types including cd4 th cells , t cells , double negative t cells , and foxp3treg cells [ 36 , 37 ] . nevertheless , we found that serum il-17a levels were significantly higher in ln - iv patients than ln - v and healthy controls . in accordance with this result , we have further investigated the expression of th1 cells cytokines ( il18 and ifn- ) and th17 cells cytokines il-17a in paraffin embedded renal biopsy tissues through ihc staining method . the il-18 , ifn- , and il-17a were significantly deposited on renal biopsy tissue from class iv ln patients in comparison to ln - iii and ln - v ( figure 2 ) . the infiltration of th1 and th17 cells into glomeruli was consistent with previous studies [ 8 , 9 , 11 ] . hereby , we conclude that these cytokines are crucial for the development of ln , especially ln - iv . although il-6 was higher in patient with ln - iv than in healthy control subjects in our study , it may be due to possible involvement of this cytokine in enhancing the th17 cell response . in our study , we found that il-18 and il-18/il-4 ratios were powerful predictor ( in roc curve ) of the serum cytokines and significantly correlated with total and renal sledai in ln - iv . this result was supported by other studies which has reported that the cytokine production is increased in active dpln nephritis patients [ 8 , 12 , 20 ] . similarly , il-17/il-4 ratio also increased in ln - iv but it was not correlated with sledai significantly ; however , it was consistent with previous studies [ 28 , 31 ] . particularly , in our study the serum il-18 , il-18/il-4 , and il-17/il-4 were the most powerful predictor cytokines in ln - iv patients . determination of these t cell subsets cytokine profiling in sle patients with ngal may assist in early prediction of ln - iv before renal biopsy and guide a clinician to initiate specific immunosuppressive therapy without delay and reduce the tendency of esrd . hereby , the measurement of these cytokines may immediately help to predict the active form of lupus nephritis , especially ln - iv prior to renal biopsy ; if biopsy could not be readily performed . nevertheless , until then , renal biopsy is the gold standard method to establish the definitive diagnosis of ln . | systemic lupus erythematosus ( sle ) is a chronic autoimmune disease characterized by aberrant t cell immune response .
diffuse proliferative lupus nephritis ( ln - iv ) is the most common , severe , and active form of lupus nephritis . in this study , we investigated the production of th1 , th2 , and th17 cytokines in prediction of active form of ln - iv .
procartaplex multiplex immunoassays panels were used for detection of serum th1 , th2 , and th17 cytokines profiling . th1 and th17 cytokines ( il-18 , ifn- , il-12p70 , il-6 , and il-17a ) were considerably expressed in the serum of lupus nephritis iv patients in comparison to the healthy control .
however , only il18 and il6 were higher in class iv versus class iii lupus nephritis .
importantly , the ratios of th1/th2 ( il-18/il-4 ) and th17/th2 ( il-17a / il-4 ) were significantly elevated in ln - iv when compared with ln - iii , ln - v , and healthy controls .
consistently , the serum cytokines il-18 , il-17a , and ifn- were markedly expressed in ln - iv patient glomeruli and interstitial tissue compared to other classes of ln by ihc .
roc further suggests that il-18 was a potential marker for ln - iv .
the data from our study suggests that the early detection and quantification of these cytokines may help in prediction of active form of ln - iv . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
patients with iih have a classical picture of headache , papilledema , and a raised cerebrospinal fluid ( csf ) pressure of more than 25 mmhg . it is more common in women than in men ( 3:1 ) with the highest incidence seen in obese women of reproductive age group ( 20 - 45 years ) . the most common presenting symptoms are manifestations of generalized intracranial hypertension , normally headache and visual obscuration . diplopia , pulsatile tinnitus , nausea and vomiting may be present in about 50% of patients , with neck / back / shoulder pain or radicular pain less frequent . the major risk of iih is visual loss , which may be permanent despite medical therapy . it seems that the symptoms worsen during pregnancy in 50% of the patients and usually resolve postpartum . a 45-year - old female , weighing 70 kg presented with complaints of headache , menorrhagia and pain in the abdomen was admitted to our hospital . she was posted for transcervical resection of the endometrium and patient had a past history of headache and blurring of vision 2 years ago and was diagnosed to have iih and was on tablet acetazolamide 250 mg every 6 h. she had a history of lumbar csf drainage twice . on pre - operative examination , pulse was 70/min and blood pressure was under control . computer tomography brain was normal and magnetic resonance imaging revealed partially empty sella and no pituitary mass lesion , cerebral hemisphere and ventricles were normal . fundus examination revealed chronic papilledema , optic nerve pallor and perimetry showed increased size of blind spot . csf manometry was performed in the lateral decubitus position and csf pressure was more than 250 mm h2o with normal cytological and biochemical profile . injection glycopyrrolate ( 0.2 mg ) , injection midazolam ( 2 mg ) and injection fentanyl ( 200 g ) were given intravenously as pre - medication . anaesthesia was induced with propofol 175 mg and tracheal intubation was facilitated with vecuronium 5 mg injection plain lignocaine 2% 5 ml was given to attenuate pressor response . monitoring included pulse oximetry , electrocardiogram ( ecg ) , noninvasive blood pressure noninvasive blood pressure ( nibp ) , etco2 , urine out - put and temperature . at the end of surgery neuro - muscular block was reversed with injection neostigmine 3.5 mg and glycopyrrolate 0.4 mg . she was shifted to post - operative recovery room and monitored for 48 h with pulse oximetry , ecg , nibp , urine out - put , and temperature . iih was first described by quinke in 1893 and was called serous meningitis . iih is caused by dural sinus thrombosis , a reduction in corticosteroid therapy , hormonal imbalance , vitamin a toxicity , anabolic corticosteroids , long - term tetracycline , hormonal contraceptives , lithium , and pregnancy . theories of iih pathophysiology include increased venous sinus pressure , decreased spinal fluid absorption , increased spinal fluid secretion , increased blood volume and brain oedema . the various treatment modalities used in patients include corticosteroids , acetazolamide , diuretics , repeated lumbar puncture and surgery . the goals of treatment of iih involve a reduction of intracranial pressure to control symptoms and prevent pressure on the optic nerve and optic meninges , preserving vision . generally , up to 30 ml of fluid is withdrawn to lower the intracranial pressure to normal . our patient had a history of iih since 2 years , was on tablet acetazolamide and showed response to medical therapy . , 20 cc of csf was removed to keep the csf pressure within normal limits . from the literature , it has been found that iih is more common in females in the age group 20 - 45 years . women with more than 10% over their ideal body weight are 13 times more likely to develop iih . the mechanism proposed is that central obesity raises intra - abdominal pressure , which increases intra - pleural pressure and cardiac filling pressure , which in turn impedes venous return from the brain and leads to increased intracranial venous pressure , and increased intracranial pressure . neuraxial anaesthesia , spinal or epidural has been used successfully for caesarean section in patients with iih . since lumbar puncture for csf drainage is a therapeutic modality for iih , there is no indication to withhold spinal anaesthesia in these patients . bedson and plaat reported the combined spinal - epidural technique for delivery by caesarean section . although , dural puncture is contraindicated in patients with increased intracranial pressure resulting from space occupying lesions due to risk of uncal herniation . however , it has been postulated that the uniform swelling and stiffness of the brain in iih prevents herniation . aly and lawther reported a case of uncontrolled iih successfully managed using an epidural catheter for analgesia in labour and delivery as well as temporary control of intracranial pressure . abouleish and ali had given spinal anaesthesia for caesarean section in patient with iih . in our patient , both surgeries were carried out simultaneously , so we had no option for regional anaesthesia . we have selected general anaesthesia as nephrectomy was carried out in the lateral decubitus position . if a patient with iih requires general anaesthesia , the planned approach should minimize the risk of a rise in intracranial pressure associated with intubation , inadequate depth of anaesthesia and extubation . so , we have to take measures to avoid an increase in intracranial pressure ( icp ) during the peri - operative period . propofol offers a number of pharmacological advantages for total intravenous anaesthesia in patients of raised icp . liberal doses of propofol combined with narcotics to achieve adequate depth of anaesthesia , mild to moderate hyperventilation , intravenous lignocaine bolus are the measures that prevent dangerous increase in icp . we induced the patient with ( 200 g ) fentanyl and propofol and avoided succinylcholine for intubation as muscle fasciculation caused by succinylcholine , increase the intra cerebral blood volume and increase the icp . atracurium causes histamine release , slightly increases the pulse rate and central system excitement , so we have used vecuronium in our patient . vecuronium does not alter icp or csf dynamics and lack of cerebral effects have made vecuronium a popular choice in patients with raised icp . definitive measures used for decreasing the icp include , mild head elevation , maintain etco2 between 25 mmhg and 30 mmhg , i.v . mannitol , continuous infusion of thiopentone or propofol , avoid hypoxia , hypercarbia , hyperthermia and hypotension . in conclusion , although iih is rare , there are special considerations for anaesthetic management in patients with this disorder . even though , these patients have an elevated icp , anaesthesia does not cause any detrimental effects in patients with iih . so , we have to take measures to avoid increase in icp during the perioperative period . despite the presence of raised icp in these patients , there is no specific contraindication to either spinal or epidural anaesthetic technique since uncal herniation does not occur in these patients . | idiopathic intracranial hypertension ( iih ) is a rare headache syndrome characterized by prolonged elevation of intracranial pressure without related pathology in either the brain or the composition of cerebrospinal fluid .
herein , we provide a brief review of the clinical presentation of iih and the anaesthetic considerations in a female posted for transcervical resection of the endometrium and right nephrectomy with the disorder .
most of patients with iih are reported during pregnancy and came for management of labour and delivery . to our knowledge
no such case has been described previously . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
osteoporosis is a chronic progressive disease characterized by low bone mass , micro - architectural bone deterioration , and decreased bone strength that lead to increased bone fragility and a consequent increase in fracture risk . the world health organization ( who ) came up with definitions of osteoporosis and osteopenia in postmenopausal white women based on bmd to help physicians classify degrees of bone loss . in current clinical practice , the diagnosis of osteoporosis is based on either a health outcome like a fragility fracture , or an intermediate outcome like a low bmd . osteoporosis is generally considered a disorder of postmenopausal women , but low bone mass and accelerated bone loss can also occur early in life and contribute to pre - menopausal osteoporosis . certain groups of premenopausal women are at higher risk of osteoporosis than their peers , and these include women with disease states like primary hyperparathyroidism , cushing 's syndrome , and thyrotoxicosis , that promote accelerated bone loss . premenopausal osteoporosis is defined as low bone mineral density ( a z score below -2.0 ) in combination with risk factors such as chronic malnutrition , eating disorders , hypogonadism , glucocorticoid exposure , and previous fractures . longitudinal studies have shown that calcium utilization increases during early puberty and that the highest rates of calcium accrual may occur at a mean age of 12.5 years in girls and 14 years in boys . factors affecting the attainment of peak bone mass include genetic background , nutritional status , and activity level . family studies have shown that 50 - -80% of variance in bone mass is heritable . bone mineral density follows a normal distribution , and low bone density , defined as a t - score of less than 1.0 standard deviation below the young adult mean is present in about 15% of young , healthy women aged between 30 and 40 years . around 0.5% of these women . currently , there are insufficient data regarding the relationship between bmd and fracture risk in the premenopausal female population . therefore , it is not possible to make recommendations regarding the appropriate bmd criteria for a diagnosis of osteoporosis in premenopausal women in the absence of secondary causes . the who definition of osteoporosis based on a t - score cut - off point of -2.5 is applicable only to the postmenopausal female and can not be applied to the premenopausal female in the absence of secondary causes of bone loss . low peak bone mass without the presence of fragility fractures or height loss may be reflective of the normal variation in bmd . risk factors of premenopausal osteoporosis include the following : genetic influences , ethinicity , hormonal influences , nutritional factors , physical activity , disease factors , medications , and smoking . racial and ethnic differences in bmd values have been reported , and population norms have been established for use as dxa reference standards . bone loss can also occur due to prolonged amenorrhea and estrogen deficiency . in a study of 200 women , aged 16 to 40 with 6 months to 24 years of amenorrhea , it was found that lumbar spine bmd was 15% lower compared to 57 age matched controls . as estrogen has antiresorptive properties in bone , it is thought that oral contraceptive ( oc ) use can increase bone mineral density . however , prospective studies on oc use in premenopausal women failed to show consistent gains in bmd . progestational agents used for contraception in premenopausal women can cause bone loss due to the associated oestrogen deficiency . increased calcium intake is generally recommended in osteoporosis . in studies looking at the association of bmd and calcium intake in healthy premenopausal women , statistically significant correlations were found between calcium intake and bmd at three femoral sites . this is prevalent in female athletes as they have a higher incidence of eating disorders than their peers and are at a much higher risk of stress fractures . in a cohort study of 56 women with eating disorders , it was found that the bmd in the femur of these women were below the critical fracture threshold in 75% of patients . the factors involved include estrogen deficiency and resultant amenorrhea , leptin levels are usually low in patients with anorexia nervosa , and may have an effect on igf-1 , especially in low body weight states . physical activity has been shown to increase bmd . a longitudinal study was done to examine the bmd of the lumbar spine and femur in premenopausal caddies and desk workers . the change in bmd was significantly better in the caddies than desk workers , suggesting that regular intense activity resulted in gain in bmd . glucocorticoids are commonly used in the treatment of many conditions , including inflammatory and autoimmune diseases . glucocorticoid induced osteoporosis is the most common cause of drug - induced osteoporosis , and occurs as a result of decreased bone formation secondary to impaired osteoblastic differentiation and function . selective serotonin reuptake inhibitors ( ssri ) can cause bone loss by affecting functional serononin receptors and transporters that are present in osteoblasts and osteocytes . anticonvulsants accelerate the metabolism of vitamin d and may also have direct inhibitory effects on osteoblast differentiation . two meta - analyses have reported significant lowering of bmd at the hip in long term smokers compared to nonsmokers . although most young people with osteoporosis have an identifiable cause , some may have idiopathic osteoporosis in which no etiology can be found . this has been variably defined in the literature and most of the reported cases are in caucasians , with the usual clinical history being one of multiple atraumatic fractures , involving mainly cancellous bone . a retrospective study on young healthy women who presented with fragility fractures was carried out who had trans - iliac bone biopsies undertaken as part of their evaluation . all secondary causes of osteoporosis were excluded by means of history taking , physical examination and biochemical testing . it was demonstrated that women with idiopathic osteoporosis had evidence of decreased bone formation and altered bone resorption . thus , it was concluded that women with idiopathic osteoporosis have uncoupling of resorption and formation , as well as osteoblast dysfunction . weight bearing exercises , adequate nutrition and calcium intake , smoking cessation as well as maintenance of a normal body mass index are of value in maintaining bmd . antiresorptive therapy has only been evaluated in premenopausal women receiving glucocorticoid therapy or in secondary causes of bone loss such a primary hyperparathyroidism . there are no data regarding the use of bisphosphonates in the treatment of premenopausal osteoporosis in the absence of these secondary causes . in women who are oestrogen replete who have normal bone turnover , bisphosphonates may be harmful as they have long term skeletal and may have adverse effects on future pregnancies . they have been shown to pass through the placenta in animal studies and accumulate in the fetus , and their effects on the developing fetal skeleton are still unknown . hence , bisphosphonates should be limited in premenopausal women until further research is done to clarify its safety and efficacy . the national osteoporosis foundation states that the current available data are insufficient to formulate specific recommendations for premenopausal women . premenopausal women with disease states associated with accelerated bone loss should be managed on a case - by - case basis . the advantages of early detection have to be weighed against the risk of potential harm , including treatment associated morbidity . osteoporosis is a chronic progressive disease characterized by low bone mass , micro - architectural bone deterioration , and decreased bone strength that lead to increased bone fragility and a consequent increase in fracture risk . the world health organization ( who ) came up with definitions of osteoporosis and osteopenia in postmenopausal white women based on bmd to help physicians classify degrees of bone loss . in current clinical practice , the diagnosis of osteoporosis is based on either a health outcome like a fragility fracture , or an intermediate outcome like a low bmd . osteoporosis is generally considered a disorder of postmenopausal women , but low bone mass and accelerated bone loss can also occur early in life and contribute to pre - menopausal osteoporosis . certain groups of premenopausal women are at higher risk of osteoporosis than their peers , and these include women with disease states like primary hyperparathyroidism , cushing 's syndrome , and thyrotoxicosis , that promote accelerated bone loss . premenopausal osteoporosis is defined as low bone mineral density ( a z score below -2.0 ) in combination with risk factors such as chronic malnutrition , eating disorders , hypogonadism , glucocorticoid exposure , and previous fractures . longitudinal studies have shown that calcium utilization increases during early puberty and that the highest rates of calcium accrual may occur at a mean age of 12.5 years in girls and 14 years in boys . factors affecting the attainment of peak bone mass include genetic background , nutritional status , and activity level . family studies have shown that 50 - -80% of variance in bone mass is heritable . bone mineral density follows a normal distribution , and low bone density , defined as a t - score of less than 1.0 standard deviation below the young adult mean is present in about 15% of young , healthy women aged between 30 and 40 years . around 0.5% of these women . currently , there are insufficient data regarding the relationship between bmd and fracture risk in the premenopausal female population . therefore , it is not possible to make recommendations regarding the appropriate bmd criteria for a diagnosis of osteoporosis in premenopausal women in the absence of secondary causes . the who definition of osteoporosis based on a t - score cut - off point of -2.5 is applicable only to the postmenopausal female and can not be applied to the premenopausal female in the absence of secondary causes of bone loss . low peak bone mass without the presence of fragility fractures or height loss may be reflective of the normal variation in bmd . risk factors of premenopausal osteoporosis include the following : genetic influences , ethinicity , hormonal influences , nutritional factors , physical activity , disease factors , medications , and smoking . racial and ethnic differences in bmd values have been reported , and population norms have been established for use as dxa reference standards . bone loss can also occur due to prolonged amenorrhea and estrogen deficiency . in a study of 200 women , aged 16 to 40 with 6 months to 24 years of amenorrhea , it was found that lumbar spine bmd was 15% lower compared to 57 age matched controls . as estrogen has antiresorptive properties in bone , it is thought that oral contraceptive ( oc ) use can increase bone mineral density . however , prospective studies on oc use in premenopausal women failed to show consistent gains in bmd . progestational agents used for contraception in premenopausal women can cause bone loss due to the associated oestrogen deficiency . increased calcium intake is generally recommended in osteoporosis . in studies looking at the association of bmd and calcium intake in healthy premenopausal women , statistically significant correlations were found between calcium intake and bmd at three femoral sites . this is prevalent in female athletes as they have a higher incidence of eating disorders than their peers and are at a much higher risk of stress fractures . in a cohort study of 56 women with eating disorders , it was found that the bmd in the femur of these women were below the critical fracture threshold in 75% of patients . the factors involved include estrogen deficiency and resultant amenorrhea , leptin levels are usually low in patients with anorexia nervosa , and may have an effect on igf-1 , especially in low body weight states . physical activity has been shown to increase bmd . a longitudinal study was done to examine the bmd of the lumbar spine and femur in premenopausal caddies and desk workers . the change in bmd was significantly better in the caddies than desk workers , suggesting that regular intense activity resulted in gain in bmd . glucocorticoids are commonly used in the treatment of many conditions , including inflammatory and autoimmune diseases . glucocorticoid induced osteoporosis is the most common cause of drug - induced osteoporosis , and occurs as a result of decreased bone formation secondary to impaired osteoblastic differentiation and function . selective serotonin reuptake inhibitors ( ssri ) can cause bone loss by affecting functional serononin receptors and transporters that are present in osteoblasts and osteocytes . anticonvulsants accelerate the metabolism of vitamin d and may also have direct inhibitory effects on osteoblast differentiation . two meta - analyses have reported significant lowering of bmd at the hip in long term smokers compared to nonsmokers . although most young people with osteoporosis have an identifiable cause , some may have idiopathic osteoporosis in which no etiology can be found . this has been variably defined in the literature and most of the reported cases are in caucasians , with the usual clinical history being one of multiple atraumatic fractures , involving mainly cancellous bone . a retrospective study on young healthy women who presented with fragility fractures was carried out who had trans - iliac bone biopsies undertaken as part of their evaluation . all secondary causes of osteoporosis were excluded by means of history taking , physical examination and biochemical testing . it was demonstrated that women with idiopathic osteoporosis had evidence of decreased bone formation and altered bone resorption . thus , it was concluded that women with idiopathic osteoporosis have uncoupling of resorption and formation , as well as osteoblast dysfunction . weight bearing exercises , adequate nutrition and calcium intake , smoking cessation as well as maintenance of a normal body mass index are of value in maintaining bmd . antiresorptive therapy has only been evaluated in premenopausal women receiving glucocorticoid therapy or in secondary causes of bone loss such a primary hyperparathyroidism . there are no data regarding the use of bisphosphonates in the treatment of premenopausal osteoporosis in the absence of these secondary causes . in women who are oestrogen replete who have normal bone turnover , bisphosphonates may be harmful as they have long term skeletal and may have adverse effects on future pregnancies . they have been shown to pass through the placenta in animal studies and accumulate in the fetus , and their effects on the developing fetal skeleton are still unknown . hence , bisphosphonates should be limited in premenopausal women until further research is done to clarify its safety and efficacy . the national osteoporosis foundation states that the current available data are insufficient to formulate specific recommendations for premenopausal women . premenopausal women with disease states associated with accelerated bone loss should be managed on a case - by - case basis . the advantages of early detection have to be weighed against the risk of potential harm , including treatment associated morbidity . low bone mass density in premenopausal women warrants further evaluation and secondary causes should be sought for and treated . antiresorptive therapy has only been evaluated in premenopausal women receiving glucocorticoids or in secondary causes of bone loss such as primary hyperparathyroidism , and should be used with caution in premenopausal women because of the lack of safety data for future pregnancies . lifestyle modification is of value in preventing progressive bone loss in premenopausal women and should be actively encouraged . | osteoporosis has traditionally been considered a disorder of postmenopausal women , but low bone mass and accelerated bone loss can also occur early in life causing premenopausal osteoporosis .
there are a few risk factors that increase a woman 's risk of premenopausal osteoporosis , including drugs , hormonal and nutritional factors , and physical in - activity , which need to be identified and managed accordingly .
lifestyle modification is of importance in preventing progressive bone loss in premenopausal women and should be actively encouraged . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
chronic infection with hepatitis c virus ( hcv ) is an independent risk factor for developing type 2 diabetes mellitus ( dm ) [ 15 ] . there is a three- to ten - fold increased risk of hcv infection among diabetic patients in comparison with different control groups ; this appears to be linked to the development of insulin resistance ( ir ) . the normal route of entry of glucose into the cell involves receptor autophosphorylation and subsequent tyrosine kinase phosphorylation of insulin receptor substrates ( irs1/2 ) ( figure 1 ) . the ir may be secondary to alternative serine phosphorylation , as well as due to factors such as obesity , metabolic syndrome , systemic inflammation , and hepatic steatosis , which are sometimes present in patients with hcv . high levels of viral rna and advanced liver fibrosis may be the cause of ir in this population . moreover , a direct cytopathic effect of hcv on the expression of irs1 and irs2 has been suggested [ 10 , 11 ] , particularly in genotype 3 . indeed , study of pancreatic beta cells and hepatic expression of irs1 and 2 have shown an increase in hepatic expression of irs1 and 2 after treatment with interferon and ribavirin . the expression of irs1 and 2 in lymphocytes has not been demonstrated in humans but has been shown in some animal studies [ 13 , 14 ] . impairment of irs2 expression ( but not in irs1 ) in monocyte cells was demonstrated in first - degree relatives of type 2 dm patients the objective of this study is to determine the expression of irs1 in peripheral leukocytes ( irs1 cells ) of hcv - infected patients and in a control group ( blood donors ) , correlating it with the expression of irs1 in the liver ( irs1 liver ) and the presence of insulin resistance . since homa - ir is amenable to criticism , and hyperinsulinemic euglycemic clamp , which is the best tool to determine insulin resistance , is difficult to be available in clinical practice , this study tested the hypothesis that irs1cells expression can be used as ir marker in hcv infected patients . our objective was to determine lymphocyte irs ( irs1 cells ) in hcv patients , correlating it to liver irs ( irs1liver ) and homa - ir . the study included treatment - nave patients between 18 and 60 years of age with chronic hcv infection ( elisa 3 and hcv - rna pcr confirmed ) , regardless of aminotransferase levels and genotype . the exclusion criteria were : patients with clinical , laboratory , and/or biopsy - proven liver disease not associated with hcv , obese ( body mass index > 30 ) , patients with excessive alcohol consumption ( > 40 g / day ) , dm , pancreatic disease , severe cardiovascular disease , chronic renal failure in dialysis therapy , malignant disease , active opportunistic infections , organ transplanted recipients , pregnancy and/or steroids , immunosuppressant or lipid - lowering drugs use . this study was approved by the ethics committee of the hospital de clinicas de porto alegre ( hcpa ) , and all patients signed an informed consent form . the readers of the index tests and reference standard were blinded to the results of the other tests . after inclusion into the trial , ultrasound - guided liver biopsies were taken from patients , the samples stained with hematoxylin - eosin and then evaluated using the metavir score . patients with stage f0/f1 were grouped as having minimal / mild fibrosis , while those with scores of f2/f3 were rated as having significant fibrosis . patients with cirrhosis ( metavir f4 ) were excluded from the study , as well as those with metavir f3 and formation of nodules ( classification of ishak f5 ) . the rate of fibrosis progression was calculated taking into account the metavir score and duration of exposure to the disease , using the formula : fibrosis / duration of disease exposure in years . the degree of insulin resistance was calculated according to homa - ir ( homeostasis model assessment - insulin resistance ) , using the measurement of insulin and fasting glucose with the formula : homa - ir = { [ insulin ( mu / ml ) glucose ( mg / dl)]/405}. patients with hcv were divided initially according to genotype and viral load , and then each into two groups , respectively , genotype 3/nongenotype3 , and low viral load ( < 400.000 ui / ml)/high viral load ( > 400.000 ui / ml ) . a 12 ml blood sample was collected in a tube without anticoagulant for subsequent centrifugation , serum separation , and storage at 80c . a liver biopsy was performed at the next consultation and in addition to the sample of liver tissue , 8 ml of blood was collected using an edta tube for separation of leukocytes , as per the manufacturer 's protocol ( ficoll - histopaque ) . the leukocytes isolated and the liver fragments were used to evaluate the mrna expression of irs1 by real - time polymerase chain reaction ( real - time pcr ) . rna extraction was performed in line with manufacturer instructions using the commercial kit rneasy mini kit ( qiagen ) and was then quantified and its quality tested by photometric measurement . primers for amplification were obtained from the harvard medical school primer bank ( http://pga.mgh.harvard.edu/primerbank/ ) . the sequences used were as follows : for the irs-1 , forward primer 5-ctatccagcgtactccaaag-3 and reverse primer 5-acaagtctgaatgctccact-3 ; for relative quantification the beta - microglobulin gene was used . the cdna synthesis was conducted using the superscript iii first - strand synthesis supermix kit in accordance with manufacturer instructions ( invitrogen ) . the pcrs were performed in a final volume of 25 ml , containing 1 m of both primers , 1x syber green supermix ( appliedbiosystems ) , and varying amounts of rt product . amplification was carried out using the mx3000p real - time pcr stratagene ( ge ) system , with data being processed by the fully integrated mx pro software , using the formula 2 . the program profile used for amplification of the gene irs1 was 95c for 2 min followed by 45 cycles of denaturation at 95c for 30 s , annealing at 52c for 15 s and extension at 60c for 30 s. the amplicons were purified using the enzymes exonuclease i ( exo i ) and shrimp alkaline phosphatase ( sap ) from ge healthcare . after verification in agarose , 3.33 u of each enzyme was added to 6 ul of the pcr product . subsequently , the reaction was heated to 37c for 30 minutes and 80c for 15 minutes . the purified pcr product was then quantified in 1.5% agarose gel for comparison using a low mass reader ( invitrogen ) . between 45 and 60 ng , dna was used for sequencing , together with 1 ul of forward primer and 6 ul water qs . the same primer was used as for the aforementioned pcr , at a concentration of 4 pm . the sequencing of amplicons was performed with an automated sequencer abi 310 genetic analyser using the reagent bigdye terminator v3.1 ( applied biosystems ) . the sequences were analyzed by the chromas lite ( technelysium pty ltd ) program to detect and identify the presence of the same fragment amplification of cdna samples obtained from the liver and leukocytes . sequences were compared with the reference sequence primerbank i d 5031805a1 , ( http://pga.mgh.harvard.edu/cgi-bin/primerbank/displaydetail.cgi?primerid=5031805a1 ) available through nucleotide blast ( http://blast.ncbi.nlm.nih.gov/ ) . blood samples were collected after 12 hours fasting to determine blood glucose , adiponectin , insulin , and lipid profile ( total cholesterol , hdl cholesterol , and triglycerides ) . measures of glucose and lipid profile were performed using uv enzymatic hexokinase with the advia 1800 ( siemens ) . the plasma insulin was measured by electrochemical luminescence using the roche modular equipment , and adiponectin was determined according to the elisa kit protocol ( adiponectin human elisa kit , biosource ) . considering a standard deviation of 100 , a significance level of 0.05 , and power of 80% , the sample size necessary in order to detect a difference of 120 units of liver irs between the hcv and control group was estimated to be at least 27 subjects ( 9 controls and 18 patients with hcv ) . the median and percentiles of 25 and 75 were used for variables with skewed distribution . the mann - whitney test and spearman 's correlation were used for analysis of the results for expression of irs1 financial support was provided by fipe ( fundo de incentivo pesquisa e eventos ) of the hcpa . from 93 potentially eligible hcv patients , 41 were included : 26 were male ( 60.5% ) ; mean age of 45 ( 7.9 ) ; 33 ( 80.5% ) were genotype 1 ; 1 ( 2.4% ) was genotype 2 ; 4 ( 9.8% ) were genotype 3 . of the control group 6 were male ( 50% ) with a mean age of 26.7 ( 3.2 ) , lower than that of patients with hcv ( p < 0.001 ) . among the 52 patients excluded , 11 were obese ( bmi > 30 ) , 2 had cancer , 15 were cirrhotic , 5 had dm , 1 had hepatitis b virus , and 3 had excessive alcohol consumption ( > 40 g / day ) . table 1 lists the data on glycemic and lipid profiles for patients with hcv in the study . when comparing the results with the metavir fibrosis scores , the median insulin was found to be significantly higher in patients with significant fibrosis in contrast to those with minimal / mild fibrosis . similarly , the homa - ir was higher in the group with more advanced fibrosis , but without reaching statistical significance . in relation to high or low viral load , fasting glucose was significantly higher in patients with high viral load . using the technique of flow cytometry , a population of mononuclear cells was identified in 83.6% of the total cells , of which 73.4% were cd3 lymphocytes . sequencing of the product of pcr was carried out to confirm the expression of irs1 both in leukocytes and in liver tissue and revealed total similarity between the sequences amplified with the cdna sequence of the irs1 gene . the median irs1 cells in patients were 0.061 ( 0.004 to 0.469 ) , significantly lower when compared to controls ( p = 0.005 ) . the median for expression of irs1 liver 0.0003 ( 0.00002 to 0.0186 ) was also lower in patients ( p = 0.018 ) . table 2 shows the results of irs1 and its correlation with age , insulin resistance ( homa - ir ) , viral load , and rate of progression of fibrosis in patients with hepatitis virus c. there was an inverse association between age and irs1 cells , while irs1liver correlated inversely with homa - ir . there was no correlation between irs1 cells and irs1 liver ( spearman test rho = 0.018 and p = 0.930 ) . although the target organ of infection by the hepatitis c virus is the liver , the action of this virus becomes increasingly clear in other organs . has recently been given to metabolic disorders caused by hcv , firstly the association with hepatic steatosis and changes in lipid metabolism , and more lately its correlation with insulin resistance and dm [ 13 , 6 ] , and also cardiovascular risk [ 2022 ] . hepatitis c can induce a chronic inflammatory state , and inflammatory cytokines are related to decreased expression of irs1 in nonalcoholic fatty liver disease [ 3 , 18 , 2325 ] . indeed , a recently published study from our group demonstrates that hcv patients have increased levels of proinflammatory cytokines ( tnf- and il-6 ) and also a higher pro - antinflammatory cytokine rate than controls . this is an important finding since some studies have shown that the largest proportion of cellular infiltrate found in a liver with chronic hepatitis c is th1 cells , such as il-1b , il-2 , il-6 , il-8 , tnf- and ifn . on the other hand , a recent meta - analysis has demonstrated that sustained virological response is lower in patients with higher homa ( > 2 ) . hcv - induced insulin resistance is considered to be more peripheral than hepatic shown by milner et al . in 29 nonobese infected patients . by means of ( 1)h - magnetic resonance spectroscopy , authors concluded that hcv induces predominantly muscle insulin resistance , closely related to inflammation , independently of visceral obesity and liver fat . in order to assess the direct role of hcv on the mechanisms of action of insulin in different areas ( leukocytes and liver tissue ) , we studied a selected group of patients with chronic hepatitis c infection . the sample selection is one of the strengths of this study as the role of the virus could be better evaluated in a population without obesity , metabolic syndrome , dm , cirrhosis , and with no history of previous antiviral treatment . to verify the quality of test , the expression of irs1 in real - time pcr was confirmed by sequencing of the amplified fragment , based on the cdna sequence , demonstrating that the amplified fragment in the leukocytes is the same amplified fragment in the liver . the expression of irs1 in the leukocytes could facilitate the search for surrogate markers of ir in evaluating the prognosis of patients with hcv . there is evidence that hcv itself can induce insulin resistance through changes in the route of insulin signaling and the entry of glucose into the cell [ 1 , 9 , 18 , 29 , 30 ] . this hypothesis is confirmed in this study by demonstrating the decrease of irs1 in patients with hcv as compared with the control group . the core hcv proteins have a direct cytopathic action on the insulin signaling pathway by decreasing the expression of irs1 , altering the normal route of tyrosine phosphorylation , and entry of glucose into the cell . the decreased expression of irs that seems to be downregulated by the hcv is an important step in the development of ir . studies have shown that genotype 1 is strongly associated with increased insulin resistance [ 9 , 31 ] , but there are evidences of ir in hepatitis c patients with any genotypes . most of the included patients in the present study were infected by hcv genotype 1 . in the present study , when considered the whole population , patients had no increase in homa - ir . this is the opposite of the results published by vanni et al . in their study , also focusing lean and nondiabetic patients , insulin resistance , determined by clamp , was not related to liver fibrosis . on the other hand , in our study , irs1 was decreased in the whole population and was not influenced by the severity of fibrosis . an inverse correlation between the expression of irs1 liver and homa - ir was shown in our study , and this is in agreement with the findings demonstrated in liver tissue by kawaguchi et al . . this study also showed that patients who achieved a sustained virologic response to treatment displayed a decrease in homa - ir and homa- , in addition to an increased expression of irs1 and 2 in the hepatocytes . in agreement with these results , huang et al . recently showed that sustained virological response can improve glucose abnormalities in prediabetic patients with chronic hcv infection . two studies in animals have demonstrated the expression of irs1 in leukocytes [ 13 , 14 ] the first , using a one dog and one cat , evaluated by pcr the expression of irs1 and irs2 , pi3-k , p-85 in different tissues responsive to insulin and in peripheral leukocytes . the aim was to investigate differences in expression of markers found in both species . authors showed that there is a significant decrease in expression of irs1 , irs2 , pi3-k , p-85 in cats as compared to dogs , but they did not address the difference between these markers in tissues like liver , muscle , adipocytes , and leukocytes . in our study , irs1 both in cells and in the liver was lower in hcv patients than controls , but there was no correlation between the different sites . the second study conducted by the same group cited above used nine dogs when investigating how much an intensive treatment controlling blood glucose levels could cause changes in peripheral leukocytes . using the same markers as evaluated in the first study , it showed there was a significant increase in irs1 , irs2 , pi3-k , p-85 after treatment , and thus the observed changes in peripheral leukocytes were regarded as an improvement in glucose metabolism after treatment with insulin . in addition , the leukocytes were considered sufficiently sensitive enough to monitor the improvement of glycemic control during the intensive treatment therapy of insulin in dogs with dm . authors considered that insulin has a strong regulatory function in leukocytes and emphasized that these cells are far more accessible and easier to obtain than other insulin sensitive tissues . our study found decreased expression of irs1 in both liver tissue and in isolated leukocytes . this is found to be unprecedented in hcv patients and opens a new perspective in relation to the evaluation of insulin resistance . accessibility to a test that can feasibly use peripheral blood in comparison to the use of a liver biopsy encourages us to develop new tools to assist in the monitoring of these patients . perhaps , it would be better in the future to compare irs1cells to hyperinsulinemic - euglycemic clamp in order to really establish its utility as a surrogate marker of insulin resistance . in conclusion , selected treatment - nave , nonobese , noncirrhotic , nondiabetic patients with hcv presented a lower expression of irs1 both in leukocytes and in the liver , and this may be related to the commencement of insulin resistance . irs1 is inversely correlated with homa - ir , which in turn is increased in patients with advanced fibrosis . further studies are needed to determine whether the leukocyte expression of irs1 may be used as a substitute marker for liver tissue expression . | aims . to determine lymphocyte irs ( irs1 cells ) in hcv patients , correlating it to liver irs ( irs 1liver ) and homa - ir
.
this study tested the hypothesis that irs1 cells expression can be used as insulin resistance ( ir ) marker in hcv - infected patients .
irs1 cells were not studied before in hcv infection .
materials and methods .
hcv chronically infected patients , nave , nonobese , noncirrhotic , and nondiabetic were prospectively included and compared to controls ( blood donors ) .
blood was taken , and leukocytes were separated .
irs1 was determined by real - time pcr .
liver tissue was obtained from transplant donors as controls .
results .
41 hcv - positive patients were included , 26 males ( 60.5% ) ; mean age of 45 ( 7.9 ) ; 33 ( 80.5% ) from genotype 1 . 6 out of 12 controls were males ( 50% ) ; mean age was 26.7 ( 3.2 ) .
there was expression of irs1 in leukocytes .
the median irs1 cells ( hcv ) were 0.061 ( 0.004 to 0.469 ) ; the median irs 1liver ( hcv ) was 0.0003 ( 0.00002 to 0.0186)lower than in controls ( resp .
, p = 0.005 and p = 0.018 ) .
homa - ir had an inverse correlation with irs 1liver ( p = 0.04 ) .
there was no correlation between irs1 liver and irs1 cells ( p = 0.930 ) .
conclusions .
there was expression of irs1 in leukocytes .
irs1 cells and irs1 liver were lower in hcv patients than in controls . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
rapidly progressive glomerulonephritis ( rpgn ) is a rare clinical syndrome that is characterized by signs of glomerulonephritis ( dysmorphic red blood cells [ rbcs ] , proteinuria ) , rapid and progressive deterioration in renal function and is associated with the extensive crescent formation surrounding 50% of glomeruli on kidney biopsy . rpgn can be classified as primary ( i.e. , in absence of underlying preexisting glomerular disease , e.g. , anti - glomerular basement membrane ( gbm ) antibody disease , renal limited vasculitis ) or secondary to systemic disease ( e.g. , postinfectious , goodpasture 's syndrome , microscopic polyangiitis , granulomatosis with polyangiitis , eosinophilic granulomatosis with polyangiitis , systemic lupus erythematosus ) or could be superimposed on underlying preexisting glomerular disease ( e.g. , crescentic - iga nephropathy [ c - igan ] ) . while acute kidney injury ( aki ) may be the initial presentation in c - igan , it can rarely present as nephrotic syndrome mainly associated with advanced glomerulosclerosis . the treatment of c - igan has not been studied in the randomized clinical trial . observational clinical studies have showed some clinical improvement with the combination of corticosteroids , cyclophosphamide and plasma exchange for variable period of time . a recent study of patients with c - igan found that nearly 70% of the patients progressed to end - stage renal disease ( esrd ) in 5 years despite receiving immunosuppressive therapy . a randomized controlled trial of mycophenolate mofetil ( mmf ) treatment in severe iga nephropathy by chen et al . showed that the use of mycophenolate is associated with decrease in proteinuria within 3 months . however , there is no study to evaluate the role of mycophenolate sodium in c - igan . we report a case of c - igan that was successfully treated with combination immunosuppressive therapy including mycophenolate with long - term follow - up . a 54-year - old male presented to his primary doctor with runny nose , fever , chills , and facial swelling . he denied any past medical history of diabetes mellitus , hepatitis , or blood transfusion . eleven days after the initial presentation , labs revealed aki with elevated serum creatinine of 3.8 mg / dl , microscopic hematuria , and massive proteinuria ( 18 g / day ) . review of the system was negative for nausea , vomiting , diarrhea , dyspnea , gross hematuria , arthralgia , or rash . there was no history of intravenous ( iv ) drug use . on physical examination , blood pressure was elevated at 197/101 mmhg , and there was pitting edema of bilateral lower extremity . the rest of the physical examination was unremarkable . at the time of initial presentation , patient had serum creatinine of 3.0 mg / dl , serum albumin 2.6 g / dl , total protein 5.1 g / dl , total cholesterol was 271 mg / dl and low - density lipoprotein level was 198 mg / dl . further laboratory investigations for secondary causes of glomerulonephritis revealed normal level of complements c3 and c4 . antinuclear antibody , cryoglobulin level , hepatitis b , hepatitis c , p - anti - neutrophil cytoplasmic antibody ( anca ) , c - anca , and anti - gbm ab were all negative . the patient subsequently underwent ultrasound - guided kidney biopsy . on renal biopsy , 39 glomeruli were identified . over half showed cellular crescent and 11 glomeruli demonstrated endocapillary hypercellularity [ figure 1 ] . immunofluorescence showed granular staining in glomerular mesangial areas for iga and c3 [ figure 2 ] . if was negative for igg , igm , c1q , fibrinogen and albumin . electron microscopy revealed electron - dense deposits in the mesangium and extensive foot processes effacement . light microscopic examination of kidney biopsy specimen revealed mesangial hypercellularity and crescent formation ( arrow ) in majority of glomeruli immunofluorescence showed granular staining in the mesangium for iga the patient was initially started on iv pulse corticosteroid for 3 days , followed by oral corticosteroid therapy and monthly iv cyclophosphamide for 6 months . after 6 months of ( the above ) therapy , 24-h urine protein decreased to 2 g and serum creatinine improved to 1.6 mg / dl . the patient was subsequently started on oral mycophenolate sodium 360 mg twice daily for six additional months as maintenance therapy . he was gradually tapered off oral corticosteroid therapy . at follow - up after 4 years of initial presentation , patient maintains normal renal function and has no proteinuria . over half showed cellular crescent and 11 glomeruli demonstrated endocapillary hypercellularity [ figure 1 ] . immunofluorescence showed granular staining in glomerular mesangial areas for iga and c3 [ figure 2 ] . if was negative for igg , igm , c1q , fibrinogen and albumin . electron microscopy revealed electron - dense deposits in the mesangium and extensive foot processes effacement . light microscopic examination of kidney biopsy specimen revealed mesangial hypercellularity and crescent formation ( arrow ) in majority of glomeruli immunofluorescence showed granular staining in the mesangium for iga the patient was initially started on iv pulse corticosteroid for 3 days , followed by oral corticosteroid therapy and monthly iv cyclophosphamide for 6 months . after 6 months of ( the above ) therapy , 24-h urine protein decreased to 2 g and serum creatinine improved to 1.6 mg / dl . the patient was subsequently started on oral mycophenolate sodium 360 mg twice daily for six additional months as maintenance therapy . he was gradually tapered off oral corticosteroid therapy . at follow - up after 4 years of initial presentation , patient maintains normal renal function and has no proteinuria . its presentation varies from asymptomatic hematuria to progressive renal failure requiring renal replacement therapy . on histopathology , the presence of mesangial hypercellularity , endocapillary hypercellularity , glomerulosclerosis , tubular atrophy and interstitial fibrosis is associated with poor prognosis . the presence of crescents was associated with hypertension , proteinuria , increased initial serum creatinine level and progression to esrd . in a multicenter study , lv et al . concluded that c - igan had a poor prognosis and initial serum creatinine level on presentation may predict kidney failure in patients with this disease . the 2012 kidney disease improving global outcomes guidelines suggested the use the steroid and cyclophosphamide in patients with iga nephropathy and rapidly progressive c - igan , which is similar to the treatment of anca vasculitis . however , there are no randomized controlled trials for the treatment of c - igan . in an observational retrospective study by roccatello et al . , intensive combination therapy with pulse steroid , cyclophosphamide and plasma exchange for 2 months showed a substantial delay in the onset of dialysis . while , the intensive treatment seemed sufficient to delay the progression of disease , it was inadequate to reverse the crescent formation and chronic changes . treated 12 patients with crescentic , proliferative iga nephropathy with pulse steroid and iv cyclophosphamide for 6 months . after 6 months of treatment , they found a significant decrease in serum creatinine level and proteinuria . on repeat biopsy after the treatment , they found that the endocapillary proliferation , cellular crescents , and karyorrhexis were eliminated . chen et al . conducted a randomized control trial of mmf treatment in severe iga nephropathy . they concluded that mycophenolate was more effective in reducing proteinuria and correcting serum lipid level , especially in patients with severe iga nephropathy and proteinuria > 2 g / day . however , there is no clinical study looking at the use of mycophenolate in the initial treatment of c - igan or as maintenance therapy . a combination of corticosteroid and cyclophosphamide - based induction therapy for 6 months followed by mycophenolate - based maintenance therapy resulted in complete remission of nephrotic syndrome and aki in our patient . our patient continues to be in complete clinical remission with normal renal function , 4 years after completing combined immunosuppressive therapy . based on our experience , one can consider mycophenolate sodium for maintenance therapy in c - igan . | optimal therapy and prognosis of crescentic - iga nephropathy ( c - igan ) are not known .
reported treatment options for c - igan include combination of corticosteroids and cyclophosphamide for 6 months .
the role of mycophenolate sodium in c - igan is unknown .
we report a case of c - igan that was successfully treated with combination immunosuppressive therapy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
prompt revascularization with percutaneous coronary intervention ( pci ) has significantly reduced the incidence of cardiogenic shock ( cs ) and improved survival in the setting of acute myocardial infarction ( ami).1,2 however , when it occurs , cs remains a highly fatal complication following an ami,3 despite aggressive revascularization and other adjunctive therapies.3,4 percutaneous ventricular assist devices ( pvads ) have been shown to provide superior hemodynamic support compared to intraaortic balloon pump ( iabp ) counterpulsation.4,5 in light of the recently reported studies that have failed to show a hemodynamic or survival benefit of iabp in the setting of post - ami cs,610 physicians might adopt a reflexive strategy to use pvads in this setting more often . while prospective randomized and adequately powered clinical trials remain warranted to evaluate the potential benefits of these new devices , real - world observational data can be useful to provide clinical insights on their use in daily routine practice . in the present study , we sought to evaluate the current use of impella 2.5 in patients with confirmed cs complicating an ami undergoing pci . in particular , we were interested in evaluating the outcomes of patients who received hemodynamic support with impella 2.5 ( abiomed , inc . , danvers , ma , usa ) , prior to pci versus those who received impella 2.5 after pci . a total of 154 consecutive unselected patients who were reported in the uspella registry to have undergone a pci and impella 2.5 hemodynamic support for a confirmed ami with a cs indication were included in our study . the uspella registry is an on - going multicenter voluntary registry open to all sites in the united states that have used the impella 2.5 for all indications in more than 10 patients . sites were invited to report all their consecutive impella 2.5 cases without pre - selection of indication or patients . between june 2009 and march 2012 , 47 us sites had joined the uspella registry . of these , 38 sites had contributed 1 or more cases of patients who met the study inclusion criteria of cs complicating an ami who underwent pci . the remaining 9 sites reported no patients who met the study ami with cs definition . the diagnosis of ami was confirmed by electrocardiographic changes indicative of new or presumed new ischemia ( significant new st - t changes or new left bundle branch block ) , the presence of elevated cardiac biomarker values or based on coronary angiography . cs was defined by the presence of the following criteria : ( 1 ) systolic blood pressure < 90 mmhg for > 30 min or the need for vasopressor and/or inotropic therapy and/or iabp to maintain a systolic blood pressure greater than 90 mmhg ; ( 2 ) signs of organ hypoperfusion such as oliguria / anuria , altered mental status , or cold extremities . patients who underwent other means of revascularization than pci or etiologies of shock other than ami were not included in this analysis . timing of impella insertion was left at the operating physician s discretion . coronary angiography and pci patients were treated with drug - eluting stents and/or bare metal stents and/or percutaneous transluminal coronary angioplasty according to individual experience and local institutional guidelines . the number of vessels and lesions treated and the use of adjunctive therapies were left at the physician s discretion . the primary end - point aimed to assess the potential difference in survival rate to discharge between patients who received impella 2.5 pre - pci and those who received it post - pci . the secondary end - points included the assessment of patients hemodynamics with impella 2.5 support and in - hospital incidence of myocardial reinfarction , stroke , repeat revascularization , renal insufficiency , bleeding , hemolysis , limb ischemia , vascular complications requiring surgical repair , and infection . myocardial reinfarction was defined as the recurrence of an mi distinct from the index event . stroke was defined as an ischemic or hemorrhagic cerebrovascular accident that persisted beyond 24 hours or less than 24 hours associated with infarction on an imaging study . renal insufficiency was defined as abnormal kidney function requiring dialysis ( including hemofiltration ) in patients who did not require dialysis prior to implant , or a rise in serum creatinine of greater than 2.5 mg / dl or greater than 2 times baseline . hemolysis was defined by abnormal plasma free hemoglobin values greater than 40 mg / dl or presence of hematuria . limb ischemia was reported whenever noted in the patient s chart as new incidences of hypoperfusion of the leg requiring treatment and marked by such symptoms as decreased skin temperature of the limb or decreased peripheral pulses . vascular complication requiring surgical repair was defined as a surgical intervention on a pseudoaneurysm , an arteriovenous fistula , a vessel dissection / perforation , or an access site thrombosis . infection was defined as a clinical infection accompanied by pain , fever , drainage , and/or leukocytosis treated with nonprophylactic antimicrobial agents . survival rate was reported at 30-day post - impella implant when available at the time of data collection . the impella 2.5 device ( abiomed , inc . ) has been described in detail elsewhere.11 briefly , the 12 fr microaxial pump is mounted on a 9 fr catheter . the pump is advanced retrogradely across the aortic valve into the left ventricle under fluoroscopy guidance . it generates up to 2.5 l / min of forward flow directly in the ascending aorta . heparinized dextrose fluid is purged through the pump and released in the general circulation at the usual rate of 412 ml / hr to prevent clot formation in the motor and early pump wear . the manufacturer recommends an activated thrombin time ( act ) of 160180 seconds during pump support . the uspella registry was designed by an executive steering committee and supervised by a scientific advisory board that oversaw its ongoing conduct . the registry protocol was reviewed and approved by the institutional review board at each site . investigators were asked to report in the registry all patients who had been supported with impella 2.5 at their institution regardless of indication . data were abstracted retrospectively from the medical record onto a standard case report form by the sites study coordinators who were centrally trained . information was collected retrospectively on patient s demographic characteristics , medical history , clinical presentation , hemodynamic , echocardiographic , and angiographic characteristics , treatment during hospitalization , hospital discharge status , and 30-day follow - up when available at the time of data collection . all patients reported in the registry that met the above definition of ami cs and underwent pci were included in the current analysis without pre - selection of patients or sites . an independent clinical event committee , consisting of 1 cardiovascular surgeon and 2 interventional cardiologists , adjudicated the in - hospital study end - points ( all - cause of death , reinfarction , stroke , repeat revascularization , renal insufficiency , and vascular complications requiring surgical repair ) . data are expressed as mean standard deviation ( sd ) , median with quartiles or frequencies and percentages , as appropriate . univariate analysis comparing impella pre - pci versus impella post - pci was performed with a chi - square test on discrete variables and with student s t - test or wilcoxon rank sum test for independent samples for continuous variables , as appropriate . survival to discharge is reported as the proportion of patients who were discharged alive from the hospital . as a supporting analysis , a kaplan - meier estimate with a log - rank test was used to compare survival rates up to 30 days between patients who received impella prior to pci ( pre - pci ) versus those who received impella after pci ( post - pci ) . surviving patients were censored at 30 days or last known follow - up , whichever is earlier in this analysis . pre - pci time interval was defined as time preceding the first pci balloon inflation . a multivariate forward stepwise logistic regression analysis was performed to identify the strongest independent predictors for in - hospital mortality while adjusting for potential confounding variables ; the model included baseline , procedural , and hemodynamic characteristics known to impact patient s outcome ( see results section for list of variables included in the model ) . a p - value of 0.05 was set as a forward stepping criterion to add sequentially variables from the model . data analysis was performed using jmp version 10.0 and sas version 9.2 statistical software packages ( sas institute , inc . , cary , nc , usa ) . a total of 154 consecutive unselected patients who were reported in the uspella registry to have undergone a pci and impella 2.5 hemodynamic support for a confirmed ami with a cs indication were included in our study . the uspella registry is an on - going multicenter voluntary registry open to all sites in the united states that have used the impella 2.5 for all indications in more than 10 patients . sites were invited to report all their consecutive impella 2.5 cases without pre - selection of indication or patients . between june 2009 and march 2012 , 47 us sites had joined the uspella registry . of these , 38 sites had contributed 1 or more cases of patients who met the study inclusion criteria of cs complicating an ami who underwent pci . the remaining 9 sites reported no patients who met the study ami with cs definition . the diagnosis of ami was confirmed by electrocardiographic changes indicative of new or presumed new ischemia ( significant new st - t changes or new left bundle branch block ) , the presence of elevated cardiac biomarker values or based on coronary angiography . cs was defined by the presence of the following criteria : ( 1 ) systolic blood pressure < 90 mmhg for > 30 min or the need for vasopressor and/or inotropic therapy and/or iabp to maintain a systolic blood pressure greater than 90 mmhg ; ( 2 ) signs of organ hypoperfusion such as oliguria / anuria , altered mental status , or cold extremities . patients who underwent other means of revascularization than pci or etiologies of shock other than ami were not included in this analysis . timing of impella insertion was left at the operating physician s discretion . coronary angiography and pci patients were treated with drug - eluting stents and/or bare metal stents and/or percutaneous transluminal coronary angioplasty according to individual experience and local institutional guidelines . the number of vessels and lesions treated and the use of adjunctive therapies were left at the physician s discretion . the primary end - point aimed to assess the potential difference in survival rate to discharge between patients who received impella 2.5 pre - pci and those who received it post - pci . the secondary end - points included the assessment of patients hemodynamics with impella 2.5 support and in - hospital incidence of myocardial reinfarction , stroke , repeat revascularization , renal insufficiency , bleeding , hemolysis , limb ischemia , vascular complications requiring surgical repair , and infection . myocardial reinfarction was defined as the recurrence of an mi distinct from the index event . stroke was defined as an ischemic or hemorrhagic cerebrovascular accident that persisted beyond 24 hours or less than 24 hours associated with infarction on an imaging study . renal insufficiency was defined as abnormal kidney function requiring dialysis ( including hemofiltration ) in patients who did not require dialysis prior to implant , or a rise in serum creatinine of greater than 2.5 mg / dl or greater than 2 times baseline . hemolysis was defined by abnormal plasma free hemoglobin values greater than 40 mg / dl or presence of hematuria . limb ischemia was reported whenever noted in the patient s chart as new incidences of hypoperfusion of the leg requiring treatment and marked by such symptoms as decreased skin temperature of the limb or decreased peripheral pulses . vascular complication requiring surgical repair was defined as a surgical intervention on a pseudoaneurysm , an arteriovenous fistula , a vessel dissection / perforation , or an access site thrombosis . infection was defined as a clinical infection accompanied by pain , fever , drainage , and/or leukocytosis treated with nonprophylactic antimicrobial agents . survival rate was reported at 30-day post - impella implant when available at the time of data collection . the impella 2.5 device ( abiomed , inc . ) has been described in detail elsewhere.11 briefly , the 12 fr microaxial pump is mounted on a 9 fr catheter . the pump is advanced retrogradely across the aortic valve into the left ventricle under fluoroscopy guidance . it generates up to 2.5 l / min of forward flow directly in the ascending aorta . heparinized dextrose fluid is purged through the pump and released in the general circulation at the usual rate of 412 ml / hr to prevent clot formation in the motor and early pump wear . the manufacturer recommends an activated thrombin time ( act ) of 160180 seconds during pump support . the uspella registry was designed by an executive steering committee and supervised by a scientific advisory board that oversaw its ongoing conduct . the registry protocol was reviewed and approved by the institutional review board at each site . investigators were asked to report in the registry all patients who had been supported with impella 2.5 at their institution regardless of indication . data were abstracted retrospectively from the medical record onto a standard case report form by the sites study coordinators who were centrally trained . information was collected retrospectively on patient s demographic characteristics , medical history , clinical presentation , hemodynamic , echocardiographic , and angiographic characteristics , treatment during hospitalization , hospital discharge status , and 30-day follow - up when available at the time of data collection . all patients reported in the registry that met the above definition of ami cs and underwent pci were included in the current analysis without pre - selection of patients or sites . an independent clinical event committee , consisting of 1 cardiovascular surgeon and 2 interventional cardiologists , adjudicated the in - hospital study end - points ( all - cause of death , reinfarction , stroke , repeat revascularization , renal insufficiency , and vascular complications requiring surgical repair ) . data are expressed as mean standard deviation ( sd ) , median with quartiles or frequencies and percentages , as appropriate . univariate analysis comparing impella pre - pci versus impella post - pci was performed with a chi - square test on discrete variables and with student s t - test or wilcoxon rank sum test for independent samples for continuous variables , as appropriate . survival to discharge is reported as the proportion of patients who were discharged alive from the hospital . as a supporting analysis , a kaplan - meier estimate with a log - rank test was used to compare survival rates up to 30 days between patients who received impella prior to pci ( pre - pci ) versus those who received impella after pci ( post - pci ) . surviving patients were censored at 30 days or last known follow - up , whichever is earlier in this analysis . pre - pci time interval was defined as time preceding the first pci balloon inflation . a multivariate forward stepwise logistic regression analysis was performed to identify the strongest independent predictors for in - hospital mortality while adjusting for potential confounding variables ; the model included baseline , procedural , and hemodynamic characteristics known to impact patient s outcome ( see results section for list of variables included in the model ) . a p - value of 0.05 was set as a forward stepping criterion to add sequentially variables from the model . data analysis was performed using jmp version 10.0 and sas version 9.2 statistical software packages ( sas institute , inc . , cary , nc , usa ) . between july 2008 and may 2012 , a total of 154 consecutive unselected patients from 38 us hospitals received mechanical hemodynamic support with impella 2.5 for cs complicating an ami . of the 154 patients , 63.4% were in cs at admission , 48.9% were transferred from an outlying facility to the institution where they received impella 2.5 , and 22.5% had sustained 1 or multiple witnessed out - of - hospital cardiac arrests ( ohca ) . at the time of impella insertion , 88.3% continued to be in sustained cs despite high - dose inotropes and/or iabp support . in the remaining patients ( 11.7% ) , the use of inotropes or iabp could not be documented in the case report forms . [ correction added on 2 jan 2014 , after first online publication : in the first paragraph of the results section , impella 2.5% has been changed to impella 2.5 . ] baseline characteristics cabg , coronary artery bypass grafting ; copd , chronic obstructive pulmonary disease ; egfr , estimated glomerular filtration rate ; iabp , intra - aortic balloon pump ; iqr , inter - quartile range ; lvef , left ventricular ejection fraction ; pci , percutaneous coronary intervention ; pvd , peripheral vascular disease ; sd , standard deviation ; stemi , st elevation myocardial infarction ; sts , society of thoracic surgeons . a total of 63 patients received impella 2.5 support prior to pci ( pre - pci group , 40.9% ) and 91 patients received impella post - pci ( post - pci group , 59.1% ) . patients presenting with an st - segment elevation myocardial infarction ( stemi ) were more likely to receive impella after pci ( 87.9% vs. 55.6% , p < 0.0001 ) . the pre - pci and post - pci groups were similar in terms of baseline characteristics , duration of shock , extent of the infarct size ( as determined by baseline plasma troponin level ) , and pci success rate as measured by post - pci timi grade flow 01 , except for higher rate of diabetes ( 56.7% vs. 36.4% , p = 0.02 ) , peripheral vascular disease ( pvd ) ( 32.2% vs. 13.6% , p = 0.0008 ) , chronic obstructive pulmonary disease ( copd ) ( 22.9% vs. 10.7% , p = 0.05 ) , and prior stroke ( 15.3% vs. 5.1% , p = 0.04 ) in the pre - pci group ( table 1 ) . both groups had poor hemodynamics prior to impella support but with a greater magnitude when the impella insertion was delayed to after pci despite the more frequent use of iabp in this group ( table 2 ) . mechanical ventilation was required more often when impella insertion was delayed after pci ( 54.8% vs. 73.3% , p = 0.02 ) . more extensive revascularization was performed in patients who received impella pre - pci with more lesions ( 2.33 1.40 vs. 1.77 1.02 , p = 0.006 ) , more vessels treated ( 1.57 0.67 vs. 1.30 0.57 , p = 0.01 ) , and more stents placed ( 1.94 1.15 vs. 1.47 0.85 , p = 0.007 ) compared with patients who received impella post - pci . trends for more complete revascularization in pre - pci group were similar in both stemi and nstemi groups . procedural characteristics pci , percutaneous coronary intervention ; timi , thrombolysis in myocardial infarction ; sd , standard deviation . door - to - balloon time data are presented when available for patients admitted with stemi or diagnosed with stemi on admission . patients hemodynamics improved significantly after initiation of hemodynamic support with impella 2.5 to the same magnitude in both groups ( table 3 ) . the median duration of support was similar between the 2 groups ( table 2 ) . sbp , systolic blood pressure ; dbp , diastolic blood pressure ; map , mean arterial pressure ; pcwp , pulmonary capillary wedge pressure . a higher survival rate was observed in the pre - pci group as compared with post - pci group ( 65.1% vs. 40.7% , p = 0.003 ) . thirty - day follow - up data was reported for 145 ( 94.2% ) patients ( nine patients were lost to follow - up at 30-day visit ) . the kaplan - meier analysis confirmed the difference in mortality trends in favor of the pre - pci group up to 30 days ( 57.4% vs. 38.2% , log - rank test p = 0.004 , fig . the odds ratio of discharge survival for impella post - pci versus pre - pci was 0.37 ( 95% ci : 0.190.72 ) , again indicating lower survival for impella post - pci vs. pre - pci . odds ratios remained consistently favorable to the impella pre - pci group , either significantly or with strong favorable trends , within subgroups based on baseline , procedural , and hemodynamic variables that could be perceived as confounding variables ( fig . cs , cardiogenic shock ; dbp , diastolic blood pressure ; map , mean arterial pressure ; mv , mechanical ventilation ; nstemi , non - st elevation myocardial infarction ; pvd , peripheral vascular disease ; sbp , systolic blood pressure . cs , cardiogenic shock ; dbp , diastolic blood pressure ; map , mean arterial pressure ; mv , mechanical ventilation ; nstemi , non - st elevation myocardial infarction ; pvd , peripheral vascular disease ; sbp , systolic blood pressure . a multivariate forward stepwise logistic regression analysis was conducted to identify independent predictors of mortality in our study . the multivariate analysis model included the following as candidates for entry : age , gender , history of chronic obstructive pulmonary disease , diabetes , pvd or prior stroke , stemi versus nstemi presentations , cardiac arrest prior to admission , onset and duration of cs , patient transfer from outlying facility , evidence of anoxic brain injury pre - impella support , need for mechanical ventilation , systolic and diastolic blood pressure levels pre - impella support , level of inotropic support pre - impella support and potential use of iabp prior to impella support , and baseline serum creatinine levels . timing of initiation of impella support ( pre - pci vs. post - pci ) was also included as a candidate for entry in the model . the timing of initiation of impella 2.5 support relative to pci was identified as an independent predictor of improved survival to hospital discharge ( p = 0.01 ) while older age ( or 1.05 , 95% ci : 1.021.08 , p = 0.003 ) , number of inotropes ( p = 0.01 ) , cs onset prior to admission ( p = 0.03 ) , and need for mechanical ventilation ( p = 0.0003 ) were found to be independent predictors for increased in - hospital mortality ( table 4 ) . there was no difference between the pre - pci group and the post - pci group in the occurrence of in - hospital complications included in the secondary end - point ( table 5 ) . this is the largest cohort to date documenting the use of impella 2.5 in the setting of ami complicated by cs . the analysis provides insight into the presentation , management , and outcomes of patients supported with impella 2.5 at a large number of high- and low - volume pci centers over multiple years , thus providing a fair representation of the current use of the device in routine practice in ami cs across the united states . the results of our study showed that : ( 1 ) the use of impella 2.5 was primarily restricted to a rescue population that failed to respond to conventional measures including inotropic and iabp support ; and ( 2 ) although the risk for imminent death remained particularly high in this selected population , our findings suggest that the prompt use of impella prior to pci may significantly improve survival . our study showed that patients who received impella 2.5 in daily routine practice presented with greater risk features than those who were reported in recent ami cs randomized trials , reflecting a higher mortality observed in routine practice.12 indeed , 21% of our study patients presented with anoxic brain damage and 38.2% had a shock duration > 12 hours prior to impella support . thus , at least 38.2% of the patients included in our study would have been considered too sick and not eligible for enrollment in the iabp - shock ii trial.6 moreover , at presentation , the incidences of diabetes ( 44.6% vs. 35.4% , p = 0.05 ) , prior mi ( 38.6% vs. 23.7% , p < 0.0001 ) , and prior coronary artery bypass graft ( 14.2% vs. 6.7% , p = 0.01 ) , prior pci ( 38.5% vs. 21.1% , p < 0.0001 ) were significantly higher in the patients included in our study compared to the patients randomized in the iabp - shock ii trial.6 more importantly , 88.4% of our patients received impella after the first - line therapy with inotropes and/or iabp failed to stabilize their hemodynamics . despite these high - risk features , the overall survival rate was favorable in our study when compared to other ami cs series.1214 in our study , survival was significantly higher in the pre - pci group compared with the post - pci group . we hypothesized that active unloading of the left ventricle , hemodynamic stabilization of the patients with the impella prior to undergoing pci , and more complete revascularization may have led to improved outcomes in our study of ami cs . indeed , nonculprit intervention in the setting of cs is a reasonable approach after careful consideration , but may be limited in the clinical setting by worsening hemodynamics . considering the limitations inherent to the retrospective nature of our investigation , one may argue that patients in the post - pci group were simply sicker accounting for the higher in - hospital mortality observed in this group . therefore , the validity of our hypothesis rests largely on the determination of whether : ( 1 ) the pre - pci and post - pci groups were comparable with respect to baseline characteristics , and ( 2 ) whether the prompt initiation of hemodynamic support with impella may have resulted in treatment differences that may have influenced outcomes . in our series , patients who received impella prior to pci appeared to be as sick as those who received impella after pci while accounting for baseline characteristics , although they presented more often with higher - risk features such as diabetes , copd , pvd , or prior stroke compared to the latter group . patients in the pre - pci group had also more extensive coronary artery disease burden , a parameter that has been shown to be associated with increased mortality in cs.15,16 our results suggest that early hemodynamic support prior to pci has the potential to improve outcomes by enabling stable hemodynamics during the intervention and therefore probably allowing for more complete revascularization . this notion is supported by recent studies in the setting of ami cs that showed improved outcomes associated with a more complete revascularization strategy.17 the current societal guidelines support nonculprit pci at the time of primary pci in the setting of cs complicating an ami2 in the case of severe stenosis in arteries supplying large territory of myocardium . additionally , active left ventricular unloading and increased forward flow to the systemic circulation may have prevented further hemodynamics deterioration and progression of the downward spiral of shock and increased risk of peri procedural death . this might explain also the large difference in death events between the 2 groups observed within the first 48 hours of pci ( fig . 3 ) . the survival to discharge rate in the post - pci group was comparable to the results reported in the shock registry ( 40.7% vs. 39.8% , p = 0.87)12 the euroshock impella registry reported by lauten et al.13 or the single - site experience reported by engstrm et al.14 in the shock registry,12 iabp was used as the predominant means of hemodynamic support . unfortunately , iabp use has not been shown to significantly improve hemodynamics7 or clinical outcomes in the setting of ami cs.6,8,9 in our study , patients in the post - pci group had poor outcomes whether medical therapy alone or combined with iabp was used to support the patient hemodynamics during pci ( fig . 5 ) . in the euroshock impella registry , an overall survival rate of 35.8% to 30 days was reported by lauten et al . in a series of 144 patients with refractory cs who had failed first - line therapy with inotropes and iabp support.13 the authors of this series concluded that impella 2.5 was implanted in patients with a particularly poor hemodynamic profile and as a last - resort option . moreover , the number of lesions treated in this study was also comparable to the one observed in the post - pci group in our study ( 1.7 1.2 vs. 1.8 1.0 ) ; however , the timing of impella insertion relative to the revascularization procedure was not specified . in the engstrm et al.14 series , the authors reported that the decision to implant impella was delayed to after pci and dependent upon the diagnosis of profound cs and confirmed to be refractory to inotropic and iabp support . where time to reperfusion has become a quality metric , physicians may adopt a reflexive approach to minimize door - to - balloon time and therefore delay impella insertion , despite the fact that in general this quality metric does not apply to patients in cs . the results of our study showed that stemi patients who received impella pre - pci had a door - to - balloon time about an hour longer compared with those who received impella post - pci , yet had better outcomes . this may further reinforce the assumption that the pre - pci patients were perhaps more hemodynamically embarrassed and required more time to be stabilized before a pci could be undertaken compared to the post - pci group . indeed , it would not be reasonable for a physician to explant an iabp to insert an impella and delay the reperfusion if the patient had been stable enough with iabp therapy and conventional measures prior to pci . in our study , a majority of patients were admitted in cs and were in shock for more than 6 hours before revascularization with a large number of them being transferred from an outlying facility . these patients do not represent the typical stemi patients in whom the door - to - balloon time metric has been shown to correlate with outcomes . indeed , the extended door - to - balloon time did not seem to be a determinant factor in outcomes in this rescue population , suggesting that early stabilization of patients with effective hemodynamic support prior to pci would be a more appropriate goal rather than the current door - to - balloon time performance metric to affect the outcomes of these sick patients . our study includes several limitations to be considered : ( 1 ) the observational approach of our investigation can not infer a definitive causal relationship between the use of impella pre - pci and subsequent reduced mortality ; thus , our results will need to be confirmed by a prospective investigation ; ( 2 ) we can not exclude the presence of potential patient or site selection biases ; and ( 3 ) the timing of impella 2.5 insertion , the completeness of revascularization , and all adjunctive therapies were left to the discretion of the physician . thus , we can not totally eliminate the risk of potential treatment biases , and finally , ( 4 ) the duration of the follow - up was limited to the in - hospital phase and long - term follow - up could not be obtained . our study includes several limitations to be considered : ( 1 ) the observational approach of our investigation can not infer a definitive causal relationship between the use of impella pre - pci and subsequent reduced mortality ; thus , our results will need to be confirmed by a prospective investigation ; ( 2 ) we can not exclude the presence of potential patient or site selection biases ; and ( 3 ) the timing of impella 2.5 insertion , the completeness of revascularization , and all adjunctive therapies were left to the discretion of the physician . thus , we can not totally eliminate the risk of potential treatment biases , and finally , ( 4 ) the duration of the follow - up was limited to the in - hospital phase and long - term follow - up could not be obtained . the results of our study suggest that early initiation of hemodynamic support prior to pci with impella 2.5 is associated with more complete revascularization and improved survival in the setting of refractory cs complicating an ami . | objectivesto evaluate the periprocedural characteristics and outcomes of patients supported with impella 2.5 prior to percutaneous coronary intervention ( pre - pci ) versus those who received it after pci ( post - pci ) in the setting of cardiogenic shock ( cs ) complicating an acute myocardial infarction ( ami).backgroundearly mechanical circulatory support may improve outcome in the setting of cs complicating an ami . however , the optimal timing to initiate hemodynamic support has not been well characterized.methodsdata from 154 consecutive patients who underwent pci and impella 2.5 support from 38 us hospitals participating in the uspella registry were included in our study .
the primary end - point was survival to discharge .
secondary end - points included assessment of patients hemodynamics and in - hospital complications .
a multivariate regression model was used to identify independent predictors for mortality.resultsboth groups were comparable except for diabetes ( p = 0.02 ) , peripheral vascular disease ( p = 0.008 ) , chronic obstructive pulmonary disease ( p = 0.05 ) , and prior stroke ( p = 0.04 ) , all of which were more prevalent in the pre - pci group .
patients in the pre - pci group had more lesions ( p = 0.006 ) and vessels ( p = 0.01 ) treated .
these patients had also significantly better survival to discharge compared to patients in the post - pci group ( 65.1% vs.40.7% , p = 0.003 ) .
survival remained favorable for the pre - pci group after adjusting for potential confounding variables .
initiation of support prior to pci with impella 2.5 was an independent predictor of in - hospital survival ( odds ratio 0.37 , 95% confidence interval : 0.170.79 , p = 0.01 ) in multivariate analysis .
the incidence of in - hospital complications included in the secondary end - point was similar between the 2 groups.conclusionsthe results of our study suggest that early initiation of hemodynamic support prior to pci with impella 2.5 is associated with more complete revascularization and improved survival in the setting of refractory cs complicating an ami . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
natural products have historically been a rich source of bioactive compounds and represent a significant portion of marketed drugs , either unchanged or as templates for synthetic modification . in recent years natural products from marine sources have received increased attention,(3 ) in part due to the vast biodiversity of the marine environment , a situation that plausibly increases the need for chemical defenses as a result of intense competition and predation . as part of our own search for novel bioactive compounds , we have focused on marine cyanobacteria because of their propensity to produce a variety of structures that are frequently toxic to mammalian cancer cells.(4 ) oftentimes , groups of related compounds are produced , sometimes constituting quite large structural families . such chemical diversity is thought to be an inherent feature of biosynthetic pathways that adapt to changing environments through natural selection(5 ) and , through differences in activity , exhibit natural structureactivity relationships . an example of this is the lyngbyastatins / micropeptins , a large group of cyclic depsipeptide enzyme inhibitors that show differing selectivity for elastase , chymotrypsin , and trypsin . we recently reported the total structure determination of grassypeptolide(11 ) ( 1 , figure 1a),(12 ) a cyclic depsipeptide that contains several interesting features , including a rare -amino acid ( 2-methyl-3-aminobutyric acid , maba ) , a large number of d - amino acids , and extensive n - methylation . this compound shares some structural features with the cyanobactins , including lissoclinamide 7 ( see figure 1b ) . interestingly , although the cyanobactins are now known to be biosynthesized through a novel ribosomal pathway,1 is most likely the result of a nonribosomal peptide synthetase ( nrps ) system , because of the incorporation of nonproteinogenic units and n - methylation . although both classes of natural products commonly contain d - amino acids , epimerization is believed to be nonenzymatic in the majority of ribosomal cyanobactins.(16 ) like lissoclinamide 7 , 1 is cytotoxic to a number of human cancer cell lines . we now report two new analogues of 1 , grassypeptolide b ( 2 ) and grassypeptolide c ( 3 ) . while 2 shows cytotoxicity similar to that of 1 , compound 3 is 1623-fold more potent . additionally , we demonstrate that 1 and 3 can bind to cu and zn , which may contribute to their activity . structures of grassypeptolide a ( 1 ) , b ( 2 ) , and c ( 3 ) ( a ) and of lissoclinamide 7 ( b ) . samples of lyngbya confervoides were collected off the florida keys as previously described and in a more recent recollection . compounds 2 and 3 were obtained as minor components of nonpolar extracts ( meohetoac , 1:1 ) , following silica chromatography and reversed - phase hplc . the h nmr spectrum of 2 in cdcl3 is strikingly similar to 1 , except for the presence of a relatively downfield methyl doublet ( h 1.65 , see table 1 and table s1 , supporting information ) , indicative of an alanine . indeed , examination of the cosy , edited hsqc and hmbc spectra for 2 revealed the presence of the same units found in 1 , except that ala was present in the place of 2-aminobutyric acid ( aba ) . overall , both proton and carbon chemical shifts of 1 and 2 were comparable , suggesting that the sequence of units and also the relative configuration of both compounds are the same ( see table 1 ) . the sequence could be confirmed easily by examination of hmbc and roesy correlations ( table s1 , supporting information ) . the obtained yield of 2 was much less than for 1 ( 1.7 versus 16.4 mg , respectively , from both collections combined ) . however , by using h2o to produce a saturated solution , a small amount of crystals could be produced that were adequate for x - ray diffraction studies ( see experimental section ) . the resulting structure ( figure 2a ) is essentially superimposable to that of 1 , despite the fact that the crystals were formed under different conditions ( figure 2b ) . as expected , the relative configuration of all stereocenters was the same as that for 1 . because the flack x parameter is near zero [ 0.16 ( 10 ) ] and the specific rotations shown by 1 and 2 were close in value ( + 76 versus + 109 , respectively ) , the absolute configuration shown is correct . grassypeptolide crystal structures : ( a ) displacement ellipsoids ( 50% probability ) for the x - ray crystal structure of grassypeptolide b ( 2 ) ; ( b ) overlay of x - ray crystal structures of grassypeptolides a ( 1 , magenta ) and b ( 2 , cyan ) . the hresi / apcims spectrum of 3 suggested a molecular formula of c56h79n9o10s2 , the same as that for 1 . examination of the h nmr , cosy , edited hsqc , hmbc , and roesy spectra for 3 revealed the presence of the same units present in 1 , namely , 2-methyl-3-aminobutyric acid ( maba ) , thr , n - me - leu , n - me - phe - derived thiazoline carboxylic acid ( n - me - phe - thn - ca ) , pro , n - me - val , and phenyllactic acid ( pla ) . the presence of a 2-aminobutyric acid derived thiazoline carboxylic acid unit was proposed by default , as there were no hmbc or roesy correlations between the thiazoline ring and the aminobutyric acid portion . importantly , although the proton and carbon chemical shifts were very similar to those of 1 and 2 , those at position 28 were distinct ( h/c was 3.83/69.0 and 5.48/59.2 for 1 and 3 , respectively ) . second , the methyl signal at position 36 also showed substantially different chemical shifts ( h/c was 2.78/39.6 for 1 and 3.169/30.7 for 3 ) . examination of correlations in the hmbc and roesy spectra easily allowed the construction of the sequences of mabathrn - me - leu and aban - me - phe - thn - capron - me - valpla . a roesy correlation was present between h-28 and h-38 ( n - me - phe and pro -protons , respectively ) , suggesting that the intervening amide bond was cis , in contrast to the corresponding bond in the crystal structures of 1 and 2 . to confirm the complete sequence of 3 , esims / ms studies were carried out using 1 and 2 for comparison ( see figure 3 ) . analysis of the fragmentation patterns of 1 and 2 , as well as ms / ms / ms of the prominent ions 859.3 and 845.3 ( see figure 3 ) allowed the assignments shown . we found a dominant continuous series of mainly b ions , resulting from ring - opening at the pron - me - val amide bond . this is consistent with previous studies of cyclic peptide fragmentation , where only b ions were observed,(18 ) and it was noted that in some proline - containing molecules , ring opening predominantly occurs at this residue.(19 ) none of the other possible b ion series were observed . however , the major series resulted from loss of plan - me - val to give a pseudo c ion ( 859.3/845.3 , see figure 3 ) , followed by loss of thrmaba to give a b ion ( 641.2/627.2 ) , pron - me - phe ( 411.0/397.1 ) , and finally aba / ala - thn ( 241.2/241.1 ) . compound 3 showed a fragmentation pattern identical to that of both 1 and 2 , and therefore it shares the same sequence . correlations also observed in the roesy spectrum of grassypeptolide a ( 1 ) in cdcl3 are shown in bold , and correlations that were used as extra constraints in molecular modeling are shown in red . this correlation was previously observed in the roesy spectrum of grassypeptolide a ( 1 ) in dmso - d6 but not the roesy spectrum in cdcl3 . attempts to crystallize 3 failed , perhaps because the isolated yield ( 0.6 mg ) was insufficient . n hcl ( 110 c , 18 h ) , and the hydrolyzate was subjected to chiral hplc - ms to reveal the presence of d - allo - thr , n - me - l - val , l - pro , n - me - d - leu , and l - pla . compound 3 was treated with ozone at 78 c followed by oxidative workup and acid hydrolysis , and then the product was analyzed by chiral hplc - ms to detect the presence of d - aba . under these conditions two peaks were observed corresponding to n - me - l - phe and n - me - d - phe in the ratio 1.28:1 , respectively . more stringent ozonolysis conditions were then used to treat both 1 and 3 ( 30 min , rt ) in order to convert n - me - phe to n - me - asp . analysis of the reaction product of 3 by chiral hplc - ms again showed the presence of both enantiomers of n - me - asp in the ratio of 1.22:1 l to d. two peaks in the ratio of 1:1.85 corresponding to n - me - l - asp and n - me - d - asp , respectively , were also apparent in the ozonolysis product of 1 under the same conditions . in an attempt to liberate n - me - phe under milder conditions , leading to less epimerization , we treated both 1 and 3 with rucl3/naio4 , which in the past has been used both to cleave double bonds and to oxidize thioethers.(20 ) after hydrolysis of the reaction product with 6 n hcl ( 110 c , 16 h ) , chiral hplc - ms analysis revealed the presence of n - me - l - phe and n - me - d - phe in the ratios 1:4.88 for 1 and 3.35:1 for 3 , clearly indicating l - configuration in 3 and d - configuration in 1 . the difference in configuration at that position is consistent with nmr chemical shift evidence , as pointed out above . additionally , compounds 1 and 3 have very different specific rotations ( [ ]d of + 78 and + 18 , respectively ) , supporting a difference in configuration . consistent with previous experience with 1 , both l - cysteic acid and d - cysteic acid ( cya ) were detected in the ozonolysis product of 3 . since both enantiomers were observed in a similar ratio when derived from 1 and 3 ( 2:1 ) , and also because the h and c nmr chemical shifts of the thiazoline moiety signals are both much the same as those of 1 , the configuration of both are likely r in 3 as well as 1 . consequently , we conclude that 1 and 3 differ indeed only in the configuration at c-28 . considering that we isolated two epimers , 1 and 3 , from cyanobacterial extracts , a relevant question is whether the intact molecules can interconvert . this has some precedence , for example , a synthetic analogue of trunkamide a containing l - phe adjacent to the thiazoline in place of d - phe showed spontaneous epimerization to the natural product.(21 ) likewise , the synthetic 31s isomer of lissoclinamide 7 showed conversion to lissoclinamide 7 ( see figure 1b ) in the presence of pyridine and cdcl3 at 60 c , although the reverse conversion was not observed.(22 ) using these same conditions we were not able to convert intact 3 to 1 or vice versa , perhaps suggesting that neither are isolation artifacts . a reduced tendency for base - induced interconversion may reflect less overall strain in the macrocycle ; compounds 1 and 3 are 31-membered , whereas lissoclinamide 7 and trunkamide a are both 21-membered . the fact that the 28s isomer , compound 3 , was isolated in much reduced yield compared with 1 suggests that 3 could be a minor side - product of the biosynthesis of 1 or else is an activated form ( vide infra).(23 ) to further explore the potential conformational differences between 1 , 2 , and 3 , we carried out molecular modeling of 3 . apart from the differences in chemical shifts already noted , the nmr spectra of 1 and 3 are similar , which therefore suggested a fairly similar conformation for both compounds . in particular , the two jnh-h values that could be measured in 3 ( indicative of angles)(24 ) had almost the same values in 1 . therefore , the same roesy distances and angle constraints previously used for modeling of 1(12 ) were used . most of the roesy correlations observed for 1 were also seen for 3 ( see table 2 , common correlations shown in bold ) , but four extra interresidue correlations were added for modeling purposes ( see table 2 , shown in red ) . in addition , the n - me - phepro amide bond was set to cis as previously noted . as with modeling for 1 , 10 random structures were subjected to distance geometry followed by simulated annealing and then constrained molecular dynamics ( see experimental section ) . this resulted in two conformational families ; however , one clearly had higher calculated energies and a larger number of constraint violations ( 3 structures , average 61.2 kcal / mol and 8 violations ; see table s4s14 and figure s1 , supporting information ) . the other family was all within 1 rmsd of the lowest energy conformation and showed closely related backbone conformations ( 7 structures , average 35.1 kcal / mol and 2.3 constraint violations ; see figure 4a and table s4 ) . interestingly , this family contained two orientations of the n - me - phe side chain , with h-28 either pointing into the center of the macrocycle or away from it . the interconversion of these two forms would have resulted from a rotation of the c27c28 bond ( see figure 4b ) . the backbone conformation for the lower energy conformational family is also like that of the crystal structure of 1 ( see figure 4c ) . molecular modeling of grassypeptolide c ( 3 ) : ( a ) lower - energy conformational family of models of grassypeptolide c ( 3 ) ; ( b ) select models showing two possible orientations of the n - me - phe side chain ( lowest - energy examples of each ) ; ( c ) comparison of lowest energy conformation of 3 ( green ) and the crystal structure of 1 ( purple ) , showing n - me - phe -protons to illustrate configuration at this center and the amide bond that is trans and cis in 1 and 3 , respectively . previously , we found that 1 was cytotoxic against a number of cancer cell lines with ic50s in the low micromolar range.(12 ) compounds 2 and 3 were tested alongside 1 in two cell lines , ht29 ( colorectal adenocarcinoma ) and hela ( cervical carcinoma ; see table 3 ) . surprisingly , 3 was 1623 times more potent than 1 and 65-fold more potent than 2 . presumably this is due to differences in conformation and suggests that the region around the n - me - phe is crucial to cytotoxicity . interestingly , the synthetic 31s - isomer of lissoclinamide 7 ( figure 1b ) was also found to be more potent than the isolated natural compound in some cell lines.(22 ) to test if the antiproliferative effects were mediated by stage specific cell cycle arrest , we investigated the effect of both 1 and 3 on cell cycle in ht29 cells ( see figure 5 ) using facs - based dna content analysis . both compounds exhibited g1 arrest at lower concentrations , followed by g2/m arrest at higher concentrations , with 3 showing these effects at lower concentrations than 1 ( see figure 5 ) . an increase in apoptotic sub - g1 or sub - g2 populations is also seen . it is interesting that 3 , the most active of the series , was recovered as the most minor component from the cyanobacterial extract . this could be an indication that 1 requires activation by epimerization , possibly as a strategy for self - resistance by the producing organism . cell cycle analysis of ht29 cells treated with grassypeptolides a ( 1 ) and c ( 3 ) for 24 h. taxol served as a positive control for g2 arrest . cyclic peptides that have tandem thiazole / oxazole or thiazoline / oxazoline rings , for example , patellamides a and c and ascidiacyclamide ( see figure 6 ) , have been shown to bind to metals such as cu and zn . in the crystal structure of ascidiacyclamide,(27 ) each cu is coordinated to one thiazole , one oxazoline , and the intervening deprotonated amide ( see figure 6 ) , which has been termed a tao domain , and is also thought to bind cu in the patellamides . additionally , a nonspecific cytotoxic metal chelator ( tachpyridine ) has been shown to cause g2/m phase cell - cycle arrest in hela cells.(30 ) since compounds 13 also promoted g2/m cell cycle arrest and contained a motif comprising two thiazolines and an intervening amide ( similar to tao ) , we investigated the binding of 1 to cu and zn . the circular dichroism spectrum of 1 revealed positive maxima at 218 , 230 , and 253 nm ( see figure 7 ) . previously the cd spectra of patellamides a and c , lissoclinamides 9 and 10 , and ulithiacyclamide had been investigated . the near - uv cd maximum at 253 nm could be due to the aromatic n - me - phe and pla residues , while the far - uv maximum at 218 nm is similar to that observed in the random coil conformation of poly(lys).(32 ) the remaining maximum at 230 nm could be attributed to the tight turn at n - me - phe - thn - ca observed in the solid state and solution structures of 1 . the cd spectra of -turns are fairly variable,(33 ) but some examples exist with positive maxima near 230 nm . upon addition of one equivalent of cu , the shape of the cd spectrum of 1 changed ( see figure 7b ) , indicating that the binding of cu to 1 occurs , and that it is accompanied by a slight change in conformation . a second equivalent of cu did not cause a further change , indicating a 1:1 stoichiometry . addition of 1 equiv of zn to 1 also brought about a slight change in the cd spectrum ( see figure 7c and d ) . while cu caused both positive and negative changes in the cd spectrum of 1 ( see figure 7b ) , zn generated only positive changes ( see figure 7d ) , perhaps indicating different conformations for the resulting complexes . these results are qualitatively reminiscent of the changes in cd spectrum seen when cu and zn are added to lissoclinamide 10 , a 21-membered cyclic peptide that contains two thiazolines , an oxazoline and a proline.(31 ) in this compound , cu causes both positive and negative changes in the cd spectrum with two isobesic points , whereas zn causes only a negative change . unfortunately , there were insufficient amounts of 3 to obtain a cd spectrum ; however , we were able to obtain evidence of both cu and zn adducts by ms for both 1 and 3 ( see figure 8) . both compounds exhibited [ m h + cu ] ions with the expected isotope distribution , as well as several zn adducts ( [ m + zn ] , [ m h + zn ] , and [ m + zncl ] ) . structures of patellamides a and c and the structure of the bis - cu(ii)-ascidiacyclamide complex , with tao domains in red . circular dichroism spectra of grassypeptolide a ( 1 ) in the presence and absence of cu and zn : ( a ) cd spectra of 1 alone and after addition of 1 and 2 equiv of cu to 1 ; ( b ) differences induced in the cd spectrum of 1 by addition of cu ; ( c ) cd spectra of 1 alone and after addition of 1 or 2 equiv of zn ; ( d ) differences induced in the cd spectrum of 1 by addition of zn . ( a ) cu and zn adducts observed for 1 ; ( b ) cu and zn adducts observed for 3 ; ( c ) calculated isotope patterns for the observed metal adducts . we have described two new cytotoxic cyclic depsipeptides , grassypeptolides b ( 2 ) and c ( 3 ) . compounds 13 show a natural structureactivity relationship . while the replacement of d - aba ( 1 ) with d - ala ( 2 ) only slightly reduced potency , inversion of n - me - d - phe ( 1 ) to n - me - l - phe ( 3 ) lowered the ic50 by 1623-fold ( see table 3 ) . like the thiazole- and oxazoline - containing cyclic peptides patellamides a and c and ulithiacyclamide , compounds 1 and 3 can bind to metals . this activity may be a potential mechanism for cytotoxicity in mammalian cells , as many classes of enzymes are known to rely on metal cofactors . for example , ribonucleotide reductase ( rr ) requires iron for catalysis of the conversion of ribonucleotides to deoxyribonucleotides , the precursors needed for the synthesis of dna during s phase of the cell cycle . iron depletion by exogenous chelators therefore causes cell cycle arrest at the g1/s phase,(34 ) through inhibition of rr and other mechanisms.(35 ) however , metal chelators have been shown to induce g2/m cell cycle arrest under some conditions , such as desferrioxamine(36 ) and tachpyridine.(30 ) the latter was shown to mediate this effect through activation of chk1 and chk2 , potentially through ataxia - telangiectasia - mutated and rad3-related kinase ( atr ) . another potential target for metal chelators is cu / zn superoxide dismutase ( sod1 ) , which protects cells from superoxide radicals produced during normal metabolism and especially at times of oxidative stress . inhibition of sod1 can lead to buildup of reactive oxygen species ( ros ) , which can result in activation of both g1 and g2 checkpoint functions through the ataxia telangiectasia gene product ( atm).(39 ) our cell cycle data for 1 and 3 , where a degree of both g1 and g2/m phase arrest is seen , is consistent with these compounds abilities to bind metals . compound 1 has a low micromolar ic50 in a number of cancer cell lines , which is a potency similar to that of desferrioxamine(40 ) and tachpyridine.(30 ) compound 3 was more potent , and this could be due to an increased affinity for metals . however , it should be noted that the direct involvement of metals in the cytotoxicity of 13 was not demonstrated , and metal - independent major pleiotropic mechanisms of action for these compounds may exist . in light of previous examples of intricate protection / activation strategies in natural products,(23 ) a potential hypothesis is that compound 3 may represent an activated form of 1 , and this process may constitute a self - resistance strategy by the producing organism . we were unable to convert 1 to 3 under basic conditions , but this does not exclude conversion by a specific enzyme . compound 3 could also be a minor byproduct of the biosynthesis of 1 , or it could be the result of a modified pathway in a minority of cells in the collected material . nmr spectra for 2 and 3 were acquired on an nmr spectrometer using a 1-mm triple - resonance high - temperature superconducting cryogenic probe.(41 ) spectra were referenced to the residual solvent signals of cdcl3 [ h / c 7.26/77.0 ] . edited hsqc experiments were optimized for 145 hz , and hmbc experiments were optimized for 7 hz . samples of l. confervoides were collected off grassy key , florida , on may 26 , 2004 , and fractionated as previously described.(12 ) samples of the same species were collected off key largo , florida , on may 8 , 2003 , and fractionated as previously described.(17 ) silica gel fractions from both extracts eluting with i - proh and meoh were subjected to preparative hplc [ column , luna 10 m c18(2 ) 100a axi , 100 mm 21.2 mm , 10.0 ml / min , uv detection at 220 and 254 nm ] using a meohh2o linear gradient ( 60100% meoh over 30 min , then 100% meoh for 5 min ) . from each fraction , impure 2 eluted at tr = 21.5 min and 1 eluted at tr = 22.1 ( 14.5 mg ) . the collected peaks appeared the same by h nmr and so were combined before being subjected to another round of hplc purification [ column , ymc - pack ods - aq , 250 mm 10 mm , 2.0 ml / min ; pda detection , 190500 nm ] using a linear meohh2o gradient ( 6097.5% meoh over 28 min , then 97.5% meoh for 20 min ) to give 2 ( 1.7 mg ) at tr = 32.7 min . the 20:80 i - proh / ch2cl2 fraction from the silica column of the extract of the grassy key material was subjected to reversed - phase hplc [ column , ymc - pack ods - aq , 250 mm 10 mm , 2.0 ml / min ; pda detection , 190500 nm ] , using a linear meohh2o gradient ( 60100% meoh over 30 min , then 100% meoh for 20 min ) , to furnish 3 ( 0.6 mg ) and 1 ( 1.9 mg ) at tr 31.4 and 33.3 min , respectively . samples of l. confervoides collected off big pine shoals , florida , on may 30 , 2009 , were extracted as previously described.(12 ) the nonpolar extract was subjected to solvent partitioning to give hexanes- , butanol- , and water - soluble fractions . the butanol - soluble portion was directly fractionated over silica gel eluting with increasing amounts of i - proh in ch2cl2 . fractions eluted with 20% and 50% i - proh / ch2cl2 ( 15.8 mg and 32.2 mg , respectively ) consisted of mixtures of grassypeptolides a ( 1 ) , b ( 2 ) , and c ( 3 ) . each fraction was subjected to repetitive semipreparative hplc [ column , synergi hydro - rp 4 m 80a , 250 mm 10.0 mm or luna phenyl - hexyl 5 m 100a , 250 mm 10.0 mm , 2.0 ml / min , uv detection at 220 and 240 nm ] using a meohh2o linear gradient ( 60100% meoh over 30 min , then 100% meoh for 20 min or 80100% meoh over 20 min , then 100% meoh for 10 min ) to give grassypeptolides a ( 1 , 3.8 mg ) , b ( 2 , 0.4 mg ) , and c ( 3 , 0.6 mg ) , confirmed by h nmr and ms analysis . colorless amorphous solid ; [ ]d + 109 ; hresi / apcims m / z [ m + na ] 1110.5115 ( calcd for c55h77n9o10s2na , 1110.5133 ) , [ m + h ] 1088.5298 ( calcd for c55h78n9o10s2 , 1088.5313 ) ; uv ( ch2cl2 ) max ( log ) 224 ( 3.20 ) , 250 ( sh , 2.80 ) , 280 ( sh , 2.58 ) ; ir ( film ) max 3306 ( br ) , 3027 ( w ) , 2921 , 2851 , 2361 ( w ) , 1731 , 1641 , 1531 , 1453 , 1266 , 1225 , 1160 , 1122 , 1085 , 1026 , 967 , 913 cm ; h nmr , cosy , edited hsqc , hmbc and roesy , see table 1 and table s1 , supporting information . colorless amorphous solid ; [ ]d + 18 ; hresi / apcims m / z [ m + na ] 1124.5299 ( calcd for c56h79n9o10s2na , 1124.5289 ) , [ m + h ] 1102.5428 ( calcd for c56h80n9o10s2 , 1102.5470 ) ; uv ( ch2cl2 ) max ( log ) 224 ( 3.82 ) , 260 ( 3.41 ) ; ir ( film ) max 3419 ( br ) , 3056 , 2961 , 2920 , 2851 , 2306 , 2125 , 1750 , 1640 , 1515 , 1456 , 1265 , 1030 , 895 cm ; h nmr , cosy , edited hsqc , hmbc and roesy , see table 2 and supporting information . the entire isolated yield of 2 was dissolved in a small amount of filtered ch2cl2 , and then meoh was added , followed by h2o until the saturation point was reached . the solution was left to slowly evaporate at rt for 10 days to yield needle - shaped crystals . data were collected at 173 k on an x - ray diffractometer equipped with a ccd area detector and a graphite monochromator utilizing mo k radiation ( = 0.71073 ) . a full sphere of data ( 1850 frames ) was collected using the -scan method ( 0.3 frame width ) . the first 50 frames were remeasured at the end of data collection to monitor instrument and crystal stability ( maximum correction on i was < 1% ) . the structure was solved by the direct methods in shelxtl6 and refined using full - matrix least - squares . the non - h atoms were treated anisotropically , whereas the hydrogen atoms were calculated in ideal positions and were riding on their respective carbon atoms . in addition to the molecule , there is a methanol and water molecule in the asymmetric unit . they are both disordered and were refined in two parts with their site occupation factors dependently refined . a total of 730 parameters were refined in the final cycle of refinement using 3804 reflections with i > 2(i ) to yield r1 and wr2 of 5.71% and 8.84% , respectively . refinement was performed using f. a portion ( 50 g ) of 3 was subjected to acid hydrolysis ( 6 n hcl , 110 c , 18 h ) and then evaporated to dryness . the sample was reconstituted in 100 l of h2o and subjected to chiral hplc analysis [ column , chirobiotic tag ( 4.6 mm 250 mm ) , supelco ; solvent , meoh10 mm nh4oac ( 40:60 ph 5.39 ) ; flow rate , 0.5 ml / min ; detection by esims in positive ion mode ( mrm scan ) ] . d - allo - thr , n - me - l - val , l - pro , and n - me - d - leu eluted at tr = 12.6 , 13.1 , 14.8 , and 112 min , respectively . the retention times ( tr , min ; mrm ion pair , parent product ) of the authentic amino acids were as follows : l - thr ( 8.0 ; 120 74 ) , l - allo - thr ( 8.6 ) , d - thr ( 9.5 ) , d - allo - thr ( 12.6 ) , n - me - l - val ( 13.1 ; 132 86 ) , n - me - d - val ( 40.4 ) , l - pro ( 14.8 ; 116 70 ) , d - pro ( 41.9 ) , n - me - l - leu ( 16.2 , 146 100 ) , n - me - d - leu ( 112 ) . compound - dependent ms parameters were as follows : thr , dp 28 , ep 9 , cep 5 , ce 14 , cxp 3.5 ; n - me - val , dp 37 , ep 6 , cep 12 , ce 16 , cxp 3 ; pro , dp 36 , ep 10 , cep 8 , ce 22 , cxp 2.3 ; n - me - leu , dp 35 , ep 6 , cep 10 , ce 17 , cxp 3 . source - dependent ms parameters were as follows : cur 50 , cad medium , is 5500 , tem 750 , gs1 70 , gs2 70 . l - pla was detected with different conditions [ column , chirobiotic tag ( 4.6 mm 250 mm ) , supelco ; solvent , meohh2o ( both with 10 mm nh4oac , ph 5.43 ) ; flow rate , 0.5 ml / min ; detection by esims in negative ion mode ( mrm scan ) ] , at tr = 10.6 . the retention times ( tr , min ; mrm ion pair , parent product ) of the authentic amino acids were as follows : l - pla ( 10.6 , 165 147 ) , d - pla ( 11.5 ) . compound - dependent ms parameters were as follows : dp 37 , ep 3 , cep 9 , ce 17 , cxp 2.8 . source - dependent ms parameters were as follows : cur 50 , cad high , is 4500 , tem 750 , gs1 70 , gs2 70 . another portion of 3 ( 50 g ) in 3 ml of ch2cl2 was cooled to 78 c . ozone was bubbled through the solution for 30 min , which was then allowed to reach room temperature and evaporated to dryness . the residue was treated with h2o2/hcooh ( 15% w / v and 50% v / v in h2o , respetively , 70 c , 20 min ) , evaporated to dryness , and reconstituted in 100 l of h2o . analysis by chiral hplc [ column , chirobiotic tag ( 4.6 250 mm ) , supelco ; solvent , meoh10 mm nh4oac ( 40:60 , ph 5.39 ) ; flow rate , 0.5 ml / min ; detection by esims in positive ion mode ( mrm scan ) ] , revealed the presence of d - aba at tr = 15.4 , but both n - me - l - phe and n - me - d - phe were detected at tr = 25.3 and 47.3 min , respectively , in the ratio 1.28:1 . the retention times ( tr , min ; mrm ion pair , parent product ) of the authentic amino acids were as follows : l - aba ( 9.1 , 104 58 ) , d - aba ( 15.4 ) , n - me - l - phe ( 25.3 , 180 134 ) , n - me - d - phe ( 47.3 ) . compound - dependent ms parameters were as follows : aba , dp 41 , ep 2 , cep 8 , ce 14 , cxp 2.3 ; n - me - phe , dp 30 , ep 10 , cep 13 , ce 20 , cxp 3 . source - dependent ms parameters were as follows : cur 50 , cad medium , is 5500 , tem 750 , gs1 70 , gs2 70 . samples of both 1 and 3 ( 50 g each ) were subjected to ozonolysis at room temperature for 30 min followed by oxidative workup and then subjected to chiral hplc analysis [ column , chirobiotic tag ( 4.6 mm 250 mm ) , supelco ; solvent , meoh10 mm nh4oac ( 30:70 , ph 5.14 ) ; flow rate , 0.5 ml / min ; detection by esims in negative ion mode ( mrm scan ) ] . for the ozonolysis product of 3 , both n - me - l - asp and n - me - d - asp were detected at tr = 6.6 and 10.6 min , respectively , in the ratio of 1.22:1 . the retention times ( tr , min ; mrm ion pair , parent product ) of the authentic amino acids were as follows : n - me - l - asp ( 6.6 , 146 102 ) , n - me - d - asp ( 10.6 ) . compound - dependent ms parameters were as follows : dp 33 , ep 4.5 , cep 14 , ce 18 , cxp 5 . source - dependent ms conditions were as follows : cur 50 , cad high , is 4500 , tem 750 , gs1 70 , gs2 70 . the ozonolysis product of 3 was also examined under different chiral hplc conditions [ column , chirex phase 3126 ( d ) ( 4.6 mm 250 mm ) , phenomenex ; solvent , 2 mm cuso4mecn ( 97.5:2.5 ) ; flow rate , 0.8 ml / min ; uv detection at 254 nm ] , to confirm the presence of d - allo - thr , n - me - l - val , l - pro and d - aba at tr = 14.5 , 16.3 , 17.4 , and 21.0 , respectively . in addition , both l- and d - cya were detected at tr = 19.8 and 23.7 , respectively , consistent with previous results for 1 ( ratio 2:1).(12 ) the retention times ( tr , min ) of the authentic standards were as follows : l - thr ( 10.3 ) , d - thr ( 11.6 ) , l - allo - thr ( 13.9 ) , d - allo - thr ( 14.5 ) , l - aba ( 15.0 ) , d - aba ( 21.0 ) , n - me - l - val ( 16.3 ) , n - me - d - val ( 22.2 ) , l - pro ( 17.4 ) , d - pro ( 33.6 ) , l - cya ( 19.8 ) , d - cya ( 23.7 ) . both 1 and 3 were treated with rucl3/naio4 using the procedure of jayaramann et al.,(42 ) with minor differences . portions of both compounds ( 100 g of 1 and 200 g of 3 ) were dissolved in ch3cn / ccl4/h2o ( 2:2:3 , 150 l total ) . to this was added powdered naio4 ( 3 equiv ) followed by rucl3 ( 0.7 mg ) , and the reactions were stirred at rt for 1 h. the reaction mixtures were then diluted with water and extracted with ch2cl2 . the combined ch2cl2 fractions were dried under n2 and then treated with 6 n hcl at 110 c for 16 h and evaporated to dryness . the resulting hydrolysates were subjected to chiral hplc analysis [ column , chirobiotic tag ( 4.6 mm 250 mm ) , supelco ; solvent , meoh10 mm nh4oac ( 40:60 , ph 5.39 ) ; flow rate , 0.5 ml / min ; detection by esims in positive ion mode ( mrm scan ) ] . for 1 , both n - me - l - phe and n - me - d - phe were detected at tr = 25.3 and 47.3 min , respectively , in the ratio 1:4.88 . for 3 , the ratio was reversed , with n - me - l - phe and n - me - d - phe detected in the ratio 3.35:1 . the retention times ( tr , min ; mrm ion pair , parent product ) of the authentic amino acids were as follows : n - me - l - phe ( 25.3 , 180 134 ) , n - me - d - phe ( 47.3 ) . source - dependent ms parameters were as follows : cur 50 , cad medium , is 5500 , tem 750 , gs1 70 , gs2 70 . the n - benzoyl o - methyl esters of ( 2r,3r)- and ( 2r,3s)-2-methyl-3-aminobutyric acid ( maba ) were treated with 6 n hcl at 110 c for 22 h. the products of each reaction were dried down and made up to 50 mm solutions in water . then , 10 l of 1 m nahco3 and 50 l of 1-fluoro-2,4-dinitrophenyl-5-l - leucinamide ( l - fdla , 1% w / v in acetone ) were added to 25 l of the maba stock solutions . the mixtures were heated to 35 c for 1 h with frequent mixing , then neutralized with 5 l of 2 n hcl , concentrated to dryness , and then reconstituted with 250 l of mecnh2o ( 1:1 ) . the fdla derivative of the ozonolysis product of 3 was prepared in a similar way using 45 g of starting material . derivatives were analyzed by reversed phase hplc [ column , kinetex 2.6 m c18 100a ( 4.6 mm 100 mm ) , phenomenex ; flow rate , 0.5 ml / min ; esims detection in negative ion mode ] , using a meohh2o ( both with 0.1% hcooh ) linear gradient ( 40100% meoh over 50 min ) . under these conditions two peaks were detected in the l - fdla derivative of the ozonolysate of 3 , corresponding to ( 2r,3r)- and ( 2s,3r)-maba - l - fdla , respectively , in the ratio 1.51:1 . this is consistent with the extent of epimerization at the 2-position observed after treatment of the standards with acid,(12 ) allowing the assignment of ( 2r,3r)-maba . the retention times ( tr , min ) of the authentic standards were as follows : ( 2r,3s)-maba - l - fdla ( 25.6 ) , ( 2r,3r)-maba - d - fdla(43 ) ( 25.6 ) , ( 2r,3r)-maba - l - fdla ( 27.1 ) , ( 2r,3s)-maba - d - fdla(44 ) ( 27.5 ) . compounds 1 and 3 were dissolved in cdcl3 ( 150 l ) and transferred to a 2.5 mm nmr tube . pyridine - d5 ( 0.5 l ) was added , and the tube was heated at 60 c for 72 h. conversion was assessed by h nmr . because of the general similarity of proton and carbon chemical shifts of 1 and 3 , the same distance and angle constraints were used as in the previously reported modeling of 1,(12 ) except that the amide bond between n - me - phe and pro was set to cis due to a roesy correlation between h-28 and h-38 in 3 . also , four additional distance constraints were added on the basis of roesy correlations unique to 3 . the modeling procedure used was identical to that previously used for 1,(12 ) with 10 random structures of 3 being subjected to ( 1 ) minimization , ( 2 ) distance geometry , ( 3 ) minimization , and ( 4 ) molecular dynamics in sybyl 7.3 . constraints were applied at every step , and the distance geometry procedure consisted of bounds generation , bounds smoothening , and embedding of coordinates , followed by an optimization procedure where the structures were minimized and subjected to simulated annealing ( sa , 2000 to 200 k over 100,000 fs , step time 0.3 fs ) and then another round of minimization . dynamics were run at 500 k for 1 ns , with a step size of 1 fs . following simulation , structures were overlaid in pymol by pair - fitting backbone carbons only . ht29 and hela cells were cultured in dulbecco s modified eagle medium ( dmem ; invitrogen ) containing 10% fetal bovine serum ( hyclone ) in a humidified atmosphere containing 5% co2 at 37 c . cells were seeded into 96-well plates at a density of 10 000 cells / well ( ht29 ) or 3 000 cells / well ( hela ) in 100 l of medium . after 24 h , compounds 13 were added to wells at varying concentrations ( as 1 l stock solutions in dmso ) . taxol was used as a positive control for cytotoxicity , and dmso alone was used as a negative control . after 48 h of treatment the plates were developed with mtt dye according to the manufacturer s protocol ( promega ) . taxol exhibited ic50s of 2.2 and 1.7 nm for ht29 and hela cells , respectively . ht29 cells were seeded in 6 cm dishes ( 650 000 cells / dish in 3 ml of dmem ) . after 24 h of incubation , various concentrations of 1 and 3 were added to the dishes , in 10 l of dmso . after a further 24 h , cells were washed with pbs and then detached with 600 l of trypsin ( invitrogen ) . dmem ( 2 ml ) was added to each dish , and the cell suspensions were centrifuged at 650 g for 10 min . the supernatant was discarded , and the cells were resuspended in 500 l of pbs and centrifuged again at 650 g for 10 min . the supernatant was discarded , and the cells were resuspended in 300 l of pbs before 700 l of ice - cold etoh was added . cells were incubated at 20 c for 30 min , and then centrifuged at 890 g for 10 min . the etoh / pbs was removed , and then cells were resuspended in 500 l of pbs containing 1 mm edta and 1 mg / ml rnase a ( sigma ) . the cells were incubated at 37 c for 30 min , with shaking , and then 5 l of propidium iodide ( 1 mg / ml , invitrogen ) was added to each tube . fluorescence from propidium iodidedna complexes was quantified using facscan ( becton dickinson ) . aliquots of 1 ( 200 g ) were added to various amounts of cucl2 in ch2cl2meoh ( 1:100 , total volume 400 l ) . solutions of 1 ( 10 g / ml ) were made containing various amounts of cu or zn in ch2cl2meoh ( 1:100 ) and directly infused the esims at a rate of 10 l / min . ms parameters were as follows : dp 113.5 , ep 4.5 , cep 45 , cur 10 , is 5500 , tem 400 , gs1 20 , gs2 10 . | grassypeptolides ac ( 13 ) , a group of closely related bis - thiazoline containing cyclic depsipeptides , have been isolated from extracts of the marine cyanobacterium lyngbya confervoides .
although structural differences between the analogues are minimal , comparison of the in vitro cytotoxicity of the series revealed a structureactivity relationship . when the ethyl substituent of 1 is changed to a methyl substituent in 2 , activity is only slightly reduced ( 34-fold ) , whereas inversion of the phe unit flanking the bis - thiazoline moiety results in 1623-fold greater potency .
we show that both 1 and 3 cause g1 phase cell cycle arrest at lower concentrations , followed at higher concentrations by g2/m phase arrest , and that these compounds bind cu2 + and zn2 + .
the three - dimensional structure of 2 was determined by ms , nmr , and x - ray crystallography , and the structure of 3 was established by ms , nmr , and chemical degradation .
the structure of 3 was explored by in silico molecular modeling , revealing subtle differences in overall conformation between 1 and 3 .
attempts to interconvert 1 and 3 with base were unsuccessful , but enzymatic conversion may be possible and could be a novel form of activation for chemical defense . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a 23-year - old japanese female presented with a pigmented skin lesion on the left lower leg . physical examination revealed a reddish - brown dome - shaped hyperkeratotic nodule of 11 10 mm with a sharply demarcated , symmetrical border ( fig . dermoscopic examination demonstrated prominent whitish scaly areas of ring - like appearance , pinkish - white structureless areas , a few milia - like cysts , dotted and glomerular vessels , light brown globules , and dotted hemorrhages ( fig . histopathologic study revealed a well - circumscribed symmetric lesion with no lateral extension of individual melanocytic proliferation . there were confluent nests with peripheral clefts composed of spindle - shaped and epithelioid melanocytes with large cytoplasm at the dermal - epidermal junction and in the papillary dermis ( fig . there were perivascular cell infiltration and maturation of nevus cells at the bottom of the lesion . immunohistochemical staining with melan - a or s-100 was positive for tumor cells , but the staining with hmb-45 was negative . melan - a was weaker in the deeply situated cells than in the superficial ones ( fig . 3a ) , and nests ascending up to the stratum corneum appeared as transepidermal elimination ( fig . spitz nevus is usually solitary and is encountered most commonly in the lower extremities and face . in most instances , however , because of few specific clinical features , it is often difficult to make a correct diagnosis of spitz nevus . accordingly , spitz nevus is sometimes clinically mistaken for other skin tumors such as hemangioma , verruca vulgaris , dermatofibroma , and so on . it looks pinkish in color because of a scarcity of melanin , and some lesions are associated with vascularization of the stroma . the major histological diagnostic criteria include the cell type ( epithelioid and/or spindle cells ) , the symmetrical appearance of the lesion , maturation of nevus cells at the bottom of the lesion , the lack of pagetoid spread of single melanocytes , and the presence of coalescent eosinophilic globules ( kamino bodies ) . minor diagnostic criteria include the presence of junctional cleavage , pseudoepitheliomatous hyperplasia , an absence of epidermal consumption , superficial dermal edema and telangiectasia , giant nevus cells , and an absence of nuclear pleomorphism . other histological changes that might rarely occur are stromal fibrosis , hyalinization of the stroma , and stromal mucin deposition . the histopathologic differential diagnosis of spitzoid tumors represents a difficult challenge . in our patient , the findings of acanthosis and hyperkeratosis favored the diagnosis of spitz nevus rather than melanoma . in addition , the proliferation pattern in the dermis was not sheet - like , but rather mainly confluent nests with stromal fibrosis , which also supported a diagnosis of spitz nevus . because of continuous sheet - like proliferation , stromal fibrosis is absent in melanoma . by immunohistochemistry , melan - a showed weaker staining in the deeply situated cells than in the superficial ones . this pattern , known as stratification , would not be seen in melanomas . on the basis of these clinicopathological features , a final diagnosis of verrucous spitz nevus on dermoscopy , pink spitz nevus typically exhibits little pigmentation and features a characteristic dotted vascular pattern . indeed , a dotted vessel pattern has been observed in 77.8% of spitz nevus cases . a negative pigment network surrounding dotted vessels has also been seen in 28.8% of cases . pigmented spitz nevus ( reed nevus ) shows very different appearances on dermoscopy ; it typically exhibits either a starburst or a the present case showed the characteristic dermoscopic pattern of verruca vulgaris , such as ring - like whitish scaly areas and dotted vessels . in addition , the presence of a central white patch was considered as the most common dermoscopic pattern in dermatofibroma . in fact , the dermoscopic similarity between spitz nevus and dermatofibroma is sometimes a cause of misdiagnosis . with the dermoscopic patterns in our case , we should have borne in mind some other differential diagnoses such as seborrheic keratosis , eccrine poroma , and spitz nevus , along with verruca vulgaris and dermatofibroma . the presence of milia - like cysts might have suggested a diagnosis of seborrheic keratosis . moreover , pinkish - white structureless areas with dotted hairpin or glomerular vessels are typical of the dermoscopic pattern in eccrine poroma . however , dotted vessels correspond to the proliferation of capillaries in the papillary dermis , which played a key role in the correct diagnosis of spitz nevus . moreover , dotted hemorrhages might often be seen in verruca vulgaris due to prominent papillomatosis , which is , on the contrary , not usually seen in spitz nevus . the histological difference between spitz nevus and verruca vulgaris would correspond to the different pattern on dermoscopy and , therefore , it might be a key feature for the differentiation of spitz nevus from verruca vulgaris . if we had initially interpreted the dermoscopic findings more carefully , we might have included a correct diagnosis of verrucous spitz nevus , at least in the list of differential diagnoses . | a 23-year - old female presented with a reddish - brown dome - shaped hyperkeratotic nodule of 11 10 mm on the left lower leg . dermoscopic examination demonstrated a prominent whitish scaly area with ring - like appearance , pinkish - white structureless areas , a few milia - like cysts , dotted and glomerular vessels , and light brown globules .
the lesion was completely excised under the diagnosis of verruca vulgaris or dermatofibroma .
histopathological examination revealed a well - circumscribed symmetric lesion with hyperkeratosis , acanthosis , and pseudohorn cysts .
the lesion was composed of spindle - shaped and epithelioid melanocytes with large cytoplasm arranged in confluent nests surrounded by stromal fibrosis .
mitotic figures and kamino bodies were absent .
moderate proliferation of capillaries was found in the papillary dermis .
immunohistochemical staining with melan - a or s-100 was positive for tumor cells , but the staining with hmb-45 was negative .
melan - a staining was weaker in the deeply situated cells than in the superficial ones , which is known as stratification .
finally , we made a diagnosis of verrucous spitz nevus based on these findings .
we should have been aware of the entity of verrucous spitz nevus as a variant of spitz nevus and its dermoscopic features in order to reach a correct diagnosis before excision . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
low levels of physical activity and high amounts of sedentary behaviour are two significant correlates of child and adolescent overweight and obesity . paediatric obesity is associated with cardiovascular risk factors such as high blood pressure , dyslipidemia , and insulin resistance . on the other hand , regular participation in physical activity can improve bone mineral density , cardiorespiratory fitness , and body composition and reduce the risk of depression [ 36 ] . to accrue optimal health benefits , current canadian physical activity guidelines recommend that adolescents accumulate at least 60 minutes of moderate - to - vigorous intensity physical activity ( mvpa ) every day and limit their recreational screen time ( i.e. , sedentary behaviour ) to 2 hours per day or less . the guidelines also recommend that adolescents limit the amount of time they spend sitting for long periods and undertaking passive transportation . despite both adolescents and parents being aware of the potential health benefits , only 4% of girls and 9% of boys in canada accumulate 60 minutes of mvpa on at least six days a week , and 60% of youth spend more than 2 hours per day participating in screen - based activities . thus , identifying modifiable determinants of physical activity and sedentary behaviour among adolescents is important for designing effective interventions . social contacts and personal relationships are important determinants of adolescent health and health behaviour , including physical activity [ 1012 ] . adolescents ' immediate social environment includes , among other factors , relationships with parents , neighbours , friends , peers , teachers , and coaches . these relationships can assist in the transfer , encouragement , and discouragement of adolescent attitudes and behaviour as well as contribute to adolescents ' social and emotional wellbeing . friends have a particular influence on adolescent health as a large portion of time is spent at school and participating in extracurricular activities . mechanisms by which friends can influence individual behaviour include coparticipation ( i.e. , participating in the same behaviour with a friend ) , modeling ( i.e. , witnessing a friend or peer performing a behaviour ) , and social norms ( i.e. , perception of the amount the behaviour is performed by others or perception of approval of a behaviour ) [ 1416 ] . qualitative evidence indicates that friends provide support for physical activity initiation via coparticipation , being an active model , and verbal support . recent studies have begun to use social network analysis to gain insight into the complex world of adolescent networks of friends and peers and their influence on adolescent physical activity [ 10 , 11 ] . social network analysis is both a theoretical paradigm and methodological tool that provides a means of quantifying relationships among entities , such as individuals or organizations , and estimating patterns of association . friendship nominations amongst a group of individuals can be aggregated to form quantitative estimates of an individual 's friendship network . analysis of friendship networks has been used to examine and explain adolescent health behaviour such as smoking , body mass index , and dietary behaviour , and more recently physical activity and sedentary behaviour [ 10 , 11 ] . there is evidence to suggest associations between popularity , friend behaviour , and friendship reciprocity with regard to an individual 's physical activity level ; however , there are still mixed results on the association between aspects of friendship networks and sedentary behaviour [ 10 , 11 ] . gender differences also exist with regard to the influence of social networks on physical activity . for instance , friends ' physical activity has been associated with boys ' , but not girls ' , physical activity [ 2123 ] . within social network analysis there are a variety of measures that examine individual positioning and relationships which have yet to be explored within the context of physical activity and sedentary behaviour but that have been examined in relation to other behaviours [ 24 , 25 ] . these measures include ego - level variables such as clique membership ( i.e. , a group of at least three individuals who are all connected ) , betweenness centrality ( i.e. , an individual 's tendency to link other network members ) , as well as network - level variables such as network density ( i.e. , number of connections in a network as a percentage of the total possible connections ) . these network measures could provide an additional layer of understanding and greater insight into the overall influence of friends on individual behaviour . network density has been examined in the adolescent substance abuse literature [ 24 , 25 ] , and its applicability to physical activity and sedentary behaviour is worth investigating . while the associations between popularity and physical activity and sedentary behaviour have been examined [ 2630 ] , having fewer or no friends may result in limited opportunities for coparticipation in physical activity . the aim of this study was twofold : ( 1 ) to examine the associations between aspects of school - based friendship networks ( i.e. , friendship network density , friend behaviour , popularity , and network roles ) , general perceived social support from friends , and achievement of recommended levels of physical activity and sedentary behaviour for adolescent boys and girls and ( 2 ) to examine the extent to which general perceived social support from friends modifies associations between friendship network measures and physical activity and sedentary behaviour . this study is part of a larger calgary - based ( alberta , canada ) project entitled creating opportunities for resilience and engagement ( core ) connections . the sample constituted all grades from 5 to 9 schools in the school district who had over 600 students in size and who did not offer specialized programming ( e.g. , performing arts , hockey ) . the median income of neighbourhoods in which the schools were situated ranged from $ 72,170 ( school c ) to $ 92,453 ( school d ) higher than the median income for all calgary neighbourhoods ( $ 67,238 ) . in each school , all adolescents in grades from 7 to 9 were invited to participate in this study . a study information package was sent to homes seeking parental consent for their adolescent 's participation . one survey captured physical activity , sedentary behaviour , general perceived social support from friends , and sociodemographic characteristics . research assistants explained the importance of privacy and confidentiality and monitored the room constantly , making sure that students were not looking at each other 's screens . two survey items captured the number of days adolescents achieved at least 60 minutes of mvpa , outside of school hours , during ( 1 ) the past 7 days and ( 2 ) in a usual week . the composite score , estimated from averaging responses to these two items , has acceptable test - retest reliability . to reflect the current canadian youth physical activity recommendations , we dichotomized the composite score into ( 1 ) achieving at least 60 minutes of mvpa on six or fewer days per week ( insufficiently active ) versus ( 2 ) achieving at least 60 minutes of mvpa on 7 days per week ( sufficiently active ) . two survey items captured the time adolescents spend watching television or videos , using a computer , playing video games , or using a handheld device , outside of school , on a typical ( 1 ) weekday and ( 2 ) weekend day . the average hours spent sedentary per day was estimated ( [ 5 weekday hours + 2 weekend hours]/7 days per week ) and dichotomized into ( 1 ) more than 2 hours per day ( high sedentary ) versus ( 2 ) 2 hours or less per day ( low sedentary ) , reflecting the current canadian adolescent sedentary behaviour guidelines . acceptable test - retest reliability for weekday and weekend television / video use ( r = 0.80 and 0.69 , resp . , ) and weekday and weekend computer use ( r = 0.66 and 0.71 , resp . general perceived social support from friends was measured through a social support scale consisting of four items . these items asked adolescents to report on how often ( never , sometimes , most of the time , or all the time ) they had friends who tried to help them ; they could count on when things go wrong ; they could share happy and sad times ; and they could talk to about problems . responses to the four items were averaged , with higher scores reflecting higher levels of support . internal consistency for socioeconomic status was measured using the family affluence scale ( fas ) which included four items asking adolescents to report the number of cars , vans , or trucks their family owned ( i.e. , 0 , 1 , or 2 vehicles ) ; if they had their own bedroom ( i.e. , no = 0 or yes = 1 ) ; the number of times their family travelled away on holiday ( i.e. , 0 , 1 , 2 , or 2 times in past 12 months ) ; and the number of computers / laptops their family owned ( i.e. , 0 , 1 , 2 , or 2 ) . the responses to fas items were summed and tertiled into low ( fas : < 6 ) , medium ( fas : 6 - 7 ) , and high family affluence ( fas : 8 ) . the fas reflects household material wealth and it has been used in several studies investigating associations between family affluence , physical activity , and sedentary behaviour [ 36 , 37 ] , as well as in the health behaviour in school - aged children who collaborative cross - national study . adolescents reported their gender , age ( i.e. , 12 years , 13 years , and 14 years old ) , how long they have lived in canada ( i.e. , 5 years or > 5 years ) , and residential relocation ( i.e. , did not move or moved at least once in the last 12 months ) . the school attended by the adolescent was also recorded ( i.e. , school a to f ) . the school attended may provide a proxy for community situatedness and affluence that was not captured in the surveys but could be important with regard to physical activity and sedentary behaviour . adolescents were presented with a list of all individuals enrolled in their grade and were asked to indicate their closest friends . in other words , we used complete network survey methods , as opposed to ego - network methods , which ask respondents to name a certain number of friends and investigate the relationships among only those nominated . using social network analysis software ucinet , seven ego - network variables were estimated based on the received ( incoming ) friendship nominations from close friends . the variables included ( 1 ) ego friendship network density ( density ) ; ( 2 ) proportion of received nominations from adolescents who achieved recommended levels of physical activity ( proportion of active close friends ) ; ( 3 ) proportion of received nominations from adolescents who participated in more than the recommended amount of sedentary behaviour ( proportion of sedentary close friends ) ; ( 4 ) amount of times an individual lies on the shortest path between two other individuals ( betweenness centrality ) ; ( 5 ) total number of nominations an adolescent received from other adolescents ( popularity ) ; ( 6 ) whether an adolescent has connections with at least two other adolescents and all three adolescents are connected through friendship nominations ( clique member ) ; and ( 7 ) if the adolescent received no friendship nominations . density was dichotomized at the median density ( 12% ) of the 18 networks ( 3 grades 6 schools ) . the variables that were chosen density , proportion of active close friends , proportion of sedentary close friends , popularity , clique member , and popularity were consistent with theories of contagion in networks , theories of homophily ( like people hanging out with like people ) , and balance theory ( ties among triads ) , consistent with our interest in the generation and maintenance of norms , albeit that these were cross - sectional investigations . we included betweenness centrality as it is a measure of social status and potential influence , due to the capacity to control flows of information . gender - stratified descriptive statistics including mean and standard deviations ( sd ) for numerical variables ( i.e. , general perceived social support from friends , proportion of active close friends , proportion of sedentary close friends , betweenness centrality , and popularity ) and frequencies for categorical variables ( i.e. , age , fas , school , time living in canada , and residential relocation in the last 12 months , friendship network density , clique member , receiving no friendship nominations ) were estimated . gender - stratified independent samples t - tests , pearson 's chi - square tests , and subsequent z - tests for pairwise comparisons of proportions were undertaken to compare differences in all numerical and categorical variables , respectively . adjusted binary logistic regression models estimated the odds ratios ( or ) and 95% confidence intervals ( 95% ci ) for the association between sociodemographic variables ( age , fas , school attended , time living in canada , and residential relocation ) , social network variables ( friendship network density , proportion of active close friends , proportion of sedentary close friends , betweenness centrality , popularity , and clique member ) , and general perceived support from friends , and the likelihood of being ( 1 ) sufficiently active versus insufficiently active and ( 2 ) high sedentary versus low sedentary . taking an exploratory approach , we also conducted a backward stepwise likelihood ratio test to identify significant interaction terms ( p < 0.05 ) between general perceived social support from friends and each of the social network variables . to aid in interpretation of the regression results , the proportion of active close friends and proportion of sedentary close friends were converted to percentages and rescaled so that a one - unit change was equal to a ten percentual point change in these variables . adolescents who did not receive a friendship nomination were excluded from the regression models because at least one nomination was required for the calculation of the proportion of active close friends and proportion of sedentary close friends . instead , mann - whitney u tests were used to compare the amount of weekly physical activity and daily sedentary behaviour undertaken between those who did not receive a friendship nomination and those who received at least one friendship nomination . from the six schools , all adolescents ( n = 1,393 ) in grades 7 through 9 were invited to participate , of which 1,122 provided active consent ( 80.5% ) . a total of 1,061 adolescents subsequently provided complete data and were included in the analysis ( 76.2% of all those eligible ) . the sample included 535 girls ( 50.4% ) and 526 boys ( 49.6% ) , excluding adolescents who did not receive any close friendship nominations ( tables 1 and 2 ) . adolescents ' age ranged from 11 to 15 years and was distributed as follows : 12 years and younger ( boys = 40.9% , girls = 40.0% ) , 13 years ( boys = 31.0% , girls = 33.3% ) , and 14 years and older ( boys = 28.1% , girls = 26.7% ) . similar percentages of boys and girls had high family affluence ( boys = 37.5% , girls = 38.7% ) , middle family affluence ( boys = 43.0% , girls = 44.5% ) , and low family affluence ( boys = 19.6% , girls = 16.8% ) . a higher percentage of boys achieved recommended levels of physical activity per week compared with girls ( boys = 16.0% and girls = 7.3% ) , while participation in at least two hours of sedentary activity per day was similar between boys and girls ( boys = 79.8% and girls = 78.7% ) . the mean number of incoming closest friend nominations for boys was 6.99 ( sd = 3.79 ) and for girls was 6.52 ( sd = 3.45 ) . network densities for close friendships across the schools and grades ranged from 7.0% to 14.0% . there were 21 adolescents ( 9 boys , 12 girls ) who did not receive any friendship nominations . among these adolescents , 7 ( 33.3% ) were 12 years , 8 ( 38.1% ) were 13 years , and 6 ( 28.6% ) were 14 years of age . moreover , 7 adolescents ( 33.3% ) had low family affluence , 8 ( 38.1% ) had medium family affluence , and 6 ( 28.6% ) had high family affluence . adolescents who received no incoming nominations participated in significantly ( p < 0.05 ) fewer days per week of at least 60 minutes of mvpa compared with those who received at least one friendship nomination ( mean = 3.28 days / wk , sd = 1.76 days / wk versus 4.33 days / wk , sd = 1.81 days / wk , resp . ) . no difference in hours per day of sedentary behaviour was found . adjusting for all covariates , a ten percentage point increase in active close friends was significantly associated with an increased likelihood of being sufficiently active ( or 1.11 ; 95% ci 1.021.21 ) ( table 3 ) . boys with a higher general perceived social support from friends were significantly less likely to be sufficiently active ( or 0.63 ; 95% ci 0.420.96 ) . boys from school e were significantly less likely to be active compared with school a ( or 0.26 ; 95% ci 0.080.84 ) . there were no significant interactions between social network variables and boys ' general perceived social support from friends in relation to physical activity . adjusting for all covariates , boys in high density network were more likely to be highly sedentary compared with boys in low density networks ( or 2.93 ; 95% ci 1.326.49 ) ( table 3 ) . compared with boys 12 years of age , boys 14 years of age were more likely to be highly sedentary ( or 2.23 ; 95% ci 1.044.77 ) . moreover , boys in schools c ( or 2.92 ; 95% ci 1.048.21 ) and f ( or 4.24 ; 95% ci 1.3013.77 ) were significantly more likely to be highly sedentary compared with boys in school a. there was a significant interaction ( p < 0.05 ) between both the proportion of active close friends ( or 1.12 ; 95% ci 1.001.26 ) and proportion of sedentary close friends ( or 1.16 ; 95% ci 1.011.32 ) and general perceived social support from friends and being highly sedentary . after adjusting for all covariates , a ten percentage point increase in active close friends was associated with achieving sufficient levels of physical activity ( or 1.14 ; 95% ci 1.021.27 ) ( table 4 ) . there was a significant interaction ( p < 0.05 ) between the proportion of sedentary close friends and general perceived support from friends in relation to being sufficiently active ( or 1.31 ; 95% ci 1.041.67 ) . adjusting for all other covariates , girls in schools c , e , and f were more likely to be highly sedentary ( or 2.89 ; 95% ci 1.226.83 , or 2.71 ; 95% ci 1.037.13 , or 6.18 ; 95% ci 1.9419.64 , resp . there was a significant interaction ( p < 0.05 ) between general perceived social support from friends and clique membership and a decreased likelihood of being highly sedentary ( or 0.38 ; 95% ci 0.150.96 ) . no other significant associations were found between the other covariates and sedentary behaviour among girls . the low prevalence of participation in at least 60 minutes of mvpa every day and high prevalence of participation in over 2 hours per day of sedentary behaviour ( i.e. , recreational screen time ) in our sample of adolescents is consistent with other canadian studies [ 9 , 41 ] . for boys and girls , a higher proportion of active close friends we also found that , for boys , friendship network density was positively associated with sedentary behaviour . an important finding was that adolescents who received no friendship nominations spent significantly fewer days per week participating in 60 minutes of mvpa compared with adolescents who received at least one friendship nomination . our study highlights the potential importance of close friendship network characteristics in influencing physical activity and sedentary behaviour in adolescents . the association between close friends ' physical activity and an individual 's physical activity was consistent with previous findings [ 10 , 11 ] ; however , studies that undertook gender - stratified analysis found associations for friends ' physical activity and physical activity among boys , but not among girls [ 2123 ] . similar to sirard et al . who found that friend 's weekly hours of mvpa were significantly associated with boy 's and girl 's physical activity , we found that , regardless of gender , a higher proportion of active close friends were positively associated with achieving sufficient levels of physical activity . having close friends who are active appears beneficial ; however , our findings also suggest that not being nominated as a close friend may have a negative impact on physical activity behaviour . while few adolescents did not receive any close friendship nominations ( n = 21 ) , they were found to participate in less mvpa than those who received at least one close friendship nomination . for example , isolate adolescents are significantly more likely to smoke compared with adolescents who are socially connected to others ( i.e. , clique members ) . it is possible that adolescents who are not considered a close friend by others receive limited support or encouragement to participate in physical activity and may have no opportunities to coparticipate in physical activities with others . a complete network analysis , like that conducted here , allowed the investigators to observe those without friendship nominations , while an ego - network analysis , by definition , would not . this study was able to contribute knowledge relating to network density and network positioning and physical activity and sedentary behaviour . boys who were in a higher density network were more likely to be sedentary compared with those in a low density network . as the majority of boys were sedentary ( 80% ) , a higher density network may have allowed for more exposure to normative attitudes , ideals , and behaviour among adolescents within the network , which could result in an increased likelihood of an individual being highly sedentary . haynie found similar results for adolescent delinquency ; the interaction between high density and delinquent peer networks resulted in higher delinquency involvement . although not the primary focus of our study , there were significant differences in the likelihood of adolescents being sufficiently active , as well as highly sedentary , among the six schools . this study , which is part of a larger project focused on improving health and wellbeing , was not initially designed to capture information about school policies , programs , or opportunities for physical activity and sedentary behaviour . speculatively , it is possible that school characteristics and opportunities may have contributed to differences in physical activity and sedentary behaviour . for example , a review by bonell et al . found that schools with higher attainment and attendance , combined with lower truancy , had lower rates of student substance abuse . with regard to physical activity , cradock et al . found that characteristics of school campuses ( i.e. , school campus area per student , building area per student , and play area per student ) were each associated with higher levels of physical activity . therefore , it is possible that school characteristics may have accounted for the differences in levels of sufficiently active and highly sedentary adolescents among the schools in this study . evidence indicates that perceived social support for physical activity is positively associated with physical activity among adolescents [ 12 , 46 , 47 ] . our study did not measure perceived support for physical activity but assessed the role of feeling emotionally supported by friends , which was not limited to within - school friends . we found evidence of effect modification between perceived social support and friendship network variables in relation to sedentary behaviour . boys who reported higher general perceived social support from friends and had a higher proportion of active close friends were more likely to be sedentary , and boys who reported higher general perceived social support from friends and had a higher proportion of sedentary close friends were also more likely to be sedentary . we are unaware of previous studies examining the interaction between perceived social support from friends and social network variables in relation to physical activity and sedentary behaviour . the findings could reflect patterns of social interaction among adolescents that may provide individuals with a virtual ( e.g. , facebook , online gaming ) versus physical form ( e.g. , sports teams , face - to - face games ) of social support . boys may also receive social support from friends who are both sufficiently active and highly sedentary ; boys may participate in team sports with friends and also participate in sedentary activities with these friends , such as watching televised professional sports together . friends within social networks influence physical activity and sedentary behaviour , as well as the role of peer pressure , starting with qualitative studies . interactions between general perceived social support and social network variables were also found for girls . girls who reported higher perceived general social support from friends and had a higher number of sedentary close friends were more likely to be sufficiently active . moreover , girls who reported higher perceived social support from friends and who were members of a clique were less likely to be highly sedentary . it is possible that girls may have nonschool - based friends with whom they are active ( e.g. , sports teams ) . girls may receive social support from their female friends , who also happen to be highly sedentary but also have male friends with whom they participate in physical activities . some of our counter - intuitive findings for boys and girls may reflect our measure of general perceived social support which did not capture social support specifically associated with physical activity or sedentary behaviour . there may also be extenuating factors , such as family support , which have been shown to influence adolescent physical activity and sedentary behaviour that were not accounted for in this analysis . previous longitudinal analyses have shown that friends ' physical activity tends to become similar over time [ 21 , 27 , 5052 ] , indicating a process of friendship influence or socialization ; however , several of these studies [ 5052 ] also found that adolescents tend to select their friends based on similarities in physical activity . the low prevalence of sufficiently active boys ( 16.0% ) and girls ( 7.3% ) may have limited the statistical power to detect some meaningful associations from the regression models . the mismatch in context between our physical activity and sedentary behaviour measures ( i.e. , behaviour both inside and outside of school ) and social network measure ( i.e. , close friends inside the school ) might have resulted in fewer significant associations being found . the determinants of physical activity and sedentary behaviour in children and adolescents are multifaceted and complex . individual - level behaviour ( e.g. , motor ability and skill ) and psychological characteristics ( e.g. , self - efficacy , attitudes , enjoyment ) , the social environment ( e.g. , friends and parents , family relationships and structure , and culture ) , the physical environment ( e.g. , neighbourhood parks , play equipment , availability and access to screen - based devices , and urban design ) , policy ( e.g. , mandatory physical education and activity breaks in schools ) , and programs ( e.g. , walking school bus ) together influence patterns of physical activity and sedentary behaviour that adolescents undertake . our study focused on the influence of the social environment only and more specifically one aspect of the social environment adolescent school - based friendship networks on physical activity and sedentary behaviour . our study findings suggest that characteristics of school - based close friendship networks are differentially associated with physical activity and sedentary behaviour . specifically , social network - derived variables associated with physical activity differ from those associated with sedentary behaviour ; relationships between individuals ' and the proportion of active close friends appear to be associated with physical activity , while network density appears to be associated with sedentary behaviour . results from this study invite consideration of future public health interventions which utilize friendship influence to increase physical activity among adolescents . while we recognize that close friendship is a matter of complex personal choice , the opportunities to get to know new and more people , which could lead to this choice , are possibly amenable . increasing the proportion of active individuals within a friendship network , particularly those with a higher number of friends , may result in a snowball effect and increase the likelihood of other individuals becoming sufficiently active . harnessing the benefits of positive friendship influence to promote modeling and coparticipation could help adolescents achieve the recommended levels of physical activity required for optimal health benefits . in other fields , attempts have been made to harness the properties of friendship networks to improve health behaviour . however , we have a partial view of a more complicated picture . not only can an individual be both sedentary and active we have shown that different aspects of networks appear to support these behaviour differently . the low prevalence of sufficiently active and high prevalence highly sedentary adolescents in our study is worrying and therefore suggests that broader multifaceted community , environmental , and school - based interventions may be of more immediate practical benefit [ 55 , 56 ] . | background .
adolescent friendships have been linked to physical activity levels ; however , network characteristics have not been broadly examined . method . in a cross - sectional analysis of 1061 adolescents ( 1115 years ) , achieving 60 minutes / day of moderate - to - vigorous physical activity ( mvpa ) and participating in over 2 hours / day of sedentary behaviour were determined based on friendship network characteristics ( density ; proportion of active / sedentary friends ; betweenness centrality ; popularity ; clique membership ) and perceived social support .
results .
adolescents with no friendship nominations participated in less mvpa . for boys and girls , a ten percent point increase in active friends was positively associated with achievement of 60 minutes / day of mvpa ( or 1.11 ; 95% ci 1.021.21 , or 1.14 ; 95% ci 1.021.27 , resp . ) .
for boys , higher social support from friends was negatively associated with achieving 60 minutes / day of mvpa ( or 0.63 ; 95% ci 0.420.96 ) . compared with low density networks ,
boys in higher density networks were more likely to participate in over 2 hours / day of sedentary behaviour ( or 2.93 ; 95% ci 1.326.49 ) .
social support from friends also modified associations between network characteristics and mvpa and sedentary behaviour . conclusion .
different network characteristics appeared to have different consequences .
the proportion of active close friends was associated with mvpa , while network density was associated with sedentary behaviour .
this poses challenges for intervention design . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
it is common in medical practice to see patients having persistent pain and radiculopathy even after undergoing discectomy surgery.12 this has remained a significant source of dissatisfaction on the part of both patient as well as the surgeon . hence , it has always been a surgical dilemma for a surgeon to do a proper case selection for disc surgery.345 sciatic pain has been thought to be caused by the mechanical compression of nerve roots by the herniated nucleus pulposus.6 now , it has increasingly become evident that intervertebral disc disease ( idd ) also involves an underlying inflammatory component . inflammatory cytokines , such as interleukin-1 ( il-1 ) , il-6 and tumor necrosis factor- ( tnf- ) are produced at the site of disc herniation and are now considered responsible for the pain perceived by patient.789101112 hence , it is not only the mechanical compression of nerve root , but also the inflammation around the nerve roots , which unfortunately is responsible for postoperative pain , perceived by the patient in spite of surgeon doing his job of removing mechanical compression completely . we , in this study , have specifically tried to address this problem of predicting postoperative recovery in patients undergoing discectomy by using high sensitive c - reactive protein ( hscrp ) levels as a prognostic marker . underlying inflammation around disc herniation causes an increase in crp level by the miniscule amount.13 similar marginal increase in crp has also been noted in atherosclerosis by various studies aimed at predicting risk of coronary and cerebrovascular disease in apparently healthy populations much before its occurrence.14151617 crp usually is measured in clinical laboratories by either immunonephelometric or immunoturbidimetric assays.18 the current methods are generally reproducible , fully automated , and capable of measuring crp with a detection limit of 3 - 5 mg / l.18 although this detection limit is adequate for the traditional clinical utility of crp in monitoring infection , it renders most of the current assays useless in assessing and measuring the amount of inflammation around disc or atherosclerosis in apparently otherwise healthy populations . hence , this study has used hscrp assay for predicting inflammation around the nerve roots on very same principle , which has used hscrp for predicting coronary artery diseases . this ultrasensitive assay is capable of measuring hscrp at a concentration of 0.00095 mg / dl using ultrasensitive latex - enhanced immunoassay ( latex ) on the bn ii nephelometer.18 in this study , we evaluated the clinical utility of this immunoassay and compared its usefulness in predicting postoperative recovery in patients undergoing lumbar discectomy . we aimed to study association between preoperative hscrp blood level and postoperative recovery with the help of modified oswestry back disability score . we selected a study group consisting of 50 cases of established lumbar disc disease that underwent disc surgery by the same surgeon over a period of 1-year . all patients were reevaluated at 3 months , 6 months and 1-year with modified oswestry back disability score [ table 1 ] . the control group consisted of 50 normal subjects matched with the study group for age , sex and body mass index . study group had 17 cases of l4-l5 herniation , 22 cases of l5-s1 and 11 cases of combined l4-l5 with l5-s1 herniation [ figure 1 ] . our inclusion criteria in the study group consisted of age between 20 and 60 years , clinical evidence of herniation in the form of disc related radicular pain of > 3 months duration , not responding to conservative treatment and interfering with daily activities , radiological evidence of herniation : magnetic resonance imaging ( mri ) obtained during symptomatic period with 1.5 t using t2-weighted ( tr / te of 4000/90 ms ) and t1w ( tr / te of 600/10 ms ) sequences showing evidence of disc degeneration that is , dark nucleus pulpous after comparing its signal intensity with adjacent csf that is , grade 2 and above of schneiderman 's classification19 and disc protrusion in the spinal canal . modified oswestry back disability score bar diagram showing level of lesion exclusion criteria consisted of patients who have chronic inflammatory diseases or malignancy , medically unfit for surgical intervention , patients having any local and systemic source of infection , chronic smokers , patients with ischemic heart disease and stroke ( high baseline crp levels ) . all cases were subjected to detailed evaluation with the help of modified oswestry low back pain scale . it consisted of low back pain disability index questionnaire about pain intensity , personal care , lifting , standing , walking , sitting , sleeping , social life , travelling and employment / homemaking . preoperative 2cc blood sample was collected under all aseptic precautions in plain bulb for estimation of hscrp level from all cases and controls . we have used radiological classification for disc degeneration severity that is , schneiderman 's classification for mri which is grade 1 ( normal ) , normal height and signal intensity ; grade 2 ( intermediate ) , speckled pattern or heterogeneous , decreased , signal intensity ; grade 3 ( marked ) , diffuse loss of signal ; grade 4 ( absent ) , signal void [ figure 2 ] . bar diagram showing radiographic grading written informed consent was obtained from all cases and controls participating in the study after explaining the nature of the test and study design . institutional ethics committee clearance regarding study and collection of blood samples for crp tests after informed consent of individuals the preoperative blood samples were analyzed to assess the hscrp concentration , as measured by an ultrasensitive latex - enhanced immunoassay ( n - latex crpii ) . the mean age in the study group was 44.20 years with 31 males and 19 females in the study group . both study and control group are comparable with respect to age and sex at p < 0.05 [ figures 3 and 4 ] . the level of hscrp in the study group was between 0.050 and 0.710 mg / dl and in the control group , 0.005 - 0.020 mg / dl [ figure 5 ] . graph showing comparison of age distribution between two groups bar diagram showing comparison of sex distribution between two groups graph showing comparison of high sensitive c - reactive protein levels between two groups data were entered using ms - excel-2007 and analyzed using spss-16 software . following statistical tests of significance un - paired t - test for comparison between two group comparison ( for comparison of mean between study and control groups ) . one - way anova test with bonferroni 's posthoc test for comparison between three groups ( for comparison of mean between three groups numerical data ) . pearson 's correlation for correlation between two numerical variables ( e.g. hscrp , pre and postscores etc . ) chi - square test ( for comparison of proportions between two groups categorical data ) . mean hscrp level in the study group was 0.321 mg / dl standard deviation ( sd ) 0.192 mg / dl , as compared to 0.011 mg / dl sd 0.007 mg / dl in the control group , which is statistical significant at p < 0.01 [ table 2 ] . comparison of hscrp levels between two groups in the study group , there was no other correlation between preoperative score and level of disc herniation or radiological severity with the hscrp level at p < 0.001 . however , there is highly significant positive correlation between preoperative hscrp level and postoperative score at p < 0.005 ( pearson correlation ) [ table 3 ] . cases with hscrp level in the range of 0.1820 0.079 mg / dl , showed better recovery ( score improved > 10 points ) , while those with hscrp level in the range of 0.470 0.163 mg / dl , showed poor recovery ( score improved < 10 points ) [ table 4 and figure 6 ] . correlation between hscrp level and pre / postoperative score correlation between hscrp level and postoperative recovery graph showing comparison between high sensitive c - reactive protein levels and post operative score data were entered using ms - excel-2007 and analyzed using spss-16 software . following statistical tests of significance are used . un - paired t - test for comparison between two group comparison ( for comparison of mean between study and control groups ) . one - way anova test with bonferroni 's posthoc test for comparison between three groups ( for comparison of mean between three groups numerical data ) . pearson 's correlation for correlation between two numerical variables ( e.g. hscrp , pre and postscores etc . ) chi - square test ( for comparison of proportions between two groups categorical data ) . mean hscrp level in the study group was 0.321 mg / dl standard deviation ( sd ) 0.192 mg / dl , as compared to 0.011 mg / dl sd 0.007 mg / dl in the control group , which is statistical significant at p < 0.01 [ table 2 ] . comparison of hscrp levels between two groups in the study group , there was no other correlation between preoperative score and level of disc herniation or radiological severity with the hscrp level at p < 0.001 . however , there is highly significant positive correlation between preoperative hscrp level and postoperative score at p < 0.005 ( pearson correlation ) [ table 3 ] . cases with hscrp level in the range of 0.1820 0.079 mg / dl , showed better recovery ( score improved > 10 points ) , while those with hscrp level in the range of 0.470 0.163 mg / dl , showed poor recovery ( score improved < 10 points ) [ table 4 and figure 6 ] . correlation between hscrp level and pre / postoperative score correlation between hscrp level and postoperative recovery graph showing comparison between high sensitive c - reactive protein levels and post operative score c - reactive protein is an acute - phase reactant , the levels of which rise dramatically during infection / inflammatory processes occurring in the body . this increment in crp is due to a rise in the plasma concentration of il-6 , which is produced predominantly by macrophages around the disc tissue.20 hence , crp is commonly used parameter for monitoring infection / inflammationhours after tissue injury / infection.16 this study shows that , those with higher hscrp level preoperatively ( in the range of 0.470 0.163 mg / dl ) showed poor recovery after surgery in the form of pain relief , which was assessed with modified oswestry back disability score . this may suggest that pre op inflammatory neuritis as suggested by high hscrp level may determine the outcome of disc surgery . contrary to expected , we did not find any relation between preoperative score or radiological grading severity with preoperative hscrp level , which was similar to findings in related studies.21 until now , only two studies by sugimori et al.21 and le gars et al.,22 have studied the correlation of preoperative hscrp level with postoperative scores . we have used modified oswestry back disability score as compared with japanese orthopedic association score in these studies . in both these studies , there was no correlation found between the level of disc herniation and hscrp level . sugimori et al.21 used highly sensitive assay similar to one , which has been used in this study that is , ultrasensitive latex - enhanced immunoassay ( n - latex crpii ) , while le gars et al.22 used an enzyme - linked immunosorbent assay with limit detection of 0.0005 mg / dl . in both these methods , a systemic inflammatory response to local inflammation around the nerve roots was found using highly sensitive analysis of crp . this inflammatory response is due to the inflammatory cytokines , which are produced by macrophages and monocytes , in response to nerve root inflammation . many studies have shown and confirmed the inflammatory responses occurring in the herniated disc region . hence , further research is necessary to explore the possibility of the use of agents , such as tnf- blocker like infliximab.23 a positive correlation between the preoperative concentration of hscrp and the back disability score postoperatively , indicate that patients with a higher preoperative level of hscrp showed poor postoperative recovery due to persistent postoperative inflammatory neuritis in them . thus , hscrp will serve as a good supplementary prognostic marker for operative decision making in borderline and troublesome cases of sciatica . thus , this risk stratification using hscrp level is important because information about likely poor results after surgery may help the surgeon to reconsider treatment strategy and discuss same with patient while doing case selection for surgery . to conclude , high sensitive c - reactive protein will serve as a good supplementary prognostic marker for operative decision - making in borderline and troublesome cases of lumbar disc disease . | background : it is common in medical practice to see patients having persistent pain and radiculopathy even after undergoing discectomy surgery .
inflammatory cytokines , such as interleukins are produced at the site of disc herniation and are now considered responsible for the pain perceived by the patient .
this study has used high sensitive c - reactive protein ( hscrp ) assay for predicting inflammation around the nerve roots on very same principle , which has used hscrp for predicting coronary artery diseases in current clinical practice .
thus , purpose of this study is to test whether hscrp can stand as an objective tool to predict postoperative recovery in patients undergoing lumbar discectomy .
that is , to study association between preoperative hscrp blood level and postoperative recovery with the help of modified oswestry back disability score.materials and methods : a study group consisting of 50 cases of established lumbar disc disease and control group of 50 normal subjects , matched with the study group .
both the study and control groups were subjected to detailed evaluation with the help of modified oswestry low back pain scale both pre and postoperatively at 3 months , 6 months and 1-year .
the preoperative blood samples were analyzed to assess the hscrp concentration .
all the cases underwent surgery over a period of 1-year by the same surgeon.results:the level of hscrp in the study group was between 0.050 and 0.710 mg / dl and in the control group , 0.005 - 0.020 mg / dl .
there was highly significant positive correlation between preoperative hscrp level and postoperative score at p < 0.005 .
cases with hscrp level in the range of 0.1820 0.079 mg / dl , showed better recovery ( score improved > 10 points ) , while those with hscrp level in the range of 0.470 0.163 mg / dl , showed poor recovery ( score improved < 10 points).conclusion : hscrp will serve as a good supplementary prognostic marker for operative decision making in borderline and troublesome cases of lumbar disc disease . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the classic presentation of cauda equine syndrome ( ces ) is a middle - aged adult complaining of bilateral sciatica , bilateral lower extremity weakness , particularly below the knees , saddle anesthesia , and urinary or rectal incontinence8 ) . other etiologies include spinal stenosis , spinal tumors , hematomas , fractures , and infections2 ) . ces is a rare but devastating medical condition , requiring urgent surgery to improve neurological symptoms . ces progresses to paraplegia and permanent urinary or rectal incontinence , hence , ces is considered the absolute indication for lumbar disc surgery89 ) . some researchers have compared the urgency of ces surgery to that of evacuating an epidural hematoma after severe head trauma6 ) . there is considerable debate regarding the appropriate timing of surgery for ces10 ) . a meta - analysis by ahn et al.1 ) recommended operating within 48 hours of the onset of symptoms , due to the significant improvement in both sensory and motor disability as well as urinary function . it is generally accepted that surgical treatment of ces should be performed as soon as possible , specifically , within 48 hours of the onset of symptoms . we analyzed retrospectively whether early decompression surgery for ces , within 24 or 48 hours , or after 48 hours of the onset of autonomic symptoms influenced postoperative bladder function . in addition , several other factors that determine the success of the surgery outcome were analyzed to permit accurate treatment decisions . these factors included rectal incontinence , sexual dysfunction , ldh level and degree of spinal canal compression . we retrospectively reviewed the clinical data of 31 patients who had decompressive surgery for ldh and were diagnosed with ces between january 2001 and december 2014 at inha university hospital . all patients complained of urinary dysfunction by acute or chronic ldh but other symptoms due to ldh , such as motor weakness , radiating pain , rectal dysfunction , and sexual dysfunction were or were not presented in enrolled patients . acute and chronic ldh were defined that any symptom except for urinary dysfunction such as radiating pain , weakness was presented in patients within less than 6 weeks from onset of urinary dysfunction or more than 6 weeks from urinary dysfunction . an ldh below l2 level was included in this study and the improvement of initial symptoms after surgery were evaluated over a follow - up between 12 - 96 months . after surgery , patients had been classified into a normal bladder function group and an abnormal bladder function group , according to their bladder function improvement . we also assessed whether the time to operation from the onset of autonomic symptom , rectal dysfunction , sexual dysfunction ( male only ) , main level of disc herniation and degree of spinal canal compression correlated with surgical outcome . the data used to evaluate the surgical outcomes were collected from clinical charts , out - patient department surveys and interview call at december 2015 . we defined the time to operation as the duration between the onset of urinary dysfunction and decompression surgery . three categories were identified : less than 24 hours , 24 - 48 hours , and more than 48 hours . the symptoms were defined as follows : rectal dysfunction , as having difficulty defecating with decreased perianal sense ; sexual dysfunction , as having difficulty achieving erection ( in males only ) ; level of herniated disc , as the level at which most severe spinal canal compression occurred ; and degree of spinal canal compression , as the ratio of herniated disc anteroposterior ( ap ) diameter of the spinal canal to ap diameter of a normal spinal canal ( fig . the severity of urinary dysfunction at admission was categorized as mild ( did not require foley catheterization ) and severe ( required foley catheterization ) . 22.0 ( ibm co. , armonk , ny , usa ) and the odds ratio determined using pearson chi - square test . a total of 31 patients ( mean age , 50.7 years ; median , 51 years ; range , 19 - 83 years ) , comprising 26 male and 5 female patients were assessed during a 12- to 96-month follow - up . 10 patients were evaluated on 3 - 6 years after operation and 7 patients were evaluated on 6 - 9 years after operation . after decompression , 7 of these patients had normal bladder function and one had abnormal bladder function . of the 23 patients with decompression after 24 hours , 12 had a normal bladder function outcome and 11 had an abnormal bladder function outcome ( table 2 ) . the proportion of patients with normal bladder function outcome was higher when decompression was performed within 24 hours compared to after 24 hours but there was not statistically significant difference ( table 2 ) . of the 16 patients operated on within 48 hours , 13 and 3 patients had normal and abnormal bladder function outcome , respectively . of the 15 patients with decompression after 48 hours , 6 and 9 had normal and abnormal bladder function outcome , respectively . patients operated on within 48 hours compared to after 48 hours , had a significantly better outcome after decompression ( table 2 ) . the group operated on within 48 hours were 6.5 times more likely to have normal bladder function after decompression compared to the group with decompression after 48 hours ( odds ratio , 6.5 ; 95% confidence interval , 1.27 to 33.03 ; fisher exact test 2-sided , p=0.029 ) . there were no complications , such as dural tears and infection , during the perioperative period . the degree of spinal canal compression , which ranged between 10% and 80% , was categorized into less than 50% ( 16 patients ) and more than 50%(15 patients ) . after decompression , a respective 11 and 5 patients had normal and abnormal bladder function for patients with less than 50% compression . for patients with more than 50% compression , 8 and 7 patients had normal and abnormal bladder function , respectively , after decompression . the proportion of patients with normal bladder function outcome was higher in patients with less than 50% compression ( 68.7% ) compared to more than 50%(53.3% ) . but there was no statistically significant difference ( p=0.371 ) in the degree of spinal canal compression to the surgical outcome ( table 3 ) . after decompression , respective 11 and 7 patients had normal and abnormal bladder function for patients with rectal dysfunction . for patients without rectal dysfunction , 8 and 5 patients had normal and abnormal bladder function , respectively , after decompression . the proportion of patients with normal bladder function outcome was almost same in patients with rectal dysfunction ( 61.1% ) and without rectal dysfunction ( 61.5% ) . there was no statistically signifi ca nt difference ( p=0.981 ) in the rectal dysfunction to the surgical outcome . after decompression , respective 6 and 2 patients had normal and abnormal bladder function for patients with sexual dysfunction . for patients without sexual dysfunction , 12 and 6 patients had normal and abnormal bladder function , respectively , after decompression . the proportion of patients with normal bladder function outcome was higher in patients with sexual dysfunction ( 75.0% ) compared to patients without sexual dysfunction ( 66.6% ) . but there was no statistically significant difference ( p=0.671 ) in the sexual dysfunction to the surgical outcome . after decompression , respective 4 and 7 patients had normal and abnormal bladder function for patients with l234 ldh . for patients with l45s1 , 13 and 7 patients had normal and abnormal bladder function , respectively , after decompression . the proportion of patients with normal bladder function outcome was higher in patients with l45s1 ldh(65.0% ) compared to patients with l234 ldh(36.3% ) . but there was no statistically significant difference ( p=0.125 ) in the main level of ldh to the surgical outcome ( table 3 ) . of the 21 patients with mild bladder dysfunction at admission , a respective 16 and 5 had normal and abnormal bladder function after decompression . among the 10 patients with severe bladder dysfunction at admission , 3 and 7 had normal and abnormal bladder function after decompression . the proportion of patients with normal bladder function outcome was higher about 2.5 times in patients with mild bladder dysfunction at admission ( 76.0% ) compared to patients with severe bladder dysfunction ( 30.0% ) . there was a statistically significant difference ( p=0.021 ) in the severity of bladder dysfunction at admission to the surgical outcome ( table 3 ) . consequently decompression resulted in a significantly impro ved outcome and there is a statistically significant difference in this study for patients on operated within 48 hours and with mild bladder dysfunction at admission . ces can occur due to ldh , tumor , or epidural abscess , and so on4 ) . but ces is a rare and severe condition and is considered the absolute surgical indication89 ) . the pathological ces process is debated but the mechanism of injury to the nerves in ces is suggested to be due to the combination of mechanical pressure , arterial ischemia , and venous congestion3 ) . ahn et al.1 ) from john hopkins university demonstrated that treating all patients with ces within 48 hours of autonomic symptoms led to significant improvement in sensory and motor deficits , and urinary and rectal function . however , kohles et al.5 ) suggested that a significant improvement in outcome was seen with decompression within 24 hours . interestingly , one prospective study analyzed 33 patients undergoing surgery for ces due to ldh7 ) , and found no statistical significance between timing of surgery ( less than 24 hours , 24 - 48 hours , more than 48 hours ) but a better outcome after decompression was found for patients who were continent of urine at onset of symptom than for patients who were incontinent of urine . this result supports the theory that the severity of bladder dysfunction at the onset of symptom may be a factor determining the outcome after decompression . our study shows that operating within 48 hours on ces patients with bladder dysfunction caused by ldh can results in a significantly improved postsurgical outcome ( 6.5 fold ) compared to decompression after 48 hours . although the proportion of patients presenting a better postsurgery when operated on within 24 hours was higher than the patients with decompression after 24 hours , it was not statistical significant difference because p - value is 0.108 . furthermore , patients with mild bladder dysfunction at admission had an improved outcome after operation compared with patients with severe bladder dysfunction . but our study did not show that other factors , level of ldh , degree of spinal canal compression , sexual dysfunction , rectal dysfunction , are related to outcome . there was a little improved outcome after operation in patients with sexual dysfunction , lower level of ldh(l45s1 ) , and less than 50% spinal canal compression but there was no statistically significant difference ( p>0.05 ) . it was a retrospective study ; recent information regarding the surgical outcome was obtained by phone interview but most data were collected from medical records , including time to operation and severity of symptoms . in addition , because most patients with urinary dysfunction were operated on immediately or one day after arrival , the evaluation of bladder function was assessed by objective tests , such as uroflowmetry and postvoid residual urine scans were only performed in some patients . furthermore , and in contrast to the objective evaluation , the outcome of bladder dysfunction after surgery was evaluated subjectively through a statement and survey . longer follow - up period can result in confused outcome after operation because of other disease affecting the outcome such as benign prostatic hyperplasia , urethral stricture . if follow - up period for patients is equal , more reliable result can be showed . our study suggests that decompression surgery should be performed for patients with a neurogenic bladder within 48 hours from the onset of bladder dysfunction to improve bladder dysfunction after decompression . in addition , patients with mild bladder dysfunction at admission showed a significantly improved outcome after decompression . | objectivethis study analyzed retrospectively the bladder function of patients after early surgery for cauda equina syndrome ( ces ) performed within 24 or 48 hours , or after 48 hours of the onset of autonomic symptoms.methodswe retrospectively reviewed the clinical data of 31 patients after decompression surgery for lumbar disc herniation ( ldh ) who had been diagnosed with ces between january 2001 and december 2014 at inha university hospital .
the following factors were assessed to evaluate the influence of time to surgery : bladder function , rectal incontinence , sexual dysfunction , ldh level , and degree of spinal canal compression.resultsafter decompression , the outcome group was categorized into normal bladder function and abnormal bladder function .
the patients operated on within 48 hours showed an improved postoperative outcome . among 16 patients operated on within 48 hours , 13 ( 81% ) recovered normal bladder function .
in contrast , among 15 patients with decompression after 48 hours , 6 ( 40% ) recovered normal bladder function . among 21 patients with mild bladder dysfunction at admission , 16 ( 76% ) recovered normal bladder function after decompression.conclusionour study suggests that patients who have decompression surgery within 48 hours of the onset of bladder dysfunction , improve their chances of recovering bladder function than those who have a late operation ( > 48 hours ) .
also , patients with mild bladder dysfunction are more likely to recover bladder function after decompression , than patients with severe bladder dysfunction . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
polycyclic aromatic hydrocarbons ( pahs ) are a class of ubiquitous environmental contaminants formed by incomplete combustion of organic material . the main sources of human exposure include occupation , passive and active smoking , food , water , and ambient air pollution . children may face increased vulnerability to environmental exposures , including pahs , due to their unique behavior patterns and higher ingestion and inhalation rates given their body size . in a representative sample of the u.s . population , children ( aged 611 years ) had higher levels of pah urinary metabolites than adolescents ( aged 1219 ) and adults ( aged 20 years ) . this is consistent with previous studies of urinary pah metabolites in children [ 3 , 4 ] and , also is consistent with children 's higher pah intakes from diet , air , and soil [ 5 , 6 ] . at least five pah compounds , including benzo(a)pyrene , are considered by the epa and iarc to be animal studies have shown that prenatal pah exposure may cause adverse neurodevelopment , including learning deficits , memory impairments , and behavioral changes [ 810 ] . the developing brain is particularly vulnerable to these effects and molecular epidemiological studies found that newborns may be up to 10 times more susceptible to dna - pah adduct formation than their mothers [ 11 , 12 ] . the mechanisms by which pah exposure affects a child 's developing brain are not fully understood , but proposed mechanisms include endocrine disruption , oxidative stress , binding to placental growth factor receptors , induction of p450 enzymes via binding to the human ah receptor , dna damage resulting in activation of apoptotic pathways [ 16 , 17 ] , or epigenetic effects . prenatal exposure to pahs predicted lower mental development index and cognitive developmental delay in the first three years of life ; symptoms of anxious / depressed and attention problems at age 57 years [ 20 , 21 ] ; decreased language , social , and average developmental quotients in 2-year - old children ; and decreased iq at age of 5 [ 23 , 24 ] . higher referral by teachers for clinical assessment of learning and behavioral problems has also been reported . attention - deficit / hyperactivity disorder ( adhd ) is a commonly recognized behavioral disorder characterized by symptoms of inattention and/or impulsivity . adhd is believed to have genetic origins , but it may interact with the environment such that environmental factors act as a trigger for the disorder [ 26 , 27 ] . learning disability ( ld ) is often associated with adhd , having been reported in 70% of adhd patients and their relatives . more than half of children with adhd are also school - identified as eligible for se services under the individuals with disabilities education act ( idea ) , with most falling under the categories of ld , emotional disturbance , or other health impairment . a study of elementary school children receiving special education ( se ) services revealed that 44% of the children met the diagnostic criteria for adhd , while only half of those were receiving care for the disorder . estimated annual costs of preschool se services for low - income nyc children with pah - induced developmental delay to be $ 13.7 million per birth cohort . there have been no reports of associations between children 's pah exposure and clinically significant neurodevelopmental effects in a nationally representative sample . here , we assess the cross - sectional relationship between concurrent levels of urinary pah metabolites and adhd , ld , and se in a nationally representative sample of u.s . data were obtained from the 2001 - 2002 and 2003 - 2004 cycles of the national health and nutrition examination survey ( nhanes ) for children 615 years of age . briefly , one to two weeks after an initial in - person interview , participants undergo a physical examination in specially designed and equipped mobile examination centers ( mecs ) . the laboratory component involves the collection of biological specimens , including urine for subjects aged 6 years and older . in 20012004 , laboratory analysis of urinary biomarkers was performed for one - third of participants aged 6 years and over . monohydroxy - pah ( oh - pah ) metabolites were measured by an analytical method involving enzymatic hydrolysis of urine , extraction , derivatization , and analysis by capillary gas chromatography combined with isotope - dilution high - resolution mass spectrometry ( gc - hrms ) . urinary metabolite concentrations ( nanograms per liter ( ng / l ) ) of eight pahs , available in both the 2001 - 2002 and 2003 - 2004 cycles , were identified and selected for the data analysis : 1-pyrene , 1-napthol , 2-napthol , 2-fluorene , 3-fluorene , 1-phenanthrene , 2-phenanthrene , and 3-phenanthrene . analytes below the limit of detection ( lod ) were assigned a value of the lod divided by the square root of 2 . five exposure variables were used in this analysis : 1-pyrene , 1-napthol , 2-napthol , fluorine fluo metabolites ( 2-fluorene + 3-fluorene ) , and phenanthrene phen metabolites ( 1-phenanthrene + 2-phenanthrene + 3-phenanthrene ) . urinary 1-pyrene is the most commonly utilized pah biomarker of exposure and is a useful surrogate of total pah exposure . the metabolites that arise from the same parent compound were combined , so that our exposure variables would more closely reflect environmental exposure to the parent compound . 1-napthol and 2-napthol were not combined , however , because these metabolites may reflect exposures to different source of naphthalene ( personal communication , dr . since the ranges of pah concentrations were positively skewed , the five exposure variables were log - transformed and treated as continuous variables and , in separate analyses , high / low categorical pah variables , dichotomized at the median , were used . the primary outcome of interest was parental report of ever - doctor - diagnosed adhd . the survey question , as asked to participants , was has a doctor or health professional ever told { you / survey participant ( sp ) } that { s / he / sp } had attention deficit disorder ? secondary outcomes were parental report of ld and receipt of special education or early intervention services ( abbreviated as se throughout ) . has a representative from a school or a health professional ever told { you / sp } that { s / he / sp } had a learning disability ? and does { sp } receive special education or early intervention services ? a number of covariates and potential confounders identified in the literature were investigated , including age , sex , race / ethnicity ( non - hispanic white , non - hispanic black , hispanic and other ) , and body mass index ( bmi ) ( < 25 , 2530 , and > 30 ) . because urinary pah metabolite concentrations vary based on urine dilution , log - transformed creatinine concentration was included as a covariate . the poverty - income ratio ( pir ) ( < 1.00 , 11.84 , 1.853 , > 3 ) , a ratio of family income to the poverty threshold , was used as an indicator of socioeconomic status . health insurance coverage and having a routine health care provider , both of which have been associated with an increased likelihood of an adhd diagnosis , were also included . birth and early childhood factors including birthweight ( < 5.5 and 5.5 lbs ) , maternal age at birth , treatment at a newborn care facility , and preschool attendance were evaluated . maternal smoking during pregnancy ( yes / no ) and having any smokers in the household ( yes / no ) were positively correlated ( spearman correlation coefficient = 0.344 , p < 0.001 ) ; therefore , the smokers in the household variable was chosen for inclusion into the multivariate models to represent postnatal environmental tobacco smoke ( ets ) given that we are evaluating the effect of concurrent pah levels , rather than prenatal pah levels . log - transformed fasting time ( hours since last meal ) was also evaluated as a covariate since recent consumption of dietary pahs may influence urinary metabolite concentrations . cary , nc ) , using sas survey procedures to account for the complex survey design of the nhanes sample . variables found to be associated with each dichotomous yes / no outcome of interest based on a chi - square test ( categorical ) or t - test ( continuous ) using a statistical threshold of p < 0.2 in bivariate analyses were included in the multivariate logistic regression analysis . non - significant covariates ( p > 0.05 ) were removed one at a time ( backward elimination ) as long as effect estimate between pah exposure and outcome was not altered by greater than 10% in order to arrive at most parsimonious model . regardless of statistical significance , the final models included age , sex , race / ethnicity , and creatinine , since pah levels will vary according to urinary dilution , and urinary dilution varies by age , sex , and race / ethnicity group . to assess potential effect modification by sex , the interaction term sex pah for each pah exposure variable was included in modeling , and subgroup analyses were also performed . because the initially selected covariates for each outcomes were nested within the larger group of covariates selected in the se model and the results did not change appreciably ( data not shown ) , the covariates found to be significant in the se model were also used in the final models for adhd and ld in order to achieve consistency among the three outcomes . thus , the final models included adjustment for age , sex , race / ethnicity , creatinine , smokers in the household , pir , birthweight , and having a routine source of health care . the sample was restricted to participants with no missing data for the pah measures , covariates , or outcomes of interest . table 1 shows the concentrations of the eight urinary pah metabolites in the 2001 - 2002 and 2003 - 2004 nhanes participants aged 615 with no missing covariates or outcomes ( n = 1257 ) . median urinary pah metabolite concentrations ( ng / l ) were 1-pyrene , 76.1 ; 1-napthol , 1290.1 ; 2-napthol , 2036.6 ; 2-fluorene , 254.3 ; 3-fluorene , 102.2 ; 1-phenanthrene , 128.7 ; 2-phenanthrene , 49.1 ; 3-phenanthrene , 106.0 . no influential outliers of the continuous covariates were observed and , thus , no observations were excluded prior to analysis . prevalences of adhd , ld , and se were 7.1% , 13.2% , and 11.4% , respectively , and the spearman correlation coefficients were for adhd and ld , = 0.344 ( p < 0.001 ) ; for adhd and se , = 0.301 ( p < 0.001 ) ; and for ld and se , = 0.679 ( p < 0.001 ) . spearman correlation coefficients between pah exposure variables and having any smokers in the household were all statistically significant ( p < 0.05 ) and ranged from = 0.056 for log - transformed 1-napthol to = 0.437 for high / low fluo metabolites . the dichotomous high / low exposure variables generally demonstrated a higher correlation coefficient with the smokers in the household bivariate analyses showed significant associations between sex , having smokers in the household , and maternal smoking during pregnancy with adhd ( table 2 ) . additionally , race / ethnicity , birthweight , pir , and fasting time were significant bivariate predictors for ld . all of those variables , as well as age and having a routine source of medical care , were significant bivariate predictors of se . multivariate analyses resulted in a significant inverse association between log - transformed ( continuous ) 2-napthol and adhd ( or = 0.75 ; 95% c.i . smokers in the household and sex remained significant , independent predictors of adhd in the final models for each of the continuous and categorical exposure variables ( data not shown ) . in models stratified by sex , a significant inverse association was found between log - transformed 1-pyrene and adhd ( or = 0.46 ; 95% c.i . 0.23 , 0.94 ) and between high 2-napthol and adhd ( or = 0.39 ; 95% c.i . overall , there were no significant associations between pah metabolites and ld in multivariate analyses ( table 4 ) . smokers in the household , birthweight , sex , poverty , and race / ethnicity ( higher risk for hispanics and other race compared to whites ) remained significant , independent predictors of ld in the final models for each of the continuous and categorical exposure variables ( data not shown ) . however , in models stratified by sex , a significant inverse association was found between log - transformed 1-pyrene and ld ( or = 0.58 ; 95% c.i . conversely , a marginally significant positive association between high 1-pyrene and se ( or = 1.83 ; 95% c.i . 1.00 , 3.34 ) additionally , high fluorine metabolite levels were significantly and positively associated with se ( or = 2.00 ; 95% c.i . 1.05 , 3.84 ) . smokers in the household , birthweight , male sex , poverty , and having a routine source of care remained significant , independent predictors of se in the final models for each of the continuous and categorical exposure variables ( data not shown ) . in models stratified by sex , a significant positive association between high fluorine and se remained among males ( or = 2.25 ; 95% c.i . 1.24 , 4.07 ) , but it was not statistically significant among females ( or = 1.78 ; 95% c.i . previous studies which have examined neurotoxic effects of prenatal pahs in children were of modest sample size and many were based in new york city [ 1921 , 24 ] and china where the results pertaining to highly - exposed populations may not be applicable to the general u.s . population . this study evaluated the association between childhood pah biomarkers and parental report of ever doctor - diagnosed adhd , ld , and receipt of se services in a large , nationally - representative sample of u.s . significant inverse associations were observed between log - transformed 2-napthol and adhd . additionally , sex - stratified analyses indicated significant inverse associations among females between 1-pyrene and both adhd and ld and between high 2-napthol and adhd . when stratified by sex , this association remained statistically significant for males but not for females . these findings suggest that pah exposure may increase or decrease the risks of certain developmental disorders depending on the child 's sex and the specific compounds to which they are exposed . unlike previous research on neurotoxic effects of pahs , nhanes data are collected cross - sectionally thereby limiting our ability to infer causality . current pah levels may not reflect past exposures , and if prenatal and early childhood periods alone are the critical windows for susceptibility to the effects of exposure , then the use of current pah levels as surrogate measures of etiologically - relevant exposures may have biased our results . despite our findings regarding specific metabolites , it is difficult to attribute health effects to specific pahs because most exposures are to pah mixtures and not to individual pah compounds . furthermore , use of urinary pah metabolites , which have half - lives as short as 635 hours , will not reflect long - term exposures . pah - dna adducts , which do not depend solely on the magnitude of recent dose , are a better measure of chronic exposure . urinary concentrations are also affected by time of day when spot urine samples are collected the within - day variance of urinary pahs contributes 72 to 89% to total variance among individuals a fluctuation which may be caused by diet , metabolism , or changes in daily routine . taking urine measurements at multiple time points or over a 24-hour period could help correct for exposure misclassification , although concentrations of urinary pah metabolites reflect metabolic / detoxification capacity which also will vary among individuals . our primary outcome is limited by its reliance on parental report of doctor - diagnosed adhd rather than confirmed diagnosis using the diagnostic and statistical manual of mental disorders , fourth edition ( dsm - iv ) criteria , or the diagnostic interview schedule for children iv ( disc - iv ) used in previous studies . similarly , diagnosis of ld and receipt of se , including early intervention services , were both assessed via parental report . however , maternal reports of adhd have been previously found to have high reliability and accuracy . nonetheless , any misclassification of the outcome should not be related to pah exposures and , therefore , would have biased results towards the null . although presence of smokers in the household was included as a measure of ets exposure , the potential for residual confounding exists . we did not quantitatively adjust for multiple comparisons in our statistical tests , which may have resulted in one or more of the observed effects . additionally , because our sample size was limited by age restrictions , rarity of outcomes , and the one - third subsample of pah measurements , we may have had insufficient power to detect some of the independent effects . it is possible , as we found with some of the exposure variables , that pah exposure does not increase the risk of adhd , ld , or receipt of se services in the general u.s . this would be consistent with a recent finding that prenatal exposures to pahs showed no significant association with dsm - oriented attention deficit / hyperactivity problems at age 6 - 7 years in the columbia center for children 's environmental health ( ccceh ) cohort . finally , as we have shown here , the effects of pah exposure may differ by sex . our sex - specific findings suggest that males may be at higher risk than females of pah - induced neurodevelopmental effects . recent research implicates sex - specific epigenetic marks triggered by environmental factors as a potential cause of the sex bias observed in many common diseases . epigenetic malprogramming caused by environmental factors may occur in a sex - specific manner , thereby leading to dimorphic gene expression and increased sensitivity of males ( or females ) to environmentally induced adverse health outcomes . pahs , in particular , have been shown to alter gene expression in hormonal regulatory pathways ( that are crucial to early brain development ) , alter expression of proinflammatory cytokines , upregulate cox-2 ( an enzyme involved in inflammation and associated with reactive oxygen species ) , and , in the ccceh cohort , to lead to differential methylation in umbilical cord white blood cell dna of newborns . more research is needed to detect whether these or other epigenetic alterations mediate the neurodevelopmental effects of pahs and whether these effects are sex - specific . nonetheless , this is the first study to examine the relationship between childhood pah exposure and adhd , ld , and se in a nationally representative sample of u.s . our results suggest an association between fluorine metabolites and increased need for se services among the general u.s . population of school - aged children aged 615 years with possible sex - specific effects . large , nationally representative , prospective studies are needed to fully investigate the neurodevelopmental effects of pah exposure in children and to disentangle the effects of prenatal and postnatal exposures . | exposure to polycyclic aromatic hydrocarbons ( pahs ) adversely affects child neurodevelopment , but little is known about the relationship between pahs and clinically significant developmental disorders .
we examined the relationship between childhood measures of pah exposure and prevalence of attention deficit / hyperactivity disorder ( adhd ) , learning disability ( ld ) , and special education ( se ) in a nationally representative sample of 1,257 u.s .
children 615 years of age .
data were obtained from the national health and nutrition examination survey ( nhanes ) 20012004 .
pah exposure was measured by urinary metabolite concentrations .
outcomes were defined by parental report of ( 1 ) ever doctor - diagnosed adhd , ( 2 ) ever doctor- or school representative - identified ld , and ( 3 ) receipt of se or early intervention services .
multivariate logistic regression accounting for survey sampling was used to determine the associations between pah metabolites and adhd , ld , and se .
children exposed to higher levels of fluorine metabolites had a 2-fold increased odds ( 95% c.i .
1.1 , 3.8 ) of se , and this association was more apparent in males ( or 2.3 ; 95% c.i .
1.2 , 4.1 ) than in females ( or 1.8 ; 95% c.i . 0.6 , 5.4 ) .
no other consistent pattern of developmental disorders was associated with urinary pah metabolites . however
, concurrent exposure to pah fluorine metabolites may increase use of special education services among u.s . children . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in taiwan , cancer has been the leading cause of death among the general population since 1982 . the age - adjusted incidence rate has increased steadily since then ; and it reached 320.65 new cases per 100,000 people in 2011 . the proportion of long - term cancer survivors is rising owing to successful cancer - screening programs , earlier detection , advanced diagnostic tools , timely and effective treatment , improved follow - up after treatment , and an aging population . consequently , the surveillance and monitoring of cancer survivors has become a crucial concern , regarding cancer control , as well as the emergence of cancer- and treatment - related health problems . myelodysplastic syndrome ( mds ) comprises a heterogeneous group of closely related clonal hematopoietic disorders that are characterized by hypocellular or hypercellular marrow with impaired morphology and maturation and peripheral blood cytopenias , followed by progressive impairment of the ability of myelodysplastic stem cells to differentiate and a tendency to evolve into acute myeloid leukemia ( aml ) . mds has been identified to be associated with previous cancer treatment by using chemotherapy ( ct ) or radiotherapy ( rt ) . treatment - related mds has been reported in various cancers , such as breast cancer , non - hodgkin lymphoma , hodgkin lymphoma , endometrial cancer , ovarian cancer , prostate cancer , and brain tumors . although the absolute number of treatment - related mds cases is small , the poor prognosis of mds warrants concern . to the best of our knowledge , no nationwide population - based study has measured treatment - related mds for cancer overall and for various individual cancers . we designed this research to determine , among cancer survivors , which primary sites of cancer were more susceptible to the development of mds after treatment , and whether ct and rt interact . we used a database from the national health insurance ( nhi ) system of taiwan to conduct this study . taiwan has implemented the nhi program since 1995 and approximately 99% of the population ( n = 23.74 million ) is currently enrolled in the program . this retrospective nested case control study used the longitudinal health insurance database 2000 ( lhid2000 ) , a part of the national health insurance research database ( nhird ) ; the database was established and is maintained by the national health research institutes ( nhri ) . the lhid2000 consists of claims data from 1,000,000 individuals randomly sampled ( approximately 4.5% of taiwan 's population ) from the registry of the nhird in 2000 . there were no statistically significant differences in the distribution of sex , age , or health - care costs between the cohorts in the lhid2000 and insurance enrollees overall as reported by the nhri in taiwan . all personal information was confidential because patient identification numbers and other sensitive personal data were encrypted . this study was approved by the institutional review board of china medical university in central taiwan ( cmu - rec-101 - 012 ) . the diagnoses were identified using diagnostic and procedural codes from the international classification of diseases , ninth revision , clinical modification ( icd-9-cm ) . a nested case we identified patients in the registry for catastrophic illness database who were 20 years of age and older and had been newly diagnosed with primary cancer with the icd-9-cm codes 140195 and 200208 , not including aml and chronic myeloid leukemia ( icd-9-cm codes 205.0 and 205.10 , respectively ) between january 1 , 2000 and december 31 , 2011 ; these patients comprised the exposure cohort . to register a case in the catastrophic illness registry , a diagnosis made by a physician with confirmatory pathological results or other supporting medical information we excluded patients with a history of mds before 2000 and patients with a history of mds before the diagnosis of cancer . each patient in the case group was followed until the diagnosis of mds ( icd-9-cm codes 284.9 , 285.0 , 205.10 , and 205.0 ) ; patients without mds in the period 20002011 comprised the non - mds group . the date of diagnosis for mds was defined as the index date . to construct the comparison group , we randomly selected 4 people from the non - mds group in the same period who were frequency - matched with the case group by age ( at 5-year intervals ) , sex , year of cancer diagnosis , and mds index year . we included 1265 patients in the mds case group and 5057 non - mds controls in this study . the diseases considered comorbidities included diabetes ( icd-9-cm code 250 ) , hypertension ( icd-9-cm code 401 - 405 ) , hyperlipidemia ( icd-9-cm code 272 ) , stroke ( icd-9-cm codes 430438 ) , ischemic heart disease ( icd-9-cm codes 410414 ) , chronic obstructive pulmonary disease ( icd-9-cm codes 490496 ) , alcoholism ( icd-9-cm codes 291 , 303 , 305.00 , 305.01 , 305.02 , 305.03 , 790.3 , and v11.3 ) , and alcoholic liver damage ( icd-9-cm codes 571.0 , 571.1 , and 571.3 ) . we also considered anticancer drugs and included alkylating agents , topoisomerase ii inhibitors , and antimetabolites which are suggested to have increased risks of mds . two kinds of treatment before the index date were examined for their possible association with mds : rt and ct . the baseline distributions of demographic characteristics , comorbidities , and treatments between mds group and non - mds group were compared using the test for categorical variables and the t test for continuous variables . univariable and multivariable unconditional logistic regression analysis was used to estimate odds ratios ( ors ) and 95% confidence intervals ( cis ) for the association between mds and rt and ct . the multivariable models were simultaneously adjusted for the comorbidities of diabetes , stroke , ischemic heart disease , chronic obstructive pulmonary disease , alcoholism , and anticancer drugs . models were also used for estimating the risks of using rt and ct for mds . all analyses were performed using sas statistical software for windows ( version 9.3 ; sas institute , inc . table 1 shows a comparison of distributions of demographic characteristics , baseline comorbidities , and treatments between the mds and the non - mds groups . among the 1265 patients with mds , 50.8% of them were women and most were older than 65 years of age ( 56.1% ) . the mean ages of the mds and non - mds groups were 65.2 ( sd = 14.8 ) and 65.2 ( sd = 14.8 ) years , respectively . compared with the non - mds group , the mds group patients were more likely to have diabetes , stroke , ischemic heart disease , chronic obstructive pulmonary disease , alcoholism , alkylating agents use , topoisomerase ii inhibitors use , and antimetabolites use ( all p < 0.05 ) . the proportions of those treated with rt and ct were significantly higher in the mds group than in the non - mds group . the results of the multivariable logistic regression models for the association of rt and ct with mds risk among patients with cancer are shown in table 2 . overall , compared with patients who did not receive rt treatment , we observed a significant , 1.53-fold increase of mds in cancer patients who received rt treatment ( 95% ci = 1.331.77 ) after adjusting for the comorbidities of diabetes , stroke , ischemic heart disease , chronic obstructive pulmonary disease , alcoholism , and anticancer drugs . compared with non - ct patients , the adjusted or for mds risk was 1.51-fold ( 95% patients with diabetes , stroke , ischemic heart disease , alkylating agents use , and topoisomerase ii inhibitors use also demonstrated a significant association with increased mds risk . baseline characteristics between myelodysplastic syndrome group and non - myelodysplastic syndrome group ors and 95% cis of myelodysplastic syndrome associated with rt , ct , and covariates furthermore , we estimated the risk of mds following treatment with rt and ct for patients with various types of cancer ( table 3 ) . a statistically significantly higher risk of mds was observed for endometrial cancer patients who received rt and ct compared with those who did not receive rt and ct ( adjusted or = 3.16 , 95% ci = 1.059.49 and adjusted or = 7.59 , 95% ci = 1.0753.6 , respectively ) . compared with stomach cancer patients who did not receive rt , similar results were observed for patients with colorectal , liver , female breast , prostate , and kidney cancers ; for all of these , receiving rt increased the risk of mds . compared with lung cancer patients who did not receive ct , similar results were observed for cervical cancer patients ; for all of these , ct increased the risk of mds . ors and 95% cis of myelodysplastic syndrome associated with rt , ct , and covariates in subdivision cancer colorectal cancer patients who received alkylating agents treatment and topoisomerase ii inhibitors treatment had higher risks of mds compared with those who did not receive alkylating agents treatment and topoisomerase ii inhibitors treatment ( adjusted or = 4.49 , 95% ci = 1.2915.6 and adjusted or = 24.2 , 95% ci = 2.63222.9 , respectively ) ( table 4 ) . ors and 95% cis of myelodysplastic syndrome associated with anticancer drugs and covariates in subdivision cancer compared with head and neck cancer patients who did not receive alkylating agent treatment , head and neck cancer patients who received alkylating agent treatment were at a much higher risk of mds . compared with cervix cancer patients who did not receive topoisomerase ii inhibitor treatment , cervical cancer patients who received topoisomerase ii inhibitor treatment had a higher risk of mds . bladder patients and non - hodgkin lymphoma with antimetabolite use also demonstrated a significant association with increased mds risk compared with their counterparts who did not receive antimetabolite treatment . compared with endometrial cancer patients who did not receive rt and ct , endometrial cancer patients who received both rt and ct had a higher risk of mds ( adjusted or = 37.0 , 95% ci = 2.96462.4 ) . compared with lung cancer patients who did not receive rt and ct , lung cancer patients who received both rt and ct demonstrated a higher risk of mds ( adjusted or = 3.62 , 95% ci = 1.339.85 ) . similar results were observed for colorectal cancer , female breast cancer , and cervical cancer patients ; receiving both rt and ct had a higher risk of mds . relative to the female breast cancer patients only receiving ct , female breast cancer patients who received both rt and ct had higher risk of mds ( adjusted or = 1.93 , 95% ci = 1.133.29 ) . compared with cervical cancer patients only receiving rt , cervical cancer patients who received both rt and ct had higher risk of mds ( adjusted or = 2.43 , 95% ci = 1.095.44 ) . taiwan has implemented the nhi program since 1995 and approximately 99% of the population ( n = 23.74 million ) is currently enrolled in the program . this retrospective nested case control study used the longitudinal health insurance database 2000 ( lhid2000 ) , a part of the national health insurance research database ( nhird ) ; the database was established and is maintained by the national health research institutes ( nhri ) . the lhid2000 consists of claims data from 1,000,000 individuals randomly sampled ( approximately 4.5% of taiwan 's population ) from the registry of the nhird in 2000 . there were no statistically significant differences in the distribution of sex , age , or health - care costs between the cohorts in the lhid2000 and insurance enrollees overall as reported by the nhri in taiwan . all personal information was confidential because patient identification numbers and other sensitive personal data were encrypted . this study was approved by the institutional review board of china medical university in central taiwan ( cmu - rec-101 - 012 ) . the diagnoses were identified using diagnostic and procedural codes from the international classification of diseases , ninth revision , clinical modification ( icd-9-cm ) . we identified patients in the registry for catastrophic illness database who were 20 years of age and older and had been newly diagnosed with primary cancer with the icd-9-cm codes 140195 and 200208 , not including aml and chronic myeloid leukemia ( icd-9-cm codes 205.0 and 205.10 , respectively ) between january 1 , 2000 and december 31 , 2011 ; these patients comprised the exposure cohort . to register a case in the catastrophic illness registry , a diagnosis made by a physician with confirmatory pathological results or other supporting medical information we excluded patients with a history of mds before 2000 and patients with a history of mds before the diagnosis of cancer . each patient in the case group was followed until the diagnosis of mds ( icd-9-cm codes 284.9 , 285.0 , 205.10 , and 205.0 ) ; patients without mds in the period 20002011 comprised the non - mds group . the date of diagnosis for mds was defined as the index date . to construct the comparison group , we randomly selected 4 people from the non - mds group in the same period who were frequency - matched with the case group by age ( at 5-year intervals ) , sex , year of cancer diagnosis , and mds index year . we included 1265 patients in the mds case group and 5057 non - mds controls in this study . the diseases considered comorbidities included diabetes ( icd-9-cm code 250 ) , hypertension ( icd-9-cm code 401 - 405 ) , hyperlipidemia ( icd-9-cm code 272 ) , stroke ( icd-9-cm codes 430438 ) , ischemic heart disease ( icd-9-cm codes 410414 ) , chronic obstructive pulmonary disease ( icd-9-cm codes 490496 ) , alcoholism ( icd-9-cm codes 291 , 303 , 305.00 , 305.01 , 305.02 , 305.03 , 790.3 , and v11.3 ) , and alcoholic liver damage ( icd-9-cm codes 571.0 , 571.1 , and 571.3 ) . we also considered anticancer drugs and included alkylating agents , topoisomerase ii inhibitors , and antimetabolites which are suggested to have increased risks of mds . two kinds of treatment before the index date were examined for their possible association with mds : rt and ct . the baseline distributions of demographic characteristics , comorbidities , and treatments between mds group and non - mds group were compared using the test for categorical variables and the t test for continuous variables . univariable and multivariable unconditional logistic regression analysis was used to estimate odds ratios ( ors ) and 95% confidence intervals ( cis ) for the association between mds and rt and ct . the multivariable models were simultaneously adjusted for the comorbidities of diabetes , stroke , ischemic heart disease , chronic obstructive pulmonary disease , alcoholism , and anticancer drugs . models were also used for estimating the risks of using rt and ct for mds . all analyses were performed using sas statistical software for windows ( version 9.3 ; sas institute , inc . , cary , nc ) , and the significance level was set at 0.05 . table 1 shows a comparison of distributions of demographic characteristics , baseline comorbidities , and treatments between the mds and the non - mds groups . among the 1265 patients with mds , 50.8% of them were women and most were older than 65 years of age ( 56.1% ) . the mean ages of the mds and non - mds groups were 65.2 ( sd = 14.8 ) and 65.2 ( sd = 14.8 ) years , respectively . compared with the non - mds group , the mds group patients were more likely to have diabetes , stroke , ischemic heart disease , chronic obstructive pulmonary disease , alcoholism , alkylating agents use , topoisomerase ii inhibitors use , and antimetabolites use ( all p < 0.05 ) . the proportions of those treated with rt and ct were significantly higher in the mds group than in the non - mds group . the results of the multivariable logistic regression models for the association of rt and ct with mds risk among patients with cancer are shown in table 2 . overall , compared with patients who did not receive rt treatment , we observed a significant , 1.53-fold increase of mds in cancer patients who received rt treatment ( 95% ci = 1.331.77 ) after adjusting for the comorbidities of diabetes , stroke , ischemic heart disease , chronic obstructive pulmonary disease , alcoholism , and anticancer drugs . compared with non - ct patients , patients with diabetes , stroke , ischemic heart disease , alkylating agents use , and topoisomerase ii inhibitors use also demonstrated a significant association with increased mds risk . baseline characteristics between myelodysplastic syndrome group and non - myelodysplastic syndrome group ors and 95% cis of myelodysplastic syndrome associated with rt , ct , and covariates furthermore , we estimated the risk of mds following treatment with rt and ct for patients with various types of cancer ( table 3 ) . a statistically significantly higher risk of mds was observed for endometrial cancer patients who received rt and ct compared with those who did not receive rt and ct ( adjusted or = 3.16 , 95% ci = 1.059.49 and adjusted or = 7.59 , 95% ci = 1.0753.6 , respectively ) . compared with stomach cancer patients who did not receive rt , stomach cancer patients who received rt were at a much higher risk of mds . similar results were observed for patients with colorectal , liver , female breast , prostate , and kidney cancers ; for all of these , receiving rt increased the risk of mds . compared with lung cancer patients who did not receive ct , lung cancer patients who received ct had a 2.67-fold risk of mds . similar results were observed for cervical cancer patients ; for all of these , ct increased the risk of mds . ors and 95% cis of myelodysplastic syndrome associated with rt , ct , and covariates in subdivision cancer colorectal cancer patients who received alkylating agents treatment and topoisomerase ii inhibitors treatment had higher risks of mds compared with those who did not receive alkylating agents treatment and topoisomerase ii inhibitors treatment ( adjusted or = 4.49 , 95% ci = 1.2915.6 and adjusted or = 24.2 , 95% ci = 2.63222.9 , respectively ) ( table 4 ) . ors and 95% cis of myelodysplastic syndrome associated with anticancer drugs and covariates in subdivision cancer compared with head and neck cancer patients who did not receive alkylating agent treatment , head and neck cancer patients who received alkylating agent treatment were at a much higher risk of mds . compared with cervix cancer patients who did not receive topoisomerase ii inhibitor treatment , cervical cancer patients who received topoisomerase ii inhibitor treatment had a higher risk of mds . bladder patients and non - hodgkin lymphoma with antimetabolite use also demonstrated a significant association with increased mds risk compared with their counterparts who did not receive antimetabolite treatment . compared with endometrial cancer patients who did not receive rt and ct , endometrial cancer patients who received both rt and ct had a higher risk of mds ( adjusted or = 37.0 , 95% ci = 2.96462.4 ) . compared with lung cancer patients who did not receive rt and ct , lung cancer patients who received both rt and ct demonstrated a higher risk of mds ( adjusted or = 3.62 , 95% ci = 1.339.85 ) . similar results were observed for colorectal cancer , female breast cancer , and cervical cancer patients ; receiving both rt and ct had a higher risk of mds . relative to the female breast cancer patients only receiving ct , female breast cancer patients who received both rt and ct had higher risk of mds ( adjusted or = 1.93 , 95% ci = 1.133.29 ) . compared with cervical cancer patients only receiving rt , cervical cancer patients who received both rt and ct had higher risk of mds ( adjusted or = 2.43 , 95% ci = 1.095.44 ) . control study highlighted the fact that overall cancer treatment with either rt or ct can significantly increase the risk of subsequently developing mds . analysis by cancer site indicated that patients with stomach , colorectal , liver , breast , endometrial , prostate , and kidney cancers after rt had a significantly high risk of developing mds . by contrast , ct was more likely to increase mds incidence among patients with lung , endometrial , and cervical cancers . different patterns of mds risk among various cancers in 3 kinds of anticancer drugs were also found . further analysis revealed that rt and ct tended to have a positive joint effect on mds occurrence . approximately 20,000 cases of mds were diagnosed in the united states in 2008 , of which approximately 10% were therapy related . from our nhi database , 454 cases of mds were diagnosed in taiwan in 2008 . the french american british cooperative group proposed a classification based on easily obtainable laboratory information . the 5 classes are refractory anemia ( ra ) , ra with ringed sideroblasts , ra with excess blasts ( raebs ) , raeb in transformation , and chronic myelomonocytic leukemia . the prognosis of mds is relatively poor , and the majority of patients progress to refractory aml within a few months . therapy - related mds is a serious long - term consequence of cytotoxic treatments for an antecedent disease . traditional cancer therapy operates by producing extensive dna damage that in turn inhibits proliferation and activates cell - death pathways . rt and ct do not target cancer cells exclusively ; therefore , mutations may also be induced among normal cells . when they persist and affect genes controlling the growth and differentiation of hematopoietic stem and precursor cells , a neoplastic myeloid clone may be generated . people accidentally exposed to ionizing radiation , as well as cancer patients receiving rt , have been extensively linked to hematological malignancies . by contrast , alkylating agents , topoisomerase ii inhibitors , and antimetabolites are frequently cited perpetrators of ct - induced mds . alkylating agents comprise a large group of anticancer drugs with clinical applications across almost all types of cancer . mds from exposure to topoisomerase ii inhibitors usually has an early onset ( within 13 years ) and causes balanced genetic alterations typically involving 11q23 . however , exposure to alkylating agents results in a later onset ( within 510 years ) and yields unbalanced chromosomal alterations often involving chromosomes 5 and 7 . researchers have found that the specific effects and chromosomal abnormalities caused by radiation seem to be similar to those seen from exposure to alkylating agents . antimetabolites are yet another group of cytostatic drugs causally involved in the development of therapy - related myeloid neoplasms . for cancer overall , our data revealed that both rt and ct are associated with a higher risk of subsequent mds . regarding individual cancers , several studies have found that rt and/or ct for breast cancer can induce mds . our results showed that breast cancer survivors who received rt are more vulnerable to developing mds compared with their counterparts , but not breast cancer survivors who received ct ( table 3 ) . when we used breast cancer patients without rt and ct as the reference , neither the rt nor the ct group showed a significantly higher risk of mds , but the group treated with both rt and ct did manifest a significantly higher risk of mds ( table 5 , or = 3.46 ; 95% ci = 1.289.33 ) . this was partially consistent with kaplan et al , who performed a registry cohort analysis and found that an elevated rate of mds and aml was observed among breast cancer patients treated with rt and those treated with rt and ct compared with available population incidence data . the authors used records from the 20012009 surveillance , epidemiology , and end results database to identify a cohort of women with first primary stage 0 breast cancer who were treated with rt , a group that is not treated with ct . they suggested that using rt to treat breast cancer is associated with an increased risk of mds / aml and affects an extremely small number of patients . it is reasonable that there have been more reports of mds development among breast cancer survivors compared with other cancer survivors . because of the relative success of cancer - screening programs , early detection and timely and appropriate treatment have yielded more favorable prognoses for patients with breast cancer compared with patients with most other types of cancer . another primary cancer site that has been gaining interest among researchers is the prostate gland . in general , prostate cancer is characterized by its relatively older average age at diagnosis and slower progression compared with most other types of cancer . rt is one of the major therapies for prostate cancer , but ct does not play a crucial role in the treatment of prostate cancer . prostate cancer patients treated with radical rt with curative intent typically receive higher doses ( up to > 70 gy ) than those involved in adjuvant rt . mukherjee et al evaluated the risk of developing mds among prostate cancer patients definitively treated with rt and found that rt did not appear to induce a statistically increased risk of subsequent mds . however , our data showed that after rt , prostate cancer patients have a significantly higher risk of developing mds . our population - based nested case control study had more mds patients and , thus , our study was more likely to detect a significant difference , which may account for this observation . the association between ct and mds in prostate cancer was not that obvious because of the relatively small number of patients receiving ct ( table 3 ) . hematological malignancies were also studied to determine the association between cancer treatment and subsequent mds . the present study failed to find any significant relationship between cancer treatment and mds in these malignancies except for antimetabolites users among non - hodgkin lymphoma with a higher mds risk ( table 4 ) . previous case reports have highlighted mds cases after abdominopelvic rt for endometrial cancer , as well as after ct and rt for brain tumors . our study revealed a positive relationship between mds cases after rt or ct for endometrial cancer and our results yielded no significant association was found between brain tumor treatment and mds . in addition , treatment - related mds in testicular cancer , ovarian cancer , and sarcoma has been reported , however , we did not have enough cases of these cancers and no significant findings were observed ( data not shown ) . we found that treatment for certain cancer sites was linked to mds , although such sites have been seldom mentioned in previous studies . these sites included stomach , colorectal , liver , and kidney cancers in the rt group and lung and cervical cancers in the ct group . we subclassified ct into alkylating agent , topoisomerase ii inhibitors , and antimetabolites to analyze because they are suggested to have increased risks of mds . because of the dilute effect of case classification , less cancer sites were identified to have the statistically significant level for an increased risk of mds . our data revealed that head and neck cancer and colorectal cancer patients with alkylating use had significantly higher risks for mds . alkylating agents are commonly used in head and neck cancer and colorectal cancer patients , and it may enhance the ability to detect a statistically significant difference . tebbi et al found a novel association between topoisomerase inhibition and risk of secondary myeloid neoplasms in pediatric hodgkin disease .. le deley et al found that the risk of mds is much higher with mitoxantrone - based ct than with anthracycline - based ct in breast cancer patients . users of topoisomerase ii inhibitors were found to have significantly higher risks for mds among colorectal cancer and cervical cancer patients in our study . antimetabolites , and in particular the immunosuppressive agents azathioprine and fludarabine , have also been associated with mds . our data revealed that antimetabolite users had significantly higher risks of mds among bladder cancer and non - hodgkin lymphoma patients . a tendency of a positive joint effect of rt and ct was observed in our study . as shown in table 5 , a reference group of patients who did not receive rt or ct exhibited the joint effect of both treatments in lung , breast , endometrial , and cervical cancers . in these cancer sites , double - treatment groups , but not single - treatment groups , had significantly higher risks of mds . when used single - treatment group as the reference , table 5 also revealed consistent higher adjusted ors of double - treatment group compared with single - treatment group ( except for liver cancer ) , although p values seldom reached the significant level due to small case number . the positive interaction between rt and ct was observed in an early study conducted by smith et al , who indicated that among patients receiving adjuvant ct for breast cancer , the risk of mds increases with age , with the intensity of therapy , and with the use of breast rt . this implied that a synergistic effect of mds may exist between rt and ct . combining rt and ct ( either concurrent or sequential ) in cancer treatment this study demonstrated the strengths of its population - based nationwide source and subsequent follow - up period . unlike most studies using population - based registries of the general population as the comparison group , our control group comprised cancer patients without mds . this was logical ; this design eliminated the concern that possible malignancies may themselves be related to mds . therefore , comprehensive analyses to determine whether the relationship between rt / ct and mds is dose - responsive were not possible . smith et al evaluated mds after doxorubicin cyclophosphamide adjuvant therapy for operable breast cancer and found that the incidence of mds was sharply elevated in the more intense regimens ; however , we can not conduct the similar analysis . second , the nhi database also lacks cancer clinical stage and pathological types , and we can not adjust these factors to minimize the possible confounding . in additional , it also hampers us using current data to demonstrate the treatment benefit regarding survival rate due to uncontrolled biases . in conclusion , this population - based nested case control study found that both rt and ct are related to the subsequent development of mds . the study highlights that physicians must keep in mind the long - term risks of ct and rt , including the development of mds . nevertheless , these results do not dispute the proven benefits of rt and ct in cancer control , which far outweigh the potential risk of mds . | abstractthis study explored which kinds of cancer are related to a higher incidence of subsequent myelodysplastic syndrome ( mds ) after radiotherapy ( rt ) and chemotherapy ( ct).we performed a nested case
control study by using data from the taiwanese national health insurance ( nhi ) system .
the case group included cancer patients who developed mds .
for the control group , 4 cancer patients without mds were frequency - matched with each mds case by age , sex , year of cancer diagnosis , and mds index year .
a multivariable logistic regression analysis was conducted , and odds ratios ( ors ) and 95% confidence intervals ( cis ) were estimated.overall , cancer patients who received rt or ct exhibited secondary mds more frequently than did those who did not ( rt : or = 1.53 ; 95% ci = 1.331.77 ; ct : or = 1.51 ; 95% ci = 1.251.82 ) .
analysis by cancer site showed that rt increased the risk of mds for patients with stomach , colorectal , liver , breast , endometrial , prostate , and kidney cancers .
by contrast , ct was more likely to increase the risk of mds for patients with lung , endometrial , and cervical cancers .
further analysis revealed that rt and ct seemed to have a positive interaction .
the major limitation of this study was the lack of certain essential data in the nhi research database , such as data regarding cancer stage and treatment dose details.this population - based nested case
control study determined that rt and ct predisposed patients in taiwan to the development of mds .
this effect was more prominent when both modalities were used . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
medical treatment is the main strategy to control secondary hyperparathyroidism in patients with end - stage renal disease ( esrd ) . for this reason , invasive procedures such as intranodular ethanol injection ( percutaneous ethanol injection therapy , peit ) or parathyroidectomy have been proposed [ 2 , 3 ] . the type of procedure used depends of the intact pth levels , number and size of the glands involved , and their ultrasonographic visibility . in the case of subtotal parathyroidectomy , patient keeps between 1/4 and 1/2 of the gland . over time , if the conditions causing hyperparathyroidism persist , gland may grow and increase again the levels of intact pth . moreover , after surgery a high percentage of patients ( 12 to 30% ) may develop recurrent or persistent hyperparathyroidism . thus , the patient will suffer the clinical consequences of hyperparathyroidism once again ( i.e. , high morbidity - mortality ) , despite surgery . when the residual nodule is visible with ultrasonography , its destruction is possible with ethanol injection until the desired levels of intact pth and calcium phosphorus product are reached . we presented a series of patients with recurrent hyperparathyroidism postsubtotal parathyroidectomy who were adequately managed with peit . the study included six patients with esrd under chronic hemodialysis and diagnosis of recurrent secondary hyperparathyroidism . all the patients had history of secondary hyperparathyroidism that became refractory to the medical treatment . because , this condition , all patients had undergone subtotal parathyroidectomy with neck exploration searching for the four parathyroid glands and removing the three glands that were macroscopically more affected and the 1/2 or 3/4 part of the gland with healthier aspect . the indication of the treatment with peit was recurrent secondary hyperparathyroidism with levels of intact pth higher than 300 pg / ml in patients who had undergone a subtotal parathyroidectomy and presence of at least one parathyroid nodule visible in the ultrasonography . the mean age of the population was 47.4 11.1 years ( median 47 , min 36max 64 ) , 3 patients were female , and the mean time elapsed from the initiation of hemodialysis therapy to the peit was 108.4 58.6 months ( median 89 , min 36max 180 ) . three patients had esrd secondary to chronic glomerulonephritis , one case was associated to eclampsia , and other two ; the cause of esrd was unknown . before peit , medical management for hyperparathyroidism included control of hyperphosphatemia with a low phosphorous diet , oral phosphate binders ( calcium , sevelamer , and aluminum ) , more intensive dialysis and in cases without contraindications oral / iv calcitriol . similar measures were used after peit in order to maintain an adequate calcium - phosphorus metabolism and to avoid recurrence of hyperparathyroidism . all injections were administered by the same qualified interventional radiologist and performed under ultrasonographic guidance . nodular volume and size of all glands treated with peit were larger than 0.1 cm as calculated by ultrasonographic evaluation of their 3 longest axes . a 95% ethanol solution was used for peit with a total alcohol volume calculated to be at least the same as the nodule volume . a modified needle for ethanol injection with small side holes , easily recognized under ultrasonography and local anesthesia with lidocaine in an ambulatory facility was used . the treatment was considered successful when the levels of intact pth decreased from 150 to 300 pg / ml , as suggested by k / doqi guidelines . biochemical assays were performed immediately before the first peit session ( basal ) and between 1 and 7 days after the last peit session ( final ) . serum creatinine , calcium , phosphorus , and alkaline phosphatase were measured with an autoanalyzer ( hitachi 917 : hitachi , ltd . , tokyo , japan ) , and intact ipth by electrochemiluminescence ( nichol 's institute , san juan capistrano , calif , usa ) . all patients had a residual parathyroid nodules identified by ultrasonography , and peit was performed 26.4 45.7 months ( median 7 , min 2max 108 ) , after parathyroidectomy ( table 1 ) . in one patient , , 3 parathyroid glands were removed , and in the second surgery some months later , glandular tissue was not identified . the patient did not accept to undergo another surgery when an ectopic parathyroid gland was detected by scintigraphy . in the remaining 5 patients , the ultrasonography detected residual and enlarged parathyroid tissue in the site where a small portion of parathyroid gland had been left during the surgical procedures . in average , 1.3 0.8 ethanol injections were made per patient and a mean of 2.8 2.8 cm of ethanol was injected . the average nodular volume was 1.5 1.7 cm , although the volumes were very different among patients ( 0.2 to 4.5 cm ) ( table 2 ) . the mean levels of pth had a significant decrease at final control , falling from 1897 754 to 549 863 pg / ml ( p < the average decrease of intact pth was 72 33% ( range 8,096,6% ) . there was also a decrease in the levels of serum calcium , phosphorus , and calcium - phosphorus product , being significant in the last two . a positive and significant correlation was found between the total nodular volume , the volume of ethanol used in each session ( r = 0.85 ; p < .02 ) , and the time from parathyroidectomy ( r = 0.87 ; p < .02 ) ( figure 2 ) . in one patient , this patient showed a reduction of 8% in the level of pth and maintained the levels of calcium and phosphorus above the recommended level by k / doqi guidelines after peit . this procedure was performed on a small nodule of only 0.2 cm , and peit had to be stopped prematurely due to technical problems to visualize and identify the parathyroid nodule . ectopic gland was not found by a scintigraphy . when analyzing the degree of compliance with the parameters of mineral metabolism recommended by k / doqi guidelines ( intact pth , calcium , phosphorus , and ca p product ) , it was observed that prior to the peit , no patients were in agreement with the 4 parameters ; 2 patients meet 3 criteria , 2 patients fulfill only one , and the remaining 2 patients did not satisfy any of the recommended parameters . at the final control post - peit , one patient meet the 4 criteria , 4 patients fulfill 3 criteria , while the remaining patient did not satisfy any of the parameters recommended by k / doqi . this last patient was the one who did not properly respond to peit ( table 2 ) . all the procedures were performed on an outpatient basis , and only one patient required hospitalization after the procedure due to severe hypocalcaemia that reverted with calcium replacement by intravenous administration . in two cases , only local discomfort and temporary mild dysphonia were registered . in several clinical settings , severe secondary hyperparathyroidism can be controlled quickly and safely by using peit . this technique is not only an alternative to surgical parathyroidectomy , but also an important adjunct to medical management . it has proved to be useful for patients either on dialysis or after renal transplantation in circumstances in which the disease is considered to be resistant to medical treatment or when the surgical risk is high [ 810 ] . secondary hyperparathyroidism is a common complication of the long - term dialysis [ 11 , 12 ] . the dopps international study has demonstrated that 26.3% of the patients from the participant countries have hyperparathyroidism . it has been shown to predominate in latin american countries [ 12 , 14 ] . secondary hyperparathyroidism is managed successfully with medical treatment in most of the patients , but the disease becomes refractory to the therapy in a considerable number of them . these is more frequent in subjects with severe , long - term hyperparathyroidism and with nodular hyperplasia in enlarged glands . this glands have a lower - density receptors for calcitriol and calcium both needed to respond to the treatment [ 1 , 15 ] . therefore , in these patients , it is necessary to consider the possibility of using invasive treatment . surgical parathyroidectomy is indicated when the patients who do not respond to the medical treatment present signs of osteitis fibrosa , extraosseous calcifications , hypercalcemia or hyperphosphatemia , with more than 2 glands visible with ultrasonography , and dramatically increased levels of intact pth [ 16 , 17 ] . although in most of the patients there is an important decrease of pth levels , a considerable number of them ranging from 10 to 30% suffer a recurrence of secondary hyperparathyroidism , and it is required , in many cases , to undergo more complicated reoperations . potential factors related with recurrent postsurgical hyperparathyroidism are the persistence of the conditions causing hyperparathyroidism such as the presence of a residual portion of parathyroid gland , which is present when either a subtotal or a total parathyroidectomy with autotransplantation is performed . in rare cases , an ectopic gland that was not obvious in presence of the other activated parathyroid glands may evidence increased size and activity . once recurrence occurred , the levels of pth will dramatically increase again with their known consequences on the skeleton and cardiovascular system . these residual nodules are refractory to the medical treatment because they do not have the adequate concentration of both calcium and calcitriol receptors . a new surgical procedure implies some risks because of the high morbidity of these patients , some technical complications in a sector with a previous surgery that usually presents periglandular fibrosis and with the only possibility of removing all the residual parathyroid tissue , which causes hypoparathyroidism in most of the cases . in the patients of the present series , surgical resection of the remnant parathyroid tissue was not recommended due to a high risk to produce severe and permanent hypoparathyroidism causing adynamic bone disease with cardiovascular calcifications . cryopreservation of parathyroid tissue is an option to prevent this complication but the technique is not available in our center . in some cases , lomonte et al . have described the successful use of cinacalcet inducing the suppression of intact pth secretion by the parathyroid glands . however , in order to achieve this aim , it is necessary to have an adequate quantity of calcium receptors in the remaining parathyroid tissue , which is not the rules in cases of secondary hyperparathyroidism refractory to the medical treatment . although cinacalcet represents a valid option for these patients , it is not available for use in many countries , for example , in latin america countries . since the early 1980s the basis of this therapy is that enlarged parathyroid glands with nodular hyperplasia are destroyed selectively by ethanol injection . we recently reported in dialysis patients a significant decrease in pth , with improvement in serum calcium , phosphate , and ca p product . patients under dialysis , with large nodule volume and very high pth levels , obtained good results after peit . failure to peit could be related to a wrongly selection of gland for ethanol injection . poor results have been obtained in glands with difficult accessibility , diffuse hyperplasia , ectopic glands , and ultrasonographic poor visibility such as in the case of patient number 6 . it has also proved to be useful in cases of hyperparathyroidism after renal transplantation , complicated with hypercalcemia and hypophosphatemia with few and minor complications . in this setting , parathyroidectomy is considered too aggressive for controlling the hyperparathyroidism , and was carries out . at the present , there are no data about the use of peit in patients with recurrent hyperparathyroidism after subtotal parathyroidectomy , so that this is the first series of patients reporting this technique in this setting . all the patients included in this study suffered from a severe secondary hyperparathyroidism and had previously undergone at least one subtotal parathyroid surgery . after peit , the level of intact pth showed a significant decrease with a mean rate of 72% . four patients reached levels of intact pth within the parameters recommended by k / doqi guidelines . in one case , the level was close to the suggested value with 311 pg / ml and in the remaining patient no adequate response was achieved ( table 2 ) . in summary , as it was previously demonstrated for patients undergoing dialysis and transplantation , peit has proved to be a useful technique for the management of recurrent postsurgical secondary hyperparathyroidism . it was useful to rapidly resolve a common complication of parathyroidectomy at a low cost and with a high level of safety . results of the present series suggest that peit should be considered for the treatment of recurrent postsurgical secondary hyperparathyroidism particularly when calcimimetic and cryopreservation are not available . prospective and controlled trials comparing peit with others therapies are needed to confirm their role in the management of this disease . | we evaluated the efficacy of percutaneous ethanol injection therapy ( peit ) as a therapeutic option for recurrence of secondary hyperparathyroidism after subtotal parathyroidectomy in esrd patients .
six patients underwent peit .
a mean of 1.3 0.8 ethanol injections was performed .
nodular volume was 1.5 1.7 cm3 , and 2.8 2.8 cm3 of ethanol was injected per patient . after ethanol injection pth decreased significantly ( 1897 754 to 549 863 pg / ml ( p < .01 ) ) .
there was also a reduction in serum calcium , phosphorus and calcium - phosphorus product .
a positive and significant correlation was found between nodular volume with ethanol injected and time from parathyroidectomy .
only one patient required hospitalization due to severe hypocalcaemia .
in other two cases , local discomfort and temporary mild dysphonia were registered .
peit is an effective treatment to control recurrences of secondary hyperparathyroidism postsubtotal parathyroidectomy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a 53-year - old woman developed large bowel obstruction with symptoms that arose 48 hours before presentation . she had visited the emergency department once 2 years before the current episode because of mass prolapsing through the rectum . per - rectal examination upon the current presentation revealed a pedunculated lesion in the rectum whose upper extent was beyond the reach of the finger . computed tomography ( ct ) scan confirmed the diagnosis of intussusception [ figure 1 ] . during the operation , chronic intussusception was identified , with an irreducible intussusceptum starting at the level of the proximal sigmoid colon and reaching to the level of the mid - rectum [ figure 2 ] . ct scan image showing target lesion of colonic intussusception operative specimen of colon showing lipoma as lead point of intussusception intussusception is an unusual cause of bowel obstruction in adults , accounting for just 1% of all cases . unlike in the pediatric population , intussusception in adults analyzed 1048 cases of adult intussusception and reported that only 29% of adult colonic intussusceptions were caused by benign lesions . weinberg et al . reported an incidence of gastrointestinal lipomas of 5.8% , based on their autopsy series . they also found that the colon is the most common part of the gastrointestinal tract to develop a lipoma . clinical diagnosis of intussusception is difficult . unlike in children , adults present with a variety of symptoms , which can be chronic or acute . ct scan is considered the most useful imaging modality to confirm the diagnosis of intussusception . the target lesion observed on ct or ultrasound scan is indicative of the intussusceptum surrounded by the edematous intussuscipiens . a lesion with a radio - density similar to that of fat just distal to the target lesion is suggestive of a lipoma as the lead point for intussusception . however , this finding may change depending on the degree of infarction and fat necrosis present . in fact , buetow et al . reported that only 1 in 10 colonic intussusceptions caused by lipoma showed fat - attenuation , whereas the remaining cases had densities varying from half - fat to pure soft - tissue densities . lipomas less than 20 mm in diameter are usually asymptomatic and are often discovered inadvertently during colonoscopy . observation of the tent sign ( mucosa can be elevated with biopsy forceps over lipoma ) , pillow sign ( lesion can be indented with the biopsy forceps ) , or naked fat sign ( fat can be extruded from the lesion after serial biopsy ) help to confirm the diagnosis of lipoma during endoscopy . such small lesions can be safely removed endoscopically . however , symptomatic lipomas of the colon require a more extensive intervention . the safety of endoscopic removal of larger lipomas is controversial , because of the possibility of invagination of the serosa in the stalk leading to free perforation . reviewed reported cases in the literature and suggested that endoscopic resection of larger lipomas can be safely performed , though they reported 6 perforations following 46 resections . in cases unsuitable for endoscopic resection , surgical resection of the involved segment is recommended for symptom relief and prevention of intussusception . for established colonic intussusception , laparotomy is generally recommended . colotomy and excision of the lesion is not generally recommended , unless the benign nature of the lead point is preoperatively confirmed . in addition , colotomy would have to be performed through a previously ischemic oedematous bowel . in irreducible intussusception , as observed in our case , such a procedure is not possible , even if the benign nature of the lesion has been confirmed . in adult colonic intussusception , because of the high proportion of malignant initiating lesions , resection of the involved segment of the bowel is generally recommended . for this reason , azar et al . , who examined 58 cases of adult intussusception , recommend a formal resection along the route of lymphatic drainage in all cases of adult intussusception . operative reduction of colonic intussusception is also not recommended , because of the fear of possible transperitoneal seeding of the tumor . colonic lipoma , though is a benign condition in itself , can lead to intussusception . resection of the involved segment of the colon is the most appropriate choice of treatment in most such cases . | the manuscript deals with the case of a 53-year - old woman who developed large bowel obstruction .
per - rectal examination revealed a pedunculated lesion in the rectum ; rigid sigmoidoscopy revealed a prolapsing pedunculated mass with a necrotic surface .
the patient recovered well following anterior resection .
histology confirmed a pedunculated sub mucosal lipoma as the lead point for intussusception .
colonic intussusception is a rare cause of adult large bowel obstruction , and the preoperative clinical diagnosis of this condition can be difficult .
resection of the involved segment of the colon is the most appropriate choice of treatment in most such cases . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
preparing dii / tungsten bead bullets : dii ( 1 - 1'-dioctadecyl-3,3,3',3'- tetramethylindocarbocyanine perchlorate ) bullets should be prepared in advance of cutting brain slices . the procedure takes approximately 2 - 4 hours depending on how many bullets are prepared at once . if starting from a new batch of tungsten beads , prepare aliquots of 300 mg each . aliquots are prepared by suspending 6 grams of tungsten in 2 ml of methylene chloride . then , pipette 100 l of bead solution into microfuge tubes to produce aliquots of 300 mg tungsten beads . alcohol can also be used minimize evaporation ) . when starting from aliquots of beads , resuspend each aliquot ( 300 mg tungsten beads ) in 300 l of methylene chloride and cover quickly to prevent evaporation . prepare dye solution by weighing 13.5 mg of lipophilic dye dii and adding 450 l of methylene chloride ( final concentration = 3mg/100l ) . place a glass slide on a piece of wax - coated weigh paper and pipette 100 l of beads onto the slide . add 100 l of dii solution , mix thoroughly using pipette tip , and air dry until beads turn light grey . use a razor blade to scrape beads off the glass slide and dice the beads into a fine powder . ( note : use a new blade if doing more than one color of bullets so as to not contaminate dyes ) . scrape beads onto the weigh paper and funnel beads into a 15 ml conical tube . add 3 ml of water and sonicate in water bath for 10 - 30 min at room temperature . ( note : dicing of the powder and sonication are applied to minimize the formation of clumps of coated beads that will disrupt the sparse labeling of individual neurons ) . 2 . preparing polyvinylpyrrolidone ( pvp ) solution and tubing : to improve bead attachment to the bullet tubing ( tezfel tubing ) , coat it with polyvinylpyrrolidone ( pvp ) solution . prepare 10 ml of pvp solution in water at a concentration of 10 mg pvp / ml . use a 12 ml syringe with tubing adaptor ( flexible tubing with slightly larger diameter ) to pass the pvp solution through the bullet tubing and vortex the beads to produce a homogenous solution and use the syringe to pull the bead solution through the tubing so that beads are evenly distributed throughout the tubing . ( ( note : ) try to minimize the number of air bubbles in the tubing ) . use the syringe to gently remove the water so that only the beads remain . spin the tubing in the prep station and dry with nitrogen gas until water droplets are no longer visible . cut bullets with tubing cutter into 13 mm lengths and place in scintillation vials containing drierite or some kind of anhydrous calcium sulfate . 3 . dii staining : this labeling technique can be used to stain neurons in brain tissue from diverse species ; in this particular case , from mouse ( 3 - 6 month old ) and non - human primates ( 9 - 15 years old ) . it is preferable that slices are prepared from fixed brain tissue obtained by transcardiac perfusion of fixative solution because tissue preservation is expected to be best under this condition . however , fixation by perfusion is not always feasible ( as was the case with the monkey tissue ) and diolistic labeling can still be successfully applied under different procedures for tissue preparation . here we describe three different procedures for tissue preparation : fix brain by transcardiac perfusion remove brain postfix for 10 min cut slice stain remove brain cut block of tissue fix block wash in pbs cut slice stain remove brain cut slices fix wash stain in the present study , the monkey brains were obtained from subjects that were transcardially perfused with ice cold artificial cerebral spinal fluid ( acsf ) prior to brain harvest and a block ( 4 mm thick ) of tissue containing the caudate and putamen was fixed for 60 min at room temperature . for all procedures , fixative solution contains 4% paraformaldehyde and 4% sucrose in pbs ( prepared fresh or used within 15 days ) . overfixation can affect staining by disrupting the integrity of the plasma membrane and causing dye to leak out of the cell ( see more information under results ) . for procedure a and b , slices ( 200m ) are cut from fixed brain or tissue block and slices placed in 24-well plate with pbs . for procedure c , fresh acute brain slices ( 200 m ) are cut with a vibratome in cold cutting solution containing ( in mm ) 110 choline - cl , 25 nahco3 , 1.25 nah2po4 , 2.5 kcl , 0.5 cacl2 , 7 mgcl2 , 25 glucose , 11.6 ascorbic acid , 3.1 pyruvic acid ( osmolarity = 310 mosmols ) and immediately after slices are placed in 24-well plates and fixed for 30 min with fixative solution at room temperature . wash the slices with pbs , 3 times . before shooting slices , remove the pbs from the wells and , using a paintbrush , place the slice in the center of the well . shoot dii bullets through 3.0 m filter paper using a helios gene gun system at 120 - 180 psi helium gas pressure by placing the gun at a distance of 1.5 cm between the sample and the end of the barrel.(important note : only neurons within 50 mm of the slice surface will be labeled by this method so it is important to keep the same side of the slice facing up during the washes and for mounting . in this way , you will make sure that the labeled neurons will be within focal distance when imaging with a confocal microscope ) . wash slices with pbs 3 times and store them in pbs for several hours to allow the dii to spread along the dendrites . mount slices onto a glass slide with prolong gold antifade and cover with an 18x18 mm no.1 coverslip . ( note : for procedure c , it is best to mount slices on the same day as the integrity of the slices is not well maintained overnight ) . alternatively , the slices can be stained with antibodies before mounting as described below.(note : slides can be used at least 6 months to a year if stored in the dark at 4c . dii is light sensitive and long - term exposure to light will cause the stain to fade ) . permeabilization : incubate slices in 0.01% triton x-100 in pbs solution for 15 min at room temperature ( 300 - 500 l per well).note : do not use higher concentrations of detergent as this will dissolve dii and significantly reduce the fluorescent staining . try to minimize the time in detergent as extensive incubations will also reduce the dii labeling . if extended incubations are necessary , keep slices in pbs rather than in blocking solution . blocking : incubate slices in blocking solution containing 10% goat serum primary antibody : add antibody at the desired dilution in blocking solution ( e.g. rabbit anti - gfp antibody at 1:1000 dilution ) . add 300 - 500 l per well and incubate for 1 - 2 hrs . ( note : if overnight incubations are necessary , remove detergent from blocking solution ) . prepare secondary antibody solution at desired dilution in blocking solution ( e.g. alexa - fluor 488 conjugated antibody at 1:1000 dilution ) . mount slices on slides with prolong gold antifade and cover with an 18x18 mm no.1 coverslip . representative results :
checking for correct labeling : section can be visualized under a fluorescent dissecting scope equipped with a mercury lamp and red fluorescent filter cube to confirm successful diolistic labeling . two important characteristics to look for are a sparse labeling pattern ( figure 1a ) and the ability to identify individual cellular components ( figure 1b - c ) . troubleshooting diolistic labeling : figure 2 shows examples of sections in which the diolistic labeling worked incorrectly . in our experience , there are three main causes for inefficient labeling : labeling is too sparse or dense : very few cells are labeled per section in one case or too many cells are labeled preventing the isolation and study of single cellular elements . solution : adjust the concentration of coated beads in the final solution used for coating the tefzel bullet tubing ( section 1.6 ) . decrease or increase the volume of water ( 3 ml initial value ) used to dissolve the beads in order to correct for too sparse or too dense labeling , respectively . in addition , low efficiency of labeling might be caused by less than optimal gas pressure when shooting the coated beads onto the sections . this possibility can be ruled out by making sure that the tefzel bullet tubing has released most of the coated beads and it appears clear after shooting . otherwise , gas pressure for shooting should be increased.bad bullets : large clumps or clusters of dye - coated tungsten beads are formed during the bullet preparation . solution : make new bullets paying particular attention to section 1.5 and/or extend sonication time in section 1.6.over-fixation : tissue is kept in paraformaldehyde solution for longer than the optimally required time for fixing ( 30 minutes for 200 - 300 m sections , 1 hour for 4 mm sections ) . this compromises the integrity of the plasma membrane and produces labeled sections that look like those shown in figure 2c - d in which labeling seems out of focus due to dispersion of dye out of the cells . labeling is too sparse or dense : very few cells are labeled per section in one case or too many cells are labeled preventing the isolation and study of single cellular elements . solution : adjust the concentration of coated beads in the final solution used for coating the tefzel bullet tubing ( section 1.6 ) . decrease or increase the volume of water ( 3 ml initial value ) used to dissolve the beads in order to correct for too sparse or too dense labeling , respectively . in addition , low efficiency of labeling might be caused by less than optimal gas pressure when shooting the coated beads onto the sections . this possibility can be ruled out by making sure that the tefzel bullet tubing has released most of the coated beads and it appears clear after shooting . otherwise , gas pressure for shooting should be increased . bad bullets : large clumps or clusters of dye - coated tungsten beads are formed during the bullet preparation . solution : make new bullets paying particular attention to section 1.5 and/or extend sonication time in section 1.6 . over - fixation : tissue is kept in paraformaldehyde solution for longer than the optimally required time for fixing ( 30 minutes for 200 - 300 m sections , 1 hour for 4 mm sections ) . this compromises the integrity of the plasma membrane and produces labeled sections that look like those shown in figure 2c - d in which labeling seems out of focus due to dispersion of dye out of the cells . confocal imaging : image stacks are acquired using a confocal microscope ( zeiss lsm 510 meta ) with a 20x objective for the whole cell and 63x water immersion objective for dendrite segments . dii was excited using a dps 561 nm laser line and green fluorescence from the secondary antibody was excited using a 488 nm laser line . the optical sectioning of the labeled sample achieved when using confocal microscopy further allows for isolation of single labeled cells in the sample . figure 3a shows a striatal medium spiny neuron from mouse brain and its complex dendrite branch pattern . high magnification images of dendrite branches of these neurons from rodent ( figure 3b ) and non - human primate ( figure 3c ) demonstrate the degree of staining in dendrites and dendritic spines using this technique in both species . dendrites and their protrusions ( spines ) appear well defined , even when considering the long , thin spine heads so abundant in medium spiny neurons.when combining diolistics with immunostaining , confocal imaging is also helpful in unequivocally localizing the stain to the same focal plane and the same cell . figure 4 shows an example of colocalization of dii labeling and immunostaining for gfp in a single cell . the image is one stack ( 0.7 m z - section ) obtained from a striatal slice from a transgenic mouse expressing the fluorescent protein gfp under the d1 dopamine receptor promoter . ( a ) low magnification image of a stained brain slice containing the caudate nucleus from a cynomolgus monkey that shows sparse labeling of neurons with dii . ( b - c ) isolated medium spiny neurons can be easily identified using a fluorescent dissecting scope . ( a - b ) stained slices from dorsal striatum of monkey ( a ) and mouse ( b ) showing large clumps of dye - coated beads and as a consequence , no individual cellular elements can be distinguished . ( c - d ) images that exemplify the result of applying diolistic labeling to sections that were kept in fixative solution for prolonged periods of time or where tissue preservation failed in monkey ( c ) and mouse ( d ) tissue . figure 3 . ( a ) , image stack of a whole cell allows for morphological analysis of the dendritic branches . ( b - c ) dendrite segments from mouse ( b ) and monkey ( c ) medium spiny neurons show clear labeling of dendrite and spines . ( a ) dii labeledmedium spiny neuron from striatum of bac transgenic mouse expressing gfp under the d1 dopamine receptor promoter . ( b ) immunostaining using anti - gfp antibody as described by methods adapted from lee et al . same field as a. ( c ) composite image of red and green fluorescence identifies dii - labeled neuron as a gfp - positive neuron . diolistic labeling is one of the most versatile techniques available for fluorescently labeling cells because it can be applied to tissue sections from diverse species , to a wide range of ages , and to tissue obtained fresh or from fixative - perfused animals ( see also gan et al . , 2009 ) . the process is relatively fast as it takes 1 - 2 days and it can be combined with other more classical labeling approaches such as immunostaining ( lee et al . , 2006 ) . special attention should be paid to avoid over fixing and the use of high detergent concentrations in incubation solutions because these will comprise the integrity of the lipophilic membrane and cause the dye to leak out of the cells . antibody penetration can be facilitated by low concentrations of triton x-100 ( lee et al . , 2006 ) , as well as digitonin or saponin in the incubation solution ( matsubayashi et al . , 2008 ) . some modifications that can be applied to this technique include the use of bullets with multiple dyes as described by gan et al . ( 2000 ) or changing the length and type of antibody exposure ( neely et al . , neuronal morphology is of great interest because of the large diversity found in the brain and the speculation that cell shape might reflect on the function multiplicity of neuronal populations in the nervous system . one example of this is the fact that many neurons in the mammalian nervous system display small protrusion called dendritic spines that are the site of glutamatergic synapses . in this way , the density of glutamatergic synapses onto a cell can be correlated to the density of dendritic spines , which can be measured using the labeling technique described herein . furthermore , other morphological parameters such as dendrite total length , branching pattern , dendritic spine shape and density can be quantified and studied . the use of fluorescent labeling for studying neuronal morphology has many advantages when compared to more traditional techniques that rely on bright field microscopy ( e.g. golgi staining ) because it allows for higher resolution confocal imaging . another advantage of using dii as a fluorophore in experiments aimed at measuring dendritic spine density and morphology is its lipophilic properties . dii partitions into the plasma membrane and provides a well defined outline of the neuronal processes and dendritic protrusions . given the small volume of most dendritic spines ( less than 1 femtoliter ) , membrane staining is more efficient and allows for better visualization of small , thin protrusions than cytoplasmic staining . all animal procedures were performed following guidance from the animal care and use committee at niaaa and the oregon national primate research center . | diolistic staining uses the gene gun to introduce fluorescent dyes , such as dii , into neurons of brain slices ( gan et al . , 2009 ;
o'brien and lummis , 2007 ; gan et al . , 2000 ) . here
we provide a detailed description of each step required together with exemplary images of good and bad outcomes that will help when setting up the technique . in our experience , a few steps proved critical for the successful application of diolistics .
these considerations include the quality of the dii - coated bullets , the extent of fixative exposure , and the concentration of detergent used in the incubation solutions .
tips and solutions for common problems are provided.this is a versatile labeling technique that can be applied to multiple animal species at a wide range of ages . unlike other fluorescent labeling techniques that are limited to preparations from young animals or restricted to mice because they rely on the expression of a fluorescent transgene , diolistic labeling can be applied to animals of all ages , species and genotypes and it can be used in combination with immunostaining to identify a specific subpopulation of cells . here
we demonstrate the use of diolistics to label neurons in brain slices from adult mice and adult non - human primates with the purpose of quantifying dendrite branching and dendritic spine morphology . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
temporalis myofascial flap was first used by golovine more than 100 years ago , and it remains a very reliable regional flap for the reconstruction of the maxillofacial defects . the proximity of the oral cavity , palate , oropharynx , and the middle third of the face in addition to the reliable vascular pedicle makes the temporalis myofascial flap valuable for reconstruction . the anatomy and surgical technique of the temporalis myofascial flap has been well documented . most of the contemporary techniques require intentional fracture of zygomatic arch and its refixation once the temporalis myofascial flap is harvested through the defect created by fracture of the zygomatic arch . although the intentional fracture of the zygomatic arch facilitates intraoral transposition of the flap , it results in additional surgical trauma . furthermore , this procedure requires hardware for refixation that ultimately increases overall duration and cost of the surgery . we have proposed a new method of intraoral transposition of the temporalis myofascial flap without zygomatic arch osteotomy . the flap is elevated and it includes temporal and frontal branches of the facial nerve . then , periosteal elevation is made in continuity with the myofascial flap in whole of the temporal fossa maintain a close contact with the bone to preserve the vessels . the temporal fascia is freed from its insertion on the upper border of the zygomatic arch . this increases the arc of rotation of the flap . if required , one can perform coronoidotomy through intraoral access to further increase the arc of rotation and the length of the flap . two long silk sutures ( anterior and posterior ) are secured to the myofascial flap at its thickest portion that is just above the zygomatic arch [ figure 1 ] . a 1-inch width malleable retractor is inserted from above , lateral to the temporais fascia and medial to the zygomatic arch , to reach the intraoral region [ figure 2 ] . antero - posterior sweeping of the malleable retractor creates a tunnel medial to the zygomatic arch . two long and narrow beak hemostats are then clamped to the oral end of the malleable retractor , and the temporal end of the malleable retractor is then pulled out gently , bringing the hemoststs along with it [ figure 3 ] . once the beaks of hemoststs exit through the temporal region , the anterior and posterior silk sutures are clamped to the hemoststs [ figure 4 ] . then , both the hemostats are pulled simultaneously intraorally . gentle traction applied to the sutures that bring the thickest portion of the myofascial flap intraorally . occasionally , an assistant can do gentle manipulation with the fingers at the thickest portion of the flap to facilitate the intraoral transposition of the flap . now , rest of the portion of the flap can easily be transposed intraorally with the help of the traction sutures [ figure 5 ] . in this way , whole of the flap can easily be transposed intraorally through a tunnel created medial to the intact zygomatic arch and sutured to fill the defect [ figure 6 ] . two long traction sutures tied at the thickest portion of the flap malleable retractor creating tunnel for intraoral transposition of the flap two narrow and long hemostats clamped to the oral end of malleable retractor traction sutures clamped to the haemostats transposition of the temporalis myofascial flap intraorally temporalis myofascial flap sutured to the intraoral defect of the various regional flaps , the temporalis muscle provides one of the best options because of its reliability , vascularity , adequate bulk , and proximity to the defects in the oral and maxillofacial region . it has been used for reconstruction of defects in the oral and maxillofacial region , including the base of skull , orbit and eyelids , cheek , chin , tongue , maxilla , palate , and mandible . the popularity of the temporalis flap is due to the success of the flap , the minimal complications at the donor site , and the adaptability at the recipient site . abubaker and abouzgia reviewed 11 published case series in the english literature between 1987 and 2000 on the use of this flap for reconstruction of intraoral defects . they showed that the flap failure rate was very low ( 1.6% ) and the incidence of complications associated with the technique was minimal and mostly transient . undoubtedly , it is the technique responsible for the success of any flap . there seems no flaw in the inherent characteristics of temporalis myofascial flap ; it is the surgical technique which can be further improved to further reduce the failure rates and complications . there has been consistent improvement in the surgical techniques to harvest the temporalis myofascial flap , mostly practice fracture , and refixation of the zygomatic arch for transposition of the flap . the disadvantages of this conventional technique include additional surgical trauma during exposure of the zygomatic arch and its intentional fracture , increased risk of facial nerve damage during exposure of the zygomatic arch , and an overall increase in the cost factor due to increased surgical time and hardware required for the fixation of the zygomatic arch . we practiced a relatively newer and simpler technique for transposition of temporalis myofascial flap into the oral cavity without fracturing the zygomatic arch , thereby eliminating all the possibilities of complications and disadvantages of the conventional terchnique that involve intentional fracture of the zygomatic arch . another technique that does not involve the intentional fracture of the zygomatic arch is rotation of the flap over the arch , but it causes unaesthetic bulk in the region of the zygomatic arch and also results in temporomandibular joint movement difficulty . in addition , there might be a risk of strangulation of the vascular pedicle that can lead to flap necrosis . the temporomyofascial flap is a versatile flap for the maxillofacial reconstruction as far as the proximity , size , reliability of vascularity , and the technical ease are concerned . although currently existing techniques provide surgical ease with low rate of complications , search for better and easier techniques should always be welcomed and practiced . we feel that technique explained in this text would help surgeons to harvest the temporalis myofascial flap in a more prudent way . | among plethora of options , the temporalis myofascial flap remains a workhorse for the maxillofacial reconstruction .
the inherent advantages include reliable vascularity , adequate size , and proximity to the defect .
although contemporary surgical techniques provide fair surgical results with low rate of complications , their intraoral transposition involve additional surgical trauma by intentional fracturing of the zygomatic arch .
we have proposed herein a simpler technique of temporalis myofascial flap transposition into the oral cavity without zygomatic arch osteotomy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
angiosarcoma is a malignant endothelial cell tumor of vascular or lymphatic origin and accounts for approximately 2% of all soft tissue sarcomas . 1
the most common primary sites are the skin and the subcutaneous tissue of the head and neck . 3
primary pulmonary angiosarcoma is extremely rare , only a few cases having been reported . a 78-year - old female nonsmoker had previously been examined , a ct scan of the chest having shown a left upper lobe pulmonary mass ( figure 1a ) . at that time , she underwent bronchoscopy with bal and bronchial biopsy . two years later , she was referred to our hospital with a six - month history of shortness of breath , dry cough , and weight loss . a chest x - ray and a chest ct scan ( without contrast ) identified a 10 7 cm lesion in the left upper lobe without forming cleavage plans with the aorta and the pulmonary artery ( figures 1b and 1c ) , with a small left pleural effusion and small mediastinal lymph nodes . an f - fluorodeoxyglucose positron emission tomography - ct ( fdg pet - ct ) scan ( figure 1d ) showed increased metabolic activity in many organs , greatest in the mass in the upper left lobe , the maximum standardized uptake value ( suvmax ) of which was 22 . metabolic activity was also increased in the mediastinal lymph nodes ( suvmax = 7 ) , as well as in the right and left suprarenal glands ( suvmax = 16 for both ) ; the aortic lumbar lymph nodes ( suvmax = 11 ) ; and the right inguinal lymph node ( suvmax = 10 ) . in addition , there was a mesenteric focus , together with subcutaneous tissue nodes and multiple locations in bone . figure 1.evolution of angiosarcoma in a 78-year - old female nonsmoker : in a , initial ct scan of the chest showing a left upper lobe pulmonary mass ; in b and c , ct scans of the chest , obtained two years later , showing a 10 7 cm lesion in the left upper lobe , with a small left pleural effusion and small mediastinal lymph nodes ; in d , an f - fluorodeoxyglucose positron emission tomography - ct scan showing increased metabolic activity in many organs , greatest in the mass in the upper left lobe . the bronchoscopic examination revealed a mass occluding the left upper lobe bronchus ( figure 2 ) , and a bronchoscopic biopsy was performed . before the results of the tissue sample examination had been obtained , she developed right hemiparesis and a new subcutaneous nodule arose . the histological examination of the biopsy specimen showed a soft - tissue neoplasm with a sheet - like or enclosing cleft arrangement of spindle and epithelioid cells with prominent nucleoli , with some multinucleation ; mitotic figures were conspicuous , as were extensive necrosis and hemorrhage ( figure 3a ) . immunohistochemical staining of the tumor specimen revealed that it was strongly positive for cd31 ( figure 3b ) , factor viii - related antigen ( figure 3c ) , and vimentin ; weakly positive for the nuclear transcription factor fli-1 and cytokeratin ae1/ae3 ; and negative for cd34 , desmin , and smooth muscle actin . .
figure 3.histological examination of the biopsy specimen : in a , extensive necrosis and hemorrhage ; in b , immunohistochemical staining for cd31 ; in c , immunohistochemical staining for factor viii - related antigen . her death was attributed to the progression of the disease , the brain metastases in particular . nevertheless , we believe that the case presented here was one of primary pulmonary angiosarcoma . the patient had a two - year evolution of a pulmonary mass that had gone unmonitored and untreated for more than two years . it seems apparent that the previous lesion corresponded to the pulmonary angiosarcoma that evolved and disseminated during that time . this case report also documents the behavior of a primary pulmonary angiosarcoma , which is characterized by insidious growth with extensive local invasion and hematogenous metastasis .
4
early diagnosis of pulmonary angiosarcoma is not common , because of its rarity and the low index of suspicion . according to data in the literature , the average age of pulmonary angiosarcoma patients is 55.9 years ( range , 23.0 - 82.0 years ) and males are more often affected than are female . 5
patients usually present nonspecific respiratory symptoms that include hemoptysis , cough , dyspnea , chest pain , and weight loss . on ct scans .
4
6
7
imaging with pet can be useful in the diagnosis , staging ,
8
and follow - up of patients with angiosarcoma . 9
in the case presented here , the fdg pet - ct scan confirmed its usefulness in identifying the regions and systems involved . . those cells can be rounded , polygonal , or fusiform , with or without an epithelioid appearance . in well - differentiated areas , abnormal endothelial cells form functioning vascular sinusoidal channels that are continuous with normal vascular channels . in patients with progressively more aggressive disease , in poorly differentiated areas , the malignant endothelial cells form continuous monolayers , usually with an epithelioid morphology . an angiosarcoma typically expresses endothelial markers including factor viii - related antigen , cd34 , cd31 , and fli-1 . among those markers , factor viii - related antigen is the most specific but the least sensitive . positivity for cd31 is relatively specific and extremely sensitive , being detected in approximately 90% of the cases . in approximately 30% of the cases , angiosarcoma expresses cytokeratin . 10
due to the rarity of angiosarcoma , no standardized therapy regimen has been established , especially for primary pulmonary angiosarcoma . patients with pulmonary angiosarcoma have been treated with radiotherapy ,
9
11
surgical resection ,
4
9
immunotherapy , chemotherapy ,
4
6
9
or a combination of those . 4
6
9
11
although none of those treatments have been shown to be effective , there have been reports of effective treatments for the condition ,
4
9
11
especially in cases of localized disease . it has been proposed that the most effective treatment is surgery , which should be considered as early as possible for resectable tumors .
5
however , neoplasms are often inoperable at the time of diagnosis . multimodality therapy , such as the combination of radiotherapy and immunotherapy ( recombinant interleukin-2 )
11
and that of surgery and chemotherapy ,
4
has also proven to be effective . chemotherapy with gemcitabine and docetaxel has been reported to produce a complete radiographic response . 9
the prognosis of pulmonary angiosarcoma is poor , mortality within the first few months after clinical presentation , as occurred in the case presented here , approaching 100% . 4
7
angiosarcoma is a rare malignant neoplasm , and only a few dozen cases of primary pulmonary angiosarcoma have been reported in the literature . a high index of suspicion is essential to its early diagnosis and could improve its poor prognosis . o angiossarcoma um tumor maligno com origem nas clulas endoteliais vasculares ou linfticas e representa aproximadamente 2% de todos os sarcomas de partes moles . 1
os locais primrios mais comuns so a pele e o tecido subcutneo da cabea e pescoo ,
2
sendo o comprometimento pulmonar quase sempre metasttico .
3
o angiossarcoma pulmonar primrio extremamente raro , havendo poucos casos relatados . mulher de 78 anos , no tabagista , anteriormente avaliada por apresentar tc de trax com massa pulmonar no lobo superior esquerdo ( figura 1a ) . na poca , foi submetida a broncoscopia com lba e bipsias brnquicas , os quais foram negativos para tecido neoplsico . dois anos depois , foi encaminhada ao nosso hospital por dispneia , tosse seca e perda de peso com seis meses de evoluo . a radiografia e a tc de trax ( sem contraste ) evidenciaram leso de 10 7 cm em lobo superior esquerdo , sem plano de clivagem com a aorta e a artria pulmonar ( figuras 1b e 1c ) , com pequeno derrame pleural esquerda e pequenos linfonodos mediastinais . a tomografia por emisso de psitrons com f fluordesoxiglicose combinada tc ( fdg pet - ct , do ingls 18f - fluorodeoxyglucose positron emission tomography - ct , figura 1d ) mostrou aumento de atividade metablica em vrios rgos , nomeadamente na massa do lobo superior esquerdo que apresentava o valor padronizado de captao ( suv , do ingls standardized uptake value ) mximo ( suvmx ) de 22 . outros stios envolvidos foram os linfonodos mediastinais ( suvmx = 7 ) , as glndulas adrenais direita e esquerda ( suvmx = 16 ) , os linfonodos articos lombares ( suvmx = 11 ) e o linfonodo inguinal direito ( suvmx = 10 ) . documentou - se ainda , um foco mesentrico , ndulos no tecido subcutneo e extensa metastatizao ssea . figura 1.evoluo do angiossarcoma em mulher de 78 anos , no tabagista : em a , tc de trax inicial mostrando massa pulmonar em lobo superior esquerdo ; em b e c , tcs de trax , obtidas dois anos depois , mostrando leso de 10 7 cm em lobo superior esquerdo , com pequeno derrame pleural esquerda e pequenos linfonodos mediastinais ; em d , tomografia por emisso de psitrons com f fluordesoxiglicose combinada tc mostrando aumento de atividade metablica em muitos rgos , maior na massa no lobo superior esquerdo .
o exame broncoscpico revelou massa ocluindo o brnquio lobar superior esquerdo ( figura 2 ) , e foram realizadas bipsias por broncoscopia . antes da obteno dos resultados do exame da amostra de tecido , a paciente desenvolveu hemiparesia direita e houve aparecimento de novo ndulo subcutneo cervical . a tc de crnio mostrou mltiplas leses cerebrais , e a paciente iniciou tratamento com corticosteroides . o exame histolgico da bipsia mostrou neoplasia de partes moles com arranjo laminar , ou em forma de fenda circundante , formada por clulas fusiformes e epitelioides com nuclolos proeminentes , com alguma multinucleao ; eram evidentes figuras mitticas , extensa necrose e hemorragia ( figura 3a ) . a colorao imuno - histoqumica do fragmento tumoral revelou que esse era fortemente positivo para cd31 ( figura 3b ) , antgeno relacionado ao fator viii ( figura 3c ) e vimentina ; fracamente positivo para fator de transcrio nuclear fli-1 e citoqueratinas ae1/ae3 ; e negativo para cd34 , desmina e actina de msculo liso . portanto , a histologia e a imuno - histoqumica foram compatveis com angiossarcoma epitelioide . figura 3.exame histolgico da bipsia : em a , extensa necrose e hemorragia ; em b , colorao imuno - histoqumica para cd31 ; em c , colorao imuno - histoqumica para o antgeno relacionado ao fator viii . a paciente apresentava massa pulmonar , com mais de dois anos de evoluo , que no havia sido monitorada nem tratada . parece - nos evidente que a leso anterior correspondia ao angiossarcoma pulmonar que evoluiu e se disseminou durante esse perodo . este relato de caso tambm documenta o comportamento do angiossarcoma pulmonar primrio , que se caracteriza por um crescimento insidioso com extensa invaso local e metstase hematognica.o seu diagnstico precoce no frequente , tendo em conta a sua raridade e o baixo ndice de suspeio . de acordo com dados da literatura , a mdia de idade dos pacientes com angiossarcoma pulmonar de 55,9 anos ( variao , 23,0 - 82,0 anos ) e o sexo masculino mais acometido do que o feminino .
5
os pacientes geralmente apresentam sintomas respiratrios inespecficos que incluem hemoptise , tosse , dispneia , dor torcica e perda de peso . na tc , o angiossarcoma primrio pode ser multifocal ou se manifestar como leses solitrias .
4
6
7
a pet pode ser til no diagnstico , estadiamento
8
e seguimento de pacientes com angiossarcoma . 9
no caso aqui descrito , a fdg pet - ct confirmou sua utilidade na identificao do envolvimento sistmico . a bipsia e a anlise imuno - histoqumica so essenciais para o diagnstico de angiossarcoma . clulas endoteliais pleomrficas anormais e malignas constituem a principal caracterstica do angiossarcoma . essas clulas podem ser arredondadas , poligonais ou fusiformes , com ou sem aparncia epitelioide . em reas bem diferenciadas , as clulas endoteliais anormais formam canais vasculares sinusoides funcionais em continuidade com canais vasculares normais . em pacientes com doena progressivamente mais agressiva , a arquitetura torna - se mais catica , com espaos vasculares menos claramente definidos . em reas pouco diferenciadas , as clulas endoteliais malignas formam monocamadas contnuas , geralmente com morfologia epitelioide . o angiossarcoma tipicamente expressa marcadores endoteliais que incluem antgeno relacionado ao fator viii , cd34 , cd31 e fli-1 . entre esses marcadores , o antgeno relacionado ao fator viii o mais especfico , mas o menos sensvel . a positividade para cd31 relativamente especfica e extremamente sensvel , sendo detectada em aproximadamente 90% dos casos . em aproximadamente 30% dos casos , o angiossarcoma expressa citoqueratina .
10
tendo em considerao a raridade do angiossarcoma , no h um esquema teraputico padro estabelecido , especialmente para o angiossarcoma pulmonar primrio . de acordo com os relatos de caso descritos , os doentes com angiossarcoma pulmonar tm sido tratados com radioterapia ,
9
11
resseco cirrgica ,
4
9
imunoterapia ,
4
6
11
quimioterapia ,
4
6
9
ou uma combinao dessas modalidades . 4
6
9
11
embora nenhuma dessas abordagens se tenha mostrado eficaz de forma consistente , h descries de resposta com algumas dessas opes teraputicas ,
4
9
11
especialmente em casos de doena localizada . a cirurgia tem sido proposta como o tratamento mais eficaz , devendo ser considerada o mais cedo possvel no caso de tumores ressecveis .
5
contudo , a sua interveno encontra - se limitada , tendo em conta que a maioria dos casos so inoperveis na data do diagnstico . a terapia multimodal , tal como a combinao de radioterapia e imunoterapia ( interleucina-2 recombinante )
11
e a de cirurgia e quimioterapia ,
4
tem se mostrado eficaz . h relatos de que a quimioterapia com gemcitabina e docetaxel produz uma resposta radiogrfica completa . 9
o prognstico do angiossarcoma pulmonar mau , sendo a mortalidade nos primeiros meses aps a apresentao clnica , como no caso aqui descrito , de aproximadamente 100% .
4
7
em concluso , o angiossarcoma uma neoplasia maligna rara , havendo apenas algumas dezenas de casos de angiossarcoma pulmonar primrio relatados na literatura . apesar de representar um desafio diagnstico para clnicos e anatomopatologistas , essencial um elevado ndice de suspeio para o seu diagnstico precoce e , possivelmente , melhor prognstico . | angiosarcoma is a rare malignant vascular tumor .
pulmonary involvement is usually attributable to metastasis from other primary sites , primary pulmonary angiosarcoma therefore being quite uncommon .
we report a case of angiosarcoma with pulmonary involvement , probably primary to the lung , which had gone untreated for more than two years .
we describe this rare neoplasm and its growth , as well as the extensive local invasion and hematogenous metastasis at presentation .
we also discuss its poor prognosis . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
one of the most important topics in the research on human muscles has been the brain s
control over maximal voluntary contractions1 . this is related to whether the motoneuron pool has sufficient
excitability relative to the force the muscle attempts to generate . this can be examined by
analyzing the muscular response pattern upon transmission of a maximal electrical stimulus
generated by a muscle undergoing a maximal voluntary contraction2 . a single transmitted electric stimulus is referred to as an
interpolated twitch , and the technique is called the twitch interpolation technique . as
the intensity of a muscular contraction increases , the amplitude of the twitch decreases ;
the excitability of the motoneuron pool can be measured by assessing the degree of amplitude
reduction . one application of this method is measurement of the level of muscular inhibition
( mi ) . muscular inhibition refers to the amount of muscle inhibited from carrying out a
maximal voluntary contraction ordered by the brain . the inhibition occurs via a process in
which a supramaximal electric stimulus is transmitted to the nerve connected to the muscle
undergoing a maximal voluntary contraction3 . in general , resisted movement , a training method to enhance muscular functions , does not
increase muscle strength by increasing the number of muscle fibers but rather increases
muscle strength by expanding them . increased muscle strength during the early stages of
training is merely the result of the adaptation of neural factors , not the result of muscle
hypertrophy4 . such neuromuscular
adaptation is known to be induced by the use of submaximal stress during the initial stages
of training . similarly , increased muscle strength after long - term resistance exercise is not
solely the result of muscle hypertrophy either , as neuromuscular factors may be
involved5 , 6 . walking and running the two most representative aerobic exercises are becoming increasingly
popular among people seeking to improve their health . resistance exercise , a type of
anaerobic exercise , is attracting many health - seeking individuals as well . as is evident ,
many people are engaging in physical activities centered on enhancing cardiopulmonary and
muscular functions . reaping the benefits from these exercises unfortunately , however , many fail to exploit these workouts to their
fullest due to an insufficient number of workout sessions , short - term and intermittent
workouts , and early termination . inappropriate and sudden stress , muscular fatigue , and muscular activation may increase the
risk of injury by changing several properties of the muscles7 . most of the existing research has simply focused on the changes in outcomes , such as
changes in muscular strength or exercise performance after resistance exercise . any form of
change in outcome implies a change in the various internal environments within a muscle ;
that is , it signifies that there are several neuromechanical changes within the muscle , such
as neurological , functional , and mechanical changes , and that the features of these changes
are dependent on the exercise load and amount of stimulation . therefore , it is essential to
analyze the internal environment of muscles against a variety of external environmental
factors and stimulation conditions in order to determine the causes of change . thus , this study employed a neuromechanical approach and used the interpolated twitch
technique ( itt ) to conduct a comprehensive and multilateral analysis of the neurological ,
functional , and mechanical changes in human skeletal muscles related to resistance
exercise . the subjects in this study consisted of 11 healthy adult males in their 20s , none of whom
had any orthopedic history ( age , 23.4 1.4 years ; height , 178.5 5.2 cm ; weight , 75.6
8.7 kg ) at the time of the study . the subjects received a complete explanation of the
objective and contents of this study , as well as the study procedures , subjects rights , and
safety issues , after which they voluntarily agreed to participate and signed an informed
consent in accordance with the ethical standards of the declaration of helsinki . the subjects performed a standing barbell calf raise exercise to examine the changes that
occur in the ankle plantar flexors after resistance exercise . to ensure an equal amount of
resistance for all of the subjects , the subjects were directed to perform sufficient warm - up
activities and to choose a load equal to their weights . they placed the bar on the back of
their shoulders with their legs apart at a distance equal to the shoulder length , placed the
metatarsal region of their feet on top of a 5-cm block , and raised their heels at a constant
speed . as they raised their heels , the subjects were directed to reach the maximum plantar
flexion , utilizing the maximum range of motion ( rom ) of their ankle joint , and when lowering
their heels , the heels were to be maintained at a point just above the ground . the subjects
performed a total of five sets consisting of 10 repetitions per set . the present study measured two types of muscular contractions : a maximal voluntary
isometric contraction and a supramaximal muscular contraction after resistance exercise , as
generated by a twitch ( that the human body can not produce voluntarily ) induced by an
artificial electrical stimulation . the equipment used to transmit the electrical stimulus
was a grass 88 siu-5 electrical stimulator ( grass technologies , natus neurology , warwick ,
ri , usa ) . the pulse duration ( 0.5 s ) was equally applied to all subjects with an
inter - pulse duration of 20 ms . to determine the optimal stimulation point , the ankle was fixed at 10 in the plantar
flexion position , and an anode was attached to the femur above the patella , while a cathode
was attached to posterior tibial nerve , which shows the maximum response in the posterior
popliteal region . the maximum stimulation point was found by means of singlet stimulation ,
after which doublet stimulation was applied to induce a supramaximal contraction . the electrical stimulus was given two times each in consideration of the potentiated
effect , and the information about the torques and angles was saved on a personal computer
after computing the voltage value from a dynamometer and running it through an
analogue - digital ( a / d ) converter . a bagnoli 8-channel wireless electromyography ( emg ) system ( delsys , boston , ma , usa ) with a
sampling rate of 200 hz and band - pass filter of 2045 hz was used to collect
electromyographic signals . the electromyography system was used to measure the level of
supramaximal contraction via stimulation of the posterior tibial nerve and the levels of
agonist and antagonist activation during a maximal voluntary isometric contraction ( mvic ) . the electrodes were placed parallel to the muscle fibers located in the center of the
muscle belly of the tibialis anterior , soleus , lateral gastrocnemius , and medial
gastrocnemius muscles . before placing the electrodes , the surfaces were shaved and
sterilized with alcohol to minimize the skin resistance levels . the electromyographic
signals were fed into an a / d converter and later saved on a personal computer . this study used the labview 8.0 ( national instruments , austin , tx , usa ) software to collect
measurement data and save it onto a personal computer . torques and angle signals were
received from the dynamometer , the signals from the four muscles were received from the
electromyography system , and synchronization signals were received from the electrical
stimulator . these data were fed into the a / d converter , and the resulting digital data were
saved on a personal computer . the voltage value received from the dynamometer was
recalibrated and converted to an nm value for analysis , while the remaining signals were
extracted as real data using chart 5 for windows ( adinstruments , colorado springs , co , usa )
program . the collected data were statistically analyzed using the spss for windows , version 12.0 ,
software . the mean ( m ) and standard deviation ( sd ) were calculated , and a paired t - test was
conducted to compare the difference in each variable before and after the resistance
exercise . the mvic torque was found to have decreased from 122.06 21.05 nm ( before exercise ) to
116.80 19.71 nm ( after exercise ) , but the change was not statistically significant . the resting twitch torque also decreased , from 37.04 10.14 nm ( before exercise ) to 31.46
8.61 nm ( after exercise ) , and the change was statistically significant ( p<0.01 ) . mi appeared to have increased from 5.83 6.16% ( before exercise ) to 7.18 5.05% ( after
exercise ) , but the increase was not statistically significant . moreover , muscle activation
slightly decreased from 0.144 0.066 v ( before exercise ) to 0.139 0.065 v ( after
exercise ) , but there was no statistical significance . the muscle contraction time decreased from 0.13 0.01 msec ( before exercise ) to 0.12
0.01 msec ( after exercise ) , and the change was statistically significant ( p<0.001 ) . similarly , the half relaxation time was also decreased , from 0.09 0.01 msec ( before
exercise ) to 0.07 0.01 msec ( after exercise ) , and the difference was statistically
significant ( p<0.001 ) ( table 1table 1.changes in muscle properties of the ankle plantar flexor after heel raise
exercise ( meansd)variableprepostmvic ( nm)122.06 21.05116.80 19.71rtt ( nm)37.04 10.1431.46 8.61**mi ( % ) 5.83 6.167.18 5.05rms ( v)0.144 0.0660.139 0.065ct ( msec)0.13 0.010.12 0.01***hrt ( msec)0.09 0.010.07 0.01***mvic : maximal voluntary isometric contraction ; rtt : resting twitch torque ; mi : muscle
inhibition ; rms : root mean square of muscle activation ; ct : contraction time ; hrt :
half relaxation time . * * p<0.01 ; * * * p<0.001 ) . mvic : maximal voluntary isometric contraction ; rtt : resting twitch torque ; mi : muscle
inhibition ; rms : root mean square of muscle activation ; ct : contraction time ; hrt :
half relaxation time . * * p<0.01 ; * * * p<0.001 the present study sought to conduct a comprehensive and multilateral analysis of acute
neurological , functional , and mechanical changes in human skeletal muscles after resistance
exercise through a neuromechanical approach . the itt was developed by merton in 19548
as a means of measuring the inactivation of the adductor pollicis muscle . it has been used in several studies
that have reported the level of muscular activation ( prominently in the ankle dorsiflexor
and plantar flexor9 , the quadriceps
femoris muscle10 , and the elbow joint
flexor4 ) during a maximal voluntary
contraction . furthermore , the itt has been used in analyzing the mechanisms of muscular
fatigue and muscle weakness induced by a range of causes . in particular , the itt has been utilized in studies of neural adaptation during a maximal
isometric contraction in relation to physical training1 . this study used a dynamometer and electrical stimulator to compare and analyze the mvic
torques and twitch torques before and after resistance exercise in an attempt to ascertain
the changes in muscular strength induced by resistance exercise . the mvic was interpreted as
a voluntary contraction produced by neural control , and the twitch torque was interpreted as
a contraction dependent on the mechanical properties of peripheral nerves without any neural
control . the resting twitch torque value was calculated by averaging the two twitches
induced by the electrical stimuli , and the resting mvic torque value was the value at the
point of maximum contraction based on the passive torque11 . the measurements showed that the mvic torque was lower after resisted exercise , but the
change was statistically insignificant . these results indicate that there is a greater reduction in muscular strength ( after
resistance exercise ) due to the peripheral mechanical systems of muscles than due to
neurological factors12 . they also signify
that although fatigue has an effect on both factors , it has a greater impact on the
mechanical factors13 . future researchers
should conduct further studies on long - lasting fatigue and fatigue reduction or recovery
factors . muscle activation was measured using an electromyography system and the mi value to analyze
neuromuscular properties . the mi value was calculated by measuring the twitching plantar
flexor torque induced by a supramaximal electrical stimulus applied to the posterior tibial
nerve when the plantar flexor muscles were undergoing a maximal voluntary isometric
contraction . the root mean square ( rms ) of muscular activation was computed by running the
measured waveform through the emgwork 4.1 software ( delsys , boston , ma , usa ) . the results
indicated no significant changes in the mi or rms in relation to resisted training . the statistical insignificance pertaining to muscle inhibition and activation should be
examined in association with similar statistically insignificant changes ( caused by
neurological factors ) in muscular strength during an mvic14 . neurological factors not only generate muscle strength but also
play a role in the acute effects of resistance exercise . in fact , it can be said that
peripheral neurological factors sustain the functional decline of mechanical factors induced
by twitching stimulations and that they are less influenced by acute effects overall . the
muscle contraction time and half relaxation time were analyzed to examine the functional
properties of skeletal muscles . the contraction time refers to the period from rest to the
onset of maximum torque , and the half relaxation time refers to the time it takes for the
maximum torque value to decline by half . generally , muscle contraction times and half
relaxation times are thought to be prolonged as muscular fatigue accumulates15 . likewise , the reductions in contraction time and half relaxation time found in this study
appear to stem from muscular fatigue induced by the resistance exercise . similar to other
factors , the measurement variables induced by twitch stimuli all have a statistically
significant impact on the acute effects noted during resistance exercise . in summary , the acute effects of resistance exercise have a temporary impact on the
peripheral mechanical system itself , not on the neurological factors , in terms of reducing
muscle strength . future studies should more closely examine the roles of neurological
factors in intensifying fatigue and several neuromechanical factors in relation to the
periods and lengths of recovery exercises . | [ purpose ] the purpose of this study was to perform a quantitative assessment of
neuromechanical adaptation in skeletal muscles and to propose the scientific underpinnings
of the acute effects induced by resistance exercise .
[ subjects ] the subjects in this study
were 11 healthy adult men in their 20s who had no orthopedic history at the time of the
study . to examine any signs of resistance exercise - induced changes in the ankle plantar
flexor ,
the subjects were directed to perform a standing barbell calf raise routine .
[ methods ] subjects were to carry a load equal to their weights and to perform five sets of
ten repetitions . the maximal voluntary isometric contraction torque , resting twitch
torque , muscle inhibition , root mean square of muscular activation , contraction time , and
half relaxation time were analyzed by synchronizing a dynamometer , an electrical
stimulator , and an electromyography system . [ results ] the maximal voluntary isometric
contraction torque appeared to decline , but the change was not statistically significant .
the decline of resting twitch torque , on the other hand , was found to be statistically
significant . muscle inhibition and root mean
square of muscular activation were both
reduced , but both changes were not statistically significant .
lastly , contraction time and
half relaxation time both statistically decreased significantly after resistance exercise .
[ conclusion ] these results indicate that the acute effects of resistance exercise have a
greater impact on the peripheral mechanical system itself , rather than on neurological
factors , in terms of the generation of muscle force . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
sjgren syndrome is chronic , systemic autoimmune disease characterized by lymphocytic infiltration of the exocrine glands.1 thus , an elaborate involvement of the salivary and lacrimal glands leads eventually to , keratoconjuctivitis sicca and xerostomia . sjgren syndrome may occur in two forms : primary sjgren syndrome and secondary sjgren syndrome . the secondary syndrome is associated with another autoimmune disease , usually rheumatoid arthritis.1 numerous criteria were proposed for diagnosis of sjgren syndrome . most widely accepted are american and european group developed international classification criteria for sjgrens syndrome.2 these criteria include six different criteria : ocular symptoms - ( minimum one of the following points ) - daily , persistent , troublesome dry eyes for not <3 months . oral symptoms - ( minimum one of the following symptoms ) - daily filling of dry mouth for not <3 months , recurrent salivary glands swelling , needs to drink water persistently . salivary gland involvement5 whole salivary flow collection when not stimulated ( < 1.5 ml in 15 min,)sialography shows the presence of diffuse sialectasia , salivary scintigraphy shows uptake is delayed , reduced concentration of tracer and its delayed excretion . antibodies to anti - ss - a , anti ss - b antigens are present . the classification requires four of the six criteria , one of which must be positive biopsy of minor salivary gland or antibody test . a 55-year - old female patient reported to the bharati vidyapeeth deemed university dental college and hospital pune , department of oral medicine and radiology on 28/8/11 complaining of :
inability to eat completely due to loss of teeth.along with that patient also complained of dryness of mouth , since 1 year , and dryness of eyes since 7 - 8 years . along with that patient also complained of dryness of mouth , since 1 year , and dryness of eyes since 7 - 8 years . extraoral examination showed bilateral parotid gland enlargement present on the right ( figure 1)and left side of the parotid region ( figure 2 ) . right parotid gland enlargement . left parotid gland enlargement . on an inspection swelling on right and left of the parotid gland , measuring about 2.5 cm 2 cm in diameter . swelling extending superior up to the inferior border of the mandible at the angle region . on palpation it was diffuse , firm , non - movable , warm , tender on palpation , overlying surface texture was normal , along with that dryness of eyes , fever was also noted . depapilation was present on the anterior 2/3 and lateral border of the tongue ( figure 3 ) . after milking of the left side of the parotid gland pus discharge was coming through parotid duct ( figure 4 ) . ultrasonography shows bilateral submandibular and parotid gland enlargement with multiple hypoechoic lesions within showing very high vascularity , likely to present systemic disorder like sjgren s syndrome . incisional biopsy of lower lip was not done because the patient was not ready for the biopsy . based on history , clinical presentation of the patient , and above investigatory findings , a confirmatory diagnosis of primary sjgren syndrome was given . it is an autoimmune destruction of exocrine glands ( primary salivary and lacrimal)that produces the clinical manifestations of dry mouth , dry eyes ( keratoconjuctivities sicca ) , and in more than 50% of cases , parotid gland enlargement . primary sjgren syndrome is diagnosed when the syndrome is limited to this pattern of involvement . however , this pattern of involvement may be a manifestation of another -well - defined autoimmune disease such as rheumatoid arthritis , systemic lupus erythematosus , or primary biliary cirrhosis . in this context , it is referred to as secondary sjgren syndrome.6,7 sjgren syndrome primarily affects women older than 40 years . however , newer diagnostic techniques such as parotid biopsies and antibody identifications have shown it in children and teenagers.8 the parotid enlargements are usually asymmetric and painless . complete physical examination of our patient at presentation and during the follow - up period of three months failed to reveal evidence of any associated connective tissue disease . treatment of sjgren s syndrome depends on the extent and severity of the clinical manifestations and is better instituted through a multidisciplinary approach . symptomatic treatment includes artificial tears , salivary substitutes to relieve the symptoms and prevent local infectious complications like conjunctivitis and corneal inflammation , development of caries and periodontal disease , a thorough dental preventive program should be implemented in all cases . corticosteroid treatment should be reserved for all the cases showing evidence of organ damage , significant leukopenia or severe clinical symptoms . pathogenesis of sjgren syndrome is complex and uncertain , but thought to be similar to that of the benign lymphoephtlial lesion . 6 - 10% of cases undergo transformation to lymphoma , because of infiltration of lymphocytic cell.9 the patient reported for the first and second visit shows value added scale ( vas ) . prescribed medicine was tablet doxycycline 100 mg on first day bid , followed by od for 5 days . continuous sipping of water throughout the day , orbit vas scale-4 for burning sensation of hot and spicy foods . after second week , drainage of pus like the exudate through left side stensons duct after milking of the parotid gland . tablet augmentin 625 mg . continues sipping of water throughout day , orbit chewing gums 3 - 4 times per day . aquet spray ( lubricating and moisten spray ) 3 - 4 times per day . capsule menopause was also advised after consultation with a gynecologist from bharati hospital for about 1 month . | sjgren syndrome is chronic , systemic autoimmune disease characterized by lymphocytic infiltration of the exocrine glands .
it is an elaborate involvement of the lacrimal and salivary glands , which eventually lead to keratoconjunctivitis sicca and xerostomia .
it may occur in two forms - primary and secondary , which is associated with another autoimmune disease , most commonly rheumatoid arthritis .
numerous criteria were proposed for diagnosis of sjgren syndrome .
most widely accepted are american and european group developed international classification criteria for sjgrens syndrome .
these criteria include ocular symptoms , oral symptoms , ocular signs , histopathology , salivary gland involvement and sialography .
the classification requires four of the six items , one of which must be positive minor salivary gland biopsy or a positive antibody test .
early diagnosis is important to prevent further complications .
the aim of this paper is to emphasis on oral changes , advanced diagnosis , and management of sjgren s syndrome . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
it is found in 19% of patients 3 months after stroke onset and in 20% after 18 months . botulinum toxin treatment for spasticity has been reported to be effective in terms of the modified ashworth scale and patients global assessment scores ; however , significant improvement was not demonstrated in global functional assessment scores , such as the barthel index and the functional independence measure . studies on botulinum toxin injection for post - stroke spasticity have mostly dealt with chronic stroke patients . early use of botulinum toxin is recommended to prevent soft - tissue shortening because spasticity contributes to contracture development in acute - to - subacute stroke . there have been several reports about successful results of early botulinum toxin treatment in subacute stroke patients ; however , the effects of botulinum toxin were not compared between subacute and chronic stroke patients . the goals of this study were to demonstrate differences in botulinum toxin treatment outcomes between subacute and chronic stroke patients , and to suggest proper timing of botulinum toxin injections . patients with spasticity of 1 + or higher on the modified ashworth scale , in the hemiplegic elbow or wrist joint , were eligible . exclusion criteria were quadriplegic stroke , fracture in the upper extremity , recent ( <3 months ) botulinum toxin injection , history of nerve block , intrathecal medication , upper arm operation to treat spasticity , unstable medical conditions , hypersensitivity to botulinum toxin , neuromuscular junction disease , pregnancy , and lactation . the study protocol was approved by the local institutional review board and conducted in accordance with the regulatory standards of good clinical practice and the declaration of helsinki . only patients undergoing inpatient or outpatient rehabilitation treatment 2 days per week were included . from these , 2 groups were selected . patients with elapsed time from stroke of between 4 weeks and 6 months were identified as the subacute group , whereas patients with elapsed time of > 5 years were the chronic group . a total dose of 200 u of botulinum toxin type a ( botox ; allergan inc . , irvine , ca ) the muscles to be injected and the appropriate doses for the individual muscle were selected according to the spasticity pattern of each patient . one or more of the elbow flexor muscles ( biceps brachii , brachioradialis , and brachialis ) were included for each patient , as well as one or more of the wrist flexor muscles ( flexor carpi radialis and flexor carpi ulnaris ) or one or more of the finger flexor muscles ( flexor digitorum profundus , flexor digitorum superficialis , and flexor pollicis longus ) , which also flex the wrist . for the clear measurement of flexion and extension without rotation , the pronator teres muscle was excluded . one vial containing 100 u of botulinum toxin type a was diluted with 2 ml of normal saline . spasticity was evaluated with the modified ashworth scale and the modified tardieu scale in the elbow and wrist joints of the hemiplegic upper extremity . modified ashworth scale scores of 1 + , 2 , 3 , and 4 were changed respectively to 2 , 3 , 4 , and 5 for statistical analysis . for modified tardieu scale measurement , the angle where the catch was beginning to be felt was defined as r1 , the angle of maximum passive range of motion was r2 , and the difference between r1 and r2 was designated d ( dynamic range ) . manual muscle testing , passive range of motion , and brunnstrom stage were also checked in the same joints . functional evaluation was performed with the modified barthel index and the fugl - meyer scale of the hemiplegic upper extremity . patients were assessed just before the injection ( pre ) and 4 weeks later ( post ) . assessment was performed by one of the investigators who was blind to the group allocation . the sample size was calculated based on standardized effect sizes obtained from previously published data from patients with brain lesions . power analysis was performed using the gpower software version 3.1 ( university of dusseldorf , dusseldorf , germany ) . we expected only small numbers of chronic stroke patients to be undergoing rehabilitation , and a priori analysis with the mann - whitney u test indicated that a sample size of at least 8 patients in each group would provide a statistical power of 80% ( = 0.20 and = 0.05 ) . taking into account the 10% dropout rate , a total of 18 patients were needed . comparisons between the 2 groups at each time - point were performed by the mann patients with spasticity of 1 + or higher on the modified ashworth scale , in the hemiplegic elbow or wrist joint , were eligible . exclusion criteria were quadriplegic stroke , fracture in the upper extremity , recent ( <3 months ) botulinum toxin injection , history of nerve block , intrathecal medication , upper arm operation to treat spasticity , unstable medical conditions , hypersensitivity to botulinum toxin , neuromuscular junction disease , pregnancy , and lactation . the study protocol was approved by the local institutional review board and conducted in accordance with the regulatory standards of good clinical practice and the declaration of helsinki . only patients undergoing inpatient or outpatient rehabilitation treatment 2 days per week were included . from these , 2 groups were selected . patients with elapsed time from stroke of between 4 weeks and 6 months were identified as the subacute group , whereas patients with elapsed time of > 5 years were the chronic group . a total dose of 200 u of botulinum toxin type a ( botox ; allergan inc . , irvine , ca ) was used for each patient . the muscles to be injected and the appropriate doses for the individual muscle were selected according to the spasticity pattern of each patient . one or more of the elbow flexor muscles ( biceps brachii , brachioradialis , and brachialis ) were included for each patient , as well as one or more of the wrist flexor muscles ( flexor carpi radialis and flexor carpi ulnaris ) or one or more of the finger flexor muscles ( flexor digitorum profundus , flexor digitorum superficialis , and flexor pollicis longus ) , which also flex the wrist . for the clear measurement of flexion and extension without rotation , the pronator teres muscle was excluded . one vial containing 100 u of botulinum toxin type a was diluted with 2 ml of normal saline . spasticity was evaluated with the modified ashworth scale and the modified tardieu scale in the elbow and wrist joints of the hemiplegic upper extremity . modified ashworth scale scores of 1 + , 2 , 3 , and 4 were changed respectively to 2 , 3 , 4 , and 5 for statistical analysis . for modified tardieu scale measurement , the angle where the catch was beginning to be felt was defined as r1 , the angle of maximum passive range of motion was r2 , and the difference between r1 and r2 was designated d ( dynamic range ) . manual muscle testing , passive range of motion , and brunnstrom stage were also checked in the same joints . functional evaluation was performed with the modified barthel index and the fugl - meyer scale of the hemiplegic upper extremity . patients were assessed just before the injection ( pre ) and 4 weeks later ( post ) . assessment was performed by one of the investigators who was blind to the group allocation . the sample size was calculated based on standardized effect sizes obtained from previously published data from patients with brain lesions . power analysis was performed using the gpower software version 3.1 ( university of dusseldorf , dusseldorf , germany ) . we expected only small numbers of chronic stroke patients to be undergoing rehabilitation , and a priori analysis with the mann - whitney u test indicated that a sample size of at least 8 patients in each group would provide a statistical power of 80% ( = 0.20 and = 0.05 ) . taking into account the 10% dropout rate , a total of 18 patients were needed . comparisons between the 2 groups at each time - point were performed by the mann fifteen subacute stroke patients and 13 chronic stroke patients were recruited , and 9 subacute patients and 9 chronic patients completed the study ( figure 1 ) . no significant differences were found between the 2 groups in terms of age , sex , type of stroke , side of hemiplegia , or comorbidities . the range of duration was 28 to 160 days in subacute group , and 2634 to 6585 days ( 718 years ) in chronic group . the results of the initial evaluation showed no significant differences except on the modified barthel index ( table 1 ) . baseline characteristics of patients in the aspect of spasticity , the modified ashworth scale score was improved significantly in the elbow and wrist extensors of subacute patients only , and the modified ashworth scale score after 4 weeks was different between the 2 groups ( p = 0.004 for the elbow and p = 0.007 for the wrist ) . results of the modified tardieu scale showed improved r1 in the elbow and wrist extensors of both groups , and r1 of the wrist extensor after 4 weeks was different between the 2 groups ( p = 0.019 ) . wrist extensor r2 , which was the same value as wrist extension range of motion , was improved in the subacute patients , and was different after 4 weeks between the 2 groups ( p = 0.008 ) ( table 2 ) . assessment just before the injection ( pre ) and 4 weeks after ( post ) there was no change in manual muscle testing of the elbow and wrist in the chronic patients . the chronic patients showed no change in the modified barthel index , whereas the subacute patients showed improvement in the modified barthel index . the fugl - meyer scale score of the hemiplegic upper extremity was improved in both groups ( table 2 ) . in this study , botulinum toxin injection improved general aspects of spasticity in the subacute patients ; however , the effects on modified tardieu scale scores of the elbow and fugl - meyer scale scores of the hemiplegic upper extremity were comparable between the subacute and chronic groups . to the best of our knowledge , this is the first study to compare the effects of botulinum toxin between subacute and chronic stroke patients in the same setting . previous studies investigated the effects of botulinum toxin in stroke patients with relatively similar duration ( acute , subacute , or chronic ) from stroke onset or at a determined time from onset ( 3 months or 6 months were frequently used ) . the main effect of botulinum toxin injection in the upper extremity was the improvement of spasticity . meta - analyses have reported improvement on the modified ashworth scale and the modified tardieu scale ; most of the studies used the modified ashworth scale and some measured the modified tardieu scale . however , in this study , the modified ashworth scale score was improved in subacute patients only . in chronic patients , the modified ashworth scale score of the wrist extensor was decreased without statistical significance , and the modified ashworth scale score of the elbow extensor was almost unchanged . the modified ashworth scale score of the elbow and wrist extensor after 4 weeks was different between the 2 groups . there have been studies on botulinum toxin injection in which the results showed no improvement on the ashworth scale or the modified ashworth scale . the effect of botulinum toxin injection on the modified ashworth scale score in chronic patients could be lower than expected , and further studies with stricter grouping of stroke duration are needed . on the contrary , r1 in the elbow and wrist extensors and the elbow extensor d showed statistically significant changes in the 2 groups , and r1 and d of the elbow extensor after 4 weeks did not differ between the 2 groups . improvement of tardieu scale scores with botulinum toxin injection was also reported previously . the tardieu scale and the modified tardieu scale are supposed to reflect spasticity more clearly than the modified ashworth scale , with the possible ability to differentiate contracture from spasticity . a study on the effect of botulinum toxin injection in children with cerebral palsy suggested d of the modified tardieu scale as a more valuable tool , whereas in the present study , the changes in r1 and d were statistically significant in both groups . because the change in r2 would be small in chronic patients with contracture , r1 might be more suitable for spasticity measurement . however , manual muscle testing of the elbow flexors and the wrist flexors was unchanged in both groups . due to the reduced flexor muscle tone wrist extension range of motion ( wrist extensor r2 ) and passive range of motion of the wrist were improved in subacute patients only . improvement of passive range of motion after botulinum toxin injection in patients with brain lesions that had developed > 1 year previously was reported , but in the chronic patients , the effect could be lower than expected . although botulinum toxin injection with rehabilitation , dynamic splinting , or serial casting improved contracture in several reports , botulinum toxin injection during the subacute period is recommended to prevent contracture . the modified barthel index was improved in the subacute patients , whereas it was nearly fixed in the chronic patients . improvement of the barthel index after botulinum toxin injection was not supported in a systematic review . the barthel index was not correlated to the degree of spasticity in botulinum toxin - treated patients because mobility and continence items are included in it . therefore , improvement of the modified barthel index in subacute patients might be the result of spontaneous recovery . only small room for improvement of the modified barthel index remained in the chronic patients because the modified barthel index of these patients had already reached the maximum score before botulinum injection . in contrast , the initial fugl - meyer scale score of the hemiplegic upper extremity was far off the full score of 66 in the chronic patients . after botulinum toxin injection , the fugl - meyer scale score was improved in both groups , and there was no difference after 4 weeks . there have been several studies using the fugl - meyer scale as a measure after botulinum toxin injection , and some reported improvement , whereas others did not . the fugl - meyer scale for the upper extremity reflects motor function with more detail because of the 1 to 66 point system . although botulinum toxin injection did not improve brunnstrom stage or the modified barthel index in the chronic patients , it did bring improvement of the fugl - meyer scale score for the hemiplegic upper extremity , which means functional improvement . in this study , improvement of spasticity after botulinum toxin injection seemed to be better visualized in the subacute patients ; however , improvement of the modified tardieu scale for the elbow and the fugl - meyer scale score for the hemiplegic upper extremity was not different between the 2 groups . consequently , improvement of spasticity and function was shown even in the chronic patients , and the change could be easily visualized by assessments such as the modified tardieu scale and the fugl - meyer scale for the hemiplegic upper extremity . although the differences were not statistically significant , the subacute group was mainly composed of older patients with cerebral infarction , whereas the majority of the chronic group consisted of relatively younger patients with cerebral hemorrhage . for economic reasons , it is not easy for chronic stroke patients to be in rehabilitation treatment continuously , and 5 of the 9 chronic patients in this study were undergoing rehabilitation with the help of workers compensation insurance . cerebral infarction is more difficult than cerebral hemorrhage to accept as an industrial disaster , and this situation might affect the different rates of stroke causes and ages in this study . however , it was reported that spasticity and changes after botulinum toxin injection were not different between cerebral infarction and hemorrhage , and the causes would not influence the results of this study . another difference between the 2 groups was the initial value of the modified barthel index , which was fixed in the chronic patients while the subacute patients were in the process of improving it . in other words , the chronic patients acquired maximum independence despite their spasticity , but the subacute patients did not . the second limitation was that this study was comprised of a small number of patients . third , the assessor was aware of the evaluation time , which was pre- or post - botulinum toxin injection ; the blinding was only to the group allocation . the reason for single - assessor assignment was to eliminate inter - rater reliability issues in the measurements . further large - scale studies with a double - blind design are needed . in conclusion , botulinum toxin injection in the subacute period is recommended because it can improve spasticity , contracture , and function . however , botulinum toxin injection can improve spasticity as evaluated with the modified tardieu scale for the elbow and function as evaluated with the fugl - meyer scale for the hemiplegic upper extremity in chronic patients , and the effects are comparable to those in subacute patients . in addition , studies on the effects of botulinum toxin injection might consider stroke duration more strictly . | abstractthe aim of this study was to compare the effects of botulinum toxin injection between subacute and chronic stroke patients.eighteen stroke patients ( 9 subacute and 9 chronic ) with spasticity of 1 + or higher in the hemiplegic elbow or wrist joint , based on the modified ashworth scale were recruited .
modified ashworth scale , modified tardieu scale , manual muscle testing , passive range of motion , brunnstrom stage , modified barthel index , and fugl - meyer scale evaluations of the hemiplegic upper extremity were performed just before the injection and 4 weeks later . a total dose of 200 u of botulinum toxin type a was injected into each patient . one or more of the elbow
flexor muscles and one or more of the wrist flexor or finger flexor muscles were included.modified ashworth scale , manual muscle testing , passive range of motion , and modified barthel index results were improved in subacute patients only . however , modified tardieu scale for the elbow and fugl - meyer scale results were improved in both groups , and the improvement was comparable.in conclusion , botulinum toxin injection in subacute patients was more helpful for spasticity , contracture , and function than in chronic patients
. however , beneficial effects of botulinum toxin injection on spasticity and function in chronic patients were found in the assessments of the modified tardieu scale and fugl - meyer scale . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
despite of increment of liver transplantation ( lt ) , there are still growing numbers of accumulated patients in waiting list in korea . child - turcotte - pugh ( ctp ) score - based system has been used for deceased donor allocation in lt in korea from 2002 . even though the donation rate after brain death was still relatively low , the absolute number and the proportion of deceased donor liver transplantation ( ddlt ) have been increasing recently . ultimate goal of allocation system is balancing between justice and utility , which means to optimize the use of scarce donor organ resource and to reduce waiting list mortality and furthermore , to maximize long - term outcome . for this purpose , the model for end - stage liver disease ( meld ) score system was adopted for deceased donor allocation in february 2002 in the united states , because it is objective , readily available data and highly predictive of short term mortality , on the other hand , ctp score - based system is partly subjective and empirical ( 1 ) . meld score was introduced for the prediction of short term mortality of patients with cirrhotic liver after transjugular intrahepatic portosystemic shunt , using serum creatinine , bilirubin , prothrombin time international normalized ratio ( inr ) and etiology of liver disease ( 2 ) . meld allocation system has resulted in positive effects , i.e. , 12% reduction in waiting list registration especially patients with meld score less than 10 because of the very little chance of receiving deceased donor liver ( 3 ) and 3.5% reduction in drop out number , which caused the increase in transplantation rates on the contrary . meld score based system have settled down to some extent in the united states and many other countries but still , is on the way of refinement , i.e. , meld - na , meld refit , additional point for patients with hepatocellular carcinoma ( hcc ) and so on ( 4 - 7 ) . however , it is not desirable to adopt the allocation system of the western countries without verification because the medical environment of korea may be quite different from that of the western countries . however , there are very few data and reports about the feasibility of meld score - based allocation system in korea ( 8 - 10 ) . the aim of this study was to investigate the feasibility of the meld score - based system compared with the current ctp score - based system and to suggest adequate cut - off to stratify waiting list mortality among korean population . nine hundred and one patients have registered for ddlt from january 2008 to may 2011 in seoul national university hospital . seven hundred and eighty eight adult patients were included for analysis after excluding 113 patients who were status 1 or younger than 18 yr old , or patients whose laboratory data were not available for calculation of meld score . we collected the patients ' data of age , sex , the korean network for organ sharing ( konos ) status , and laboratory data retrospectively . values of serum total bilirubin ( mg / dl ) , prothrombin time inr , serum creatinine ( mg / dl ) less than 1.0 were changed to 1.0 to avoid negative value because they should be calculated in logarithmic function . creatinine values higher than 4.0 were changed to 4.0 according to the previously proposed protocol ( 5 ) . meld scores were calculated according to the following formula : meld score=9.57 * loge ( creatinine , mg / dl)+3.78 * loge ( total bilirubin , mg / dl)+11.2 * loge ( inr)+6.43 median meld score was 17 ( range , 6 - 57 ) . patients were classified into three groups according to the meld score , i.e. , low meld score group ( meld score<24 ) , high meld score group ( 24meld score<31 ) and highest meld score group ( mled score31 ) . patients were also classified as three groups according to konos status , i.e. , 2a group , 2b group , and 3 & 7 group . konos classification is similar with previous unos classification ( table 1 ) ( 1 ) . patients were observed for 6 month after registration . during follow up period , patients who underwent lt ( ddlt or ldlt ) or patients who were loss of follow up were considered as censored . ( medcalc software , mariakerke , belgium ) . to identify adequate cut - off value , we performed c - statistics and the area under the curve ( auc ) value was calculated . the short term ( 1 , 3 , and 6 months ) survival was evaluated via kaplan - meier method according to current allocation system and meld score . this study was approved by the institutional review board of seoul national university hospital ( h-1212 - 017 - 446 ) . this study was approved by the institutional review board of seoul national university hospital ( h-1212 - 017 - 446 ) . and 3 month survival dropped at 25 point . according to c - statistics , the adequate cut - off value for 1-month mortality was 31 ( sensitivity , 58.18 ; specificity , 89.50 ) and the area under the curve ( auc ) value was 0.794 ( 95% ci , 0.764 - 0.822 ; p<0.001 ) ( fig . 1b ) . the cut - off value for 3-month mortality was 24 ( sensitivity , 65.22 ; specificity , 80.46 ) and auc was 0.778 ( 95% ci , 0.747 - 0.806 , p<0.001 ) ( fig . patients with higher meld score ( meld31 ) has the lowest 1-month survival rate ( 65.2% , p<0.001 ) but the other two groups showed no difference ( p=0.860 ) ( fig 1d ) . however , 3-month survival rates were significantly different between three groups . one hundred sixty four patients were listed as status 2a , 400 patients as status 2b and 224 patients as status 3 or 7 ( table 1 ) . among 164 patients in status 2a , however , 28.8% of patients in status 2b ( 115/400 ) was high meld group ( 24 ) . 2a shows 1 , 3 , and 6 month survival according to the current konos status . however , among status 2a patients , 82 patients with meld < 24 showed better survival ( 93.0% of 3-months survival ) than current status 2b group ( 82.3% ) ( fig . however , patients with highest meld score ( 31 ) among status 2b group showed poorer survivals ( 48.2% of 3-months survival ) than current status 2a group ( 70.2% ) ( fig . 2c ) . 3 shows the clinical course of the patients for 6 months after registration under the current allocation system . only 8.6% of patients ( 68/788 ) in the waiting list received ddlt within 1 month . the rate of ddlt was not much increased until 6 months after that 19% of the patients ( 150/788 ) received ldlt within 1 month . 337 ( 42.8% ) patients underwent lt during 6 months follow - up . among them , only 91 patients ( 91/337 , 27.0% ) underwent ddlt , and 246 patients ( 246/337 , 73.0% ) underwent ldlt . however , 353 patients ( 44.8% ) were still in waiting list and 121 patients ( 15.4% ) were dropped out due to death and 8 patients ( 1.0% ) were loss of follow up during 6 months after initial registration . among status 2a patients , 48.2% ( 79/164 ) received ddlt . however , only 18.5% ( 23/124 ) of highest meld and 27.6% ( 24/87 ) of high meld group received ddlt ( table 2 ) . and 3 month survival dropped at 25 point . according to c - statistics , the adequate cut - off value for 1-month mortality was 31 ( sensitivity , 58.18 ; specificity , 89.50 ) and the area under the curve ( auc ) value was 0.794 ( 95% ci , 0.764 - 0.822 ; p<0.001 ) ( fig . 1b ) . the cut - off value for 3-month mortality was 24 ( sensitivity , 65.22 ; specificity , 80.46 ) and auc was 0.778 ( 95% ci , 0.747 - 0.806 , p<0.001 ) ( fig . patients with higher meld score ( meld31 ) has the lowest 1-month survival rate ( 65.2% , p<0.001 ) but the other two groups showed no difference ( p=0.860 ) ( fig 1d ) . one hundred sixty four patients were listed as status 2a , 400 patients as status 2b and 224 patients as status 3 or 7 ( table 1 ) . among 164 patients in status 2a , however , 28.8% of patients in status 2b ( 115/400 ) was high meld group ( 24 ) . 2a shows 1 , 3 , and 6 month survival according to the current konos status . however , among status 2a patients , 82 patients with meld < 24 showed better survival ( 93.0% of 3-months survival ) than current status 2b group ( 82.3% ) ( fig . however , patients with highest meld score ( 31 ) among status 2b group showed poorer survivals ( 48.2% of 3-months survival ) than current status 2a group ( 70.2% ) ( fig . 2c ) . 3 shows the clinical course of the patients for 6 months after registration under the current allocation system . only 8.6% of patients ( 68/788 ) in the waiting list received ddlt within 1 month . the rate of ddlt was not much increased until 6 months after that 19% of the patients ( 150/788 ) received ldlt within 1 month . 337 ( 42.8% ) patients underwent lt during 6 months follow - up . among them , only 91 patients ( 91/337 , 27.0% ) underwent ddlt , and 246 patients ( 246/337 , 73.0% ) underwent ldlt . however , 353 patients ( 44.8% ) were still in waiting list and 121 patients ( 15.4% ) were dropped out due to death and 8 patients ( 1.0% ) were loss of follow up during 6 months after initial registration . among status however , only 18.5% ( 23/124 ) of highest meld and 27.6% ( 24/87 ) of high meld group received ddlt ( table 2 ) . deceased donor allocation system has not been a major concern in korea , because ldlt has been prevalent . current korean liver allocation system adopted the previous unos system , which utilizes ctp score - based system . however , it comprises a couple of subjective factors such as ascites and encephalopathy , therefore , it can be easily manipulated for the purpose of allocation . furthermore , in status 2b category , non - medical factors such as waiting time and center incentive determined the order of allocation in current korean allocation system . as the ddlt is increasing in korea , there is an argument that the current allocation system needs to be changed into more objective system such as meld score - based system . hepatitis b virus ( hbv ) related liver disease is more prevalent and ldlt is more prevalent . therefore , it is necessary to evaluate the feasibility of meld system in korea compared with the current allocation system by analyzing korean database . there have been some studies about the feasibility of meld score in korea . however , most of them were about the prognosis after resection or prognosis of the patients with cirrhosis . ( 11 ) showed that meld score was better predictive factor of early mortality after resection for patients with hcc and cirrhotic liver than ctp score irrespective of etiology of cirrhosis . kim et al . ( 12 ) also showed the meld - na and meld score was superior to ctp score for prediction of early mortality for patients with cirrhosis . ( 8) suggested the meld system as a solution for allocation dilemma ( status 1 vs status 2a ) in cases of hbv related fulminant hepatitis . however , there have been no korean studies about the usefulness of meld score system for prediction of early mortality after registration for ddlt . the definition of konos status 2a is the life expectancy of 1 week or so without lt . so far , those patients of status 2a have had priority of deceased donor liver over the patients of other status according to this definition . this study , however , did not show the early mortality corresponding to the definition . only 12.7% of patients among status 2a patients were dead at 1 month after registration and they also showed low mortality rate 29.8% , 33.8% at 3 and 6 months respectively . because of relatively higher incidence of ldlt in korea , the mortality could be lower than the united states . however , compared with relatively higher mortality rate in highest meld score ( 34.8% of one month mortality in meld31 ) , the one month mortality rate of current status 2a ( 12.7% ) is too low in contrast to the definition . the risk of mortality in status 2b group was also relatively low compared with that of intermediate meld score group ( fig . therefore , current allocation system does not reflect the risk of early mortality after registration correctly . furthermore , short term mortality can be stratified by meld score among status 2a group ( fig . one month mortality was 35.1% in patients with meld score more than 31 among status 2b , which is higher than that of general status 2a patients ( 12.7% ) ( fig . 2c ) . thus , we might have overestimated some patients with low actual risk of mortality and we also have overlooked some patients with high actual risk of mortality in the current allocation system . therefore , we can conclude that meld system is better than the current allocation system to stratify the survival during waiting in korea . in the current system , if there is no status 1 patient in the waiting list , deceased liver allocates to the status 2a recipients in the same region first , and then if no candidate in the same region , it extends to whole nation before seeking status 2b patient in the same region . in this study , we tried to find the optimal cut - off to apply this nation - wide extension policy in status 2a if meld system is applied . in the united states furthermore , the proportion of patients ( meld24 ) group was 26.7% , which was similar with that of the current status 2a therefore , 31 and/or 24 point seemed appropriate cut - offs to differentiate allocation policy in korea . optimal allocation means ' more livers to sicker patients ' , however , short - term post - operative mortality might be increased after this strategy . the actual short term outcome has been reported not to be changed compared with the previous outcome according to unos / optn analysis . there have been several efforts of validation after adoption of meld based system in the united states ( 15 , 16 ) . and further studies are ongoing for refinement of meld score - based system ( 4 - 6 , 17 ) . ( 4 ) reported that meld - na and integrated meld were the best prognostic models after comparing 6 score systems . another issue is the exceptional situations such as hcc and hepatopulmaonary syndrome and so on in which meld based allocation is not applicable ( 18 - 20 ) . one of the limitations of this study is that we assumed that all mortality was related with hepatic failure . the non - liver failure related mortality such as hcc progression was not considered in this study . however , the tumor biology of the patients in waiting list was usually good because no additional point for hcc in the current listing rule and therefore , the reason for ddlt listing was mainly liver dysfunction in korea . in conclusion , meld score - based system is better than ctp score - based system in that it uses objective data and it can predict short - term mortality better . therefore , we expect that more number of high risk patients can receive ddlt and thus , dropout rate will be decreased by adopting meld score - based system in korea . the current ctp score - based system should be changed into the meld score - based system in korea . | to adopt the model for end - stage liver disease ( meld ) score - based system in korea , the feasibility should be evaluated by analysis of korean database .
the aim of this study was to investigate the feasibility of the meld score - based system compared with the current child - turcotte - pugh ( ctp ) based - system and to suggest adequate cut - off to stratify waiting list mortality among korean population .
we included 788 adult patients listed in waiting list in seoul national university hospital from january 2008 to may 2011 .
the short - term survival until 6 months after registration was evaluated .
two hundred forty six ( 31.2% ) patients underwent live donor liver transplantation and 353 ( 44.8% ) patients were still waiting and 121 ( 15.4% ) patients were dropped out due to death .
significant difference was observed when meld score 24 and 31 were used as cut - off .
three - months survival of status 2a was 70.2% .
however , in status 2a patients whose meld score less than 24 ( n=82 ) , 86.6% of patients survived until 6 month .
furthermore , patients with high meld score ( 31 ) among status 2b group showed poorer survival rate ( 45.8% , 3-month ) than status 2a group . in conclusion ,
meld score - based system can predict short term mortality better and select more number of high risk patients in korean population . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
despite the marked advances in the perioperative management of the liver transplant recipient , an assessment of clinically significant graft injury following preservation and reperfusion remains difficult . the lack of a sensitive clinical marker of acute liver injury has a profound impact on clinical practice and the success of translational research in liver transplantation . such a clinical marker could aid the management of graft dysfunction in early identification of recipients who will require retransplantation . currently , posttransplant peak aspartate aminotransferase ( ast ) is a widely accepted clinical marker for graft damage in liver transplant practice [ 26 ] . in fact , the united network for organ sharing ( unos ) suggests relisting criteria for the recipients with primary graft dysfunction ( pnf ) on the basis of the post - transplant peak ast . ast is an enzyme that is involved in amino acid metabolism , primarily existing in hepatocytes . during transplantation graft hepatocytes are inevitably injured , and intracellular enzymes are subsequently released into the systemic circulation of the recipient . we theorized that the recipient ast serum concentration is a function of the total amount of ast released by the graft liver diluted by the total circulating blood volume at the time of blood sampling . therefore , the ast value could be misleading or inaccurate , depending on the size of the graft ( total mass of injured hepatocytes ) and the volume of blood in the recipient 's circulation . we have previously reported on the use of the ratio of donor to recipient body surface area ( bsai ) to predict donor - recipient graft size mismatch [ 8 , 9 ] . we showed that size mismatch has a bidirectional impact on graft survival with a progressive increase in the risk of graft failure towards both ends of the size - mismatch spectrum , small - for - size to large - for - size 5 by generalized additive model . bsai has an important value in deceased liver transplant to quickly and reliably predict size - mismatch - related comorbidities and graft outcome . in this study , we hypothesized that serum ast when adjusted by the ratio of the donor - to - recipient body surface area ( asti ) could more accurately approximate the true mass of injured hepatocytes than the uncorrected or absolute peak ast , subsequently providing a more precise assessment of graft fate . in order to test this hypothesis , we conducted a study to investigate the sensitivity and specificity of asti versus absolute peak ast to predict pnf and graft survival in a large cohort of postliver transplant patients . after institutional review board approval , primary retrospective data collection was from patient records who underwent whole orthotopic liver transplantation ( lt ) from january 2002 to march 2008 at our institution ( jackson memorial hospital , university of miami , leonard miller school of medicine , miami , fl , usa ) . we were interested in the effect of size - matched peak ast ( asti ) on postoperative outcomes . therefore , among all transplant recipients , we excluded those who underwent split or partial lt as well as those who underwent simultaneous other organ transplantation , such as liver - kidney , liver - heart , liver - intestine , or multivisceral transplantation or live donor lt . body surface area index ( bsai ) to investigate donor - recipient size mismatch on postoperative primary graft dysfunction [ 8 , 9 ] . the bsai was calculated by the following equation :
( 1)bsa = weight ( kg)0.425height ( cm)0.7250.007184bsai = donor bsarecipient bsa . size - adjusted peak ast ( asti ) was calculated by dividing peak ast by bsai . peak ast was defined as maximum ast within 7days after lt .
statistical analysis . primary nonfunction ( pnf ) of liver graft is the most detrimental condition after transplantation . unos suggests the listing criteria for recipients with pnf as an ast 3,000 and a pt - inr 2.5 or acidosis ph 7.30 ( arterial ) , ph 7.25 ( venous ) , and/or lactate 4 mmol / l or anhepatic candidate within 7 days after implantation of a graft . of these criteria , the combination of ast and pt - inr was used for comparative purposes in this study . scatter plotting was used to show the statistical association between ast and asti with subsequent development of pnf . the area under the receiver - operating - characteristic curve ( auc ) was used to evaluate diagnostic accuracy of asti relative to that of conventional ast . the predictive value of current unos criteria for pnf ( by combination of ast and pt - inr ) was assessed by sensitivity and specificity in our study cohort . the logistic regression model was used to describe the association between seven study groups differentiated by ranges of asti and the incidence of pnf . all recipient and donor variables were included in the multivariable model . to assess the independence of asti effect on pnf , a backward conditional elimination procedure was then undertaken using the donor and recipient demographic factors . cox proportional - hazards models were used to examine the association between seven study groups differentiated by ranges of asti and graft survival ; data were censored at the time of the last visit or patient death . one - year graft survival was used to assess the short- and mid - term effect of asti . covariates were analyzed by using a backward conditional method with the donor and recipient demographic factors . kaplan - meier survival analysis with generalized wilcoxon analysis was used to assess the difference in graft survival between asti 3,500 and asti < 3,500 . , college station , tx ) were used for statistical analysis and all reported p values are two - sided , and p values of less than 0.05 were considered to indicate statistical significance . a total of 930 whole lt procedures performed from january 2002 to march 2008 were reviewed in this study . 717 out of 930 consecutive whole olt performed from january 2002 to march 2008 were included in this study . a total of 213 patients were ultimately excluded from the analysis for the following reasons : live donor lt ( 1 case ) , split lt ( 24 cases ) , auxiliary partial lt ( apolt , 6 cases ) , fulminant hepatic failure ( 14 cases ) , and simultaneous other organ transplants ( 55 cases ) as well as missing data ( 113 cases ) . the base - line characteristics of the recipients and donors of lt are summarized in table 1 . figure 1 shows a scatter plot of the relationship between peak ast and size - adjusted ast ( asti ) for cases with or without subsequent development of pnf . diagonal blue dot line shows 1 : 1 correlation between ast and asti . cases above this reference line had a large - for - size graft and below the line a small - for - size graft . iu / l , which is the current criterion for relisting as pnf suggested by unos . prediction of pnf by ast and asti . a receiver - operating - characteristic ( roc ) curve for ast and adjusted ast ( asti ) at risk for pnf roc curves show the relationship between true positive and false positive rates for a test across various threshold values used to diagnose a condition . the area under the curve ( c statistic ) for the roc shown in asti is 0.930 . unos criteria of pnf had a sensitivity of 75% and specificity of 97.7% in our study cohort . the combination of asti 3,500 iu / l and pt - inr 2.3 had the best predictive value , with a sensitivity of 87.5% and a specificity of 98.0% , which was better than that obtained with unos criteria . improvement of prediction for pnf was further assessed by a case - by - case comparison of results between conventional unos criteria and asti criteria ( table 2 ) . seven cases were identified as the cases which had different results between conventional unos criteria and new asti criteria . five cases had better results with new asti criteria and two cases had better results with conventional unos criteria . of three cases with the diagnosis of small - for - size donor , one case had a better result with asti due to improvement by size adjustment . of four cases with the diagnosis of large - for - size donors , three cases had better result with asti for the same reason . predictive values of different asti cutoffs for the primary nonfunction of the graft were analyzed with a logistic regression model ( figure 3(a ) ) . a logistic regression model showed that asti has significant impact on pnf ( hazard ratio 1.0003 ( 95% ci : 1.00031.0007 ) , p = 0.00001 ) . if asti was greater than 2,000 iu / l , there was an exponential increase of hazard risk ratio for pnf along with increased asti . predictive value of asti for one - year graft survival in the cox proportional hazard model . predictive value of different asti cutoffs for one - year graft survival was analyzed with cox proportional hazard model ( figure 3(b ) ) . a cox proportional hazard model showed that asti has significant impact on graft survival ( hazard ratio 1.0002 ( 95% ci : 1.00011.0003 , p = 0.00012 ) . if asti is greater than 3,500 iu / l , there is an exponential increase of hazard risk ratio for pnf along with increased asti . comparison of one - year graft survival in patients with asti 3,500 iu / l and asti < 3,500 iu / l . because asti had significant impact on one - year graft survival , we divided our study cohort into two groups : asti 3,500 then graft survival was compared by kaplan - meier survival analysis with generalized wilcoxon analysis . kaplan - meier survival analysis showed the probability of the primary graft outcome among patients who had a peak - adjusted ast ( asti ) of greater than 3,500 iu / l along with those who had an asti of less than 3,500 iu / l ( figure 4 ) . the graft survival at 1 year was 73.8% in the asti > 3,500 iu / l group and 83.7% in the asti < 3,500 iu / l group . there was a significant reduction in graft survival in asti > 3,500 iu / l group ( p = 0.004 ) . despite the significant advances in the management of the liver transplant ( lt ) recipient , the quantitative assessment of graft damage remains uncertain . acute injury and inflammation of transplanted organs during the immediate postoperative period may be linked to early organ dysfunction resulting in higher graft failure rates and rejection in the recipient . therefore , development of appropriate clinical markers to identify organ injury in the early postoperative period will have a profound impact on patient outcomes as well as on the success of clinical and translational research [ 11 , 12 ] . such clinical markers of liver damage can be of assistance in identifying the mechanisms of liver inflammation and injury and predisposing factors of donor organ injury , making it possible to implement injury - specific treatment strategies to promote organ resuscitation . in response to the transplant community 's urgent need for a useful clinical marker of injury , ongoing nih clinical trials in organ transplantation have attempted to investigate posttransplant genomic expression patterns , which may correlate with a high probability of graft dysfunction or failure . currently , in lt practice posttransplant peak ast is the most widely accepted clinical markers of graft damage . ast is an enzyme that is involved in amino acid metabolism , primarily existing in liver as well as heart , skeletal muscles , kidney , and brain . when hepatic parenchymal cells are injured , ast is released into the systemic circulation , causing an elevation of serum ast . however , the serum ast level depends on the mass of the donor liver graft ( the degree and extent of injured and dying hepatocytes ) and on the recipient circulatory blood volume . the working hypothesis that guided this study is that the peak ast corrected by the ratio of donor - to - recipient body surface area could be determined to be more accurately associated with the degree of graft injury , thus better predicting graft outcome in lt . indeed , the results of this study prove that the size - adjusted peak ast ( asti ) has higher sensitivity and specificity to predict pnf compared to size - unadjusted ast . iu / l and either ( a ) inr 2.5 or arterial ph 7.30 or venous ph 7.25 and/or lactate 4mmol / l , ( b ) anhepatic patient within 7 days after transplantation . in our study cohort , when we applied unos criteria , we found a relatively low sensitivity of 75.0% and specificity of 97.7% . this relatively high false positive result with conventional unos criteria may be due to the fact that some cases of pnf occurred in small - for - size donors as shown in figure 1 , where ast is more likely to underestimate the severity of graft damage based on the reasoning previously described . also , we found that the severity of graft damage in large - for - size donors can be overestimated by size - unadjusted ast . in fact , one case was underestimated and three cases were overestimated by conventional criteria and this error was corrected by asti criteria as shown in table 2 . when we used size - adjusted ast ( asti ) , the combination of size - adjusted asti and pt - inr predicted pnf more accurately , and the sensitivity increased to 87.5% with a specificity of 98.0% at cutoff of asti 3,500 iu / l and pt - inr 2.3 . in addition , asti correlated well with the incidence of pnf and short - term graft survival . increases in asti were significantly associated with increasing incidence of pnf . also asti was highly correlated with the incidence of 1-year graft failure , if asti exceeded 3,500 iu / l . a more sensitive prediction of pnf with asti will enable clinicians to more accurately identify the recipient who requires retransplantation , perhaps , at an earlier stage in the postoperative period , resulting in better patient outcome . one - year graft survival ( shown in figure 4 ) showed that asti > 3,500 iu / l group was associated with a steep decrease in graft survival in the early postoperative period compared to asti < 3,500 iu / l group . these findings suggest that in lt markers of postoperative graft injury should be interpreted with caution by taking into account graft size mismatches . bsai appears to be a powerful tool to detect donor - recipient size mismatch in cadaveric lt but awaits further validation . small - for - size or large - for - size grafts not only have been attributed to decreased graft survival , increased additional graft usage ( retransplantation ) , and increased incidence of other complications but also have made an assessment of posttransplant graft injury difficult . this study has demonstrated that size mismatch may have an even greater negative impact on graft outcome in the presence of other donor risk factors , such as prolonged cold ischemia . furthermore , the lack of a suitable clinical measure to reliably predict size mismatch has probably hindered our ability to judge its clinical importance in cadaveric lt . bsai provides a simple , reproducible , and sensitive way of detecting size mismatch in cadaveric lt . second , fluid excess ( ascites and edema ) is universal in end - stage liver disease . fluid excess causes weight - to - height parameters such as percentage ideal body weight , bmi , and bsa to be underestimated , and the bsa of the recipient may not accurately reflect the liver volume in these situations . alternative ways to more accurately detect size disparity may be ( i ) measuring the donor graft weight at back table or ( ii ) using the recipient 's dry weight instead of recipient bsa . however , we believe that asti is a simple , reproducible , and sensitive predictor of graft outcome associated with size mismatch . the liver has the excellent regenerative capacity even in the face of significant loss of hepatocyte mass . this has been demonstrated after liver resection or traumatic hepatic injury [ 14 , 15 ] . once mass ( volume ) or functional compensation starts , bsai may no longer accurately reflect the size mismatch between donor and recipient . in experiments with rodents , regeneration of liver mass occurred by 3 days after hepatectomy and restoration is complete by 57 days . recent clinical observations showed that recipients of partial grafts have a rapid proliferation of liver mass , with a majority reaching a calculated standard liver volume by one month [ 17 , 18 ] . although several factors have been proposed to explain the delay in the regeneration process , such as small - for - size donor , severity of ischemic injury , immunosuppressive medications , presence of steatosis , and older age , for these reasons the use of bsai - adjusted liver enzymes as more sensitive and specific markers of liver injury should be limited to the immediate postoperative period . lastly , although asti seems to be a useful index to predict outcome in adult olt , it remains unclear whether asti is also useful in pediatric olt . since slv calculated with bsa can be applied to pediatric populations , asti should also be applied to pediatric patients and should provide useful information for preoperative estimation of liver grafts regardless of age . however , predicting outcome by bsai for pediatric population warrants further investigation . we conclude that the asti appears to be a sensitive predictor of postoperative liver graft injury in the early postoperative period . despite some shortcomings , we believe our analysis shows that the asti may provide significantly better prediction of size mismatch - related graft dysfunction in lt . finally , we believe that asti should be considered in the early identification of graft dysfunction or pnf and should be validated in a prospective study to see whether it accurately and consistently predicts pnf or graft function and reduces posttransplant mortality . | background . despite the marked advances in the perioperative management of the liver transplant recipient ,
an assessment of clinically significant graft injury following preservation and reperfusion remains difficult . in this study , we hypothesized that size - adjusted ast could better approximate real ast values and consequently provide a better reflection of the extent of graft damage , with better sensitivity and specificity than current criteria .
methods .
we reviewed data on 930 orthotopic liver transplant recipients .
size - adjusted ast ( asti ) was calculated by dividing peak ast by our previously reported index for donor - recipient size mismatch , the bsai .
the predictive value of asti of primary nonfunction ( pnf ) and graft survival was assessed by receiver operating characteristic curve , logistic regression , kaplan - meier survival , and cox proportional hazard model . results .
size - adjusted peak ast ( asti ) was significantly associated with subsequent occurrence of pnf and graft failure . in our study cohort ,
the prediction of pnf by the combination of asti and pt - inr had a higher sensitivity and specificity compared to current unos criteria .
conclusions .
we conclude that size - adjusted ast ( asti ) is a simple , reproducible , and sensitive marker of clinically significant graft damage . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
an ideal archwire should have an acceptable amount of stabilization , hardness , formability , resiliency , biocompatibility , and weldability . stainless steel and chromium - cobalt wires are the favorite wires for the last stages of treatment , where the stability of the arch form is required . the required forces for tooth movement , function through different systems such as coil springs , power arms , and attachments welded on wires and also different forms of loops either made from the wire or welded . welding attachments on the wire help to apply forces along the center of resistance of teeth . welding is a method for joining metals , which has different types such as laser welding and electric spot welding . nowadays , using laser as a method for welding in orthodontic practice the different composition of orthodontic wires can affect on the penetration depth of laser into metal wires , therefore having an effect on the joint strength of welded parts . electric spot welding is a process in which two or more surfaces are joined by the heat produced by current electric flow . rapid welding , easy laboratory process , low expense , and good hygiene are the advantages of this technique . nascimento et al . investigated the effect of electric spot welding on the tensile strength of wires . results showed that stainless steel wires welded to stainless steel ones have more tensile strength in comparison with other combinations . krishnan et al . investigated the strength of stainless steel wires after welding process and mentioned that nugget formations that were produced in welding point during welding process and micro structural modification that happened because of heat generated in welding area , can have effect on the mechanical characteristics of these wires . the load deflection rate of the wire is the most important factor in determining the biologic behavior of tooth movement . according to burstone 's study , the major factor in selecting a wire is its load deflection rate . regarding that there has been no study on the comparison of electric spot welding effect on the mechanical features of stainless steel and chromium - cobalt wires therefore in this study , we evaluated the effects of electric spot welding on the load deflection rate of stainless steel and chromium - cobalt wires . in this experimental - laboratory study , two different types of straight wires , stainless steel ( 3 m , uniteck , monrovia , ca , usa ) and chromium - cobalt ( blue remaloy , dentarum , pforzheim , germany ) with 0.016 inch 0.022 inch diameter were used . the control groups had two subgroups : a group of 18 stainless steel wires ( 30 mm ) and a group of 18 chromium - cobalt wires ( 30 mm ) . the case groups had three subgroups :
18 samples which 30 mm of chromium - cobalt wire was welded with two 8 mm pieces of chromium - cobalt wires ( r + r).18 samples which 30 mm of chromium - cobalt wire was welded with two 8 mm pieces of stainless steel wires(s + r).18 samples which 30 mm of stainless steel wire was welded with two 8 mm pieces of stainless steel wires(s + s ) .
18 samples which 30 mm of chromium - cobalt wire was welded with two 8 mm pieces of chromium - cobalt wires ( r + r ) . 18 samples which 30 mm of chromium - cobalt wire was welded with two 8 mm pieces of stainless steel wires(s + r ) . 18 samples which 30 mm of stainless steel wire was welded with two 8 mm pieces of stainless steel wires(s + s ) . electric spot welding was performed 2 times by the master 2000 machine ( dentarum , pforzheim , germany ) , which was set at 30w power , after joining its two electrodes . the designed model was made of two rectangular cubes which were placed 12 mm far from each other . two maxillary central incisor edgewise brackets ( 0.018 inch 0.025 inch ) were attached on the cubes so that the midpoint of the brackets had a 14 mm distance from each other . the third bracket was attached to the head of a cylinder and placed on the moveable vertical part of the testing machine . when the device was set at the unload stance , the third bracket was exactly in the middle of the two welded spots , and the three brackets were in one line . the universal testing machine ( walter+bi ag , lhningen , switzerland ) was used for the load deflection test . the load value was measured at 0.5 mm , 1 mm , and 1.5 mm deflections on the 0.022 inch dimension of the wire [ figures 1 and 2 ] . universal testing machine set up while wire deflected 1.5 mm from above view . at the end , data were analyzed by repeated measure analysis of variance ( anova ) , one - way anova , paired t - test , and tukey test using spss software version 13 ( spss , chicago , il , usa ) . the mean load values for 0.5 mm , 1 mm , and 1.5 mm deflections for each sample are represented in table 1 and chart 1 . according to the significant interaction between load changes and weld type and also to the wires , proved in the repeated measure anova , the one - way anova test revealed that in each group , the load values measured for the 0.5 mm , 1 mm , and 1.5 mm deflections were significantly different ( p < 0.001 in all groups ) . the difference between the load values measured in 0.5 mm , 1 mm , and 1.5 mm deflections was significant in all groups ( p < 0.001 ) . the tukey test showed that in 0.5 mm , 1 mm , and 1.5 mm deflections , the loads measured for the s + s group were significantly different from other groups . also , the difference between the load values of the s + r group and the s and r groups were significant ( s + r group had higher amounts ) but the difference between the s + r and r + r group was not significant ( except in 1.5 mm deflection in which the amounts in r + r were significantly higher ) , and also there was a significant difference between r and s groups and r + r group ( in all deflections the mean load in r + r group was higher in comparison with r and s groups ) . mean and sd and ci of the loads measured in study groups ( n = 18 ) . orthodontic wires which enforce biomechanical forces are the main point of interest in clinical practice . until 1920 , the sole orthodontic wire available was made of gold . stainless steel was introduced in 1929 . today , austenitic stainless steel is the primary alloy used in orthodontic wires . after stainless steel , other alloys with acceptable features such as chromium - cobalt were introduced to orthodontics . the rationale for using a wire for a specific treatment should be based on a wide range of mechanical features such as elastic modulus ( stiffness or load deflection rate ) . biomechanical considerations claim that wire stiffness is an important feature which is defined as the correlation between orthodontic force and deflection in the elastic range . our results showed that increasing in deflection ( in these type of wires ) significantly ( p < 0.001 ) increased the force applied by the wire , which was predictable . according to kusy and greenberg , although stainless steel and chromium - cobalt have different compositions , their modulus of elasticity is similar , and when the heat hardening and torsional strength of chromium - cobalt are not needed , they can be replaced with each other . our study also showed that differences in measured loads between nonwelded stainless steel and nonwelded chromium - cobalt wires in these three deflections were not significant ( p = 1 , 0.93 , 0.54 ) . this result is similar to the study of meling and odegaard , which reported that 0.016 0.022 inch chromium - cobalt wire has similar stiffness with the same - sized stainless steel wire . kusy reported that elgiloy ( chromium - cobalt , rocky mountain orthodontics , denver , colo , usa ) had a similar stiffness with stainless steel . welding can be performed using electric spot weld or laser weld . both stainless steel and chromium - cobalt our result showed that spot welding process increased the stiffness of the wire . in this study , welding was performed outside the test region to eliminate the effects of increased length on stiffness . one of the major factors in electric spot welding is the heat produced by electrodes in the joining area . some studies claim that the low resistance of copper electrodes causes the heat to remain only in the welding spot . other studies have reported that the increased temperature in the welding spot can cause significant alterations in the features of the wire adjacent to the welding point . we can say that the effects of the increased temperature caused by electric spot welding maybe similar to heat treatment effects because nowadays orthodontic spot welders are used for heat treatment . metallurgy references consider stiffness as a structure with insensitive feature , but researchers have shown that heat treatment can affect the stiffness of orthodontic wires . reduced inner stress during heat treatment in low temperature is considered as a recovery mechanism in stainless steel and elgiloy . various studies have evaluated heat treating different sizes of chromium - cobalt wires and reported that their stiffness increases for 10 - 20% . other studies , however , claim that more than 15% increase in modulus of elasticity is very rare . analyzing straight chromium - cobalt wires the amount of the increase in modulus of elasticity of stainless steel wires after heat treatment is usually 2 - 5% but 15% has also been reported . on the other hand , ingerslev reported that wire stiffness is not affected by heat treatment . watanabe et al . stated that laser welding has less heat effects on the adjacent regions , therefore , is the preferable method in clinic . comparing the s + s and r + r groups showed that welded stainless steel loading amounts ( in all three deflections ) were significantly higher than welded remaloy ( p < 0.001 ) . different combinations of co , fe , mb between the wires can probably be the cause of this difference . comparing the load deflection rate of the s + r group with the s + s group showed that the s + s group had significantly higher stiffness in all three deflections ( p < 0.001 ) . watanabe et al . also showed that heterogenous welded combination have lower load deflection rates compared to homogenous ones , maybe because of different heat transmission in weld point in heterogenous combination compared to the homogenous ones . in s + r group samples , the base wire was remaloy , so it might be predictable that their load deflection rates were mostly similar to the base wire and lower than s + s group . the results showed that although the loading amounts in s + r group were more than r + r in 0.5 mm and 1 mm deflection , their difference was not statistically significant ( p = 0.99 , 1 ) . within the limitations of this laboratory study , it is concluded that electric spot welding process done on stainless steel and chromium - cobalt wires can lead to an increase in their load deflection rates . this study was financially supported and approved by the isfahan university of medical science , iran . the authors of this manuscript declare that they have no conflicts of interest , real or perceived , financial or non - financial in this article . this study was financially supported and approved by the isfahan university of medical science , iran . the authors of this manuscript declare that they have no conflicts of interest , real or perceived , financial or non - financial in this article . | background : one of the methods used for joining metals together is welding , which can be carried out using different techniques such as electric spot welding .
this study evaluated the effect of electric spot welding on the load deflection rate of stainless steel and chromium - cobalt orthodontic wires.materials and methods : in this experimental - laboratory study , load deflection rate of 0.016 0.022 inch stainless steel and chromium cobalt wires were evaluated in five groups ( n = 18 ) : group one : stainless steel wires , group two : chromium - cobalt wires , group three : stainless steel wires welded to stainless steel wires , group four : stainless steel wires welded to chromium - cobalt wires , group five : chromium - cobalt wire welded to chromium - cobalt wires .
afterward , the forces induced by the samples in 0.5 mm , 1 mm , 1.5 mm deflection were measured using a universal testing machine . then mean force measured for each group was compared with other groups .
the data were analyzed using repeated measure analysis of variance ( anova ) , one - way anova , and paired t - test by the spss software .
the significance level was set as 0.05.results:the tukey test showed that there were significant differences between the load deflection rates of welded groups compared to control ones ( p < 0.001).conclusion : considering the limitation of this study , the electric spot welding process performed on stainless steel and chromium - cobalt wires increased their load deflection rates . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a major task for evolutionary biology has been to develop and test theories for the origin of novelty that are consistent with the fundamental genetic principles of gradual populational change . novelty , however , is a loaded term with many different definitions that include or exclude a variety of morphological characters ( brigandt and love 2012 ) . following pigliucci ( 2008 ) , we prefer a more inclusive definition of evolutionary novelty : new traits , or novel combinations of traits within a lineage that perform a new ecological function and may result in the establishment of new evolutionary lineages . more narrowly focused definitions might be desirable for some purposes ( muller and wagner 1991 ; wagner and lynch 2010 ) . however , our goal in this essay is to elaborate one mechanism for the sudden origin and evolutionary success of new variants that applies just as well to exceptional size and shape , new color patterns , use of new habitats , and new exons . some theorists have invoked special phenomena such as genome - wide macromutations ( goldschmidt 1940 ) or genetic revolutions ( mayr 1954 ) to get around perceived difficulties with the emergence of profound change as the accumulation of subtle changes by the conventional dynamics of mutation , gene flow , drift and selection . however , modern evolutionary theory and empirical research in genetics have consistently reaffirmed the ability of conventional population genetics to explain the origin of new species and phenotypes , and simultaneously exposed flaws in the alternatives ( charlesworth et al . for example , goldschmidt ( 1933 , 1940 ) proposed that a novel phenotype ( such as insect wings , a character associated with higher level taxonomy ) must first arise as an instantaneous product of a single macromutation or systemic mutation . individuals bearing such macromutations were characterized as hopeful monsters by goldschmidt ( 1933 , 1940 ) to emphasize that their appearance is neither purposeful nor gradual , and their prospects for success are a matter of luck . a hopeful monster is an individual phenotypically discontinuous from the range of phenotypes of its population , and whose hopes of establishing a new lineage lie in finding a novel niche for which its monstrosity happens to be preadapted . such a mechanism of speciation was criticized early for being so improbable as to overtax one s credulity ( dobzhansky 1937 , p. 53 ) because of the rarity of the initial mutation of large effect , and the resulting improbability of finding an equally monstrous mate ( dobzhansky 1937 ) . recent empirical and theoretical research on hybrid speciation might have revived the hopeful monster in a new , more credible form ( mallet 2007 ) . recombination of parental chromosomes in the f2 and later generations during hybridization can generate genotypes that express phenotypes outside the normal range of variation observed in either parental gene pool , a phenomenon termed transgressive segregation ; rosenthal et al . 2005 ; johnson et al . 2010 ; parsons et al . 2011 ) . often , transgressive hybrids have higher fitness in novel environments , increasing the likelihood of divergence from parental populations ( arnold and hodges 1995 ; buerkle et al . 2007 ; shahid et al . 2008 ; abbott et al . 2010 ; fitzpatrick et al . 2010 ) . a few examples of new phenotypes inferred to arise from hybridization include ( see arnold 1997 ; arnold 2006 ; stelkens and seehausen 2009 for more exhaustive reviews ) : extreme size of tiger x lion f1 hybrids ( gray 1954 ) ; unique shapes and colors of hybrid orchids ( rolfe and hurst 1909 ) ; ability of recombinant sunflowers to thrive in extreme habits ( lexer et al . 2003 , 2007 ) ; specialization on a novel host plant in lonicera flies ( schwarz et al . 2005 ) ; and expression of novel gene transcripts ( including new exons ) via alternative splicing in hybrid poplars ( scascitelli et al . not all specific examples are relevant in nature , and not all would qualify as evolutionary novelty under certain definitions ( muller and wagner 1991 ; pigliucci 2008 ; wagner and lynch 2010 ) , but this small selection of cases serves to illustrate sudden appearance of profound differences between parents and hybrid offspring reminiscent of goldschmidt s hopeful monsters.fig . 1recently metamorphosed juvenile tiger salamanders representative of ambystoma mavortium ( bts ) , a. californiense ( cts ) and transgressive later generation hybrid . the late generation hybrid has both a transgressive coloration and body size ( mass and snout - vent length ) beyond the range of parental populations recently metamorphosed juvenile tiger salamanders representative of ambystoma mavortium ( bts ) , a. californiense ( cts ) and transgressive later generation hybrid . the late generation hybrid has both a transgressive coloration and body size ( mass and snout - vent length ) beyond the range of parental populations arnold and colleagues have promoted the importance of transgressive segregation as the evolutionary novelty model of hybridization ( arnold 1997 ; arnold et al . mallet ( 2007 ) even referred to transgressive hybrids as hopeful monsters , and p. bateson ( 1984 , 2002 ) proposed a simple model for the sudden appearance and successful spread of a novel phenotype via hybridization as a mechanism of saltational evolution . we expand and make genetically explicit the haploid , diploid and polyploid cases of his model ( fig . 2 ) . 2003 ) and hybrid fitness ( dobzhansky 1937 ; muller 1942 ; turelli and orr 2000 ) . all are special cases of a general multilocus model ( fitzpatrick 2008 ) which can give rise to the evolution of novelty or discontinuity as the cumulative or combined outcome of conventional population genetic change . indeed , recombination has always been recognized as an important source of variation ( mendel 1866 ) ; whether such variation is perceived as profound or 2genetically explicit versions of bateson s model . a the haploid case , b the diploid case , c allopolyploidy . genotypes with asterisks are novel recombinant , true - breeding genotypes genetically explicit versions of bateson s model . a the haploid case , b the diploid case , c allopolyploidy . bateson s ( 1984 , 2002 ) proposal for how recombination can generate sudden change is a straightforward narrative . two different mutations ( a and b ) appear and become fixed in different populations with similar phenotypes ( circles in his diagram ) . when the populations merge , recombinant individuals with both a and b express a new phenotype ( diamonds in his diagram ) , which is more successful and becomes fixed . aside from mutation , bateson did not use genetically explicit vocabulary , but his diagram suggests a haploid genome , with mutations a and b occurring in different loci such that recombination can place them together in the same individual . we show a version of bateson s model with explicit haploid , diploid , and allopolyploid cases in fig . 2 . the key feature is that the new phenotype depends on the interaction between alleles a and b at different loci . if both a and b alleles are common in the admixed population , the new phenotype will be expressed by a large number of individuals who can interbreed with each other , rather than a single mutant monster with no prospect for a mate . moreover , even if interactions at other loci render some hybrids ( even f1 hybrids ) partly or mostly sterile , recombination could produce transgressive hybrids with restored fertility in the f2 and later generations ( fig . . 3a schematic representation of the process by which two fixed allelic differences ( a and b ) at unlinked loci might recombine during meiosis in two f1 hybrids to create a novel homozygous genotype ( aabb ) in the f2 hybrid . note that the two novel recombinant chromosomes in the f2 are the result of independent recombinational events a schematic representation of the process by which two fixed allelic differences ( a and b ) at unlinked loci might recombine during meiosis in two f1 hybrids to create a novel homozygous genotype ( aabb ) in the f2 hybrid . note that the two novel recombinant chromosomes in the f2 are the result of independent recombinational events bateson ( 2002 ) went on to note that his idea had points of similarity with the dobzhansky - muller model of hybrid dysfunction ( dobzhansky 1937 ; muller 1942 ; turelli and orr 2000 ) and the earlier verbal model of w. bateson ( 1909 ) . in fact , the explicit diploid version of bateson s model differs from the dobzhansky - muller model only in the sign of the interaction : the bateson model supposes the interaction between a and b increases fitness , while the dobzhansky - muller model specifies a decrease in fitness of recombinant hybrids ( table 1a , b ) . both models describe gene interaction ( epistasis ) causing a hybrid phenotype to fall outside the range for either parental population . that is , they are special cases of transgressive segregation.table 1diploid , two - locus models for hybrid phenotypesaaaaaa(a ) epistatic hybrid dysfunction bb111 bb11 h01 h1 bb11 h11 h2(b ) epistatic hybrid vigor bb111 bb11 + s01 + s1 bb11 + s11 + s2(c ) additive complementation bb1 2x1 x1 bb1 x11 + x bb11 + x1 + 2xin each case , parental genotypes are aabb aabb . epistatic hybrid dysfunction ( a : the dobzhansky - muller model ) and epistatic hybrid vigor ( b : the bateson model ) differ only in whether effects are assumed to be deleterious or beneficial . the additive complementation model ( c ) shows how recombinants can be phenotypically extreme relative to parentals ( aabb and aabb ) even without gene interaction ( each a or b allele contributes an amount x to the phenotypic value , regardless of the other locus ) . all can be written as special cases of a general quantitative genetic model ( hill 1984 ; lynch and walsh 1997 ; fitzpatrick 2008 ) diploid , two - locus models for hybrid phenotypes in each case , parental genotypes are aabb aabb . epistatic hybrid dysfunction ( a : the dobzhansky - muller model ) and epistatic hybrid vigor ( b : the bateson model ) differ only in whether effects are assumed to be deleterious or beneficial . the additive complementation model ( c ) shows how recombinants can be phenotypically extreme relative to parentals ( aabb and aabb ) even without gene interaction ( each a or b allele contributes an amount x to the phenotypic value , regardless of the other locus ) . all can be written as special cases of a general quantitative genetic model ( hill 1984 ; lynch and walsh 1997 ; fitzpatrick 2008 ) transgressive segregation can also be caused by strictly additive effects of multiple genes ( table 1c ; nilsson - ehle 1911 ; grant 1975 ) . ( 2003 ) because in qtl studies of transgressive hybridization in plants , additive effects are detected more often than epistatic or dominance interactions ( rieseberg et al . strictly additive and strictly epistatic models are special cases of the general quantitative genetic model allowing phenotypes to be affected by additive , dominance , and epistatic effects ( hill 1984 ; lynch and walsh 1997 ; fitzpatrick 2008 ) . extending these basic ideas to many loci and multivariate phenotypes leads to the very general conclusion that recombination between disparate genomes has great potential to produce novel phenotypes ( gavrilets 1999 ) . the primary prediction characterizing many years of speciation research is that hybridization between disparate genomes will often generate novel phenotypes that are inviable or sterile ( hopeless monsters ) , and this becomes ever more likely with increasing differentiation ( dobzhansky 1937 ; mayr 1942 ; muller 1942 ; orr and turelli 2001 ; coyne and orr 2004 ; gavrilets 2004 ) . at the same time , the number of potentially beneficial interactions might increase ( stelkens and seehausen 2009 ; stelkens et al . 2009 ) , leading to a race between the potential for hybrid speciation and the evolution of complete reproductive isolation . here , as in the case of mutations of large effect , there is probably an inverse relationship between the magnitude of a transgressive beneficial phenotype and the likelihood that it will actually be generated in nature . the most important prediction arising from hybridization as a source of novelty is that admixed populations with many recombinant individuals repeatedly bring together many genetic differences in many unique combinations . first , instead of a single genetic difference , the diversity of recombinant genotypes after the f1 generation provides a wide field for selection of beneficial versus deleterious interactions ( lexer et al . 2003 ; parsons et al . 2011 ) . as pointed out by arnold and hodges ( 1995 ) , this means that even if most hybrid interactions are deleterious , there is still a good chance for the rare beneficial recombinant to appear , unless f1 hybrids are completely sterile or inviable . second , segregating hybrid populations will repeatedly produce recombinant genotypes with transgressive phenotypes ( figs . 2 , 3 ) , instead of only producing a single unique mutant or rare variant likely to be lost , even if advantageous ( gillespie 2004 ) . this means hopeful monsters produced by transgressive segregation have a good chance of finding suitably monstrous mates in a hybrid population and can establish a true - breeding population derived from many independent interspecific matings ( bateson 2002 ) . although speciation by transgressive hybridization is expected to be rapid in diploids ( ungerer et al . 1998 ) , we predict fixation of novel transgressive hybrids to be more rapid and perhaps more common in haploid and allopolyploid hybrids . all of the recombinant hybrids in haploid and allopolyploid populations will be true - breeding , compared to just a fraction of diploid recombinant hybrids ( fig . 2 ) . in the case of complete or incomplete dominance of a and b , all four diploid recombinant genotypes will exhibit a transgressive phenotype , but only the double homozygote will be true - breeding . this might lead to lower average fitness of a diploid hybrid population that contains some high - fitness transgressive phenotypes for several generations after hybridization is initiated ( johnson et al . finally , other more subtle predictions might arise from variation in genomic structure and development . for example , the dobzhansky - muller model helps explain empirical generalizations including haldane s rule and the large - x effect in hybrid dysfunction . by extension , the expression of beneficial transgressive phenotypes might differ between sex chromosomes and autosomes , with differential consequences for males and females in lineages with chromosomal sex determination . specifically , if transgressive phenotypes are often recessive ( s0 < s1 < s2 in table 1b ) and one or more of the interacting genes is on the sex chromosome , then the phenotype is more likely to be expressed in the heterogametic sex , even in the f1 generation . whether such rules might exist for transgressive phenotypes depends largely on whether dominance is a consistent effect in trait expression . the only broad generalization emerging from reviews of the empirical literature so far appears to be that the additive complementation model is often adequate to explain the data ( rieseberg et al . 1999 ; burke and arnold 2001 ) . however , epistasis and dominance are not infrequently detected , and the difference might reflect lower statistical power to detect non - additive effects . the idea that hybridization can rapidly produce novel forms is familiar among botanists , but rarely appeared in mainstream discussions of speciation until recently thanks to several case studies of homoploid hybrid speciation ( for reviews see : arnold 1997 ; rieseberg et al . recombination of fixed genetic differences between two populations in the f2 and later generations can produce hybrids with phenotypes novel to both parental populations ( fig . 3 ) . when these recombinant phenotypes have fitness beyond the range of parental phenotypes they are transgressive ( fig . 1 ) . bateson s model of hybridogenic hopeful monsters and the dobzhansky - muller incompatibility model of hybrid inviability are both cases of transgressive segregation . the dobzhansky - muller model produces a hopeless monster : hopeless because sterility and inviability make finding a mate and/or novel niche moot and monstrous because sterility and inviability are both phenotypes outside the parental range of phenotypes ( table 1a ) . the bateson model produces a hopeful monster : hopeful because it has a good chance of finding a mate given continued hybridization and greater fitness than parental phenotypes in some environments , and monstrous because of its transgressive phenotype ( table 1b ) . all three models are special cases of the general quantitative genetic model , thus reconciling sudden and gradual origins of novelty without requiring a special class of mutations or population dynamics . transgressive segregation might be an important mechanism promoting sudden phenotypic changes and ecological transitions in evolution . even if most of the variation produced is deleterious , a rare transgressive hybrid genotype could rapidly fix in a population or establish a novel lineage . it is even possible that regularities in the distribution of dominance effects could lead to general predictions ( such as the large x effect and haldane s rule ) for transgressive trait expression , but more research on the genetic architecture of transgressive traits is needed . regardless of those details , admixture can simultaneously bring together many new combinations of alleles , generating multilocus novelties that might never have appeared via gradual accumulation of new mutations in a single population . gene exchange is not the sole , nor even necessarily most likely , source of evolutionary novelty ( meyer 2002 ; moczek 2008 ) , but is perhaps the most likely mechanism of sudden , population level change . | the origin of novelty is a critical subject for evolutionary biologists .
early geneticists speculated about the sudden appearance of new species via special macromutations , epitomized by goldschmidt s infamous hopeful monster .
although these ideas were easily dismissed by the insights of the modern synthesis , a lingering fascination with the possibility of sudden , dramatic change has persisted .
recent work on hybridization and gene exchange suggests an underappreciated mechanism for the sudden appearance of evolutionary novelty that is entirely consistent with the principles of modern population genetics .
genetic recombination in hybrids can produce transgressive phenotypes , monstrous phenotypes beyond the range of parental populations .
transgressive phenotypes can be products of epistatic interactions or additive effects of multiple recombined loci .
we compare several epistatic and additive models of transgressive segregation in hybrids and find that they are special cases of a general , classic quantitative genetic model .
the dobzhansky - muller model predicts hopeless monsters , sterile and inviable transgressive phenotypes . the bateson model predicts hopeful monsters with fitness greater than either parental population .
the complementation model predicts both .
transgressive segregation after hybridization can rapidly produce novel phenotypes by recombining multiple loci simultaneously .
admixed populations will also produce many similar recombinant phenotypes at the same time , increasing the probability that recombinant
hopeful monsters will establish true - breeding evolutionary lineages .
recombination is not the only ( or even most common ) process generating evolutionary novelty , but might be the most credible mechanism for sudden appearance of new forms . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
akathisia is an involuntary movement disorder characterized by a subjective feeling of restlessness and fidgety movements . first - generation antipsychotic agents had drug - induced akathisia due to its high incidence and particularly aversive nature . despite the fact that second - generation antipsychotics have a lower potential to cause extrapyramidal side - effects , including akathisia , their incidence is not negligible . a variety of akathisia subtypes have been described : acute , withdrawal , tardive and chronic . tardive akathisia is characterized by longer - term akathisia manifestations , and is occasionally confused with chronic akathisia . it may persist or may become worse when the antipsychotic treatment is discontinued or reduced . it seems that tardive akathisia may have pharmacological differences from acute akathisia . unlike acute akathisia , neither chronic nor tardive akathisia has been reported with drugs not being neuroleptics , considering that these types of akathisias may be pure neuroleptic - related syndromes , and that this makes them potentially important syndromes to examine with regard to pathophysiology . there appears to be dopamine receptor blockade in the mesocortical dopamine system in acute akathisia , while it has been noted that the delayed akathisia may have resulted from a pharmacodynamic effect through serotonin - dopamine and alfa - receptor interaction . in the present study , we planned to evaluate the nature of delayed - onset akathisia in patients on amisulpride monotherapy . overall , 56 patients on amisulpride treatment for 2 months at a stabilized amisulpride dose for their schizophrenia , delusional or schizoaffective disorder were folowed - up . of them , 18 patients with diagnostic and statistical manual of mental disorders - iv ( dsm - iv ) presented with acute or delayed - onset akathisia , and all of them also met the entry criteria . the inclusion criteria were : taking stabilized amisulpride dose for at least 2 months , having normal physical and neurological examination and normal routine laboratory tests and electrocardiography within the normal range . the exclusion criteria included the presence of a severe physical illness , the history of alcohol and substance abuse or dependence , a previous history of neurologic disease and the presence of any endocrinological state . the patients were evaluated at baseline and at the time when akathisia presented clinically , with respect to the positive and negative syndrome scale ( panss ) and barnes akathisia scale ( bas ) . to confirm the akathisia , a score of 2 on the global scale ( range 05 ) of the bas was required . statistical analysis was performed using the statistical package for social sciences ( spss / pc 10.0 version ) . table 1 shows the demographic and clinical data of the 18 patients who developed akathisia . majority of the patients reported one or more adverse effects during the 2-month period apart from the akathisia , most of which were mild to moderate in intensity . the most frequently reported adverse effects were reduced energy ( n = 6 ) , tremor ( n = 5 ) and nausea ( n = 3 ) . overall , significant changes were noted in the panss and clinical global impression - severity ( cgi - s ) scores after the study period . the mean total panss scores were 69.4 8.1 and 52.1 7.2 at baseline and after 2 months , respectively ( p < 0.01 ) . the mean cgi - s scores were 3.64 1.2 and 2.5 0.9 at baseline and at 2 months , respectively ( p < 0.05 ) . using the primary categorical criterion of akathisia ( 2 points of the bas global scale ) , 12 ( 21.4% ) of the 56 patients experienced delayed - onset akathisia , and six ( 10.7% ) showed acute akathisia . the mean time of onset of acute or delayed - onset akathisia was 5.8 2.1 and 39.4 11.3 days , respectively . the mean bas scores at baseline and after the period of 2 months were 1.3 0.6 and 3.9 2.4 , respectively ( p < 0.01 ) . eight patients ( four with acute and four with tardive akathisia ) responded to dose reduction and four responded to benzodiazepines and propranolol treatment while six did not respond to any treatment . to the best of our knowledge , this is the first study to assess the time course of the occurrence of amisulpride - induced akathisia . the present study revealed that amisulpride could lead to , especially , delayed - onset akathisia rather than acute akathisia . because of its mechanism of action not having any affinity to 5-ht2 receptors , amisulpride , a benzamide derivative , has high and similar affinities for the dopamine d2 and d3 receptor subtypes and is devoid of any significant affinity to other receptor systems . therefore , its high d2 occupancy can account for the high rate of akathisia because of the fact that eight of the patients ( four with acute and four with tardive akathisia ) responded to dose reduction . however , a question arises : why amisulpride induces delayed - onset akathisia ? despite the fact that no known active metabolites in rodents were determined , natesan et al . reported slower brain penetration of the amisulpride , measured by its ability to displace [ h ] raclopride in the striatum when compared with haloperidol , risperidone and clozapine . moreover , natesan et al . found that despite amisulpride 's effect of quick onset ( 1 h ) and decline ( 6 h ) of prolactin elevation , it showed a delayed pattern of d2/3 receptor occupancy : 43 , 60 and 88% after 1 , 2 and 6 h ( 100 mg / kg ) , respectively , unlike the atypicals clozapine and risperidone , supporting its poor blood therefore , we suggest that its delayed penetration into the brain may be a contributing factor for its delayed - onset akathisia effect . on the other hand , the severity and time difference for developing extrapyramidal side - effects , including akathisia , also depend on some pharmacological differences between drugs , such as the rate of dissociation from the d2 receptor , the degree of dopamine-2 ( d2 ) and 5ht2a receptor antagonism and the antimuscarinic potential of the drug . therefore , when thinking on the mechanism of tardive akathisia , we should take into consideration not only the d2 receptor blocking effect but also the other receptor - binding profiles such as minimal muscarinic receptor or the 5-ht2 receptor affinity . second , the small sample may limit the interpretation and generalizability of our findings . thus , although our results revealed that amisulpride could considerably lead to delayed - onset akathisia , studies comprising larger samples receiving different antipsychotics , and more comprehensive assessment , will help in ascertaining the role of amisulpride in delayed - onset akathisia . | despite the fact that second - generation antipsychotics have a lower potential to cause extrapyramidal side - effects , including akathisia , their incidence is not negligible .
recent work suggests that tardive akathisia may have pharmacological differences from acute akathisia . in the present study , we have evaluated the nature of delayed - onset akathisia in patients on amislpride monotherapy .
overall , we screened 56 patients on amisulpride treatment for 2 months at a stabilized amisulpride dose . however , 18 patients with diagnostic and statistical manual of mental disorders - iv ( dsm - iv ) presented with acute or delayed - onset akathisia , and all of them also met the entry criteria .
the patients were evaluated at baseline and at the time when akathisia presented clinically , with respect to the positive and negative syndrome scale and barnes akathisia scale ( bas ) . using the primary categorical criterion of akathisia ( 2 points of the bas global scale ) , 12 ( 21.4% ) of the 56 patients experienced delayed - onset akathisia , and six ( 10.7% ) showed acute akathisia .
the mean time for onset of acute or delayed - onset akathisia was 5.8 2.1 and 39.4 11.3 days , respectively .
the mean bas scores at baseline and after the period of 2 months were 1.3 0.6 and 3.9 2.4 , respectively ( p < 0.001 ) .
our results revealed that amisulpride could considerably lead to delayed - onset akathisia .
however , studies comprising larger samples receiving different antipsychotics , and more comprehensive assessment , will help to ascertain the role of amisulpride in delayed - onset akathisia . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
various unusual morphologies of whiskers and nanowires have been reported in past few years [ 1 - 9 ] . since its discovery by wagner and ellis in , the vapor solid ( vls ) growth mechanism has been used to explain the formation of the majority of vapor grown whiskers and nanowires . the typical morphology of whiskers and nanowires is that each whisker or nanowire terminates with a catalyst particle on its end . solid ( vs ) mechanism , to explain the initialization of the one - dimensional growth of nanowire or whisker with a catalyst - free process as followings : if the supersaturation is below the value required for the formation of a crystal of some material with euhedral morphology , anisotropic one - dimensional growth occurs in specific crystal directions . moreover , a screw dislocation growth model ( sd ) is also proposed by sear to explain the formation of some whiskers under substrate stress . usually , there is a dark - line at the axial center within the whisker under tem analysis . recent years a new kind interesting structure , periodic bead - like structure , has been discovered . dai et al reported that ga2o3 chains with closely spaced knots connected by nanowires were acquired by thermal evaporation method . wang et al successfully synthesized zn2sno4 nanowire with periodic structure by the thermal evaporation method . chains of crystalline - silicon nanospheres were formed by a self - organized process via an extension of the vapor - liquid - solid mechanism using gold as catalyst by kohno et al . . in addition , xie s group successfully prepared in2o3/sno2 hetero - junction beaded nanowires via a simple thermal vapor deposition method . liu et al prepared periodically structured single - crystalline zinc branches by electrodeposition method . here , we report another interesting growth model for formation of a novel structure ( periodic instability of diameter ) of zno nanowires via catalyst free vapor deposition method . to our knowledge , it s the first time to report the structure of periodic instability in zno nanowire . the formation of this kind of structure can be explained by self - oscillatory mechanism . the preparation of the zno nanowires was performed in a conventional furnace with a horizontal alumina tube . in a typical process , the sapphire substrate was put onto an alumina boat loaded with a mixture of zn ( purity : 99.999% ) , carbon and zno powders . then , the chamber was heated up to 950 c at a rate of 20 c / min under a 200 sccm constant flow ar ( 2%o2 in ar ) and kept for 20 min . after cooling down , the as - prepared products were characterized by field emission scanning electron microcopy ( sem ) ( sem : sirion 200 feg ) , x - ray diffraction spectra ( xrd ) ( philips xpert - pro , cu k ( 0.15419 nm ) radiation ) and x - ray photoelectronic spectroscopy ( xps ) . 1 ) shows that all diffraction peaks can be indexed to those of the hexagonal wurtzite phase of zno and sapphire substrate . 2a ) demonstrates that a large number of nanowire were randomly deposited on sapphire substrate . the average length of zno nanowire is 5 m and the diameters of nanowire range from 100 nm to 200 nm . 3 ) analysis also shows that the nanowires consist of zn and o elements . high resolution sem image ( fig . the diameter of nanowire change periodically and the distance between knots is uniform . it could be seen that periodic structure only appears when the diameter of wire is small . for nanowires with large diameter , the periodic instability diminishes ( fig . 2c ) . xrd spectrum of zno nanowires on sapphire sem images of periodic bead - like zno nanowires on sapphire : ( a ) low - magnification image of periodic bead - like nanowire ; ( b ) low - magnification image of periodic bead - like nanowire ; it could be seen the periodic instability diminishes when diameter is large ; ( c ) high low - magnification image of periodic bead - like nanowire xps spectrum of zno nanowires . ( a ) o element , ( b ) zn element the occurrence of periodic instability of diameter of nanowires is induced by self - oscillatory mechanism . in the initiative stage , a zn rich droplet was formed on the substrate and then zn , o species is absorbed in the droplet . continuous dissolving zn and o species into the droplet lead to the saturation and one - dimensional crystal growth of zno . this process is similar to vls process , in which zn droplet play as a self - catalyst nucleation site for nanowire growth . during growth of nanowires , the oscillation of diameter of wire occurred under certain conditions ( crystallization temperature , vapor supersaturation , etc . ) within the range , within of which the gibbs - thomson effect works . the feedback could be described with a feedback model as followings : 1 . positive feedback : if the diameter of nanowire decrease , the concentration of o in droplet will increase due to the lowering of consumption of o at the liquid solid interface , then the roughness of the liquid solid interface increases , and hence the diameter of nanowire decreases further . 2 . negative feedback : if the diameter of nanowire decreases , the mole fraction of o in the droplet decreases because the curvature of the zn droplet increases ( the gibbs thomson effect ) ; then , the roughness at solid - liquid interface ( the liquid phase is o in zn droplet ; solid phase is zno ) decreases , and the diameter increases , and so on , and then an oscillation of wire diameter occurred . positive feedback will lead to the continuous expanding or shrinking of nanowire . when negative feedback dominated , oscillation occurs . when negative feedback dominates ( the gibbs thomson effect be ineffect ) , the relation of diameter of nanowire and concentration of o in droplet can also be explained by following equations : ( 1)(2 ) where x0 denotes the mean diameter , c denotes the concentration of o in droplet . and denote the positive coefficient , and t denotes the time . from the above eqs.1and2 , we have eq.3(3 ) this equation is a harmonic oscillator resolution . it means that the periodic structure of nanowire develop through a self - oscillation mechanism . the reason why the periodic instability vanish at large diameter could be understood as followings : the o supersaturation ( vapor phase / liquid phase ) of /kt can be determined by following equation : ( 4 ) denotes the difference between the chemical potentials of o in vapor phase and in droplet . 0denotes the same difference at a plane interface ( d ) , denotes the atomic volume of o. from this equation , we know that diameter of droplet increase and the supersaturation will increase and approach to the value of 0/kt . in a word , the larger the diameter of nanowire is , the larger the diameter of zn droplet is , and the higher supersaturation of the liquid solid interface is . as the supersaturation increase ( diameter : 200500 nm for zno ) , the epitaxial growth will manifest itself by masking the periodic structure ; hence the periodic structure will disappear . in summary , zno nanowires , with periodic bead - like structure , were prepared by thermal physical vapor deposition method . a self - oscillation mechanism was employed to explain the formation of such unusual morphology . this mechanism only manifests itself when the diameter of nanowire is small ( < 200 nm ) . these nanostructures are expected to be useful in optoelectronics and provide much useful information for researcher to understand the growth mechanism of nanowire or whisker . authors acknowledge the support from the national key project of fundamental research for nanomaterials and nanostructures ( grant no . | zno nanowires with a periodic instability of diameter were successfully prepared by a thermal physical vapor deposition method .
the morphology of zno nanowires was investigated by sem .
sem shows zno possess periodic bead - like structure .
the instability only appears when the diameter of zno nanowires is small .
the kinetics and mechanism of instability was discussed at length .
the appearance of the instability is due to negative feed - back mechanism under certain experimental conditions ( crystallization temperature , vapor supersaturation , etc ) . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
obesity , metabolic syndrome , and associated insulin resistance are major contributors to cardiovascular disease , the leading cause of mortality in the united states . insulin resistance is characterized by hyperglycemia and increase in lipolysis and free fatty acid levels and increased hepatic triglyceride secretion and sterol - regulatory element - binding protein-1 ( srebp-1 ) [ 2 , 3 ] . srebps are transcription factors known to regulate genes involved in fatty acid and cholesterol synthesis and are regulated by pampk [ 3 , 4 ] . ampk is phosphorylated and activated by the major kinase , lkb1 , and acts as a metabolic checkpoint that is suppressed in hyperglycemic conditions [ 48 ] . hyperglycemia and associated increase in reactive oxygen species ( ros ) are known to decrease ho levels [ 1 , 9 , 10 ] . there are two forms of ho , the inducible ho-1 and the constitutively expressed ho-2 [ 4 , 11 ] . ho-1 and -2 catabolize heme into equimolar concentrations of carbon monoxide , bilirubin , and free iron , generating an antioxidant effect and increasing nitric oxide ( no ) bioavailability and providing cardiovascular protection [ 4 , 11 ] . ho-1 is the major cytoprotective moiety of the ho system because of its rapid inducibility by a broad spectrum of compounds and conditions including stress . however , recent studies using ho-2 mice suggest that ho-2 is also critical for cellular homeostasis and for upregulation of ho-1 [ 4 , 11 ] . when ho-1 increases , levels of antioxidant and anti - inflammatory molecules increase and the level of reactive oxygen species ( ros ) decreases . the benefits of increased levels of ho-1 protein include the prevention of high blood pressure , decreased vasoconstrictors , increased vasodilators , and the inhibition of oxidative stress [ 1 , 10 , 12 ] . the effects of ho are also associated with an increase in adiponectin , a protein hormone that modulates many metabolic processes and can improve cardiovascular function while downregulating proinflammatory factors [ 1 , 9 , 13 , 14 ] . adiponectin exists in three different forms trimer , hexamer , and high molecular weight ( hmw ) with hmw adiponectin being the form that attenuates cardio - vascular disease [ 1 , 14 ] . in both , obese subjects and animals , the plasma levels of adiponectin are inversely related to insulin sensitivity [ 4 , 13 , 15 , 16 ] . the upregulation of ho-1 is associated with an increase in adiponectin levels and correlates with decreased inflammatory cytokines , il-1 , il-6 , and tnf [ 1 , 9 ] . recently developed ho-2 null mice have displayed characteristics of a metabolic syndrome - like phenotype with enhanced systemic inflammatory and oxidative stress response . curiously , these mice also demonstrate a failure to induce stress - dependent ho-1 upregulation along with suppression of adiponectin levels . that attenuated ho-1 upregulation in an ho-2 null mouse is accompanied by metabolic imbalance led us to examine the effects of an ho-1 inducer in such a setting . the apo - a1 mimetic peptide , l-4f , was administered to ho-2 null mice so as to rescue ho-1 expression . this apo - a1-mimetic peptide was synthesized from amino acids that improved the ability of hdl to protect ldl against oxidation in animals with atherosclerosis . l-4f treatment resulted in reduced adiposity , evident by decreased visceral fat content , in conjunction with improved energy balance and metabolic homeostasis in ho-2 null mice . these changes were further characterized by increases in ho-1 and adiponectin levels along with enhanced cellular expression of lkbi - pampk in the liver tissues . all animal experiments followed an institutionally approved protocol in accordance with the nih guide for the care and use of laboratory animals . these well - characterized ho-2 null mice have a c57bl/6 129/sv genetic background that was used on age- and gender - matched controls . mice were divided into three groups ( 10 mice / group ) : wt , ho-2 + vehicle , and ho-2 + l-4f . beginning at 20 weeks of age when the mice had established diabetes , l-4f ( i.e. , ac - d - w - f - k - a - f - y - d - k - v - a - e - k - f - k - e - a - f - nh2 ) synthesized from l - amino acids as previously described ( stephen p 2008 ) at a dose of 200 g/100 g daily in 2 ml vehicle , or vehicles ( abct : ammonium bicarbonate buffer at ph 7.4 containing 0.01% tween 20 ) were administered intraperitoneally ( i.p . ) for 6 weeks . blood pressure was measured by the tail cuff method before and every 7 days after l-4f administration . body weights of ho-2 and wt mice at the beginning of the experiment were 28 2 g and 20 2 g , respectively . glucose levels were 160 20 and 121 20 mg / dl for ho-2 and wt mice , respectively . at the time of sacrifice the body weight of all mice the subcutaneous and visceral fat in the abdomen , mesenteric fat , and fat around the liver , kidney , spleen , and heart were dissected free , pooled for each mouse and weighed . blood samples were collected in k3edta tubes at sacrifice , and the plasma was separated . frozen hepatic samples were pulverized in t - per ( thermofisher scientific , rockford , il , usa ) homogenization buffer , rotated for 1 hour at 4c , and then centrifuged at 12,000 rpm for 25 minutes at 4c . the supernatant was collected and protein was quantified using the bca protein assay ( pierce biotechnology , inc . , woburn , ma ) . protein expression analysis was preformed through immunoblotting with antibodies against ho-1 ( stressgen biotechnologies corp . , victoria , bc , canada ) , adiponectin , pakt , akt , pampk , and ampk ( cell signaling technology , inc . imaging and quantification were done using the odyssey imaging system ( li - cor biosciences , lincoln , ne , usa ) . total rna was recovered from liver following the perfect pure tissue kit ( 5prime , in gaithersburg , md , usa ) rna extraction protocol with dnase treatment . cdna was made using the improm reverse transcriptase kit ( promega , madison , wi , usa ) . primer sequences for mouse ho-1 were 5-cagccccaccaagttcaaac-3 and 5-tcaggtgtcatctccagagtgttc-3 , adiponectin 5-agccgcttatatgtatcgctca-3 and 5- tgccgtcataatgattctgttgg-3 , ampk 5-cgcagacagccccaaag-3 and 5-agagacttgggcttcgttgtgt-3 , lkb1 5-tgctggactccgagacctta-3 and 5-cctgcgcagctttttcttc-3 , akt 5-gaaccgtgtcctgcagaactctag-3 and 5-gtgggtctggaatgagtacttgag-3 , and gapdh 5-ccaggttgtctcctgcgact-3 and 5-ataccaggaaatgagcttgacaaagt-3. the thermal cycling conditions were 95c for 20 seconds followed by 40 cycles of 95c for 3 minutes , 60c for 30 seconds , and finally 95c for 15 seconds , 60c for 1 minute , and 95c for 15 seconds . liver samples were placed in scintillation vials ( 2 per vial ) containing 1 ml of krebs - hepes buffer , ph 7.4 , and lucigenin ( 5 lucigenin chemiluminescence was measured in a liquid scintillation counter ( ls6000ta , beckman instruments ) and superoxide production quantified as previously described . after 6 h fast , mice were injected intraperitoneally with glucose ( 2.0 g / kg body weight ) . blood samples were taken at various time points ( 0120 min ) , and blood glucose levels and serum insulin levels were measured . for determination of insulin tolerance , mice were injected intraperitoneally with insulin ( 2.0 u / kg ) . blood samples were taken at various time points ( 090 min ) , and blood glucose levels were measured . tissue ho activity , in liver samples from wt , ho-2 treated and untreated mice , was assayed as described previously [ 18 , 19 ] using a technique in which bilirubin , the end product of heme degradation , was extracted with chloroform , and its concentration was determined spectrophotometrically ( dual uv / vis beam spectrophotometer lambda 25 ; perkinelmer life and analytical sciences , wellesley , ma , usa ) using the difference in absorbance at a wavelength from 460 to 530 nm with an absorption coefficient of 40 mm cm . under these conditions , ho activity was linear with protein concentration , time - dependent , and substrate - dependent [ 18 , 19 ] . statistical significance between experimental groups was determined by the fisher method of analysis of multiple comparisons ( p < 0.05 ) . for comparison between treatment groups , the null hypothesis was tested by a single - factor anova for multiple groups or unpaired t - test for two groups . in figure 1(a ) we show that ho-2 deletion significantly increased body weight when compared to wt mice and was reversed after six weeks of l4-f treatment . a similar pattern was observed in weight reduction of subcutaneous and visceral fat by administration of l4-f in ho-2 mice as shown in figures 1(b ) and 1(c ) . furthermore , we determined that the random blood glucose levels in the ho-2 null mice were significantly increased compared to wt and were reversed back to normal baseline with l4-f treatment ( figure 2(a ) ) . both systolic and diastolic blood pressures were significantly elevated in ho-2 null mice as compared to wts ( p < 0.05 ) ( figure 2(b ) ) . this increased body weight , adiposity , and elevated blood pressure suggests metabolic syndrome like phenotype in ho-2 ko mice , which was successfully reversed by ho-1 induction . to investigate if the metabolic syndrome , observed in ho-2 null mice , is associated with insulin resistance , we performed insulin sensitivity and glucose tolerance tests . insulin administration to wt , ho-2 null , and l4-f treated ho-2 null mice produced a rapid decrease in glucose levels in the wt and l-4f treated ho-2 ko mice compared to ho-2 null ( p < 0.05 ) , suggesting improved sensitivity of ho-2 null mice with l-4f treatment , decreasing from 333.7 6.0 mg / dl for ho-2 null mice to 84.7 4.9 mg / dl in the l-4f treated ho-2 null mice ( figure 2(c ) ) . plasma glucose levels at all times were significantly elevated in the ho-2 null mice compared to the l-4f treated ho-2 null mice . glucose administration to all mice rapidly increased the glucose level after 30 min and remained elevated in the ho-2 null mice , compared to the l4-f treated ho-2 null and wt mice which returned to initial levels at 120 min ( figure 2(d ) ) . analysis of lucigenin - detectable chemiluminescence demonstrated enhanced oxidative stress in hepatic samples from ho-2 ko versus wt mice ( p < 0.05 ) . this increase in o2 generation was attenuated ( p < 0.05 ) in ho-2 null mice treated with l-4f for 6 wks ( figure 3(a ) ) . in figure 3(b ) , we show that the ho-2 null mice express significantly ( p < 0.05 ) lower levels of ho-1 as compared to wt mice ; however levels are restored with l-4f treatment . a daily injection of l-4f for 6 weeks also resulted in a significant increase in ho-1 mrna levels compared to the ho-2 null mice ( figure 3(c ) ) . deletion impairs ho-1 inducibility leading to a decrease in ho activity . in figure 3(d ) we show that treatment with l-4f in the ho-2 null mice significantly increases ho-1 activity . western blot analysis demonstrated that ho-2 deletion is associated with significant decrease in the expression of adiponectin when compared to age - matched wt ( figure 4(a ) ) . treatment with l-4f increased these levels by 2-fold to levels significantly higher than those measured in ho-2 null mice ( figure 4(a ) ) . consistent with the changes in protein shown in figure 4(a ) , we show with real - time pcr that adiponectin levels significantly increase with treatment with l-4f compared to untreated in the ho-2 null mice ( figure 4(b ) ) . to elucidate the mechanism involved in the changes observed with l-4f treatment , we determined expression and activity of signaling pathways that may be involved in the process . interestingly , the expression of activated ampk was regulated by ho-2 deletion since the ho-2 null mice expressed significantly lower levels of pampk albeit normal levels of ampk . l-4f restored the levels of pampk in the ho-2 null mice without affecting total ampk levels ( figure 4(c ) ) . furthermore , there was a significant increase in lkb1 expression in the l-4f treated ho-2 null mice ( figure 4(d ) ) , which suggests that the ampk / lkb1 pathway could play a role in the l-4f mediated resource of ho-2 phenotype . in addition , to elucidate modulation of akt - dependent pathways by ho-1 induction via l-4f , immunoblot assessment of pakt / akt was performed which exhibited enhanced ( p < 0.05 ) pakt / akt levels in ho-2 ko ( 1.39 0.12 ) versus wt ( 1.02 0.09 ) mice . this effect of ho-2 deletion on pakt expression was unaffected by l-4f administration in ho-2 null mice ( 1.46 0.14 ) . the data presented here shows that treatment of ho-2 null mice with l-4f rescues the key markers of metabolic syndrome via an increase in ho-1 and adiponectin through a signaling mechanism involving the lkb1/ampk signaling pathway ( figure 5 ) . interestingly , l-4f had no effect on activated akt ( pakt ) , suggesting selectivity of l-4f to pampk . first key finding presented here is in line with earlier reports [ 4 , 11 ] suggesting a role of ho-2 in mediating ho-1 upregulation . ho-2 null mice were characterized by disruption of metabolic homeostasis and displayed increased body weight , adiposity , insulin resistance with elevated blood pressure , and oxidative stress . pathophysiological conditions such as these have historically been shown to be associated with increase in cellular defense mechanisms including ho-1 . ho-2 , a constitutively expressed isoform , supports sustenance of basal redox status in the cells , and its knockdown is not surprisingly met with oxidative stress . ho-1 induction , however , in this ho-2 knockdown state fails to occur even in the presence of added pathophysiological insult such as metabolic syndrome . this failure of ho-1 upregulation could further dampen cellular defenses and contribute towards the phenotypic alteration observed in these animals . restoration of ho-1 expression and activity accompanied by phenotype reversal further supports the role of deficient ho-1 in mediating , at least partly , clinicopathological alterations observed in ho-2 null state . previous reports have documented physical interactions of the two ho isoforms , which could contribute towards ho-2-dependent induction of ho-1 . second key observation of this study is the modulatory effect of heme - ho system on adiponectin and associated metabolic signaling pathways and their role in alleviating metabolic pathologies observed in an ho-2 ko state . one major marker of obesity is inflammation , which produces an excess of reactive oxygen species , specifically superoxide . when there is chronic exposure to an excess of superoxide , adiponectin and ho-1 levels decrease significantly and contribute to the pathogenesis of insulin resistance [ 2 , 4 , 9 , 12 ] . an increase in ho-1 levels increases adiponectin levels , which is known to possess a vascular protective role , preserve endothelial function , and improve insulin sensitivity through glucose uptake [ 1 , 9 ] . treatment with l-4f is shown to increase both ho-1 and adiponectin levels in vitro and in vivo [ 2 , 15 ] while decreasing superoxide ( figure 3(a ) ) , further supporting the idea that l-4f improves the phenotype in the metabolic syndrome mouse model through an increase in insulin sensitivity and glucose tolerance . l-4f treatment significantly increased pampk and lkb1 levels , all associated with improved insulin sensitivity . p - ampk is known to act in the regulation of cell survival , protect against oxidative stress [ 15 , 2224 ] , and , when activated , contribute to glucose transport , fatty acid oxidation , and increased mitochondrial function [ 2 , 25 ] . it is known that crosstalk between ampk and akt can regulate nitric oxide bioavailability and vascular function [ 22 , 23 , 26 ] . however l-4f did not affect the protein expression or activation of akt , suggesting a pathway more specific to ampk . lkb1 is a serine - threonine kinase that directly phosphorylates ampk and decreases lipogenesis [ 4 , 5 , 8 ] . we show that l-4f induces lkb1 in ho-2 null mice , indicating that ho-1 mediates the transcriptional regulation of lkb1 by l-4f to activate ampk . in conclusion , as depicted in the schematic ( figure 5 ) , the upregulation of ho-1 and adiponectin levels by l-4f coincides with increased pampk and lkbi levels , providing a signaling mechanism by which l-4f rescues the metabolic syndrome phenotype and improves energy balance . thus , l-4f could provide as a beneficial drug treatment to complement conventional therapeutic of disease associated with disruption of metabolic homeostasis . | insulin resistance , with adipose tissue dysfunction , is one of the hallmarks of metabolic syndrome .
we have reported a metabolic syndrome - like phenotype in heme oxygenase ( ho)-2 knockout mice , which presented with concurrent ho-1 deficiency and were amenable to rescue by an eet analog .
apo a - i mimetic peptides , such as l-4f , have been shown to induce ho-1 expression and decrease oxidative stress and adiposity . in this study
we aimed to characterize alleviatory effects of ho-1 induction ( if any ) on metabolic imbalance observed in ho-2 ko mice . in this regard , ho-2(/ ) mice were injected with 2 mg / kg / day l-4f , or vehicle , i.p .
, for 6 weeks .
as before , compared to wt animals , the ho-2 null mice were obese , displayed insulin resistance , and had elevated blood pressure .
these changes were accompanied by enhanced tissue ( hepatic ) oxidative stress along with attenuation of ho-1 expression and activity and reduced adiponectin , pampk , and lkb1 expression .
treatment with l-4f restored ho-1 expression and activity and increased adiponectin , lkb1 , and pampk in the ho-2(/ ) mice .
these alterations resulted in a decrease in blood pressure , insulin resistance , blood glucose , and adiposity .
taken together , our results show that a deficient ho-1 response , in a state with reduced ho-2 basal levels , is accompanied by disruption of metabolic homeostasis which is successfully restored by an ho-1 inducer . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
data provided by the world health organization show that during the last decade , cardiovascular disease became the main cause of death worldwide , accounting for 17.3 million deaths per year.1 during 19902001 , cardiovascular mortality increased from 26% to 28% in developed and developing countries.1 the highest rates of mortality due to cardiovascular diseases , representing approximately 58% , are recorded in eastern european countries , whereas the lowest ( 10% ) are to be found in the african territories ( saharan africa).1 however , in financially strong countries , the percentages reach 38%.1 all in all , the incidence of most cardiac diseases increases with the process of aging . in romania , although there are important limitations regarding the data - collection system , we can identify a clear tendency of increasing mortality due to ischemic heart disease and stroke . in the 1990s , there was a sudden increase in the prevalence of ischemic heart disease , with a subsequent increasing tendency . according to the latest american heart association statistics , published in january 2013 , romania holds fourth place in the world in terms of mortality due to ischemic heart disease and stroke in men , after the russian federation , lithuania , and bulgaria , and third place in women , after the russian federation and bulgaria.2 while in 1970 , 7.33% of the cardiovascular deaths were due to myocardial infarction , the proportion amounted to 13.5% in 1998.3 in this context , this study aims at determining how the main cardiovascular risk factors and ischemic heart disease evolved in the course of 1 year in a group of subjects over 65 years of age in an urban community of romania . we conducted a retrospective study based on medical records issued by general practitioners , aimed at achieving an epidemiological survey of cardiovascular risk factors and cardiac diseases in subjects over 65 years old by highlighting sex differences . the study population was followed prospectively during 1 year ( 20072008 ) in order to determine the changes that occur in cardiovascular risk profile and cardiovascular disease . we studied 515 patients ( 264 women and 251 men ) over 65 years of age , evaluated for the presence of cardiovascular risk factors and ischemic heart disease . fifty - three patients were lost to follow - up ( deceased or with unavailable personal data ) , and only 462 patients underwent the second assessment ( 235 women , 227 men ) . during the initial evaluation and 1 year after that , the following parameters were determined : anthropometric measurements , blood pressure , smoking status , lipid profile ( total cholesterol , triglycerides , high - density lipid [ hdl]-cholesterol , low - density lipid [ ldl]-cholesterol ) , fasting plasma glucose , and the presence of ischemic heart disease . blood glucose was measured by the glucose oxidase method , while serum lipids , total cholesterol , triglycerides , and hdl - cholesterol were measured by using commercially available kits . ldl - cholesterol was estimated using friedewald s formula . according to current european society of cardiology guidelines , hypertension was classified as : mild hypertension 140/90159/99 mmhg , moderate hypertension 160/100179/109 mmhg , and severe hypertension > 180/110 mmhg.4 data on hypertension were collected from the medical records kept by the patients family physicians . uncomplicated hypertension was registered as a cardiovascular risk factor , not as cardiovascular disease . by using the criteria set out in the national cholesterol education program adult treatment panel iii approach to dyslipidemias , total cholesterol levels over 200 mg / dl , ldl - cholesterol levels over 100 mg / dl , triglyceride plasma concentrations exceeding 150 mg / dl , and hdl - cholesterol levels less than 46 mg / dl in women and 40 mg / dl in men were considered pathological.5 patients were classified according to their body mass index ( bmi ) as normal weight ( bmi 25 kg / m ) , overweight ( bmi between 25 kg / m and 29.9 kg / m ) and obese ( bmi > 30 kg / m).4 statistical analysis was performed using spss for windows ( version 16.0 ; ibm corporation , armonk , ny , usa ) and medcalc ( version 10.3.0.0 ; medcalc software , ostend , belgium ) software programs . analysis of the differences between qualitative variables was performed using the test . the kolmogorov the normality condition was met by bmi and serum lipids ( total cholesterol and ldl - cholesterol ) , but not for glycemia , hdl - cholesterol , or triglycerides ( so we had to use the mann there were no differences between the first and second assessments concerning the incidence of smoking ( 12.3% versus ( vs ) 12.5% ) , obesity ( 25% vs 26% ) , diabetes mellitus ( 19% vs 22.9% ) , or hypertension ( 88.2% vs 92.2% ) . regarding the presence of dyslipidemia , we found a marked decrease in its prevalence ( 40.6% vs 30.3% , p<0.001 ) . as shown in table 1 and figure 1 , there were no differences between the two medical assessments regarding the plasma mean levels of triglycerides , hdl - cholesterol , and ldl - cholesterol . however , there was a significant decrease in total cholesterol levels , but also an increase in plasma glucose concentrations ( table 1 ) . although at the initial medical evaluation there were significant sex differences in the incidence of smoking , obesity , dyslipidemia , and hypertension , at 1-year follow - up most of them had disappeared ( only those concerning smoking and dyslipidemia stayed unchanged ) ( table 2 ) . during the first assessment , there was a significant difference in all plasma lipid - fraction values between women and men , in contrast to the second evaluation , when these differences were present only in terms of hdl - cholesterol and total cholesterol levels ( table 3 ) . a higher incidence of ischemic heart disease ( 51.65% vs 63% ) was noticed during the second evaluation , even though the occurrence of silent ischemic heart disease decreased from 3.9% to 0.2% ( p=0.0002 ) , which emphasizes the fact that the increase was due to stable angina pectoris , old myocardial infarction , or other causes of ischemic heart disease ( arrhythmias or heart failure ) , regardless of sex ( table 4 ) . the incidence of ischemic heart disease was considerably higher in elderly women than in men , with an increase from 55.7% to 65.1% in women and from 47.4% to 60.8% in men , which revealed a similar growth for both sexes , the ratio differences between men and women being significantly similar . myocardial infarction amounted to 9.5% in 2008 , similar to the values recorded in 2007 ( 8.7% , not significant ) . there were no significant differences between the initial evaluation and 1 year later , irrespective of sex ( women 5.7% vs 6% in 2008 , men 12% vs 13.2% in 2008 ) . differences regarding stable angina remained unchanged between the two assessments , in both women ( 24.7% in 2008 vs 21.2% in 2007 ) and men ( 12.8% in 2008 and 12.7% in 2007 ) . stable angina occurred more often in women , whereas old myocardial infarction was predominant in men during both evaluations . in addition , there were no significant changes in the incidence of heart failure and rhythm disorders between the two assessments ( 10.48% vs 13.2% and 23.1% vs 26% , respectively ) . as for cardioprotective medication , 65% of the patients received aspirin , 71.9% beta - blockers , and 74.9% angiotensin - converting enzyme inhibitors ; 48.8% were given statins . patients over 75 years of age received less medication than those under 75 years : 32% versus 54.2% , respectively ( p=0.009 ) . according to the interheart study , traditional cardiovascular risk factors account for most of myocardial infarction risk worldwide in both sexes , ages and in all regions.6 in eastern europe , the most frequent modifiable cardiovascular risk factors are smoking , obesity , hypertension , and hypercholesterolemia ( serum cholesterol levels over 200 mg / dl ) . the present study showed that the main investigated cardiovascular risk factors ( arterial hypertension , diabetes mellitus , smoking , obesity ) had the same incidence 1 year after the initial assessment . there are insufficient data on the incidence of cardio vascular risk factors in general and the main heart diseases in romania , especially as after the 1990s there was a heart disease boom following the transition from communism to a so - called liberalization . the rise is constant , with no perceptible tendencies of improvement , which could be explained by a drastic lifestyle change , chiefly the prevalence of smoking and fast - food diets . hypertension is one of the major cardiovascular risk factors found in romania , with a constantly growing incidence . in 2006 , the occurrence of hypertension was reported to be 40% , and by 2012 it remained unchanged , increasing with age.7,8 the incidence of hypertension was very high in the study group of elderly subjects : 88% in 2007 and 92.2% in 2008 . among the countries of eastern europe , croatia has the highest ratio of hypertensive men ( 50% ) and bosnia - herzegovina has the highest number of hypertensive women ( 45%).1 romanian epidemiological data show that the incidence of smoking decreased from 29.7% to 22% between 2003 and 2011.9 presently , 35.2% of romanian men and 15.3% of romanian women are smokers.9 in our study , the prevalence of smoking was more than double in men than in women , both during 2007 and 2008 . in eastern europe , the highest incidence of smoking in men was reported in ukraine ( 62% ) and in women in serbia ( 27%).1 the prevalence of diabetes mellitus increased insignificantly from 19% to 22.9% . women displayed similar ratios during both years ( 21.2% vs 23.8% ) , whereas men presented a significantly higher incidence ( from 16.7% to 22% ) . in 2007 , 40.6% of the subjects displayed dyslipidemia , whereas dyslipidemia was found only in 30.3% of the patients in 2008 , the decrease being similar in women and men ( from 48.5% to 36.6% in women , and from 32.3% to 23.8% in men ) . significantly lower levels were recorded for hypercholesterolemia . the incidence of hypercholesterolemia in romania amounted to nearly 63% , but only 16% of the subjects were therapeutically controlled ( values < 175 mg / dl).1 hypercholesterolemia affects almost 39% of the world population , with more than half this incidence from developing countries . in eastern europe , the highest occurrences of unaware hypercholesterolemia can be found in bulgaria ( 72% ) , latvia ( 70% ) and croatia ( 70%).10 among romanian subjects over 30 years old , cholesterol levels vary between 192 and 216 mg / dl in men and between 189 and 217 mg / dl in women.1 in our group of elderly romanian subjects , the lower lipid - fraction levels could be due to both primary and secondary cardiovascular prevention measures and also to the intensive treatment with statins recommended by physicians or even requested by patients who were informed about the role of high lipid - fraction levels in the development of cardiovascular diseases . according to the data provided by the euroaspire ( european heart survey on secondary and primary prevention of coronary heart disease ) iii study,10 the statin administration ratio was lower than the all lipid - lowering drugs ( 88.8% ) administration ratio in europe . in spite of the lower ratio of statin prescription , our study recorded a significant decline in the incidence of dyslipidemia in general and average cholesterol level in particular . the respective changes can be ascribed to the fact that the initial assessment of risk factors had alerted the patients to the presence of dyslipidemia ( side by side with the presence of other risk factors ) , which triggered lifestyle adjustments . the ratios remained almost identical in men and women during both years ( women , 29.5% in 2007 , 29.6% in 2008 ; men [ insignificant difference ] , 20.3% in 2007 , 20.6% in 2008 ) . the incidence of obesity is also growing in romania in both women ( 8% [ 35.9% overweight ] ) and men ( 7.6% [ 49.9% overweight]).11 an alarming increase in obesity was recorded among children and teenagers.11 in europe , the highest rates of obesity in men and women are to be noticed in croatia ( 22% ) and turkey ( 30% ) , respectively.1,12 special attention needs to be paid to the evolution of cardiovascular risk factors and sex - related differences . in our study , the incidence of hypertension was basically identical in both years : 88.2% in 2007 and 92.2% in 2008 . women had higher blood pressure values than men in both years , but a high incidence was found in both sexes . the incidence of hypertension increased with age for both sexes , with a more noticeable increase in women between 45 and 54 years old . in subjects younger than 35 years , hypertension was clearly more common in men than in women.13 however , regardless of age , the presence of hypertension in women is associated with a three- to fivefold higher risk of coronary heart disease.14,15 our study showed that in elderly subjects , all lipid fractions levels were higher in women than in men , regardless of the assessment moment . before menopause , total cholesterol and ldl - cholesterol were generally lower in women , whereas hdl - cholesterol was higher than in men.16 whereas after the age of 50 years , ldl - cholesterol levels remained relatively the same in men , in menopausal women there was a significant increase in ldl - cholesterol levels , reaching maximum values between the ages of 55 and 65 years.16 thus , after the age of 65 years , the incidence of dyslipidemia was about twice as high in women.17 menopause also influenced hdl - cholesterol levels , which decreased gradually during the last 2 years preceding menopause and after , especially the hdl2 fraction , which has an important cardioprotective role.16,18 cardiovascular protection dropped with the decrease in hdl levels . therefore , low hdl values may be considered major factors for an increased cardiovascular risk in postmenopausal women . however , in our study , hdl - cholesterol levels were higher in women in both years . triglyceride levels also increased after menopause.19 our research showed that the incidence of obesity was higher in elderly women than in men , especially in the first year of observation . women seemed more likely to display cardiovascular risk factors than men , especially obesity in adolescence , pregnancy , and menopause.16 the increasing occurrence of ischemic heart disease can be attributed to the 1-year aging process of the subjects enrolled in the study . in addition , another explanation could be the fact that the patients who underwent the initial assessment of cardiovascular risk factors were informed about the presence of cardiovascular risk factors and cardiovascular disease . therefore , the patients probably sought medical advice more often during the following year , so additional cardiovascular diseases perhaps present at the initial assessment but undetected by regular screening tests might have been diagnosed . ischemic heart disease occurs about 10 years later in women than in men.20,21 in general , the form of ischemic heart disease prevailing in women is angina pectoris , whereas myocardial infarction occurs more often in men , previous assertions being in agreement with our findings.17,22 it is important to emphasize that in the present study , the data were collected from medical records kept by general practitioners , so none of the subjects displayed acute coronary syndromes at the moment of assessment . the highest incidence of st - segment elevation acute coronary syndromes occurs in young men ( under 55 years ) , the ratio decreasing with age.21 nearly half of the male patients with ischemic heart disease younger than 65 years came with clinical symptoms of an st - segment elevation acute coronary syndrome , whereas only 40% of the women did.21 in patients over 65 years of age , the differences between men and women were less significant.21 in women , unstable angina is responsible for most cases of acute coronary syndromes,21,23 especially before the age of 65 years . after the age of 65 years , women present in equal proportions st - segment elevation and non - st - segment elevation acute coronary syndromes.13 in the present study , although the main risk factors , chiefly obesity and dyslipidemia , decreased during 1 year , the incidence of ischemic heart disease increased . the data prove that over 65 years of age , cardiovascular pathology ceases to be sex - related . the increase in the incidence of cardiovascular diseases could be chiefly ascribed to the 1-year aging of the study patients , and secondly to the fact that the initial assessment of the risk factors alerted the patients to their presence and the possibility of cardiovascular diseases , so that more cardiovascular diseases possibly present at initial examination but undetected by regular screening were diagnosed . finally , we believe that the results of the present paper present significant data on the incidence of cardiovascular risk factors in a population over 65 years of age of a city that is an academic center , supposedly with highly proficient medical specialists . in conclusion , the data supplied by our study show that in subjects over 65 years old , cardiovascular disease prevails in women , with some particular characteristics that should be taken into account , and that cardiovascular risk factors need to be addressed and influenced . however , one should not expect a major decrease or improvement in the cardiovascular risk factors during such a short period ; positive results will probably be achieved through long - term interventions . | backgroundromania has some of the highest mortality figures in the world attributable to ischemic heart disease and stroke among both men and women.objectivesto assess the changes in cardiovascular risk factors and ischemic heart disease in a group of subjects over 65 years of age during 1 year in an urban community of romania.materials and methodswe studied 515 subjects ( 264 women and 251 men ) with a mean age of 73.416.44 years , followed up over the course of 1 year in order to determine the changes that occurred in cardiovascular risk factors and in the evolution of ischemic heart disease . at the beginning and after 1 year
, we determined the following parameters : anthropometric measurements , blood pressure , smoking status , lipid profile ( total cholesterol , triglycerides , high - density lipid cholesterol , low - density lipid cholesterol ) , fasting plasma glucose , and the presence of ischemic heart disease.resultsthere were no differences between the first and second assessments concerning the incidence of smoking ( 12.3% versus ( vs ) 12.5% ) , obesity ( 25% vs 26% ) , diabetes mellitus ( 19% vs 22.9% ) , or hypertension ( 88.2% vs 92.2% ) .
statistically significant differences were recorded regarding dyslipidemia ( 40.6% vs 30.3% , p<0.001 ) .
cholesterol median values decreased ( 204 mg / dl vs 194 mg / dl , p=0.003 ) , while median concentrations of plasma glucose increased ( 101 mg / dl vs 105 mg / dl , p<0.05 ) . at the same time
, we noted a higher incidence of ischemic heart disease ( 51.65% vs 63%).conclusionour data show that in subjects over 65 years of age , cardiovascular disease occurs more often in women , but with certain features that should be taken into account .
in addition , we point out the importance of reducing cardiovascular risk factors .
however , we should not expect a major decrease or improvement in cardiovascular risk factors with such a short follow - up .
such results will be achieved only through long - term interventions . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
parkinson 's disease ( pd ) is a progressive degenerative disease related to the extrapyramidal system . patients with this disease show four major symptoms : resting tremor , muscle rigidity , akinesia , and postural reflex disturbance , all of which show a gradual progression . although pd is observed over a wide age range , its crisis and prevalence rates generally increase with age . in japan , although the primary cause of pd is the degeneration of the dopamine secretory cells in the mesencephalon substantia nigra pars compacta , the other major causative factors include the degeneration and disappearance of neurons in the noradrenaline system ( locus coeruleus ) , the serotonin system ( dorsal raphe nucleus ) , and the acetylcholine system ( basal ganglion of meynert ) . as a result , pd patients show various disorders in the motor and nonmotor systems . nmss include various disorders such as mood disorders , cognitive dysfunction , mental symptoms , autonomic nervous system disorders , and perception disorders . these nmss can be evident in the progressive stage , as well as in the early stages of functional nonmotor disorders related to cognitive , emotional , and behavioral aspects . regarding mood disorders presenting as nms , depression , apathy , and anhedonia complicate pd and are present at high rates in pd patients ( approximately 40% ) , although these rates differ among the various reports . these complications are important factors that detrimentally affect the patients ' quality of life and care burden . although apathy and anhedonia are often confused with depression , they differ from depression in terms of mechanisms , therapeutic approaches , and prognoses . if therapy is desultorily performed due to misdiagnosis , recovery from the primary disease may be delayed , activities of daily living may decrease , and the morbid states may worsen . therefore , correct differential diagnosis is essential . in the present study we describe the results obtained from our assessments of apathy and anhedonia occurring along with pd . depression is diagnosed on the basis of the diagnostic criteria defined in the diagnostic and statistical manual of mental disorders - fourth edition ( dsm - iv ) ( table 1 ) . apathy is a state in which only decreased willingness is noticeable , while depressed mood and a feeling of tragedy , which are characteristic of depression , are not observed , and emotional bias is not recognized . therefore , apathy is not defined in the dsm - iv ( if apathy is forcibly expressed , it can be considered as a state in which only the first half of loss of interest or loss of pleasure in table 1 , that is , loss of interest , exists ) . among general physical diseases , essay on shaking palsy , observed that it is often complicated by depression in addition to motor symptoms . there are varying forms of depression in pd , and these forms show widely varying rates of occurrence.reijnderset al . ( 2008 ) analyzed 104 papers and reported that the least and greatest values of the prevalence rate of depression occurring along with pd are 2.7% and 89% , respectively . the prevalence rate of depression occurring along with pd was believed to vary because the evaluation methods , judgment criteria , and sampling methods varied in different studies . however , the prevalence rate of depression occurring along with pd varied largely even in cases where thepopulation and examinationmethodswere similar to each other , as shown in table 2 . only 2.4% ( 2.2%7.6% ) of the cases showing depression along with pd satisfy the criteria for major depression . this value is almost equal to the prevalence rate of major depression in the general population . therefore , depression occurring along with pd should be recognized as minor depression , or dysthymia , instead of major depression . recently , ehrt et al . compared pd patients with depression to similarly aged depression patients without pd . all depression patients without pd were diagnosed with major depression , and 1/4 of the pd patients with depression were diagnosed with major depression . moreover , the incidences of depressive mood , feeling of guilt , and loss of pleasure were significantly higher in depression patients without pd , and the incidence of loss of concentration was significantly higher in pd patients with depression . these results agree with previous findings which suggest that apathy is readily evident and that feelings of guilt , suicide attempts , and depressed mood are milder in pd patients with depression than in patients with endogenous major depression . thus , apathy in combination with pd explicitly expresses one of the pathological characteristics of depression in pd . starkstein , a researcher who proposed apathy as a disease , pointed out the following diagnostic criteria for apathy : a1 , a decrease in goal - directed behavior ; a2 , a decrease in goal - directed cognition ; a3 , an emotional deficit associated with goal - directed behavior . based on the results obtained by studies on brain damage and cerebrovascular accidents , apathy is reported to be caused by damage to the dorsolateral prefrontal cortex , basal ganglion , orbital region , internal capsule ( posterior limb ) , or the thalamus . the frequency of occurrence of apathy is the highest when the frontal lobe is damaged . there is a 60% and higher probability of complication by apathy in patients with progressive - stage alzheimer 's disease [ 15 , 16 ] , although this figure varies widely among reports . the frequency of apathy occurrence is the secondly higher when the basal ganglion is damaged . basal ganglia diseases , such as pd , progressive supranuclear palsy , and huntington 's chorea , are complicated by apathy in approximately 40% of the cases [ 7 , 17 ] . in patients with pd , abnormalities in the orbitofrontal area , such as the cingulate gyrus , the corpus striatum , and the frontal lobe circuit ( which plays an important role in profit - sharing - based reinforcement learning ) , and the mesocortical dopamine system result in motivational disorders such as apathy . symptoms common to apathy and depression include loss of interest , or loss of pleasure , retardation , fatigue , decreased emotional reactions , indifference , social degeneration , decreased initiation , decreased persistence , and loss of insight , and hypersomnia . symptoms observed only in depression include depressed mood , suicidality , self - condemnation , excessive or inappropriate guilt , feelings of despair , and loss of appetite . however , apathy syndrome , in which remarkable apathy is observed , is a different morbid state that occurs over an extended period . depression is generally considered an affective ( emotional ) disorder accompanied by pathos . however , apathy is considered a motivational disorder and is not accompanied by affective disorders . unlike the findings in depression , emotion is flattened and no pathos is observed in apathy . recently , kirsch - darrow et al . evaluated depression and apathy in pd by using dystonia as a control . they found cases of pd and dystonia that were similarly complicated by apathy and depression . however , independent apathy development was observed at a high rate in pd patients only . therefore , they concluded that apathy is the core feature of pd , and it can occur without depression , because apathy is a symptom that is independent of depression . apathy evaluation methods can be roughly classified into subjective evaluation methods , which are based on self - recording systems , and objective evaluation methods , which are based on interviews ( observation ) . the apathy evaluation scale ( aes ) and the apathy scale ( as ) can be used for subjective evaluation . starkstein et al . created as by amending aes to reduce the number of items to 14 , and thereby making the scale easier to use for pd patients . moreover , the validity of as has already been established . as is an evaluation scale based on a self - recording system ; patients whose spontaneity is remarkably low and those with advanced dementia can not answer the questions , which may limit the use of as . in 2006 , although lars consists of 33 items , most of these items adopt the structured interview form with a choice between yes or no . the prevalence rates of depression and apathy in pd and the depression characteristics were examined using multiple controls . the pd group consisted of 46 pd patients ( table 3 ) , and the three control groups consisted of 54 patients with acute - phase stroke ( stroke group ) , 20 patients with medication - overuse headache ( moh ; moh group ) , and 10 patients with endogenous depression ( endogenous depression group ) . the age and sex of the pd group patients were similar to those of the patients in the control groups . the patients in each group were diagnosed using the diagnostic criteria defined in the dsm - iv . the levels of depression were categorized as major depression , minor depression , or dysthymia . the hamilton depression scale , which is comprised of 17 items ( ham - d17 ) , was also used to assess the patients . using the japanese version to determine the apathy score , we diagnosed the existence of apathy in each group . based on the results , the prevalence rate of mood disorders in each group was calculated , and the complication rates of depression and apathy in each group were investigated . subsequently , using subgroups of patients who were diagnosed with depression , a subanalysis was performed on nine low - ranked items of the 17 items in the ham - d17 ; in this subanalysis , five - grade evaluation was performed to investigate the characteristics of mood disorders in pd . the wilcoxon signed - rank test was used for the low - ranked item subanalysis in the ham - d17 in pd . furthermore , the mann - whitney 's u test was used to compare items in the pd group with those in each control group . ( a ) prevalence rates of depression and apathy
table 4 shows the depression and apathy prevalence rates . the depression prevalence rate in the pd group was 19.6% , and this rate was almost equal to that in the stroke group . the apathy prevalence rate in the pd group was as high as 50% , and this rate was much higher than those in the control groups . moreover , 88.9% of pd patients who were diagnosed with depression also had apathy , with a complication rate remarkably higher than those of the other groups . the depression prevalence rate in the pd group was 19.6% , and this rate was almost equal to that in the stroke group . the apathy prevalence rate in the pd group was as high as 50% , and this rate was much higher than those in the control groups . moreover , 88.9% of pd patients who were diagnosed with depression also had apathy , with a complication rate remarkably higher than those of the other groups . ( b ) subanalysis of nine low - ranked items of the ham - d17 in the pd group
table 5 shows the average score sd of each of the nine low - ranked items of the ham - d17 in the pd group and the three control groups . figure 1 shows a graph of the average pd group scores . among the nine items , work and interests obtained the highest average score , followed by anxiety , psychic . no significant difference was observed in the average score between these two items in the signed - rank test . however , the average scores of the other seven items , such as depressed mood , were significantly lower than that of work and interests . table 5 shows the average score sd of each of the nine low - ranked items of the ham - d17 in the pd group and the three control groups . figure 1 shows a graph of the average pd group scores . among the nine items , work and interests obtained the highest average score , followed by anxiety , psychic . no significant difference was observed in the average score between these two items in the signed - rank test . however , the average scores of the other seven items , such as depressed mood , were significantly lower than that of work and interests . ( c ) comparison of the pd group with the control groups ( stroke , moh , and endogenous depression)the average scores of the ham - d17 items depressed mood , retardation , and agitation were significantly lower in the pd group than in the endogenous depression group ( table 5 ) . particularly , the average score of the item depressed mood was lower in the pd group than inthree control groups . in contrast , the average scores of the item work and interests and items that reflected anxiety in the pd group were similar to those in the endogenous depression group . the average scores of the ham - d17 items depressed mood , retardation , and agitation were significantly lower in the pd group than in the endogenous depression group ( table 5 ) . particularly , the average score of the item depressed mood was lower in the pd group than inthree control groups . in contrast , the average scores of the item work and interests and items that reflected anxiety in the pd group were similar to those in the endogenous depression group . the results in section 2.4.3 ( a ) show that the prevalence rate of apathy is much higher in the pd group than in the control groups . this finding supports the results reported by kirsch - darrow et al . , who described that apathy is the core feature of pd . the complication rate of depression and apathy described in section 2.4.3 ( a ) and the results described in section 2.4.3 ( b ) and ( c ) support the hypothesis that in pd patients apathy is generally and frequently observed , even in the state of depression . section 2.4.3 ( c ) shows that no significant difference was observed in the average score of work and interests between the pd group and endogenous depression group , and section 2.4.3 ( b ) describes that a significant difference was observed in the average score between work and interests and depressed mood , feeling of guilt , and suicide . these results indicate that in pd patients with depression the frequencies of decreased willingness and loss of pleasure are higher , and the frequencies of feeling of guilt , self - accusation , and feeling of loss are lower , and also the rate of suicide is lower than in patients with endogenous depression . similar to depression and apathy , pd is typically accompanied by anxiety disorders , which are observed in approximately 40% of pd patients , although this rate differs among various reports . anxiety disorders are caused by decreased serotonin following dorsal raphe nucleus denaturation due to pd progression , or by overactivity of the noradrenaline system caused by the disinhibition of the dopamine nerve to the locus coeruleus . in this study , we did not diagnose anxiety disorders in accordance with the dsm - iv , and therefore , the detailed mechanism of anxiety disorders is unknown . however , the results related to anxiety in ( c ) suggest that similar to depression in pd , anxiety disorders can also become a complication in pd . similar to apathy , anhedonia has recently attracted attention as an nms in pd . apathy is mainly characterized by loss of primary motivation , loss of interest in the environment , and affective dullness . anhedonia is the state in which the patient can not derive essential pleasures from behaviors and activities that were joyfully performed in the past . in other words , anhedonia is a morbid state in which the patient 's sensitivity to pleasure has decreased . if anhedonia is forcibly expressed , it is the state in which only loss of pleasure is manifest , but not loss of interest as shown in table 1 . anhedonia in pd can be explained as follows : ( a ) disturbance of the dopaminergic circuit , which projects dopamine from the mesolimbic system to the frontal cortex , affecting the reward system in the neurodegenerative process ; ( b ) decreased motivation ; ( c ) decreased willingness , decreased spontaneity , loss of sociality , and loss of interest in joyful stimuli ( sexual acts , eating , smoking , drinking , etc . ) as mentioned above , anhedonia has nearly the same meaning as loss of pleasure in the diagnostic criteria of major depression in the dsm - iv . among symptoms that have been reported as anhedonia in pd , moreover , the mechanism , which is assumed to be a reward - system disturbance in the dopamine system , is common to apathy and anhedonia . lemke et al . conducted an open study to evaluate the effect of pramipexole and reported that anhedonia was observed in 45.7% of the 626 pd patients involved in the study . pluck and brown investigated apathy in 45 pd patients and reported that in cases where apathy was clearly observed , anhedonia was also significantly present . to evaluate anhedonia , the snaith - hamilton pleasure scale ( shaps ) , created by snaith et al . since these items are scarcely affected by motor functions , shaps can be used to evaluate anhedonia in pd patients . unlike as , shaps can not diagnose anhedonia on a stand - alone basis ( anhedonia is suspected when the score is 3 or higher ) . however , shaps is useful in determining the effects of therapy . the study conducted by lemke et al . the relationship between the morbid states of apathy and anhedonia in pd was examined . in this examination 50 pd patients were used as subjects ( tables 5 and 6 ) . using diagnostic criteria defined in the dsm - iv we diagnosed depression ( major depression , minor depression , or dysthymia ) . moreover , using the as japanese version and shaps , apathy and suspected anhedonia were diagnosed and quantified . prevalence rates of depression , apathy , and anhedonia were calculated , and their complication rates were investigated . the correlation between as and shaps was evaluated using the spearman 's correlation coefficient by rank test . ( a ) prevalence rateprevalence rates of depression , apathy ( as 16 ) , and suspected anhedonia as shown in figure 2 , nearly all cases diagnosed with depression were complicated with apathy and anhedonia , and nearly all cases diagnosed with apathy were complicated with anhedonia . prevalence rates of depression , apathy ( as 16 ) , and suspected anhedonia ( shaps 3 ) were 18% , 44% , and 74% , respectively . as shown in figure 2 , nearly all cases diagnosed with depression were complicated with apathy and anhedonia , and nearly all cases diagnosed with apathy were complicated with anhedonia . ( b ) relationship between apathy and anhedoniafigure 3 shows the correlation between as ( apathy ) and shaps ( anhedonia ) . as shown in this figure , a strong correlation ( r = 0.64 and p = .00000065 ) figure 3 shows the correlation between as ( apathy ) and shaps ( anhedonia ) . as shown in this figure , a strong correlation ( r = 0.64 and p = .00000065 ) was obtained between as and shaps . the prevalence rates of depression and apathy are similar to those in the examination results from part 1 . the prevalence rate of suspected anhedonia was significantly higher than that in the report by lemke et al . since shaps was used in the present study and had been translated into japanese by the author of this paper and since the validity of shaps in japanese has not been established , the prevalence rate of suspected anhedonia may be overestimated . however , nearly all patients diagnosed with suspected anhedonia were also diagnosed with apathy . moreover , a strong correlation was obtained between as and shaps , as described in ( b ) . therefore , apathy and anhedonia share a common mechanism ( dopamine exhaustion disturbances of the reward system ) . thus , apathy and anhedonia are core features of mood disorders in pd and are independent of depression in japanese patients . figure 4 shows an approximate relationship between apathy , anhedonia , and depression in pd . at present , there are no proven medicines for apathy and anhedonia in pd , and the suitability of pd therapy for treating apathy and anhedonia needs to be evaluated . when pd is strongly suspected to be caused by dopamine deficiency ( e.g. , therapy has been extremely insufficient , or apathy or anhedonia appears only in the off stage ) , dopaminergic therapy may be effective . in particular , pramipexole , a dopamine agonist , is reported to improve the symptoms of depression and decreased willingness . however , such results were mainly obtained in open studies , and the therapeutic methods differ according to the opinions of specialists . additional dopaminergic therapy in patients who show sufficient control over motor symptoms may increase the risk of inducing adverse effects , such as lower limb edema , daytime drowsiness , valvular disease of the heart , mental symptoms , and dyskinesia . therefore , the so - called made to order therapy in consideration of the patient 's background is essential . apathy or anhedonia in pd exhibits similar symptoms to subcortical dementia , in which the motivational disorder caused by a disturbance in the dopamine projection system of the mesencephalon frontal cortex plays a central role . if true , dopaminergic therapy should be the first choice to treat apathy and anhedonia in pd patients . among dopamine agonists , pramipexole , pergolide , and ropinirole particularly , pramipexole has a stimulatory action on d2 receptors in the nigrostriatal dopamine system related to the motor system and d3 receptors . d3 receptors are widely distributed in the mesolimbic pathway ( from the ventral mesencephalon to the nucleus accumbens ) and the amygdaloid body in the dopamine projection system in the mesencephalon frontal cortex . the d3 stimulatory action of pramipexole in these emotion - related sites is presumed to improve symptoms of apathy and anhedonia . reported that pramipexole is effective for treating depression in pd . because a randomized double - blind method was adopted , the confidence level of the obtained results was high . several reports have described that selegiline , a monoamine oxidase b ( mao - b ) inhibitor , is effective for the treatment of decreased willingness and depressed mood in pd.tom and cummings recommended selegiline as the first choice to treat depression in pd patients not exhibiting suicidality . the primary effects of selegiline are inhibition of mao - b and efficient use of intracranial dopamine . pea promotes serotonin release to improve symptoms of decreased willingness and depressed mood in pd . therefore , pea is particularly effective for apathy and anhedonia complicated with depression . unlike dopamine agonists that are typically used alone , selegiline can be used in combination with other medicines , that is , the so - called add - on use is possible . however , since selegiline used in combination with antidepressants ( which are described below ) is contraindicated , care must be taken when administering selegiline . since amantadine hydrochloride induces dopamine secretion and exhibits a catecholamine stimulatory action , this medicine is useful to treat pd . because of its mechanism , the effect of amantadine hydrochloride on apathy is expected . few reports exist on the effects of various antidepressants on apathy in pd ( without depression ) . selective serotonin reuptake inhibitors ( ssris ) , serotonin noradrenaline reuptake inhibitors ( snris ) , tricyclic antidepressants ( tcas ) , and tetracyclic antidepressants were reported to be effective therapies for major depression occurring along with pd . in particular , the effect of the tca nortriptyline was reported to be effective in a randomized controlled trial with a placebo group . the positive effects of the ssris sertraline and paroxetine on depression in pd patients were reported in open studies based on more than 100 cases . the american academy of neurology ( ann ) recommends amitriptyline for the treatment of depression in pd . these results were obtained on the basis of depression , not apathy or anhedonia alone . generally , antidepressants are not effective for the treatment of depression in which remarkable decrease in willingness is observed . on rare occasions , antidepressants worsened the decreased willingness . thus , antidepressants should not be imprudently used for cases where apathy or anhedonia is independently observed . maruyama administered milnacipran , an snri , to eight pd patients with depression and reported that it was effective in treating depression distinctive to pd , including cases where significant apathy or anhedonia was observed . moreover , milnacipran administration caused total remission in cases of depression with pd for which an ssri was not effective . according to the monoamine hypothesis , snris , which have significant noradrenaline - inducing activity , are effective for depression in which apathy or decreased willingness are expected in cases for which pramipexole is not sufficiently effective , the validity of snris must be established . since the morbid states of apathy and anhedonia are complicated , these symptoms are often difficult to diagnose . several therapeutic methods for apathy and anhedonia are considered effective . similar to depression , apathy and anhedonia clearly affect the quality of life of patients and their families . therefore , accurate diagnoses of morbid states in the early stage of the disease and corresponding appropriate treatments are more important than ever . | depression , apathy , and anhedonia are often comorbid in patients with parkinson 's disease .
since the morbid states of apathy and anhedonia are complicated , these symptoms are often difficult to diagnose . several therapeutic methods for apathy and anhedonia are considered effective .
however , the validity of these methods has not been established .
similar to depression , apathy and anhedonia clearly affect the quality of life of patients and their families .
therefore , accurate diagnoses of morbid states in the early stage of the disease and corresponding appropriate treatments should be given high priority . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
allergen immunotherapy ( ait ) is based on administration of increasing doses of the causal allergen to reduce clinical reactivity in allergic patients , and therefore is the only treatment targeting the cause and not merely the symptoms of respiratory allergy.1 the outcome is achieved via the immunologic mechanism of action of ait , that mostly consists of restoring a th1-dominant t - cell response and generating specific t - suppressor cells.2 these effects are clinically expressed by tolerance to the administered allergen , resulting , as far as respiratory allergy is concerned , in a decreased burden of rhinitis and asthma.3 ait may be administered via the injected route ( subcutaneous immunotherapy , scit ) or the sublingual route ( sublingual immunotherapy , slit ) . the efficacy of slit in allergic rhinitis and asthma is demonstrated by a number of meta - analyses,410 including subpopulations such as children,5,7 patients specifically evaluated for asthma,6 and patients treated with particular allergens such as the house dust mite9 or grass pollen.10 another important subpopulation is represented by patients inadequately controlled on drug treatment , who have severe symptoms during the pollen season and consequently a high burden of disease and high economic costs.11 frew et al were the first to show that one season of scit was significantly more effective than placebo with regard to symptoms and medication scores in patients with grass pollen - induced rhinoconjunctivitis who had had an unsatisfactory response to standard drug treatment.12 in their study , two maintenance doses of 10,000 and 100,000 standardized quality ( sq ) units were used , with higher efficacy but also lower tolerability using the higher dose . it is well known that slit is significantly better tolerated than scit , but no trials are available showing that slit is effective in patients not adequately controlled by drugs . a recent post hoc analysis of published studies using 5-grass pollen tablets showed that better clinical efficacy was achieved by immunotherapy in patients with more severe allergic rhinitis , although it was not reported if these patients were unresponsive to drugs.13 in a real - life study , we evaluated the efficacy of slit using 5-grass pollen tablets in patients poorly responsive to drug treatment . seven allergy centers in italy , namely niguarda hospital ( milan ) , san marco general hospital ( bergamo ) , treviglio hospital ( bergamo ) , italian institute for auxology ( milan ) , maggiore general hospital ( milan ) , riuniti hospital ( bergamo ) , and legnano hospital ( milan ) participated in this study . male and female subjects aged 1245 years with seasonal allergic rhinitis were included . for inclusion , patients had to have had symptoms of rhinitis during the grass pollen season ( from mid april to end of june ) for at least 2 consecutive years , an unsatisfactory response to drug treatment in the previous season , as assessed by the patients themselves using a specific questionnaire , and a positive skin prick test with grass pollen extracts . allergic rhinitis was classified according to allergic rhinitis and its impact on asthma ( aria ) guidelines.3 the main exclusion criteria were allergic rhinoconjunctivitis caused by cosensitization and likely to influence symptoms during the study , previous ait , and the usual contraindications to ait.14 this multicenter observational study , known as ors ( oralair rhinitis solution , stallergenes , antony , france ) was conducted in two phases : at the end of the 2010 pollen season , the investigators identified patients with allergic rhinitis unresponsive to drug therapy ( retrospective phase ) ; and during the 2011 pollen season collected clinical data from these patients , who were treated preseasonally and coseasonally with 5-grass pollen tablets ( prospective phase ) . medication scores in the two seasons were calculated by attributing a score of 3 to topical steroids , a score of 2 to oral antihistamines or antileukotrienes , and a score of 1 to topical antihistamines or nasal decongestants . the primary objective of the study was to investigate the effectiveness of first - year slit treatment in patients with allergic rhinitis unresponsive to drug treatment . the secondary objectives were to assess use of rescue medication , the presence of comorbidities , and patient satisfaction , measured using a visual analog scale that has been proven to be a valid tool in evaluating allergic rhinitis,15 in particular for patient satisfaction.16 using the visual analog scale , patients assessed their level of satisfaction by indicating a position along a continuous line between two points from 0 ( very dissatisfied ) to 10 ( very satisfied ) . for data collection , we used a paper case report form recording the aria classification of allergic rhinitis,3 onset of symptoms , clinically relevant allergen(s ) , comorbidities , response to therapy , and patient satisfaction . written informed consent was obtained before entering the study , and in the case of minors was obtained from next of kin , caregivers , or guardians . the ethics committees at each of the participating sites approved the study , ie , the ethics committees of niguarda hospital ( milan ) , san marco general hospital ( bergamo ) , treviglio hospital ( bergamo ) , italian institute for auxology ( milan ) , maggiore general hospital ( milan ) , riuniti hospital ( bergamo ) , and legnano hospital ( milan ) . slit was performed using a preparation of 5-grass pollen in tablets ( oralair ; stallergenes s.a . , antony , france ) , the characteristics of which have already been reported.17 briefly , the preparation contains a mixture of phleum pratense , dactylis glomerata , anthoxanthum odoratum , lolium perenne , and poa pratensis , covering the immunoglobulin e sensitization profiles of grass - allergic patients in the mediterranean area.18 each tablet was taken sublingually once daily in the morning before breakfast and was kept under the tongue until complete dissolution before swallowing . it was administered according to a pre - coseasonal schedule of slit , ie , started 4 months before the expected start of the grass pollen season and stopped at the end of the pollen season , for an overall duration of 6 months . any local or systemic adverse effects of slit were to be recorded by the patients . a central organization ( ibis informatica , milan , italy ) undertook the data entry and statistical analysis . mcnemar s test was used to compare the two pollen seasons ( 2010 versus 2011 ) . continuous parameters were reported as the frequency , mean , standard deviation , median , first and third quartile , and minimum and maximum . comparison of the two pollen seasons was performed using the student s t - test for paired data , and the difference between seasons was reported with the related 95% confidence interval . statistical analysis was carried out using bmdp dynamic 2009 version 8.2 software ( bmdp statistical software , inc . seven allergy centers in italy , namely niguarda hospital ( milan ) , san marco general hospital ( bergamo ) , treviglio hospital ( bergamo ) , italian institute for auxology ( milan ) , maggiore general hospital ( milan ) , riuniti hospital ( bergamo ) , and legnano hospital ( milan ) participated in this study . male and female subjects aged 1245 years with seasonal allergic rhinitis were included . for inclusion , patients had to have had symptoms of rhinitis during the grass pollen season ( from mid april to end of june ) for at least 2 consecutive years , an unsatisfactory response to drug treatment in the previous season , as assessed by the patients themselves using a specific questionnaire , and a positive skin prick test with grass pollen extracts . allergic rhinitis was classified according to allergic rhinitis and its impact on asthma ( aria ) guidelines.3 the main exclusion criteria were allergic rhinoconjunctivitis caused by cosensitization and likely to influence symptoms during the study , previous ait , and the usual contraindications to ait.14 this multicenter observational study , known as ors ( oralair rhinitis solution , stallergenes , antony , france ) was conducted in two phases : at the end of the 2010 pollen season , the investigators identified patients with allergic rhinitis unresponsive to drug therapy ( retrospective phase ) ; and during the 2011 pollen season collected clinical data from these patients , who were treated preseasonally and coseasonally with 5-grass pollen tablets ( prospective phase ) . medication scores in the two seasons were calculated by attributing a score of 3 to topical steroids , a score of 2 to oral antihistamines or antileukotrienes , and a score of 1 to topical antihistamines or nasal decongestants . the primary objective of the study was to investigate the effectiveness of first - year slit treatment in patients with allergic rhinitis unresponsive to drug treatment . the secondary objectives were to assess use of rescue medication , the presence of comorbidities , and patient satisfaction , measured using a visual analog scale that has been proven to be a valid tool in evaluating allergic rhinitis,15 in particular for patient satisfaction.16 using the visual analog scale , patients assessed their level of satisfaction by indicating a position along a continuous line between two points from 0 ( very dissatisfied ) to 10 ( very satisfied ) . for data collection , we used a paper case report form recording the aria classification of allergic rhinitis,3 onset of symptoms , clinically relevant allergen(s ) , comorbidities , response to therapy , and patient satisfaction . written informed consent was obtained before entering the study , and in the case of minors was obtained from next of kin , caregivers , or guardians . the ethics committees at each of the participating sites approved the study , ie , the ethics committees of niguarda hospital ( milan ) , san marco general hospital ( bergamo ) , treviglio hospital ( bergamo ) , italian institute for auxology ( milan ) , maggiore general hospital ( milan ) , riuniti hospital ( bergamo ) , and legnano hospital ( milan ) . slit was performed using a preparation of 5-grass pollen in tablets ( oralair ; stallergenes s.a . , antony , france ) , the characteristics of which have already been reported.17 briefly , the preparation contains a mixture of phleum pratense , dactylis glomerata , anthoxanthum odoratum , lolium perenne , and poa pratensis , covering the immunoglobulin e sensitization profiles of grass - allergic patients in the mediterranean area.18 each tablet was taken sublingually once daily in the morning before breakfast and was kept under the tongue until complete dissolution before swallowing . it was administered according to a pre - coseasonal schedule of slit , ie , started 4 months before the expected start of the grass pollen season and stopped at the end of the pollen season , for an overall duration of 6 months . any local or systemic adverse effects of slit were to be recorded by the patients . a central organization ( ibis informatica , milan , italy ) undertook the data entry and statistical analysis . mcnemar s test was used to compare the two pollen seasons ( 2010 versus 2011 ) . continuous parameters were reported as the frequency , mean , standard deviation , median , first and third quartile , and minimum and maximum . comparison of the two pollen seasons was performed using the student s t - test for paired data , and the difference between seasons was reported with the related 95% confidence interval . statistical analysis was carried out using bmdp dynamic 2009 version 8.2 software ( bmdp statistical software , inc . , forty - seven patients of mean age 25.7 years were included in the study , comprising 23 males and 24 females , with 38 adults and nine adolescents . allergic rhinitis had been present for 128.5 years in the adults and for 5.54.2 years in the adolescents . of the 47 patients , at inclusion in 2010 , none ( 0% ) reported mild intermittent allergic rhinitis , three ( 6.4% ) had moderate to severe intermittent allergic rhinitis , ten ( 21.3% ) had mild persistent allergic rhinitis , and 34 ( 72.3% ) had moderate to severe persistent allergic rhinitis . the response to symptomatic treatment was judged as poor by 33 patients ( 70.2% ) and very poor by 14 patients ( 29.8% ) . during the 2011 grass pollen season , after treatment with 5-grass pollen tablets , 33 patients ( 79.2% ) reported mild intermittent allergic rhinitis , none ( 0% ) had moderate to severe intermittent allergic rhinitis , seven ( 14.9% ) had mild persistent allergic rhinitis , and seven ( 14.9% ) had moderate to severe persistent allergic rhinitis . comparing the two seasons , 31 patients classified as having mild or moderate to severe persistent disease when treated with symptomatic drugs changed to mild intermittent allergic rhinitis when treated with 5-grass pollen tablets ( p<0.01 ) . all patients were sensitized to grass pollen . among the adolescents , six were monosensitized and three were also sensitized to the house dust mite . adults showed a number of other sensitizations , ie , house dust mite in 11 patients , olive pollen in seven , birch pollen in six , cypress pollen in four , parietaria pollen in four , and ragweed pollen in three patients . table 1 shows the comorbidities reported by patients , the most common being conjunctivitis and asthma . the mean medication score changed from 4.21.3 before to 2.42.0 after slit ( p<0.01 ) , representing a decrease of 42% ( figure 2 ) . in particular , a significant decrease was found in the use of oral antihistamines ( 46.8% ) and nasal decongestants ( 21.3% ) . also , concerning the consumption of drugs for asthma , a decrease , albeit not significant , was found , corresponding to 6.4% for both 2-agonists and inhaled corticosteroids . the mean visual analog score for patient satisfaction increased from 31.3 before to 8.71.3 after slit , indicating a significant improvement ( p<0.01 , figure 3 ) . a definition of severe chronic upper airway disease has been introduced to identify those patients whose symptoms are inadequately controlled despite adequate pharmacologic treatment based on guidelines , and thus have impaired quality of life , social functioning , sleep , and school / work performance.19 a recent reappraisal of the current status of knowledge on severe chronic upper airway disease listed a need for defining success of medical treatment including immunotherapy in terms of control in allergic rhinitis.20 however , thus far , only one study has addressed this issue . in a large study of patients with grass pollen - induced allergic rhinitis not controlled by standard drug treatment , 203 were randomized to maintenance with 100,000 sq units , 104 to 10,000 sq units , and 103 to placebo , with both active treatments being significantly more efficacious than placebo . the 100,000 sq unit regimen was more effective , but the 10,000 sq unit regimen caused fewer side effects.12 it is surprising that no other study has been done in this area , either with scit or slit , that has the advantage of being much better tolerated.21 in addition , slit meets the requirements for use as treatment for pollen - allergic patients because it has the highest evidence of efficacy as demonstrated by meta - analyses48,10 and offers benefit over scit in terms of compliance and pharmacoeconomic aspects.22 in a real - life study , we sought to assess the effectiveness of slit in the form of the 5-grass pollen preparation in drug - resistant patients , given that this therapy has already been demonstrated to be effective and safe in both adults17 and children.23 the 5-grass pollen tablets were prescribed after a pollen season in which standard drug treatment , ie , antihistamines , nasal corticosteroids , and nasal decongestants , had been ineffective . following 5-grass pollen therapy , the clinical stage of allergic rhinitis , as defined by aria classification , was overturned . the number of patients with mild intermittent allergic rhinitis increased from 0 to 33 , while the number of patients with moderate to severe persistent allergic rhinitis decreased from 34 to 7 , ie , the severity of symptoms was reversed . this finding indicates that 5-grass pollen tablets are able to achieve clinical control of allergic rhinitis in patients unresponsive to drugs , as previously demonstrated for scit.12 asthma was not a major issue for our patients , but a decrease in use of bronchodilators and inhaled corticosteroids was found with slit . this is not unexpected , given the strong relationship between allergic rhinitis and asthma.3 as far as factors related to failure of antiallergic drugs are concerned , a recent paper on severe chronic upper airway disease suggested a number of disease - related , patient - related , and treatment - related factors.20 among them , comorbidities , such as chronic sinusitis , and adherence to medical treatment seem particularly important . we can exclude a role for comorbidity in our population , because no patient reported sinusitis . on the other hand , it is well known that adherence is a major problem in treating allergic rhinitis.24,25 the patients in our study reported having been adherent with their prescribed drug treatment , but no stringent method of control , such as counting the assumed drug doses or frequent phone calls , was used . in any case , it is unlikely that patients with symptoms unresponsive to drugs , ie , the type of population we targeted , use less than the optimal dose recommended by their physicians . in fact , in a recent italian survey of 1,379 patients with allergic rhinitis undertaken by 107 general practitioners , adherence with aria guidelines was evaluated according to severity classification , and adherence was observed to increase according to the severity of the condition . in particular , adherence was satisfactory in patients with moderate to severe persistent allergic rhinitis , with a rate of 89% for those with allergic rhinitis alone and 95% for those with allergic rhinitis and asthma . the authors concluded that adherence to aria guidelines is satisfactory only in patients with more severe disease.26 it is of particular interest to focus on the relevance of drug resistance in patients with allergic rhinitis . to the best of our knowledge , only one study that included an epidemiologic assessment is available , and showed that 111 ( 13.9% ) of 796 patients had uncontrolled allergic rhinitis after treatment . the evaluation included a number of parameters , including total symptom scores for rhinitis , a visual analog scale , the rhinoconjunctivitis quality of life questionnaire , and the allergy - specific work productivity and impairment questionnaire . a cluster - randomized trial model was used to mimic real life , with no exclusion of patients at randomization , so as to include the broad range of patients regularly seen by physicians.27 concerning patient satisfaction with treatment , it is reasonable to assume that this is related to clinical outcome . recent studies have investigated patient satisfaction with treatment for allergic rhinitis and allergic asthma . in a survey conducted in 21 allergy centers in italy , only 33.5% of patients with allergic rhinitis and 40.7% of patients with asthma were satisfied with their symptomatic treatment . the main factors associated with treatment dissatisfaction were female gender , comorbidity , and the severity of symptoms of allergic rhinitis and asthma.28 similar results were reported in a survey of more than 5,000 patients in europe , with one third being dissatisfied with the treatment prescribed.29 in our study , all patients were dissatisfied with their medical treatment because nonresponsiveness to drugs was an inclusion criterion . however , the level of satisfaction , as measured by the visual analog scale , was very low with drugs but increased significantly with slit . in the present real - life study , we found that most patients with grass pollen - induced allergic rhinitis who did not respond to drug treatment achieved control of their allergic rhinitis using pre - coseasonal treatment with 5-grass pollen tablets during a one - year period . this finding now needs to be confirmed by randomized controlled trials targeting this important subpopulation of patients with allergic rhinitis . | backgroundan important subpopulation in allergic rhinitis is represented by patients with severe form of disease that is not responsive to drug treatment .
it has been reported that grass pollen subcutaneous immunotherapy is effective in drug - resistant patients . in a real - life study
, we evaluated the efficacy of 5-grass pollen tablets in patients with grass pollen - induced allergic rhinitis not responsive to drug therapy.methodswe carried out this multicenter observational study in adults and adolescents with grass - induced allergic rhinitis not responsive to drug therapy who were treated for a year with 5-grass pollen tablets .
clinical data collected before and after sublingual immunotherapy ( slit ) included allergic rhinitis and its impact on asthma ( aria ) classification of allergic rhinitis , response to therapy , and patient satisfaction.resultsforty-seven patients entered the study . by aria classification , three patients had moderate to severe intermittent allergic rhinitis , ten had mild persistent allergic rhinitis , and 34 had moderate to severe persistent allergic rhinitis .
there were no cases of mild intermittent allergic rhinitis before slit .
after slit , 33 patients had mild intermittent allergic rhinitis , none had moderate to severe intermittent allergic rhinitis , seven had mild persistent allergic rhinitis , and seven had moderate to severe persistent allergic rhinitis .
the mean medication score decreased from 4.21.3 before to 2.42.0 after slit ( p<0.01 ) , representing a reduction of 42% .
the response to treatment before slit was judged as poor by 70% of patients and very poor by 30% .
patient satisfaction was significantly increased after slit ( p<0.01).conclusionin real life , most patients with grass pollen - induced allergic rhinitis not responsive to drug treatment can achieve control of the condition with one season of treatment using 5-grass pollen tablets . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the generic name xanthoriicola was introduced for the species x. physciae ( hawksworth & punithalingam 1973 ) . this fungus appears to be obligately lichenicolous on xanthoria parietina in europe , and is also reported from africa and asia ( siefert et al . the fungus primarily occurs in the apothecia , growing through the hymenium , with broad cupulate enteroblastic conidiogenous cells generating conidia at the surface ( fig . 1 ) . the conidia are dark brown , spherical , single - celled , and have a coarse , warted surface ornamentation . this fungus was illustrated by line drawings in hawksworth & punithalingam ( 1973 ) , and photomicrographs and scanning electron micrographs are presented in hawksworth ( 1979 ) . the surfaces of infected apothecia become sooty black and so are easily seen in the field . whole swards of the host lichen are rarely affected , so while deleterious to the host it does not destroy their populations . it has not been reported as growing in isolated culture , and experiments to inoculate fresh specimens of the host have proven unsuccessful ( t.f . data ) . furthermore , no sexual state has been discovered or postulated by association with other fungi that occur on the same host lichen . the fungus is particularly unusual in that the conidia are formed semi - endogenously , that is within the lower part of the collarette of the conidiogenous cells . this is a rare situation in hyphomycetous conidial fungi , and is otherwise seen only in craspedodidymum , cystodendron , lambinonia , metacapnodium , and some groups of phialophora s. lat . in addition , some studies by raman spectroscopy suggested that xanthoriicola physciae might form scytonemin , a protective pigment only otherwise known in cyanobacteria ( preece 2009 ) although that report now seems likely to have been a result of contamination from cyanobacteria growing on the surface of the hymenium . xanthoriicola physciae consequently appeared , on morphological grounds to occupy an isolated position amongst the conidial fungi . in addition to the xanthoriicola specimens sequenced , 48 specimens of dothideomycetes were included in the molecular study ( figs 23 ) . the sampling was selected to include taxa that were close to our new sequences in genbank , i.e. mainly conidial members of the teratosphaeriaceae , together with other representatives of capnodiales and dothideales . voucher information , and genbank accession numbers of newly sequenced taxa are provided in table 1 . fungi growing in the host apothecia were carefully excised with the point of a sterile scalpel blade to minimize as much as possible the obtaining of host tissue . total dna was extracted using the qiagen dneasy plant minikit , according to the manufacturer s instructions . a fragment of ca . 1000 bp in the nlsu was amplified using the primers lr0r ( r vilgalys , www.biology.duke.edu/fungi/mycolab/primers.htm ) , lr5 ( vilgalys & hester 1990 ) , and also ones specifically designed in our laboratory to selectively amplify the dna of xanthoriicola physciae , avoiding that of the host . the primers we designed were : x158f ( 5-gagaggatgcttctgggca-3 ) and x756r ( 5-ccgaagctcccacctccgtt-3 ) . primer combinations used were lr0r / lr5 , lr0r/ x756r , and x158f / lr5pcr . pcr amplifications were performed using illustra hot start pcr beads , according to the manufacturer s instructions , and using the settings in hawksworth et al . , the pcr products were purified using the viogene pcr - m clean - up system or the enzymatic method exo - sap - it. sequences were aligned using mafft v. 6.611 ( katoh et al . 2002 , katoh & toh 2008 ) using the procedures described in wedin et al . the ambiguous regions in the alignment were identified and eliminated using gblocks v. 0.91b ( castresana 2000 ) . maximum parsimony and parsimony bootstrap analyses were performed using paup v. 4.0b10 ( swofford 2003 ) with the following settings : gaps were treated as missing data , 1 000 random addition sequence replicates , tbr branch swapping , steepest descent off , collapse branches if minimum length is 0 , multrees on , and with 1000 trees allowed to be saved in each replicate . for the bootstrap analyses ( felsenstein 1985 ) we used : heuristic search settings identical with the above analysis , but with ten random addition replicates , 1000 bootstrap replicates , a full heuristic search , and retained groups with a frequency > 50 % . maximum likelihood analyses ( ml ) were achieved using the program garli v. 0.951 ( zwickl 2006 ) . improvement values were set to 0.01 with a total improvement lower than 0.05 compared to the last topology recovered . bootstrap support was assessed using 1 000 tree replicates under the same parameters as above . ( 2001 ) to analyse the data by markov chain monte carlo ( mcmc ) sampling as implemented in the software mrbayes v. 3.1.2 ( huelsenbeck & ronquist 2001 ) . likelihood models were selected for each of the three gene regions using the akaike information criterion ( aic ) and the bayesian information criterion ( bic ) as implemented in jmodeltest ( posada 2008 ) . we used full likelihood optimization and selected from among only the 24 models implemented in mrbayes . following this scheme , bayesian prior distributions included treating all tree topologies as equally likely , a uniform ( 0 , 50 ) distribution for the gamma shape parameter , a uniform ( 0 , 1 ) distribution for the proportion of invariable sites , and a flat ( 1 , 1 , 1 , 1 , 1 , 1 ) dirichlet for the rate matrix . two parallel runs were performed , each with five chains , four of which were incrementally heated with a temperature of 0.15 . the analysis was diagnosed for convergence every 100 000 generations , measured as the average standard deviation of splits across runs in the last half of the analysis . every 100 tree was saved , and the first half of the run was discarded as burn - in . in addition to the xanthoriicola specimens sequenced , 48 specimens of dothideomycetes were included in the molecular study ( figs 23 ) . the sampling was selected to include taxa that were close to our new sequences in genbank , i.e. mainly conidial members of the teratosphaeriaceae , together with other representatives of capnodiales and dothideales . voucher information , and genbank accession numbers of newly sequenced taxa are provided in table 1 . fungi growing in the host apothecia were carefully excised with the point of a sterile scalpel blade to minimize as much as possible the obtaining of host tissue . total dna was extracted using the qiagen dneasy plant minikit , according to the manufacturer s instructions . bp in the nlsu was amplified using the primers lr0r ( r vilgalys , www.biology.duke.edu/fungi/mycolab/primers.htm ) , lr5 ( vilgalys & hester 1990 ) , and also ones specifically designed in our laboratory to selectively amplify the dna of xanthoriicola physciae , avoiding that of the host . the primers we designed were : x158f ( 5-gagaggatgcttctgggca-3 ) and x756r ( 5-ccgaagctcccacctccgtt-3 ) . primer combinations used were lr0r / lr5 , lr0r/ x756r , and x158f / lr5pcr . pcr amplifications were performed using illustra hot start pcr beads , according to the manufacturer s instructions , and using the settings in hawksworth et al . , the pcr products were purified using the viogene pcr - m clean - up system or the enzymatic method exo - sap - it. 2002 , katoh & toh 2008 ) using the procedures described in wedin et al . the ambiguous regions in the alignment were identified and eliminated using gblocks v. 0.91b ( castresana 2000 ) . maximum parsimony and parsimony bootstrap analyses were performed using paup v. 4.0b10 ( swofford 2003 ) with the following settings : gaps were treated as missing data , 1 000 random addition sequence replicates , tbr branch swapping , steepest descent off , collapse branches if minimum length is 0 , multrees on , and with 1000 trees allowed to be saved in each replicate . for the bootstrap analyses ( felsenstein 1985 ) we used : heuristic search settings identical with the above analysis , but with ten random addition replicates , 1000 bootstrap replicates , a full heuristic search , and retained groups with a frequency > 50 % . maximum likelihood analyses ( ml ) were achieved using the program garli v. 0.951 ( zwickl 2006 ) . improvement values were set to 0.01 with a total improvement lower than 0.05 compared to the last topology recovered . bootstrap support was assessed using 1 000 tree replicates under the same parameters as above . ( 2001 ) to analyse the data by markov chain monte carlo ( mcmc ) sampling as implemented in the software mrbayes v. 3.1.2 ( huelsenbeck & ronquist 2001 ) . likelihood models were selected for each of the three gene regions using the akaike information criterion ( aic ) and the bayesian information criterion ( bic ) as implemented in jmodeltest ( posada 2008 ) . we used full likelihood optimization and selected from among only the 24 models implemented in mrbayes . following this scheme , bayesian prior distributions included treating all tree topologies as equally likely , a uniform ( 0 , 50 ) distribution for the gamma shape parameter , a uniform ( 0 , 1 ) distribution for the proportion of invariable sites , and a flat ( 1 , 1 , 1 , 1 , 1 , 1 ) dirichlet for the rate matrix . two parallel runs were performed , each with five chains , four of which were incrementally heated with a temperature of 0.15 . the analysis was diagnosed for convergence every 100 000 generations , measured as the average standard deviation of splits across runs in the last half of the analysis . every 100 tree was saved , and the first half of the run was discarded as burn - in . we generated 11 new nlsu rdna sequences ( table 1 ) , which were aligned together with sequences already available in genbank . the matrix contained 775 characters from which 167 unambiguously aligned parsimony informative sites were used in the parsimony analysis . our maximum parsimony analysis resulted in 725 000 most parsimonious trees of 644 steps , with ci = 0.393 and ri = 0.692 . the bayesian analysis halted after 4 800 000 generations , when the average standard deviation of split frequencies across runs was then lower than 0.01 (= 0.0096 ) . we considered the two runs to have converged and a majority rule consensus tree was constructed from the 48 000 trees of the stationary tree sample . the 11 specimens of xanthoriicola physciae formed a single clade supported both by parsimony bootstrap ( 91 % ) , ml bootstrap ( 100 % ) , and bayesian posterior probabilities ( 1.0 ) ( figs 23 ) . some incongruence was found between the results of parsimony analysis and the two other analysis methods used , and therefore two topologies are shown . 2 . since no conflicts were found between the bayesian and the ml topologies , only the bayesian reconstruction is shown in fig . when the maximum parsimony method was used , piedraia species appeared as the closest relatives of xathoriicola , together forming a clade with 81 % bootstrap support ( fig . 2 ) . however , the bayesian and maximum likelihood methods both recovered friedmanniomyces as the sister group of xanthoriicola , although only with strong phylogenetic support by the bayesian method ( bayesian posterior probability = 0.99 ; fig . are included in a more inclusive monophyletic group together with elasticomyces elasticus , recurvomyces mirabilis , teratosphaeria jonkershekensis , and diverse unnamed rock inhabiting fungi ( bayesian posterior probability = 1.0 ) . the systematic placement of the monotypic lichenicolous genus xanthoriicola has remained obscure in the absence of any known sexual stage . both the analyses we undertook place it in the same general area of the fungal phylogenetic tree , but with some differences as to the taxa revealed as the closest known relatives . in the maximum parsimony tree ( fig . piedraia comprises two known species both of which form minute ascomata on hair ; p. hortae on human hair ( black piedra ) and p. quintanilhae on that of chimpanzees . the ascomata occur as black nodules on the hair , and have vermiform single - celled ascospores ; the ascospores have whip - like extensions at both ends in p. hortae , but such extensions are absent in those of p. quintanilhae . no asexual state is known , and reports of one in trichosporon are attributable to mixed infections . excellent illustrations of p. hortae , and references to key literature , are provided by de hoog et al . sister to the piedraia / xanthoriicola clade in this analysis , but without bootstrap support , are two species of the hyphomycete genus friedmanniomyces , which has no known sexual state . 3 ) it is the friedmanniomyces species that appear as the sister group , with high support for the clade ( 0.99 ) , the relationship to the piedraia species being unresolved . this leads us to suspect that the relationship between xanthoriicola and piedraia , observed in the parsimony analyses , could be due to a long - branch attraction effect . friedmanniomyces endolithicus is found growing intermixed with cryptoendolithic lichen hyphae in the surface layers of sandstones in antarctica . it has pale brown hyphae which give rise to chains of schizolytically produced doliiform conidia which are brown , 0(3)-septate , and have truncated ends , and also forms multicellular balls of thick - walled brown cells ( seifert et al . 2011 : pl 2d ) . in f. simplex , which occurs in similar situations , the conidia are darker brown , 1(2)-celled , generally more elongated , with peculiar and often terminal chlamydospore - like cells , but no multicellular conidial balls . both species grow in pure culture , and are described in detail by selbmann et al . fungi in the clade labelled b in the bayesian tree , with 1.0 support ( fig . recurvomyces mirabilis which was also isolated from sandstone in antarctica ( selbmann et al . 2008 ) , but unlike the friedmanniomyces species produces 01-septate , subhyaline to yellowish brown , thin - walled , elongate - ellipsoid conidia forming enteroblastically from the eponymous conidiophores which are characteristically often bent back towards the hyphae on which they arise . elasticomyces elasticus was originally isolated from thalli of usnea antarctica in antarctica ( selbmann et al . 2008 ) , but has since been found obtained from rock surfaces in the alps , andes , and himalayas ( selbmann , pers . the pale to dark brown conidia are produced as arthrospores from long hyphae , the apices of which can continue to grow while the distal regions break up into 1-septate to multiseptate fragments ; the conidium walls can be smooth or somewhat rough . superb illustrations of this fungus and of recurvomyces mirabilis are provided by selbmann et al . 3 ) are teratosphaeria jonkershoekensis , in which no conidial state is known , and numerous unnamed sequences , apparently all derived from cultures or sequences obtained from rocks ; rock - inhabiting fungi ( rif ) . of especial interest because of its sister group position to the friedmanniomyces / xanthoriicola clade is ccfee5499 . that fungus was isolated from rock surfaces in the alps and presents as a non - sporulating , dark , felty on the surface , crustose mycelium , with a morphology characteristic of rif ; its analyses show it to be distinct from f. endolithicus but it does fall in a separate group of fungi all isolated from rock surfaces ( selbmann , pers . comm . ) . a ( with 1.0 bootstrap support ) , which includes piedraia and the friedmanniomyces / xanthoriicola clade , also comprises the clinically important black yeast hortaea werneckii ( responsible for tinea nigra on human hands or more rarely feet ; de hoog et al . teratosphaeria had been synonymized with mycosphaerella , but , was resurrected by crous et al . ( 2007 ) and placed in the new family teratosphaeriaceae , a sister family to mycosphaerellaceae . the type species , t. fibrillosa , has a superficial stroma linking the ascomata ( not seen in most other species ) , ascospores becoming brown and verruculose while in the ascus and with a mucous sheath , a multilayered endotunica in the ascus , pseudoparaphysoidal remnants disappearing with age , and ostiolar periphyses present in some other species . around 60 species are now recognised , but some have no known anamorphs , and some no known teleomorph . we note that two sterile filamentous lichens , cystocoleus and racodium , also proved to have affinities with hortaea werneckii ( muggia et al . ( 2009 ) found that cystocoleus fell into the teratosphaeriaceae clade , while racodium was more basal and incertae sedis . lsu sequences for these genera were included in the preliminary analyses to look for a possible relation to xanthoriicola , but both grouped with sequences of the capnodiales acting as an outgroup and so were not included in the final analyses . however , it is nevertheless interesting to note that these lichenized fungi have some phylogenetic relationship to fungi able to colonise lichen and plant tissues , and rock surfaces . all these are under extreme environmental conditions of dryness , large temperature fluctuations , solar radiation , and nutrient shortage . we conclude that xanthoriicola should , on the basis of the lsu analyses carried out here , be most appropriately referred to the same family as piedraia and teratosphaeria in capnodiales . this clade has strong support in both the maximum parsimony ( 93 % ) and bayesian ( 1.0 ) analyses . we note that piedrariaceae ( barr 1979 ) is an earlier family name than teratosphaeriaceae ( crous et al . 2007 ) , but we do not take that up here as we consider that the affinity with piedraria may be accentuated by long - branch attraction , and also that much more taxon - sampling in this part of the fungal tree of life is necessary to be confident about familial circumscriptions . this study shows that technical advances can facilitate progress in the resolution of systematic placements for lichenicolous fungi with no sexual state and currently of uncertain position , and also that an understanding of the relationships of these taxa has implications for phylogenetic reconstructions in the dothideomycetes . further , molecular phylogenetics , using dna from specimens , has the power to resolve problematic generic and species concepts in lichenicolous fungi . | the phylogenetic placement of the monotypic dematiaceous hyphomycete genus xanthoriicola was investigated .
sequences of the nlsu region were obtained from 11 specimens of x. physciae , which formed a single clade supported both by parsimony ( 91 % ) , and maximum likelihood ( 100 % ) bootstraps , and bayesian posterior probabilities ( 1.0 ) .
the closest relatives in the parsimony analysis were species of piedraria , while in the bayesian analysis they were those of friedmanniomyces .
these three genera , along with species of elasticomyces , recurvomyces , teratosphaeria , and sequences from unnamed rock - inhabiting fungi ( rif ) , were all members of the same major clade within capnodiales with strong support in both analyses , and for which the family name teratosphaeriaceae can be used pending further studies on additional taxa . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
methane production during anaerobic fermentation of nutrients in the rumen is an essential metabolic but nutritionally wasteful process which represents 2 to 15% of gross energy loss [ 1 , 2 ] . livestock contributes 1218% to the global anthropogenic greenhouse gas emissions depending upon emission attributes [ 3 , 4 ] and accounts for about 37% of the total anthropogenic methane . therefore , reducing methane production is an important goal of ruminant nutritionists not only for reducing greenhouse gases and global warming but also for improving the efficiency of animal production . recently , researchers have emphasized on the reduction of methane emission by using ionophores , organic acids , fatty acids , plant extracts , and halogenated methane analogues could be used to decrease ruminal methane production [ 512 ] . plant secondary metabolites , that is , saponins , tannins , and essential oils have also been widely studied for their beneficial effect on ruminants and several workers reported that saponins and plants rich in saponins decreased the methane production in the rumen [ 11 , 1315 ] . hence , the present investigation was carried out to assess the effect of gross as well as pure saponins fraction of albizia lebbeck on antimicrobial potential on selected bacterial and fungal pathogens , rumen fermentation characteristic , and antimethanogenesis . seeds of albizia lebbeck were collected from the campus of national dairy research institute , karnal , india . seeds were washed with distilled water , dried at 50c in hot air oven for 24 h , then ground in hammer mill to pass through 1 mm sieve . seed powder was defatted in petroleum ether ( boiling range 4060c ) refluxing for 6 h in a soxhlet 's apparatus at 45c . the contents were filtered and 25 g fat - free sample was diluted with absolute methanol taken in 1 : 10 ratio . the contents were shaken at 25c and 120 rpm for 24 h followed by centrifuge for 20 min at 3500 rpm for 20 min . methanol extract was filtered through whatman filter paper number 1 and dried under rotary evaporator . dried methanolic plant extract was dissolved in distilled water ( 10 ml ) , transferred in to a separating funnel , and extracted with equal volume of n - butanol ( 3 times ) . dried saponins content was dissolved 510 ml of distilled water freeze dried resulting in a yellowish amorphous powder designated gross saponins extract ( gse ) . gse was fractionated by applying on silica gel ( mesh range 60120 ) column chromatography and eluted successfully with chcl3-meoh ( 9 : 1 ) to yield fraction a ; subsequent elution with chcl3-meoh - h2o ( 40 : 10 : 1 ) to give the fraction b. total saponins contents of a. lebbeck seeds were estimated by colorimetric methods . gross saponins extract ( 10 mg ) was dissolved in 5 ml of 80% aqueous methanol and 50 l of this solution was taken in different test tubes to which 0.25 ml of vanillin reagent ( 8% , w / v in 99.9% ethanol ) was added . test tubes were placed in ice - cold water bath and 2.5 ml of 72% ( v / v ) sulphuric acid was added slowly on the inner side of the wall . after mixing the content in each tube , then left as such for 3 min , then warmed the tubes at 60c for 10 min using water bath and cooled in ice - cold water bath . absorbance was measured at 544 nm using spectrophotometer against the reagent blank and standard curve was prepared . quillaja saponin ( sigma - aldrich ) was used as a reference standard and the concentration of total saponins was expressed as quillaja saponin equivalents ( qs g / mg extract ) . two gram - positive and two gram - negative bacteria and two fungi species were employed to determine the antimicrobial action of a. lebbeck seed powder extracted saponins . all microbial cultures were taken from national collection centre , dairy microbiology division , national dairy research institute , karnal , india , and microbial type culture collection , imtech , chandigarh , india . antibacterial and antifungal activities of the crude seed powder ( csp ) and gross saponins extract ( gse ) were tested using agar well diffusion method as described previously . nutrient agar / bhi agar was used for the determination of antibacterial and antifungal activities . the samples were tested at 25 , 50 , 100 , 250 , and 500 g concentrations of treatments . on agar plates test bacterial cultures ( 10 cfu / ml ) were spread with sterilized loop and incubated at 37c for 3 h. wells of 8 mm size were punched on plates using sterile borer . different dilutions of test samples were then added to the wells in approximately 100 l volume . following incubation for 2448 h at 37c , the sensitivity of the bacterial species to the saponins was determined by measuring the diameter of the zone of inhibition around the well . chloramphenicol ( 30 g / well ) and kanamycin sulphate ( 50 g / well ) were used as possible control for gram - positive bacteria and gram - negative bacteria , respectively . suspensions of fungal spores were prepared from 57 days old cultures that grew at 28c on a sda plates which were prepared by pour plating using fungal spores of a. niger as inoculums . an aliquot to this inoculum was introduced to molten sda and poured into petri dishes . c. wells of 8 diameters were punched and test samples were introduced at different concentration as described in the previous section . the antifungal activity was evaluated by measuring zones of inhibition of fungal growth surrounding the wells . each sample was assayed in triplicate and nystatin ( 50 g / well ) was used as positive control . the substrates used in incubation were prepared by taking different roughage and concentrate ratio , that is , high fiber diet ( d1 , 60r:40c ) , medium fiber diet ( d2 , 50r:50c ) , and low fiber diet ( d3 , 40r:60c ) and milled to pass through 1 mm sieve and used as substrate . the roughage part composed of wheat straw and the concentrate part composed of maize ( 33% ) , gnc ( 21% ) , mustard cake ( 12% ) , wheat bran ( 20% ) , deoiled rice bran ( 11% ) , mineral mixture ( 2% ) , and common salt ( 1% ) , respectively . all the treatments , that is , 6% ( dm basis ) of gross saponins extract ( gse ) and saponin fractions a and b were arranged in factorial randomized block design ( rbd ) with three replicates . sets were also incubated devoid of substrate with and without supplementation which served as blanks for particular treatment and values were corrected for different parameters with blanks . the experiment was conducted in 100 ml calibrated glass syringes containing 200 5 mg of substrates with 6% gse and 6% of saponins fraction a and b , respectively , and then 30 ml reduced buffer medium was anaerobically added to each syringe . syringes were incubated at 39c for 48 h in temperature - controlled water bath cum shaker . the rumen liquor was from a fistulated adult male buffalo ( bubalus bubalis ) maintained on a standard diet ( roughage : concentrate ; 60 : 40 ) 1 h before morning feed . strained rumen liquor was collected in sterile , prewarmed and pre - co2 flushed insulated thermos flask and brought to the laboratory immediately . all animal procedures were performed in accordance with the guidelines of institutional animal ethics committee of national dairy research institute , karnal ( india ) . after 48 h incubation , total gas ( tg ) was estimated by the extent of displacement of piston of glass syringes . tg produced due to fermentation of substrate was corrected by subtracting tg produced in blank syringe ( containing inoculum and buffer but not the substrate ) from total gas produced in the syringe containing substrate , inoculum , and buffer . methane concentration in representative gas samples was estimated by using gas chromatograph ( nucon-5765 , india ) equipped with flame ionization detector ( fid ) and stainless steel column packed with porapak - q ( length 6 ; o.d.1/8 the gas flow rates for nitrogen , hydrogen , and air were 30 , 30 , and 300 ml / min , respectively . temperature of injector oven , column oven , and detector were 40 , 50 , and 50c , respectively . ch4 in samples were calculated by external calibration , using a certified gas standard mixture of 50% ch4 and 50% co2 ( spantech , england ) . the true dm degradability of feed sample of each syringe containing residues after incubation was estimated as per method . the proximate analysis ( organic matter , crude protein , ether extract , and total ash ) of substrate was carried out as per the method . the cell wall constituents of substrates were determined according to described method . for determination of nh3-n , 5 ml of supernatant was taken in tube mixed with 12 ml 1n naoh and steam passed using kel plus - n analyzer ( pelican , india ) and the nh3 evolved was collected in conical flask containing boric acid solution having mixed indicator and titrated against n/100 h2so4 . for the estimation of individual volatile fatty acids , 4 ml of 25% metaphosphoric acid was added to 1 ml of incubation sample ; the mixture was mixed uniformly and left as such for 3 - 4 h at ambient temperature . thereafter , samples were centrifuged at 3000 rpm for 10 min and clear supernatant was stored at 20c until analyzed . the volatile fatty acids were analyzed by using gas liquid chromatography ( nucon-5765 , new delhi , india ) after some modification of the previously described method . the pf is calculated as the ratio of substrate truly degraded in vitro ( mg ) to the volume of gas ( ml ) produced by it . the mbm yield was calculated by using the degradability of substrate and gas volume and stoichiometrical factor as suggested :
( 1)microbial mass = substrate truly degraded (gas volume stoichiometrical factor ) ,
where the stoichiometrical factor used was 2.25 . content of the glass syringes containing d2 with treatment was shaken thoroughly and one ml samples was withdrawn at 48 h of the experiment . total genomic dna was extracted using genomic dna extraction kit ( fermentas , usa ) as per manufacturer 's instructions . dna concentrations were measured in nanoquant instrument ( tecan , usa ) . in order to minimize the variations , qrt - pcr was performed to quantify total rumen methanogens , methanomicrobiales , and protozoa . assays were performed in mj mini mini opticon real - time pcr system ( bio - rad , usa ) using sybr green jump start taq readymix ( sigma , usa ) . samples were assayed in 25 l reaction mixture containing 5 mm mgcl2 , sybr green master mix , 50 ng of template dna , and 0.5 m of each primer . the total gas production kinetics and cumulative methane gas production were carried out in d2 with different treatment combinations and incubated as per the procedure mentioned above for different intervals , that is , 0 , 1 , 2 , 3 , 6 , 9 , 12 , 24 , 36 , 48 , 60 , 72 , and 96 h. kinetics of gas production was calculated using a nonlinear model . the nlin procedure of sigma stat 3.11 was used to fit the following model : p = b , where p is the gas production rate at time t , b is the potential gas production ( ml ) , and c is gas production rate constant ( ml / h ) of b and t is the time of incubation ( h ) . the potential gas production and rate of gas production were calculated by fitting the modified equation . experimental data of different parameters were analyzed in randomized block design with three replicates for analysis of variance . the effects of gross saponins and different saponins fraction compared with controls were tested using the factorial arrangement in randomized block design in opstat ( http://14.139.232.166/opstat/index.asp ) statistical software developed by chaudhry charan singh , haryana agriculture university , hissar , haryana , india . the crude seed powder ( csp ) and gross saponins extract ( gse ) of a. lebbeck seed exhibited significant antimicrobial activities against bacterial and fungal cultures ( table 1 ) . the extent of inhibition was greater in the case of pure saponin fraction than crude saponins fractions . the results of present experiments indicated that the zones of inhibition for gram - negative and gram - positive bacteria were increased with increasing of concentration of treatments , that is , csp and gse . gram - negative bacteria e. coli and gram - positive bacteria b. cereus were more susceptible to inhibition than other tested bacteria to csp and gse . e. coli showed the maximum zone of inhibition ( 12.8 mm , 7.2 mm ) , while , b. cereus showed the maximum ( 13.3 mm , 7.8 mm ) at 500 g levels of gse and csp , respectively . gram - positive bacteria b. cereus was more susceptible to inhibition in comparison with gram - negative bacteria e. coli . gsp and gse were also used for the evaluation of their antifungal activity against candida butyri and aspergillus niger . a. niger was significantly susceptible to inhibition by saponins fraction and showed the highest inhibition 11.8 and 6.7 mm at 500 g level of gse and csp , respectively . c. butyri was least inhibited by saponin fractions and showed the highest inhibition ( 3.2 mm ) at 500 g level of gse and did not showed any activity at low level of gse as well as csp . the results of present study indicated that gross saponins fraction of a. lebbeck showed the inhibitory action against garm - positive bacteria but not show significant inhibition against gram - negative bacteria and fungi . this is not surprising because the gram - negative bacteria and fungi have been shown to be more resistant to antibiotics [ 29 , 30 ] . this may possibly be the presence of high lipid content in the cell walls of gram - negative bacteria and saponins may not be able to penetrate the cell membrane of the microorganism [ 31 , 32 ] . the finding of present study was consistent with previous published reports that specifically showed that saponins could have antimicrobial properties [ 3335 ] . the ingredient and chemical compositions of diets containing different roughage and concentration ratio were presented in table 2 . in vitro results of incubating three diets during 48 h with gse , saponin fraction a and b on digestibility , rumen fermentation , methanogenesis , and so forth were presented in tables 3 and 4 , respectively . in the current experiment , results indicated that ivdmd values were increased as compared to control and the differences among treatments values were significant ( p 0.05 ) except gse inclusion in d2 and d3 , where slight reduction in ivdmd was observed . in case of d1 and d3 , ivdmd was increased with 15.33% and 2.05% by supplementation of saponin fractions a , while in d2 highest 7.38% increase of ivdmd was noticed on inclusion of saponin fraction b of a. lebbeck seeds . digestibility increase as a result of the presence of saponins was similar to the previous studies , in which the apparent dry matter digestibility increased on supplementation of surfactant saponins at the levels of 520 l / g dry matter . another study reported that the ivdmd was not affected significantly ( p < 0.05 ) on the addition of pure saponins . in present study the partition factor ( pf ) values and microbial biomass ( mg ) production decreased with all saponins supplementation in d2 and d3 ; however , in d1 , 21.99% and 55.92% increases in pf and mbm were observed during supplementation of saponins fraction a ( table 3 ) . they reported that the mbm and pf increased on inclusion with extracted saponins from achyranthes aspera , tribulus terrestris , and albizia lebbeck at 3 , 6 , and 9% levels on dm basis . results of present study indicated that methane production was decreased in saponins extracted from a. lebbeck seed supplementation and in different diets ; methane production ( ml / gdm ) was reduced approximately in the range 12 to 49% , except gse with d2 . results of current study showed that the methane production was reduced up to 49% which was in accordance with results of several experiments conducted by different workers [ 14 , 3941 ] . in another study , holtshausen et al . reported in study with yucca schidigera plant extract containing 6% saponins which showed 8.5% methane reduction at the level of 0.38 g / liter . similarly , feng et al . showed that gross saponin of tribulus terrestris at 0.3 , 0.6 , and 0.9 g / liter levels significantly ( p < 0.05 ) reduced methane concentration by 23.43 , 24.93 , and 25.30% , respectively , by in vitro gas production technique . results of the present experiment showed that the reduction of methane production per 200 mg of truly digested substrate ( tds ) was highest in saponin fraction a with all diets , when compared with control ( table 3 ) . showed that addition of quillaja saponin reduced the methane by 4.1 ml/100 mg substrate at 1.25 mg of saponin / liter under in vitro studies . in the rumen , the methane production also depends upon the association between methanogens , protozoa , and rate of methane production per methanogenic cell . patra and saxena suggested that saponin may decrease the protozoal numbers which leads to reducing the availability of hydrogen ions for methane production by methanogens . furthermore , it has been shown that the saponins reduced methane production via diminished activity of methane producing gene without changing the total methanogen population . the individual volatile fatty acids ( ivfas ) concentration varied among the treatments ( table 4 ) . acetate concentration increased on inclusion of all treatments in case of d2 and d3 and highest increased ( 15.66% ) was seen in saponin fraction b supplementation in d2 . while in d1 , acetate production was decreased in all treatments . results of current experiment indicated that the concentration of propionate slightly was affected by a. lebbeck seed saponins . in d2 , it was increased in all treatments and increased most with saponins fraction b ( 36.23% ) in comparison to control ( table 4 ) . nonsignificant change in butyrate concentrations were observed in present study . among all three diets , only d2 showed the slight decrease in a / p ratio ; however , in case of d1 and d2 it was increased and highest increase ( 27.71% ) was seen in d3 on supplementation with saponin fraction b. the results of present study were in accordance with several other studies [ 13 , 46 ] . in another study , istiqomah et al . observed that the acetate to propionate ratio decreased at 5 , 10 , and 15% saponin levels . the ammonia nitrogen ( mg/100 ml ) was decreased due to the a. lebbeck seed saponins in all three diets , and the maximum decrease ( 38.71% ) was found in d3 on supplementation with saponin fraction b ( table 4 ) . the results of current study indicated that the ammonia nitrogen was marginally affected and slightly decreased as compared to control diet without supplementation of saponins . observed that nonsignificant reduction in ammonia nitrogen on inclusion with purified saponins at the levels of 0 , 1.55 , 3.10 , 4.65 and 6.20 mg/30 ml rumen inoculums . gas kinetics results showed that potential gas production ( b ) was increased on supplementation with gse ( 18.13% ) and saponin fraction b ( 12.17% ) , while slight decrease was noticed on saponin fraction a inclusion in comparison to control ( figure 1 ) . on the other hand , the gas production rate ( c ) was decreased in all treatments and highest decrease ( 15.81% ) was noticed on inclusion of saponin fraction a in diets . in current study , the results of cumulative methane gas production ( ml / gdm ) were presented in table 6 and trends were similar to gas kinetics . highest ( 20.35% ) increase in methane gas potential ( b ) and highest reduction ( 13.54% ) in methane production rate were observed on supplementation with gse and saponin fraction a , respectively ( figure 2 ) . in present study , results indicated that all treatments show the antiprotozoal effect and maximum reduction in protozoa population ( 35.1% ) was seen in saponin fraction a , when compared to control diet . the results of present experiment were consistent with earlier studies [ 14 , 49 , 50 ] . it is believed that saponins form complexes with cholesterol present in the cell membrane and result in the cell lysis , which in turn decreases the hydrogen ion transfer and ultimately reduces the methane production . in present study it is concluded that saponins fraction a of albizia lebbeck has antimethanogenic potential and has an ability to modulate the rumen fermentation parameters . however , a systematic evaluation is needed to confirm the active structural components of saponin fraction a , and their interaction with the microbial community and the diet , and to clarify the mechanism by which saponin fraction a or their metabolites exert effects on the rumen microbes . | the present study was undertaken to investigate the effect of crude seed powder ( csp ) and gross saponins extract ( gse ) of seeds of albizia lebbeck on antimicrobial activity by taking two gram - positive ( staphylococcus aureus and bacillus cereus ) , two gram - negative ( escherichia coli and salmonella typhi ) bacteria , and two fungi species ( aspergillus niger and candida butyric ) were taken at 25 , 50 , 100 , 250 , and 500 g levels using agar well diffusion method . zone of inhibition was increased with increasing of concentration of csp and saponins which indicates that gram - negative bacteria ( e. coli ) , gram - positive bacteria ( b. cereus ) , and a. niger were significantly susceptible to inhibition .
another experiment was conducted to study the effect of gse and saponins fraction a and b of a. lebbeck supplementation at 6% on dm basis on methane production and other rumen fermentation parameters using in vitro gas production test , by taking three different type diets , that is , high fiber diet ( d1 , 60r : 40c ) , medium fiber diet ( d2 , 50r : 50c ) , and low fiber diet
( d3 , 40r : 60c ) . significant ( p 0.05 ) increase was seen in ivdmd , methane production ; however ammonia nitrogen concentration decreased as compared to control .
the methane production was reduced in a range between 12 and 49% by saponin supplemented diets except in case of gse in d2 .
sap a showed the highest methane reduction per 200 mg of truly digested substrate ( tds ) than other treatment groups .
results in relation with quantification of methanogens and protozoa by qpcr indicated the decreasing trend with saponins of a. lebbek in comparison with control except total methanogen quantified using mcr - a based primer . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the acute respiratory distress syndrome ( ards ) is a major cause of morbidity and mortality in critically ill - patients , with an estimated 190,000 new cases in the united states every year . a variety of systemic insults can lead to ards including sepsis , trauma , pneumonia and neurologic hemorrhage . the pathophysiology centers around disruption of the alveolar capillary membrane , causing excess fluid accumulation in both the interstitium and alveoli ; consequences include impaired gas exchange and decreased lung compliance . despite advances in knowledge of the pathophysiology of this complex disease , remarkably few pharmacologic therapies have proven effective , with proper mechanical ventilation remaining the hallmark of management of the lung injury . because of their ability to block sodium channels , they have been widely used in local and regional anesthesia , as well as in the treatment of cardiac arrhythmias . recently , studies have shown a greater spectrum of use at lower concentrations , with beneficial effects on post - operative ileus , prevention of metastatic disease , microvascular permeability and neuroprotection . however , these same anti - inflammatory principles have made use of local anesthetic to attenuate inflammatory reactions in the lung a recent research interest . literature to date suggests that there are specific inflammatory steps leading to hypoxemia , high - permeability pulmonary edema and neutrophil accumulation in the lungs . thus , local anesthetics may have a potential role in attenuating the inflammatory cascade in ards . the distal airway consists of alveolar macrophages ( am ) and epithelial cells at the alveolar - capillary membrane . with an initial insult , it is hypothesized that am and alveolar epithelial cells are activated and produce tumor necrosis factor ( tnf)-alpha , muscle precursor cells-1 , interleukinil ( il)-1b and other cytokines , which in turn up - regulate intercellular adhesion molecules ( icam-1 ) . once icam-1 is up regulated , neutrophils release proteolytic enzymes and oxygen free radicals , which damage the delicate alveolar / endothelial barrier . neutrophils gain access to the alveoli and lung parenchyma causing further inflammatory changes and hypoxia . beck - schimmer et al . described the increase in icam-1 release in a lipopolysaccharide lps - induced rat lung injury model in conjunction with an increase in tnf - alpha and il-1 ; when the same model was treated with anti - tnf - alpha antibodies and anti - il antibodies , icam-1 expression was decreased by 81% and 37% respectively . neff et al . demonstrated that when a lps - induced lung injury model was treated with icam-1 antibodies , neutrophil induced necrosis of epithelial cells decreased from 53%-34% . the work of blumenthal et al . has tried to expand on these known ideas with the use of local anesthetics . using a very similar laboratory model of lps - induced lung injury both in - vivo ( rat lung ) and in - vitro ( alveolar epithelial cells and endothelial cells ) , blumenthal et al . , was able to show a decrease in icam-1 expression in alveolar epithelial and vascular endothelial cells with ropivacaine , a commonly used local anesthetic . ropivacaine was also shown to decrease neutrophil accumulation in - vivo when applied intravenously ( iv ) and intratracheally ( it ) by 81% and 56% respectively . cytokine accumulation was also decreased in both iv and it applications . finally , the alveolar - capillary permeability measured by albumin content in the respiratory compartment diminished with ropivacaine use . ropivacaine has many benefits over older local anesthetics , such as lidocaine that have been studied in clinical trials . lidocaine has been shown to attenuate lung injury in - vivo as well as aspiration , reperfusion injury and hyperoxia - induced lung injury . another study showed that lidocaine inhibits cellular adhesion molecules and superoxide formation . nevertheless , lidocaine has a known side effect profile including cardiotoxicity and neurotoxicity , which has limited its study in ards patients . in addition , in the setting of ards and lidocaine administration , cardiovascular collapse has occurred . ropivacaine , with its improved safety profile when compared with other local anesthetics , may prove to be a safer option in critically ill - patients , especially with its in - vivo benefits when administered it , further limiting systemic toxicity . ( taken with the existing basic science literature ) may now provide the impetus for translational trials at the bedside , to assess whether ropivacaine may in fact have a role in ards . lower tidal volumes , higher positive - end expiratory pressure and permissive hypercapnia are standards of care in ards literature . despite much research regarding pharmacologic therapies , there has been only one study that has shown improved mortality with a pharmacologic intervention . showed reduction in barotrauma , days off ventilator , days out of the intensive care unit and adjusted 90 day survival rate with a continuous infusion of cisatracurium . the mechanism of neuromuscular blocking agents to affect the pathology of acute lung injury ( ali ) is speculative , although a reduction in proinflammatory cytokines , eventually leading to improved oxygenation may have played a role this is a similar theory to ropivacaine 's possible benefits . it is time to start the process of clinical trials in this novel pharmacologic therapy to possibly attenuate inflammation in ards . important questions that lie ahead include : the logistics and safety of it administration of local anesthetics in critically ill - patients , the magnitude of reduction in inflammatory mediators and the measurement of patient - level outcomes , including lung function , quality - of - life , morbidity and mortality . this process will require collaboration with both basic science and clinical investigators , with an eye to critically evaluate a hopefully beneficial translational intervention . the process of lung injury secondary to a primary insult , inflammation , hypoxia and worsening inflammation consist of a cyclical cascade , with each insult fueling the fire and leading to worsened lung function . basic science and clinical research support both support the concept of potentially targeting the inflammatory pathway in helping to attenuate lung injury in ards . the next step is to perform well - designed studies at the clinical level to delineate the effects of local anesthetics , particularly ropivacaine via the it route , in attenuating ali . the time has come to translate what we have learned about inflammation and lung injury at the bench and start to evaluate it at the bedside . | the acute respiratory distress syndrome ( ards ) remains a world - wide treatment challenge , with high morbidity and mortality .
the central pathophysiology of ards centers around inflammation in the lung and increased microvascular permeability .
local anesthetics have been shown to have anti - inflammatory effects at the basic science level and the advent of local anesthetics with improved cardiovascular safety profiles has made use of local anesthetics in attenuating the inflammation in ards a recent research interest . in this review , we will provide a brief summary of some of the basic science work in local anesthetics and lung inflammation and provide a case for the bench to bedside research in this potential therapy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
multiple sclerosis ( ms ) is a chronic inflammatory and demyelinating disease of the central nervous system , which is accompanied by significant disabilities . twenty years ago , kurtzke g. suggested three prevalence areas of ms in the world , namely low ( 5 per 100,000 population ) , medium ( 5 - 30 per 100,000 population ) , and high - risk areas ( more than 30 per 100,000 population ) . high - risk areas were seen in northern europe , northern america , canada , southern australia , and new zealand . on the other hand , medium based on kurtzke classification , the middle eastern countries were considered as low risk areas for ms . previously , iran was considered to have a low prevalence rate of ms , but this rate has significantly increased in the recent years . fars province is located between longitudes of 5036e and 5535e of greenwich and latitudes of 2703n and 3140n of the equator . it has an area of 122,608 km with three distinct climatic regions and a total population of 4,651,718 until october 2013 . although there are some published data regarding the epidemiological features of ms in other parts of iran , scarce data are available about the prevalence and demographic characteristics of ms in fars province . therefore , the current study aims to address the prevalence and incidence rates of ms as well as the temporal trend of the disease in fars province , southern iran , which is one of the largest provinces of the country . this historical , retrospective cohort study was conducted on the data from all patients who had ms ( all subtypes of ms ) according to the mcdonald s criteria . they were members of the fars multiple sclerosis society ( fmss ) until october 2013 . all patients were referred to the ms committee of shiraz university of medical sciences by neurologists and were again reevaluated by three expert neurologists to confirm their diagnosis . this is the only referral center for ms patients in fars province and , as a result , nearly all the ms patients are registered in this computerized database . a few patients from other neighboring provinces also were registered in this database and were excluded from the study . additional information about the patients gender , age at time of diagnosis , education , and clinical course were obtained from this database . the population figures for fars province were used as the denominators for calculation of prevalence and incidence rates . based on the information released by the iranian central bureau , which is derived from the national census , the population of fars province was 4,651,718 in october 2013 . the prevalence rate of the disease was calculated considering the total number of patients and the population of fars province in october 2013 . besides , the annual incidence rates were calculated based on the new cases diagnosed with each year and yearly estimated population of fars province from 2002 to 2012 . the results were reported as descriptive indices , such as frequency ( percentage ) and meanstandard deviation . the independent t - test was used to compare the means of age and sex in the patients with clinically isolated syndrome ( cis ) and relapsing remitting ms ( rrms ) . in addition , 95% confidence interval ( 95% ci ) of mean age was computed . the prevalence and incidence rates of ms were computed with respect to sex and year with 95% ci . the results were reported as descriptive indices , such as frequency ( percentage ) and meanstandard deviation . the independent t - test was used to compare the means of age and sex in the patients with clinically isolated syndrome ( cis ) and relapsing remitting ms ( rrms ) . in addition , 95% confidence interval ( 95% ci ) of mean age was computed . the prevalence and incidence rates of ms were computed with respect to sex and year with 95% ci . a total of 3,354 ms patients were identified in this study . among the study patients , 2,689 ( 80.2% ) were female and 665 ( 19.8% ) were male with a female / male ratio of 4.04 . the mean age of the patients was 32.949 years ( 95% ci : 32.63 - 33.25 ) . in addition , the mean age of the male and female patients was 33.248.9 ( 32.5 - 33.9 ) and 32.869.5 ( 32.5 - 33.2 ) years , respectively . moreover , about 73.8% of the patients were between 20 - 40 years of age . considering the population of fars province in october 2013 ( female population : 2,398,113 ; male population : 2,343,705 ; and the total population : 4,651,718 ) , the total point prevalence rate of ms was 72.1 per 100,000 persons ( 95% ci : 69.6 - 74.5 ) . besides , the sex - specific prevalence rate of the disease was 116.5 ( 95% ci : 113.4 - 119.6 ) per 100,000 persons in females and 28.3 per 100,000 persons ( 95% ci : 26.8 - 29.9 ) in males . it should be mentioned that the total prevalence rate of the disease was 20.5/100,000 in 2002 ( 7.8 in males and 33.2 in females ) . among the study patients , 2,476 cases were in 20 - 40 year old age group with the age specific prevalence rate of 148.3 per 100,000 persons ( 238.5 for females and 59.6 for males ) . the study findings revealed the mean annual incidence rate of 5.2/100,000 from 2002 to 2012 . the incidence rate of the disease was 4.1/100,000 in 2002 and increased to 8.98/100,000 in 2012 . therefore , in the last 11 years ( 2002 to 2012 ) , 2.2- and 3.57-fold increase was observed in the incidence and prevalence rates of ms , respectively . this increasing rate was seen in both females and males , but significantly more in females . the increasing incidence rate during the last 11 years is shown in figure 1 . considering the type of ms , the increasing rate was seen predominantly in cis , while a decrease in frequency was detected in rrms , as shown in figure 2 . the annual incidence rate ( 95% ci ) of multiple sclerosis in fars province from 2002 - 2012 indicates an increasing incidence rate ( especially in females ) in fars province during the last 11 years . the frequency of clinical types of multiple sclerosis in fars province from 2002 - 2012 shows , considering the type of ms , the increasing rate is seen predominantly in cis while a decrease in frequency is detected in rrms . according to the results , the most frequent type of ms was rrms ( n=1851 patients , 61.5% ) followed by cis ( n=842 patients , 28% ) . the mean age of the patients with cis and rrms was 30.28.4 ( 95% ci : 29.6 - 30.8 ) and 33.48.39 ( 95% ci : 33 - 33.8 ) years , respectively . our study revealed that fars province is a high - risk area for ms with the total prevalence rate of 72.1 per 100,000 persons ( 116.5/100 , 000 in females and 28.3/100,000 in males ) . previously , iran was considered to have a low prevalence rate of ms according to kurtzke categorization . however , recently published data revealed that some areas of iran could be considered as high prevalence areas . the prevalence rate of ms was reported to be 35.5 per 100,000 ( 2006 , etemadifar m. et al . ) and 73.3 per 100,000 ( 2011 , etemadifar m. et al . ) in isfahan ( central of iran ) , 51.9 per 100,000 in tehran ( 2010 , sahraian ma . et al . ) , 20 per 100,000 in mazandaran ( north of iran ) , 5 - 12 per 100,000 in khorasan ( northeast of iran ) , and 14 per 100,000 in sistan and baluchistan ( southeast of iran ) . accordingly thus , these differences in prevalence rates in different regions could be explained , at least to some extent , by these ethnic and environmental differences . yet , why the prevalence rate in central and large provinces of iran ( tehran , isfahan , and fars ) is significantly higher compared to that in other provinces is not exactly clear . many environmental and genetic factors are considered as the contributing factors in the etiology of ms . several reports have indicated that the prevalence of ms is higher in the regions with low sun exposure and vitamin d deficiency . also suggested vitamin d deficiency as an important factor , which could affect the prevalence of ms in iran . although it is believed that the iranian population has enough sun exposure , vitamin d deficiency is still prevalent in the country . one of the reasons that may explain the high rate of vitamin d deficiency in iran is the lifestyle changes , such as extensive use of sunscreens or an increase in the number of people living in apartments where there is a significant decrease in sun exposure . moreover , hijab was mentioned as a possible contributing factor to vitamin d deficiency in the iranian population , however , there is no other documented evidence that could confirm this hypothesis . furthermore , a previous study demonstrated a correlation between the prevalence of ms and specific types of heavy industries . the present and previous studies shown the highest prevalence rate of ms in iranian provinces ( e.g. , isfahan , tehran , and fars ) with the highest rates of industrial activity . the hygiene hypothesis may provide the explanation why there has been an increase in the prevalence rate of ms in the region . epidemiological studies have suggested that reduced exposure to infection may be an explanation for the increased incidence of allergic and autoimmune diseases . the improvement of hygiene among the iranian population in the last decade could be the other environmental factor affecting the increasing prevalence rate of ms in iran . in addition , some studies in india showed that ms was significantly more prevalent among parsis ( originated from pars province , iran ) compared with other ethnic groups . however , the prevalence rate of ms in fars province was higher compared with other middle eastern countries . the prevalence rate of the disease was reported to be 31.15/100,000 , 25/100,000 , and 40/100,000 in kuwait , saudi arabia , and jordan , respectively . on the other hand , the prevalence rate of ms in eastern asia was much lower compared with iran and other middle eastern countries . evidence has shown that environmental factors play an important role in acquisition of ms . however , considering the differences in the prevalence rates of ms in iran and other middle eastern countries as well as the higher rate of ms among persian ethnic groups in india , we advocate that genetic susceptibility and ethnicity might play a more significant role in the iranian s susceptibility to ms . alonso a. et al . in a systematic review ( 2008 ) reported that the overall worldwide incidence rate of ms was 3.6 and 2.0 cases per 100,000 person - years in females and males , respectively . in the current study , the mean annual incidence rate of ms was 5.2/100,000 persons and a 2.2-fold increase was observed in the incidence rate of ms in fars province from 2002 to 2012 . the increasing incidence and prevalence rates of ms were also reported in the previous iranian studies . to date , 55% of the iranian population belongs to the 15 - 30 years age group . ms mostly occurs in young patients and the predominance of young population in iran may justify the high prevalence of ms in this country . therefore , potential decrease in the number of young population in iran in the coming years may result in a decrease in the incidence rate of the disease . the other possible contributing factors to the increasing rate of ms are improved diagnostic tools , such as mri , and better and earlier diagnosis . in addition , there have been some reports of the increasing trend of other autoimmune diseases , such as guillaine barre syndrome , in iran . thus , conducting meticulous basic and clinical researches are highly recommended on the causes of this trend . according to figure 2 , in the recent years , the number of patients diagnosed with cis has increased , while the prevalence rate of rrms has decreased . the reason for this change is probably increasing knowledge about the disease and high suspicious of physicians that lead them to earlier diagnosis in earlier stages of the disease when the patient has only had one attack of neurological deficit . revised macdonald s criteria ( 2010 ) and more available magnetic resonance imaging ( mri ) , the gold standard tool for ms diagnosis , have also helped easier diagnosis in the earlier stages of the disease . the findings of this study indicated that the prevalence of secondary progressive ms has decreased in the recent years . this might be due to the fact that the patients are diagnosed in the early stages of the disease and are treated with disease modifying drugs . early treatment of the patients with disease modifying drugs , including beta - interferon , can delay progression of the disease into secondary progressive ms . in the current study , female to male ratio was 4.04:1 , which is similar to other studies performed in iran . yet , this ratio has been reported as 2 - 3:1 in the western population , but 6 - 9:1 in east asian countries . the prevalence of ms in some areas of iran is similar to caucasians , but the sex ratio is different , which is an interesting finding also reported in some previous studies . the higher rate of ms among women may be related to their physiological factors , including sex hormones . additionally , the increasing incidence of ms in females suggests that the hormonal differences make women more susceptible to environmental risk factors . these exogenous factors contributing to the pathogenesis of ms could affect men and women differently . in the iranian population , the number of female smokers is significantly lower than male smokers are , but low sunlight exposure and its associated vitamin d deficiency are significantly higher among females . alvaro alonso in a systematic review reported that the female to male ratio increased from 1.4 in 1955 to 2.3 in 2000 . therefore , the female to male ratio has increased from past to present as well as from west to east . most of the patients in this study had rrms ( 61.5% ) followed by cis ( 28% ) . this is in agreement with other studies conducted around the world , including asian and middle eastern countries . the current study revealed that the fars province had high prevalence and incidence rates of ms . in addition , a sharp increase was observed in the incidence rate of the disease in the last decade . | background : multiple sclerosis ( ms ) is a chronic inflammatory and demyelinating disease of the central nervous system , which is accompanied by significant disabilities . although there are some published data regarding the epidemiological features of ms in other parts of iran , scarce data are available about the prevalence and demographic characteristics of ms in fars province .
the current study aimed to address the prevalence and incidence rate of ms as well as the temporal trend of the disease in fars province , southern iran.methods:this historical retrospective cohort study was carried out in fars multiple sclerosis society affiliated with shiraz university of medical sciences .
all the consecutive patients who fulfilled 2010 mcdonald criteria for definite ms were included in the study .
the patients gender , age at time of diagnosis , education , and clinical course were recorded .
the prevalence and incidence rates were also calculated.results:this study was conducted on 3,354 patients . among the patients , 2,689 ( 80.2% ) were female and 665 ( 19.8% ) were male .
the female / male ratio was 4.04 .
the point prevalence rate of the disease was 72.1/100,000 persons in october 2013 .
this index was 116.5 per 100,000 persons in females ( 95% ci : 113.4 - 119.6 ) and 28.3 per 100,000 persons in males ( 95% ci : 26.8 - 29.9 ) .
the mean annual incidence rate was 5.2/100,000 from 2002 until 2012.conclusion:considering kurtzke classification , fars is a high - risk area for ms and women are affected more compared with men .
moreover , the incidence rate sharply increased in the last decade . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
hemiplegic migraines are characterised by fully reversible motor auras and have been recognised as a distinct group by the international classification of headache disorders , edition ii ( ichd - ii ) . they present with two subtypes : genetic ( familial hemiplegic migraine ) and sporadic ( sporadic hemiplegic migraine ) [ 1 , 2 ] . the latter has been associated with a number of medical conditions , such as tumours , vascular disorders and autoimmune diseases . we report the case of a woman with sporadic hemiplegic migraine associated with crest syndrome ( calcinosis , raynaud s phenomenon , esophageal dysmotility , sclerodactyly and telangiectasia ) . a 34-year - old woman was referred to our clinic with a presumptive diagnosis of transient ischemic attack ( tia ) . she presented with episodes of transient hemiparesis that fully resolved without sequelae and were followed by severe headache . these episodes consisted of progressive left - sided weakness occurring in a stepwise pattern : first affecting the face , then the arm and finally the leg . some of the episodes were preceded by sensory disturbances and , on other occasions , by scintillating scotomas . the symptomatology lasted no more than 30 min and was followed by an intense contralateral headache with a migrainous pattern lasting from 12 to 36 h. the patient admitted having experienced similar episodes since adolescence , with a once - a - year frequency over the past 5 years . during the past year her past medical history was remarkable for crest syndrome , which first appeared at age 15 with raynaud s phenomenon . she later developed skin induration in her hands and feet , calcinosis cutis and facial telangiectasias . these latter symptoms , which appeared approximately 15 years after raynaud s phenomenon , led to the diagnosis of crest syndrome . the neurological examination was normal , and the laboratory panel showed a raised erythrocyte sedimentation rate of 48 mm / h and a mild normocytic anaemia ( haemoglobin = 11.5 mg / dl ) . she had previously tested negative for anti - neutrophil cytoplasmic antibodies ( anca ) , rheumatoid factor ( rf ) , anti - dna and anti - cardiolipin antibodies , hepatitis b and c , hiv and syphilis . magnetic resonance imaging ( t1-weighted , t2-weighted and flair sequences ) showed only a few punctiform hyperintense white matter lesions on t2-weighted images . diffusion - weighted imaging ( dwi ) taken between 12 and 24 h after the hemiplegic attacks on two occasions were normal . she was started on prophylactic treatment with topiramate 25 mg / day , reaching a final dose of 75 mg bid . after 9 months of follow - up , there was nearly a 50% reduction in both the frequency and severity of the migraine attacks with aura , and she did not experience further episodes of hemiplegic migraine . hemiplegic migraines have been recognised as a separate entity by the ichd - ii ( 2004 ) , comprising both familial ( fhm ) and sporadic ( shm ) subtypes [ 1 , 2 ] . the sporadic form is defined as a migraine with aura including motor weakness but with no first or second degree relative with aura including motor weakness . shm clinical characteristics are very similar to those of fhm , consisting of motor aura usually followed by other typical auras ( mostly visual and sensory ) and headache [ 2 , 4 , 5 ] . motor deficits are usually unilateral , and most of them resolve in less than an hour . a large subset of patients also met the clinical criteria for basilar migraine during the attacks [ 1 , 2 , 4 ] . the main differential diagnoses include transient ischemic attacks ( tia ) , stroke and epilepsy [ 1 , 2 , 6 ] . other entities with a similar clinical presentation , albeit uncommon , include melas ( mitochondrial myopathy , encephalopathy , lactic acidosis and stroke - like episodes ) and handl ( transient headache with neurological deficits and csf lymphocytosis ) . the frequency of the attacks tends to decrease with age , and the pattern becomes similar to migraine with aura . there are also reports in the literature describing cases of shm attacks secondary to an underlying medical condition such as systemic lupus erythematosus ( sle ) , anti - phospholipid syndrome ( aps ) , sturge weber syndrome , hemifacial atrophy and tumours , among others . this last group is also known as symptomatic sporadic hemiplegic migraine ( symptomatic shm ) . there are no uniform recommendations regarding treatment , although drugs such as propranolol , verapamil , flunarizine and naloxone have been used with variable degrees of response [ 2 , 4 ] . it has been suggested that triptans and ergotamine derivatives are not useful and are even detrimental . with regard to disease management , it seems reasonable to initiate preventive treatment only in those patients who have frequent and/or severe attacks . for the management of our patient , we started prophylactic treatment , taking into account both the frequency and intensity of her migraine attacks . she was started on topiramate given its favourable side effects profile in comparison with other treatments such as calcium channel blockers or naloxone in a young woman with a crest syndrome as an associated pathology . she was also prescribed naproxen to relieve acute attacks . to our knowledge crest syndrome is considered a subtype of limited scleroderma , consisting of calcinosis , raynaud s phenomenon , esophageal dysmotility , sclerodactyly and telangiectasia . the pattern of cutaneous involvement is limited to the face and distal extremities , sparing the trunk . raynaud s phenomenon is usually the first symptom and is followed years later by skin thickening of the hands ( sclerodactyly ) as well as the other manifestations of the disease . systemic involvement ( e.g. , lung fibrosis and kidney failure ) tends to be less severe than in systemic sclerosis . the presence of anti - centromere antibodies is a highly specific marker , though not very sensitive ( 50% ) . in contrast to those with systemic sclerosis , the prognosis is generally better for patients with crest . many reports in the literature associate raynaud s syndrome with migraine [ 8 , 9 ] . compared to the general population , the prevalence of migraine is 24 times higher in patients with primary raynaud s syndrome . in addition , raynaud s syndrome appears to be more prevalent in patients with migraine . there is also an increased prevalence of migraine in other diseases associated with raynaud s , namely , sle . the involvement of small vessels is considered to be a relevant factor in the physiopathology of raynaud s and crest syndrome . the mechanisms proposed to explain this involvement include an imbalance in vasomotor tone reactivity and changes in the architecture of the vessel walls , leading to obliterative fibrosis [ 7 , 12 ] . these changes could sensitise the trigeminal vascular system , which is considered to play a major role in the physiopathology of migraine . based on this we could speculate that the migraine attacks in our patient might be related to her crest syndrome , although a casual association can not be ruled out . | hemiplegic migraines are characterised by attacks of migraine with aura accompanied by transient motor weakness .
there are both familial and sporadic subtypes , which are now recognised as separate entities by the international classification of headache disorders , edition ii ( ichd - ii ) .
the sporadic subtype has been associated with other medical conditions , particularly rheumatological diseases .
we report the case of a woman with sporadic hemiplegic migraine associated with crest syndrome ( calcinosis , raynaud s phenomenon , esophageal dysmotility , sclerodactyly and telangiectasia ) .
since there is a close relationship between migraine and raynaud s phenomenon , it could be speculated that the sporadic hemiplegic migraines in our patient might be secondary to crest syndrome . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
one - dimensional semiconductor nanowires and nanotubes have stimulated increasing attention in the last few years and are expected to lead to novel device application due to their intriguing properties and potential applications in constructing nanoscaled electronic and optoelectronic devices [ 1 - 12 ] . among semiconducting oxide nanostructure , sno2 nanowires , nanobelts , and nanowires are very important n - type semiconductors for applications as transparent conducting electrodes , gas sensors , and lithium - ion batteries , which utilize the unique characteristics of sno2 nanostructures including a wide band gap ( eg = 3.6 ev at 300 k ) and large surface - to - volume ratios . a precondition for sno2 nanostructures based on the applications is an easy and lager - scale synthesis of sno2 nanostructures . several methods have been reported for the synthesis of sno2 nanowires / nanobelts , including thermal decomposition , electrospinning , solution - based crystal growth , laser ablation , and template - based approaches . however , those methods always required long time for heating and cooling , which hinder the mass production of sno2 nanostructures . due to its versatility and simplicity , field - effect transistors ( fets ) based on single carbon nanotube , si nanowire , zno nanowire and others are with excellent properties superior to their bulk counterparts . sno2 nanowires are one of the potential semiconducting materials for nanoelectronic devices due to their excellent electronic properties . in the present study , we report a novel method to synthesize aligned sno2 nanowires by using high - frequency inductive heating furnace . a mixture of sno2 and the carbon nanotubes ( cnts ) waste soot which was a main by - product in the production of cnts by arc - discharge . the sno2nanowires were synthesized on a silicon substrate by heating pure sno2powders ( 50 wt.% ) and cnts waste soot ( 50 wt.% ) which was a main by - product in the production of cnts at 1,027 k in the quartz tube . an appropriate amount of source powders ( about 1 g ) and the silicon substrate separated by 10 cm were put in the center of the quartz tube . the silicon ( 100 ) substrate patterned with au using conventional photolithographic method was located downstream of the source powders . the precursor was loaded in a graphite boat and located in a high - purity graphite tube . as a heating crucible , the graphite tube was placed in a horizontal quartz tube and heated in a high - frequency induction furnace . the quartz tube was first evacuated at 10torr by a vacuum pump . after heated up to the desired temperature ( 1,027 k ) , an ar gas flow at a rate of 20 sccm was introduced , and the growth was initiated and maintained for less than 3 min . when the system was cooled to room temperature , many white products were formed on the surface of the substrate . schematic diagram of the apparatus for synthesis of sno2nanowires the as - grown sno2nanowires were characterized by scanning electron microscopy ( sem , fei sirion 200 ) equipped with energy - dispersive x - ray spectroscopy ( edx , inca oxford ) and transmission electron microscopy ( tem , jem-2010 ) . the electronic measurements were made using an agilent 4156c semiconductor characterization system under an ambient condition at room temperature . figure 2a and b show two typical sem images of the as - grown sno2ordered nanowire arrays deposited on the silicon substrate . it can be observed that large quantities of nanowires were grown vertically on the silicon substrate and formed the sno2nanowire arrays with the length of tens of mircrometers , and the surfaces of the nanowires are uniform and smooth . figure 2c shows a low - magnification tem image of single sno2nanowire with diameters ranging from ~20 nm . it can be seen that the sno2nanowire is very smooth , straight , and uniform , and the geometrical shape is structurally perfect . the crystallography of the nanowires was investigated by select area electron diffraction ( saed ) pattern . the interplanar spacing is about 0.334 nm , which is corresponding to the ( 110 ) plane of rutile crystalline sno2 . a , bthe typical sem images of as - synthesized aligned sno2nanowires , clow - magnification tem , anddhrtem image of single sno2nanowire figure 3 shows x - ray diffraction ( xrd ) patterns of sno2 nanowires . the sno2 lattice constants obtained by refinement of xrd data are a = 4.737 , c = 3.185 , which are consistent with bulk rutile sno2 tetragonal structure . it indicates that sno2 nanowires are in excellent accordance with a rutile structure . to study the composition of single as - prepared nanowire , eds measurements ( fig . all the resultant nanowires are mainly composed of sn , o , and c ( come from cnts ) . x - ray diffraction patterns of as - synthesized sno2nanowires eds patterns of as - synthesized sno2nanowires figure 5 shows the ft - ir spectrum in the range of 1,0004,000 cm of as - synthesized sno2 nanowires . it shows dominant peaks at 1,635 , 2,377 , 2,925 , 3,467 , and 3,865 cm which corresponds to si o , sn o , c o , cnt , h o h , and c hx , respectively . the peak near 1,635 cm can be assigned to the vibration of o sn o that corresponds to the a2u mode . ft - ir spectrum of as - synthesized sno2nanowires these peaks confirm that sno2nanowires possess the crystalline structure of the tetragonal rutile structure , which is corresponding to the results of xrd . solid during the experiment . in terms of this mechanism , there exist three processes . first , sno2 powders react with cnts waste soot powder , which results in the formation of sno gas under high temperature . subsequently , sno gas will decompose to sn and o2 at a temperature higher than 1,027 k. some sn droplets reacted with the au particles and formed au finally , aligned sno2 nanowires were produced by the reaction with sn and o2 during the process of transporting the sn to the substrate by carrier gas . moreover , the temperature is reached in several short seconds during high - frequency induction heating process , which results in eliminating the dimensional growth of the au species present on the surface , so it gives rise to the formation of sno2 nanowires , while other nanostructure products can not be formed . the following chemical reaction equations are proposed to explain the growth mechanism:(1)(2)(3 ) after growth , the sno2nanowires were transferred from silicon substrates , and a number of fets device structures were fabricated . devices were fabricated by thermally growing sio2film with 500 nm thickness on the top of n - type si wafers , followed by deposition of an au layer with sputtering and standard photolithography . parallel au electrode pairs , with ~1 m in length and 80 nm in thickness , were patterned . the as - prepared sno2nanowires were sonicated into a suspension in ethanol , followed by solution casting the slightly dispersed sno2nanowires between the drain and the source of au electrodes to form a single sno2nanowire fet ( sno2-fet ) . the sno2-fet samples were quickly transferred to a stove to anneal in ar at 973 k for 5 min in order to improve the quality of au sno2contacts . 3is the sem image of the as - fabricated single sno2nanowire with a channel width of ~200 nm . the current voltage of drain and source ( idsvds ) data of the device are shown in fig . the gate voltages were applied from 0 to 9 v and the drain voltages were from 1.0 to 1.0 v for room temperature samples . it is very clearly shown that we have demonstrated that the conductance increased with the increase of the back gate voltage , which indicates an n - type property for the sno2 nanowire . the possible reason is due to oxygen vacancies and extra gallium interstitial atoms in the lattice during the synthesis process . an on / off current ratio ( ion / ioff ) of more than 10 has been achieved at vgs from 1 to 1 v with vds of 0.2 v. the fets based on single sno2 nanowire exhibited better electrical properties , which affected both on / off current ratio and threshold voltage of the devices . the mobility can be calculated from the following formula [ 33 - 35](4)(5)(6 ) where gm is the transconductance , c is the capacitance and l is the channel length , , h , and r are the dielectric constant , the thickness , and the radius of silicon dioxide , respectively . using = 3.9 , h = 500 nm , l = 1.5 m , and r = 15 nm , it can be calculated e = 169 cm / v s at vds = 0.3 v. transistor characteristic of back - gated single sno2nanowire fet devices on silicon substrates : ids vdscurves for gate voltages withvgs = 9 v to 0 in 3 v steps fromtoptobottom . theinsetis the sem image of the as - fabricated single sno2nanowire this value is consistent with those obtained in planar single - crystalline sno2nanowire and other metal oxide nanowires . the performance of sno2-fet devices depends to a large extent on the source and drain contacts . in our cases , we find that it is effective to improve the quality of au sno2contacts by annealing the sno2-fet devices in ar at 973 k for 5 min . therefore , the value of effective mobility , transconductance , and on / off ratio has also been significantly improved . we present a simple , fast , and a low - cost method to synthesize sno2nanowire arrays by using fast heating furnace . a ball - milled mixture of sno2and cnts sem and tem images show nanowire diameters of 50100 nm and lengths up to tens of mircrometers . the electrical properties of the as - synthesized single sno2nanowire in fets devices show that the n - type sno2nanowires have larger on / off ratio ( > 10 ) and higher carrier mobility at room temperature . we acknowledge that this work is supported by national natural science foundation of china ( no . | sno2nanowire arrays were synthesized by fast heating a mixture of sno2and the carbon nanotubes waste soot by high - frequency induction heating .
the resultant sno2nanowires possess diameters from 50 to 100 nm and lengths up to tens of mircrometers .
the field - effect transistors based on single sno2nanowire exhibit that as - synthesized nanowires have better transistor performance in terms of transconductance and on / off ratio .
this work demonstrates a simple technique to the growth of nanomaterials for application in future nanoelectronic devices . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
tobacco is the only legally available product that kills people.1 tobacco consumption in any way is lethal . tobacco smoke not only causes physical and mental harms to the smoker himself but also affects others exposed to it ( passive smokers ) . the effects of tobacco can range from simple bronchitis to impotence among men and encompassing death in its fist . every 6 seconds , one person dies as the result of tobacco consumption in the world.2 if current trends continue and necessary actions are not taken tobacco - related deaths will increase to more than eight million a year by 2030 , and 80% of those deaths will occur in the developing world.34 health hazards of tobacco are well known but only small numbers of tobacco users are fully aware of the harmful effects of tobacco which leads to initiation and continuation of tobacco use . they think of it as a bad habit that they are knowingly involved with.5 communicating the hazardous effects of tobacco remains a primary goal of the tobacco control policy . warning labels on tobacco products are an effective way of communicating the consequences of tobacco use and bring about behavioural changes like quitting and reducing the tobacco consumption.6 health warnings on packages are appealing because tobacco packaging is not removed and discarded but is used as container until contents are consumed ; it provides low cost to regulators ; unparalleled reach among tobacco users and is also an important source of information , attract the attention of tobacco users , increase awareness of the health hazards of tobacco . canada , in the year 2001 , became the first country to mandate graphic warnings followed by brazil.78 studies in australia , belgium , brazil , canada , thailand and some other countries show that health warnings on cigarette packs especially the graphic ones are an important source of information . since canada first adopted its graphic pack warnings , many other countries have done the same.910 the number of countries adopting graphic warnings is increasing ( see http://www.tobaccolabels.ca/healthwarnings for the latest number ) . as far as india is concerned , implementation of the pictorial warnings has taken a rather long time and was to be enforced on may 31 , 2009 . these warning labels on tobacco products are mandated under the cigarettes and other tobacco products ( cotpa ) ( prohibition of advertisement & regulation of trade & commerce , production , and supply & distribution ) act , 2003.11 despite existing tobacco control policies , not only the number of juvenile and young tobacco users continues to rise unabated , but so have the diseases , disabilities and deaths attributed to tobacco use , upped considerably . the purpose of the current study was assessment of awareness and effectiveness of warning labels on tobacco use among health and non - health professionals , barwala panchkula . a descriptive cross - sectional questionnaire study was conducted from april to may 2013 among six conveniently selected professional colleges ( nursing , dental , pharmacy , diploma , engineering , b.ed ) in barwala , panchkula to assess the awareness and effectiveness of warning labels on tobacco use . ethical clearance was obtained from the institutional ethical committee and oral informed consent was obtained from the participants . data was collected by means of self - designed , structured questionnaire which comprised seven questions divided into four areas of enquiry on demographic details , tobacco usage , awareness and effectiveness of warning labels present on tobacco products . a pilot study was conducted 1 month prior to the original study with a sample of 50 individuals who were not part of the main sample to know feasibility and validity of questionnaire before the main study . based on pilot study sample size ( annexure ) was estimated for the main study ( n = 408 ) . a prior permission was obtained from concerned college authorities . from each college , 68 students were selected randomly by using simple random sampling technique . the purpose of the study and all the terms used in the questionnaire were explained to the students . the students were also ensured complete confidentiality and anonymity of the participants twenty - five minutes were given to each person to fill the questionnaire . participants who were not willing to participate in the study or who were absent during three consecutive visits were excluded from the study . the data was compiled and entered into standard microsoft excel 2007 . for the purpose of statistical analysis data was dichotomised as health ( nursing , dental and pharmacy ) and non - healthcare professionals ( diploma , engineering , b.ed ) . the differences between variables were assessed by the chi - square test and a significance level of p < 0.05 was set throughout . the study sample consisted of 53.5% health professionals and 46.5% non - health professionals [ figure 2 ] . among the participants 22.6% were current tobacco users , 8.9% past tobacco users and 68.5% never tobacco users . sample distribution based on gender sample distribution based on profession table 1 and figure 3 depicts tobacco use habit based on gender . cigarette was most common form of tobacco used among both the gender and the most common reason for starting tobacco use was peer pressure . distribution of tobacco use based on gender tobacco use habits among gender table 2 and figure 4 depicts tobacco use habit based on profession . distribution of tobacco use among health and non - healthcare professionals tobacco use habits among health and non - healthcare professional table 3 depicts awareness about harmful effects of tobacco based on profession . healthcare professionals were more aware about harmful effects of tobacco as compared to non - healthcare professionals ( p - value < 0.05 ) . awareness about harmful effects of tobacco table 4 depicts awareness about warning labels on tobacco product . most of study participants have noticed the warnings on tobacco products and most of them believe that they could understand warning labels . more that 70% believe that warnings create awareness about health hazards of tobacco and help in reducing or quitting tobacco . awareness about warning labels on tobacco product table 5 shows assessment of pictorial warnings and their association with tobacco . a picture of lung disease and oral cancer was correctly identified by > 70% health professionals and > 40% by non - health professionals . when further enquired about the most effective warning label , the picture of oral cancer ( 55.6 ) followed by picture of lung disease ( 32.3% ) was found to be most effective . assessment of pictorial warnings and their association with tobacco when participants were asked suggestion for making warning effective , they believed that by introducing scarier picture on tobacco products , writing the warning in native language and mentioning about more ill effects of tobacco these can be made more effective . if packaging is one of effective means to entice a person buy a product , it can also be effectively used to ensure that person shuns it.12 warning labels are an easy inexpensive way to show the truth about tobacco consumption . the warning will thus reach all users and non - tobacco users and increase their awareness about tobacco use . review of literature suggest that no study has been carried out comparing awareness and effectiveness of warning labels on tobacco use among health and non - healthcare professionals . thus , the present study was conducted to assess awareness and effectiveness of warning labels on tobacco use among health and non - healthcare professionals , barwala , panchkula . this study used a convenience sampling technique , to ensure equal representation of health and non - healthcare professionals as the intention was to explore perceptions by these professionals . in this study , only young adults were included because of the potential impact of warning labels on this age group and the idea that young adults who are non - tobacco users or only use tobacco occasionally may be influenced by label information . results of study revealed that 22.6% of study participants were tobacco users and 8.9% were past tobacco user . cigarette smoking was highest among study participants which was in concordance with study done by rahman m ( 2007)13 and karingannavar a(2010).14 the major reasons attributed to consume tobacco were stress and peer pressure . more than 90% of study participants had noticed tobacco warning labels which was in concordance with study done by centers for disease control and prevention ( cdc ) , 2000.15 pictorial warnings were found to be more effective than text warnings . this can be due to fact that they are eye catching , informative , add on as an additional motivation in quitting tobacco consumption . majority of study participants feel that they could understand pictorial warnings . however , when they were asked to assess the pictorial warning labels many of study participants were not able to assess them correctly . thus , the mandated warnings do not serve the desired purpose since they are not properly understood . findings of this study corroborate with those of an earlier study conducted in mumbai by oswal et al ( 2011 ) and study by arora et al ( 2012 ) in five different states , which suggest that pictorial warnings that existed on tobacco packs are perceived to be ineffective by the indian population.1617 continued use of ineffective warning labels on tobacco products represents a missed opportunity as the government has failed to effectively utilise this evidence - based strategy to enhance knowledge about the effects of tobacco among the people , in addition to other educational interventions , e.g. , anti - tobacco advertising employed by the ministry of health and family welfare in india . more influential warning labels are required in order to achieve the goals set for tobacco control . this study has some limitations , such as the convenient sampling method and self - reported questionnaires that may cause several biases including recall and social desirability bias . however , strength of our study remains in the fact that it provides an overview on awareness and effectiveness of warning labels among health and non - healthcare professionals for the first time and can prove to be a benchmark for future comparisons by the public health personnel and decision makers . warning labels on tobacco packs effectively inform people about adverse health effects of tobacco . the present cross - sectional questionnaire study among 372 health and non - healthcare professionals of barwala revealed that most of study participants have noticed the warnings on tobacco products and most of them believe that they could understand warning labels . more than 70% study participants believe that warnings create awareness about health hazards of tobacco and help in reducing or quitting tobacco . health professionals were able to assess pictorial warnings more correctly as compared to non - healthcare professionals . however , mandated warnings do not serve the desired purpose since they are not properly understood . people would like to see warnings with scarier picture , textual warning in native language and mentioning about more ill effects of tobacco . findings of this study provide important lessons for india as well as other developing countries , to ensure effective and field - tested health warnings are displayed on tobacco product packages which can address all the issues related to increasing the awareness and motivation to quit tobacco consumption among all the folks and not to let governments succumb to tobacco industry pressures which can result in milder and ineffective health warnings . | background : health hazards of tobacco are well known but only small numbers of tobacco users are fully aware of the harmful effects of tobacco . warning labels on tobacco products are an effective way of communicating the consequences of tobacco use and bring about behavioural changes like quitting and reducing the tobacco consumption .
so the present study was conducted to investigate the awareness and effectiveness of warning labels on tobacco products among health and non - healthcare professional of barwala , panchkula.materials and methods : a descriptive cross - sectional survey was carried out among 408 subjects who were randomly selected from different professional colleges of barwala , panchkula .
data obtained were anlysed using descriptive statistics and chi - square test using spss 20.0.results:most of study participants has noticed the warnings on tobacco products and most of them believe that they could understand warning labels .
more that 70% believe that warnings create awareness about health hazards of tobacco and help in reducing or quitting tobacco .
pictorial warning was found to be better as compared to text warning .
health professionals were able to assess pictorial warnings more correctly as compared to non - healthcare professionals.conclusion:warning labels on tobacco packs effectively inform people about adverse health effects of tobacco but the mandated warnings do not serve the desired purpose since they are not properly understood . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
toxoplasma gondii is disseminated worldwide and is one of the most prevalent infectious agents in humans . toxoplasma gondii is an opportunistic parasite in which acute infection is usually asymptomatic in immunocompetent patients , and spontaneous recovery is the norm ( 1 , 2 ) . generally , toxoplasmosis is dependent on many factors , such as sanitation levels , temperature , humidity , and contact with soil and domestic animals , with a seroprevalence that varies from 0% to 95% ( 3 , 4 ) . the prevalence of toxoplasma gondii is about 22.5% , 0.27% - 12.9% , 23.1% , 80% , and 50% - 84% in the usa ( 5 ) , south korea ( 6 ) , turkey ( 7 ) , and brazil ( 8 , 9 ) , respectively . according to assmar et al . other studies have indicated that 55.7% of the population in the provinces of mazandaran , gilan , and khozestan ( 11 ) , 17.7% in fars and azarbayjan provinces ( 11 , 12 ) , and 68.4% in the southern region of tehran ( 11 , 13 ) are seropositive . acute toxoplasmosis is asymptomatic in 80% of healthy hosts and only 20% of adults and children exhibit symptomatic infection ( 14 ) . however the existence of toxoplasma tissue cysts in hosts may contribute to the maintenance of immunity against reinfection , and their presence may also cause symptomatic toxoplasmosis under certain conditions , especially in infants with congenital toxoplasmosis and immunocompromised patients ( 15 ) . studies have shown that renal failure patients , such as those on hemodialysis , are immunodeficient , and such patients are therefore at high risk for numerous infections ( 16 - 18 ) . no studies have been conducted regarding toxoplasmosis in hemodialysis patients in the northeast of iran . in the present study , we therefore aimed to determine the prevalence of anti - toxoplasma gondii igg , igm , and iga antibodies in hemodialysis patients with chronic kidney disease ( ckd ) in sari , iran . from july to september 2013 , this cross - sectional study was carried out on 73 patients with ckd undergoing regular hemodialysis in the hemodialysis unit of fatemeh zahra hospital at the mazandaran university of medical sciences in sari , iran . a total of 145 healthy volunteers with normal creatinine and bun levels and without any underlying renal disease ( control group ) who matched the ckd patients according to age , gender , and geographical area were selected . the study was approved by the local ethics committee , and informed consent was obtained from all the participants . medical records as well as data such as age , sex , and the length of time on hemodialysis treatment were obtained from all the hemodialysis patients . to determine the seroprevalence of toxoplasma infections , 10 ml of peripheral blood was taken under aseptic conditions from all the patients in the hemodialysis and control groups , and each sample was left for 30 - 60 minutes at room temperature for spontaneous clotting before being centrifuged at 1500 rpm for 10 minutes . the serum samples were stored in acid - washed polyethylene tubes and kept frozen at 20c until tested in referral laboratory of mazandaran university of medical sciences . anti - toxoplasma gondii igg , igm , and iga were determined using a conventional enzyme - linked immunosorbent assay ( elisa ) technique . elisa kits were purchased from the commercial manufacturer pishtazteb , iran , for the igg and igm tests , and ei 2410 - 9601 a ( euroimmun , germany ) was procured for the iga test . according to the manufacturers recommendations , igg absorbance levels < 9 were considered negative , 9 - 11 was considered borderline , and > 11 was positive ; igm absorbance levels < 0.9 were considered negative , 0.9 - 1.1 was assumed to be borderline , and > 1.1 was positive ; and an iga ratio < 0.8 was considered negative , a ratio 0.8 but < 1.1 was assumed to be borderline , while 11 was positive . in the event of a borderline test result , an additional blood sample was obtained 2 weeks later and retested in parallel with the first suspect sample . the data were analyzed using a chi - squared test , and p < 0.05 were considered statistically significant . of the 73 ckd patients , there were 40 males and 33 females aged between 28 and 88 years ( mean : 62.32 12.06 years ) . the length of time on hemodialysis treatment was 3 - 13 weeks ( mean : 12.05 1.97 weeks ) . in the control group comprising 145 healthy volunteers , there were 63 males and 82 females aged between 27 and 84 years ( mean : 55.52 11.43 years ) . in the present study , 59 of the 73 ( 80.8% ) cases in the patient group and 132 of the 145 ( 91% ) healthy volunteers ( control group ) were found to be positive for igg antibodies , and 23 ( 31.5% ) cases in the patient group and 46 ( 31.8% ) healthy volunteers ( control group ) were found to be positive for iga antibodies . the percentage of participants who were anti - toxoplasma
gondii igg - antibody positive in the control group was found to be significantly greater than in the ckd patient group , although the difference was not statistically significant for the iga antibody ( p < 0.05 ) . meanwhile , all the hemodialysis patients were negative for the anti - igm antibody , as were four ( 2.76% ) of the control group subjects , and no statistically significant difference was observed between the groups . the seroprevalence distribution of the three antibody groups and a comparison of the anti - toxoplasma antibodies present among the hemodialysis patients and healthy volunteers are shown in tables 1 and 2 , respectively . the relationship between duration of hemodialysis treatment and anti - toxoplasma
gondii antibody seropositivity was also verified , and we found a significant difference between these two parameters ( = 5.24 , p = 0.155 ) . abbreviations : m , male ; f , female ; ig , immunoglobulin . toxoplasmosis , which is an indexed global public health concern ( 8) , is an opportunistic infection that causes non - symptomatic infections in immunocompetent individuals ( 7 ) . almost equal percentage prevalence , namely 80.6% and 91% , of anti - toxoplasma gondii igg antibody was revealed in the hemodialysis patients and healthy volunteers in this study , respectively . the results of the patient group share a similar frequency with figures reported in turkey ( 76.5% ) ( 17 ) . however , the data in our study were higher than those reported by sahinl et al . ( 16 ) ( 59.1% ) and maraghi et al . ( 18 ) , ebrahim zadeh et al . ( 20 ) of 59.1% , 40.67% , 56.7% and 60% , respectively in iran , and aufy et al . ( 22 ) of 56.06% , 56.7% and 10% , respectively in turkey , egypt and mexico ; whereas in our results the percentage of anti - toxoplasma gondii igg antibody in the volunteer group was more than other studies ( 17 - 22 ) . furthermore , in our study , there were no positive cases of anti - toxoplasma gondii igm antibody in the patient group and only 2.76% of the healthy volunteer showed the igm antibody . ( 17 ) who studied hemodialysis patients and healthy volunteers in turkey . on the other hand , aufy et al . ( 16 ) , maraghi et al . ( 18 ) , ebrahim zadeh et al . ( 20 ) and nissaptorn et al . ( 23 ) studies determined 16.7% , 6.8% , 8.6 % , 13.5% , 3.3% and 5.7% respectively in the patient groups , which is not compatible with our results . the anti - toxoplasma gondii iga antibody was prevalent in 61.5% of the hemodialysis patients and 31.8% of the healthy volunteers in our study . the outcome in our study was different from those reported in certain studies where such differences may have been related to local environmental conditions . additionally , our study indicated that there was no significant association between anti - toxoplasma gondii due to igg antibody frequency and the duration of hemodialysis treatment in either sex , whereas such a correlation was shown in the studies of sahinl et al . we conducted a case - controlled study to determine the prevalence of anti - toxoplasma gondii igg , igm , and iga antibodies in hemodialysis patients with ckd in sari , mazandaran province , iran . nowadays clinicians should become more aware of these patients , and parasitological surveys should be carried out steadily to eliminate the risk of severe toxoplasmosis . additionally , it is recommended that this study be extended to include a large sample of ckd patients on hemodialysis from other cities in mazandaran province , iran . the epidemiological data collected in this study could serve as a reference for future studies and may be useful in developing preventive and educational strategies , and consequently reducing healthcare expenditure . we conducted a case - controlled study to determine the prevalence of anti - toxoplasma gondii igg , igm , and iga antibodies in hemodialysis patients with ckd in sari , mazandaran province , iran . nowadays clinicians should become more aware of these patients , and parasitological surveys should be carried out steadily to eliminate the risk of severe toxoplasmosis . additionally , it is recommended that this study be extended to include a large sample of ckd patients on hemodialysis from other cities in mazandaran province , iran . the epidemiological data collected in this study could serve as a reference for future studies and may be useful in developing preventive and educational strategies , and consequently reducing healthcare expenditure . | backgroundtoxoplasma gondii has worldwide distribution and is one of the most prevalent infectious agents in humans.objectivesthe aim of this study was to determine the prevalence of anti - toxoplasma gondii antibodies in hemodialysis patients with chronic kidney disease ( ckd ) in the hemodialysis unit of fatemeh zahra hospital at the mazandaran university of medical sciences in sari , iran.methodsseventy-three patients with ckd and 145 healthy volunteers were assessed for anti - toxoplasma gondii ( igg , igm , and iga ) antibodies using a conventional elisa technique.resultsthe anti - toxoplasma gondii igg antibody was detected in 80.8% of the cases in the patient group , while 31.5% of the cases in the ckd patient group and 31.8% in the control group were found to be positive for the anti - toxoplasma gondii iga antibody .
all the patients in the ckd group were negative for the anti - toxoplasma gondii igm antibody , although 2.76% of the healthy volunteers were found to be positive .
the present study suggests that there was no significant difference between the hemodialysis patient group and the healthy volunteers.conclusionsthe epidemiological data collected in this study could serve as a reference for future studies and may be useful in developing preventive and educational strategies , and consequently reducing healthcare expenditure . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
ovarian cancer is a heterogeneous disease with different histological types.1,2 it has a high mortality , due to the lack of sensitive and specific biomarkers and the paucity of specific symptoms in initial stages , leading to delayed diagnosis . methods for screening and early diagnosis of ovarian cancer in asymptomatic women have been ineffective.3 ovarian cancer is the most lethal gynecological cancer , and the overall survival at five years is less than 40% , with 95% survival for patients with cancer confined to the ovaries , 79% in those whose disease infiltrated into tissues adjacent to the ovaries , and 28% in those with an advanced clinical stage . most patients have advanced - stage disease at diagnosis.47 prevention is limited by inadequate knowledge regarding its causes and the lack of sensitive and specific biomarkers and available techniques for screening and early diagnosis.8 inflammation is a risk factor for ovarian cancer , and the inflammatory response is involved in almost all stages of tumor development.911 chronic inflammation is associated with the development and progression of tumors . epithelial ovarian cancer appears to be associated with inflammation , and the growth , differentiation , and signaling of these tumors appear to be regulated by cytokines.12,13 biomarker expression may reflect the subtype , tumor diagnosis , and prognosis . that is , there is variation in the rate of expression of biomarkers among ovarian carcinoma subtypes.2,14 the growth and progression of ovarian carcinoma may be due to local cytokine - induced immunosuppression , which may lead to a state of immune privilege in the site of the tumor , allowing tumor development as an escape mechanism.14 the cytokine expression may vary according to ovarian carcinoma subtype , contributing to the diagnostic and prognostic factors.2,15 this study evaluated immunohistochemical staining in stroma and epithelium of a panel of cytokines in benign and malignant ovarian neoplasms . the study group comprised 56 patients receiving treatment from may 2009 to december 2013 at the pelvic mass clinic of the obstetrics and gynecology / oncology research institute ( ipon)/uftm . all patients underwent surgical treatment according to preestablished criteria16,17 and were subsequently diagnosed with ovarian benign neoplasia or primary ovarian malignant tumor . data recorded were as follows : age , parity , race , smoking , history of hormone therapy , age at menarche and menopause , hormonal status , histological grade , international federation of gynecology and obstetrics ( figo ) stage,18 histological type , lymph node metastasis , response to chemotherapy ( complete , partial ) , and disease - free interval . in evaluating the histological grade , a pathologist reviewed the grade , dividing them into grade 1 ( well differentiated ) , grade 2 ( moderately differentiated ) , and grade 3 ( poorly differentiated ) . all procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 helsinki declaration . the research ethics committee ( uftm ) approved the study ( protocol number 1408/2009 ) . biopsies were reviewed by an experienced pathologist and the selected paraffin blocks were subjected to further cuts of 4 mm thickness , in silanized slides ( atps silano , sigma a3648 ) , using the technique of streptavidin - biotin - peroxidase . the slides were maintained at 56 c for a period of 24 hours and then were deparaffinized in three baths of xylene remaining about 5 minutes each and dried in three baths of absolute alcohol , and 80% alcohol , for about 10 seconds . subsequently , the slides remained in a phosphate buffered saline ( pbs ) for five minutes . shortly after , the excess buffer was removed and the cut edge was dried carefully . next , the slides were placed in tubes containing citrate buffer 10 mm ( ph 6.0 ) or tris - ethylenediamine tetraacetic acid ( edta ) , which was supplemented with distilled water until the limit for 30 minutes at 100 c . hydrogen peroxide was added to 3% of each section for 10 minutes for blocking endogenous peroxidase . after that , the slides were washed in pbs and incubated with the primary antibody in about 18 hours in a humid chamber with a temperature of 3 c4 c . the antibody was diluted with bovine serum albumin ( sigma ) according to the indications present in their specifications . these preparations with bovine serum albumin ( bsa 2% ) and primary antibody can block the non - specific binding , to reduce background staining . after overnight incubation at 4 c with specific primary antibody , the slides were placed at room temperature , about 15 minutes , washed in pbs , and dried . the biotinylated secondary antibody ( dako cytomation lsab and system - hrp ) was added to each slide for 30 minutes at room temperature in a humid chamber . the streptavidin peroxidase complex ( dako cytomation lsab and system - hrp ) was added for 30 minutes . the primary antibodies used were il-2 antibody ( h-133 , rabbit polyclonal igg ; sc-7896 ; lot # h0811 ; santa cruz biotechnology , inc . ) , il 5 antibody ( h-85 , rabbit polyclonal igg ; sc-7887 ; lot d0708 ; santa cruz biotechnology , inc . ) , nlc - l - il-6 antibody ( mouse monoclonal ; lot l155309 ; leica microsystems nussloch ) , il-8 rb ( e-2 ) antibody ; mouse monoclonal igg ; sc-7304 ; lot f1510 ; santa cruz biotechnology , inc . ) , il-10 antibody ( polyclonal ; lot 11042807 ; cat no . 250713 ; abbiotec ) , and p - tnfr1 ( receptor 1 tumor necrosis factor ) ( be 274 ) antibody ( rabbit polyclonal igg , lot b0509 ; sc-130220 ; santa cruz biotechnology , inc . ) ; positive controls were used . after washing in pbs , the slides were developed by the addition of a chromogen solution , diaminobenzidine ( dab ) ( dako cytomation and liquid dab substrate chromogen system ) , for five minutes . finally , the slides were immersed in three baths of absolute alcohol for about 10 seconds each , to remove excess water , and then they were washed with xylene . three observers ( mpj , am - f , and rsn ) evaluated the sections subjectively , and the intensity of staining was evaluated using the following designations : 0 ( no signal 0%10% of the labeled sectional area ) , 1 ( weak 11%25% of the labeled sectional area ) , 2 ( medium 26%50% of the marked cutting area ) , and 3 ( strong 51%100% of the labeled sectional area ) . interobserver agreement between staining intensity scores was calculated by kappa , and discordant evaluations were defined by the more experienced researcher . chi - square test with yates correction and fisher was used ( graphpad instat ) , which was considered significant if less than 0.05 . the study group comprised 56 patients receiving treatment from may 2009 to december 2013 at the pelvic mass clinic of the obstetrics and gynecology / oncology research institute ( ipon)/uftm . all patients underwent surgical treatment according to preestablished criteria16,17 and were subsequently diagnosed with ovarian benign neoplasia or primary ovarian malignant tumor . data recorded were as follows : age , parity , race , smoking , history of hormone therapy , age at menarche and menopause , hormonal status , histological grade , international federation of gynecology and obstetrics ( figo ) stage,18 histological type , lymph node metastasis , response to chemotherapy ( complete , partial ) , and disease - free interval . in evaluating the histological grade , a pathologist reviewed the grade , dividing them into grade 1 ( well differentiated ) , grade 2 ( moderately differentiated ) , and grade 3 ( poorly differentiated ) . all procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 helsinki declaration . the research ethics committee ( uftm ) approved the study ( protocol number 1408/2009 ) . biopsies were reviewed by an experienced pathologist and the selected paraffin blocks were subjected to further cuts of 4 mm thickness , in silanized slides ( atps silano , sigma a3648 ) , using the technique of streptavidin - biotin - peroxidase . the slides were maintained at 56 c for a period of 24 hours and then were deparaffinized in three baths of xylene remaining about 5 minutes each and dried in three baths of absolute alcohol , and 80% alcohol , for about 10 seconds . subsequently , the slides remained in a phosphate buffered saline ( pbs ) for five minutes . shortly after , the excess buffer was removed and the cut edge was dried carefully . next , the slides were placed in tubes containing citrate buffer 10 mm ( ph 6.0 ) or tris - ethylenediamine tetraacetic acid ( edta ) , which was supplemented with distilled water until the limit for 30 minutes at 100 c . hydrogen peroxide was added to 3% of each section for 10 minutes for blocking endogenous peroxidase . after that , the slides were washed in pbs and incubated with the primary antibody in about 18 hours in a humid chamber with a temperature of 3 c4 c . the antibody was diluted with bovine serum albumin ( sigma ) according to the indications present in their specifications . these preparations with bovine serum albumin ( bsa 2% ) and primary antibody can block the non - specific binding , to reduce background staining . after overnight incubation at 4 c with specific primary antibody , the slides were placed at room temperature , about 15 minutes , washed in pbs , and dried . the biotinylated secondary antibody ( dako cytomation lsab and system - hrp ) was added to each slide for 30 minutes at room temperature in a humid chamber . the streptavidin peroxidase complex ( dako cytomation lsab and system - hrp ) was added for 30 minutes . the primary antibodies used were il-2 antibody ( h-133 , rabbit polyclonal igg ; sc-7896 ; lot # h0811 ; santa cruz biotechnology , inc . ) , il 5 antibody ( h-85 , rabbit polyclonal igg ; sc-7887 ; lot d0708 ; santa cruz biotechnology , inc . ) , nlc - l - il-6 antibody ( mouse monoclonal ; lot l155309 ; leica microsystems nussloch ) , il-8 rb ( e-2 ) antibody ; mouse monoclonal igg ; sc-7304 ; lot f1510 ; santa cruz biotechnology , inc . ) , il-10 antibody ( polyclonal ; lot 11042807 ; cat no . 250713 ; abbiotec ) , and p - tnfr1 ( receptor 1 tumor necrosis factor ) ( be 274 ) antibody ( rabbit polyclonal igg , lot b0509 ; sc-130220 ; santa cruz biotechnology , inc . ) , the slides were developed by the addition of a chromogen solution , diaminobenzidine ( dab ) ( dako cytomation and liquid dab substrate chromogen system ) , for five minutes . finally , the slides were immersed in three baths of absolute alcohol for about 10 seconds each , to remove excess water , and then they were washed with xylene three observers ( mpj , am - f , and rsn ) evaluated the sections subjectively , and the intensity of staining was evaluated using the following designations : 0 ( no signal 0%10% of the labeled sectional area ) , 1 ( weak 11%25% of the labeled sectional area ) , 2 ( medium 26%50% of the marked cutting area ) , and 3 ( strong 51%100% of the labeled sectional area ) . interobserver agreement between staining intensity scores was calculated by kappa , and discordant evaluations were defined by the more experienced researcher . chi - square test with yates correction and fisher was used ( graphpad instat ) , which was considered significant if less than 0.05 . patients with ovarian neoplasms were divided into two study groups : benign group ( 28 patients ) and malignant group ( 28 patients ) . of those with malignant neoplasms , the mean age was 49.9 14.1 years , the mean parity was 2.2 1.7 births , the average age of menarche was 13.1 1.7 years , and the average age of menopause was 49.7 4.2 years . regarding the use of contraception , 2 patients ( 7.1% ) had used hormonal contraceptives , none used condoms , and 4 ( 14.3% ) had undergone tubal ligation . one patient ( 2.5% ) used hormone replacement therapy , and six patients ( 21.4% ) were smokers . in relation to hormonal status , 10 ( 35.7% ) were premenopausal , and 18 ( 64.3% ) were postmenopausal . of those with benign neoplasms , the mean age was 47.6 10.5 years , the mean parity was 2.8 1.8 births , and the average age of menarche was 13.1 1.6 years . regarding the use of contraception , six patients ( 21.4% ) had used hormonal contraceptives , none used condoms , and 13 ( 46.4% ) had undergone tubal ligation . two patients ( 7.1% ) used hormone replacement therapy , and six patients ( 21.4% ) were smokers . in relation to hormonal status , 17 ( 60.7% ) were premenopausal , and 11 ( 39.3% ) were postmenopausal . in relation to figo stage , 13 patients ( 46.4% ) were in stage i , 1 ( 3.6% ) was in stage ii , 12 ( 42.9% ) were in stage iii , and 2 ( 7.1% ) were in stage iv . histological types of malignant neoplasms included 1 ( 3.6% ) papillary adenocarcinoma , 1 ( 3.6% ) endometrioid adenocarcinoma , 1 ( 3.6% ) clear cell carcinoma , 1 ( 3.6% ) borderline serous cystadenocarcinoma , 2 ( 7.1% ) adenocarcinomas , 2 ( 7.1% ) mucinous cystoadenocarcinomas , 2 ( 7.1% ) serous cystadenocarcinomas , 8 ( 28.6% ) papillary serous adenocarcinomas , and 9 ( 32,1% ) borderline mucinous cystadenocarcinomas . for benign ovarian neoplasms , the histological types were : 1 ( 3.6% ) serous cystadenoma and brenner tumor , 2 ( 7.1% ) mucinous cystadenoma and brenner tumor , 9 ( 32.1% ) mucinous cystadenomas , and 16 ( 57.1% ) serous cystadenomas . the epithelial and stromal stainings in benign and malignant ovarian tumors are presented in table 1 . stromal and epithelial tnfr1 and il-5 , and stromal il-10 had more frequent immunostaining 2/3 in benign neoplasms compared with malignant tumors . malignant tumors had more frequent immunostaining 2/3 for epithelial and stromal il-2 in relation to benign tumors . the immunostaining 0/1 of il-8 was more frequent in the stroma of benign neoplasms compared with malignant neoplasms . tables 2 and 3 show the relationship between cytokines studied and prognostic factors . in the ovarian cancer stroma evaluation , histological grade 3 was significantly correlated with staining 2/3 for il-2 ( p = 0.004 ) . women whose disease - free survival was less than 2.5 years had tnfr1 stromal staining 2/3 ( p = 0.03 ) more frequently . this study evaluated potential cytokines that can be used as diagnostic and prognostic markers in ovarian cancer . the immune response profile , in which differentiation and proliferation occur in response to the production of certain cytokines , is capable of contributing to the induction of apoptosis and tumor regression control.19 the ability to intervene and intensify the action of the immune system to produce a beneficial antitumor response remains an area of intense research . the development of cancer may indicate a failure in the immune response , such as a tumor escape mechanism . tumor cells exhibit a variety of mechanisms that enable them to overcome immunodetection and destruction , making immune responses ineffective.20 tnfr1 was expressed predominantly in the epithelium and stroma of benign neoplasms , showing strong staining , compared with malignant neoplasms ( p = 0.01 for epithelium and p = 0.001 for stroma ) . by activating proteolytic enzymes such as caspases , tnf- is capable of triggering a cascade of reactions , culminating in apoptosis of tumor cells.21,22 most tissues with immunostaining of 2/3 for il-2 were malignancies . il-2 stimulates the proliferation and activation of natural killer cells , thus having antitumor activity.23 regarding il-5 , immunostaining of 2/3 was more frequent in benign neoplasms in both the epithelium and the stroma . to our knowledge , this is the first study that demonstrates a difference between benign and malignant neoplasms in immunostaining for il-2 and il-5 , suggesting the important role of these cytokines as targets for future research evaluating new diagnostic markers in ovarian cancer . most weak il-8 immunostaining of tissue stroma was found in benign neoplasms , with scores of 0/1 . regarding il-10 , the stroma of benign neoplasms more frequently demonstrated immunostaining of 2/3 than did that of malignant neoplasms . il-10 alters the differentiation , maturation , and function of dendritic cells , increasing their spontaneous apoptosis and interfering with the induction of antitumor responses.24 in normal ovarian cells , il-10 probably maintains its original autocrine role by inhibiting the secretion of numerous other cytokines , such as il-1 , il-6 , tnf- , and other growth factors essential for tumor progression and development.15,25,26 when the prognostic factors were evaluated , our study showed weak expression ( 0/1 ) of stromal il-2 in patients with well and moderately differentiated malignancies and a stronger expression ( 2/3 ) in poorly differentiated neoplasms . il-2 aids the growth and differentiation of t- and b - lymphocytes and stimulates growth and maturation of natural killer cells and dendritic cells.27,28 in ovarian cancer , there is no study showing a relationship between il-2 and prognostic factors . u / ml , il-4 < 159 pg / ml , and il-8 > 339 pg / ml were related to stage i or ii invasive colorectal cancer , in which there is no infiltration of the lymph nodes.29 women whose disease - free survival was less than 2.5 years had tnfr1 stromal staining 2/3 more frequently . this suggests that strong staining of tnfr1 in a malignant neoplasm may be a poor prognostic factor . the secretion of tnf- is one of the immune escape mechanisms of the tumor , deviating the immune response toward a th2 profile.30 studies suggest that tnf- leads to chronic inflammation , angiogenesis , and other processes , which promote the initiation , growth , and spread of the tumor.31 many studies have associated inflammation with ovarian tumorigenesis , with tnf- playing a key role in modulating invasion , angiogenesis , and metastasis.3234 antibodies that recognize tumor - associated antigens may help in the pathological diagnosis of cancer and help define the prognosis and detection of recurrent cancer.20 in particular , it is important to understand whether multiple tumor sites within a given patient have different immunologic micro - environments . increased heterogeneity in these pathways may reflect underlying differences in stroma biology and inflammatory response intrinsic to the various sites.35 this could explain the heterogeneous response of cytokine expression profile . stromal cells have different gene expression profiles that contribute to the heterogeneity of the tumor . the understanding of their role in tumor development is necessary in the search for new therapies that interfere with carcinogenesis.36,37 the peritumoral stroma can control tumor growth and invasion . the interaction between neoplastic cells and the stroma is a very important factor for tumor growth.38 therefore , the stromal compartment has been the subject of studies related to the prognosis of several cancers . the role of specific cytokines to the development , diagnosis , and prognosis of ovarian cancer is not well known . there are no published studies showing an immunohistochemical panel of cytokines in malignant and benign neoplasms and their correlation with prognostic factors . in the future , we plan to identify a panel of immunohistochemical markers that may help in the prognosis and treatment of ovarian cancer , as treatment currently is restricted to surgery and chemotherapy , with few options for targeted therapies . our study can be the first step toward the discovery of an immunohistochemical panel in ovarian cancer to determine the likely prognosis and best treatment of the disease , which could be based on targeted therapies related to il-2 and tnf-. the peritumoral stroma seems to have a more important role than the epithelium in tumor progression . continued analysis of the relationship between cytokines and ovarian carcinoma might help us to design a novel immunotherapy . il-2 and tnfr1 stromal immunostainings are related prognostic factors in ovarian cancer and can be the target of new therapeutic strategies . | introductionovarian cancer has a high mortality and delayed diagnosis .
inflammation is a risk factor for ovarian cancer , and the inflammatory response is involved in almost all stages of tumor development .
immunohistochemical staining in stroma and epithelium of a panel of cytokines in benign and malignant ovarian neoplasm was evaluated .
in addition , immunostaining was related to prognostic factors in malignant tumors.methodthe study group comprised 28 ovarian benign neoplasias and 28 ovarian malignant neoplasms .
a panel of cytokines was evaluated by immunohistochemistry ( th1 : il-2 and il-8 ; th2 : il-5 , il-6 , and il-10 ; and tnfr1 )
. chi - square test with yates correction was used , which was considered significant if less than 0.05.resultstnfr1 , il-5 , and il-10 had more frequent immunostaining 2/3 in benign neoplasms compared with malignant tumors .
malignant tumors had more frequent immunostaining 2/3 for il-2 in relation to benign tumors .
the immunostaining 0/1 of il 8 was more frequent in the stroma of benign neoplasms compared with malignant neoplasms .
evaluation of the ovarian cancer stroma showed that histological grade 3 was significantly correlated with staining 2/3 for il-2 ( p = 0.004 ) .
women whose disease - free survival was less than 2.5 years had tnfr1 stromal staining 2/3 ( p = 0.03 ) more frequently.conclusionil-2 and tnfr1 stromal immunostaining are related prognostic factors in ovarian cancer and can be the target of new therapeutic strategies . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
we present a case of disseminated cysticercosis with extensive central nervous system ( cns ) involvement and extracranial dissemination in a young woman , which presented as a case of affective mood disorder with the chronic tension type headache . the extra - cranial dissemination involved atypical head and neck regions such as posterior pharyngeal wall , masseter , pterygoids , paravertebral neck muscles and tongue . though cysticercosis is the most common helminthic infection of the , cns disseminated cysticercosis is rare . a few cases of neurocysticercosis presenting with psychiatric complaints have been reported , but there have been no reported cases of disseminated neurocysticercosis presenting with depression . a 21-year - old woman residing in new delhi presented to the department of medicine with a history of insidious onset , progressive headache on and off for the past 6 months . the headache was bilateral , dull aching in nature occurring at any time of the day and had no special character or precipitating factors . it was associated with fatigue , low mood , irritability and loss of appetite , multiple somatic pains and crying spells . initially , the headache was relieved by over the counter analgesics , but it used to recur after a few days . after 2 months of persistent symptoms , she had consulted a physician where she had been diagnosed to have tension type headache . a formal psychiatric evaluation done at that time revealed minor depressive episode . when her symptoms did not abate she was started on amitriptyline 25 mg once daily for prophylaxis of chronic tension type headache . there was no history of blurring of vision , diplopia , squint , pain , redness or watering of eyes . her elder sister had a history of seizure disorder for which she had been taking anti - epileptic drugs for the past 2 years . a contrast enhanced magnetic resonance imaging was done , which showed multiple cystic lesions with eccentric nodules in bilateral basal ganglia , cerebellum , brainstem , cerebral hemispheres ; a few of them indenting the lateral ventricle . similar lesions were seen in the scalp , posterior pharyngeal wall , masseter , pterygoids , paravertebral neck muscles and tongue [ figure 1 ] . there was a single lesion in left orbit abutting the superior rectus and a single lesion in the right orbit abutting the optic nerve [ figures 2 and 3 ] . x - ray of the thigh showed multiple cigar shaped calcifications [ figure 4 ] . her complete blood count , liver function test , kidney function test were within the normal limits . based on the imaging findings a definite diagnosis of neurocysticercosis with extra - cranial dissemination was made . she was started on albendazole with oral steroids and neuroimaging follow - up was planned . after 2 months follow - up , her headache had decreased and she did not complain of any myalgia . magnetic resonance imaging showing cystic lesions in masseter , pterygoids , tongue and cerebral hemispheres magnetic resonance imaging brain showing multiple hypodense lesions in bilateral brain parenchyma with scolices and surrounding edema . single cystic lesion in left orbit abutting optic nerve magnetic resonance imaging brain with cystic lesion in right orbit compressing optic nerve and superior oblique muscle plain x - ray of thigh showing multiple cigar - shaped calcifications consumption of measly pork containing cysticerci leads to intestinal teniasis , but does not directly cause cysticercosis . when cysticerci involve the cns it leads to neurocysticercosis . cases of disseminated cysticercosis have been reported from india with involvement of subcutaneous tissues , skeletal muscles , heart , lungs , spleen , pancreas and liver . cysticerci are uncommon in the head and neck region apart from the orbit but cases of cysticerci of tongue , masseter , mylohyoid , lower lip , soft palate and sternocleidomastoid have been reported previously . neurocysticercosis can present with seizures , headache , focal neurological deficit , encephalitis , dementia . neurocysticercosis presenting as extrapyramidal disease ( parkinsonism and focal dystonia ) , kluver - bucy syndrome , weber 's syndrome and cortical blindness have also been reported . hamed and el - metaal reported a case of neurocysticercosis presenting with depressive manifestations together with disturbance of writing , mild deep sensory loss , limb - kinetic apraxia , lack of coordination and dystonia of the right upper limb . disseminated cysticercosis presenting as a mood disorder and mimicking a primary headache disorder has not been reported before . in our patient our patient was treated with albendazole and oral steroids according to the consensus guidelines published by garca et al . traditionally , tension type headache has been believed to have a psychological basis . even though studies have proved the neurobiological basis of these headaches , the psychological connotations of this diagnosis remain in the minds of physicians and it is easy to leap to this diagnosis in a clinical background of low mood , crying spells and other psychiatric complaints . routine use of imaging modalities may be justified to rule out neurocysticercosis in endemic areas before making a diagnosis of a primary headache disorder . an early diagnosis of cysticercosis and cysticidal treatment can prevent considerable morbidity in this setting . | neurocysticercosis is a common parasitic infection in india presenting usually with seizues , headache , focal neurological deficits .
neurocysticercosis presenting as a psychiatric illness is rare .
disseminated cysticercosis with involvement of central nervous system and head and neck muscles is rare even in endemic areas .
we present a case of disseminated cysticercosis , which presented with chronic tension type headache and affective mood disorder .
treatment with cysticidal drugs led to complete remission of psychiatric complaints .
in endemic areas history suggestive of mood disorder should not be used as supportive evidence of a primary headache syndome like tension type headche without ruling out secondary causes .
making an early diagnosis can prevent morbidity . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
endomyocardial fibrosis ( emf ) is an idiopathic disease that is mostly confined to the tropical and subtropical rainforest regions of the world.1 however , subsequent reports have shown its occurrence in the guinea savannah of nigeria,2,3 and even outside the tropical zones.47 it is the most common cause of restrictive cardiomyopathy worldwide.8 the disease causes fibrosis of the endomyocardium of the ventricles , leading to impaired filling and subsequent heart failure of the affected ventricle.9 the right ventricle is the most commonly affected , followed by biventricular and then left ventricular involvement.9 although several theories have been put forward as to the etiopathogenesis of emf , there is no consensus of opinion on any of these , and the disease has therefore remained an enigma.10 there are reports that the prevalence of emf is decreasing globally , hence this study was undertaken to determine the prevalence of emf as well as any changing patterns at ladoke akintola university of technology teaching hospital , osogbo , south - west nigeria . this was a retrospective descriptive study involving review of all medical admission cases , and all cases seen at the cardiology clinic and medical outpatient / specialty clinics at ladoke akintola university of technology teaching hospital , osogbo , south - west nigeria , over a 7-year period covering january 2003 to december 2009 . more than half ( n = 7956 ) of these patients were attending the cardiology clinic . demographic , clinical , investigation , treatment , and follow - up data were retrieved from the case notes of patients identified to have emf . demographic data collected included age , gender , religion , occupation , marital status , and socioeconomic background . ethical approval was given by the ethical committee of ladoke akintola university of technology teaching hospital . the total number of patients attending our medical outpatient and cardiology clinics in the period spanning january 2003 to december 2009 was 12,794 , with a subset of 7956 attending the cardiology clinic . only three cases of emf were found , giving an emf prevalence in the study period of 0.04% and 0.02% for those attending the cardiology clinic and the medical outpatient clinics , respectively . there was one male and two females , giving a male to female ratio of 1:2 . the mean age was 25 4.95 years , with an age range of 1730 years , whilst the duration of symptoms before reporting at our center was 35 years . the two female patients had new york heart association class iii disease , necessitating admission to stabilize them . all three of these patients had right ventricular emf with atrial fibrillation and no eosinophilia . figure 1 shows the electrocardiogram of patient no 1 after having had amiodarone for some months to control the atrial fibrillation . low voltage recording in most leads and frequent atrial ectopics are seen with atrial fibrillation in lead avf . figure 2 shows a recent chest x ray of patient no 2 with globular heart and oligaemic lung fields . the two female patients are still attending the clinic , but the male patient was lost to follow - up . 0.04% for all medical cases , which compares favorably with a study in enugu , south - east nigeria , in which the prevalence of emf was found to be 0.09% and 0.8% amongst admitted cases and echo - scanned cases , respectively.11 this contrasts with a prevalence of 10% obtained in nigeria during the 1960s and 1970s.9 in 2001 , falase indicated that the prevalence of emf might have decreased.9 in kampala , uganda , where a high prevalence of 10%15% was reported in the 1960s by davies,12,13 a very low prevalence of 0.08% based on autopsy of 147 patients was reported by farrer - brown and jarbit at the mulago hospital in 1972.14 similarly in kerala , india , the number of newly diagnosed cases of emf decreased from 20 per year in 19761999 to 10 per year in 19912001 , and to 78 per year in 20012007 , further underscoring the global decline in prevalence of emf.15,16 the majority of studies that reported a prevalence of 10% in nigeria were carried out in south - west nigeria , which is located in the heart of the tropical rain forest . this is also the location of the tertiary health facility reporting this very low prevalence . more recently , a study of 1441 cardiac patients referred for echocardiography at a tertiary health facility in abeokuta , south - west nigeria , did not find a single case of emf.17 the decline in the prevalence of emf from 10% in the 1960s and 1970s to 0.02% in medical patients and 0.04% in cardiology patients in our study may be due to improvement in primary to tertiary health care delivery in the 21st century in nigeria . a lot of emphasis had been placed on primary health care since the mid 1980s to provide basic health care to the whole population , and coupled with this is the issue of free health care by different state governments across the country at both the primary and secondary health care levels . also , the federal , state , and local governments have established and equipped more health facilities at all levels . more training institutions for doctors , nurses , community health extension workers , and other health care workers have also been established . there are now better facilities at all tertiary facilities , with every center having an echocardiography machine , hence it is easier to diagnose most cardiac lesions noninvasively . there is also a lot of aid from international bodies and communities to help stem the tide of all types of infection . the overall effect of this is better control of infection , and early and prompt treatment of infected people . we are of the opinion that the etiology of emf may be infections and/or parasites as hypothesized in earlier studies , and hence the fall in incidence of the disease with improved infection control . there is now an epidemiological transition under way in sub - saharan africa from communicable diseases to noncommunicable diseases , further underscoring the fact that infectious diseases are on a downward trend . a recent study performed in the same center as the current study showed that 44.99% of total admissions over a 3-year period were due to noncommunicable diseases.18 the male to female ratio of 1:2 seen in this study is at variance with the previously reported gender distribution for emf in africa . darbela et al reported a ratio 1:1 for 56 autopsies in uganda,19 and in an 8-year study , andy et al reported a ratio of 3.1:1 for 41 cases in south - west nigeria and 3.1:1 for 48 cases in south - east , nigeria.1 similarly , ike et al , working in south - east nigeria , reported male to female ratios of 1.3:1 for adults , 1:1 for pediatric cases , and 3:1 for cases diagnosed by echocardiography.11 hence the gender distribution is not helpful , having shown a lot of inconsistency over the years . the mean age of the cases in our study was 25 4.95 ( range 1730 ) years , because data were retrieved only for adult cases . however , it had been shown that people of any age can be affected.20 further , the age range in the study done by ike et al was 2.574 years.11 a recent study in kerala , india , showed that most of the 54 newly diagnosed patients were older than 30 years , with only 23% being younger than 10 years ; however , two of the patients ( 3.7% ) were older than 60 years.16 duration of symptoms was 35 years , even in our only male patient , who presented with florid signs and symptoms of chronic right - sided heart failure . this is a common finding in this environment , whereby most of our patients present very late to the hospital and do not report the correct duration of symptoms . all the three patients presented to hospital during the rainy season ( april october ) , as had been reported in other studies in nigeria.21,22 table 2 shows the results of the relevant investigations done for the three patients in this study . this is in agreement with the majority of the work done in nigeria.9,11,23 however , some studies have shown that autopsies may reveal left ventricular or biventricular emf despite the preponderance of clinical right ventricular emf.1,24 all the patients had low voltage complexes on electrocardiography but only two had pericardial effusion . low voltage complexes are usually caused by myocardial fibrosis with or without pericardial effusion.25 complete or incomplete right bundle branch block was common , indicating conduction pathway disruption on the right side . atrial arrhythmias are common , especially atrial fibrillation,6,9,16,25 which was found in all of the study patients . electrocardiography in patients with emf is usually nonspecific or sensitive,2,6 and similarly the chest x - ray ; these investigations only act as leads to the possible diagnosis and support the echocardiography findings . eosinophilia was not found in any of our patients , as reported earlier by some other studies performed in the same environment as this current study , where a strong association was found between hypereosinophilia induced by helminthes / microfilaria and endomyocardial fibrosis.1,26,27 conservative treatment with frusemide , spironolactone , and warfarin was given . amiodarone was then offered to the patients as needed to control atrial fibrillation , because financial constraints precluded their referral for definitive surgery . the prevalence of emf in our study area has declined from 10% in the 1960s and 1970s to 0.02% for medical cases and 0.04% for cardiac cases . emf essentially remains a poorly understood restrictive cardiac disease , although its prevalence is now on the decline globally . we suggest that the decline in the tropics is due to better control of communicable diseases occasioned by an improved health care delivery system in the last few decades . more studies still need to be done to follow this trend of prevalence and offer plausible answers to the mystery surrounding its etiology and possible preventive strategies . | background : endomyocardial fibrosis ( emf ) is a restrictive cardiomyopathy , the prevalence of which is declining globally .
this study was carried out to determine if there were changing patterns in its local prevalence in south - west nigeria.methods:we reviewed the medical records of all patients admitted to or attending the cardiology clinic or medical outpatient / specialty clinics in the department of medicine , ladoke akintola university of technology teaching hospital , osogbo , south - west nigeria .
medical data for those with emf from january 2003 to december 2009 were retrieved and analyzed.results:only three cases of emf were identified from a total of 12,794 medical patients containing a subset of 7956 cardiac patients .
the prevalence of emf was 0.02% and 0.04% for medical and cardiac patients , respectively .
all the patients with emf were in the second or third decades of life , and had right ventricular emf and atrial fibrillation , but no eosinophilia.conclusion:this study shows that the prevalence of emf has declined in the study area from 10% in the 1960s and 1970s to 0.02% for medical cases and 0.04% for cardiac cases in the first decade of the 21st century .
right ventricular emf still predominates , but without eosinophilia .
improved health care delivery s positive impact on the control of communicable diseases might be responsible for these observed changes .
more work needs to be done both within and outside nigeria to follow this trend and unravel the mystery surrounding this poorly understood cardiac disease . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
, world health organization recommends directly observed treatment short course ( dots regimen ) for all cases of both pulmonary and extrapulmonary tuberculosis.11 the dots strategy is based on intermittent drug intake and short - course therapy , and it also includes tenets such as political commitment , good management practices , and the direct observation of doses to ensure compliance . to date , dots remains the keystone of global efforts at tuberculosis control.1213 however , there are no published data on the effectiveness of dots regimen in spinal tuberculosis . this study assesses the effectiveness of dots regimen in spinal tuberculosis , the frequency and type of side effects , and the effect of the regimen in the various stages of the disease . fourty nine consecutive cases of spinal tuberculosis were treated with dots regimen from june 2004 to january 2007 . a case of spinal tuberculosis was diagnosed in the presence of the following criteria : the clinical features like persistent localized back pain , constitutional symptoms such as loss of weight , loss of appetite and evening rise of temperature , physical signs like localized tenderness , reduced range of movement , cold abscess , spinal deformity , and laboratory findings like raised erythrocyte sedimentation rate ( esr ) and raised c reactive protein . the x - ray features include regional osteopenia , fussy disc margins reduction / obliteration of the disc space , loss of anterior vertebral body height and kyphotic deformity with paravertebral shadow [ figure 1 ] . ( a ) x - ray lumbar spine lateral view at presentation showing narrowing of l3/4 disc space with end plate erosion . ( b and c ) t2w mri mid sagittal and coronal views showing hyperintense / contrast enhancement suggestive of edema / inflammation involving bodies of l 1 , l 2 , l 3 with end plate irregularities and disc space narrowing at l 2 l 3 . there is hyper intense / contrast enhanced para vertebral abscess / soft tissue component extending from l1to l 3 level . the para spinal muscles are edematous ( d ) the same patient after 9months of dots showing healing with bony fusion positive bacteriological findings by either culture or positive real - time polymerase chain reaction ( rtpcr ) for mycobacterium tuberculosis in the aspirated sample from the lesion . patients above the age of 15 years with histopathological evidence of spinal tb or strong clinicoradiological evidence of tuberculosis with no gross muscle weakness ( mrc grade 3 or more ) or severe kyphosis with a minimum followup of 2 years was included in the study . patients who ceased treatment before 6 months or those in whom surgical decompressions were done or human immunodeficiency virus ( hiv ) positive were excluded . patients who were suspected to have spinal tuberculosis were investigated by blood investigations , x - rays , magnetic resonance imaging , percutaneous ct - guided needle biopsy for culture , histopathology , and rtpcr for m. tuberculosis as required . of the 49 patients , ct - guided tissue sample was taken for biopsy , culture and rt - pcr in 40 patients , 32 patients had histopathological or bacteriological confirmation , and eight had inconclusive evidence such as scanty aspirate or blood only . all patients were given dots therapy after liver function tests ( lft ) and an ophthalmological evaluation . all the drugs were given free of cost and drug quality was assured by the concerned health bodies under revised national tuberculosis control programme ( rntcp ) of government of india . patients were treated as inpatients during the initial 2 to 3 days of treatment , in order to watch for any adverse drug reaction . once the patient was tolerating the treatment well , patients were discharged and sent to the nearest dots provider . patients who were ambulatory at the time of diagnosis were kept ambulatory during treatment with spinal brace , with restriction of heavy and load - bearing activities . all patients with spinal tuberculosis were treated by category i dots regimen used for seriously ill extrapulmonary disease . this consisted of four drugs ( inh , rifampicin , ethambutol , and pyrazinamide ) administered under direct observation by a trained personnel , three times a week for two months , followed by two drugs ( inh and rifampicin ) , thrice weekly for seven months or until regression of symptoms along with laboratory and radiological signs of resolution , whichever was later.14 laboratory signs of healing include return of esr to normal and correction of lymphocytosis . radiological signs of healing includes , return to normal bone density and sclerosis and reduction in paravertebral soft tissue shadow in x - ray , and regression of pathological soft tissue swelling on magnetic resonance imaging.15 compliance was ensured using frequent field visits , random checking , quality assessment protocols , and modern management principles by rntcp personnel . patients were asked to come for followup to our department every month for two months and then once in two months till the treatment is completed . during each followup visit , physical and neurologic examination findings were recorded , complete blood counts with esr and lft were monitored and followup x - rays were taken . ophthalmology consultation was done at the beginning of treatment and on first followup to rule out optic neuropathy due to ethambutol . if there was no positive response in clinical , radiological , and laboratory parameters after 12 - 16 weeks of treatment or if there is worsening during this period , then patients were suspected to be clinically resistant to first - line antituberculous drugs or having compressive lesion and were subjected to anterior decompression and instrumentation along with afb culture and sensitivity of the specimen . if found to be resistant to primary - line drugs , additional drugs were started , as per dots protocol , consisting of streptomycin + isonicotinyl hydrazine + rifampicin + ethambutol + pyrazinamide + moxifloxacin + cycloserine , pending culture and sensitivity results.16 second line drugs for drug - resistant tuberculosis include kanamycin , ciprofloxacin , sparfloxacin , ethionamide , etc.17 however , none of the patients in this study was found to have drug resistance . in case of drug intolerance like persistent allergic rash , rising increase in liver enzyme levels drug therapy was altered as per the advice of the pulmonologist , this was done by stopping all the drugs for 2 to 3 days , then introducing one drug at a time over the next 10 to 15 days while keeping the patient admitted and monitoring the patient clinically and by lft . if the neurological deficit progressed , the patients were subjected for a surgical decompression . on completion of 9 months of anti tuberculous therapy ( att ) , if the patient is relieved of pain and other symptoms , esr was back to normal , and imaging studies showed signs of healing , then treatment was stopped . so , there was at least 12-to 15-month gap after completion of att when outcome was assessed . however , if the patient is having persistent pain , elevated esr , progression of neurological deficit , increase in size of the abscess , or progression of kyphosis , the treatment was continued and surgical intervention by anterior decompression and instrumentation was done . in patients with neurological deficits , a radiological staging of the disease was done based on the table 1.5 the radiological assessment was done by four independent observers ( two radiologists and two orthopedic surgeons ) in order to avoid bias . while grading the final outcome , the following criteria were taken into consideration:15
clinical evidence of healing evaluated by relief of symptoms , marked reduction in pain , increase in physical endurance,18 and decreased esr.radiological signs of healing by means of x - ray , i.e. , cessation of bone destruction , appearance of the normal trabecular pattern , correction of osteopenia , bone block or bony ankylosis , and regression in the size of the abscess were assessed [ figure 2].14completion of dots therapy without fail for at least 9 months.frequency and nature of adverse drug reactions.severe progression of kyphosis ( > 30 degree from beginning the treatment ) at affected level at the end of treatment / severe side effects that forced to discontinue treatment.failure of treatment by nine months , like patient having persistent pain , elevated esr , progression of neurological deficit , increase in size of the abscess , or progression of kyphosis , necessitating continuation beyond 9 months / addition of drugs.failure of nonoperative treatment and/or progression of neurological deficit requiring surgical intervention .
clinical evidence of healing evaluated by relief of symptoms , marked reduction in pain , increase in physical endurance,18 and decreased esr . i.e. , cessation of bone destruction , appearance of the normal trabecular pattern , correction of osteopenia , bone block or bony ankylosis , and regression in the size of the abscess were assessed [ figure 2].14 completion of dots therapy without fail for at least 9 months . frequency and nature of adverse drug reactions . severe progression of kyphosis ( > 30 degree from beginning the treatment ) at affected level at the end of treatment / severe side effects that forced to discontinue treatment . failure of treatment by nine months , like patient having persistent pain , elevated esr , progression of neurological deficit , increase in size of the abscess , or progression of kyphosis , necessitating continuation beyond 9 months / addition of drugs . sequential series of x - rays in a 50year old female with thoracolumbar tb ( a ) at presentation , ( b ) at 4months and at 10months , ( c ) showing the destruction of the joint space and erosion of the endplates initially followed by bony fusion and bone block formation by around 9 months of dots . this patient had an atypical sclerotic appearance , however the diagnosis was confirmed by a ct guided biopsy on this basis , results were classified into the following four groups:14 excellent result : complete resolution of disease with dots regimen for 9 months , with no residual disability or deformity and absent or minor adverse drug reactions . good result : complete resolution of disease with dots regimen for 9 months with no residual disability or deformity and with the occurrence of medically manageable side effects of drug therapy , such as gastrointestinal intolerance , drug - induced jaundice , etc . fair result : complete resolution of disease , but with a post - treatment kyphosis deformity of 30 degrees or more at the affected level or the patients had to be shifted to second line drugs , or patients who are having mild residual pain which is however not limiting their physical activity . poor result : cases that did not respond to conservative treatment , primary or secondary line , had a deteriorating neurological deficit and had to be operated . in patients with neurological deficits , neurological grading based on the mrc grading was assessed in detail . a radiological staging of the disease was done based on the table 1.5 the radiological assessment was done by four independent observers ( two radiologists and two orthopedic surgeons ) in order to avoid bias . while grading the final outcome , the following criteria were taken into consideration:15
clinical evidence of healing evaluated by relief of symptoms , marked reduction in pain , increase in physical endurance,18 and decreased esr.radiological signs of healing by means of x - ray , i.e. , cessation of bone destruction , appearance of the normal trabecular pattern , correction of osteopenia , bone block or bony ankylosis , and regression in the size of the abscess were assessed [ figure 2].14completion of dots therapy without fail for at least 9 months.frequency and nature of adverse drug reactions.severe progression of kyphosis ( > 30 degree from beginning the treatment ) at affected level at the end of treatment / severe side effects that forced to discontinue treatment.failure of treatment by nine months , like patient having persistent pain , elevated esr , progression of neurological deficit , increase in size of the abscess , or progression of kyphosis , necessitating continuation beyond 9 months / addition of drugs.failure of nonoperative treatment and/or progression of neurological deficit requiring surgical intervention . clinical evidence of healing evaluated by relief of symptoms , marked reduction in pain , increase in physical endurance,18 and decreased esr . radiological signs of healing by means of x - ray , i.e. , cessation of bone destruction , appearance of the normal trabecular pattern , correction of osteopenia , bone block or bony ankylosis , and regression in the size of the abscess were assessed [ figure 2].14 completion of dots therapy without fail for at least 9 months . frequency and nature of adverse drug reactions . severe progression of kyphosis ( > 30 degree from beginning the treatment ) at affected level at the end of treatment / severe side effects that forced to discontinue treatment . failure of treatment by nine months , like patient having persistent pain , elevated esr , progression of neurological deficit , increase in size of the abscess , or progression of kyphosis , necessitating continuation beyond 9 months / addition of drugs . sequential series of x - rays in a 50year old female with thoracolumbar tb ( a ) at presentation , ( b ) at 4months and at 10months , ( c ) showing the destruction of the joint space and erosion of the endplates initially followed by bony fusion and bone block formation by around 9 months of dots . this patient had an atypical sclerotic appearance , however the diagnosis was confirmed by a ct guided biopsy on this basis , results were classified into the following four groups:14 excellent result : complete resolution of disease with dots regimen for 9 months , with no residual disability or deformity and absent or minor adverse drug reactions . good result : complete resolution of disease with dots regimen for 9 months with no residual disability or deformity and with the occurrence of medically manageable side effects of drug therapy , such as gastrointestinal intolerance , drug - induced jaundice , etc . fair result : complete resolution of disease , but with a post - treatment kyphosis deformity of 30 degrees or more at the affected level or the patients had to be shifted to second line drugs , or patients who are having mild residual pain which is however not limiting their physical activity . poor result : cases that did not respond to conservative treatment , primary or secondary line , had a deteriorating neurological deficit and had to be operated . eight were excluded due to , lost of followup ( n=3 ) , expired ( n=2 ) and discontinuation of att ( n=3 ) by patients , one during the treatment due to myocardial infarction unrelated to the treatment and the other one after successful completion of the treatment due to unrelated cause . there were 22 males and 19 females with an average age of 41.1 years ( range 15 to 72 years ) . most of the patients ( 22% , n=9 ) belonged to the 21 to 30 years age group . the mean duration of the symptoms was 3.2 months ( sd = 5.29 ) with a maximum of 2 years and a minimum of 2 weeks . the average esr at the beginning of the treatment was 91.1 ( sd = 18.07 ) with a maximum esr of 120 and a minimum of 44 . the fall in esr was not so marked in the initial 1 month but it fell steeply in the next few months and stabilized by around 4 to 6 months . the thoracic spine was involved in 29.3% ( n=12 ) , thoracolumbar junction in 24.4% ( n=10 ) , the lumbar and sacral vertebrae involved in 46.3% ( n=19 ) . twelve patients ( 29.3% ) showed mild angular kyphosis with 2 to 3 vertebral involvement . the angle of kyphosis ranged from 12 to 34. the mean angle of progression of kyphosis at the site was less than 8 at the site of kyphosis . only one patient had progression to greater than 40 ; however , there was no neurological deficit . 48.7% ( n=20 ) of the patients had adverse drug reactions like nausea , skin rashes , and abdominal discomfort but only one of them was severe enough to warrant change of drug . 12.2% ( n=5 ) of the patients had gastric disturbances like vomiting and abdominal discomfort , which was relieved by antacids and h2 antagonists . another 12.2% ( n=5 ) had marginally elevated liver enzymes , of which only one patient was symptomatic ( 2.5% ) . one patient developed severe hypersensitivity to pyrazinamide and had to be substituted with second line drugs as per the pulmonologist 's advice . of the three with poor results , two patients had no improvement even after further 2 months of intermittent short - course chemotherapy and had to undergo surgical decompression after which they improved with the continuation of dots regimen . the third patient was a 58-year - old male with t11/12 spinal tuberculosis with grade iii power in lower limbs , whose neural deficit improved on non operative treatment ; however , he did not have complete symptomatic relief at 9 months . there was no significant difference between the outcomes depending on the different level of involvement . the clinical outcome was irrespective of the number of vertebral involvement or the level of involvement . after creating a 2 2 table with predestructive and early destructive groups as early presenters and the rest as late presenters , and also combining excellent and good as favorable outcome and fair and poor as unfavorable response , a fishers 2-tailed exact test was done [ table 3 ] . outcome of dots in various stages of spinal tuberculosis 2 2 tables for outcome depending on stage of the disease the two - tailed p value equals 0.0031 . patients diagnosed in the predestructive stage had excellent results in 87.5% of the cases , whereas in early destructive phase , it decreased to about 72.2% , in mild angular kyphosis to 50% , and none in the moderate angular kyphosis . the p value equals 0.0031 , which implies that there is a significant association between stage of the disease at the time of the treatment and the outcome . the effectiveness of dots regimen in pulmonary and nonskeletal forms of extrapulmonary tuberculosis is well established.19 but its role in spinal tuberculosis is not yet established . the failure of treatment and emergence of drug resistance is due to non compliance which can only be overcome by establishing a human bond between the patient and the provider through dot . in the developing world , evidence from uncontrolled studies shows that the introduction of dots has increased completion of therapy and cure rates from 2550% ( with unsupervised treatment ) to 8090% , with relapse rates of less than 5%.2021 the daily regimen has shown 7% of hepatotoxicity and about 46% of severe arthralgias,22 the incidence of these side effects with dots intermittent short - course chemotherapy in this study was hepatotoxicity in less than 2.5% and arthralgia in 7.3% only , and intermittent therapy is as effective as daily therapy.2325 in vitro studies have shown that drugs given thrice a week were as effective as those given daily.24 these experiments demonstrate that when a culture of m. tuberculosis is exposed to a single dose of antituberculosis drugs , there is a delay of several days ( 24 - 48 hrs)the so - called all antituberculosis drugs , with the exception of thioacetazone , exhibit this lag phenomenon and are therefore suitable for intermittent administration . studies at tuberculosis research centre ( trc ) , chennai , india , have shown that twice - weekly regimen was as effective as the daily - unsupervised regimen.2627 this forms the rationale of the usage of the thrice weekly regimens recommended in the rntcp . hence , intermittent regimen has the advantage of being less toxic , less costly28 requiring fewer visits by patients , and is logistically more feasible . despite all the above mentioned advantages of dots regimen , many orthopedic surgeons continue to give daily regimens . this is basically due to the fact that the efficacy of short - course intermittent therapy like dots regimen is not scientifically proven . nussbaum et al . stated that no patient with neurological deficit recovered or stabilized with non - operative management.29 moon , on the other hand , recommended that only advanced neurological deficit , such as paraplegia , is a surgical indication in this disease.3 in this study , surgical indications were based on the study conducted by nene and bhojraj,14 where presentations with paraplegia , gross motor weakness ( mrc grade 2 or less ) , or neurologic deterioration while on treatment were absolute indications for surgical intervention . in our series , 12 patients presented with varying motor deficits , and 10 of these recovered completely with medical treatment alone , without the need for surgical decompression . when the outcome was compared with the short - course regimen given in that study , there was no significant difference in the outcome suggesting the comparable efficacy of the intermittent regimen vs daily regimen.14 it is evident from the above data that earlier the initiation of the treatment , the better is the result . if the treatment is started during the predestructive or early destructive stages , the results are excellent or good ; however , in the later stages of kyphosis with involvement of more vertebrae , the results start becoming fair or poor . the destroyed tissues can never attain the pre - disease level once they are destroyed ; this explains the better results in those patients treated in the early stages of the disease . this is in accordance with the study conducted at trc in 1997 by rajeshwari et al . which showed the significance of early detection of cases in obtaining better results.23 limitation of the study is that sample size is small , most of the cases were in the early stages of tuberculosis and only a small number of cases had moderate disease hence it is unclear whether dots is useful in advanced stages of disease . another limitation is that patients with significant neurologic deficit or deformity were excluded from the study . dots strategy is as effective as short - course daily regimen in early stages of disease . clinical outcome of treatment depends on the amount of destruction at the commencement of chemotherapy , with excellent results in the predestructive and early destructive phases of disease . | background : most important cause of treatment failure and emergence of drug resistance in the treatment of tuberculosis is noncompliance .
compliance can be improved by direct observation of drug intake , intermittent therapy , and short - course treatment .
the efficacy of directly observed treatment short course ( dots ) strategy advocated by world health organization ( who ) in spinal tuberculosis is not yet proven .
we conducted a prospective clinical study on a consecutive series of patients with spinal tuberculosis treated by category i revised national tuberculosis control programme ( rntcp ) regimen based on dots strategy of who from 2004 to 2007 to evaluate the efficacy.materials and methods : forty - nine consecutive patients of spinal tuberculosis were treated with short - course intermittent chemotherapy under category i rntcp / dots strategy .
patients were followed up for a minimum period of 2 years .
surgery was done if the patient presented with significant neurologic deficit or when the drug treatment failed .
outcome was assessed by clinical , radiologic , and laboratory criteria , and graded into excellent , good , fair , and poor based on various parameters.results:63.4% ( n=26 ) of the patients had excellent results .
14.6% ( n=6 ) of the patients had good and fair results .
three patients ( 7.3% ) had poor results 48.7% ( n=20 ) of the patients had but only one of them was severe enough to warrant change of drug.conclusions:efficacy of dots was comparable with other standard regimens .
there was a significant reduction in adverse side effects when compared with daily regimens .
study showed that the outcome was better in those treated early . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the prevalence of smoking tobacco is comparable to the european average , although the age at consumption onset showed signs of decline over the last decade [ 3 , 5 ] . while this observation might be in line with a slight decline of tobacco use among youth , it is significant as during adolescence nicotine dependence develops soon after smoking initiation and even from low levels of nicotine exposure [ 68 ] . epidemiological studies have further highlighted that a consequent number of adolescents and young adults report using multiple psychoactive substances in switzerland [ 9 , 10 ] . for example , it was reported that smoking is strongly associated with alcohol consumption and to a lesser extent with cannabis use already among 15 years old . yet , the results from this latter swiss study cover only few possible combinations of substance use patterns and do not consider factors related to adolescent smoking , such as social influences . along with individual ( e.g. , other health - related behaviors , personality ) and structural ( e.g. , purchase age restrictions , advertisement ) factors , social factors , such as family and peer environment and particularly parental and peers ' smoking , appear to have a considerable influence on adolescents ' smoking behavior [ 11 , 12 ] . various theories , for example , social learning theory , primary socialization theory , social identity theory , and social network theory , provide a framework for understanding the social processes that play a role in adolescents ' decisions to engage in smoking behavior [ 1214 ] . while all of these theories emphasize a different social and cognitive process , they all converge in suggesting that norms and behaviors of adolescents ' peers or family members are important determinants of ( health - related ) behavior . hence , numerous epidemiological studies have documented the effects of other substance use behaviors on individual substance use , highlighting that peers ' smoking is associated with smoking initiation , progression , and trajectory ( see [ 1416 ] ) . the effect of parental smoking on offspring 's smoking was also repeatedly investigated in social risk - factors research , but associations have generally been modest and inconsistent across studies [ 1720 ] . for instance , previous studies demonstrated that when considering these two influences concurrently , parents ' substance use had an effect on adolescents ' smoking although possibly weaker than peers ' substance use [ 18 , 21 ] . to our knowledge , thus , the lack of comprehensive vision of the interrelations among youth smoking , other substance use behaviors , and parental and peers ' smoking can be seen as a flaw when trying to develop comprehensive ( versus substance specific ) preventive initiatives that can be ( or not ) universal or selective regarding targeted population and implementation setting [ 2224 ] . the overall aim of the study is to document the association of selected factors ( i.e. , sociodemographic characteristics , other substance use experiences , and family and peers ' smoking ) with smoking behaviors among adolescents aged 14 and 15 years in switzerland . more specifically , we aim at investigating the influence of these factors on adolescent smoking by contrasting their association with a hierarchy of smoking profiles . we used data from the swiss 2010 health behaviour in school - aged children ( hbsc ) survey , undertaken under the aegis of the world health organization ( who - europe ) . the study was granted ethical clearance by the cantonal ethics committee for research on human beings of vaud canton ( protocol 173/09 ) and conducted in accordance with apa ethical standards . the data were collected between january and april 2010 in classroom by means of a paper - and - pencil self - administered questionnaire ( i.e. , in french , german , or italian ) . classes ( i.e. cluster sampling ) were randomly selected proportionate to the size of the swiss cantons . pupils completed questionnaires independently over a 45 min school period ( absent pupils at the time of data collection were not surveyed later on ) . classes participation rate reached 88.0% , while within participating classes pupils participation rate was of 94.8% . detailed information about the study design can be found in currie et al . and windlin et al . the following analysis was based on an original sample of 3,560 boys and girls of 14 and 15 years of age attending 8th and 9th grades drawn from a cluster sampling procedure of all 8th and 9th graders in swiss public schools . an interdisciplinary research group developed the questionnaire , including optional items on family and peer substance use [ 1 , 25 ] . smoking status was defined based on two questions investigating smoking experience and behaviors ; that is , have you ever smoked tobacco ? yes / no ) and how often do you smoke tobacco at present ? ( options : every day / at least once a week but not every day / less than once a week / i do not smoke ) . based on these items , smoking status was categorized , resulting in the following four smoking experience profiles : lifetime abstinence ( never smoker ) , current abstinence ( ever smoker but not at present ) , current occasional smoking ( weekly or more seldom but not daily ) , and current daily smoking .
alcohol use ( 3 categories ) . alcohol use indicator was created based on inquiring about whether the respondent drank alcoholic beverages and , if yes , the number of drinks he / she was drinking on a typical drinking occasion . based on their responses ( i.e. , individuals who never had drunk alcohol ) , light drinker ( i.e. , drinking less than one drink per occasion ) , and drinker three items assessing the frequency of use of cannabis over the last 30 days , the last 12 months , and ever , respectively ( response options ranging from never to 40 times or more ) , were used to examine experimenting with or smoking cannabis . respondents were categorized as never user ( no report of any episode of use ) , experimenter ( i.e. , who smoked 1 - 2 times , independently of the timeframe ) , and user ( i.e. , report of more than two episodes of use ) .
parental smoking ( 3 categories ) . whether youths ' parents were smokers , for which the pupils were asked to indicate if their dad ( step - dad or mom 's partner ) and mom ( step - mom or dad 's partner ) were smoking . multiple response options were coded into three categories , which are none of the parents ( or analogous parental figures ) smoked , one of them smoked , or both smoked . the exposure to peers ' smoking was based on respondents ' response to a question , according to your opinion , how many of your friends smoke ? . response categories were here considered on a continuum ranging from none of them to all of them ( intermediate option being few of them , about half of them , and the majority ; peers ' smoking was considered either as continuous , scale ranging from 0 to 4 , or asll categorical ; see section 2.5 for more details ) . gender ( female as reference ) and age ( 14 versus 15 years ; continuous ) were further considered as these variables are important predictors of trying out or developing substance use behaviors in adolescence . regarding the questions on adolescent smoking , 0.6% of values were missing . missing values for indicators related to history of alcohol and cannabis use as well as family and youths with any missing data on these indicators ( 4.6% ) were excluded from the analysis . the final sample consists of 3,395 pupils ( 1,639 boys and 1,756 girls ) aged 14 and 15 ( mean : 15.00 ; sd : .54 ; decimal year ) . relationships among smoking status and history of alcohol and cannabis use , parental and peers ' smoking , and sociodemographics were estimated using multinomial regression models with different smoking status condition as a reference group . the presented analyses considered smoking status as dependent variable and alcohol use ( treated as categorical , never drinker as reference ) , cannabis use ( never user as reference ) , parental smoking ( no parents smoking as reference ) , and peers ' smoking ( treated both as continuous and categorical ; see the scale description above ) , as well as gender ( male as reference ) and age ( continuous ) as independent factors . interaction effects between parental and peers ' smoking on adolescent smoking were tested in an additional set of multinomial regression models ( results not presented in table ) . all analyses were performed using the statistical software package stata se 11.2 and were adjusted for cluster sampling design effects . distributions of smoking status , alcohol and cannabis use , family and peers ' smoking indicators by gender and age are presented in table 1 . in total , 49.0% of youth aged 14 to 15 reported to have never smoked in their lifetime , 9.0% reported smoking on a daily basis , and 12.0% reported smoking less frequently . the remaining 30.0% were current abstainers ( i.e. , ever smoker but not at present ) . current daily smoking appeared to increase markedly between the age of 14 ( 6.1% ) and the age of 15 ( 11.6% ) ; current occasional smoking remained rather constant . in terms of alcohol use , more than 60% of 14-year - old subjects were never drinkers or light drinkers , but almost 55% of 15-year - old subjects were drinkers . moreover , more than one out of four respondents reported using cannabis use . specifically , 10.0% had used cannabis once or twice ( cannabis experimenters ) and 15.2% used it more often ( cannabis users ) . finally , with regard to parental and peers ' smoking , 40.8% of respondents reported that at least one of their parents smoked , and 37.9% indicated that about half or more of their friends smoked ( i.e. , about half , majority , or all friends smoked ) . distribution of substance use ( alcohol and cannabis ) and of parental and peers ' smoking given the smoking status of the respondents can be found in table 2 . while a majority of youth who had never been smoking had never been drinking either ( 54.2% ) , respectively , 59.9% of current abstainers , 82.9% of occasional smokers , and 90.0% of current daily smokers were classified as drinker . also , while 97.7% of lifetime abstainers ( smoking ) had never tried cannabis , 84.4% of daily smokers had ( 11.5% of cannabis experimenters and 72.9% of users ) . the results from the set of multinomial regression models can be found in table 3 . comparing lifetime and current abstinence , other substance use behaviors as well as family and peers ' smoking being a light drinker and/or cannabis experimenter and being a drinker and/or cannabis user were positively associated with having tried smoking . specifically , more intensive use of alcohol and/or cannabis was associated with a greater likelihood of being current versus lifetime abstainer ( i.e. , coefficient increased with the rise in the use or exposure ) . besides , the higher parental and/or peers ' smoking exposure , the greater likelihood to having tried smoking . for crude interpretation , based on the reported coefficients , drinkers had more than five times higher probability of trying smoking compared to someone who has never drank alcohol ( i.e. , e = 5.16 ) . consistently , all substance use and smoking exposure conditions loaded positively with the more intensive smoking status . further , the magnitude of loadings concurred with the intensity of exposition to independent factors . in every model , drinkers and cannabis users had larger loadings compared to light drinkers and cannabis experimenters , and youth with both parents smoking had larger loadings than did youth with one parent smoking . furthermore , coefficients relating to peers ' smoking loaded positively on smoking status , indicating that the likelihood of more intensive smoking behaviors increased with the proportion of smoking peers . with the exception of two coefficients reaching only borderline levels of significance ( i.e. , p values of 0.069 for the associations between having one and two parents smoking and current occasional smoking versus current abstinence ) , all measures of association between parental and peers ' smoking factors and smoking status reached significance . this contrasts with a kind of backward influence effect of other substance use measures and particularly of alcohol use on smoking status . this influence is specifically observed in the fact that , whereas all considered condition associated significantly with smoking status when contrasting lifetime abstinence with the other status , being light drinker ( versus having never tasted alcohol ) was not associated with smoking status in other comparisons . in the same way , being a cannabis experimenter ( versus having never smoked cannabis ) was not associated with smoking status when contrasting current occasional versus daily smoking but was in another instance . finally , considering the effects of other substance use and smoking environment factors , gender and age were inconsistently associated with smoking status . whereas negative coefficient loadings were consistently observed for gender ( i.e. , females being apparently less inclined to smoke or smoke regularly compared to males ) the association did not reach significant level in any of the six status comparisons . regarding age , the results are less consistent but reveal differences that are of relevance when describing factors involved in the progression of smoking behaviors . current daily smoking showed positive loading of age compared to other conditions ( and even significant positive association when compared to current occasional smoking , that is , indicating that older age is associated with more intensive smoking among smokers ) . yet , when comparing the two groups of abstainers with current occasional smoking , age associated negatively with current occasional smoking , showing that , when controlling for the effect of other substance use behaviors and environmental factors , getting older was linked to nonsmoking behaviors among youths who do not smoke on a daily basis ) . additional multinomial regression models were performed to investigate potential interaction effects between parental and peers ' smoking on individual smoking status . further , the direction and significance level of associations documented in table 3 did not vary meaningfully in these models ( detailed results can be obtained from the authors upon request ) . the aim of this study was to investigate the association of adolescents ' smoking behaviors with alcohol and cannabis use and parental and peers ' smoking while taking into account gender and age effects . based on a large representative sample of 14 and 15 years of age , our results highlight high smoking rates among youth of this age in switzerland and suggest that parental and peers ' smoking behaviors , as well as adolescents own alcohol and cannabis use , are highly associated with adolescents ' smoking status . compared to adolescents who had never drank alcohol in their life ( or at least not more than a sip or so ) , light drinkers ( drinking less than 1 drink per occasion ) were more likely to have ever tried smoking and to currently smoke ( versus never have smoked ) . this likelihood was even higher for youth drinking usually one or more drinks per drinking occasion . these results are in line with previous studies that have reported clustering of risk behaviors during adolescence . yet , noteworthy is the observation that being a light drinker ( versus never drinker ) was associated with having or not tried to smoke but not with more extended smoking experience , while drinking more intensively was further associated with current smoking behavior ( i.e. , positive association with occasional and daily smoking versus current abstinence ) . this accordingly suggests a possible dose response effect in the association between substance use behaviors and experience , more specifically among smoking status , alcohol , and cannabis use . this provides additional evidence of the relevance of developing multisubstance and/or multirisk behaviors prevention programs . regarding parental smoking , about two out of five adolescents reported that at least one of their parents smoked . these youths had higher likelyhoods to smoke and to smoke on a daily basis compared to those whose parent did not smoke . this likelihood was higher for youths with both parents smoking than for those with only one smoking parent . this suggests that the exposure to parental smoking increases the likelihood that adolescents will start using tobacco and will smoke intensively if they are going to smoke . this finding is consistent with the literature on parental influence on offspring smoking behaviors ( see , e.g. , ) . environmentally , for example , parental smoking may directly influence smoking in offspring through behavioral modeling and permissiveness toward smoking and/or indirectly through positive attitudes toward smoking and perceived availability of tobacco [ 29 , 30 ] . further exploration of this hypothesis would help determine which of these domains should be targeted as a priority in future preventive strategies aimed at reducing concurrently parental and offspring smoking , for example . our study conducted with 14-and-15 year - old adolescents in switzerland also confirms one of the most robust findings in the literature on adolescent smoking risk factors , that is , the association between adolescents ' and peers ' smoking ( see , e.g. , [ 12 , 14 ] ) . specifically , the findings indicate that adolescents who have more smoking peers are more likely to be smoking and smoking daily . the hbsc 's cross - sectional study showed the tendency for adolescent peer group members to share common characteristics , like smoking , but did not allow concluding that peers ' smoking ( directly ) influences adolescent smoking . actually , both socialization effect , which refers to the tendency to be influenced by effective or perceived attitudes and behaviors of one 's friends , and selection effect , which refers to the tendency to join people with similar attitudes and behaviors , may contribute to peer group homogeneity . finally , despite the adolescent 's growing autonomy from parents and increased orientation towards peers , our findings indicate that , while peers appear to have a strong influence on adolescents ' smoking behavior , parents ' influence remains significant at the age of 14 - 15 , at least from a statistical point of view . however , the cross - sectional nature of the study does not give opportunities to assess how and when parental and peers ' smoking contribute to this behavior ; for example , whether pathways exist among parental smoking , affiliation with peer networks where smoking is widespread , and adolescents own smoking behaviors . furthermore , the study could not determine whether the homogeneity of smoking behaviors within a given peer group should be considered through peer socialization process , which might only be indirectly influenced by the larger social context , including parental smoking . a number of additional limitations should be noted . it does not differentiate between more ( i.e. , best friends ) and less significant friends and does not differentiate same - sex and opposite - sex peers ' smoking , whereas the closeness and status of smoking peer might exert different influences on adolescent smoking . additionally , the item assessing peer smoking is based on a subjective report of friends ' behavior and , to some extent , it can be seen as a proxy assessment of the perception of smoking norm , the latter being another factor influencing smoking behaviors during adolescence . , current nonsmoking status does not consider the influence of past behaviors ; that is , whether a non - smoking parental figure was actually a former smoker ( who possibly quit smoking only recently ) or never smoker . this lack of specificity might imply bias . yet , since the effect size of estimates of association between parental and youth smoking should be weakened , the reported estimates can be considered conservative . also , the fact that data collection is based on self - reported measures collected within school classes might imply both desirability bias ( i.e. , either over- or understatements of risk behaviors ) and clustering effect . whereas it is impossible to control or assess the former , the effects of the cluster sampling design were taken into account within the analytical strategy applied . first , since the measure of smoking behavior did not address the quantity of cigarettes smoked , for example , among current daily smokers or among current abstainers , a detailed history of past and current tobacco use pattern could not be established . future studies on early adolescence life course changes of smoking status considering other substance use and parental and peer influence should be aimed at . also , more detailed measures of drinking patterns ( e.g. , considering not only usual quantities of alcohol consumed , but also the frequency of consumption and the propensity to heavy episodic drinking ) as well as additional sociodemographic covariates could be considered . in conclusion , they highlight the strong intricacy of the association of adolescent smoking behaviors with other substance use behaviors and parental and peers ' smoking behaviors . accordingly , they support the relevance of concurrent prevention initiatives in switzerland that could target adolescents with specific substance use profile and/or those who are growing up in social milieus families and peer networks where smoking is possibly not seen as an issue . | this study investigates the connectedness of adolescents ' smoking status , history of alcohol and cannabis use , and parental and peers ' smoking , dimensions only rarely explored concurrently .
multinomial regression models that compared the smoking status of adolescents were estimated based on a representative sample of 3,560 adolescents aged 1415 from switzerland .
while 49.0% of respondents had never smoked , 9.0% smoked on a daily basis and 12.0% occasionally ; 32.6% had never drank alcohol and 74.7% had never used cannabis .
overall , parental and peers ' smoking and other substance use factors are significantly associated with smoking status . yet ,
history of substance use revealed less consistent associations with smoking status among current smokers ( daily versus occasional smoking ) .
the findings highlight the connectedness of adolescents ' and other substance use behaviors and support the relevance of concurrent prevention initiatives targeting adolescents with specific substance use profiles and/or growing up in prosmoking social milieus . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
xyloglucan ( xyg ) is a hemicellulosic polysaccharide found in all land plants ( popper and fry , 2003 , 2004 ; popper , 2008 ; sarkar et al . 2009 ) in varying amounts ; for example , xyg is a major hemicellulosic component of the primary cell wall of flowering plants ( up to 25% ) , but a minor , sometimes barely detectable , constituent of grasses ( less than 2% ; hsieh and harris , 2009 ) . xygs have a -1,4-glucan backbone that is highly branched , with characteristic repetitive patterns of -xyl residues linked to glucose at the o-6 position . the side chain xylosyl residues can be further substituted with different mono- , di- , or trisaccharides ; the pattern of these substitutions produces the broad diversity of xyg structural motifs that are present in different plant species ( hoffman et al . , 2005 ; pena et al . for example , the letter g indicates an unbranched glc residue , and x denotes the -d - xyl-(1 6)--d - glc motif in the xylosylated glucan backbone . xyl residues can carry a -d - gal ( l motif ) , an -l - ara ( s motif ) , or a -d - xyl ( u motif ; hoffman et al . in turn , gal residues in the l side chain can be linked to an -l - fuc residue ( f motif ; hoffman et al . , 2005 ) , or an -l - gal ( j motif ; hantus et al . , 1997 ) ; also , the ara residue in the s side chain can carry a -l - ara ( t motif ; york et al . , 1996 ) . 2008 ) found that avascular plants , such as mosses and liverworts , can form xyg with a 2,4-linked xyl residue , where xylosyl can be substituted with a -d - gala and a -d - gal ( p motif ) , with an -l - ara and a -d - gal ( m motif ) , an -l - ara and the disaccharide -d - gal-(1 6)--d - gala ( n motif ) , or the disaccharide -d - gal-(1 6)--d - gala and a -d - gal at the o-2 and o-4 positions , respectively . different patterns and types of xyg subunits can be found in different species and different tissues . most vascular seed - bearing plants synthesize xxxg - type xyg ( oneill and york , 2003 ; hoffman et al . , 2005 ) , but grasses and some lamiids produce xxgg- and xxggg - type xyg with fewer xyls on the glucan backbone ( gibeaut et al . , 2004 ; hoffman et al . , 2005 ) . typically , xxxg - type xyg comprises xxxg , xxfg , xxlg , and xlfg subunits , which are present in different proportions depending on the plant tissue and developmental stage ( pauly et al . , 2001 ; obel et al . , the fuc residue is linked to -d - gal at the o-2 position , while the xyg in equisetum and selaginella has the fuc linked to an -l - ara residue at the o-2 position ( e motif ; pena et al . , 2008 ) . it was proposed that fucosylated xyg was first synthesized in a common ancestor of hornworts and vascular plants ( pena et al . , 2008 ) . gal residues in xxlg , xxfg , and xlfg can carry acetyl groups as was found in arabidopsis and sycamore xyg ( kiefer et al . , 1989 ; gille et al . , thus , the zingiberales and commelinales have both xxgn and xxxg core motifs with few xxfg units , and no xlfg ( hsieh and harris , 2009 ) . in the poales , the poaceae have exclusively xxgn - type xyg without fuc , but the other families contain either the mixed type xyg with xxxg and xxgn core motifs or only xxxg and xxfg motifs , but no xlfg ( hsieh and harris , 2009 ) . frequently , in xxgg- or xxggg - type xyg , one or two unbranched glc residues have acetyl groups instead of the -xyl ( hoffman et al . , 2005 ) . del bem and vincentz ( 2010 ) constructed an evolutionary model of the emergence of xyg - related genes in viridiplantae , proposing a stepwise increase in xyg branching complexity starting from xyg - like molecules that contained only glc and xyl , which are found in streptophyte algae , to galactosylated motifs , which emerged in embryophytes , and finally to fucosylated xygs , which emerged in the last common ancestors of spermatophytes . although xyg has never been directly released from algae cell walls , some indirect evidence indicates that certain green algae contain xyg - like polysaccharide ( vansandt et al . additionally , xyg epitopes were immunologically detected in some members of evolutionarily advanced charophycean green algae orders ( sorensen et al . , 2010 , 2011 ) . since liverworts , which are believed to be the oldest extant land plant family ( qiu et al . , 2006 ) , have xxgg- and xxggg - type xyg , it was proposed that xxxg - type motifs evolved later in hornworts and many vascular plants ( pena et al . , 2008 ) . demonstration in hornworts of the presence of fucosylated xyg with similarities to seed - bearing plant xyg motifs allowed pena et al . ( 2008 ) to propose that in some lamiids and grasses , the genes encoding xyg - specific fucosyltransferases may have been eliminated completely , or are expressed only in specific cells or conditions . xyloglucan biosynthesis requires glucan synthase to form the glucan backbone and requires multiple different types of glycosyl transferases to decorate the glucan chain to produce the broad diversity of xyg side chains found in various plants . considering the high specificity of glycosyl transferases ( keegstra and raikhel , 2001 ) , the formation of each linkage is believed to require a distinct transferase ; therefore , a combination of at least one ( 1,4)--glucan synthase , three ( 1,6)--xylosyltransferases , two ( 1,2)--galactosyltransferases , and one ( 1,2)--fucosyltransferase is needed to assemble a complete xlfg subunit . the presence of other xyg motifs discovered in different taxa , and briefly described in the first section , implicates involvement of other types of glycosyltransferases in various plant species ; these transferases may include xyg specific arabinosyltransferases , galacturonyltransferases , additional galactosyltransferases , and xylosyltransferases that would elongate diverse xyg side chains . for example , in arabidopsis , xyg biosynthesis requires at least five types of enzymatic activities : udp - glc - dependent glucan synthase to synthesize the glucan chain , udp - xyl - dependent xylosyltransferases to transfer xyl onto a specific glc in the glucan chain , udp - gal - dependent galactosyltransferases to transfer gal onto xyl and elongate side chains attached to the second and third glc in the xyg subunit , gdp - fuc - dependent fucosyltransferase to transfer fuc onto gal in the side chain attached to the third glc in the xyg subunit , and finally xyg specific acetyltransferase to attach the acetyl group to gal . candidate genes encoding all these enzymes have been identified and partially characterized using a combination of biochemical and genetic approaches ( figure 1 ) . for example , the amino acid sequence of fucosyltransferase ( fut1 ) purified from pea was used to identify arabidopsis
fut1 from the gt37 gene family ( perrin et al . , 1999 ) , and heterologous expression demonstrated that arabidopsis and pea fut1 genes encode proteins with xyg fucosyltransferase activity ( perrin et al . , 1999 ; faik et al . , 2000 ) . complete elimination of fucosylated xyg subunits in the arabidopsis
fut1 t - dna knock - out mutant suggests that xyg specific fucosyltransferase activity in arabidopsis is encoded by a single gene ( keegstra and cavalier , 2011 ) . the structure of the xlfg xyg subunit . discovered in a screen for mutants with aberrant cell wall formation , arabidopsis thaliana mur3 ( reiter et al . , 1997 ) encodes a xyg galactosyltransferase that adds galactose specifically to the third xylosyl residue , forming an xxlg subunit ( madson et al . , 2003 ) . more recently , a second xyg galactosyltransferase was discovered by rna - seq analysis of developing nasturtium seeds and then confirmed by mutation of the arabidopsis ortholog ( at5g62220 ) . the arabidopsis gene , named xyg l - side chain galactosyltransferase ( xlt2 ) showed no redundancy with mur3 , and is required for galactosylation of the second xylose in the xyg subunit ( jensen et al . a gene family ( cazy gt34family ) , containing seven genes spread among three clades in arabidopsis , was identified and predicted to encode xyg xylosyltransferases ( faik et al . , 2002 ) . heterologous expression of two of those genes , xxt1 and xxt2 , demonstrated that the encoded proteins have xylosyltransferase activity ( cavalier and keegstra , 2006 ) . the studies also demonstrated that xxt1 and xxt2 have the same substrate - acceptor specificity , catalyzing the substitution of two glycosidic residues in adjacent positions , and thereby generating a ggxxgg structure . also , xxt1 xxt2 double mutant plants lack detectable xyg in their cell walls ( cavalier et al . , 2008 ) , confirming that xxt1 and xxt2 are xyg xylosyltransferases that are essential for xyg formation . application of reverse genetics demonstrated that another member of the gt34 gene family , xxt5 , is also involved in xyg biosynthesis , although its activity has not been demonstrated in vitro ( zabotina et al . , 2008 ) . the lack of detectable xyg in the xxt1 xxt2 double mutant plants challenges conventional models for the functional organization of the primary cell wall and also existing assumptions about linkage - specific enzyme relationships in polysaccharide biosynthesis . the xxt1 and xxt2 single mutant plants each have only a slight decrease in xyg content , but the xxt5 single mutant has a 50% reduction in xyg content and the xyg that is made in the xxt5 mutant plant shows an altered subunit composition ( zabotina et al . however , the knock - out of xxt5 does not eliminate xylosylation of any particular glucose in the xyg backbone , which suggests that the absence of xxt5 protein is compensated for , at least in part , by the presence of the other two xylosyltransferases . thus , the ability of xxt1 and xxt2 to partially compensate for the lack of xxt5 in synthesizing fully xylosylated xyg subunits raises questions about their specificity with respect to which glucose in the glucan backbone is the target of their activity . the studies of two additional double mutants , xxt1 xxt5 and xxt2 xxt5 , as well as a triple mutant line , xxt1 xxt2 xxt5 , revealed further complexity in the functional relationship of xxt proteins . a combination of biochemical and immunological analyses ( zabotina et al . , 2012 ) demonstrated that either xxt1 or xxt2 alone is sufficient to synthesize the complete set of xyg subunits , although in significantly lower amounts compared with plants that have xxt5 in addition to xxt1 and xxt2 . thus , either xxt1 or xxt2 is capable of adding all three of the xylosyl residues present in xyg ; this confirms earlier in in vitro experiments ( cavalier and keegstra , 2006 ) . however in vivo , the efficiency of xxt1 or xxt2 when functioning alone is significantly lower than when the three proteins are present together . also , although the xxt5 protein itself does not seem to be capable of adding xylosyl residues to the xyg backbone in vivo , the lack of this protein causes the most dramatic impact on xyg biosynthesis . the xxt1 , xxt2 , and xxt5 double and single mutant phenotypes indicate that these loci encode the major xyg xylosyltransferases . two members of the arabidopsis
gt34 gene family ( at4g37690 and at2g22900 ) are closely related to the galactomannan galactosyltransferases identified by edwards et al . ( 1999 ) , which suggests that they encode galactosyltransferases ( keegstra and cavalier , 2011 ) . two other members of this family ( at1g18690 and at1g74380 ) are expressed at very low levels in all tissues that were examined ( http://www.weigelworld.org/resources/microarray/atgenexpress/ ; schmid et al . , 2005 ) and are therefore unlikely to contribute significantly to xyg biosynthesis . this supports the hypothesis that xxt1 , xxt2 , and xxt5 are the main xyg xylosyltransferases that synthesize xyg , at least in the major plant tissues . analysis of microarray data showed that these three xxt genes are expressed in all tissues that were analyzed , but have different levels of expression . in the majority of tissues , xxt2 has approximately twofold higher expression than xxt1 and xxt5 , but xxt2 and xxt5 have comparable expression levels except in a few specialized tissues such as stamen and root pericycle , where xxt1 has the highest expression level of the three genes . the members of the gt2 gene family , arabidopsis
cellulose synthase - like c genes ( cslc4 , cslc5 , and cslc6 ) are believed to be involved in xyg biosynthesis , being implicated in glucan backbone synthesis . initially , cslc4 was identified as a candidate gene for the ( 1,4)--glucan synthase in nasturtium and arabidopsis ( cocuron et al . , 2007 ) . moreover , when xxt1 was co - expressed in the same cells , longer chains were detected , indicating that xxt1 can assist cslc4 in glucan synthesis . since yeast cells can not produce udp - xylose , xylosylation of the synthesized glucan oligomers later , reverse - genetic studies suggested that two other genes , cslc5 and cslc6 , are also involved in xyg biosynthesis ( cavalier and keegstra , 2010 ) . among these three genes , cslc4 has higher levels of expression in all arabidopsis tissues and also is expressed in the same tissues and with the same developmental timing as the xxts , but expression of cslc5 and cslc6 is limited to specific tissues ( schmid et al . , 2005 ) . in arabidopsis xyg , acetyl recently , the putative xyg specific acetyltransferases , axy4 and axy4l , were discovered in arabidopsis using a forward genetic screen ( gille et al . , 2011 ) , although their catalytic activity and substrate specificity have yet to be confirmed . it is also unclear whether axy4 attaches acetyl groups to all galactosyl residues or only to some of them , and whether this happens during xyg biosynthesis or after xyg is completely synthesized . when axy4 was overexpressed in wild type arabidopsis , cell wall xyg still contained unacetylated galactoses ( gille et al . , 2011 ) , suggesting the possible involvement of other axy proteins . whether axy4 can interact with any of the proteins involved in xyg biosynthesis remains to be investigated as part of an exploration of the biological role of xyg acetylation . identification of glycosyl transferases that can potentially fully decorate the xyg glucan backbone and synthesize the complete xyg structure ( figure 1 ) stimulated further investigations to understand their functional organization in the golgi . the few available examples suggest that glycosyl transferases localized in the golgi might function in multiprotein complexes ( atmodjo et al . , 2011 ; harholt et al . , indeed , recent data suggest that proteins involved in xyg biosynthesis are co - localized in multiprotein homo- and hetero - complexes and most likely interact through their catalytic domains . for example , bifc assays using arabidopsis protoplasts transiently expressing transferases fused with the c and n parts of yfp demonstrated approximate co - localization of xyg xylosyltransferases in two hetero - complexes , xxt2-xxt5 and xxt1-xxt2 ; xxt2 was also shown to form an xxt2-xxt2 homo - complex ( chou et al . , 2012 ) . using the same approach , xxt5 and cslc4 were shown to form a hetero - complex , xxt5-cslc4 . results from in vitro pull - down experiments using recombinant proteins expressed without transmembrane domains confirmed the interactions between xxt2 and xxt5 , and xxt1 and xxt2 , suggesting that these proteins can physically interact through their catalytic domains ( chou et al . , 2012 ) . a recent study ( davis et al . , 2010 ) suggested that cslc4 is positioned in the golgi membrane with its active loop and both c- and n - termini protruding to the cytosolic side of the golgi . bifc assays showed that cslc4 forms homo - complexes and switching the c and n yfp fragments fused to either the c or n - terminus of cslc4 did not affect the intensity of reconstituted yfp fluorescence ( chou et al . , 2012 ) . this suggests that both termini are localized close to each other , while the cslc4 active loops are positioned on the outer sides of the homo - complex , farther from each other . similarly , bifc assays demonstrated that mur3 and fut1 also co - localize and interact with each other and with either xxt2 or cslc4 . these results have yet to be confirmed by an independent approach , but it is plausible to believe that during xyg formation , these proteins likely come into close proximity to xxts to finalize the complete xyg structure . whether all these proteins form a single multiprotein complex or a more dynamic structure that differs in different situations has yet to be investigated . for example , it has been suggested that the fucosyltransferase fuc1 functions independently from glucan elongation and xylosylation ( faik et al . , 1997a , b ) . after using pea microsomal fractions to study xyg formation in vitro , the authors proposed that fucosylation of galactosylated heptasaccharide occurs after complete formation of the glucan backbone . 2010 ) , using arabidopsis xxt1 , mur3 , and fut1 fused with gfp and expressed in n. tabacum by-2 cells , showed that xxt1 and mur3 localized predominantly in golgi cis and medial cisternae , respectively , but fut1 was detected in trans cisternae . however , it is worth noting that tobacco xyg does not contain terminal fucose in its subunits ; therefore arabidopsis fut1 may not have been able to establish the proper interactions to be correctly localized in n. tabacum golgi . further elucidation of the structure of the xyg synthase complex is needed to understand its functions , and the regulation of xyg biosynthesis . . , 2011 ) that xyg synthesized in golgi has , most likely , an xxxgxxfg repeating pattern and the diversity of xyg structure is created after its deposition into the cell wall . this regular structure would derive most efficiently from cooperative action of multiple xyg biosynthetic enzymes organized in a multiprotein complex in the golgi , rather than from spatially and functionally independent enzymes . during the last decade , significant progress has been made in revealing the proteins involved in xyg biosynthesis , which , together with detailed structural studies , makes this important cell wall polysaccharide a good model for examining the mystery of polysaccharide evolution , formation , and modification . accumulating evidence demonstrates that the evolution of polysaccharide structural complexity during land colonization produced key adaptations , including cell wall mechanical strengthening needed to support plants in the absence of water buoyancy and to protect them against biotic and abiotic environmental stresses . to provide this complexity , plants evolved complex and dynamic polysaccharide synthesizing machinery localized in the golgi . enzymes involved in polysaccharide biosynthesis are most likely organized in multiprotein complexes , the structure of which is probably dynamic , varying in different plant tissues and throughout plant development . the structural organization and regulation of xyg and other polysaccharide synthase complexes remain to be uncovered in the future . the author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . | the hemicellulosic polysaccharide xyloglucan ( xyg ) , found in the primary cell walls of most plant tissues , is important for structural organization of the cell wall and regulation of growth and development .
significant recent progress in structural characterization of xygs from different plant species has shed light on the diversification of xyg during plant evolution . also ,
identification of xyg biosynthetic enzymes and examination of their interactions suggests the involvement of a multiprotein complex in xyg biosynthesis .
this mini - review presents an updated overview of the diversity of xyg structures in plant taxa and recent findings on xyg biosynthesis . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the online version of this article ( doi:10.1007/s13555 - 016 - 0163 - 0 ) contains supplementary material , which is available to authorized users . one type , non - small cell lung carcinoma ( nsclc ) , accounts for 85% of all lung cancers . prior studies have demonstrated the important role of epidermal growth factor receptor ( egfr ) , a tyrosine kinase growth factor family transmembrane glycoprotein [ 57 ] , in which gene mutation happens in 4080% of all nsclc patients [ 1 , 4 , 8 ] . gefitinib ( iressa ) is an oral tyrosine kinase egfr inhibitor [ 2 , 9 , 10 ] approved by the food and drug administration , usa , as the monotherapy for both local and metastatic nsclc [ 11 , 12 ] . cutaneous toxicities are the most common forms of egfr inhibitor side effects , affecting approximately 45100% of patients [ 13 , 14 ] and varying from papulopustular rashes on the face and upper side trunk to xerosis cutis , paronychia , hair disorder , and pruritus [ 14 , 15 ] , leading to treatment modification or interruption in 817% of patients . these side effects are related to the egfr expression role in promoting the proliferation , survival , motility , and regulation of the differentiation and keratinization of human skin cells , such as keratinocytes , corneocytes , sweat glands and hair follicles . transepidermal water loss is a measurement of the absolute rate of body water loss which acts as a parameter reflecting permeability barrier status and which may discover disturbances in the skin protective function at an early stage , even before they are visible . due to the limited number of clinical studies on the cutaneous side effects and tewl value measurements in patients receiving egfr inhibitor , the authors were interested to conduct this study . a descriptive observational study with cross - sectional design and a consecutive sampling method was conducted from 1 february to 4 march 2016 . we collected nsclc patients from the hemato - oncology clinic / internal medicine department , dr . we included all patients with positive egfr mutation who were on gefitinib as the current main therapy ( and had been diagnosed and treatment has been started prior to the study ) and those who signed the informed consent form . we excluded patients who had other dermatologic disorder histories before gefitinib consumption or on the examination location ( volar surface of both arms ) ; those who used topical medication , medical devices , and other occlusive substances on examination location ; those who did not follow - up ; and those who refused to participate in this study . history taking and physical examination were conducted while patients were in resting phase ( 20 min ) before the tewl value measurement . a tewameter tm 300 , ( khazaka 2003 ) was used to measure tewl values in 30 s , thrice on the volar surface of both arms , at room temperature 2022 c and air humidity 4060% . patient bilateral arm tewl average value was calculated , with a normal lower arm surface tewl range value reference of 2.26 1.36 g / m / h . all procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation ( institutional approval from medical research ethical committee , medical faculty - universitas padjadjaran / dr . hasan sadikin general hospital ) and with the helsinki declaration of 1964 , as revised in 2013 . the hemato - oncology clinic / internal medicine department recorded that there were 37 nsclc patients using gefitinib by the year 2014 . at the time this study was conducted , 16 patients were confirmed dead , another 14 patients did not make follow - up visits or had no valid contact number and address , another 2 patients had moved out of the town , and the last 1 stopped her gefitinib regimen . only 4 former patients came to our clinic and agreed to participate in our study along with other 7 new patients . 1).fig . 1study participants enrolment
study participants enrolment eleven lung adenocarcinoma patients with positive egfr mutation , consisted of 6 male and 5 female patients within age group > 40 years old were included in this study . the youngest patient was 43 and the eldest was 84 years ( mean 62.18 13.27 ) . the shortest interval of gefitinib consumption was 1 week , while the longest was 18 months ( average 10.27 6.14 months ) . most participants had been using gefitinib for > 6 months ( 7/11 patients ) . according to physical examination one male patient who belonged to the > 65 years group had been using gefitinib for just 1 week and had not complained of any cutaneous side effect , which was confirmed by his physical examination ( see table 1).table 1cutaneous side effect manifestations examination resultcharacteristic(n = 11)notesex male6 female5age groups ( years ) 40441mean ( sd ) : 62.18 ( 13.27 ) 45491median : 62.00 50542interval : 4384 55590 60643 654gefitinib consumption interval ( months ) < 11 120mean ( sd ) : 10.27 ( 6.14 ) 231median : 12.00 340interval : 018 450 562 > 67cutaneous disorder yes10 no1
cutaneous side effect manifestations examination result female patients had more xerosis cutis ( 5/5 patients ) and paronychia ( 2/5 patients ) , while male patients experienced more acneiform eruption ( 4/5 patients ) . xerosis cutis and acneiform eruption were the two most common cutaneous findings in every age group , while paronychia was detected mostly in the 4044 and 6064 age groups . as mentioned previously , one patient who had only been using gefitinib for 1 week ( < 1 month ) showed no cutaneous side effects manifestation ( see tables 2 , 3).table 2cutaneous side effect manifestations examination resultcutaneous side effect manifestationstotal ( n = 10)xerosis cutis8acneiform eruption7paronychia3others ( hair disorder , mucositis , hypersensitivity reactions)0
table 3cutaneous side effects and tewl results categorized by participant baseline characteristicsvariable total ( n = 11)xerosis cutis ( n = 8)acneiform eruption ( n = 7)paronychia ( n = 3)mean bilateral tewl values ( g / m / h)sex group male ( n = 6)34111.64 ( 2.34 ) female ( n = 5)53210.68 ( 1.17)age group ( years ) 4044 ( n = 1)11115.72 ( 0 ) 4549 ( n = 1)11011.12 ( 0 ) 5054 ( n = 2)11011.03 ( 0.59 ) 5559 ( n = 0)000 6064 ( n = 3)21210.78 ( 1.71 ) 65 ( n = 4)33010.5 ( 1.44)gefitinib consumption interval ( months ) < 1 ( n = 1)0008.55 ( 0 ) 12 ( n = 0)000 23 ( n = 1)01011.98 ( 0 ) 34 ( n = 0)000 45 ( n = 0)000 56 ( n = 2)22113 ( 3.84 ) > 6 ( n = 7)64210.96 ( 1.01 )
cutaneous side effect manifestations examination result cutaneous side effects and tewl results categorized by participant baseline characteristics the mean tewl value measurement on both volar surfaces of patients was 11.205 ( 1.881 ) g / m / h ( see table s1 in the supplementary material for details ) . mean tewl measurement values were higher in male than in female patients . based on age group , tewl value was also the highest in the gefitinib consumption group of 56 months and lowest in the group of < 1 month ( see table 3 ) . the hemato - oncology clinic / internal medicine department recorded that there were 37 nsclc patients using gefitinib by the year 2014 . at the time this study was conducted , 16 patients were confirmed dead , another 14 patients did not make follow - up visits or had no valid contact number and address , another 2 patients had moved out of the town , and the last 1 stopped her gefitinib regimen . only 4 former patients came to our clinic and agreed to participate in our study along with other 7 new patients . 1).fig . 1study participants enrolment
study participants enrolment eleven lung adenocarcinoma patients with positive egfr mutation , consisted of 6 male and 5 female patients within age group > 40 years old were included in this study . the youngest patient was 43 and the eldest was 84 years ( mean 62.18 13.27 ) . the shortest interval of gefitinib consumption was 1 week , while the longest was 18 months ( average 10.27 6.14 months ) . most participants had been using gefitinib for > 6 months ( 7/11 patients ) . according to physical examination one male patient who belonged to the > 65 years group had been using gefitinib for just 1 week and had not complained of any cutaneous side effect , which was confirmed by his physical examination ( see table 1).table 1cutaneous side effect manifestations examination resultcharacteristic(n = 11)notesex male6 female5age groups ( years ) 40441mean ( sd ) : 62.18 ( 13.27 ) 45491median : 62.00 50542interval : 4384 55590 60643 654gefitinib consumption interval ( months ) < 11 120mean ( sd ) : 10.27 ( 6.14 ) 231median : 12.00 340interval : 018 450 562 > 67cutaneous disorder yes10 no1
cutaneous side effect manifestations examination result female patients had more xerosis cutis ( 5/5 patients ) and paronychia ( 2/5 patients ) , while male patients experienced more acneiform eruption ( 4/5 patients ) . xerosis cutis and acneiform eruption were the two most common cutaneous findings in every age group , while paronychia was detected mostly in the 4044 and 6064 age groups . as mentioned previously , one patient who had only been using gefitinib for 1 week ( < 1 month ) showed no cutaneous side effects manifestation ( see tables 2 , 3).table 2cutaneous side effect manifestations examination resultcutaneous side effect manifestationstotal ( n = 10)xerosis cutis8acneiform eruption7paronychia3others ( hair disorder , mucositis , hypersensitivity reactions)0
table 3cutaneous side effects and tewl results categorized by participant baseline characteristicsvariable total ( n = 11)xerosis cutis ( n = 8)acneiform eruption ( n = 7)paronychia ( n = 3)mean bilateral tewl values ( g / m / h)sex group male ( n = 6)34111.64 ( 2.34 ) female ( n = 5)53210.68 ( 1.17)age group ( years ) 4044 ( n = 1)11115.72 ( 0 ) 4549 ( n = 1)11011.12 ( 0 ) 5054 ( n = 2)11011.03 ( 0.59 ) 5559 ( n = 0)000 6064 ( n = 3)21210.78 ( 1.71 ) 65 ( n = 4)33010.5 ( 1.44)gefitinib consumption interval ( months ) < 1 ( n = 1)0008.55 ( 0 ) 12 ( n = 0)000 23 ( n = 1)01011.98 ( 0 ) 34 ( n = 0)000 45 ( n = 0)000 56 ( n = 2)22113 ( 3.84 ) > 6 ( n = 7)64210.96 ( 1.01 )
cutaneous side effect manifestations examination result cutaneous side effects and tewl results categorized by participant baseline characteristics the mean tewl value measurement on both volar surfaces of patients was 11.205 ( 1.881 ) g / m / h ( see table s1 in the supplementary material for details ) . mean tewl measurement values were higher in male than in female patients . based on age group , tewl value was also the highest in the gefitinib consumption group of 56 months and lowest in the group of < 1 month ( see table 3 ) . this study showed that 10/11 patients experienced cutaneous side effects which confirmed the previous literature , wang et al . , who revealed that 67.6% of lung carcinoma patients with unknown egfr mutation status who received gefitinib in taiwan experienced cutaneous side effects . according to cohen et al . , the level of egfr mutation was assumed to be associated with cutaneous side effects , because of the elevated egfr inhibition in the skin tissue . some patients were more susceptible to side effects of egfr inhibition , due to dna polimorphism of normal cells and carcinoma . the most common cutaneous side effects findings in this study were xerosis cutis , followed by acneiform eruption , and paronychia ( see figs . 2 , 3 , 4 ) . according to roe , xerosis cutis developed in 100% of patients after 6 months consuming the egfr inhibitor . this might have happened because , in normal conditions , it took 14 days for epidermal cells to reach the stratum corneum , and thus keratinocyte differentiation disorder due to egfr inhibitor causing xerosis cutis was a late - onset side effect [ 14 , 21].fig . 4paronychia of patient s third toe nail
acneiform eruption on patient s chest xerosis cutis on patient s upper extremity paronychia of patient s third toe nail acneiform eruption in this study was found in almost every age group and was more common in male patients , as demonstrated by previous studies , due to the outdoor activities that exposed males to ultra violet ( uv ) light more than females . ultra violet light exposure resulted in keratinocyte destruction through photoproducts and reactive oxygen species ( ros ) formation . inhibition of egfr resulted in distortion of skin cell growth , epithelial cells differentiation , and skin protection function , including to uv exposure protection . moreover , egfr inhibition led to increased inflamatory chemokin expression which then recruited and resulted in inflammatory cells infiltration , especially in the follicle infundibulum . wang et al . revealed the correlation between xerosis cutis and paronychia , and that xerosis cutis is a risk factor for paronychia , since xerosis cutis induced by the egfr inhibitor might cause desquamation with subsequent sticking between the nail plate and the neighboring skin , inducing chronic irritation and inflammation . we confirmed this condition in our study that the patients who had paronychia also experienced xerosis cutis ( see fig . 4 ) . there were no other cutaneous side effects such as hair changes , mucositis , or drug hypersensitivity to gefitinib observed in our patients in this study . , with one of seven patients who used erlotinib egfr inhibitor experiencing hair growth and texture alteration . mean patient tewl value in this study increased compared to the normal value range 2.26 1.36 g / m / h , as a consequence of egfr inhibition that might cause abnormal keratinocyte differentiation resulting in disturbances of the stratum corneum and sebaceous glands leading to the loss of the epidermal water - retaining function . elevation of tewl was also reported by fabbrocini et al . in 33 carcinoma patients who experienced egfr inhibitor side effects ( 16.67 g / m / h ) . however , our study differed from fabroccini s since we carried out stratification for each patient characteristic group . transepidermal water loss value measurement in our study participants ( see table 3 ) showed a higher value in male patients ( 11.64 g / m / h ) compared to females ( 10.68 this might have resulted from several influencing factors , such as the use of topical products , exposure to chemicals ( including frequency of exposure to solvents and detergents / surfactants ) , and the degree of skin damage which affected patients skin hydration state . moreover , sweat and sebaceous gland activities were higher in males and so might have increased the tewl value . similar results have been published by reed et al . , who showed mean tewl values in male patients of 5.1 0.6 g / m / h and in female patients of 4.8 0.4 g / m / h . transepidermal water loss value measurements classified by age group in our patients showed the highest value in the 4044 years age group while the lowest one was in the > 65 years age group . this happened because the participant with the highest tewl value who experienced the most severe form of xerosis cutis was in the 4044 years age group , while the one participant who did not experience skin disorder was included in the > 65 years age group . this condition had an impact on the participants mean tewl value in those age groups . classified by gefitinib consumption interval , the lowest tewl value was found in patients using gefitinib for less than a month and the highest in the 56 months interval ( see table 3 ) . as mentioned before , the only patient who had been using gefitinib for < 1 month had not experienced any cutaneous effects which might also affect the tewl value . on the other hand , one of two patients who has been on gefitinib therapy for 56 months experienced the most cutaneous side effects and had the highest tewl value . the limited number of samples in our study might not fully reflect the real population distribution of cutaneous side effects due to gefitinib treatment . future studies should be conducted with longer observation times and records of both tewl value measurements and cutaneous side effects from examinations in the pre- and post - gefitinib therapy period to provide better descriptions of egfr inhibitior - induced cutaneous side effects . this study showed that 10/11 patients experienced cutaneous side effects which confirmed the previous literature , wang et al . , who revealed that 67.6% of lung carcinoma patients with unknown egfr mutation status who received gefitinib in taiwan experienced cutaneous side effects . according to cohen et al . , the level of egfr mutation was assumed to be associated with cutaneous side effects , because of the elevated egfr inhibition in the skin tissue . some patients were more susceptible to side effects of egfr inhibition , due to dna polimorphism of normal cells and carcinoma . the most common cutaneous side effects findings in this study were xerosis cutis , followed by acneiform eruption , and paronychia ( see figs . 2 , 3 , 4 ) . according to roe , xerosis cutis developed in 100% of patients after 6 months consuming the egfr inhibitor . this might have happened because , in normal conditions , it took 14 days for epidermal cells to reach the stratum corneum , and thus keratinocyte differentiation disorder due to egfr inhibitor causing xerosis cutis was a late - onset side effect [ 14 , 21].fig . 4paronychia of patient s third toe nail
acneiform eruption on patient s chest xerosis cutis on patient s upper extremity paronychia of patient s third toe nail acneiform eruption in this study was found in almost every age group and was more common in male patients , as demonstrated by previous studies , due to the outdoor activities that exposed males to ultra violet ( uv ) light more than females . ultra violet light exposure resulted in keratinocyte destruction through photoproducts and reactive oxygen species ( ros ) formation . inhibition of egfr resulted in distortion of skin cell growth , epithelial cells differentiation , and skin protection function , including to uv exposure protection . moreover , egfr inhibition led to increased inflamatory chemokin expression which then recruited and resulted in inflammatory cells infiltration , especially in the follicle infundibulum . wang et al . revealed the correlation between xerosis cutis and paronychia , and that xerosis cutis is a risk factor for paronychia , since xerosis cutis induced by the egfr inhibitor might cause desquamation with subsequent sticking between the nail plate and the neighboring skin , inducing chronic irritation and inflammation . we confirmed this condition in our study that the patients who had paronychia also experienced xerosis cutis ( see fig . 4 ) . there were no other cutaneous side effects such as hair changes , mucositis , or drug hypersensitivity to gefitinib observed in our patients in this study . , with one of seven patients who used erlotinib egfr inhibitor experiencing hair growth and texture alteration . mean patient tewl value in this study increased compared to the normal value range 2.26 1.36 g / m / h , as a consequence of egfr inhibition that might cause abnormal keratinocyte differentiation resulting in disturbances of the stratum corneum and sebaceous glands leading to the loss of the epidermal water - retaining function . elevation of tewl was also reported by fabbrocini et al . in 33 carcinoma patients who experienced egfr inhibitor side effects ( 16.67 g / m / h ) . however , our study differed from fabroccini s since we carried out stratification for each patient characteristic group . transepidermal water loss value measurement in our study participants ( see table 3 ) showed a higher value in male patients ( 11.64 g / m / h ) compared to females ( 10.68 g / m / h ) . this might have resulted from several influencing factors , such as the use of topical products , exposure to chemicals ( including frequency of exposure to solvents and detergents / surfactants ) , and the degree of skin damage which affected patients skin hydration state . moreover , sweat and sebaceous gland activities were higher in males and so might have increased the tewl value . similar results have been published by reed et al . , who showed mean tewl values in male patients of 5.1 0.6 g / m / h and in female patients of 4.8 0.4 g / m / h . transepidermal water loss value measurements classified by age group in our patients showed the highest value in the 4044 years age group while the lowest one was in the > 65 years age group . this happened because the participant with the highest tewl value who experienced the most severe form of xerosis cutis was in the 4044 years age group , while the one participant who did not experience skin disorder was included in the > 65 years age group . this condition had an impact on the participants mean tewl value in those age groups . classified by gefitinib consumption interval , the lowest tewl value was found in patients using gefitinib for less than a month and the highest in the 56 months interval ( see table 3 ) . as mentioned before , the only patient who had been using gefitinib for < 1 month had not experienced any cutaneous effects which might also affect the tewl value . on the other hand , one of two patients who has been on gefitinib therapy for 56 months experienced the most cutaneous side effects and had the highest tewl value . the limited number of samples in our study might not fully reflect the real population distribution of cutaneous side effects due to gefitinib treatment . future studies should be conducted with longer observation times and records of both tewl value measurements and cutaneous side effects from examinations in the pre- and post - gefitinib therapy period to provide better descriptions of egfr inhibitior - induced cutaneous side effects . gefitinib has been approved for the treatment of nsclc in many countries . however , its use is associated with cutaneous side effects of varied severity . health care providers should acknowledge and understand that these conditions can be managed in order to allow the continuation of the therapy . multidisciplinary management is essential to prevent severe symptoms , to increase patient compliance , consequently increasing the survival of patients with a better quality of life . below is the link to the electronic supplementary material .
supplementary material 1 ( doc 118 kb )
supplementary material 1 ( doc 118 kb ) franky chandra , dendi sandiono , unwati sugiri , oki suwarsa , and hendra gunawan declare that they have no conflict of interest . all procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation ( from medical research ethical committee , medical faculty - universitas padjadjaran / dr.hasan sadikin general hospital ) and with the helsinki declaration of 1964 , as revised in 2013 . written informed consent was obtained from all patients for being included in the study . all data generated or analyzed during this study are included in this published article as supplementary information files . this article is distributed under the terms of the creative commons attribution - noncommercial 4.0 international license ( http://creativecommons.org/licenses/by-nc/4.0/ ) , which permits any noncommercial use , distribution , and reproduction in any medium , provided you give appropriate credit to the original author(s ) and the source , provide a link to the creative commons license , and indicate if changes were made . | introductioncutaneous side effects caused by epidermal growth factor receptor ( egfr ) inhibitors occurred in 45100% of patients which may lead to therapy modification or interruption .
this study aimed to evaluate cutaneous side effects and transepidermal water loss ( tewl ) values in non - small cell lung carcinoma ( nsclc ) patients who received gefitinib egfr inhibitor.methodsa descriptive observational study with cross - sectional design and a consecutive sampling method was conducted from 1 february to 4 march 2016 .
eleven nsclc patients with egfr mutation who visited the hemato - oncology clinic / internal medicine department , dr .
hasan sadikin general hospital , bandung , indonesia , were assessed through history taking , physical examination , and tewl examination using tewameter.resultsten of the eleven patients experienced cutaneous side effects .
the most frequently observed was xerosis cutis ( 8/10 patients ) , followed by acneiform eruptions ( 7/10 patients ) , and paronychia ( 3/10 patients ) .
none of these patients experienced hair changes , mucositis , or drug hypersensitivity .
mean tewl value of these patients was higher than normal ( 11.205 1.881
g / m2/h).conclusionspatients who received gefitinib egfr inhibitor experienced cutaneous side effects including xerosis cutis , acneiform eruptions , and paronychia , and have mean tewl values higher than normal . therefore
, it might affect the skin barrier function.electronic supplementary materialthe online version of this article ( doi:10.1007/s13555 - 016 - 0163 - 0 ) contains supplementary material , which is available to authorized users . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
animals : bird species analyzed in this study were selected considering
clade of phylogenetic tree based on dna sequences . a one - year - old female blue - eared pheasant ( crossoptilon
auritum ) , a male ruddy shelduck ( tadorna ferruginea ) , a
one - year - old male mallard ( anas platyrhynchos ) , two male great horned owls
( bubo virginianus ) , two male and one female bar - headed goose
( anser indicus ) , one male indian peafowl ( pavo
cristatus ) , one 12-year - old male goose ( anser anser ) , one
19-year - old female black - headed ibis ( threskiornis melanocephalus ) , one
female swan goose ( anser cygnoides ) , two male snowy owls ( bubo
scandiacus ) , one female chilean flamingo ( phoenicopterus
chilensis ) , one eight - year - old male humboldt penguin ( spheniscus
humboldti ) , one female cape barren goose ( cereopsis
novaehollandiae ) and one gender - undetermined black - crowned night heron
( nycticorax nycticorax ) , were provided by maruyama zoo ( sapporo , japan ) . their livers were
immediately frozen in liquid nitrogen and stored at 80c until use . all experiments using
animals were performed according to the guidelines of the hokkaido university institutional
animal care and use committee . cdna cloning and sequencing of ahr : hepatic total rna was isolated using
tri reagent ( sigma - aldrich , st . louis , mo , u.s.a . ) and reverse - transcribed to cdna using
oligo(dt ) . partial ahr1 and ahr2 dna sequences were amplified by pcr using the primers
listed in table 1table 1.primers for avian ahrforward 5-sequence-3reverse 5-sequence-3avian ahr fullcaggatgaaccccaatgtcacgtcacataaatccactagatgccaaaavian ahr1 - 1ggatgaaccccaatgtcacctaatcgtccttgaaaattcataavian ahr1 - 2tcatctgcaggttacgatgcctacacagactcatcttgccttaavian ahr1 - 3tgcccttcatgtttgccactggtgatccaatttgtgaacatcccatavian ahr1 - 4cagctctgtcaaaagatgaaattacataaatccactaga . the pcr parameters for the amplification of ahr1 were as follows : 94c for 2
min , then 94c for 30 sec , 66c for 45 sec and 72c for 3 min for 35 cycles , followed by
72c for 5 min . pcr products were subject to direct - sequencing using primers avian ahr1 - 1 to
4 and an annealing temperature of 50c ; the forward and reverse ahr2 primers were used in
pairs with an annealing temperature of 63c . for obtaining dna sequence information for the
ligand - binding domain , the primers : ahr2-lbd - f 5-tctccagacaaagcacaagctggac-3 and
ahr2-lbd - r 5-gtacaggactgcttcccccgtg-3 were used . phylogenetic tree and amino acid sequence alignment of ahr1 and ahr2 : dna
sequences of avian ahr1 were aligned by clustal w using molecular evolutionary genetics
analysis ( mega ) 5 . the accession numbers for the
sequences included in this analysis were : ostrich ahr1 ( ab820092 ) , blue eared - pheasant ahr1
( ab820094 , ab820095 ) , indian peafowl ahr1 ( ab820097 ) , swan goose ahr1 ( ab820099 ) , bar - headed
goose ahr1 ( ab820101 ) , goose ahr1 ( ab820103 ) , mallard ahr1 ( ab820105 , ab820106 ) , ruddy
shelduck ahr1 ( ab820108 ) , cape barren goose ahr1 ( ab820110 ) , black - headed ibis ahr1
( ab820112 ) , humboldt penguin ahr1 ( ab820113 ) , chilean flamingo ahr1 ( ab820115 , ab820116 ) ,
black - crowned night heron ahr1 ( ab820118 , ab820119 ) , snowy owl ahr1 ( ab820121 ) , great horned
owl ahr1 ( ab820122 , ab820123 ) , peregrine falcon ahr1 ( ab560859 ) , common cormorant ahr1
( ab109545 ) , black - footed albatross ahr1 ( ab106109 ) , common tern ahr1 ( af192503 ) , chicken ahr
( af192502 ) , ostrich ahr2 ( ab920093 ) , blue eared - pheasant ahr2 ( ab820096 ) , indian peafowl
ahr2 ( ab820098 ) , swan goose ahr2 ( ab820100 ) , bar - headed goose ahr2 ( ab820102 ) , goose ahr2
( ab820104 ) , mallard ahr2 ( ab820107 ) , ruddy shelduck ahr2 ( ab820109 ) , cape barren goose ahr2
( ab820111 ) , humboldt penguin ahr2 ( ab820114 ) , chilean flamingo ahr2 ( ab820117 ) ,
black - crowned night heron ahr2 ( ab820120 ) , great horned owl ahr2 ( ab820124 ) , peregrine
falcon ahr2 ( ab560860 ) , black - footed albatross ahr2 ( ab106110 ) , common cormorant ahr2
( ab287294 ) and chicken ahr2 ( xm421887 ) . , an alignment was performed using ~250 bases of dna of the ligand - binding domain and
excluded areas containing gaps . a phylogenetic tree was constructed by the maximum
likelihood method based on mega5 program . the bootstrap consensus tree inferred from 500 two critical amino acids in the ahr1 and ahr2 proteins : based on the two
critical amino acids in the ligand - binding domain of ahr1 , the avian species we examined could be divided into three groups . the first
group , with amino acids 325-ile and 381-ser , consisted of the ostrich and chicken . the
chicken is reported to be a highly sensitive species to tcdd [ 14 , 17 , 18 , 34 ] . the blue - eared pheasant ,
indian peafowl , black - footed albatross and swan goose composed the second group , possessing
amino acids 325-ile and 381-ala . other avian species , including the bar - headed goose , goose ,
mallard , ruddy shelduck , cape barren goose , snowy owl , great horned owl , peregrine falcon ,
black - headed ibis , humboldt penguin , chilean flamingo , common cormorant and the
black - crowned night heron , belonged to the last group , harboring amino acids 325-val and
381-ala ( figs . 1 and 2fig . the amino acid sequences of the ligand - binding
domain from ahr1s were aligned using the clustalx2 software , and the accession numbers
are listed in the materials and methods . the amino acid sequences of part of the
ligand - binding domain from ahr2s were aligned using the clustalx2 software , and the
accession numbers are listed in the materials and methods . snowy owl , common tern and black - headed ibis are
not shown in this figure . ; table 2table 2.the critical amino acids in ligand - binding domains of ahr1 and ahr2 with
in vivo sensitivityahr1ahr2orderin vivo sensitivity325381325381 ostrich islast chickenisvsghigh * blue - eared pheasant ialagmiddle [ 3 , 22]*indian peafowl ialag*swan goose iavaa*bar - headed goose vavaa*goose vavaalow * mallardvavaalow [ 3 , 5 , 16]*ruddy shelduck vavaa*cape barren goose vavaa black - footed albatross iavac common cormorant vavaclow peregrine falcon vavaclow common ternvaclow [ 4 , 15]*black - headed ibis vavac*humboldt penguin vavac*chilean flamingo vavac*black - crowned night heron vavac*snowy owl vavasg*great horned owl vavasgthe two amino acids in ahr1 and ahr2 at positions 325 and 381 of each avian species
were indicated . i : isoleucine , s : serine , a : alanine , v : valine , l : leucine . *
indicates the species whose ahrs are cloned and sequenced in this study . abbreviations
for each order are ; st : struthioniformes , g :
galliformes , a : anseriformes , c :
ciconiiformes and sg : strigiformes . a ) in
vivo sensitivity of common pheasant or ring - necked pheasant
( phasianus colchicus ) . b ) in vivo sensitivity of
double - crested cormorant ( phalacrocorax auritus ) . c ) in
vivo sensitivity of american kestrel ( falco
sparverius ) . ) . the amino acid sequences of the ligand - binding
domain from ahr1s were aligned using the clustalx2 software , and the accession numbers
are listed in the materials and methods . the amino acid sequences of part of the
ligand - binding domain from ahr2s were aligned using the clustalx2 software , and the
accession numbers are listed in the materials and methods . snowy owl , common tern and black - headed ibis are
not shown in this figure . the two amino acids in ahr1 and ahr2 at positions 325 and 381 of each avian species
were indicated . i : isoleucine , s : serine , a : alanine , v : valine , l : leucine . abbreviations
for each order are ; st : struthioniformes , g :
galliformes , a : anseriformes , c :
ciconiiformes and sg : strigiformes . a ) in
vivo sensitivity of common pheasant or ring - necked pheasant
( phasianus colchicus ) . b ) in vivo sensitivity of
double - crested cormorant ( phalacrocorax auritus ) . c ) in
vivo sensitivity of american kestrel ( falco
sparverius ) . the species could also be divided into three groups according to the amino acids in the
ahr2 ligand - binding domain . the group possessing the amino acids 325-leu and 381-ala
comprised the ostrich , blue - eared pheasant and indian peafowl . the chicken is the only one
species to constitute the group of species to possess 325-val and 381-ser ahr2 . other avian
species belonged to the group harboring the amino acids 325-val and 381-ala ( figs . 1 and
2 ; table 2 ) . ahr1 and ahr2 phylogenetic analyses : the phylogenetic tree constructed
from the avian ahr1 sequences indicated that the ostrich was distinct from the other avian
species . also , galliformes , including chicken , pheasant and peafowl ,
ciconiiformes , including albatross , tern , cormorant , penguin , flamingo ,
falcon and heron and strigiformes , including the snowy owl and great horned
owl , grouped close together on the tree . these groupings were consistent with the taxonomic
groupings of the avian species ( fig . 3fig . alignment was
performed with a length of about 2,000 bases , including the functional domains , pas - a ,
pas - b and the q - rich domains and excluded the regions containing gaps . the percentages of replicate trees in which the
associated taxa clustered together in the bootstrap test ( 500 replicates ) are shown
next to the branches . swan
goose , bar - headed goose , goose , ruddy shelduck , cape barren goose and black - headed
ibis are not shown in this figure . ) . alignment was
performed with a length of about 2,000 bases , including the functional domains , pas - a ,
pas - b and the q - rich domains and excluded the regions containing gaps . the percentages of replicate trees in which the
associated taxa clustered together in the bootstrap test ( 500 replicates ) are shown
next to the branches . swan
goose , bar - headed goose , goose , ruddy shelduck , cape barren goose and black - headed
ibis are not shown in this figure . in the case of ahr2 , the phylogenetic tree was also linked to the taxonomy of the species
with the exception of the ostrich and great horned owl . the orders galliformes ,
ciconiiformes and anseriformes in phylogenetic tree were all
assembled the same as that of ahr1 ( fig . dna sequences of ahr2s were aligned using the by
clustal w using mega5 program . alignment
was performed at a length of about 200 bases , a region of the ligand - binding domain ,
and also excluded regions containing gaps . the bootstrap consensus tree inferred from
500 replicates is taken to represent the evolutionary history of the taxa analyzed . the percentages of replicate trees in which the associated taxa clustered together in
the bootstrap test ( 500 replicates ) are shown next to the branches . snowy owl and black - headed ibis are not shown in this
figure . ) . dna sequences of ahr2s were aligned using the by
clustal w using mega5 program . alignment
was performed at a length of about 200 bases , a region of the ligand - binding domain ,
and also excluded regions containing gaps . the bootstrap consensus tree inferred from
500 replicates is taken to represent the evolutionary history of the taxa analyzed . the percentages of replicate trees in which the associated taxa clustered together in
the bootstrap test ( 500 replicates ) are shown next to the branches . in mammals , several factors have been reported to determine the ligand - binding affinity or
dioxin sensitivity to ahr - induced toxicity . in c57bl/6 and dba/2 mice , large differences in
ahr ligand - binding affinity result from ahr point mutations at codon 375 in the
ligand - binding domain . similarly , han / wistar rats ,
which are insensitive to dioxin , harbor a point mutation at position 497 in ahr . avian species are distinct in that they possess two ahr isoforms , ahr1 and ahr2 , and the
type of ahr dominantly expressed varies among avian species . most species dominantly express ahr1 , and ahr1 ligand - binding affinity is
reported to directly correlate with cyp1a transactivation ability . critical mutations which decide dioxin sensitivity have been found
in avian species at positions 325 and 381 of ahr1 . head et al . showed
these two amino acids are effective for predicting avian dioxin sensitivity . in the study , avian species are divided into three groups according to the key amino acids in ahr1 . the
most sensitive group is with ahr1 of 325-ile and 381-ser , middle for 325-ile and 381-ala ,
and the least sensitive for 325-val and 381-ala . in this study , the blue - eared pheasant ,
goose and mallard are newly classified according to the two amino acids , and we found that
the grouping corresponds with in vivo sensitivity also in these cases . in the current study , we investigated whether similar avian species would have similar
levels of dioxin sensitivity . indeed , the phylogenetic trees constructed from the amino
acids sequences of ahrs gave results in - keeping with the evolutionary history of these
proteins . unexpectedly , even though the amino
acids sequences of ahrs highly reflected the taxonomy , the identity of the two critical
amino acids , at positions 325 and 381 , did not correspond to the phylogenetic trees of ahr
or taxonomy . in fact , these two amino acids were not conserved in the orders ,
galliformes and ciconiiformes [ 14 , 34 ] . therefore , our new
findings suggested that these key amino acids at positions 325 and 381 are independent from
the other amino acids sequences of ahrs , so that they can not be predicted from the
phylogenetic tree or from taxonomy . that is , the ligand - binding affinity or the dioxin
sensitivity of each avian ahr protein can not be determined from the taxonomy . the amino acid sequence of the ahr1 ligand - binding domain was highly conserved among
different species . in the ostrich , multiple amino acid changes were found throughout the
ligand - binding domain , compared with other avian species . this ostrich ahr1 was reported to
possess high transactivation ability in our previous study , similar to chicken ahr1 . regarding the two critical amino acids , avian species harboring isoleucine at position 325
in ahr1 were chicken , peafowl , pheasant , albatross , swan goose and ostrich . all species in
the order galliformes examined in this study , including chicken , peafowl
and pheasant , possessed isoleucine at position 325 . however , albatross and swan goose were
the only species to possess this amino acid in their respective orders ,
ciconiiformes and anseriformes . only two of the avian
species , chicken and ostrich from the orders galliformes and
struthioniformes , respectively , possessed a serine at position 381 . species within the order galliformes , such as peafowl and pheasant , did not
harbor this amino acid . taken together , these findings indicate that the two critical amino
acids are independent of taxonomy or even phylogeny of the full - length amino acid sequence
of ahr1 . therefore , we conclude that it is difficult to predict the dioxin sensitivity of
avian species from taxonomy or evolutionary history . in the case of avian ahr2 , the amino acid sequence of the ligand - binding domain was not as
highly conserved as that of ahr1 . in terms of the two critical amino acids in the
ligand - binding domain , the only species to possess 381-ser in ahr2 was the chicken . in addition , we identified the
amino acid leucine at position 325 in pheasant , peafowl and ostrich . this amino acid has not
previously been reported at this position , and its corresponding ahr function is therefore
unknown . it will be of interest to investigate the function or ligand - binding affinity of
this type of ahr protein . future researches are also required to fully investigate the avian
ahr2 protein and its role in avian dioxin sensitivity . in conclusion , the two critical amino acids at positions 325 and 381 in the ligand - binding
domain of ahr were investigated in several bird species , and the results were compared with
the taxonomy or phylogenetic trees for the ahr proteins . the two critical amino acids did
not correlate with the taxonomy or phylogeny of these proteins , and dioxin sensitivity was
independent of taxonomy . | abstract there are two arylhydrocarbon receptor ( ahr ) isoforms in birds , ahr1 and ahr2 .
the varying sensitivity of ahr is
reported to be related to two critical amino acids at positions 325 and 381 in the ahr1
ligand - binding domain . in this study , seven avian species whose in vivo
dioxin sensitivity was known , and 13 species with no data regarding their in
vivo dioxin sensitivity were examined .
the two critical amino acids in the
ligand - binding domain were investigated in avian species , and the results were compared
with the taxonomy or phylogenetic trees for the bird ahr proteins .
we found that the two
critical amino acids did not correlate with the taxonomy or phylogeny of these proteins ,
suggesting that dioxin sensitivity was independent of taxonomy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the strength aspect of the posterior restoration material is more important than the esthetic aspect because posterior restorations are subject to higher stresses during mastication than anterior restorations . to overcome fracture of all ceramic restorations , these include lithium disilicate , glass - infiltrated alumina , high - purity alumina , and zirconia.1 among many dental ceramics , yttria - stabilized tetragonal zirconia polycrystal ( y - tzp ) was proven to be satisfactory and was widely used for its remarkable fracture resistance and flexural strength compared to other dental ceramic materials.2 zirconia exists in three different crystal phases at three different temperatures ; monoclinic , tetragonal , and cubic . the monoclinic phase changes into the tetragonal phase at temperatures from above 1,070. then zirconia becomes stable in the tetragonal phase at temperatures between 1,170 and 2,370. at temperatures above 2,370 , zirconia exists in the cubic phase . zirconia can maintain the tetragonal phase at room temperature when stabilizers such as ceria , magnesia , or yttria are added . the transformation of martensitic tetragonal to monoclinic phase may be initiated by stress , such as machining , wear , or water . the transformation from the tetragonal to monoclinic phase causes a volume expansion by 3 - 4% . this transformation - toughening phenomenon results in the fracture resistibility and higher strength of zirconia . zirconia has flexural strength ranging between 800 - 1200 mpa and a fracture toughness ranging between 6 - 8 mpa , and it meets the mechanical requirements for high stress - bearing posterior restorations.345 guess et al.6 reported that monolithic lithium disilicate ceramic which were fabricated by the application of computer - aided design / computer - aided manufacturing ( cad / cam ) resulted in fatigue - resistant crowns , whereas veneered zirconia crowns showed a higher susceptibility to cyclic loading with early veneer failures based on fatigue findings . advances in dental ceramic materials and the development of cad / cam along with milling technologies have improved the materials and made them easier to use which was impossible with conventional dental processing techniques.789 the monolithic zirconia crowns have been used more widely because of the recent developments in zirconia stain and glaze techniques . even with their rapid development and increased uses , distinct criteria have not been established for the application of monolithic zirconia crowns . since fea was developed in the engineering field , it has been a popular option to analyze stress . in dentistry , fea has been used to study stress distributions in the teeth and restorative materials.1011 the purpose of this study was to evaluate the influence of different cement materials on the stress distribution in monolithic zirconia crowns by three dimensional fea . fea has been used as a method to analyze the magnitude and distribution of stresses in complex geometries . the geometric solid model was divided into elements , which were used as mathematical functions.1213 a standard crown preparation with a 8 convergence angle between tooth axis and axial wall , the chamfer depth of 1.2 mm , was prepared on a mandibular first molar of the nissin study model ( d85dp-500b.1 , nissin dental , kyoto , japan ) by using a surveyor ( f1 , degu dent gmbh , kanau , germany ) . the prepared model and unprepared mandibular right first molar resin model were scanned using an optical scanner ( optical 3d scanner activity 101 , smart optics sensor technik gmbh , bochum , germany ) . they were imported into the cad software for modeling ( free form modeling systems , sensable - geomagic , woburn , ma , usa ) . subsequently , a monolithic zirconia crown was designed based on an unprepared tooth resin model by using cad . the solid models of a monolithic zirconia crown ( 1.5-mm thickness ) , a cement layer , and a prepared tooth were generated by using the scanned images with cad software ( hyper works 10.0 , altair engineering , ontario , canada ) . even though the recommended cement thickness is 50 m , the cement thickness in this study was defined to be 200 m to approximate the reported mean occlusal gap values of 219 - 369 m.14 moreover , reich et al . studied the cement thickness of crown fabricated by 3 commercially available cad / cam systems and reported the mean occlusal gaps were 215 m , 371 m and 383 m.15 in this process , 4 different models were fabricated for the different cement types ( zinc phosphate cement ( zpc ) , polycarboxylate cement ( pc ) , glass ionomer cement ( gic ) , and resin cement ) . the monolithic zirconia crown layer , the cement layer , and the prepared tooth were assembled in the final model ( fig . model i : vertical load 700 n , zinc phosphate cementmodel ii : vertical load 700 n , polycarboxylate cementmodel iii : vertical load 700 n , glass ionomer cementmodel iv : vertical load 700 n , resin cement
model i : vertical load 700 n , zinc phosphate cement model ii : vertical load 700 n , polycarboxylate cement model iii : vertical load 700 n , glass ionomer cement model iv : vertical load 700 n , resin cement the finite element model was developed by using abaqus / cae 6.9 software ( dassault systmes , vlizy - villacoublay , france ) . the solid model the material properties used in this study are listed in table 1.16 the following assumptions were included in the finite element models : ( 1 ) all components ( monolithic zirconia crown , cement layer , and prepared tooth ) were assumed to be homogeneous , linearly elastic , and isotropic in properties ; ( 2 ) no slip happened between components ( perfect bonding ) ; ( 3 ) the cement layer had a 200-m uniform thickness except at the margins ; ( 4 ) the monolithic zirconia crown had a 1.5-mm uniform thickness except at the margins ; ( 5 ) no components were flawed ; and ( 6 ) all degrees of freedom were constrained at the root component surface . occlusal loads must be resisted by the prostheses as well as the cement . in the majority of previous research , maximum bite force has been reported as 700 n.1718 therefore , the magnitude of the values of load used in the present study was 700 n to simulate maximum bite force depending on the published data.101718 the load of 700 n was distributed uniformly on the following 8 points of the crown in a vertical direction : 3 points on the outer inclines of each buccal cusp , 3 points on the inner inclines of each buccal cusp , and 2 points on the inner inclines of each lingual cusp ( fig . d - e).10 the maximum principal stresses were recorded for the monolithic zirconia crown , each cement layer , and prepared tooth . concentrations of maximum principal stress were observed on 8 loading points on the occlusal surface , the buccal cusp on the buccal surface , the lingual pit on the lingual surface , and the cervical area on the mesial and distal surfaces . difference in the stress distribution of the monolithic zirconia crown was observed in each model for the mesial , distal , and intaglio surfaces . model i showed the highest maximum principal stress on the occlusal , cervical areas of the mesial , and intaglio surfaces , while model ii showed the highest maximum principal stress on the cervical areas of the distal surface . 3 ; concentrations of maximum principal stress were observed on the occlusal surface , intaglio surface , and cervical area of the cement layers . model i showed the highest maximum principal stress on the mesial and distal surfaces , while model ii showed the lowest maximum principal stress on the mesial and distal surfaces of the cement layer . model iii and model iv showed similar stress distribution pattern each other except for the lingual surface . model iv showed the lowest maximum principal stress concentration on the lingual surface of the cement layer . 4 ; concentrations of minimum principal stress were observed on the occlusal surface , intaglio surface , and cervical areas of the cement layer . model i showed the highest stress concentrations on the buccal , mesial , and distal surfaces , whereas model ii showed the lowest stress concentrations on the buccal , mesial , and distal surfaces . 5 ; concentrations of von mises stresses were observed on the occlusal surface and cervical areas of the cement layer . model i showed the highest stress concentrations on the occlusal , buccal , lingual , cervical areas of the mesial , and intaglio surfaces , while model ii showed a lower stress concentrations on the lingual and mesial surfaces than the other models . model iii showed the lowest stress concentration on the buccal surface , while model iv showed a lower stress concentration on the distal surface than the other models . the highest levels of the maximum principal stress , minimum principal stress , and von mises stress in each component are shown in fig . the use of the monolithic zirconia crowns has become popular in the restorative dentistry . while there are a vast variety of dental cements presently available in the market including zpc , pc , gic , and resin cements , there are no well - established guidelines for the selection of dental cements for the monolithic zirconia restorations . dental cements are designed to provide stability and retention to the restorations in the harsh oral environment . usually , 2 or 3 mechanisms work together in combination , depending on the nature of the cement and material.19 dental cements are subdivided as resin - based and non - resin - based cements . they should have properties such as resistance to dissolution , a strong bond , high strength under tension , good manipulation properties , and biocompatibility . zpc has been traditionally regarded as the most popular material , despite its lack of adhesion , solubility , and low hardness properties . although the final marginal accuracy of all - ceramic systems produced from cad / cam has significantly improved , these products still result in larger internal gaps than those of cast crowns , possibly resulting in thicker cement layers and less frictional retention to the abutments.1415 these would be drawbacks for zpc because of its solubility and lack of adhesiveness . zpc has been used in some all - ceramic systems , but long - term clinical data have not yet been published . pc was the first cement exhibiting adhesive properties to the tooth . however , pc exhibited low compressive strength , tensile strength , and it may undergo significant plastic deformation under functional force after set . these cements exhibit several clinical advantages , including physicochemical bonding to tooth structures , low coefficients of thermal expansion , and long - term release of fluoride . however , low mechanical strength compromises the use of gic in high - stress - bearing areas . moreover , gic would not be suitable for ceramics that require support from the cement . therefore , resin - based cements are widely used as the choice of cements for ceramic restorations due to the disadvantages of other cements such as lack of solubility , support , and adhesion . it has the advantages such as high bonding strength , high compressive strength and low solubility . restorative dentistry constantly undergoes changes and no currently available cement is ideal for all situations . resin - based cements are used in all - ceramic systems because of the important role that those cements play in the final clinical success of this treatment modality.2021222324 several authors have studied the role of dental cement by using fea . proos et al.16 investigated the influence of adhesive resin and zpc on in - ceram coping and gold coping , and their results suggested that the type of dental cement has a minor effect on the resultant stress distribution . kamposiora et al.,25 who studied the stress level and distribution of the cement layer with 4 types of cement under an all - ceramic crown and gold crown , found that zpc shows a greater stress value than other cement materials . shahrbaf et al.26 studied the influence of the tooth preparation design and the elastic moduli of cement which include 4 kinds of commercially available resin cements and extremely high value hypothetical cement . their results suggested that both the preparation design and the elastic modulus of cement affect the stress distribution of the restored crown - root complex . rekow et al.27 studied the influence of 7 variables , including crown material and thickness , cement material and thickness , position of load , cusp inclination , and the supporting core , on the maximum principal stress distribution . they found that the crown material and thickness are major contributive factors . in their study , all cements were assumed to be in the rigid bonding condition , which means that the interface of each component can not slip . may et al.,28 who studied the influence of the cement thickness and bonding condition on the feldspathic porcelain crown by means of 2-dimensional multiphysics fea and a physical test , found that the well - fitted , bonded feldspathic crown can withstand a greater load than the non - bonded crown , but the bonding effect disappears under a large cement layer . the present study used 4 types of dental cements and showed that these types of cements have similar stress distributions except for zpc and pc , which had a wider distribution of a high stress level on the monolithic zirconia crown and cement layer . these findings suggest that low - elastic materials result in a lower stress distribution in the cement layer and transfer less stress to the prepared tooth . resin cements have the advantage of high tensile strength , high compressive strength , high bonding strength , and low solubility . moreover , resin cements have shown better retention than zpc or gi.29 however , conventional resin cements require multiple steps for bonding procedure.30 in addition , it is difficult to establish chemical bonding between resin cements and the zirconia inner surfaces without functional monomer or other surface treatments . therefore , self - adhesive resin cement containing functional monomer is recommended for luting agent of the monolithic zirconia crowns . the results of in vitro simulation testing can not be postulated to the clinical situation , because this simulation study design did not contemplate typical factors of the oral cavity , such as dynamic forces of mastication or fatigue loading . this , however , was not taken into consideration in the current study . in the present study , further studies are necessary on the effect of the cement type under conditions of dynamic occlusion , various cement thicknesses , and cement polymerization . in clinical practice , the restored crown - root complex is always located in conditions that are moist and prone to temperature changes . therefore , further studies are necessary on the influence of the cement under conditions of bonding , water storage , cyclic loading , and thermo - cycling . within the limitations of this study , it can be concluded that the use of different dental cements that have different elastic moduli has an impact on the stress distribution of the monolithic zirconia crown , cement layer , and prepared tooth . dental cement with higher elastic modulus creates a wider distribution of a higher stress concentration area within the cement layer . resin cement is recommended for luting agent of the monolithic zirconia crown , because it showed low stress concentration in the cement layer and it has an advantage of low solubility . | purposethe objective of this study was to evaluate the influence of various cement types on the stress distribution in monolithic zirconia crowns under maximum bite force using the finite element analysis.materials and methodsthe models of the prepared # 46 crown ( deep chamfer margin ) were scanned and solid models composed of the monolithic zirconia crown , cement layer , and prepared tooth were produced using the computer - aided design technology and were subsequently translated into 3-dimensional finite element models .
four models were prepared according to different cement types ( zinc phosphate , polycarboxylate , glass ionomer , and resin ) . a load of 700 n was applied vertically on the crowns ( 8 loading points ) .
maximum principal stress was determined.resultszinc phosphate cement had a greater stress concentration in the cement layer , while polycarboxylate cement had a greater stress concentration on the distal surface of the monolithic zirconia crown and abutment tooth .
resin cement and glass ionomer cement showed similar patterns , but resin cement showed a lower stress distribution on the lingual and mesial surface of the cement layer.conclusionthe test results indicate that the use of different luting agents that have various elastic moduli has an impact on the stress distribution of the monolithic zirconia crowns , cement layers , and abutment tooth .
resin cement is recommended for the luting agent of the monolithic zirconia crowns . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
tenascin - c is an ecm protein well known for its high expression in almost all solid tumors and for its antiadhesive properties for cells in culture ( for reviews see chiquet - ehrismann , 1993 ; crossin , 1996 ; vollmer , 1997 ; jones and jones , 2000 ; orend and chiquet - ehrismann , 2000 ) . the level of tenascin - c expression and the nature of the isoform expressed seems in a variety of tumors to correlate with a higher incidence of metastases and poor prognosis ( goepel et al . 2001 ; adams et al . , 2002 ; herold - mende et al . , 2002 ) . therefore , it is of great interest to find out how tumor cells react to the presence of tenascin - c . in most of the published studies to date , effects of tenascin - c on cell adhesion , spreading , migration , and growth have been reported ( for review see orend and chiquet - ehrismann , 2000 ) . however , the molecular mechanisms mediating these responses to tenascin - c remain largely unknown . from previous studies we know that a tenascin - c substratum supports the growth of rat primary mammary carcinoma cells more than fibronectin ( chiquet - ehrismann et al . , 1986 ) . furthermore , we have shown that mcf-7 human mammary carcinoma cells induce tenascin - c expression in cocultured fibroblasts surrounding the tumor cell nests ( chiquet - ehrismann et al . , 1989 ) . we therefore decided to screen for transcripts that are differentially expressed in mcf-7 cells grown on a tenascin - c versus a fibronectin substratum . we now report on our discovery that a tenascin - c substratum induces the expression of the phospho - serine / threonine binding adaptor protein 14 - 3 - 3 tau in mcf-7 mammary carcinoma cells and describe its influence on cell adhesion and cell growth . mcf-7 cells were grown in medium containing 10% fcs for 24 h on plates coated with fibronectin or tenascin - c , respectively . they grow in epithelial patches on fibronectin but lose their cell cell contacts and adopt irregular shapes with long processes on a tenascin - c substratum ( fig . this is reminiscent of the results obtained with mcf-7 cells grown on collagen gels in the presence and absence of tenascin - c where the cells in the presence of tenascin - c were found to loose their cell cell contacts and detached from the substratum ( chiquet - ehrismann et al . , 1989 ) . to identify molecular differences between the cells grown on fibronectin versus tenascin - c , we isolated mrna from these cells and performed a screen for differentially expressed transcripts . this screen resulted in the identification of a cdna clone encoding the adaptor protein 14 - 3 - 3 tau . 14 - 3 - 3 proteins are a family of phospho - serine / threonine binding proteins with > 70 known ligands as diverse as kinases , phosphatases , receptors , structural proteins , and transcription factors ( for reviews see fu et al . , we confirmed the higher level of 14 - 3 - 3 tau transcripts in two mrna batches isolated from independently cultured mcf-7 cells on tenascin - c versus fibronectin substrates by semiquantitative pcr . 2 a , transcript levels of gapdh were equal , whereas 14 - 3 - 3 tau was highly increased in the samples from the cells cultured on tenascin - c compared with fibronectin . we next tested whether the level of the 14 - 3 - 3 tau protein was also affected . we loaded equal amounts of cellular protein on an sds - page followed by detection of 14 - 3 - 3 tau by a specific antiserum on an immunoblot . 2 b , the level of the 14 - 3 - 3 protein was also much higher in cell extracts of cells grown on a tenascin - c substratum than on fibronectin . mcf-7 cells were cultured for 24 h in complete medium on fibronectin - coated ( a ) and on tenascin - c coated ( b ) dishes and photographed . on fibronectin , they adopt a cobble - stone like epithelial morphology , whereas on tenascin - c they lose the cell cell contacts and adopt irregular shapes . bar , 200 m . induction of 14 - 3 - 3 tau in cells grown on tenascin - c . ( a ) photographs of ethidium bromide - stained agarose gels shows rt - pcr reactions of mrna isolated from mcf-7 cells grown for 24 h on a fibronectin ( fn ) or on a tenascin - c ( tn ) substratum . they reveal an increase in 14 - 3 - 3 transcripts in cells from the tenascin - c substratum , whereas gapdh expression is equal in both situations . the same result was obtained in two independently performed experiments ( exp . 1 and exp . ( b ) amidoblack staining of a 12% sds gel blotted to a pvdf membrane showing equal protein content of cell extracts loaded from cells grown on fibronectin ( fn ) or tenascin - c ( tn ; left ) . the immunoblot of the same membrane obtained with anti14 - 3 - 3 tau reveals a stronger signal in the extract from cells grown on tenascin - c than on fibronectin ( right ) . from the literature we know that 14 - 3 - 3 proteins are implicated in the regulation of cell growth and oncogenic transformation ( takihara et al . , 2000 ) and that they exhibit antiapoptotic activity ( xing et al . therefore , we decided to test for an effect of elevated 14 - 3 - 3 tau levels in mcf-7 cells on their adhesion and growth behavior when cultured on tenascin - c versus fibronectin substrates . we transfected mcf-7 cells with a construct encoding 14 - 3 - 3 tau containing an nh2-terminal flag tag . cell clones were isolated and tested on immunoblots for expression of the transfected 14 - 3 - 3 tau in comparison to the endogenous 14 - 3 - 3 tau protein as shown in fig . 3 a. clones 2 and 5 exhibiting the highest amount of the transfected 14 - 3 - 3 relative to the endogenous protein were selected for further experiments . when they were grown on tenascin - c coated plates they exhibited a cobble stone like morphology as on fibronectin , whereas the parental cells showed an irregular morphology on tenascin - c ( fig . 4 a ) . isolation of mcf-7 clones overexpressing 14 - 3 - 3 tau . cell extracts ( not normalized to protein content ) of the parental mcf-7 cells ( m ) and of clones 15 isolated after transfection with flag - tagged 14 - 3 - 3 tau were separated by 12% sds - page . immunoblots thereof were performed using anti - flag to identify the product from the transfected construct and anti14 - 3 - 3 tau to detect the endogenously expressed protein . the two bands could easily be distinguished , since the flag - tagged protein migrated slightly slower than the endogenous protein . clones 2 and 5 ( circled numbers ) , exhibiting the strongest band with anti - flag relative to the presence of the endogenous protein were selected for further studies . ( b ) parental mcf-7 cells and clones 2 and 5 were cultured for 24 h in complete medium on a fibronectin versus a tenascin - c substratum and photographed . the parental cells showed an altered morphology induced by the tenascin - c substratum , whereas no difference was visible in the 14 - 3 - 3overexpressing clones 2 and 5 . effect of 14 - 3 - 3 tau on cell morphology and adhesion on fibronectin versus tenascin - c substrata . ( a ) tritc - phalloidin staining of mcf-7 parental cells and clones 2 and 5 overexpressing 14 - 3 - 3 tau grown in fibronectin - coated ( fn ) or tenascin - c coated ( tn ) wells . mcf-7 cells are well spread on fibronectin but elongated with many actin - rich processes on tenascin - c as opposed to clones 2 and 5 , which how similar morphologies on either substratum with actin accumulations at the cell peripheries of the well spread cells . ( b ) anti - flag staining reveals cells overexpressing transfected 14 - 3 - 3flag ( 14 - 3 - 3 ) , and ritc - phalloidin staining shows f - actin in all cells present in the same field of cultures of ht1080 cells and t98 g cells grown on either fibronectin ( fn ) or tenascin - c ( tn ) . only the transfected cells were able to adhere and survive on the tenascin - c substratum , whereas on fibronectin most cells remained present . two more cell lines were analyzed for a similar effect of 14 - 3 - 3 tau on cell adhesion on tenascin - c . were transiently transfected with 14 - 3 - 3 tau after plating them on either a fibronectin or a tenascin - c substratum . 1 d later , transfected cells were visualized by staining the flag tag of the transfected 14 - 3 - 3 tau , and all cells were stained by phalloidin ( fig . 4 b ) . on fibronectin , a small proportion of the large number of adhering cells expressed 14 - 3 - 3 tau , whereas on tenascin - c only a few cells were present but all expressing 14 - 3 - 3 tau . this implies that in these cells overexpression of 14 - 3 - 3 tau also led to an increased cell adhesion on tenascin - c . possibly , this effect is related to the reported interaction of 14 - 3 - 3 tau with rap1/b - raf ( berruti , 2000 ) , since rap1 signaling has been implicated in the regulation of integrin - mediated cell adhesion ( bos et al . , 2001 ) . another possibility could be an interaction of 14 - 3 - 3 with integrins themselves as has been reported for 14 - 3 - 3 beta and integrin 1 ( han et al . , 2001 ) or for 14 - 3 - 3 zeta with the integrin - associated docking protein p130 ( cas ) . finally , an interaction of 14 - 3 - 3 zeta with the actin depolymerizing factor cofilin and its regulatory kinase lim kinase 2 has been observed ( birkenfeld et al . , 2003 ) , and 14 - 3 - 3 zeta seems to stabilize phosphocofilin levels ( gohla and bokoch , 2002 ) , pointing to a further pathway for 14 - 3 - 3 proteins by affecting cell morphology through direct action on the actin cytoskeleton . we next tested the effect of the overexpression of 14 - 3 - 3 tau on cell growth . we plated equal numbers of cells on fibronectin versus tenascin - c substrates in complete medium and cultured the parental versus the 14 - 3 - 3transfected clones 2 and 5 for 3 d. after 3 d in culture , the mcf-7 cells reached higher densities on fibronectin than on tenascin - c , whereas no distinction could be made for clone 2 or 5 , respectively ( unpublished data ) . the lower cell number of the parental mcf-7 cells on a tenascin - c substratum coincided with a reduced level of dna replication on a tenascin - c substrate in comparison to fibronectin as measured by h - thymidine incorporation ( fig . clones 2 and 5 was recovered on tenascin - c and reached values almost as high as on fibronectin ( fig . a possible mechanism is that cell cycle progression is stimulated by an interaction of 14 - 3 - 3 with phosphorylated p27 and by retaining this cell cycle inhibitor in the cytoplasm ( fujita et al . , 2002 ) . alternatively , stimulation of cell growth by 14 - 3 - 3 could be indirect by its known inhibitory action on apoptosis ( xing et al . , 2000 ; masters and fu , 2001 ) . to test whether cells on tenascin - c were protected from apoptosis by overexpression of 14 - 3 - 3 tau , we plated the parental mcf-7 cells and clones 2 and 5 on tenascin - c and fibronectin - coated wells , respectively , and analyzed the number of apoptotic cells under both conditions . however , not even the parental mcf-7 cells showed increased apoptosis on tenascin - c compared with the cells plated on fibronectin . reduction of the serum level in the medium to 1% lead to a concomitant increase in apoptotic cells on both substrates . therefore , the hypothesis that 14 - 3 - 3 tau could protect mcf-7 cells from apoptosis can not be the reason for the observed increase in growth . h - thymidine incorporation was measured in mcf-7 cells and clones 2 and 5 cultured in medium with 0.1% fcs on fibronectin - coated versus tenascin - c coated wells . in mcf-7 cells , dna replication was reduced by > 60% on tenascin - c compared with fibronectin , whereas the difference for clones 2 and 5 was greatly diminished . clearly 14 - 3 - 3 proteins are important adaptor proteins with many target proteins such as raf-1 ( fantl et al . , 1994 ; fu et al . , 1994 ; li et al , 1995 ) , pkc ( van der hoeven et al . , 2000 ) , phosphatidylinositol 3-kinase ( bonnefoy - berard et al . , 1995 ) , bad ( zha et al . , 1996 ) , and cdc25 ( kumagai and dunphy , 1999 ) and thus seem to have a central and integrating role in orchestrating signaling pathways regulating cell growth and death . furthermore , their positive effect on cell adhesion presents an additional input in their capability of influencing cell behavior . for cells that have not completely lost their anchorage dependence , therefore , it is interesting that tenascin - c , an extracellular matrix protein highly overexpressed in cancer tissues , causes an increase in the expression of 14 - 3 - 3 tau in cancer cells . tenascin - c may , therefore , alter the physiological status of the tumor cells by induction of 14 - 3 - 3 tau , thereby promoting their growth . mcf-7 mammary carcinoma cells ( htb-22 ; american type culture collection ) , ht1080 fibrosarcoma cells ( ccl-121 ; american type culture collection ) , and t98 g glioblastoma cells ( crl-1690 ; american type culture collection ) were cultured in dulbecco 's medium ( life technologies ) containing 10% fcs ( amimed ) at 37c and 5% co2 . substrates of tenascin - c or fibronectin were prepared by coating these proteins at 25 g / ml in pbs including 0.01% tween for 1 h at rt . tenascin - c and fibronectin were purified as described previously ( fischer et al . , 1997 ) . equal numbers of cells were plated on tenascin - c versus fibronectin in complete medium . after 22 h , the medium was removed , the cell layers were washed with medium without fcs , and medium containing 0.1% fcs was added . 22 h later , the cells were labeled with h - thymidine for 6 h and harvested and analyzed as described previously ( huang et al . , 2001 ) . apoptosis was analyzed by tunel staining using the in situ cell death detection kit ( roche diagnostics ag ) according to the procedure of the manufacturer . for immunofluorescence and f - actin staining , cells were fixed with 4% pfa in pbs for 30 min and permeabilized with 0.1% trition x-100 in pbs for 5 min . then , they were either incubated for 1 h with 0.05 m tritc - phalloidin ( sigma - aldrich ) or with anti - flag ( m2 ; stratagene ) at a 1:500 dilution , or with both simultaneously , all in pbs containing 3% goat serum for 1 h. secondary goat anti mouse alexa488-conjugated antibodies ( molecular probes ) diluted 1:1,000 in pbs/3% goat serum were applied for detection of the primary antibodies . finally , the specimens were mounted in mowiol ( calbiochem ) and examined and photographed using a axiophot microscope ( carl zeiss microimaging , inc . ) an oligotex direct mrna kit ( qiagen ) was used to isolate mrna from two 10-cm plates of mcf-7 cells grown on either fibronectin or tenascin - c substrata for 24 h in complete medium . these mrna samples were used for rt - pcr reactions and subtractive hybridization using the advantage cdna pcr kit ( clonetech laboratories , inc . ) and the pcr - select cdna subtraction kit ( clonetech laboratories , inc . ) according to the manuals supplied . primers were derived from the insert sequences to verify a differential expression of the respective transcripts in the two cdna batches by semiquantitative pcr reactions using taq polymerase ( roche diagnostics ag ) . to amplify the 14 - 3 - 3 tau , we used the following primer pair : 5-agttgcgtgtggtgatgatcg-3 and 5-gtatgagtcttcattcagtg-3. samples were taken from each reaction after completion of 15 , 20 , 25 , and 30 cycles and analyzed on agarose gels after ethidium bromide staining . this allowed us to verify the linear range of amplification that we used for comparison . a full - length 14 - 3 - 3 tau construct containing an nh2-terminal flag tag was engineered by rt - pcr from mrna of mcf-7 cells using the advantage cdna pcr kit ( clonetech laboratories , inc . ) . a first set of 14 - 3 - 3-specific primers was used ( 5-gcggccgcggagacgtgaac-3 and 5-aaggatgacaccctgtatgg-3 ) followed by a second round of pcr with ( 5-atgcggccgcaccatggactacaaggatgacgatgacaagatggagaagactgagctg-3 and 5-atctcgagttagttttcagccccttctgc-3 ) to add the flag tag and the appropriate restriction sites noti and xhoi at respective ends needed for subsequent cloning into the expression vector pcdna3 ( invitrogen ) . the resulting construct was verified by sequencing and was called 14 - 3 - 3flag . it contained the complete coding sequence of human 14 - 3 - 3 tau available from genbank / embl / ddbj under accession no . mcf-7 cells were transfected with 14 - 3 - 3flag using the transfection reagent fugene ( roche diagnostics ag ) , and clones were selected for by the addition of g418 ( life technologies ) . the resistant cell clones were tested for the production of the 14 - 3 - 3flag protein on western blots of cell extracts using anti - flag ( m2 ; stratagene ) , a peroxidase - labeled anti mouse igg ( cappel / icn ) , and the ecl reagent ( amersham biosciences ) for chemiluminescent detection of the reactive bands . endogenous synthesis of 14 - 3 - 3 tau was detected on the same blot using anti14 - 3 - 3 theta / tau ( research diagnostics inc . ) . the flag - tagged 14 - 3 - 3 migrates slightly slower than the endogenous protein due to the presence of the tag . ht1080 and t98 g cells were each plated on fibronectin and tenascin - c coated plates . 1 d later , they were transiently transfected with the 14 - 3 - 3flag construct using the transfection reagent fugene . on the next day , cells were fixed and stained with anti - flag and phalloidin as described above for the mcf-7 cells . mcf-7 mammary carcinoma cells ( htb-22 ; american type culture collection ) , ht1080 fibrosarcoma cells ( ccl-121 ; american type culture collection ) , and t98 g glioblastoma cells ( crl-1690 ; american type culture collection ) were cultured in dulbecco 's medium ( life technologies ) containing 10% fcs ( amimed ) at 37c and 5% co2 . substrates of tenascin - c or fibronectin were prepared by coating these proteins at 25 g / ml in pbs including 0.01% tween for 1 h at rt . tenascin - c and fibronectin were purified as described previously ( fischer et al . , 1997 ) . equal numbers of cells were plated on tenascin - c versus fibronectin in complete medium . after 22 h , the medium was removed , the cell layers were washed with medium without fcs , and medium containing 0.1% fcs was added . 22 h later , the cells were labeled with h - thymidine for 6 h and harvested and analyzed as described previously ( huang et al . , 2001 ) . apoptosis was analyzed by tunel staining using the in situ cell death detection kit ( roche diagnostics ag ) according to the procedure of the manufacturer . for immunofluorescence and f - actin staining , cells were fixed with 4% pfa in pbs for 30 min and permeabilized with 0.1% trition x-100 in pbs for 5 min . then , they were either incubated for 1 h with 0.05 m tritc - phalloidin ( sigma - aldrich ) or with anti - flag ( m2 ; stratagene ) at a 1:500 dilution , or with both simultaneously , all in pbs containing 3% goat serum for 1 h. secondary goat anti mouse alexa488-conjugated antibodies ( molecular probes ) diluted 1:1,000 in pbs/3% goat serum were applied for detection of the primary antibodies . finally , the specimens were mounted in mowiol ( calbiochem ) and examined and photographed using a axiophot microscope ( carl zeiss microimaging , inc . ) an oligotex direct mrna kit ( qiagen ) was used to isolate mrna from two 10-cm plates of mcf-7 cells grown on either fibronectin or tenascin - c substrata for 24 h in complete medium . these mrna samples were used for rt - pcr reactions and subtractive hybridization using the advantage cdna pcr kit ( clonetech laboratories , inc . ) and the pcr - select cdna subtraction kit ( clonetech laboratories , inc . ) according to the manuals supplied . primers were derived from the insert sequences to verify a differential expression of the respective transcripts in the two cdna batches by semiquantitative pcr reactions using taq polymerase ( roche diagnostics ag ) . to amplify the 14 - 3 - 3 tau , we used the following primer pair : 5-agttgcgtgtggtgatgatcg-3 and 5-gtatgagtcttcattcagtg-3. samples were taken from each reaction after completion of 15 , 20 , 25 , and 30 cycles and analyzed on agarose gels after ethidium bromide staining . this allowed us to verify the linear range of amplification that we used for comparison . a full - length 14 - 3 - 3 tau construct containing an nh2-terminal flag tag was engineered by rt - pcr from mrna of mcf-7 cells using the advantage cdna pcr kit ( clonetech laboratories , inc . ) . a first set of 14 - 3 - 3-specific primers was used ( 5-gcggccgcggagacgtgaac-3 and 5-aaggatgacaccctgtatgg-3 ) followed by a second round of pcr with ( 5-atgcggccgcaccatggactacaaggatgacgatgacaagatggagaagactgagctg-3 and 5-atctcgagttagttttcagccccttctgc-3 ) to add the flag tag and the appropriate restriction sites noti and xhoi at respective ends needed for subsequent cloning into the expression vector pcdna3 ( invitrogen ) . the resulting construct was verified by sequencing and was called 14 - 3 - 3flag . it contained the complete coding sequence of human 14 - 3 - 3 tau available from genbank / embl / ddbj under accession no . mcf-7 cells were transfected with 14 - 3 - 3flag using the transfection reagent fugene ( roche diagnostics ag ) , and clones were selected for by the addition of g418 ( life technologies ) . the resistant cell clones were tested for the production of the 14 - 3 - 3flag protein on western blots of cell extracts using anti - flag ( m2 ; stratagene ) , a peroxidase - labeled anti mouse igg ( cappel / icn ) , and the ecl reagent ( amersham biosciences ) for chemiluminescent detection of the reactive bands . endogenous synthesis of 14 - 3 - 3 tau was detected on the same blot using anti14 - 3 - 3 theta / tau ( research diagnostics inc . ) . the flag - tagged 14 - 3 - 3 migrates slightly slower than the endogenous protein due to the presence of the tag . ht1080 and t98 g cells were each plated on fibronectin and tenascin - c coated plates . 1 d later , they were transiently transfected with the 14 - 3 - 3flag construct using the transfection reagent fugene . on the next day , cells were fixed and stained with anti - flag and phalloidin as described above for the mcf-7 cells . | we searched by a cdna subtraction screen for differentially expressed transcripts in mcf-7 mammary carcinoma cells grown on tenascin - c versus fibronectin . on tenascin - c , cells had irregular shapes with many processes , whereas on fibronectin they were flat with a cobble stone like appearance .
we found elevated levels of 14 - 3 - 3 tau transcripts and protein in cells grown on tenascin - c . to investigate the consequences of an increased level of this phospho - serine / threonine binding adaptor protein , we transfected mcf-7 cells with a construct encoding full - length 14 - 3 - 3 tau protein and selected clones with the highest expression levels .
the morphology of these cells on tenascin - c was flat , resembling that of cells on fibronectin .
this was reflected by a similar pattern of f - actin staining on either substratum .
furthermore , the growth rate on tenascin - c was increased compared with the parental cells . after transient transfection of ht1080 fibrosarcoma and t98 g glioblastoma cells with 14 - 3 - 3 tau , only the 14 - 3 - 3 tau expressing cells were able to adhere and survive on tenascin - c , whereas all cells adhered well on fibronectin .
therefore , we postulate that tenascin - c promotes the growth of tumor cells by causing an increase in the expression of 14 - 3 - 3 tau , which in turn has a positive effect on tumor cell adhesion and growth . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
immunoglobulin g4 ( igg4)-related sclerosing disease is a rare disease entity that is known to involve various organs including the pancreas , biliary tree , salivary gland , retroperitoneum , kidneys , and so on ( 1 ) . its etiology is still unclear and it is composed of many disorders that have specific clinical , pathological , and serologic features ( 2 ) . so far , there has been only one report of igg4-related sclerosing diseases arising in the small bowel , and it is mainly described in the histopathologic findings ( 3 ) . in this paper , we report a case of histologically proven igg4-related sclerosing disease involving the ileum with imaging findings on ct and small bowel series . this report is , to our knowledge , the first to describe the radiologic findings of igg4-related sclerosing diseases of the small bowel . a 43-year - old man was admitted to our hospital with a one - year history of intermittent abdominal pains . he had a past medical history of acute myocardial infarction 10 years ago and a six - month history of benign prostatic hyperplasia . the laboratory tests at presentation showed mild leukocytosis ( 10470/ul ) with an elevated neutrophil percentage ( 79.6% ) and an elevated c - reactive protein value ( 50.6 mg / l ) . contrast - enhanced abdominal ct with a 64-row mdct ( sensation 64 , siemens medical solutions , malvern , pa , usa ) showed irregular wall thickening , losses of mural stratification and aneurysmal dilatation of the distal ileum ( fig . there were multiple enlarged lymph nodes ( maximal diameter : 1.5 cm ) around the distal ileum ( fig . adhesion of the bowel loops with traction and abrupt angulation were also revealed ( fig . there were no significant abnormal findings in the other gi tracts . clinically and radiologically , there were no significant abnormal findings in other organs . the clinical and radiologic findings were somewhat confusing and non - specific because their sum can suggest both malignancy and benign inflammatory diseases , and are not specified to one category . the patient underwent exploratory laparoscopy . at surgery , the distal ileum showed segmental wall thickening and edematous wall with interloop adhesions . pathological study confirmed the diagnosis of igg4-related sclerosing disease , which showed intramural chronic inflammation with prominent igg4 rich - lymphoplasmacytic infiltrates [ igg4 positive cells > 50/high power field ( hpf ) ] , fibrosis , and obliterative phlebitis ( fig . the patient was discharged on day 9 in good condition with regular follow - ups in the surgical outpatient clinic . extra - pancreatic manifestations have been reported and the disease has been recognized as a systemic disease ( 5 ) . the disease is now commonly referred to as igg4-related sclerosing disease , with similar histopathologic features in various organs characterized by sclerosing inflammation involving numerous igg4-positive plasma cells ( 6 ) . clinically , patients with autoimmune pancreatitis are usually presented with jaundice or mild abdominal discomforts . patients with igg4-related sclerosing disease without pancreatic involvements can manifest various symptoms and signs according to the involved organs . laboratory findings including elevated igg and igg4 serum levels and autoantibodies such as ana and the rheumatoid factor are helpful in the diagnosis of igg4-related sclerosing disease . the histolopathological hallmark of the disease is the large number of igg4-positive plasma cells in the tissue . cheuk and chan ( 7 ) recently proposed a diagnostic criteria of > 50 igg4 + plasma cells per hpf and an igg4 + /igg + ratio > 40% , which our patient fulfilled . other important histopathologic findings include lymphoplasmacytic infiltration , sclerosis without cellular myofibroblastic proliferation , and phlebitis ( 8 , 9 ) . various organs can involve igg4-related sclerosing diseases : the pancreas , salivary glands , hepatobiliary tract , orbit , lymph nodes , aorta , skin , central nervous system , breast , kidney , prostate , lung , thyroid , and urethra ( 3 , 12 , 13 ) . inflammatory bowel disease is occasionally associated with igg4-related sclerosing disease ( 14 , 15 ) , but there are few reports of igg4-related sclerosing disease primarily involving the gastrointestinal tract ( 3 ) . to our knowledge , this report is the first to describe the radiologic findings of igg4-related sclerosing disease of the small bowel . in our case , the radiologic findings can suggest both malignant features and benign inflammatory disease features . the imaging findings that are suggestive of malignant tumors showed irregular wall thickening , loss of mural stratification , and aneurysmal dilatation of the distal ileum without small bowel obstruction . with these findings , we can suggest malignant neoplastic diseases such as lymphoma , adenocarcinoma , and metastasis . these mass - like imaging features may be related to the mass - forming characteristics of igg4-related diseases , which can manifest inflammatory pseudotumor in many organs ( 16 ) . other imaging findings that are suggestive of benign inflammations were multifocal narrowing , traction , aggregation , and abrupt angulation of the distal ileum . these findings can suggest benign inflammatory diseases with fibrotic and stenotic features , such as crohn 's disease and tuberculosis . these fibrotic and stenotic imaging features are considered relevant to the sclerosing feature of the recently reported histopathologic findings on igg4-related sclerosing disease of the small bowel ( 3 ) . heterogeneous mural enhancement and multiple enlarged lymph nodes were relatively non - specific findings and can be found in both malignant and benign diseases . we consider that these radiologic findings of combined malignant - looking and inflammatory fibrostenotic features might be clues to the diagnosis of igg4-related sclerosing diseases of the small bowel . in summary , igg4-related sclerosing disease is a rare systemic disease that involves various organs . there are few studies , however , about the igg4-related sclerosing disease of the gastrointestinal tract . in this report , we present the first case , to our knowledge , of radiologic findings of igg4-related sclerosing diseases arising in the small bowel . although a definite diagnosis relies on histopathological confirmation , the radiologic findings may provide a clue to the diagnosis of igg4-related sclerosing diseases of the small bowel . | immunoglobulin g4 ( igg4)-related sclerosing disease is rare and is known to involve various organs .
we present a case of histologically proven igg4-related sclerosing disease of the small bowel with imaging findings on computed tomography ( ct ) and small bowel series .
ct showed irregular wall thickening , loss of mural stratification and aneurysmal dilatation of the distal ileum .
small bowel series showed aneurysmal dilatations , interloop adhesion with traction and abrupt angulation . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
salt sensitivity ( ss ) is a heterogeneous phenomenon characterized by a significant increase in blood pressure ( bp ) in response to changes in dietary salt intake or by experimental intravenous salt overload followed by furosemide - induced salt depletion.1 although multiple mechanisms are involved in the bp response to the variation in sodium intake , an evident change in the renal tubular transport of sodium occurs in salt - sensitive individuals ( s individuals).2 in salt - resistant individuals ( r individuals ) , a change from a low - sodium diet ( 70 mmol / day ) to a high - sodium diet ( 185 mmol / day ) is accompanied by a significant reduction of sodium reabsorption by the proximal tubules . in contrast , s individuals experience a significant increase in bp and a blunted inhibition of proximal tubular sodium transport . respond to a salt load with an increased glomerular filtration rate in an attempt to compensate for the inability to block the tubular sodium reabsorption.3 the same response pattern is usually observed in s hypertensive individuals.4 epidemiological studies have indicated a clear relationship between salt sensitivity individuals and the development of cardiac hypertrophy and glomerular damage.5 - 8 in experimental studies with rats , salt loading promotes the expression of factors related to the deposition of extracellular matrix in the mesangium , such as tgf- , independent of changes in bp.9 moreover , in humans , microalbuminuria is observed in hypertensive individuals with an s pattern.10,11 the presence of ss also affects the response to antihypertensive drugs , such as diuretics and angiotensin - converting enzyme inhibitors.12 although clinically relevant , the identification of s individuals involves exaggerated sodium consumption followed by salt depletion with the use of low - salt diets or diuretics . although some authors have indicated better reproducibility using alternate chronic exposure to low- or high - salt diets,13 the model of acute salt loading and depletion initially proposed by weinberger et al.1 is widely accepted for the identification of s individuals . in this model , volunteers are subjected to intravenous loading of 2 l of isotonic saline over a period of 4 h , and at the end of this process , bp is measured using the conventional sphygmomanometer ( cs ) . on the next day , the volunteers are subjected to a low - salt diet ( 10 mmol / day ) followed by three doses of oral furosemide , and cs bp is again measured at the end of this period . a difference greater than 10 mmhg between the two periods indicates the presence of ss . because of the extensively documented various factors that interfere with the cs measurement of bp , some authors have recommended the use of the abpm device as the best tool for assessing the bp in acute salt loading and depletion protocols.14 however , there is no consensus about the ideal time intervals of measurements , and there is no clear evaluation of the agreement between the two methods of bp measurement in this context . moreover , blood pressure measurements obtained by the ambulatory blood pressure monitoring ( abpm ) are usually lower than those obtained using the cs . thus , the main objective of the present study was to compare the concordance of two different methods of bp measurements in protocols of acute salt loading and depleting , including an evaluation of the different time intervals of bp measurements with the use of an abpm device . eighteen healthy , normotensive volunteers aged 18 to 43 years with clinical and biochemical parameters ( hepatic , renal and hematologic function ) within normal limits were selected for the study . the protocol was approved by the institutional research ethics committee , and the volunteers gave written informed consent to participate . the subjects were instructed to consume a diet containing a standard amount of sodium ( 180 mmol / day ) five days before the beginning of the acute protocol . adherence to the diet was monitored by the measurement of the 24-h urine sodium on the fifth standard diet day . on the day of acute protocol , after an overnight fast , the volunteers were asked to come to the clinical research unit where they stayed for two days . starting at 8:00 am on the first day , 2 l of 0.9% isotonic saline solution were infused into a peripheral vein over a period of 4 h. an abpm device ( spacelabs model 90207 , washington , usa ) was installed in each participant 's non - dominant arm and programmed to measure bp at 10-minute intervals for the first 12 h. at the end of the saline infusion , bp was measured with a previously calibrated mercury sphygmomanometer , and the mean value of three measurements was calculated . on the second day of the experimental period , volunteers consumed a low - salt diet ( 10 mmol / day ) and received three 40-mg doses of oral furosemide at 8:00 a.m. , 10:00 a.m. and 2:00 p.m. the abpm device was again installed according to the parameters described above , and the cs bp was measured at the end of salt depletion ( 8:00 p.m. ) . the patients were classified as s individuals when the difference in the cs systolic bp ( sbp ) measurements between the salt loading and salt depletion periods was > 10 mmhg ( sbpdiu - salt ) . the cs bp measurements were compared to the means obtained using the abpm in the following combinations : sbp between the 4 h of saline infusion and the 12 h of salt depletion ( sbp4 - 12 ) ; between the 4 h of saline infusion and the last 6 h of salt depletion ( sbp4 - 6 ) ; between the 12 h of the salt - loading period and the last 6 h of depletion ( sbp12 - 6 ) ; and between the 12 h of the salt - loading period and the 12 h of salt depletion ( sbp12 - 12 ) . in addition to bp , blood and urine samples were obtained at the end of the saline infusion ( 12:00 p.m. of day 1 ) and at the end of the protocol ( 8:00 p.m. of day 2 ) for the determination of sodium , creatinine , plasma renin activity and aldosterone . plasma renin activity and aldosterone were determined by radioimmunoassay ( diasorin , minnesota , usa ) . fractional sodium excretion ( fena ) was determined using the following formula : ( una x pcr / ucr x pna ) 100 , where una , pna , ucr and pcr are the concentrations of urine sodium ( mmol ) , urine creatinine ( mg / dl ) , plasma sodium ( mmol ) and plasma creatinine ( mg / dl ) , respectively . data were reported as means sem and were compared using a paired t - test or anova for repeated measures , followed by a bonferroni post - test . the correlations between fena and the variation in renin and aldosterone activity and sbp ( cs or abpm ) were determined using the pearson correlation , and the concordance between the cs and abpm measurements during the various time intervals studied for the identification of s individuals was determined using the kappa ( ) coefficient.15 the reference criterion used for s individual classification was arbitrarily chosen as sbpdiu - salt > 10 mmhg . the comparison between the abpm sbp during the different intervals and the cs sbp was performed using the pearson correlation coefficient ( ) . sas / stat software ( version 9.0 , sas institute , usa ) was used all statistical calculations . this study included 18 volunteers ( 10 men and 8 women ) who were self - reportedly white and were on average 292 years old . all of the subjects were normotensive ( the sbp and diastolic bp ( dbp ) were 1153 mmhg and 732 mmhg , respectively ) and none were obese ( bmi of 25.20.9 the volunteers were divided into s ( sbpdiu - salt > 10 mmhg ) and r groups , and their main clinical characteristics are presented in table 1 . there was no difference between the s and r groups in nutritional status , age or daily salt consumption . as expected , the s group showed a greater reduction of sbpdiu - salt compared to the r group ( -21.43.0 mmhg vs. -5.01.2 mmhg , p = 0.0006 ) . however , compared with the use of the cs , we observed a smaller fall in sbp in the s group between the salt loading and depletion periods with use of the abpm ( -21.43.0 mmhg vs. -12.40.8 mmhg ; p = 0.007 ) . figure 1 illustrates the behavior of cs bp during the periods of salt loading and depletion . salt loading increased the sbp and dbp ( p<0.05 ) only in the s group . also , only the s group experienced a decrease in the sbp and dbp with the furosemide - induced salt depletion ( p<0.05 ) . both r and s volunteers presented elevated fena during salt loading ( p<0.01 ) compared with fena baseline values . however , only the r group experienced a significant increase in fena after furosemide administration when compared with the salt loading ( p<0.05 ) . table 2 illustrates that there was no significant difference in the variation of the response of the renin - angiotensin - aldosterone system between the r and s groups , as measured in terms of the plasma renin activity and the plasma aldosterone values between the phases of salt loading and depletion . table 2 also shows the behavior of the excreted sodium load during salt loading and depletion . a significant increase in the excreted sodium load was observed after salt loading , which was maintained during the phase of furosemide use , although there were no significant differences between the r and s groups . there was a significant correlation between the sbp and dbp measurements made using the abpm and those made using the cs during the phases of salt loading and depletion for all the periods analyzed . however , the pearson correlation coefficient ( ) for the different time periods showed various results ; the best correlations were observed between the cs sbp and the mean of the abpm sbp measurements made during the 4 h of intravenous nacl infusion and the mean of the abpm sbp measurements made during the 12 h of the salt depletion with furosemide ( sbp4 - 12 , = 0.71 ) . figure 2 shows the correlation observed between the cs sbp and dbp and the mean abpm bp during the phase of salt loading ( 4 h ) and depletion with furosemide ( 12 h ) . table 3 shows the values of concordance ( k ) for the classification of s and r using sbpdiu - salt > 10 mmhg as the reference cut - off value . full concordance ( k = 1 ) with cs sbp was observed only when the criterion for classification was based on the abpm bp measurements during the 4 to 12-h period ( sbp4 - 12 ) . the objective of this study was to compare the concordance of two different methods of bp measurement in protocols of acute salt loading and depletion , including an evaluation of different time intervals of bp measurements with the use of an abpm device . our data showed that the classification of individuals as s or r , based on the measurement of the difference in sbp between the periods of salt loading and depletion using abpm , varied according to the time interval of bp measurement . the greatest concordance between the sbpdiu - salt using the cs method defined by weinberger and an abpm device to measure bp was the interval of sbp 4 - 12 . the cs sbpdiu - salt was used here as the gold standard because this type of measurement has been extensively studied in previous protocols1,8 and has been shown to be correlated with humoral markers , particularly the renin - angiotensin - aldosterone system . furthermore , it was shown to be an independent risk factor for cardiovascular death . in this context , weinberg et al . 8 conducted a 27-year follow - up study of a cohort of 430 normotensive individuals subjected to the acute salt loading and depletion protocol . they found that the presence of s individuals detected by this method was accompanied by an increase in cardiovascular mortality compared with r individuals . previous studies have suggested that the identification of s individuals can be more accurate by manipulating the sodium content of an individual 's diet.6,14 however , these protocols rely on compliance with a specific diet , which results in difficult technical execution . another relevant point for the comparison of these two methodologies is the concordance of the classification as s individuals and r individuals when the same volunteer was subjected to the two methods in a sequential manner . weinberg et al . reported agreement between acute salt loading protocols when dietary sodium manipulations were performed over prolonged periods of time.16 however , other studies have not had the same results and have reported a weak concordance between the two methods.14,17 the bp measurement method may also generate an important bias of the criterion for subject classification as s individuals and r individuals . however , few studies have compared the different methods of bp measurement for this purpose . in a study of dietary salt intervention , the abpm measurements were more accurate than the use of office bp measurement for the classification of s individuals and r individuals an observation that was suggested to be due to the larger number of measurements obtained with the abpm , which may have involved a lower chance of error.13 the present study contributes to the definition of the best time interval for bp measurements when using the abpm device in protocols of acute salt loading and salt depletion . our data show that the time interval of bp measurements had a clear influence on the designation of s and r individuals , with the cs bp used as the standard . analysis of the pearson coefficient ( table 2 ) showed that the measurements made between the periods of 4 and 12 h , which corresponded to the peak of salt load ( during the 4 h of intravenous nacl infusion ) of the first day , and the measurements obtained during the daytime of the second day were best correlated with the variation of cs sbp between the two periods.1 the same table also shows a poor correlation between the sbp measurements corresponding to 12 h of daytime salt loading and those corresponding to 12 h of daytime salt depletion , particularly those most frequently used in this protocol.18 the analysis of concordance ( k ) supported the pearson univariate analysis , showing full agreement between the measurements of sbp4 - 12 and sbpdiu - salt . despite this agreement , there was a significant difference in the sbp values obtained by the two methods , with greater amplitude and dispersal of the cs measurements compared with the abpm measurements . the results of this study do have limitations because the sample size was small ( 18 individuals ) . also , the sbp value > 10 mmhg was arbitrarily established for the classification of s. however , the abpm bp measurements were usually lower values than those obtained with the cs , an observation that may modify the cut - off for the classification of s individuals on the basis of abpm . because the variation in sbp between the phases of salt loading and depletion follows a gaussian distribution , a new study with a larger number of participants is necessary to determine the best abpm cut - off value to distinguish r and s individuals . however , such limitations do not invalidate the observation that the best interval for measuring bp with the abpm is sbp4 - 12 . in conclusion , the present study shows that the use of abpm in protocols of acute salt loading and depletion should involve measurements at 10-minute intervals , with a recording of the 4-h interval of acute intravenous salt infusion and the 12-h interval of salt depletion with furosemide and setting the cut - off value for the classification of s at sbp4 - 12 > 10 mmhg . we wish to thank centro de mtodos quantitativos da faculdade de medicina de ribeiro preto , universidade de so paulo ( cemeq - fmrp - usp ) for assistance with revisions and statistical analysis . the present study was financed by fundacao de apoio a pesquisa do estado de sao paulo ( fapesp ) grant 05/59269 - 2 , financiadora de estudos e projetos ( finep ) grant 01.05.0948.00 and fundacao de apoio e pesquisa do hospital das clnicas da fmrp - usp ( faepa ) . no authors declared a conflict of interest . | introduction : ambulatory blood pressure monitors have been used in salt loading and depletion protocols . however , the agreement between measurements made using ambulatory blood pressure monitors and those made with the sphygmomanometer has not been evaluated.objective:the objective of this study was to compare the concordance of the two methods of blood pressure measurements in protocols of acute salt loading and depletion.method:systolic blood pressure was measured using a sphygmomanometer at the completion of salt infusion ( 2 l nacl 0.9% , 4 h ) and salt depletion ( furosemide , 120mg / day , p.o . ) in 18 volunteers . using the pearson correlation coefficient ( ) , these readings
were compared with the mean systolic blood pressure measured using the ambulatory blood pressure monitoring device during the following periods : 4 h of saline infusion and 12 h of salt depletion ; 4 h of saline infusion and the last 6 h of salt depletion ; 12 h of salt loading and the last 6 h of depletion ; 12 h of salt loading and 12 h of depletion .
salt sensitivity was defined by a difference in the systolic blood pressure between salt loading and salt depletion greater than 10 mmhg when measured with the sphygmomanometer , and the kappa analysis of concordance ( k ) was used with a significance level of p<0.05.results : only the blood pressure readings obtained using the ambulatory blood pressure device during 4 h of intravenous nacl and during 12 h of salt depletion showed a high correlation with the variation in the systolic blood pressure measured by the sphygmomanometer , with a full agreement with the salt sensitivity classification ( = 0.71 ; p = 0.001 and k = 1).conclusion : in acute salt loading and depletion protocols , an ambulatory blood pressure monitoring device should be used to record the blood pressure during the 4-h interval of salt infusion and 12-h interval of salt depletion . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in islet transplantation , the failure of insulin independence is brought about by the loss of islet grafts , caused by instant blood - mediated inflammatory reaction , immune rejection , non - specific inflammation or ischemia of the donor islets . therefore , monitoring the condition of transplanted islets is important for determining whether the islets are viable or damaged , and for selecting the appropriate treatment for preventing graft loss and rescuing patients from severe transplant - related complications . there have been no parameters for evaluating the islet condition except laboratory data including blood glucose and serum c - peptide , but many attempts to visualize the islets have been made for this purpose worldwide . especially , magnetic resonance imaging ( mri ) and positron emission tomography ( pet ) are known as useful imaging examinations for detecting islets , not only in rodents but also in humans . ultrasound ( us ) is useful for detecting anatomical and pathological changes in many organs including liver , pancreas , gallbladder , lymph nodes , kidney and gynecological organs . us examination can be performed simply and easily in a short time , with no special preparation required . we focused on us examination for visualizing islets and have attempted to prove the usefulness for this purpose . at first , we performed us examination using diabetic mice that received syngeneic islet transplantation into the renal subcapsular space and detected that the vicinity of transplanted islet grafts could be seen as a hyperechoic area . we confirmed that us examination was useful for detecting the location and condition of transplanted islets in an animal model , in spite of the difficulty of individual islet visualization . recently , we encountered a patient who received total pancreatectomy with islet autotransplantation ( tp with iat ) and performed intraoperative us examination to detect the islets during transplantation . a 39 y - old man who had an episode of severe abdominal pain and pancreatic bleeding due to chronic pancreatitis ( cp ) and pancreatic arteriovenous malformation ( avm ) was admitted to our institution to undergo tp with iat . before hospitalization although he had no past history and no complication of diabetes , he had episodes of alcohol abuse and smoking . preoperative serum insulin was 48.3 u / ml and serum c - peptide was 3.15 ng / ml . glucose tolerance was at a normal level . preoperative ct revealed enriched abnormal vessels ( approximately 2.0 cm - sized ) in pancreatic head and the portal vein was enhanced at an early stage . it also showed a 2.5 cm cystic lesion in the pancreatic tail , which was suspected to be a pancreatic pseudocyst . these image findings indicated avm , and it was considered that the pancreatitis was caused by avm . we considered that total pancreatectomy ( tp ) could not be prevented because there were findings associated with avm in the pancreatic head and tail . to prevent brittle pancreatic diabetes caused by total islet loss , islet autotransplantation ( iat ) we already had approval of the ethics committee of tohoku university school of medicine for the clinical project of tp with iat . before performing tp with iat for this patient , we had already decided on the procedure to be used follows : ( 1 ) a double lumen catheter ( for central vein , sized 14 gauze and 30 cm length ) was inserted into the portal vein via the superior mesenteric vein for transplantation and monitoring the portal vein pressure , ( 2 ) the tip of the catheter was positioned at the bifurcation of the anterior and posterior branch of the portal vein and the islets were selectively infused into the right lobe of the liver to prevent total liver embolization and ( 3 ) intraoperative us examination was performed for detecting islets in the portal vein and determining whether the portal vein was embolized or not . however , tp for avm is technically difficult to perform en - bloc resection due to the existence of many abnormal vessels and pancreatic inflammation . in addition , extensive blood loss is difficult to prevent because the feeding arteries ( gastroduodenal artery for the head and splenic artery for the body and tail ) must be ligated at the last step of the operation to shorten the warm ischemia time ( wit ) . thus , we selected a two - step tp method : distal pancreatectomy ( dp ) was performed first and then pancreaticoduodenectomy ( pd ) was done to decrease the blood loss and to shorten the wit . after the exposure of the pancreas , by following the gastroduodenal and common hepatic artery , the root of the splenic artery ( spa ) was picked up but not ligated to preserve the blood flow . the pancreatic neck was then separated from the anterior surface of the porto - mesenteric vein . after gentle mobilization of the body and tail of the pancreas and spleen , pancreatic transection in the neck followed by ligation of the splenic vein was performed before ligation of the spa ( final step of the dp ) . after removal of the distal pancreas , the proximal pancreas with the duodenum was then removed by the standard whipple s procedure . size catheter was cannulated into the main pancreatic duct and ductal injection was performed at the procurement site using et - k solution ( otsuka pharmaceutical factory inc . ) . the pancreas was immersed into the cold et - k solution , packed in a cooler box with crushed ice and carried to the cell - processing center of our institution . after performing tp and tract reconstructions , a double lumen central venous catheter was inserted into the main portal vein via the superior mesenteric vein . islets were isolated from the body / tail and head of the pancreas with a semi - circuit digestion system using liberase mtf - c / t ( roche diagnostics k.k . ) . purification using cobe 2991 was performed in order to reduce the risk of portal embolism and successfully decreased graft volume ( 600 l ) . two hundred twenty - nine thousand five hundred thirty - eight islet equivalents ( ieqs ) with the purity of 30% were acquired from the pancreas . the islets were packed in one bag containing 200 ml of heparinized ( containing 1,500 units of heparin ) transplantation solution . we connected the bag to one side of the portal vein catheter and dripped the islets into the portal vein . the other side of the catheter was connected to a pressure monitor and the portal vein pressure was measured during the whole procedure of transplantation . intraopetative us was done during the iat using a diagnostic ultrasound system ( nemio xg , toshiba medical system co. ) . we performed the us examination by putting the probe on the liver directly and confirmed the tip of the catheter , detected as a high echoic tube , at the bifurcation between the anterior and posterior branches of the portal vein . transplanted islets , which flowed toward the periphery of the portal vein from the tip of the catheter , were visualized as hyperechoic clusters ( fig . after finishing the transplantation , the patient was moved to the intensive care unit where he stayed for 3 d. he received intensive insulin therapy ( keeping the blood glucose under 130 mg / dl ) and was medicated with 0.9 mg / day of glp-1 analog ( victoza , novo nordisk pharma ltd . ) during admission . the insulin doses at discharge were 6 units / day of an ultra - rapid type ( humulin r , eli lilly japan k.k . ) and 7 units / day of a long lasting type ( lebemir , novo nordisk pharma ltd . ) . after discharge , his blood glucose and hba1c levels gradually increased , but he has had no symptoms suggesting hypoglycemia till 1 y after transplantation . the blood glucose , hba1c and serum c - peptide at 3 mo were 142 mg / dl , 6.5% and 0.31 ng / ml . . it can provide information useful for understanding the islet condition and function when combined with laboratory data including blood glucose and serum c - peptide . the first study about islet visualization was published in 2004 , and it showed that intrahepatically transplanted islets labeled by superparamagnetic iron oxide ( spio ) , could be detected as low intensity clusters in mri t2 weighted image using a diabetic rodent model . after this study , many preclinical trials have been performed , such as a study about visualizing islet by clinical mri ( standard clinical 1.5-tesla scanner ) and one using a baboon . a clinical trial using mri in islet transplanted diabetic patients was first performed in 2008 , and now mri is a major imaging modality for islet visualization . pet is also an important imaging modality for visualizing islets , and it was recently applied in a clinical setting . however , we consider that us should be focused on in this area because of its ease and convenience and have tried to demonstrate its effectiveness for detecting islets . in our previous study , we performed high frequency us examination using diabetic mice that underwent subrenal syngeneic or xenogeneic ( rat ) islet transplantation . syngeneic islets appeared as a hyperechoic area and the volume of the area was positively correlated with the numbers of transplanted islets . on the other hand , xenogeneic islets were shown as an iso - hypoechoic area , which reflected on the edematous changes due to rejection , and the hypoechoic area diminished and disappeared with a time . in other words , viable islets were shown as a hyperechoic image and damaged islets as a hypoechoic image by us . however , these images reflect the aggregate of islets and not individual islets , and visualization of individual islets is still difficult . recently , we have promoted clinical trials of tp with iat for benign pancreatic disease . to prove the usefulness of us examination for detecting islets in a clinical setting , we performed intraoperative us examination in one cp with avm patient and evaluated the image . although us is a convenient and essential imaging examination for deciding the puncture line for percutaneous transhepatic portal cathetarization and is routinely used for islet transplantation in clinical settings , no studies have mentioned how transplanted islets are visualized in us . we clarified that transplanted human islets could be visualized as hyperechoic clusters in this case report . this finding and our previous data clarified some speculations about us imaging for evaluating the islet condition . first , viable islets can be visualized as a hyperechoic image not only in rodent but also in human . it is conceivable that islet imaging in intraoperative us ( especially echogenicity ) can provide reliable information to predict the outcome , success or failure , of the islet transplantation . second , islets can be visualized not only with high frequency us but also with usual us used for human abdomen ( the central frequency was 7.5 mhz ) in spite of their tiny structures ( within 1 mm diameter ) . our data suggest the novel possibility of visualizing islets . by including the present manner of us in deciding the puncture line for percutaneous transhepatic islet transplantation and in detecting some transplant - related complications such as portal thrombosis , hemoperitoneum and hemothorax the next step for us is visualization of individual islets as in mri and pet . bulte , et al . was the first to succeed in individual islet visualization using a microcapsulation technique . this patient received continuous intensive insulin therapy during operation and after transplantation for resting transplanted islets before engraftment . by monitoring blood glucose , diabetologists of our institution managed the dose of insulin following increase of nutrients , and continuous insulin therapy was changed to discontinuous injection when the insulin dose became stable . tp with iat has been performed for cp in many islet transplant institutions , especially in the usa . recently , a reliable systematic review about tp with iat was published and showed that insulin independence after tp with iat was 1064% . these publications revealed that perfect insulin independence is difficult for current tp with iat , while this therapy is useful for preventing brittle diabetes due to tp . one of the main reasons is difficulty of islet isolation for cp because of fibrosis and inflammation of pancreas tissue . in our case , he was transplanted insufficient islet numbers ( approximately 3,500 ieq / kg ) for insulin independent , but he can prevent unstable diabetic condition due to tp till now . we could accomplish the prevention of hypoglycemia in this case , but believe that further improvements of our protocol are necessary to promote this therapy . in conclusion , our intraoperative us examination could visualize transplanted islets as hyperechoic clusters and was useful to confirm that islets were successfully transplanted into the liver with no complications . intraoperative us examination can be useful for detecting islets during transplantation in the clinical setting . | a 39-y - old man , who had an episode of pancreatic bleeding due to chronic pancreatitis , received total pancreatectomy with islet autotransplantation ( tp with iat ) .
intraoperative ultrasound ( us ) examination was done to detect transplanted islets and evaluate the quality of us imaging .
islet isolation from the resected total pancreas was performed and approximately 230,000 islet equivalents ( ieq ) ( the tissue volume was 600 l and the purity was 30% ) were acquired .
a double lumen catheter , used for transplantation and for monitoring the portal vein pressure , was inserted into the portal vein via the superior mesenteric vein , and the tip of the catheter was positioned at the bifurcation of the anterior and posterior branch of the portal vein to selectively infuse the islets into the right lobe of the liver in order to prevent total liver embolization .
intraoperative us examination ( central frequency 7.5 mhz , nemio xg , toshiba medical system co. ) was started at the same time as the transplantation .
us examination revealed the transplanted islets as hyperechoic clusters that flowed from the tip of the catheter to the periphery of the portal vein . there were no findings of portal thrombosis or bleeding in the us image , and also no increase of the portal vein pressure during transplantation .
in conclusion , we succeeded in visualizing human islets using us , which enabled us to perform islet transplantation safely .
the hyperechoic images were considered to be viable islets .
intraoperative us examination can be useful for detecting islets at transplantation in a clinical setting . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the odontogenic fibroma is a benign neoplasm of odontogenic ectomesenchymal origin , characterized by relatively mature collagenous fibrous tissue with varying amount of odontogenic epithelium . it can occur in central or peripheral location , the latter being more common by a 1.4:1 ratio . a slight female predominance has been seen in a literature review by daley et al . age at diagnosis varies widely with a peak in the third and fourth decades of life . the world health organization ( who ) defined it as a benign odontogenic neoplasm of fibroblastic origin characterized by relatively mature collagenous fibrous tissue and varying amounts of odontogenic epithelium with potential to occur in either a central or an extraosseous location . the extraosseous counterpart is designated as peripheral odontogenic fibroma . it appears as a firm , slow - growing and usually sessile gingival mass covered by normal appearing mucosa . clinically , it can not be distinguished from common fibrous gingival lesions . encountered mainly on facial gingiva of mandible , with incisor - canine and premolar area being the most common sites , they seldom cause displacement of teeth . connective tissue ranges from loose ( almost myxomatous ) to markedly cellular or to relatively acellular and well organized . islands / strands of odontogenic epithelium are scattered throughout connective tissue , which may be prominent / scarce . dysplastic dentin , amorphous ovoid cementum like calcifications and trabeculae of osteoid may also be present . the peripheral odontogenic fibroma shows histopathologic features similar to those of the central odontogenic fibroma ( who ) type . in the past , some authors had designated clinically and histopathologically lesions similar to peripheral odontogenic fibroma as odontogenic gingival epithelial hamartoma / peripheral fibroblastic dentinoma , odontogenic epithelial hamartoma . the reason for it being referred to as odontogenic gingival epithelial hamartoma in the past is a reflection of the authors placing more emphasis on the epithelial component rather than the fibroblastic component . it does not appear to be a hamartoma because hamartomas are developmental , while in this particular study by baden , lesions reported as hamartomas appeared only in sixth and seventh decades of life rather than during the development of dentition , which means that they were not hamartomas . at one time , the terms peripheral ossifying fibroma and peripheral odontogenic fibroma were used quite interchangeably till gardener published a clarification in terminology . while the former one is a commonly found reactive lesion with well - formed bone , numerous giant cells and only rarely , if present , odontogenic epithelial rests , the latter one , which is quite rare , has extensive odontogenic epithelium with occasionally found dysplastic dentin / cementum like calcifications and only rarely , giant cells are present . the origin of both the lesions is quite different and so is the biologic behavior . the former is a benign tumor of connective tissue origin with a marked tendency to recur , while the latter is of odontogenic mesenchymal origin whose recurrence is not known exactly but is reported to vary from very low to as high as 38.9% . buchner et al . presented nine cases of peripheral odontogenic fibroma that illustrate the variety of its histopathologic findings . they also suggested that the term who type to be used to distinguish it from peripheral ossifying fibroma . the first detailed clinicopathologic study of peripheral odontogenic fibroma was published by daley et al . clinical data from this study indicate that the lesion is more common than reported previously and also that it has a significant recurrence rate . another study by buchner presents the relative frequency of peripheral odontogenic tumors ( pots ) , in which it was found that peripheral odontogenic fibroma accounted for 51.1% of the total pots . however , pots themselves are quite rare , consisting of only 0.05% of all oral biopsy specimens . being a rare lesion itself , the literature mostly consists of case reports[31013 ] of rarer forms or presentations of the same lesion which consist of diffuse , multifocal type and diffuse associated with ocular , skin lesions . in the past , some authors had designated clinically and histopathologically lesions similar to peripheral odontogenic fibroma as odontogenic gingival epithelial hamartoma / peripheral fibroblastic dentinoma , odontogenic epithelial hamartoma . the reason for it being referred to as odontogenic gingival epithelial hamartoma in the past is a reflection of the authors placing more emphasis on the epithelial component rather than the fibroblastic component . it does not appear to be a hamartoma because hamartomas are developmental , while in this particular study by baden , lesions reported as hamartomas appeared only in sixth and seventh decades of life rather than during the development of dentition , which means that they were not hamartomas . at one time , the terms peripheral ossifying fibroma and peripheral odontogenic fibroma were used quite interchangeably till gardener published a clarification in terminology . while the former one is a commonly found reactive lesion with well - formed bone , numerous giant cells and only rarely , if present , odontogenic epithelial rests , the latter one , which is quite rare , has extensive odontogenic epithelium with occasionally found dysplastic dentin / cementum like calcifications and only rarely , giant cells are present . the origin of both the lesions is quite different and so is the biologic behavior . the former is a benign tumor of connective tissue origin with a marked tendency to recur , while the latter is of odontogenic mesenchymal origin whose recurrence is not known exactly but is reported to vary from very low to as high as 38.9% . buchner et al . presented nine cases of peripheral odontogenic fibroma that illustrate the variety of its histopathologic findings . they also suggested that the term who type to be used to distinguish it from peripheral ossifying fibroma . the first detailed clinicopathologic study of peripheral odontogenic fibroma was published by daley et al . clinical data from this study indicate that the lesion is more common than reported previously and also that it has a significant recurrence rate . another study by buchner presents the relative frequency of peripheral odontogenic tumors ( pots ) , in which it was found that peripheral odontogenic fibroma accounted for 51.1% of the total pots . however , pots themselves are quite rare , consisting of only 0.05% of all oral biopsy specimens . being a rare lesion itself , the literature mostly consists of case reports[31013 ] of rarer forms or presentations of the same lesion which consist of diffuse , multifocal type and diffuse associated with ocular , skin lesions . a 30-year - old female presented in the department of periodontics , srcdsr , with a localized gingival swelling in relation to interdental gingiva of mandibular left canine - first premolar region [ figure 1 ] . it was present since 1 year and had slowly grown to this size , causing displacement of both the teeth and creating a space between them . patient gave a vague history of presence of similar growth in the same region around 11 years back which she got excised in a government hospital , but no records could be obtained regarding that either from the patient or from the hospital . on examination , the swelling was approximately 0.8 1 cm in size [ figure 2 ] , was found to be sessile , nonlobulated , sharply demarcated but otherwise of the same color as the surrounding mucosa . on palpation , it had a fibrotic consistency . complete full mouth periodontal examination revealed the presence of generalized 3 - 4 mm deep pockets and subgingival flecks or complete bands of calculus . patient had a very poor oral hygiene . a clinical diagnosis of generalized mild to moderate chronic periodontitis with focal fibrous hyperplasia / irritation fibroma was made . iopa intra oral periapical radiograph ( iopa ) of the involved area was taken which revealed a horizontal bone loss [ figure 3 ] . excisional biopsy was done along with open flap debridement as the patient was suffering from periodontitis . the growth was removed with an internal bevel incision and root surface was scaled and planed thoroughly . periodontal pack was placed and the patient was recalled after 7 days for pack and suture removal . at follow - up , the area seemed to heal well . the patient is getting treated for periodontitis now and will remain on a regular follow - up of 3 months in the future . pre - operative photograph mesiodistal length of excised lesion radiograph of the area post - operative photograph ( 5-week follow - up ) microscopically , the lesion showed partially circumscribed tumor mass exhibiting interlacing fascicles of collagen fibers and scattered abundant odontogenic nests and strands [ figure 5 ] . intervening connective tissue also consisted of numerous localized areas of chronic inflammatory cells ( mainly plasma cells ) and few multinucleated giant cells . the overlying epithelium was hyperplastic , parakeratinized stratified squamous epithelium with thin , long rete ridges . the differential diagnosis includes inflammatory lesions such as fibrous hyperplasia , fibroma , giant cell fibroma , peripheral ossifying fibroma , pots , peripheral giant cell granuloma , and pyogenic granuloma . peripheral odontogenic fibroma does not involve the underlying bone and only sometimes shows areas of calcification on radiograph . the lesion itself showed no calcification , while the reason for interdental bone loss is periodontitis since it is generalized . armas et al . have published a case report of recurrence of peripheral odontogenic fibroma three times and the last one occurred not only after a gap of 11 years which is the longest reported time of recurrence , but also presented in association with a central odontogenic fibroma although there were no radiographic findings the first two times . this would emphasize the importance of radiographic investigation and follow - up of such type of cases . tooth displacement , which is generally not caused by this lesion , was present in this case most likely because of the presence of generalized periodontitis that makes the tooth amenable to pathologic migration . due to the nonavailability of previous records , we can not say whether it is a recurrence of the same lesion after a long period of 11 years or another independent lesion . the literature also indicates the presence of another pathological entity , namely fibrous hyperplasia exhibiting odontogenic rests , which was eliminated from differential diagnosis on the basis that the epithelium found in our specimen was actually large in amount as seen in the photomicrograph . it is further stressed that as far as the excisional part is concerned , mucogingival problem is not created unless and until the attached gingiva is involved , which is not quite usual , or rather it has not been commented upon except in one of the case reports . however , if it is involved , grafting procedures can be done . in our case , , we stress upon the radiographic and histopathologic investigation of all gingival growths in addition to regular follow - ups of all such patients . | odontogenic tumors mainly occur as intraosseous growths but sometimes may present in a peripheral location on the gingiva where they are referred to as peripheral odontogenic tumors ( pots ) which are a rare entity , the most common of them being the peripheral odontogenic fibroma that is an otherwise uncommon , slowly growing , benign odontogenic neoplasm of the periodontal soft tissues . in fact , peripheral odontogenic fibroma is the only pot that is more frequent than its central counterpart . although considered to be with a potential to recur after excision , the actual recurrence rate is not known due to paucity of literature .
this paper presents a case report along with review of the available literature and reinforces the importance of patient follow - up in addition to radiographic and histological examination of seemingly innocuous gingival exophytic lesions . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
non - infectious diseases comprise 43% of the disease burden around the world ; and it is expected that in 2020 the diseases become responsible for 60% of the total disease burden and 73% of all cases of death . large epidemiological studies in different countries have shown that smoking is highly correlated with incidence of many non - infectious diseases ( 2,3 ) . in many countries , smoking is equal to cigarette smoking . mortality rate of cigarette smokers in all age groups is 2 - 3 times higher than that in non - smokers . prevention of non - infectious diseases is based upon identification of primary and major risk factors , and prevention and control of these factors ( 4,5 ) . cigarette smoking and alcohol cause cardiovascular disease , myocardial infarction , many serious diseases , as well as many cancers ( 6 ) .
according to the world health organization ( who ) report , the global prevalence of cigarette smoking is 47% and 12% in men and women , respectively . the rate is 7% for women in the developing countries versus 25% for women in the developed countries ( 7 ) . studies in different countries have shown that the rate of smoking is higher in men . however , in most studies a decrease in the gap between the rate of smoking in men and women has been shown ( 8 - 10 ) . therefore , it could be concluded that the prevalence of smoking among women is increasing . the results of a study in the usa demonstrated that the rate of smoking is decreasing among men and increasing among women . the rate of smoking was also higher in girls than boys ( 11 ) . in our country , based on the tehran lipid and glucose study ( tlgs ) , the prevalence of cigarette smoking was 10.6% ( 22% in men versus 2.1% in women ) ( 12 ) . in the study carried out by ahmadi et al . in shiraz , the prevalence rates of smoking among men and women were 26% and 3.6% , respectively ( 13 ) . the rate of cigarette smoking among women in all the studies carried out in iran was in the range of 1.3 - 5.9% ( 13 - 16 ) . however , the spectrum of smoking has not been thoroughly investigated in women . in a study carried out in the urban and rural areas of tehran in 1999 to 2000 , the rates of daily smoking in male and female people above 15 were 22.2% and 2.1% , respectively ( 1 ) . the smoking rates obtained in this study were higher than those reported by the studies performed in the previous years ( 18,19,21 ) and lower than those reported in the studies performed later ( 19,17 - 22 ) . ( estimated smoking rate of 12.1% in tehran ) also confirms it ( 23 ) . according to who reports , the rates of smoking and smoking - related diseases are increasing among women , particularly young women ; such that the ratio of smoking women has increased 12% all over the world , and frequency of lung cancer in women has exceeded breast cancer in some parts of the world ( 24 ) .
in spite of the slight increase in the rate of cigarette smoking among iranian women , the rate is still much lower than that in men and also in comparison with the rates reported for women in many other countries . several studies have been performed in this respect and the prevalence rate of smoking among iranian women was reported in the range of 0.04 to 10.5% . since the prevalence data is sparse , it seems that carrying out a systematic review and careful analysis of the data could produce valuable information about cigarette smoking among iranian women . the aim of this study is to extract maximal available and published data about cigarette smoking among iranian women in recent years , and to provide a more comprehensive picture of the problem by combining the results obtained in recent years . search strategy : to find the studies related to the prevalence rate of cigarette smoking , iranian and international electronic sources of iran - doc , iran - medex , cinahl , psycinfo , embase , medline , cochrane tobacco addiction group , sid , ebsco host , ovid , science direct , iranpsych , pubmed , who , biomed , magiran , and google scholar were searched for related documents during 1995 to 2011 . the search strategy was mainly systematic use of persian and english keywords with all possible combinations . to improve the search sensitivity , general keywords were used as follows ; ( woman or girl ) and ( cigarette or smoking ) and ( frequency or prevalence ) and iran . the bibliographies of searches were screened to find relevant data . moreover , in order to access the grey literature , non - electronic resources were searched . the resources includes proceedings of the conferences , dissertations , and the data produced by state and non - state centers and organizations that have research activities in the field of addiction . criteria for selection and evaluation of quality of the papers :
firstly , the titles and abstracts of all papers were searched in order to find relevant titles . then , all papers were searched and relevant papers were reviewed . the aim of the study was to determine the prevalence rate ; thus , inclusion criteria were giving an estimation of cigarette smoking among iranian women , and conduction of the study in iran . another inclusion criterion was having acceptable quality with regard to the study population , design , avoiding biases , and the method of dealing with confounding factors . after finding studies with relevant titles , the paper abstracts were evaluated using the strobe checklist ( strengthening the reporting of observational studies in epidemiology ) . the checklist included 22 major items as follows : title and abstract , introduction , methodology and study design , measurement of variables , statistical analysis , aims of the study , results , discussion , and conclusion . finally , papers that obtained the minimum score of 16 out of 22 were selected for data extraction step of the meta - analysis process and underwent statistical analysis .
in this study , then , after reviewing the titles , 120 papers were selected , and after evaluation of the papers for their abstracts , 83 irrelevant papers that did not meet the inclusion criteria were excluded . the remaining 37 studies entered the third step ; i.e. , qualitative evaluation . the studies with population not representative of the general population , and those having low quality according to the checklist were excluded . four studies were not included in the analysis owing to wide variations among them and other studies . for example , studies by amiri et al . in 2003 in bushehr due to the wide variations equal to 939.75 , ansari et al . in 2006 in tehran due to insufficient sample size ( less than 350 samples ) , ismaili nadimi et al . in 2006 in rafsanjan due to high variation equal to 886.37 , and divsalar et al . in 2003 in kerman due to wide variations equal to 546.36 were omitted ( 25 - 28 ) . however , two papers were not accessible in full text for the authors , and the abstracts were used for analysis . among the papers selected , 1 ) .
flowchart of inclusion of the studies in our systematic review and meta - analysis . they addressed four population subgroups as follows : 1 ) students in the age range of 11 - 18 , 2 ) university students at the age of 20 and above , 3 ) adults in the age range of 20 - 40 , and 4 ) all individuals of 15 - 64 years old . studies that addressed subgroup 3 and the studies on age groups above 35 or with old publication years were analyzed descriptively . then , a datasheet was prepared to extract the descriptive data , which is enclosed . the datasheet included bibliographic data ( place of study , first author s name , year of study , place of sampling , sample size , prevalence of cigarette smoking in the study , and the mean age range of participants ) . moreover , the criteria related to quality of the studies were recorded in the forms . it should be mentioned that since we did not have access to the details of primary data of each participant , in each study the general data of prevalence of cigarette smoking among women , sample size , place and time of study , and other necessary data were used as aggregated data .
data extraction :
in this step , a form with eight sections was designed . the required information included the bibliographic data ( subject , title , journal s name , and author ) and methodological data ( methodology and study design ) , as well as the information on the prevalence of cigarette smoking among women , general characteristics of the samples , methods of data evaluation , groups or target groups , and quantitative data of the samples such as mean age of smokers , amount of smoking , and elimination of confounding variables . considering the who definition , cigarette smokers were selected with regard to the history of the number of cigarettes smoked during a day as follows :
active smoker : an individual who smokes more than seven cigarettes per week ( at least one cigarette per day )
heavy smoker : an individual who smokes more than 20 cigarettes per day ( 29 - 31 ) .
statistical analysis :
in this step , the prevalence rate of women s cigarette smoking in all related descriptive studies were collected . then , variances of each study were determined using the binomial distribution formula . using heterogeneity test ( cochrane q test ) , statistically significant difference among findings of the studies the point estimation and 95% confidence interval ( 95% ci ) were calculated by describing the findings in the forest plot . by evaluating the quality of full text of 12 relevant papers , 33173 women were eligible to be included in the study . the details of the data used in the meta - analysis are depicted in table 1 . the lowest prevalence of cigarette smoking among iranian women ( 0.04% ) was reported by kelishadi et al . in isfahan , 2003 . they evaluated the prevalence of smoking among students in the age range of 11 - 18 in urban and rural areas with a large samples size . the highest prevalence rate of smoking among iranian women ( 10.5% ) was reported by amiri et al . in bushehr , 2003 . this can be explained by performing the study on the urban population , and in the age range of 25 - 64 , among whom 68% were above 35 . study on the subgroup of students :
the overall prevalence in three eligible studies was 0.19% ( 95% ci= 0- 0.4 ) . however , the findings were found to be significantly incongruent ( i2= 0.54 ) ( table 2 ) . results of meta - analysis for this subgroup showed the lowest prevalence rate in this subgroup , which is explained by the low mean age of the students ( fig.2 ) . study on the subgroup of adults :
the overall prevalence rate for six eligible studies was 2.12% ( 95% ci= 1.1 - 3.1 ) . nevertheless , the studies were found to be significantly incongruent with regard to their findings ( i2= 0.96 ) ( table 2 ) .
in these studies , the wide and sometimes different age range of participants and accumulation of the data obtained from urban and rural areas led to incongruity . 3 ) .
comparative results in evaluated subgroups with regard to smoking prevalence among adults . results of meta - analysis in national studies :
the overall prevalence rate for three eligible studies was 5.098% ( 95% ci= 1.4 - 8.7 ) . nevertheless , it was found that the studies were significantly incongruent in their results ( i2= 0.96 ) . ( table 2 ) publication years and accumulation of the data from urban and rural areas around the country were major sources of incongruity , and thus the results of meta - analysis for these studies were evaluated separately ( fig . 4 ) .
comparative results in evaluated subgroups with regard to smoking prevalence among national studies . in this study , it was attempted to achieve an estimation of the overall prevalence of cigarette smoking among iranian women by evaluating the findings reported in other studies . results of the current study demonstrated that in the three subgroups evaluated , smoking rate among iranian women is estimated within the range of 0.19 - 5.09% . there is a significant incongruity among the studies with regard to their findings . using meta - analysis of the subgroups , major sources of incongruity in the studies were determined as the mean age , living in urban or rural areas , and publication year of the papers . the overall prevalence rates of cigarette smoking among iranian women in different regions of the country were 0.19 , 2.12 , and 5.09% for students , adults , and national surveys in all provinces of the country , respectively . the rates are comparable with the who estimation of 4.3% in 2005 ( 32 ) . the rates reported in various studies were different owing to the difference in the study area extent , place of sampling , and the sample size . major factors influencing the difference in the prevalence rates reported were the mean age , living in urban or rural areas , and the year of carrying out the study and publishing the papers .
in the current study , comparing the overall prevalence of cigarette smoking among iranian women in urban and rural areas was not possible owing to the small number of studies meeting the analysis criteria .
in the study , the highest quality paper was the one written by meysami et al . in 2007 titled as the smoking pattern among iranian adult population . they reported the smoking rate among iranian women as 1.4% ( 33 ) . in their study , adults age groups in urban and rural areas and characteristics of the population under study were clearly defined . the highest rate was reported in a study performed in bushehr on people above 25 in the capital city of the province , while the lowest rate was reported in a study on male and female students in the age range of 11 to 18 , living in rural areas of isfahan . regarding the people s culture in rural areas and the negative attitude toward smoking by girls and women in these areas , it was shown that the rate was lower in the studies that were performed on rural population or rural and urban population collectively ( 17 ) .
according to the who report in 2008 , the rate of cigarette smoking among iranian women was higher than that among iraqis ( 1.6% ) , women in the uae ( 1.2% ) , less than that in turkey ( 14.8% ) , and almost similar to the rates in other persian gulf countries ( 32 ) .
in another study conducted by the who on the iranian population , a decrease in the smoking rate was reported from 1991 ( 3.4% ) to 2000 ( 1.5% ) ( 34 ) . also , the studies have shown that the rate of smoking among iranian women is much less than all other european countries except azerbaijan ( 0.4% ) ( 35 ) .
however , since in the iranian culture there is a negative attitude toward smoking by women and in all the studies included in the study , the surveys were performed by asking the people about smoking , there is a possibility for under - report . for instance , sarafzadegan et al reported a statistically significant difference between the rates of self - report and chemical indices of smoking in women ( 1.3% versus 6.7% ) ( 15 ) . the increasing rate of smoking among young women in the developing countries is a major concern for the who in public health and prevention of the diseases . improved health condition and consequently increasing proportion of the elderly population in the developing countries leads to an increase in the rate of non - infectious diseases in these countries . therefore , it is necessary for these countries to adopt appropriate measures to reduce risk factors of these diseases . moreover , women comprise a target and susceptible group in health systems and maintaining their health is of great importance . cigarette smoking by women is not only a major health problem in iran and the eastern mediterranean countries , but also all over the world . according to the who report in 2005 , results of global surveys on smoking status among adolescents have shown that the rate of smoking is increasing in girls of 13 to 15 worldwide . however , in the current study , the rate of smoking among female students was lower ( 33 ) . one of the limitations of the current study was that most relevant studies were performed on a certain population subgroup such as students , university students , adolescents , the young , specific age groups , or different parts of the country . several studies in the country have addressed the rate of smoking among boys and men . in general , few studies with acceptable sample size and study design were available on different age groups of the iranian women population . it is suggested that a uniform framework for the study design , methodology , and definition of the variables be adopted for similar studies . carrying out studies only on the smoking rate among women is not sufficient , and studies on all age groups and also certain groups of women should be performed . however , similar to original studies , these meta - analyses are prone to inevitable limitations , biases , and errors . to achieve a more accurate picture with higher reliability , it is suggested to perform studies with similar and standard methodology at the national level in this respect . results of this systematic review indicate that prevalence of smoking among iranian women is less than the rates reported by the who . moreover , the rate of smoking among iranian women is significantly less than the rates reported for the emro region ( eastern mediterranean regional office ) and reports of the who . prevalence rate of smoking in our country has not probably changed in comparison with previous decades ( 32 ) . owing to the large number of studies with different methodologies and results , and evaluation of the current status , it is difficult to predict the future status of smoking among women . however , it seems that prevalence of cigarette smoking among women above 25 and adults is higher than the rates in other age groups . considering the high proportion of young population , an increase in the rate of smoking among iranian women is predictable . | background smoking has physical , psychological , and social impacts on women s health and subsequentlythe community s health .
therefore , it is important to have an estimation of smoking among iranian women.since comprehensive data are not available in this respect , the authors performed a systematic review and metaanalyzedall high - quality studies in this field.methods all available electronic papers were searched by certain keywords and were included in this studyaccording to the inclusion criteria regardless of the publication year .
furthermore , non - electronic resources includingthe final report of research projects , dissertations , unpublished papers ( grey literature ) and books publishedby the iranian ministry of health were also evaluated in the study .
the materials were assessed for theirquality and meeting the inclusion and exclusion criteria .
considering the high degree of variability in many selectedstudies , we used random effect method for meta-analysis.results the highest and lowest rates of cigarette smoking among women were 10.5% and 0.04% , respectively.the prevalence rates of smoking were different in various subgroups ; ranging from 0 to 0.4% in students , 1.1to 3.1% in adults , and 1.4 to 8.7% in all subgroups . according to the meta - analyses performed for the subgroups , the mean age of participants , performing the study in urban or rural areas , and the year of paper publicationwere major sources of heterogeneity.conclusionthe studies were highly different with regard to their findings , and it seems that there is an ageand time trend for the findings . furthermore , the prevalence of smoking was different in various regions of thecountry . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
slo include encapsulated organs such as the spleen and lymph nodes and un - encapsulated mucosal lymphoid organs such as peyer 's patches , tonsils , and nasal - associated lymphoid tissues . slo develop before birth and are important locations for the initiation of adaptive immune responses since they maximize encounters between antigen , antigen - presenting cells , and lymphocytes present in blood and surrounding mucosal tissues . slo formation requires the interaction between cd3cd4cd45 lymphotoxin-12 ( lt12)-expressing lymphoid - tissue inducer cells and lymphotoxin- receptor - expressing stromal organizer cells . lt12 activates lymphoid tissue stromal organizer cells to produce homeostatic chemokines such as cxc chemokine ligand 13 ( cxcl13 ) and cc - chemokine ligand 21 ( ccl21 ) and ccl19 , which regulate lymphocyte homing and compartmentalization ( 1 ) . tls , also named tertiary lymphoid organs or ectopic lymphoid tissues , are architecturally similar to conventional slo . tls include organized b - cell follicles with germinal centers ( gcs ) , distinct t cell areas that contain some dendritic cells ( dcs ) , high endothelial venules ( hev ) that traffic immune cells from circulation into tls , and lymphatics that transport tissue dcs into the tls ( 234 ) . tls not only share spatial organization , cellular compartments , vasculature , and chemokines with slo , but also functional characteristics including leukocytes priming , clonal expansion , somatic hypermutation , affinity maturation , immunoglobulin class switching , b cell - receptor revision , and maintenance of peripheral tolerance ( 567 ) . even so , there are important differences . for example , slo are genetically preprogrammed and pre - patterned as they arise at key locations in the body during embryogenesis under the control of a precise developmental program . slo have distinctive features ( 8) : that is , they trigger priming of naive t cells following interaction with dcs and resume quiescence when the " foreign " antigen is eliminated ( 9 ) . by contrast , development of tls can be driven by environmental influences , including chronic inflammation , autoimmune diseases ( 1011 ) , transplant rejection ( 12 ) , and cancer ( 13 ) . tls develop as un - encapsulated lymphoid aggregates almost everywhere in the body and do not appear at predictable sites : this is especially true when there is a continuing need for leukocyte extravasation or where antigens persist ( 1014 ) . thus , many of the mechanisms that control the development , cellular compositions and functional maintenance of slo and tls are common to both . a variety of cell types , including lymphoid tissue inducer ( lti ) cells , local stromal cells , b cells , dcs , and some t cell subsets , such as t helper cells , th17 cells , treg cells and cd8 t cells , are critical for tls formation ( fig . lti cells induce tls formation by expressing a wide range of proteins , particularly lt12 ( 15 ) . lti cells accumulate in the presence of cxcl13 and interleukin-7 ( il-7 ) and their receptors such as cxcr5 and il-7r ( 1617 ) . the cells interact with antigen - specific cd4 t cells and associate with memory t cells in the gcs via ox40 and cd30 ( 18 ) . however , some tls develop independently from lti cells or associated molecules ; for example , omental milky spots in the peritoneal cavity ( 19 ) and tumor necrosis factor- ( tnf)-dependent lymphoid tissue in the intestine ( 20 ) . in addition , other cell types , like b cells ( 21 ) , t cells ( 22 ) , or m1-polarized proinflammatory macrophages ( 23 ) , can substitute for lti cells during tls development , particularly when activated and expressing lt12 on the surface . for example , activated cd3cd4 t cells interact with dcs in a hashimoto thyroiditis mouse model , resulting in tls formation ; this process , depends on mature cd3cd4 t cells but not on conventional lti cells ( 24 ) . stromal cells include fibroblastic reticular cells ( frcs ) that reside in the t cell zone , follicular dendritic cells ( fdcs ) that populate b cell follicles , marginal reticular cells adjacent to subcapsular sinus lymphatic endothelial cells , pericytes , epithelial cells , and versatile stromal cells ( vscs ) ( 6 ) . stromal cells are well known for forming extracellular matrix in all lymphoid organs by providing survival signals and adhesive substrata to immune cells ( 25 ) . for example , arterial tls in the adventitial connective tissue adjoining arteries is formed through vascular smooth muscle cell lymphotoxin ( lt ) receptor signaling ( 26 ) . interactions between lti cells and stromal cells are critical for proper tls formation ( 27 ) . in particular , increased expression of adhesion molecules such as intercellular adhesion molecule 1 ( icam1 ) and chemokines such as cxcl13 , ccl19 and ccl21 , are critical for recruitment of hematopoietic cells ( 1 ) . thus , tls in cns autoimmune diseases often developed in the meninges but not in neural parenchyma ; this is because stromal cells mainly reside in the meninges ( 28 ) . also , frcs play a critical role in maintaining aberrant components in the wrong tissue at the wrong time , thereby contributing to tls persistence in chronic inflammatory diseases ( 2930 ) . b cells , which accumulate on the follicular dc network , are the major tls component . most tls exhibit b cell class switching and the presence of activation - induced cytidine deaminase and germinal center reactions ( 3132 ) . autoreactive b cells in tls may escape apoptosis and negative selection due to sustained production of the b cell survival factor , baff . some b cells may reach the bone marrow , where they reside as long - lived plasma cells ( 33 ) . after exposure to continuous stimuli in a chronic inflammatory environment , b cells upregulate lymphotoxin expression through il-4r signaling and promote frc proliferation and activation via lymphotoxin - ltr signaling ( 35 ) . moreover , b cells contribute to local immune responses to persisting autoantigens by producing proinflammatory cytokines , chemokines and growth factors , all of which are crucial for tls formation . also , b cells co - operate with cd8 tumor - infiltrating lymphocytes to promote anticancer immunity and act as new prognostic biomarkers for cancer survival ( 3637 ) . a variety of t cells are involved in tls formation or maintenance , including cd8 t cells and some cd4 t cell subsets , natural killer t cells ( nkt ) , th17 cells , follicular helper t ( tfh ) cells , and t regulatory cells ( tregs ) . depletion of synovial cd8 t cells causes disintegration of gc - containing follicles , disappearance of fdcs , significantly reduced production of lt12 and a lack of immunoglobulin ( ig ) secretion ( 38 ) . cd4 + t helper ( th ) cells in a special tls , which is formed during chronic allergic inflammation in the lung and named inducible bronchus - associated lymphoid tissue ( ibalt ) , show a memory phenotype ( 39 ) . nkt cells restricted by the antigen - presenting molecule cd1d seem to be required for inducible formation of fat - associated lymphoid clusters , which support and coordinate the activation of innate b cells and t cells during serosal immune responses in the peritoneal cavity ( 40 ) . th17 cells are a subset of cd4 t cells subsets that are the main source of cytokines interleukin-17 , il-21 , and il-22 . th17 cells and these cytokines play important roles in host defense against various infections and can be responsible for the pathogenesis of many autoimmune diseases ( 41 ) . interestingly , th17 cells share many characteristics with lti cells , including lt1 expression ( 42 ) . th17 cells exert their deleterious effects by promoting formation of ectopic gcs in tls in inflamed tissues ( 43 ) , thereby facilitating chronic rejection ( 44).th17 cell plasticity permits acquisition of tfh - like effector characteristics that support tls expansion and germinal center reactions ( 45 ) . in vitro - generated th17cells transferred into mice tls formation by th17 cells in the cns requires il-17 ( 22 ) , while il-17 is needed to initiate but not to maintain ibalts ( 46 ) . th17 cells initiate tls formation by remodeling meningeal - resident stromal cells and affecting communication between them in mice with experimental autoimmune encephalomyelitis ( eae ) , and propagate neuroinflammation through lt expression ( 43 ) . tfh cells are localized in b cell follicles expressing high levels of the co - stimulatory molecules inducible t cell co - stimulator and il-21 , thereby promoting activation and differentiation of b cells for ig class switching and ig production ( 47 ) . tfh cells are linked to germinal center responses and the formation and maintenance of tls ( 48 ) . t follicular helper - like cells are indispensable for b cell expression of a classical germinal center phenotype ( 49 ) . in many autoimmune diseases , ccr7-deficient mice possess few tregs in lung - draining bronchial lymph nodes suggesting that ibalt formation might be caused by non - functional treg cells ( 50 ) . consistent with this , depletion of tregs from mice upregulates expression of il-17a and cxcl9 in the lungs and induces tissue neutrophilia ( 51 ) . on the other hand , lymphocytes are found in large lymph node ( ln)-like , complex tumor - associated tls in cancer patients ( 52 ) ; these tls facilitate interactions between t cells and dcs . both costimulatory ligand expression by dcs and t cell proliferation in tumor - associated tls increase upon treg cell depletion , leading to tumor destruction ( 3 ) . tls develop in most solid cancers and correlate with a favorable clinical outcome for cancer patients , regardless of the stage of disease ( 36 ) . dcs in tls often show an activated / mature phenotype , with high cd86 and il-12 expression . dc depletion leads to ibalt disintegration and fewer gc reactions , indicating that dcs are critical for tls maintenance . dcs might increase antigen presentation , form tight clusters with infiltrating cd4 t cells , and promote t cell proliferation ( 24 ) . in addition , dcs increase the production of cytokines and chemokines , including cxcl13 , ccl21/ccl19 ( 54 ) , b cell - activating factor ( baff ) , il-6 , and il-15 ( 55 ) , as well as that of type i interferons ( 56 ) . dcs also play an important role in endothelial cell differentiation ( 57 ) . in human lung cancer , tls - associated mature dcs generates a specific immune context characterized by a strong th1 and cytotoxic orientation that confer a positive prognostic value ( 58 ) . such molecules include lt , lt12 , cxcl13 , ccl21 , ccl19 , il-17 , il-22 , il-23 , il-7 , and il-27 , all of which play differential roles depending on the site of infection and the nature of the pathogen . lt is a cytokine produced by lymphocytes and is anchored to the surface of th1 and th17 cells . depleting lt - expressing th1 and th17 cells using a monoclonal antibody targeting surface lt inhibits t cell - mediated inflammation and autoimmune disease ( 59 ) . similar to slo formation , lt can induce stromal cells in the tls to develop into fdcs and hevs ( 60 ) . cxcl13 functions in b cell recruitment and trafficking , and is also critical for the formation and maintenance of b lymphocyte follicles in some autoimmune - associated tls ( 61 ) . cxcl13 also promotes lt12 secretion by b cells and t cells , which establishes a positive feedback loop that perpetuates lymphocyte recruitment ( 62 ) , dc proliferation , and t cell priming ( 63 ) . ccl21 helps to maintain inflammation by promoting integrin - dependent adhesion and extravasation of naive t cells ( 57 ) . without ccl21 , these cells are unable to return to the circulation and accumulate in inflamed tissues , which may lead to tls formation ( 64 ) . almost all tls in chronically rejected human renal allografts correlate with il-17 expression ( 65 ) . ibalt formation depends on il-17 produced by cd4 t cells , since the latter promote secretion of high levels of cxcl13 and ccl19 , which are critical for tls formation ( 46 ) . in a mouse model of eae , th17 cells induce tls formation , which is in turn dependent on il-17 and pdp ( 22 ) . th17 cells are also associated with tls formation in other human diseases ( 44 ) . il-22 acts downstream of the lt pathway and regulates tls organization and maintenance in the colon during infection ( 66 ) . il-22 can also regulate production of cxcl13 , which can orchestrate b - cell clustering , lymphoid aggregation , and autoantibody production in tls ( 67 ) . blockade of either il-22 pathway significantly impairs and reverses tls formation , suggesting that il-22 has an indispensable role in maintaining tls ( 67 ) . il-22 is efficiently induced by il-23 , which is strongly associated with rheumatoid arthritis ( ra ) ( 68 ) . recent evidence suggest a role for il-7 in the development of slo and tls ( 69 ) . gene expression profiling of synovial tissue from patients with ra identified il-7 signal transduction in tissues within tls , which was accompanied by increased expression of il-7 receptor ( il-7r)/il-2r chains and il-7 in cases of tls - associated synovitis ( 71 ) . also , il-9 expression produced by th9 cells in ra patients correlates with the degree of synovial inflammatory infiltrate and tls organization ( 72 ) . however , il-27 can negatively regulate tls development in ra by controlling effector t cells ( 73 ) . the presence of fully functional ectopic gcs in tls has been described in a broad variety of autoimmune diseases , including ra ( 75 ) , sjgren 's syndrome ( 76 ) , lupus nephritis ( 77 ) , autoimmune diabetes ( 78 ) , a mouse model of multiple sclerosis ( 43 ) , a mouse model of spontaneous autoimmune uveitis ( 79 ) , hashimoto 's thyroiditis , and graves ' disease ( 80 ) . although a wide spectrum of lymphoid arrangements coexist in the same patient , tls includes relatively poorly organized perivascular aggregates , diffuse lymphoid infiltrates , and highly organized ectopic lymphoid follicles that display hev development ; t / b cell segregation ; gc formation ; and specialized reticular networks containing fdc and follicular reticular cells ( 410 ) . in most auto - immune disorders , for example , tls are responsible for inducing or exacerbating autoimmune responses which , in human primary sjgren 's syndrome samples , correlate with increased levels of proinflammatory mediators and autoantibody production ( 81 ) . also , tls in a mouse model of hepatocellular carcinoma serve as niches for malignant hepatocyte progenitor cells , which may lead to tumor recurrence ( 82 ) ; this is despite the finding that tls protect against most tumors , including both primary tumors and metastatic tumors ( 13 ) . there is a correlation between cytokine or chemokine levels and increased complexity of tls in autoimmune lesions , supporting a causative role for these mediators in tls formation ( 75 ) . however , some studies demonstrate that tls are not totally consistent with arthritis activity or severity , even though they correlate with local auto - antibody production ( 83 ) . tls facilitate localization of ectopic gcs and generation of new specific autoreactive b cells , thereby facilitating local antimicrobial responses , epitope spreading ( 84 ) , and autoimmune exacerbation . increased diversity of autoreactive b cells in the tls may also be due to escape from peripheral tolerance , resulting in disturbance of autoreactive b cell selection ( 64 ) . tls help to eliminate or neutralize pathogens by generating plasma cells that produce specific antibodies . tls may amplify autoimmune responses , tissue damage , thereby exacerbating a disease , which may then show a poor response to standard biological therapies ( 11 ) . treatment of an autoantibody - mediated cardiac allograft mouse model , with an inhibitory ltr - ig fusion protein abolished tls formation and markedly inhibited effector antibody responses ( 85 ) . a mouse anti - cxcl13 antibody demonstrated some efficacy in a mouse model of ra and in a th17-mediated murine model of multiple sclerosis ( 86 ) . the t follicular helper - germinal center / b - cell axis is pro - atherogenic , and genetic disruption of cd8 tregs leads to increased tls development in the aorta and exacerbates disease . thus , disrupting this axis or enhancing cd8 treg cell function represents a promising therapeutic approach ( 87 ) . also , treg cell ablation within tumor - associated - tls in a mouse model of lung cancer induces robust effector t cell responses and tumor destruction ( 3 ) , suggesting that treg cell deletion might be a promising method of in disrupting tls development and preventing tumor progression . treatments aimed at depleting b cells do not alter the characteristic features of sjgren 's syndrome , which include increased clonal expansion in the salivary glands of patients ; this is because established chronic tls are already present ( 88 ) . thus , combination therapy targeting multiple steps or multiple components of tls in human diseases deserves consideration . recent years have witnessed much research into the mechanisms underlying tls formation and their relationship with disease . to some extent , tls could clear pathogens and therefore be beneficial to the individual . yet many questions remain . for example , retinoic acid is demonstrated to be responsible for gut - associated lymphoid tissues formation ( 89 ) . it is unknown whether retinoic acid also activates li cells in autoimmune disease . and are lti cells the earliest sensors of autoantigens and tissue damage that can deliver signals to other cells and amplify the deleterious effects ? also , the exact effect of tls in humans is still unknown . for example , to what extent do tls contribute to the ongoing inflammatory process and tissue damage in humans ? humanized mouse models are quite useful in human disease research . since they can be experimentally manipulated to study human hematology and immunology in vivo , as well as cancer therapy . this model system could be a promising way to investigate the role of tls in human diseases ( 90 ) . it is not sure whether the immune response is different in tls and slo ? and are there any specific cell populations in tls that have functions different from that in slo ? do the specific cells or cytokines contribute much to tls formation and maintenance ? and epstein - barr virus is thought to be a critical factor that determines tls formation ( 91 ) , as is murine cytomegalovirus in the salivary glands ( 92 ) ; therefore , do viruses affect tls formation / function ? in addition , is tls development driven by different disease subtypes , or are tls the inevitable result of persistent inflammation ? and what may contribute to tls resolution ? even though tls are not fully understood , the functional artificial lymphoid tissue shows therapeutic promising . since artificial lymphoid tissue induce specific immunity at ectopic sites and offer a novel breakthrough to restore the immune status and to treat uncontrollable obstinate diseases such as cancer , autoimmune diseases and severe infection ( 93 ) . so it is exciting to investigate the mechanism of tls in human diseases by combining the artificial lymphoid tissue system with humanized mouse models . | tertiary lymphoid structures ( tls ) are ectopic lymphoid tissues involved in chronic inflammation , autoimmune diseases , transplant rejection and cancer . they exhibit
almost all the characteristics of secondary lymphoid organs ( slo ) , which are associated with adaptive immune responses ; as such , they contain organized b - cell follicles with germinal centers , distinct areas containing t cells and dendritic cells , high endothelial venules , and lymphatics . in this review ,
we briefly describe the formation of slo , and describe the cellular subsets and molecular cues involved in the formation and maintenance of tls .
finally , we discuss the associations of tls with human diseases , especially autoimmune diseases , and the potential for therapeutic targeting . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
esophageal cancer ( ec ) is one of the most common cancers , with both high incidence and mortality . the most common histological types are esophageal squamous cell carcinoma ( escc ) and esophageal adenocarcinoma ( eac ) . in china , escc is the predominant histologic type ( 9095% ) , in contrast to the predominance of eac in the west . there are important biological differences between escc and eac , therefore , a prognostic study that takes into account the predominance of escc in china is important . the inflammatory marker , such as c - reactive protein , neutrophil or platelet count , has been shown to be a prognostic factor in several cancers , including ecs . recent studies demonstrated that lymphopenia is associated with prognosis in several cancers , such as hematological malignancy , breast cancer , and renal cell cancer . however , to the best of our knowledge , no studies regarding the predictive value of lymphopenia in patients with ec are available . therefore , the aim of this study was to investigate the prognostic value of lymphopenia in patients with escc . from january 2006 to december 2008 , a retrospective analysis was conducted of 307 consecutive patients with escc who underwent esophagectomy at zhejiang cancer hospital ( hangzhou , china ) . all of the patients included in the analysis fit the criteria : ( 1 ) escc was confirmed by histopathology ; ( 2 ) patients with curative esophagectomy ; ( 3 ) patients without preoperative neoadjuvant chemotherapy and/or radiotherapy ; and ( 4 ) preoperative blood cell counts were obtained before esophagectomy within 1 week . the exclusion criteria were as follows : ( 1 ) non - escc or gastroesophageal junction carcinoma ; ( 2 ) patients with previous or concomitant other cancers ; ( 3 ) patients with incomplete resection with microscopic or macroscopic residual tumors ; ( 4 ) patients with previous neoadjuvant chemotherapy and/or radiotherapy ; or ( 5 ) patients with previous anti - inflammatory medicines within 1 week . the lymphadenectomy included two - field and three - field lymphadenectomy . in the current study , most of patients underwent two - field lymphadenectomy . patients who had received neoadjuvant therapy were excluded in the current study . as the role of postoperative adjuvant chemotherapy and/or radiotherapy was controversial during that period , adjuvant therapy was not mandatory . the most frequent adjuvant chemotherapy included 5-fluorouracil ( 5-fu ) and cisplatin in our institute . usually , two to four courses of chemotherapy were used , separated by a 3-week interval . adjuvant radiation was initially performed through the anteroposterior field to 36 gy , then through the parallel opposing oblique fields to 14 gy . the diagnosis of escc was confirmed by histopathology . all patients were staged according to the 7th edition of american joint committee on cancer ( ajcc ) cancer staging ( tnm stage ) . then the following data , such as tumor length , vessel invasion , differentiation , t stage , and n stage were recorded according to the results of pathologic reports . tumor length was measured with a handheld ruler and was recorded in the pathologic reports . vessel invasion , with he staining , was considered only if the tumor cells were within an endothelium - lined , vessel - like structure . according to the 7th edition staging system , tumors can be divided into well - differentiated tumors , moderately differentiated tumors , and poorly differentiated tumors . the 7th edition defines the t stage into four subclasses : t1 , tumors invade lamina propria or submucosa ; t2 , tumors invade muscularis propria ; t3 , tumors invade adventitia ; and t4 , tumors invade adjacent structures ( t4a , resectable tumors invade adjacent structures such as pleura , pericardium , diaphragm ; t4b , unresectable tumors invade adjacent structures such as aorta , vertebral body , and trachea ) . the 7th edition defines the n stage according to the number of positive lymph nodes : n0 , no positive lymph nodes ; n1 , one or two positive lymph nodes ; n2 , three to six positive lymph nodes ; and n3 , seven or more positive lymph nodes . data on preoperative blood cell counts were extracted in our medical records . in our study , a lymphocyte count ( lc ) of fewer than 1.0 giga / l was defined as lymphopenia . < 1.0 giga / l ) and hlc ( lc 1.0 giga / l ) . based on the medical records , the following data were also collected for each patient : age ( 60 and > 60 years ) , gender ( male and female ) , tumor length ( 3.0 and > 3.0 cm ) , tumor location ( upper , middle , and lower ) , differentiation ( well , moderate , and poor ) , vessel invasion ( negative and positive ) , t stage ( t1 , t2 , t3 , and t4a ) , n stage ( n0 , n1 , n2 , and n3 ) , and adjuvant therapy . patients were followed up at our outpatient department every 3 to 6 months for the first 2 years , then annually . as this series described the prognosis of patients with escc , therefore , a cancer - specific survival ( css ) was ascertained in the current study . chi - squared tests were used to determine the significance of differences for patients grouped by lc as a dichotomous variable . receiver operating characteristic ( roc ) curve was also plotted to verify the accuracy of lc for css prediction ( survival vs death ) . the area under curve ( auc ) was used as an estimation of diagnostic accuracy . a p - value less than 0.05 was considered to be statistically significant chi - squared tests were used to determine the significance of differences for patients grouped by lc as a dichotomous variable . receiver operating characteristic ( roc ) curve was also plotted to verify the accuracy of lc for css prediction ( survival vs death ) . the area under curve ( auc ) was used as an estimation of diagnostic accuracy . a p - value less than 0.05 was considered to be statistically significant . < 1.0 giga / l ) was ( 51/307 ) 16.6% in our study . as a continuous variable , lower lc correlated with n stage ( p = 0.001 ) . as a dichotomous variable , lymphopenia ( lc < 1.0 giga / l ) was also associated with n stage ( p = 0.038 ) ( table 1 ) . comparison of baseline clinical characteristics based on lc the histogram of the lc ( range 0.43.7 < 1.0 giga / l ) had a significantly shorter 5-year css ( 21.6% vs 43.8% , p = 0.004 ) ( figure 2 ) . in addition , in our study , there were also significant differences regarding 5-year css in tumor length ( 56.1% vs 34.2% , p < 0.001 ) , vessel invasion ( 44.2% vs 18.4% , p < 0.001 ) , t stage ( 57.7% vs 31.0% , p < 0.001 ) , and n stage ( 59.0% vs 19.2% , p however , no significant difference was found regarding 5-year css in adjuvant therapy ( 40.8% vs 38.5% , meier css curves stratified by lc . patients with lymphopenia had a significantly shorter 5-year css ( 21.6% vs 43.8% , p = 0.004 ) . hlc = high lymphocyte count , llc = low lymphocyte count , m = month . univariate and multivariate analyses of css in escc patients for assessing the confounding effect of lc on t stage ( t12 vs t34a ) and n stage ( n0 vs n13 ) , we further stratified patients into different groups regarding t stage and n stage . the 5-year css of patients with lc < 1.0 giga / l was shorter than that of patients with lc 1.0 giga / l in t12 group ( 26.1% vs 66.7% , p = 0.001 ) and t34a group ( 17.9% vs 33.1% , p = 0.043 ) , respectively ( figure 3a and b ) . however , as shown in figure 3c and d , no significant differences were found in n0 ( 45.0% vs 61.0% , p = 0.208 ) and n13 ( 6.5% vs 22.6% , p = 0.094 ) between patients with and without lymphopenia . the 5-year css of patients with lc < 1.0 giga / l was shorter than that of patients with lc 1.0 giga / l in t12 group ( 26.1% vs 66.7% , p = 0.001 , [ a ] ) and t34a group ( 17.9% vs 33.1% , p = 0.043 , [ b ] ) , respectively . however , no significant differences were found in n0 ( 45.0% vs 61.0% , p = 0.208 , [ c ] ) and n13 ( 6.5% vs 22.6% , p = 0.094 , [ d ] ) between patients with and without lymphopenia . hlc = high lymphocyte count , llc = low lymphocyte count , m = month . by univariate analysis , we found that tumor length , vessel invasion , t stage , n stage , and lc had significant associations with css ( table 2 ) . then all of the 5 variables above were included in a multivariate cox proportional hazards model to adjust the effects of covariates . in multivariable analysis , we demonstrated that t stage ( hazard ratio [ hr ] = 1.499 , 95% confidence interval [ ci ] 1.0152.214 , p = 0.042 ) , n stage ( hr = 2.534 , 95% ci 1.8143.540 , p < 0.001 ) and lymphopenia ( hr = 1.579 , 95% ci 1.1002.265 , p = 0.013 ) were independent prognostic factors in patients with escc ( table 2 ) . giga / l ) had an hr of 1.579 ( 95% ci : 1.1002.265 ) for css . however , the magnitudes of effect for tumor length ( p = 0.284 ) and vessel invasion ( p = 0.340 ) were reduced between the univariate and multivariate analysis . the auc was 0.699 ( 95% ci : 0.6390.759 , p < 0.001 ) . < 1.0 giga / l ) predicts survival with a sensitivity of 86.2% and a specificity of 27.2% ( figure 4 ) . a roc curve plots the sensitivity on the y - axis against one minus the specificity on the x - axis . a diagonal line at 45 , known as the line of chance , would result from a test , which allocated subjects randomly . the area under curve ( auc ) was used as an estimation of diagnostic accuracy . < 1.0 giga / l ) predicts survival with a sensitivity of 86.2% and a specificity of 27.2% . to the best of our knowledge , this is the first study to determine the prognostic value of lymphopenia ( lc < 1.0 giga / l ) in predicting postoperative survival in patients with escc . patients with lymphopenia had a significantly shorter 5-year css ( 21.6% vs 43.8% , p = 0.004 ) . multivariate analysis demonstrated that lymphopenia is a significant predictor of css . patients with lc < 1.0 giga / l had an hr of 1.579 ( 95% ci : 1.1002.265 , p = 0.013 ) for css . there is strong linkage between inflammation and cancer . in our study , we analyzed the prognostic role of lymphopenia in escc patients without neoadjuvant treatment mainly because neoadjuvant therapy ( chemotherapy and/or radiation ) will have an important impact on the inflammation . therefore , we initially evaluated the usefulness of lymphopenia for predicting postoperative survival in patients with escc . this observation is in line with data from saroha et al , but is contrary to the result of mehrazin et al , who suggested that lymphopenia is not correlation with the n stage ( p = 0.120 ) . furthermore , our study showed that patients with lymphopenia had a significantly shorter 5-year css ( 21.6% vs 43.8% , p = 0.004 ) . on multivariate analysis , lymphopenia was a significant predictive factor of css ( p = 0.013 ) . it is widely agreed that t stage and n stage are strong , independent prognostic factors in ec . in our study , we also demonstrated that t stage ( p = 0.042 ) and n stage ( p < 0.001 ) were independent prognostic factors . for assessing the confounding effect of lc on t stage ( t12 vs t34a ) and n stage ( n0 vs n13 ) , we further stratified patients into different groups regarding t stage and n stage . in our study , the predictive value of lymphopenia was significant in patients with t stages , but not significant in patients with n stages . our results clearly demonstrated that lymphopenia can serve as an independent predictor of long - term survival for escc patients , especially in t stages . several studies have demonstrated that tumor length was related to prognosis but was not an independent prognostic factor in patients with ec . eloubeidi et al , yendamuri et al , and feng et al , however , showed that tumor length was a prognostic indictor of ec . zafirellis et al showed that vessel invasion was an independent prognostic indicator in patients with ec . their results demonstrated that vessel invasion was not an independent prognostic factor in patients with ec . in our study , tumor length and vessel invasion related to prognosis but were not independent prognostic factor in patients with escc . since the magnitudes of effect for tumor length and vessel invasion are reduced between the univariate and multivariate analysis and they loss statistical significance , we can suggest that the impact of tumor length and vessel invasion on css are confounded by the other variables in the model . in addition , there is strong evidence to recommend multimodal treatments with adjuvant chemoradiotherapy followed by surgery for patients with resectable locally advanced cancers . resectable locally advanced ec refers to t3t4a or n13 and early stage ec refers to t12 or n0 according to the 7th edition of the ajcc . recent studies have demonstrated that postoperative adjuvant chemoradiotherapy significantly improves the long - term survival of patients with ec compared with surgery alone . however , no significant difference was found regarding 5-year css in adjuvant therapy in our study ( 40.8% vs 38.5% , p = 0.458 ) . two possible reasons were as follows : firstly , the postoperative adjuvant chemoradiotherapy was not mandatory in our study . secondly , although adjuvant therapy was followed by surgery , the survival of locally advanced ec was poor . the potential limitations of the present study include the use of a retrospective analysis and the short duration of the mean follow - up . furthermore , in our study , we excluded patients who had received neoadjuvant treatment ( chemotherapy and/or radiotherapy ) , which may have influenced the result . on the one hand , chemotherapy and/or radiation will have a side effect on blood cells , including lc . on the other hand , recent studies revealed that chemotherapy and/or radiotherapy could improve survival before surgery for locally advanced ec , but not for early stage ec . in addition , our study revealed that lymphopenia is an independent predictive factor in patients with escc , however , it should be kept in mind that lymphopenia itself alone without other variables may not associate with postoperative survival in patients with escc . although we adopted rigorous inclusion and exclusion criteria , it was shown that diabetes mellitus , renal and/or hepatic failure , and many inflammatory diseases may potentially affect the lymphocytes . in addition , we excluded patients with previous anti - inflammatory , however , anti - diabetic , anti - hypertensive drug , and/or other medications may potentially affect the lc . therefore , larger prospective studies will need to be performed to confirm these preliminary results . in conclusion < 1.0 giga / l ) is associated with prognosis and can be considered as an independent marker of prognosis in patients with escc . however | abstractlymphopenia is a useful predictive factor in several cancers .
the aim of this study was to determine the prognostic value of lymphopenia in patients with esophageal squamous cell carcinoma ( escc).a retrospective analysis of 307 consecutive patients who had undergone esophagectomy for escc was conducted . in our study , a lymphocyte count ( lc ) of fewer than 1.0 giga / l was defined as lymphopenia .
kaplan
meier method was used to calculate the cancer - specific survival ( css ) .
cox regression analyses were performed to evaluate the prognostic factors .
receiver operating characteristic ( roc ) curve was also plotted to verify the accuracy of lc for css prediction.the mean lc was 1.55 0.64 giga / l ( range 0.43.7 giga / l ) .
the incidence of lymphopenia ( lc
< 1.0 giga / l ) was 16.6% ( 51/307 ) .
patients with lymphopenia ( lc
< 1.0 giga / l ) had a significantly shorter 5-year css ( 21.6% vs 43.8% , p = 0.004 ) . on multivariate analysis , lymphopenia ( lc < 1.0
giga / l ) was an independent prognostic factor in patients with escc ( p = 0.013 ) .
lymphopenia had a hazard ratio ( hr ) of 1.579 [ 95% confidence interval ( ci ) : 1.1002.265 ] for css .
roc curve demonstrated that lymphopenia ( lc
< 1.0 giga / l ) predicts survival with a sensitivity of 86.2% and a specificity of 27.2%.lymphopenia ( lc
< 1.0 giga / l ) is still an independent predictive factor for long - term survival in patients with escc . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in this single - center , double - blind , placebo - controlled phase 2 pilot trial , eligible women were randomized 1:1 to either 10 g tx-004hr vaginal e2 softgel capsules or matching placebo vaginal softgel capsules ( therapeuticsmd ) administered intravaginally once - daily for 14 days . a reproducible , computer - generated block randomization schedule ( produced in sas v. 9.1.3 , plan procedure ) was used to randomize the women to the study groups . biostudy solutions , llc generated the assignment codes , which were locked in a room with restricted access . the packaging , labeling , appearance , and route of administration of tx-004hr and placebo were identical , and all persons participating in the study were blinded to the treatment each woman received . the blind was maintained until study completion . on day 1 , participants completed a questionnaire that assessed vva symptoms and specified their most bothersome symptom ( mbs ) , and the investigator assessed the appearance of the vaginal mucosa ( secretions , color , epithelial integrity , and epithelial surface thickness ; see table 1 ) . women self - administered their first dose of study medication at the clinical site under supervision , and capsule disintegration was assessed after 6 hours . during screening , vaginal smears were collected to evaluate vaginal ph and cytology ( vaginal maturation index [ vmi ] ) . participants were provided with a diary and instructed to record dosing dates and times for the 2-week study period . on day 15 , vva symptoms ( participant assessment via questionnaire ) , vaginal mucosa , cytology , ph , and capsule disintegration ( investigator assessment ) were evaluated . diaries were collected and adverse events ( aes ) were assessed on days 8 and 15 . e2 levels were tested during screening at a local laboratory using a lower limit of quantification of less than 10 pg / ml . an independent institutional review board approved the protocol , and participants provided written informed consent before any study - related activities . the trial was conducted in accordance with good clinical practices , us federal regulations , and the declaration of helsinki regarding treatment of human participants in a study . postmenopausal women ( 40 - 75 y of age ) were enrolled if they had a body mass index less than or equal to 34 kg / m ; less than or equal to 5% superficial cells on vaginal smear cytology ; a vaginal ph more than 5.0 ; an e2 level less than or equal to 50 pg / ml ; and at least one of the following symptoms of vva with a moderate - to - severe severity score : vaginal dryness , vaginal pain associated with sexual activity , vaginal and/or vulvar irritation / itching , dysuria , or vaginal bleeding associated with sexual activity . women were excluded if they had a current or prior medical condition considered clinically significant , undiagnosed vaginal bleeding , or a current vaginal infection requiring treatment ; had a contraindication to estrogen therapy ( et ) or an allergy to e2 ; smoked at least 15 cigarettes per day ; or had substance abuse in the past year . participants could not have taken any prescription or over - the - counter drug that might interact with e2 therapy within 28 days of screening , or used progestogen implants , vaginal or injectable et , or vaginal or injectable estrogen - progestin therapy ( ept ) within the past 3 months ; transdermal et or ept or et lotions or gels within the past 8 weeks ; or estrogen pellets or injectable progestogen therapy within the past 6 months . efficacy endpoints were based on the fda 's guidance , and included change from baseline ( screening ) to day 15 in the percentage of parabasal vaginal cells , percentage of superficial vaginal cells , and percentage of intermediate vaginal cells ; in vaginal ph ; and change from baseline ( randomization ) to day 15 in self - assessed severity of most bothersome vva symptom ( mbs ) . the range of mbs severity scores was 0 ( none ) to 3 ( severe ) . endpoints also included change from baseline to day 15 in investigator assessment of the vaginal mucosa ( secretions , epithelial integrity , epithelial surface thickness , and color ) . the severity scale ranged from 0 to 3 , with 0 indicating no atrophy and 3 indicating severe atrophy . safety endpoints included changes in vital signs , weight , results of a physical examination ( including breast and pelvic examination ) , and aes . a sample size of 50 ( 25 women per treatment arm ) was considered adequate to estimate the magnitude and variability of efficacy measures needed to determine sample size for a future phase 3 trial . a p value of 0.05 was considered statistically significant , with the exception that confidence intervals were based on an alpha level of 0.10 ( ie , 90% ci ) . for all comparisons except severity of the mbs and investigator assessments of the vaginal mucosa , the change from baseline values was evaluated using ancova with baseline as the covariate , to analyze the differences between the tx-004hr vaginal e2 softgel capsules and placebo groups . in this single - center , double - blind , placebo - controlled phase 2 pilot trial , eligible women were randomized 1:1 to either 10 g tx-004hr vaginal e2 softgel capsules or matching placebo vaginal softgel capsules ( therapeuticsmd ) administered intravaginally once - daily for 14 days . a reproducible , computer - generated block randomization schedule ( produced in sas v. 9.1.3 , plan procedure ) was used to randomize the women to the study groups . biostudy solutions , llc generated the assignment codes , which were locked in a room with restricted access . the packaging , labeling , appearance , and route of administration of tx-004hr and placebo were identical , and all persons participating in the study were blinded to the treatment each woman received . the blind was maintained until study completion . on day 1 , participants completed a questionnaire that assessed vva symptoms and specified their most bothersome symptom ( mbs ) , and the investigator assessed the appearance of the vaginal mucosa ( secretions , color , epithelial integrity , and epithelial surface thickness ; see table 1 ) . women self - administered their first dose of study medication at the clinical site under supervision , and capsule disintegration was assessed after 6 hours . during screening , vaginal smears were collected to evaluate vaginal ph and cytology ( vaginal maturation index [ vmi ] ) . participants were provided with a diary and instructed to record dosing dates and times for the 2-week study period . on day 15 , vva symptoms ( participant assessment via questionnaire ) , vaginal mucosa , cytology , ph , and capsule disintegration ( investigator assessment ) were evaluated . diaries were collected and adverse events ( aes ) were assessed on days 8 and 15 . e2 levels were tested during screening at a local laboratory using a lower limit of quantification of less than 10 pg / ml . an independent institutional review board approved the protocol , and participants provided written informed consent before any study - related activities . the trial was conducted in accordance with good clinical practices , us federal regulations , and the declaration of helsinki regarding treatment of human participants in a study . postmenopausal women ( 40 - 75 y of age ) were enrolled if they had a body mass index less than or equal to 34 kg / m ; less than or equal to 5% superficial cells on vaginal smear cytology ; a vaginal ph more than 5.0 ; an e2 level less than or equal to 50 pg / ml ; and at least one of the following symptoms of vva with a moderate - to - severe severity score : vaginal dryness , vaginal pain associated with sexual activity , vaginal and/or vulvar irritation / itching , dysuria , or vaginal bleeding associated with sexual activity . women were excluded if they had a current or prior medical condition considered clinically significant , undiagnosed vaginal bleeding , or a current vaginal infection requiring treatment ; had a contraindication to estrogen therapy ( et ) or an allergy to e2 ; smoked at least 15 cigarettes per day ; or had substance abuse in the past year . participants could not have taken any prescription or over - the - counter drug that might interact with e2 therapy within 28 days of screening , or used progestogen implants , vaginal or injectable et , or vaginal or injectable estrogen - progestin therapy ( ept ) within the past 3 months ; transdermal et or ept or et lotions or gels within the past 8 weeks ; or estrogen pellets or injectable progestogen therapy within the past 6 months . efficacy endpoints were based on the fda 's guidance , and included change from baseline ( screening ) to day 15 in the percentage of parabasal vaginal cells , percentage of superficial vaginal cells , and percentage of intermediate vaginal cells ; in vaginal ph ; and change from baseline ( randomization ) to day 15 in self - assessed severity of most bothersome vva symptom ( mbs ) . the range of mbs severity scores was 0 ( none ) to 3 ( severe ) . endpoints also included change from baseline to day 15 in investigator assessment of the vaginal mucosa ( secretions , epithelial integrity , epithelial surface thickness , and color ) . the severity scale ranged from 0 to 3 , with 0 indicating no atrophy and 3 indicating severe atrophy . safety endpoints included changes in vital signs , weight , results of a physical examination ( including breast and pelvic examination ) , and aes . a sample size of 50 ( 25 women per treatment arm ) was considered adequate to estimate the magnitude and variability of efficacy measures needed to determine sample size for a future phase 3 trial . a p value of 0.05 was considered statistically significant , with the exception that confidence intervals were based on an alpha level of 0.10 ( ie , 90% ci ) . for all comparisons except severity of the mbs and investigator assessments of the vaginal mucosa , the change from baseline values was evaluated using ancova with baseline as the covariate , to analyze the differences between the tx-004hr vaginal e2 softgel capsules and placebo groups . fifty postmenopausal women were enrolled in the study and randomized to either tx-004hr vaginal e2 softgel capsule ( n = 24 ) or placebo ( n = 26 ) . two women in the placebo group discontinued treatment ; one was due to an ae ( vulvovaginal discomfort ) and the other withdrew consent . overall , participant demographics and baseline characteristics were not statistically different between the treatment groups ( table 1 ) . fifty postmenopausal women were enrolled in the study and randomized to either tx-004hr vaginal e2 softgel capsule ( n = 24 ) or placebo ( n = 26 ) . two women in the placebo group discontinued treatment ; one was due to an ae ( vulvovaginal discomfort ) and the other withdrew consent . overall , participant demographics and baseline characteristics were not statistically different between the treatment groups ( table 1 ) . the prevalence of superficial cells increased from baseline by 35.2 percentage points with tx-004hr at day 15 . this increase was significantly greater than the increase seen with placebo of 8.75 percentage points ( p = 0.0002 ; fig . the change from baseline to day 15 in the percentage of intermediate cells also increased more with tx-004hr vaginal softgel capsules ( 18.7 percentage points ) compared with placebo ( 3.54 percentage points ; p = 0.0017 ; fig . , the prevalence of parabasal cells showed a significantly greater decrease from baseline to day 15 with tx-004hr than with placebo ( 54.4 percentage points vs 4.80 percentage points ; p < 0.0001 ; fig . changes from baseline in the maturation index of the vaginal smear ( least squares [ ls ] means and standard errors [ se ] ) . p values represent significant differences in ls mean change from baseline to day 15 between the vaginal e2 softgel capsule and placebo using ancova with treatment as a fixed effect and baseline as a covariate . vaginal ph decreased significantly more from baseline to day 15 with tx-004hr ( 0.974 ) than with placebo ( 0.339 ; p = 0.0002 ) . overall , no significant difference in the decrease from baseline in severity of the mbs between treatments was found ( 1.043 vs 1.042 for tx-004hr vs placebo , respectively ; p = 0.9951 ) . although no statistical difference between groups was found , the individual symptoms of dryness and dyspareunia decreased in severity by approximately 1.0 and 0.8 points versus approximately 0.7 points and 0.5 points for the e2 softgel capsules and placebo , respectively . greater mean decreases from baseline were observed with vaginal epithelial integrity ( 0.342 vs 0.176 ; p = 0.0001 ) and vaginal secretions ( 0.643 vs 0.274 ; p = 0.0401 ) in the tx-004hr vaginal e2 softgel capsules group compared with the placebo group ( fig . no significant differences from baseline were observed for vaginal color or epithelial surface thickness between treatments . investigator 's assessment of the mucosal epithelium ( least squares [ ls ] means and standard errors [ se ] ) . p values represent significant differences in ls mean change from baseline to day 15 between the vaginal e2 softgel capsule and placebo using ancova with treatment as a fixed effect and baseline as a covariate . atrophy subjectively assessed as 0 = none , 1 = mild , 2 = moderate , and 3 = severe . the prevalence of superficial cells increased from baseline by 35.2 percentage points with tx-004hr at day 15 . this increase was significantly greater than the increase seen with placebo of 8.75 percentage points ( p = 0.0002 ; fig . the change from baseline to day 15 in the percentage of intermediate cells also increased more with tx-004hr vaginal softgel capsules ( 18.7 percentage points ) compared with placebo ( 3.54 percentage points ; p = 0.0017 ; fig . , the prevalence of parabasal cells showed a significantly greater decrease from baseline to day 15 with tx-004hr than with placebo ( 54.4 percentage points vs 4.80 percentage points ; p < 0.0001 ; fig . changes from baseline in the maturation index of the vaginal smear ( least squares [ ls ] means and standard errors [ se ] ) . p values represent significant differences in ls mean change from baseline to day 15 between the vaginal e2 softgel capsule and placebo using ancova with treatment as a fixed effect and baseline as a covariate . vaginal ph decreased significantly more from baseline to day 15 with tx-004hr ( 0.974 ) than with placebo ( 0.339 ; p = 0.0002 ) . overall , no significant difference in the decrease from baseline in severity of the mbs between treatments was found ( 1.043 vs 1.042 for tx-004hr vs placebo , respectively ; p = 0.9951 ) . although no statistical difference between groups was found , the individual symptoms of dryness and dyspareunia decreased in severity by approximately 1.0 and 0.8 points versus approximately 0.7 points and 0.5 points for the e2 softgel capsules and placebo , respectively . greater mean decreases from baseline were observed with vaginal epithelial integrity ( 0.342 vs 0.176 ; p = 0.0001 ) and vaginal secretions ( 0.643 vs 0.274 ; p = 0.0401 ) in the tx-004hr vaginal e2 softgel capsules group compared with the placebo group ( fig . no significant differences from baseline were observed for vaginal color or epithelial surface thickness between treatments . investigator 's assessment of the mucosal epithelium ( least squares [ ls ] means and standard errors [ se ] ) . p values represent significant differences in ls mean change from baseline to day 15 between the vaginal e2 softgel capsule and placebo using ancova with treatment as a fixed effect and baseline as a covariate . atrophy subjectively assessed as 0 = none , 1 = mild , 2 = moderate , and 3 = severe . over the 14-day study period , a total of 14 ( 28% ) women experienced 17 aes ( 13 aes in the tx-004hr vaginal e2 softgel group and 4 aes in the placebo group ) . all aes were mild in severity , no serious aes were reported , and no deaths occurred during the study . this phase 2 study showed that tx-004hr , a novel , solubilized e2 vaginal softgel capsule , was better than placebo in improving the vmi , reducing vaginal ph , and reducing atrophic effects on epithelial integrity and vaginal secretions . in addition , treatment with tx-004hr was safe and well tolerated when administered intravaginally once daily for 14 days . also , as demonstrated in phase 1 pharmacokinetic studies , systemic estrogen levels with tx-004hr were two to three times lower than with an approved vaginal e2 tablet at equivalent doses . thus , this new vaginal e2 softgel capsule is effective at treating the signs of vva with low systemic estrogen levels . furthermore , the results of a survey of the women participating in this study indicate that the majority of women thought the capsule was easy to use , were satisfied with the product , and would consider using the treatment again . the significant improvements in the signs of vva that this study found with the tx-004hr vaginal e2 softgel capsule were clinically meaningful . the efficacy observed with tx-004hr at week 2 with objective markers ( ie , changes in vmi ) in our study seems to be superior to historical data reported with the vaginal e2 tablet at the same dose ( 10 g e2 ) . in a 52-week , multicenter , double - blind study ( n = 309 ) , improvements were observed from baseline after 2 weeks of daily administration of a 10-g e2 tablet that were significantly better than with placebo . the increase in the percentage of superficial cells at 2 weeks was significantly greater than placebo , but was less than the improvement seen in this study in which superficial cells increased to 37% after 2 weeks of treatment . the significant improvements seen in our pilot phase 2 study in all components of the vmi , in ph , and in observations of vaginal epithelial integrity and secretions are an important indication of potential improvements in symptoms of vva . the vmi and ph are the most useful objective markers of vaginal atrophy due to estrogen decline . visual assessments of the vaginal mucosa have been shown to correlate with the objective measures and , thus , are an additional validation of the diagnosis of vva and of the monitoring of effects of treatment on vva . significant improvements in vmi , ph , and the vaginal examination ( vaginal epithelial integrity and vaginal secretions ) were observed within 2 weeks . with a longer duration of treatment and follow - up , and a larger sample size no major or unexpected safety concerns were observed with tx-004hr vaginal e2 softgel capsule treatment during the study period . this is consistent with the favorable safety profiles of other low - dose vaginal estrogen therapies that have been previously reported . the testing of the safety and efficacy of tx-004hr vaginal e2 softgel capsules is currently being expanded in the phase 3 rejoice trial . three doses are being tested ( 25 g , 10 g , and an ultra - low - dose of 4 g ) with additional outcome measures . primary outcome measures include change from baseline in vmi , vaginal ph , and the severity of dyspareunia as mbs after 12 weeks . secondary outcome measures include change from baseline in the severity of vaginal dryness and vaginal burning ; appearance of the vaginal mucosa at 2 , 6 , 8 , and 12 weeks ; change from baseline in female sexual function index at 12 weeks ; and hormone concentration assessments at pretreatment , day 1 , and weeks 2 and 12 . the results of this study suggest that tx-004hr vaginal e2 softgel capsules are a safe , effective , local , novel treatment option for postmenopausal women with moderate - to - severe vva . improvements in vaginal cytology and ph from baseline at week 2 were significantly higher with tx-004hr than with placebo . these improvements on vaginal cell physiology seem to be superior to other vaginal therapies based on historical data . the clinical evidence presented here , coupled with favorable pharmacokinetic results showing two to three times lower systemic exposure of e2 than an approved vaginal e2 tablet at the same dose , along with positive satisfaction survey results , is promising and has helped to frame the design of a larger phase 3 trial to further evaluate the safety and clinical efficacy of tx-004hr . if approved , the tx-004hr vaginal e2 softgel capsule would provide a new alternative for women with vva , with better efficacy , earlier onset of action , easier usage , and lower systemic estrogen exposure than currently available options . | abstractobjective : the aim of the study was to evaluate the safety and efficacy of vaginal estradiol ( e2 ) softgel capsules for moderate - to - severe symptoms of vulvar and vaginal atrophy ( vva ) .
previous phase 1 studies showed lower systemic estrogen concentrations with this softgel capsule compared with an approved low - dose vaginal e2 tablet.methods:in this randomized , double - blind , placebo - controlled phase 2 study , 50 postmenopausal women ( aged 40 - 75 y ) with at least1 moderate - to - severe vva symptom received 10 g vaginal e2 softgel capsules or placebo daily for 14 days .
changes from baseline in vaginal maturation index , investigator 's assessment of vaginal mucosa ( secretions , epithelial integrity , epithelial surface thickness , color ) , vaginal ph , and most bothersome symptom were assessed .
adverse events were evaluated.results:compared with placebo , the percentage of superficial ( 35.2 percentage points [ pp ] vs 8.75 pp ; p = 0.0002 ) and intermediate ( 18.7 pp vs 3.54 pp ; p = 0.0017 ) cells increased from baseline significantly more with vaginal e2 capsules , and parabasal cells decreased significantly more ( 54.4 pp vs 4.80 pp ; p < 0.0001 ) .
vaginal ph decreased significantly more with vaginal e2 capsules ( 0.974 vs 0.339 ; p = 0.0002 ) . decreases in severity of atrophic effects on vaginal epithelial integrity ( 0.342 vs 0.176 ; p = 0.0001 ) and secretions ( 0.643 vs 0.274 ; p
= 0.0401 ) were significantly greater with vaginal e2 capsules vs placebo .
there was no statistical difference in most bothersome symptom severity change from baseline .
no serious adverse events were reported.conclusions:vaginal e2 softgel capsules are a safe , effective , local treatment option for postmenopausal women with moderate - to - severe vva , with lower systemic estrogen absorption than currently available intravaginal treatments . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
although tumors of the central nervous system ( cns ) are the most common solid neoplasms of childhood , spinal tumors remain a relatively rare occurrence ( incidence 1 per million ) . pediatric intramedullary spinal cord lesions ( pimscl ) account for 46% of all cns tumors in this age group . studies have highlighted certain differences between the pediatric and the adult intramedullary spinal cord lesions . these include a different histological spectrum of the lesions and a differential outcome to treatment . moreover , a younger age , anesthetic considerations in very young children and deleterious effects of radiotherapy are some of the other concerns peculiar to these patients . keeping above differences in mind , we set out to study the incidence and the frequencies of various pediatric intramedullary mass lesions , their outcome to treatment and the factors determining their outcome to treatment . a literature review is also presented in order to discuss issues pertinent in the evaluation and management of these lesions . thirty - one consecutive children ( aged 118 years , mean 11.1 years , male : female = 1.8:1 ) with pathologically proven intramedullary spinal cord lesions treated at our center between 2007 and 2013 were studied . pimscl constituted 17.4% of intramedullary tumors during this period ( out of total 178 cases ) . the patients without a minimum of 6 months follow - up , incomplete medical records and operated previously at other centers were excluded from this study . preoperatively , all the cases underwent magnetic resonance imaging ( mri ) of the spine ( with cranial screening in some selected cases ) . following the surgical procedure , the functional status was assessed using the modified mccormick grading system [ table 1 ] . data were managed using statistical package for social sciences software version 18.0 ( chicago , il ) . in our series , the extent of resection was classified as follows :
gross total : > 95% excisionsubtotal : 5095% excisionpartial : 1050% excisionbiopsy : < 10% excision . gross total : > 95% excision subtotal : 5095% excision partial : 1050% excision biopsy : < 10% excision . modified mccormick scale the mean age of the children was 11.21 4.78 years ( range : 6 months to 18 years ) . the pain was the most common presenting symptom ( n = 16 , 51.6% ) . neck pain was present in 6 patients ( 19.3% ) , whereas back pain was present in 10 patients ( 32.2% ) . bladder involvement was present in 11 patients ( 35.5% ) , whereas only 6 patients ( 19.4% ) had complaints pertaining to bowel dysfunction . lower cranial nerves were involved in 2 patients ( 6.5% ) and 1 patient had involvement of fifth cranial nerve ( 3.2% ) . table 2 summarizes the demographic and clinical features of the children analyzed in the current study . as far as modified mccormick grades at the time of presentation were concerned , 9.7% ( n = 3 ) were in grade 1 , 12 patients ( 38.7% ) were in grade 2 , 4 patients ( 12.9% ) were in grade 3 , whereas 6 patients each ( 19.4% ) were in grade 4 and grade 5 . the summary of demographic , clinical , and radiological findings of our study the salient imaging findings observed in our series are shown in table 2 . on mri , tumors were located at cervical region ( n = 12 , 38.7% ) , dorsal region ( n = 10 , 32.2% ) , and at lumbar region ( n = 9 , 29% ) in decreasing frequency . 8 out of 12 cervical tumors had cervicomedullary junction involvement . the majority of the patients had long segment involvement ( more than two vertebral segment level ) ( n = 26 , 83.8% ) . of these 26 patients , the majority was constituted by astrocytomas ( n = 9 ) followed by ependymoma ( n = 6 ) . other tumors with multisegmental involvement were epidermoid ( n = 6 ) , dermoid ( n = 2 ) , and one case each of hemangioblastoma , neuroenteric cyst , and tuberculoma . average segment involved in astrocytoma was 5.7 , in ependymoma was 3.8 , and in case of epidermoid was 4 . nine out of 10 astrocytomas and 6 out of 7 ependymomas had long segment disease . this patient was a 13-year - old boy and he had one lesion at c7-d1 and another lesion was located at l4-s2 , between the cauda equina roots as shown in figure 1a c . this 13-year - old boy presented with two concurrent lesions at cervical ( c7-d1 ) ( a ) and lumbar region ( l4-s2 ) ( b and c ) gross total tumor excision was performed in 19 patients ( 61.3% ) , subtotal in 9 patients ( 29% ) , partial excision was performed in 2 ( 6.5% ) patient , and the only biopsy was performed in 1 patient ( 6.5% ) . subtotal excisions were performed in 4 cases of astrocytoma , 2 cases of tuberculoma , and one case each of long segment cervical grade 2 ependymoma , epidermoid , and cervical neuroenteric cyst , respectively . in cases of astrocytoma , a poor plane of cleavage prevented us from attempting total excision . in the patient with neuro enteric cyst spanning from the cervicomedullary junction to c7 level , the intramedullary lipoma at its caudal end was subtotally excised as it was inseparably adherent to the cord substance . in patients with tuberculoma , subtotal internal decompression was done deliberately leaving the capsule behind in order to avoid damaging the normal cord substance around the lesion . the patient with grade 2 ependymoma at d1-d5 level had a poor plane of cleavage inferiorly , which was deliberately left behind . both patients undergoing partial excisions had astrocytomas . both of them had long segment lesions extending from the cervicomedullary junction to the cervicodorsal region . tumor biopsy without even decompression had to be done in one case of a long segment astrocytoma extending from the cervicomedullary junction to d6 level . this patient had poor functional grade preoperatively and his respiration was also severely compromised . during surgery on histopathological analysis , the majority of our patients ( n = 17 , 54.8% ) had gliomatous tumors . of these 17 patients , 10 patients had astrocytoma ( 32.2% ) and 7 patients had ependymoma ( 22.6% ) . developmental tumors were seen in 11 patients ( 35.4% ) and included epidermoid ( n = 7 , 22.6% ) , dermoid ( n = 2 , 6.5% ) , lipoma and neuroenteric cyst ( n = 1 , 3.2% ) each , respectively . other lesions encountered were hemagioblastoma ( n = 1 , 3.2% ) , tuberculoma ( n = 2 , 6.5% ) . histopathological diagnoses in the present series of great interest was that the histopathological spectrum of the lesions in the first decade of life was different from those in the second decade . in the first decade , out of 11 patients , developmental tumors accounted for majority ( n = 6 ) ( epidermoid = 3 , dermoid = 1 , neuroenteric cyst = 1 , lipoma = 1 ) followed by astrocytomas ( n = 3 ) and tuberculoma ( n = 2 ) . on the other hand , 14 out of 20 children in the second decade had gliomatous tumors ( astrocytomas 7 , ependymomas 7 ) . other tumors in the second decade were epidermoid ( n = 4 ) , hemangioblastoma ( n = 1 ) , and dermoid ( n = 1 ) . hence , gliomatous tumors predominated in the second decade as against developmental tumors in the first . this patient was a 6-year - old boy with pilocytic astrocytoma extending from c1 to d6 . other complications , apart from surgical mortality included wound related complications ( n = 4 ) , transient deterioration in the motor power , and respiratory complication requiring a tracheostomy . wound related complications included wound infection , cerebrospinal fluid ( csf ) leakage ( 1 patient each , 3.2% ) , and wound bulge in 3 patients ( 9.7% ) . transient postoperative deterioration in the motor power was seen in 15 ( 48.4% ) patients . both patients were discharged on tracheostomy and in both the cases , stoma was successfully closed later . both radiotherapy and chemotherapy were given in one 16-year - old boy , a case of anaplastic ependymoma at the d4-d8 region . he received 4 cycles of procarbazine , ccnu , and vincristine ( pcv ) regimen . another 15-year - old girl with anaplastic ependymoma ( who grade 3 ) at d10-d11 level underwent radiotherapy and chemotherapy ( 4 cycles of pcv ) after excision of the recurrence . the mean follow - up was 26.5 months ( range : 6 - 80 months ) . improvement in bladder function was seen in 5 ( 45.4% ) patients while bowel symptoms improved in 2 ( 33.3% ) patients . after treatment , the distribution based on mccormick functional grading changed as follows : 8/31 ( 25.8% ) grade 1 , 7/31 ( 22.6% ) grade 2 , 6/31 ( 19.4% ) grade 3 , 4/31 ( 12.9% ) grade 4 , and 6/31 ( 19.4% ) grade 5 . figure 2 shows the pre- and post - operative modified mccormick grades . in terms of modified mccormick grade , two out of 12 poor grade patients improved to a good grade , 1 patient died , whereas 9 patients remained in poor grade even after surgery . those who improved were in grade 4 preoperatively . hence , children who were in poor preoperative grade hardly improved after surgery , this particularly applied to grade 5 . histopathological analysis of the patients with poor functional outcome showed 3 cases each of low - grade astrocytomas and ependymoma , 2 cases of epidermoids , 1 case each of glioblastoma , dermoid , and tuberculoma . hence , histopathologically , gliomatous tumors and infiltrative lesions had a tendency to present in a poor grade , and they hardly improved even after surgery . bar diagram is showing the distribution of patients as per modified mccormick grades pre- and post - operatively we looked at the duration of symptoms prior to surgery in patients who had a poor postoperative outcome . the mean duration of symptoms was 16.8 months as compared to 16.9 months of patients belonging to good grade . hence , the duration of preoperative symptoms did not correlate with poor outcome after surgery . disease progression was present in 6 patients ( 19.35% ) . these were epidermoid cyst ( n = 2 ) , anaplastic ependymoma ( n = 1 ) , grade 2 ependymoma ( n = 1 ) , dermoid ( n = 1 ) , and grade 1 astrocytoma ( n = 1 ) . 5 out of these 6 patients had total excision barring the subtotally excised grade 2 ependymoma . five out of these 6 patients underwent re - surgery . hence , developmental tumors , high - grade ependymomas , and incompletely excised grade 2 ependymomas showed a tendency to recur . a patient with anaplastic ependymoma at d4-d8 region underwent radio - chemotherapy after subtotal surgical excision . after 4 cycles of chemotherapy regimen , the patient developed diarrhea , respiratory distress with mental obtundation , and hypotension during the treatment and succumbed to the illness . another patient of cervical glioblastoma from the cervicomedullary junction to c6 vertebra died after 1-year of follow - up having completed his radiotherapy . a 16-year - old boy presented with gradually progressive spastic quadriparesis with neck pain of 8 months duration . on examination , there was the presence of wasting at right shoulder region with spasticity ( grade 3 ) in remaining muscle groups of both upper and lower limbs . , there was a large intramedullary mass lesion extending from c1 to c6 level , the mass was ill - defined , causing and widening of the spinal cord . the lesion was hypointense on t1 and hyperintense on t2 with heterogenous contrast enhancement [ figure 3a e ] . t1- and t2-weighted images sagittal section ( a and b ) is showing the presence of an intramedullary mass lesion from c1 to c6 causing expansion of spinal cord . postoperative image ( e ) subtotal excision of tumor at surgery ( suboccipital craniectomy with c1-c6 laminectomy ) , the tumor was ill - defined , grayish pink in color , soft , suckable , and highly vascular . maximal possible tumor excision was performed ; however , the postoperative image showed some residual tumor that was missed during surgery [ figure 3f ] . although the patient required postoperative ventilatory support for 24 h , otherwise his immediate postoperative period was uneventful . he received a postoperative adjuvant full course of radiotherapy a total dose of 5400 gy in 30 divided fractions . he was also advised chemotherapy but because of financial constraints , chemotherapy could not be completed . a 16-year - old boy presented with gradually progressive spastic quadriparesis with neck pain of 8 months duration . on examination , there was the presence of wasting at right shoulder region with spasticity ( grade 3 ) in remaining muscle groups of both upper and lower limbs . preoperative modified mccormick grade was 4/5 . on imaging , there was a large intramedullary mass lesion extending from c1 to c6 level , the mass was ill - defined , causing and widening of the spinal cord . the lesion was hypointense on t1 and hyperintense on t2 with heterogenous contrast enhancement [ figure 3a e ] . t1- and t2-weighted images sagittal section ( a and b ) is showing the presence of an intramedullary mass lesion from c1 to c6 causing expansion of spinal cord . postoperative image ( e ) subtotal excision of tumor at surgery ( suboccipital craniectomy with c1-c6 laminectomy ) , the tumor was ill - defined , grayish pink in color , soft , suckable , and highly vascular . maximal possible tumor excision was performed ; however , the postoperative image showed some residual tumor that was missed during surgery [ figure 3f ] . although the patient required postoperative ventilatory support for 24 h , otherwise his immediate postoperative period was uneventful . he received a postoperative adjuvant full course of radiotherapy a total dose of 5400 gy in 30 divided fractions . he was also advised chemotherapy but because of financial constraints , chemotherapy could not be completed . unacceptable morbidity , these tumors were earlier treated with biopsy only or at the most , minimal decompression which was followed by adjuvant therapy . in addition , these tumors were earlier excised in stages , wherein a dorsal myelotomy was done in the first stage in the hope that the tumor will self - extrude under pressure and this extruded tumor was then removed at a later stage . however , recent times have seen a vast change in the way these lesions are managed . advances in neuroimaging , microsurgical techniques as well as development of various surgical adjuncts such as laser , cavitron ultrasonic surgical aspirator ( cusa ) , and intraoperative monitoring have made radical excisions of these lesions not only feasible but also reasonably safe . furthermore , numerous studies have questioned the utility of adjuvant therapy in neoplastic spinal lesions . hence , we have come a long way as far as the treatment of the intramedullary lesions is concerned . pimsct are rare and account for no more than 46% of cns tumors in children ( the incidence of pimsct in our series , however , was a notch higher ( 17.4% ) . this could reflect a geographical variation or a referral bias as these tumors are often referred to the higher centers for surgery . while developmental tumors and inflammatory lesions predominated in the first decade , astrocytomas and ependymomas accounted for a majority in the second decade . this difference in the spectrum could indicate different pathogenetic mechanisms underlying the development of these lesions at different age groups . ependymomas have a lower incidence as compared to astrocytomas , as seen in the present study ( 32.2% vs. 22.6% ) . ependymomas tend to increase in frequency with increasing age . a recent study by constantini et al . failed to find even a single case of ependymoma in patients <3 years of age . in our series , the pain was the most common presenting symptom and weakness was the most common sign . more than one - third of the patients presented with bladder complaints . this commensurated with the findings reported previously by others . as far as the preoperative functional status was concerned , the majority of the children ( n = 19 , 62.3% ) presented in good grades . this was in spite of the fact that most of them presented late for treatment ( mean duration of symptom = 16.5 months ) . this indicates that the disease process was very slow and children tended to have a good neurological reserve . this assumes a special importance in that , although an early surgery is desirable , no matter how late the patient presents for treatment , there is always a case for surgical intervention . in our study , 83.8% ( n = 26 ) of the children had a long segment disease . the average segment involved in astrocytomas was 5.7 , whereas , in ependymomas , the average segment involved was 3.8 . he showed that the astrocytomas tended to be more extensive ( a mean span of 5.6 vertebral bodies ( minimum of 2 vertebral bodies , maximum of 19 vertebral bodies ) than ependymomas ( mean extent of 34 vertebral bodies ) . , there was a long segment neuro enteric cyst with a lipoma located over the caudal end of the cyst . this multifocality in spinal cord low - grade glioma is very rare and we have not come across any case in the literature . the surgical treatment essentially aims at maximal resection of the tumor while attempting to preserve normal functions . issues pertaining to resection of these tumors include : ( 1 ) laminectomy versus laminoplasty . ( 2 ) adjuncts used during the surgery and ( 3 ) extent of excision and the factors determining the same . the major reason of preferring osteoplastic laminotomy over laminectomy is the prospect of prevention of postoperative spinal deformity in the former . furthermore , the cervical region is more prone to have a postlaminectomy deformity as compared to the thoracic and lumbar spine . the incidence of postlaminectomy spinal deformity increases with time and one - third of these patients finally required surgical intervention . apart from its role in the prevention of spinal deformity , osteoplastic laminotomies may potentially decrease the incidence of postoperative csf leak and operative site pain . however , increasingly this is being carried out for all intramedullary tumors irrespective of the site of involvement . over the past few decades , the evolution of certain surgical adjuncts has greatly facilitated higher grades of excision in these tumors . intraoperative use of cusa helps in rapidly removing these tumors , particularly useful in debulking astrocytomas . although there have been concerns that the vibration effect of cusa could hamper the nerve conduction of the motor tracts , recent studies have proven that that these effects are practically nonconsequential beyond 1 mm of vibrating probe . the application of laser ( nd - yag ) in excision of these tumors comes during myelotomy and removal of last few bits of the tumor along the tumor cord interface . however , tissue charring and prolonged procedural time are the major limiting factors of using laser . it helps in determining the extent of the tumor , tumor cysts , and any missing tumor residue . moreover , features such as the echogenicity , symmetricity , and location of the tumor within the cord help in determining the nature of tumors ( astrocytomas vs. ependymomas ) . ultrasound interpretation is however greatly dependent on the operator and may be erroneous in differentiating tumor remnants from blood and edema . this , however , requires different anesthetics considerations , an experienced neurophysiologist and trained occupational therapy personnel . usually , a combination of motor evoked potential and somatosensory evoked potential is used at most centers . the extent of tumor excision is another issue related to the management of the pimscl . this is due to the infiltrative nature of astrocytomas with consequent lack of distinct tumor - cord interface during surgery . on the other hand , tumors such as ependymomas and hemangioblastoma usually have very good planes of cleavage surrounding them , allowing them to be completely excised , more often than not . in addition , the developmental lesions ( e.g. , dermoid , epidermoid , neuro enteric cyst , and lipoma ) and inflammatory lesions such as tuberculomas usually do not have well defined planes around them , either because of congenital or inflammatory adhesions . hence , it is usually not possible to excise them without incurring significant neurological deficits . more ever intraoperative events such as bradycardia and hemodynamic fluctuations seen in cervicomedullary junction tumors also affect the extent of surgical excisions as seen in our study . in cases of ependymomas , complete excision is associated with zero percent recurrence , although some authors documented about 510% recurrence rate even after complete excision . in high - grade neoplasms ( both astrocytomas and ependymomas ) , the role of adjuvant therapy in the management of intramedullary spinal tumors has changed over time . in the early days , when biopsy and limited decompression were the rule , adjuvant radiotherapy was given to each and every patient irrespective of histopathological diagnosis . currently , however , the unequivocal indications of radiotherapy in intramedullary spinal cord tumors include high - grade lesions ( astrocytomas and ependymomas ) and unresectable significant residual tumor . as far as the low - grade astrocytomas are concerned , radiotherapy is not advocated after complete resection . for incompletely excised they argue that it delays the progression of the disease . whereas the other school of thought argues that these tumors are by nature , slow growing , and do not require radiotherapy . they like to intervene either by re - surgery ( if tumors are deemed resectable ) or by radiotherapy when tumor shows recurrence . we follow the latter policy ; similar philosophy is also applied to low - grade ependymomas . it is associated with radiation myelitis , worsening of spinal curvature , and malignant conversion of benign tumors . radiation is , however , a must after resection of high - grade tumors . even though it does not prolong the overall survival , the progression free survival is prolonged . the role of chemotherapy in the management of intramedullary tumors is not clear ; people have tried various chemotherapy regimens in the management of high - grade spinal intramedullary neoplasms albeit with limited success . in pediatric patients chemotherapeutic agents are very toxic and at times , like in one of our patients , these complications can be lethal . chemotherapy has a definite role in the management of intramedullary tuberculomas . in 2 of our patients with tuberculoma sensory improvement occurred in 46.6% patients followed by a motor ( 44.8% ) and sphincteric function ( 45% ) . twenty - one patients were in good postoperative grade indicating that children tend to tolerate surgery well and recover to reasonable postoperative functional status . as we saw , those who had poor functional outcomes , preoperative poor functional grade , and histopathology of the tumors ( gliomatous tumors and inflammatory lesions ) seemed to be major factors contributing to it . duration of preoperative symptoms , however , did not appear to affect postoperative functional status . astrocytomas and ependymomas , taken together constituted the most common intramedullary spinal lesions in children ; however , developmental tumors predominated in the first decade . | background : pediatric intramedullary spinal cord lesions are not only rare but also different from adults in a number of aspects .
we aimed to study the incidence and the frequencies of various pediatric intramedullary mass lesions , their outcome to treatment and the factors determining their outcome of treatment.materials and methods : thirty - one consecutive children ( aged 118 years , mean 11.1 years , male : female = 1.8:1 ) with pathologically proven intramedullary spinal cord lesions treated at our center were studied .
clinico - radiological , histopathological , operative , and outcome data were reviewed retrospectively .
the functional status was assessed using the modified mccormick grading system.results:gross total tumor excision was performed in 19 patients ( 61.3% ) , subtotal in 9 patients ( 29% ) , partial excision was performed in 2 ( 6.5% ) patient , and only biopsy was performed in 1 patient ( 6.5% ) .
there was one peroperative death , 2 patients died at follow - up .
complications included wound related complications ( n = 4 ) , transient deterioration in the motor power , and respiratory complication requiring a tracheostomy .
six patients showed recurrence at a mean follow - up of 16.4 months .
developmental tumors , high - grade ependymomas , and incompletely excised grade 2 ependymomas showed a tendency to recur.conclusions:children constituted nearly 1/5th ( 17.4% ) of intramedullary spinal cord tumors .
astrocytomas and ependymomas taken together constituted the most common intramedullary spinal lesions in children ; however , developmental tumors predominated in the first decade .
children usually presented in good functional grades preoperatively and maintained good grades after surgery . functional outcome was dependent on the preoperative neurological status and histopathology of the lesions . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
pilonidal sinus is a disease which is very common , especially in men and usually located in sacrococcygeal area . however , the disease can be also seen in rare localizations such as umblicus , forehead , scalp , clitoris , interdigital area and axilla . in the etiology of pilonidal sinus , acquired theory is accepted by most of surgeons instead of the congenital one . in the present study , we purposed to report our case of hirsute turkish women aged 25 having axillary pilonidal sinus . after application of total surgical excision with eliptical skin incision , histopathological evaluations confirmed the prediagnosis of axillary pilonidal sinus . the patient was lost to follow - up and neither recurrens nor distance metastasis has been detected during 36 months . in our opinion ; surgical therapy of axillary pilonidal sinus , allows to complete resection in addition to absolute histopathological diagnoses and it may be an appropriate choice of treatment especially for the disease having one or two sinuses . pilonidal sinus is a disease which is reported by anderson et al as a hair detected in a sacrococcygeal ulcer in 1847 , defined firstly by hodges et al as a term of pilonidal sinus and mostly found in sacrococcygeal area . besides this area , it can be also seen in rare localizations such as umblicus , forehead , scalp , clitoris , interdigital area , penis , abdomen , neck and axilla[101213 ] . in the etiology of pilonidal sinus , congenital theory was accused by kooistra et al in 1942 , collection of hairs on midline of back was become a current issue by karydakis et al firstly in 1992 and acquired theory was reported by bascom et al in 1980 . a hirsute turkish woman aged 25 applied to our clinic in november 2006 with the history and complaint of the intermittent small amount of leakage from her right axilla during the past year . there was no any history of pilonidal sinus and operation of which at the other sites of her body . on the physical examination , one small sinus sized 2 mm in diameter in her right axilla not including any hair was detected . pilonidal sinus was defined at neither the intergluteal sulcus and nor the other regions of her body . after application of methylene blue through the orifice of the pilonidal sinus , total excision of the tractus with the neighbouring subcutaneous tissue and the elliptical skin part containing the sinus orifice was performed . following the total surgical excision , primer suturation of the subcutaneous tissue and the skin the tractus was limited only in subcutaneous tissue and the histopathological evaluations confirmed the preassumptive diagnosis of axillary pilonidal sinus . any perioperative or postoperative complication and recurrence has not been detected during the 36 months follow - up . sinus tract and the section of the hair inside it ( arrows ) ( h & e , original magnification , 1020 ) . apocrine gland structures ( thick and short arrows ) and the neighbouring section of the hair ( thin ang long arrow ) ( h & e , original magnification , 510 ) . in the beginning , the congenital theories have been suggested for the pathogenesis of pilonidal sinus , but afterwards the acquired theory is accepted by most of surgeons[416 ] . friction ( abduction adduction ) , suction , massage , shaving , pounding , minor infection and maceration are assorted mechanisms which play a part in acquised theory of pilonidal sinus . mayo et al indicated that the hairs may curl back on themselves and pierces the surrounding skin with their distal ends first by growth forces . on the contrary , oryu et al suggested that penetration of shed hairs with their proximal or distal ends first coul not be designated , so the mentioned authors could not be designate the penetration direction of hair in their 5 patients . we come accross with axilla as a very rare body area for including pilonidal sinus[101216 ] . malignant degeneration of pilonidal disease is a rare complication composed of approximately 0.1 % of patients with chronic untreated or recurrent pilonidal disease and is associated with a high recurrence rate and poor prognosis comparing with regular nonmelanoma skin cancer . among malignant degeneration of pilonidal sinus most cases are squamous cell carcinoma . biological behavior of pilonidal sinus carcinoma is much more aggressive than squamous cell carcinoma at the other sites and they are deeply invasive into the subcutaneous tissue in the great majority of cases . underlying bone is involved in 8% of cases , also . i nguinal lymph node metastasis is very poor as a prognostic sign and is associated with a median survival time of only 7 months . according to our point of view , besides complete resection allows to appropriate choice of treatment especially for the disease having one or two sinuses , it also enables to absolute histopathological diagnoses . in conclusion , pilonidal disease is a very common disease , especially in men and generally located in sacrococcygeal area . so , we aimed to present our case of hirsute young turkish women having the mentioned disease . histopathological evaluations revealed the charecteristic structures of axillary pilonidal sinus , after application of total surgical excision via eliptical skin incision . the case was lost to follow - up and no recurrens or complication has been detected during 36 months . awareness of the probability of a pilonidal disease even in seldom locations like groins of axilla is important and although the malignant degeneration of the disease is very rare , it has much more poor prognosis comparing with squamous cell carcinoma and regular nonmelanoma skin cancer . | context : pilonidal sinus is a disease which is very common , especially in men and usually located in sacrococcygeal area .
however , the disease can be also seen in rare localizations such as umblicus , forehead , scalp , clitoris , interdigital area and axilla . in the etiology of pilonidal sinus , acquired theory is accepted by most of surgeons instead of the congenital one.case report : in the present study , we purposed to report our case of hirsute turkish women aged 25 having axillary pilonidal sinus .
after application of total surgical excision with eliptical skin incision , histopathological evaluations confirmed the prediagnosis of axillary pilonidal sinus .
the patient was lost to follow - up and neither recurrens nor distance metastasis has been detected during 36 months.conclusions:in our opinion ; surgical therapy of axillary pilonidal sinus , allows to complete resection in addition to absolute histopathological diagnoses and it may be an appropriate choice of treatment especially for the disease having one or two sinuses . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
rats were maintained in rooms with controlled temperature and light at 23 3c and 14 h
light/10 h dark cycle ( lights on at 0500 h ) . adult female rats showing at least two regular
four - day estrous cycles were mated . the day of parturition was defined as day 0 ( d0 ) of lactation and the number of pups was adjusted to eight on d1 . pups were
removed from their dam on d21 of lactation and mid - lactational forced weaning was performed on d10 . all experiments were performed according to the guidelines for
animal experiments of kitasato university and approved by the committee for laboratory animals , care and use at school of veterinary medicine , kitasato
university . inguinal mammary tissues were collected from rats on d12 , 21 , 22 , 23 , or two days after forced weaning on d10 . the tissues of d21 ( weaning day ) rats were
harvested at 0 or 6 h after pup removal . the tissue samples were snap - frozen in liquid nitrogen and stored at 80c until rna extraction . total rna was extracted
using trizol reagent ( invitrogen , carlsbad , ca , usa ) and then reverse - transcribed into cdna using a high capacity cdna reverse transcription kit ( applied
biosystems , foster city , ca , usa ) . reverse transcription - pcr ( rt - pcr ) for gnrh - r or ribosomal protein l19 ( rpl19 ) was performed
using premix taq ( ex taq version 2.0 ; takara bio , shiga , japan ) for 35 or 22 cycles , respectively , at 94c for 30 sec , 58c for 30 sec ,
and 72c for 60 sec , with an initial denaturing step at 94c for 2 min and a final elongation step at 72c for 7 min . primers used in the current studytargetprimer ( 5-3)gnrh - rforward : aatcatcttcgccctcacacreverse : agcacgggtttagaaaagcagnrh - r exon 1forward : ccgtccttggagaaatatggreverse : agcggcatgacgattagagtgnrh - r exon 2forward : tcttcaggatgatctacctagccreverse : cctgatgaaggactcgtgtggnrh - r exon 3forward : ccaagaataatatcccaagagcareverse : tcccgtatatgggtttcagcrpl19forward : ggaagcctgtgactgtccatreverse : ccatgagaatccgcttgttt . amplified products were separated by 2% agarose gel electrophoresis and detected by ethidium bromide staining . inguinal mammary tissues were also collected from rats each day from d20 to 24 for western blot analysis . the tissues of d21 ( weaning day ) were harvested at 0 or
6 h after pup removal . the samples
containing 20 g of protein were electrophoresed on 12% polyacrylamide gels ( bio - rad , hercules , ca , usa ) and transferred onto polyvinylidene fluoride membranes
( bio - rad ) . membranes were blocked with 5% skim milk ( wako pure chemicals , osaka , japan ) for 1 h at room temperature and then incubated with primary antibodies :
anti - gnrh receptor , mouse monoclonal antibody ( 1:200 ; acris antibodies gmbh , herford , germany ) , or anti--actin mouse monoclonal antibody ( 1:1,000 ; c4 , santa cruz
biotechnology , santa cruz , ca , usa ) , overnight at 4c . the gnrh - r antibody was raised by immunization of the n - terminal 129 amino acid peptide of human gnrh - r ,
which shows 82.8% homology with rat gnrh - r and less than 40% homology with other rat proteins . after washing , the membranes were incubated with
peroxidase - conjugated goat igg fraction to mouse igg ( 1:20,000 ; icn pharmaceuticals , aurora , oh , usa ) for 2 h at room temperature . immunoreactive protein was
detected with ecl plus western blotting detection reagents or ecl prime western blotting detection reagents ( ge healthcare , little chalfont , uk ) . the signal was
detected by exposure of the membrane to an x - ray film for 5 , 10 , or 15 min with an imagequant las 4000 digital imaging system ( ge healthcare ) . rt - pcr examination for gnrh - r mrna showed no amplification in the mammary tissues of lactation d20 , a day before weaning ( fig . rt - pcr was performed with total rna isolated from mammary tissues of three rats each on
day 21 before weaning and 6 h after weaning on days 21 , 22 , and 23 . the primer sets for gnrh - r and rpl19
mrna were designed to yield 251-bp and 264-bp fragments . ) . gnrh - r mrna was dramatically increased over time until two days after weaning on d23 ( fig . next , the
expression was decreased to trace levels on d26 and 29 ( fig . this indicates that the expression of gnrh - r is
well - regulated and that the cessation of suckling stimuli triggers this expression . ikeda et al . found that gnrh mrna was expressed in the mouse
mammary tissues during the lactating and involution periods , but did not detect gnrh - r mrna by pcr . did not determine the regulation of gnrh - r mrna expression during the narrow period just after weaning . rt - pcr was performed with total rna isolated from mammary tissues of three rats each on
day 21 before weaning and 6 h after weaning on days 21 , 22 , and 23 . the primer sets for gnrh - r and rpl19
mrna were designed to yield 251-bp and 264-bp fragments . we further confirmed the expression of gnrh - r in mammary tissues with different sets of primers in forced weaned rats . the gnrh - r gene consists
of three exons and encodes 984 base pairs through exons 13 in rodents [ 33 , 34 ] . mammary tissues were collected from a forced weaned rat after two days and from a lactating rat . ( a ) primers for exons 13 of the gnrh - r gene were used . rt - pcr was performed on dnase - treated total
rna isolated from the mammary tissues on lactation day 12 ( d12 ) and 2 days after forced weaning on day 10 ( fw ) . amplification of gnrh - r mrna ( lane 14 ; exon
1 , lane 58 ; exon 2 , lane 912 ; exon 3 ) was performed using templates with or without reverse transcription reaction ( rt ) to prevent the amplification of
genomic dna . three primer sets specific to exons 1 , 2 , and 3 were designed to amplify 306- , 201- , and 271-bp amplicons , respectively . ( b ) rpl19 was used as
an internal control for the two rats used ( lane 1316 ) . ) . this result again revealed that the cessation of suckling induces gnrh - r mrna expression in the mammary tissues and that full - length mrna is
synthesized . ( a ) primers for exons 13 of the gnrh - r gene were used . rt - pcr was performed on dnase - treated total
rna isolated from the mammary tissues on lactation day 12 ( d12 ) and 2 days after forced weaning on day 10 ( fw ) . amplification of gnrh - r mrna ( lane 14 ; exon
1 , lane 58 ; exon 2 , lane 912 ; exon 3 ) was performed using templates with or without reverse transcription reaction ( rt ) to prevent the amplification of
genomic dna . three primer sets specific to exons 1 , 2 , and 3 were designed to amplify 306- , 201- , and 271-bp amplicons , respectively . ( b ) rpl19 was used as
an internal control for the two rats used ( lane 1316 ) . we previously reported that the expression of annexin a5 is dramatically increased in the epithelial cells of mammary tissues . we predicted that gnrh acts locally in the mammary gland during post - lactational involution . we also published several reports regarding the
relationship between gnrh and annexin a5 in various tissues . currently , the physiological function of annexin a5 is unknown , but it is
thought to be involved in apoptosis and tissue remodeling . the present data support that gnrh affects degeneration and tissue remodeling in the mammary epithelium
after lactation . to confirm the translation of gnrh - r mrna , western blotting analysis using a gnrh - r antibody against the n - terminal peptide sequence was performed . the results
confirmed two immunoreactive bands , approximately 60 kda and 30 kda proteins , in the lactating and post - lactating mammary tissues . ( a , b ) western blotting was performed with mammary tissue samples on lactation
day 20 ( d20 ) and 6 h after weaning on day 21 ( d21 + 6h ) , day 22 ( d22 ) , day 23 ( d23 ) , and day 24 ( d24 ) . ( c , d ) western blotting was performed on the mammary tissues from d21 ( on
weaning ) and d23 , and the anterior pituitary tissue . -actin is used as an internal control . ) . a previous study that also used a gnrh - r monoclonal antibody against the n - terminal 129 amino acid residues , which differed from the antibody used in
the present study , detected an approximately 60-kda protein in the rat pituitary gland . gnrh - r in mice and rats is a
seven - transmembrane , g - protein - coupled receptor of 327 amino acid residues with two or three n - terminal glycosylation sites and can be detected at 5570 kda by
sds - page . this band was increased after weaning and reached
a peak on d23 , coinciding with mrna results . interestingly , there was another 30-kda immunoreactive band , which decreased after weaning . although the sequence of
the 30-kda protein is not known and was observed even during lactation while there was no detectable level of gnrh - r mrna , the gnrh - r variant may have been
present alternatively , impairment of post - translational glycosylation may produce a gnrh - r
with a lower apparent molecular weight on sds - page . future studies
are needed to investigate the post - transcriptional or post - translational modification of gnrh - r in the mammary gland . ( a , b ) western blotting was performed with mammary tissue samples on lactation
day 20 ( d20 ) and 6 h after weaning on day 21 ( d21 + 6h ) , day 22 ( d22 ) , day 23 ( d23 ) , and day 24 ( d24 ) . ( c , d ) western blotting was performed on the mammary tissues from d21 ( on
weaning ) and d23 , and the anterior pituitary tissue . time - specific expression of gnrh - r in the mammary gland after pup removal strongly suggests that the expression is related to changes in the endocrine milieu
after lactation , specifically the cessation of massive prolactin release . we previously
reported that prolactin suppresses annexin a5 expression in the corpus luteum , suggesting negative control of gnrh function by prolactin . experimental suppression
of prolactin release caused luteal regression , and a gnrh antagonist was shown to inhibit the process of apoptosis . further studies are needed to clarify the role of gnrh in apoptosis and the signaling pathways involved in the post - lactational mammary gland . in summary , we detected a post - lactational increase in gnrh - r expression in rat mammary tissues . these results suggest that local gnrh is involved in the
involution of mammary tissues after weaning to induce epithelial apoptosis and tissue remodeling . conflict of interests : none of the authors have any potential conflicts of interest associated with this research . | gonadotropin - releasing hormone ( gnrh ) is a neurohormone of the hypothalamus controlling pituitary gonadotropin secretion and hence gametogenesis .
while it has
also been believed that gnrh is synthesized and functions in various peripheral tissues , the expression of gnrh receptor ( gnrh - r ) in peripheral tissues is not
well - described .
we previously found that annexin a5 , which is increased in the pituitary gonadotropes by gnrh , is dramatically increased in rat mammary
epithelial cells after weaning , suggesting that local gnrh is responsible for this increase .
annexin a5 is a member of the annexin family of proteins and is
thought to be involved in various regulatory mechanisms , including apoptosis . in the present study , we examined gnrh - r expression in the mammary tissues after
weaning .
although gnrh - r mrna was not detected in the mammary tissues during lactation , it was dramatically increased after weaning .
forced weaning at
mid - lactation ( day 10 ) also promoted the expression of gnrh - r transcripts in mammary tissues within 2 days .
furthermore , western blotting analysis with
anti - gnrh - r showed that the expression of an immuno - positive 60-kda protein , whose size was equivalent to that of rat gnrh - r , was confirmed to increase after
weaning .
these findings clarified the induction of gnrh - r in the mammary tissues after weaning and suggest that gnrh is involved in the involution and tissue
remodeling of post - lactating rat mammary tissues . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
infantile hepatic hemangioendothelioma ( ihh ) is a vascular tumor of the liver composed of anastomosing vascular channels lined by plump endothelial cells . it is the most common vascular tumor of the liver in infancy and the third most common hepatic tumor in children . approximately 85% of affected patients present before 6 months of age , with < 5% cases detected beyond 1 year of age . to our knowledge , only 2 adult with ihh has been reported in the english literatures . in this paper , we reported a diffuse ihh in an adult patient , with early central enhancement on ct and mri . a 39-year - old man was admitted to our hospital because of a 2-year history of abnormal liver function tests and a 7-day history of jaundice . physical examination revealed that the liver was palpable 2 cm below the right lower costal margin . he had elevated levels of serum total bilirubin ( 164.9 mol / l ; reference range 218 mol / l ) , direct bilirubin ( 83.1 mol / l ; reference range < 7 mol / l ) , alkaline phosphotase ( 115 u / l ; reference range 3292 u / l ) , and gamma glutamyl transpeptidase ( 173u / l ; reference range < 47 u / l ) . the serum hepatitis b virus surface antigen , hepatitis c virus antibody , hepatitis e virus antibody , hepatitis a virus igm antibody , syphilis antibody , and human immunodeficiency virus antibody were all negative . he had no history of being exposed to hepatotoxins , undergoing any transfusions , regular tobacco or alcohol use , and familial liver disease . laboratory tests showed normal -fetoprotein , carcinoembryonic antigen , and cancer antigen 19 to 9 levels . enhanced ct on the arterial phase revealed multiple centrally enhanced lesions diffusely involved the enlarged liver . the enhanced areas of the lesions became larger on the portal phase and all the lesions became homogeneous enhanced on the delayed phase ( figure 1 ) . these lesions showed heterogeneously hyperintense on t2-weighted images , hypointense on t1-weighted images , and early centrally enhanced on dynamic gadolinium - enhanced mr imaging , with complete tumor enhancement after 180 s ( figure 2 ) . axial unenhanced ct ( a ) showed the enlarged liver with homogeneous hypodensity and the lesions were indistinct . axial enhanced ct ( b ) in the arterial phase showed numerous enhanced nodules throughout the liver ( arrows ) . in the portal phase ( c ) , the sizes of the enhanced nodules became larger with increased extent of enhancement ( arrows ) . in the delayed phase ( d ) , the nodules became uniform enhancement and nearly indistinct . unenhanced coronary ( a ) and axial ( b ) t2-weighted mr images showed diffuse nodules ( ranging from a few millimeters to 4.4 cm in diameter ) with heterogeneously high signal intensities . the axial enhanced t1-weighted image in the arterial phase ( d ) showed central enhancement of the nodules ( arrow ) . in the portal phase ( e ) , the hypervascular regions of the nodules became larger ( arrow ) . in the delayed phase ( f ) , the nodules became uniform enhancement ( arrow ) with reticular regions of hypointensity between the nodules . gross specimen revealed that the liver was replaced by diffuse numerous grayish brown nodules without evidence of hemorrhage and necrosis . microscopically ( figure 3 ) , the nodules were not encapsulated and intermixed with the hepatic plates . histopathology ( a , hematoxylin and eosin stain , 200 ) showed twisting vascular channels lined with proliferating pleomorphic endothelial cells . histopathology at higher ( b , hematoxylin and eosin stain , 400 ) magnification showed large hyperchromatic and pleomorphic endothelial cells with abundant mitoses , nuclear atypia , and prominent nucleoli . immunohistochemically , the endothelial cells showed a strong cd-34 reaction ( c , original magnification , 200 ; d , original magnification , 400 ) . type 1 , tumors are composed of variable sized vascular spaces lined by relatively immature endothelial cells ; type 2 , tumors are composed of larger , more immature cells with increased cellularity , reflecting more aggressive microscopic appearance . the authors considered type 1 was histologically benign and type 2 is histologically equivalent to angiosarcoma . in addition , a mixture of type 1 and type 2 components within the same liver has been reported . larger tumors frequently have central areas of infarction , hemorrhage , and calcification or fibrosis . on precontrast ct , small lesions usually enhance completely , whereas some large lesions demonstrate incomplete enhancement , probably due to necrosis or hemorrhage . ihh , generally , is heterogeneous intensity on pre - contrast t1 weighted images because of the presence of hemorrhage , infarction , calcification , or fibrosis . on t2 weighted images , ihh is usually hyperintense due to its vascular nature , similar to the appearance of adult cavernous hemangioma . the dynamic enhanced mri features are similar to that on enhanced ct . unlike the previously described cases , our case showed early central enhancement pattern on both contrast ct and mri . a few reports demonstrate that some hepatic angiosarcomas also exhibit central enhancement on the arterial phase . ackermann et al has reported a large tumor of ihh type 2 with early central enhancement . to our knowledge , diffuse ihh with early central enhancement has not previously been reported in the english literature . in this case , the reason of central enhancement was unclear . we hypothesized that the central enhancement of the lesions on the arterial phase followed by a centrifugal enhancement in the portal and delayed phases was because the feeding arteries were in the centers of the lesions , and not in the peripheries . this postulation remained to be proven by imaging pathological correlations . in conclusion , this was a rare case of diffuse ihh in an adult patient . unlike the previously described imaging appearances of ihh , our case showed diffuse nodules with early central enhancement on ct and mri . considering the importance of the ability to differentiate ihh from other hepatic tumors , radiologists should be aware of these imaging appearances to establish knowledge of the entire spectrum of ihh . ethical approval was obtained from the ethics committee of changhai hospital , shanghai , china . written informed consent was obtained from the patient 's relative for publication of this case report and any accompanying images . | abstractinfantile hepatic hemangioendothelioma ( ihh ) is the most common vascular tumor of the liver in infancy .
adult with ihh is extremely rare .
we presented a diffuse ihh in an adult patient with computed tomography ( ct ) and magnetic resonance image ( mri ) findings.a 39-year - old man was admitted to our hospital because of a 2-year history of abnormal liver function tests and a 7-day history of jaundice .
physical examination revealed enlarged liver .
unenhanced abdominal ct showed enlargement of the liver with diffuse hypodensity .
enhanced ct on the arterial phase revealed multiple centrally enhanced lesions diffusely involved the enlarged liver .
the enhanced areas of the lesions became larger on the portal phase and all the lesions became homogeneous enhanced on the delayed phase .
these lesions showed heterogeneously hyperintense on t2-weighted image , hypointense on t1-weighted image , and early centrally enhanced on dynamic gadolinium - enhanced mri , with complete tumor enhancement after 180 s. the patient underwent orthotopic liver transplantation .
ihh type 2 was confirmed by pathology .
the patient died of tumor recurrence in the liver 4 months after transplantation.unlike the previously described imaging appearances of ihh , this case showed diffuse nodules with early central enhancement on ct and mri .
considering the importance of the ability to differentiate ihh from other hepatic tumors , radiologists should be aware of these imaging appearances to establish knowledge of the entire spectrum of ihh . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
however , more and more studies showed ipsilateral vah were common in patients with posterior circulation stroke , suggesting patients with vah might at an increased risk of ischemic stroke . to determine the relationship of vah and ischemic stroke , vah should be differentiated from acquired stenosis accurately at first . the differential diagnosis between vah and stenosis might be difficult by the luminal imaging including digital subtract angiography ( dsa ) , computer tomography angiography ( cta ) , and magnetic resonance angiography ( mra ) , as they only provide information on the luminal flow but not the morphological characteristics of vessel wall . knowledge of wall characteristics will help further elucidate the mechanism of ischemic stroke in vah patients . high resolution magnetic resonance images ( hr mri ) is emerging as a new technique for assessing wall characteristics of intracranial arteries , and has been used to investigate vessel remodeling pattern , plaque distribution and percent plaque area in recent years . by using two - dimensional ( 2d ) high resolution mri , mariani et al . compared with 2d imaging method , three - dimensional ( 3d ) imaging method could offer isotropic resolution and enable a comprehensive survey of intracranial arteries with multiple planar reconstructions . in addition , compared with the extracranial vah which have been investigated with ultrasonography or dsa , the intracranial vah was given less attention . in this study , our aim was to determine wall characteristics of vah with 3d volumetric isotropic turbo spin echo acquisition ( 3d vista ) images and differentiate between acquired atherosclerotic stenosis and vah . we retrospectively reviewed our single institutional hr mri database in the digital picture archiving and communication system from june 2014 to february 2015 . images with 3d time - of - flight ( tof ) mra were initially evaluated , and suspicious vah was defined as a lumen diameter of 2 mm , and the larger contralateral side was defined as a dominant vertebral artery according previous study . patients would be excluded from this study if the lumen diameter of both vertebral arteries were 2 mm . image quality of vista images was assessed using a previously developed four - point scale ( 1=poor , 2=adequate , 3=good , 4=excellent ) . the atherosclerotic risk factors were noted including hypertension , hyperlipidemia , diabetes mellitus , smoking history and obesity . hypertension was defined as systolic blood pressure 140 mmhg , diastolic blood pressure 90 mmhg , or the patients are currently treated with an antihypertensive drug . hyperlipidemia was defined as a total cholesterol level 240 mg / dl or low - density lipoprotein cholesterol level 160 mg / dl or receiving lipid - lowering treatment . a 3 t mr scanner ( ingenia ; philips healthcare , best , the netherlands ) with a 15-channel phased - array head coil was used in this study . 3d vista images were acquired in a traversal plane to cover the major intracranial arteries identified on the 3d tof mra . imaging parameters of 3d vista were as follows : repetition time / echo time = 1300 ms/36 ms , field of view = 140 mm 200 mm 105 mm , matrix = 280 332 210 , number of excitation = 2 . acquisition voxel volume was 0.5 mm 0.6 mm 0.5 mm , reconstruction voxel volume was 0.5 mm 0.5 mm 0.5 mm . two experienced readers who were blinded to clinical data assessed vista images by visual inspection . the differences between two observers were solved by consensus . based on vista images , acquired atherosclerotic stenosis was distinguished from vah firstly when wall thickening ( with or without thrombus ) was found in the suspicious vah , and outer vessel diameter was more than 50% of the dominant vertebral artery . then , the vah patients were classified as two subgroups : ( 1 ) vah with atherosclerosis when vista images showed slim lumen with vessel wall thickening in the hypoplastic vertebral artery , but outer vessel diameter 50% of dominant vertebral artery . ( 2 ) vah with normal wall when vista images showed slim lumen without vessel wall thickening in the hypoplastic vertebral artery . the wall characteristics of basilar arteries and dominant vertebral arteries were also assessed and categorized as the clinical and wall characteristics were compared between the vah patients with atherosclerosis and vah patients with normal wall [ table 1 ] . demographic and clinical characteristics of vah patients sd : standard deviation ; vah : vertebral artery hypoplasia . spss 11.5 ( spss , inc . , chicago , il , usa ) was used as the statistical analysis software . all reported p values were two - sided , and p < 0.05 were considered significance . we retrospectively reviewed our single institutional hr mri database in the digital picture archiving and communication system from june 2014 to february 2015 . images with 3d time - of - flight ( tof ) mra were initially evaluated , and suspicious vah was defined as a lumen diameter of 2 mm , and the larger contralateral side was defined as a dominant vertebral artery according previous study . patients would be excluded from this study if the lumen diameter of both vertebral arteries were 2 mm . image quality of vista images was assessed using a previously developed four - point scale ( 1=poor , 2=adequate , 3=good , 4=excellent ) . the atherosclerotic risk factors were noted including hypertension , hyperlipidemia , diabetes mellitus , smoking history and obesity . hypertension was defined as systolic blood pressure 140 mmhg , diastolic blood pressure 90 mmhg , or the patients are currently treated with an antihypertensive drug . hyperlipidemia was defined as a total cholesterol level 240 mg / dl or low - density lipoprotein cholesterol level 160 mg / dl or receiving lipid - lowering treatment . a 3 t mr scanner ( ingenia ; philips healthcare , best , the netherlands ) with a 15-channel phased - array head coil was used in this study . 3d vista images were acquired in a traversal plane to cover the major intracranial arteries identified on the 3d tof mra . imaging parameters of 3d vista were as follows : repetition time / echo time = 1300 ms/36 ms , field of view = 140 mm 200 mm 105 mm , matrix = 280 332 210 , number of excitation = 2 . acquisition voxel volume was 0.5 mm 0.6 mm 0.5 mm , reconstruction voxel volume was 0.5 mm 0.5 mm 0.5 mm . two experienced readers who were blinded to clinical data assessed vista images by visual inspection . acquired atherosclerotic stenosis was distinguished from vah firstly when wall thickening ( with or without thrombus ) was found in the suspicious vah , and outer vessel diameter was more than 50% of the dominant vertebral artery . then , the vah patients were classified as two subgroups : ( 1 ) vah with atherosclerosis when vista images showed slim lumen with vessel wall thickening in the hypoplastic vertebral artery , but outer vessel diameter 50% of dominant vertebral artery . ( 2 ) vah with normal wall when vista images showed slim lumen without vessel wall thickening in the hypoplastic vertebral artery . the wall characteristics of basilar arteries and dominant vertebral arteries were also assessed and categorized as the clinical and wall characteristics were compared between the vah patients with atherosclerosis and vah patients with normal wall [ table 1 ] . demographic and clinical characteristics of vah patients sd : standard deviation ; vah : vertebral artery hypoplasia . continuous variable ( age ) was assessed for normality by the kolmogorov smirnov test . spss 11.5 ( spss , inc . , chicago , il , usa ) was used as the statistical analysis software . all reported p values were two - sided , and p < 0.05 were considered significance . between june 2014 and february 2015 , a total of 30 patients ( male : 26 ; female : 4 ) with suspicious intracranial vah were enrolled . the atherosclerotic risk factors included hypertension ( n = 22 , 73.33% ) , hyperlipidemia ( n = 20 , 66.67% ) , diabetes mellitus ( n = 15 , 50.00% ) , smoking ( n = 15 , 50.00% ) , and obesity ( n = 3 , 10.00% ) . the number of atherosclerotic risk factors in the patients was 1 ( n = 5 , 16.67% ) , 2 ( n = 7 , 23.33% ) , 3 ( n = 14 , 46.67% ) or 4 ( n = 4 , 13.33% ) atherosclerosis risk factors , respectively . five of the 30 patients with possible unilateral intracranial vah suggested by luminograms were finally diagnosed as acquired atheroslcerotic stenosis due to the presence of atherosclerotic plaque with similar vessel outer diameter as the dominant verterbral arteries on the hr mri . for the 5 patients , mra findings were suspicious for vah in the left side ( 3 cases ) or right sides ( 2 cases ) . further study with cta or dsa also showed slim lumen in the vertebral arteries , suggesting intracranial vah . however , hr mri depicted atherosclerotic plaques and large thrombi ( 2 cases ) [ figure 1 ] in those patients , and the outer diameter was similar with the dominant sides , suggesting acquired atheroslcerotic stenosis . computer tomography angiography suggested right vertebral artery hypoplasia ( a , arrow ) . the left vertebral artery ( va ) was the dominant one ( b arrow ) . coronal and axil reconstructed views of high resolution magnetic resonance images ( hr mri ) showed a large thrombus leading to lumen occlusion in the middle portion ( c , arrow ) and eccentric plaque in the distal portion of intracranial va ( d , arrow ) . this case was diagnosed as acquired atherosclerotic stenosis since hr mri showed similar outer vessel diameter in the right va as that in the left va . twenty - five patients ( left side : 8 cases ; right side : 17 cases ) were finally diagnosed as vah . in the 25 patients , hr mri showed a slim lumen and the outer vessel diameters were equal or less than 50% of the dominant vertebral arteries . of the 25 vah patients , hr mri showed normal wall in 9 patients [ figure 2 ] and atherosclerosis in 16 patients including little atherosclerotic plaque in 9 patients [ figure 3 ] , slight wall thickening in 6 patients [ figure 4 ] , and thrombus and wall thickening in 1 patient [ figure 5 ] . magnetic resonance angiography suggested left vertebral artery hypoplasia ( vah ) ( a , arrow ) . high resolution magnetic resonance images with coronal ( b , arrow ) and axil ( c , arrow ) reconstructed image showed slim lumen with normal wall . this case magnetic resonance angiography was suspicious of vertebral artery hypoplasia ( vah ) in the left side with severe stenosis in the terminus ( a , arrow ) . high resolution magnetic resonance images with coronal ( b , arrow ) and axil ( c , arrow ) reconstructed images showed slim lumen with obvious eccentric plaque in the terminus . magnetic resonance angiography was suspicious of right vertebral artery hypoplasia ( vah ) ( a , arrow ) . coronal ( b , arrow ) and axil ( c , arrow ) reconstructed views of high resolution magnetic resonance images showed slim lumen with slight vessel wall thickening . computer tomography angiography suggested right vertebral artery hypoplasia ( vah ) with absence of lumen in the distal portion of intracranial vertebral artery ( va ) ( a arrow ) . coronal ( c arrow ) and axil ( d , arrow ) reconstructed views of high resolution magnetic resonance images showed wall thickening with a large thrombus leading to lumen occlusion in the distal portion of intracranial va . high resolution magnetic resonance images showed outer vessel diameter in the right va was less than 50% of the left va . atherosclerotic basilar arteries and atherosclerotic dominant intracranial vertebral arteries were found in 15 ( 60% ) and 12 ( 48% ) of 25 patients , respectively . compared with the vah patients with normal wall , vah patients with atherosclerosis showed atherosclerotic basilar arteries and dominant vertebral arteries more frequently ( p = 0.000 ) . no significant difference was found in the sex , age and atherosclerotic risk factors between the two groups [ table 1 ] . between june 2014 and february 2015 , a total of 30 patients ( male : 26 ; female : 4 ) with suspicious intracranial vah were enrolled . the atherosclerotic risk factors included hypertension ( n = 22 , 73.33% ) , hyperlipidemia ( n = 20 , 66.67% ) , diabetes mellitus ( n = 15 , 50.00% ) , smoking ( n = 15 , 50.00% ) , and obesity ( n = 3 , 10.00% ) . the number of atherosclerotic risk factors in the patients was 1 ( n = 5 , 16.67% ) , 2 ( n = 7 , 23.33% ) , 3 ( n = 14 , 46.67% ) or 4 ( n = 4 , 13.33% ) atherosclerosis risk factors , respectively . five of the 30 patients with possible unilateral intracranial vah suggested by luminograms were finally diagnosed as acquired atheroslcerotic stenosis due to the presence of atherosclerotic plaque with similar vessel outer diameter as the dominant verterbral arteries on the hr mri . for the 5 patients , mra findings were suspicious for vah in the left side ( 3 cases ) or right sides ( 2 cases ) . further study with cta or dsa also showed slim lumen in the vertebral arteries , suggesting intracranial vah . however , hr mri depicted atherosclerotic plaques and large thrombi ( 2 cases ) [ figure 1 ] in those patients , and the outer diameter was similar with the dominant sides , suggesting acquired atheroslcerotic stenosis . computer tomography angiography suggested right vertebral artery hypoplasia ( a , arrow ) . the left vertebral artery ( va ) was the dominant one ( b arrow ) . coronal and axil reconstructed views of high resolution magnetic resonance images ( hr mri ) showed a large thrombus leading to lumen occlusion in the middle portion ( c , arrow ) and eccentric plaque in the distal portion of intracranial va ( d , arrow ) . this case was diagnosed as acquired atherosclerotic stenosis since hr mri showed similar outer vessel diameter in the right va as that in the left va . twenty - five patients ( left side : 8 cases ; right side : 17 cases ) were finally diagnosed as vah . in the 25 patients , hr mri showed a slim lumen and the outer vessel diameters were equal or less than 50% of the dominant vertebral arteries . of the 25 vah patients , hr mri showed normal wall in 9 patients [ figure 2 ] and atherosclerosis in 16 patients including little atherosclerotic plaque in 9 patients [ figure 3 ] , slight wall thickening in 6 patients [ figure 4 ] , and thrombus and wall thickening in 1 patient [ figure 5 ] . magnetic resonance angiography suggested left vertebral artery hypoplasia ( vah ) ( a , arrow ) . high resolution magnetic resonance images with coronal ( b , arrow ) and axil ( c , arrow ) reconstructed image showed slim lumen with normal wall . magnetic resonance angiography was suspicious of vertebral artery hypoplasia ( vah ) in the left side with severe stenosis in the terminus ( a , arrow ) . high resolution magnetic resonance images with coronal ( b , arrow ) and axil ( c , arrow ) reconstructed images showed slim lumen with obvious eccentric plaque in the terminus . the case was diagnosed as vah with atherosclerosis . magnetic resonance angiography was suspicious of right vertebral artery hypoplasia ( vah ) ( a , arrow ) . coronal ( b , arrow ) and axil ( c , arrow ) reconstructed views of high resolution magnetic resonance images showed slim lumen with slight vessel wall thickening . computer tomography angiography suggested right vertebral artery hypoplasia ( vah ) with absence of lumen in the distal portion of intracranial vertebral artery ( va ) ( a arrow ) . coronal ( c arrow ) and axil ( d , arrow ) reconstructed views of high resolution magnetic resonance images showed wall thickening with a large thrombus leading to lumen occlusion in the distal portion of intracranial va . high resolution magnetic resonance images showed outer vessel diameter in the right va was less than 50% of the left va . atherosclerotic basilar arteries and atherosclerotic dominant intracranial vertebral arteries were found in 15 ( 60% ) and 12 ( 48% ) of 25 patients , respectively . compared with the vah patients with normal wall , vah patients with atherosclerosis showed atherosclerotic basilar arteries and dominant vertebral arteries more frequently ( p = 0.000 ) . no significant difference was found in the sex , age and atherosclerotic risk factors between the two groups [ table 1 ] . although there is no clear definition of vah , it was generally defined when the diameter of hypoplastic vertebral artery was less than 2 mm , or less than 3 mm or there was a difference between the lateral and contralateral vessel with an asymmetry ratio of equal or greater than 1:1.7 on the luminograms . the reported frequency of vah is from 1.9% to 10% depending on the various definitions used for vah . the association between vah and ischemic events was controversial . to investigate the clinical relevance of vah , acquired atherosclerotic stenosis should be distinguished and excluded from vah group firstly . however , intracranial vertebral artery atherosclerotic stenosis was also popular and has similar luminogram as intracranial vah . in the new england medical center posterior circulation registry study , severe stenosis or occlusion of the intracranial vertebral artery was the most common arterial lesion , and the most common pathological processes are atherosclerosis . the atherosclerotic intracranial vertebral artery was an important recipient site and common source of emboli . undoubtedly , the results would be misinterpreted if the patients with intracranial vertebral artery atherosclerotic stenosis were included in vah studies , and the conclusion for clinical relevance of vah might be somewhat biased . differentiation between congenital vah and acquired atherosclerotic stenosis is difficult since it generally relies on the luminography including mra , cta or dsa . none of these techniques could provide the precise morphology of the vessel wall of intracranial artery . hr mri can directly visualize the arterial wall , permit identification of atherosclerotic plaques , and help differentiate between acquired atherosclerotic stenosis and vah . the differentiation has another clinical significance since endovascular treatment is emerging as a valuable tool for patients refractory to medical therapy . the complications might be unavoidable if vah patients were misdiagnosed as atherosclerotic stenosis and received endovascular therapy . previous studies showed vah seemed to be more prone to pro - thrombotic or atherosclerotic processes than normal or dominant vertebral arteries , and speculated the vah - related ischemic stroke was still due to large artery atherosclerosis . posterior circulation ischemic stroke might result from atherosclerotic lesions in hypoplastic vertebral arteries because vertebral arterial atherosclerosis ( with or without thrombi ) can cause in situ strokes and are prone to cause distal embolization . atherosclerotic vah was found in most of patients in our study , providing another evidence for the mechanism of ischemic stroke . furthermore , compared with normal or dominant vertebral arteries , vah with atherosclerosis might be more vulnerable to severe stenosis or occlusion due to the smaller caliber . caplan had described similar finding that the smaller of paired arteries were more prone to occlusion . severe stenosis or occlusion would aggravate the flow volume reduction in vah , which might be another important mechanism of ischemic stroke in vah patients . mra could not provide precise information of atherosclerotic lesions for intracranial vah . although cta is recognized as a good method to depict carotid plaques , the value for detecting the atherosclerotic lesions in the intracranial vertebral arteries seemed to be limited . direct wall imaging not only permits hr mri providing a confirmative diagnosis of vah , but also helps evaluate the atherosclerotic processes of intracranial vah . knowledge of the wall characteristics would help further understanding the role of vah in the posterior circulation ischemic stroke . three - dimensional vista sequence is a new method introduced recently with high - isotropic resolution and large volume coverage for intracranial arteries . by using this 3d volume acquisition , all the vertebral arteries could be assessed globally with multi - planar reconstructed images including the coronal and axil plane images as described in this study . this feature was very important for evaluation of tortuous intracranial vertebral arteries , which was difficult in the 2d image acquisition . recently , other magnetic resonance techniques , such as true fast imaging in steady state precession or basiparallel anatomic scanning - mri were introduced to differentiate arterial occlusion from vertebral hypoplastic variants . however , such sequences still focused on the luminogram rather than the arterial wall , and could not clearly depict atherosclerotic lesions with excellent quality images , especially for vah . first , the study population was small because only the patients with hr mri were included , and the retrospective study might have selection bias . however , our findings are still important for understanding the mechanism of ischemic stroke in vah patients . a larger cohort study with follow - up will be performed to assess the clinical relevance of vah in the future . thirdly , although 3d vista could provide good excellent quality images for assessing intracranial larger arteries including middle cerebral artery and basilar artery , the resolution should be further improved for the hypoplastic vertebral artery due to the smaller caliber . in addition , we only perform the hr mri for the intracranial arteries , and the intracranial segment did not represent the entire vertebral artery . in conclusion , hr mri with 3d vista sequence was able to help differentiate between vah and acquired atherosclerotic stenosis . in addition , hypoplastic vertebral arteries were also prone to atherosclerosis or thrombus , resulting in severe stenosis or occlusion . | background : there are few studies for evaluating wall characteristics of intracranial vertebral artery hypoplasia ( vah ) . the aim of this study was to determine wall characteristics of vah with three - dimensional volumetric isotropic turbo spin echo acquisition ( 3d vista ) images and differentiate between acquired atherosclerotic stenosis and vah.methods:thirty patients with suspicious vah by luminograms were retrospectively enrolled between january 2014 and february 2015 .
the patients were classified as acquired atherosclerotic stenosis or
vah based on 3d vista images .
the wall characteristics of vah were assessed to determine the presence of atherosclerotic lesions , and the patients were classified into two subgroups ( vah with atherosclerosis and vah with normal wall ) .
wall characteristics of basilar arteries and vertebral arteries were also assessed .
the clinical and wall characteristics were compared between the two groups.results:five of 30 patients with suspicious vah were finally diagnosed as acquired atherosclerotic stenosis by 3d vista images .
25 patients were finally diagnosed as vah including 16 ( 64.00% ) patients with atherosclerosis and 9 ( 36.00% ) patients with normal wall . in the 16 patients with atherosclerosis ,
plaque was found in 9 patients , slight wall thickening in 6 patients , and thrombus and wall thickening in 1 patient . compared with vah patients with normal wall ,
vah patients with atherosclerosis showed atherosclerotic basilar arteries and dominant vertebral arteries more frequently ( p = 0.000).conclusions : three - dimensional vista images enable differentiation between the acquired atherosclerotic stenosis and vah .
vah was also prone to atherosclerotic processes . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
human apolipoprotein m ( apom ) is mainly found in hepatocytes of the liver and tubular epithelial cells in kidney 1 , and it could also been expressed weakly in the colorectal tissues 2 . it has recently been documented that apom can protect endothelium by delivering sphingosine-1-phosphate ( s1p ) to the s1p1 receptor 3 and enhance the antioxidant effect of high density lipoprotein ( hdl ) , in which the most abundant protein is apoa - i 4 . also , it has been demonstrated that apom is important for the formation of pre-hdl and cholesterol efflux to hdl , which could attenuate atherosclerotic process 5 . we have previously reported that hepatic apom levels were significantly decreased in hyperglycemic rats , and in cell cultures high concentrations of glucose inhibited apom expression 6 . it was previously demonstrated that hyperglycemia could increase the flux of free fatty acids ( ffas ) by accelerating lipolysis , which may induce or aggravate insulin resistance in the liver and muscle through altering the insulin signaling pathway 7 , 8 . in light of evidence that mice with genetic defects of leptin ( ob / ob mouse ) , exhibiting resistance to insulin , also showed significantly lower levels of apom 9 , we speculate that down - regulation of apom expression by hyperglycemia may be associated with insulin resistance . rosiglitazone , a peroxisome proliferator - activated receptor- ( ppar ) agonist used for the treatment of type 2 diabetes , is a potent insulin sensitizer that promotes glucose uptake by adipose tissue , skeletal muscle and liver 10 - 12 . apart from improving insulin resistance , recent evidences demonstrated that rosiglitazone has multieffects , including attenuating airway inflammation by inhibiting the proliferation of effector t cells 13 , reducing hippocampal neuronal damage 14 , improving endothelial function 15 , increasing cell surface glut4 level 16 , preventing pulmonary fibrosis 17 and even preventing graft - versus - host disease 18 . however , it remains unknown whether rosiglitazone affects apom in vivo . in the present study we examined the effects of rosiglitazone and hyperglycemia on apom expression in a rat 's models . according to our previous investigation showing that liver x receptor ( lxr ) 19 , 20 and atp - binding cassette transporter a1 ( abca1 ) 21 could involve in the regulation of apom expression . in the present study , we further examined the effects of rosiglitazone and hyperglycemia on expression of pparb / d and genes of lxr signaling pathway including its target gene , abca1 in rat 's models in order to find possible mechanism(s ) of apom regulation by rosiglitazone and hyperglycemia . animal experiments . the experimental protocols were approved by the animal care and use committee of soochow university , suzhou , china . in general , each experimental group contained 6 - 8 adult male sprague - dawley rats ( 250 - 300 g ) . rats were commercially obtained from the shanghai slac laboratory animal co. , china or the changzhou cavens laboratory animal co. , china . rats were kept in separate cages in a temperature - controlled ( 22c ) room with 12-hrs light - dark cycle and were provided with standard rodent chow and water ad libitum . the rats were acclimatized for one week before the experiments . in the present study , all rats were pre - operated and two small catheters were placed in a jugular vein seven days before the liquid infusion . in brief , rats were anesthetized with 10% chloral hydrate ( 4ml / kg ) . two catheters were placed in a jugular vein , one for infusion of 25% glucose solution ( 10mlkgh for 6 h , huayu pharmaceutical co. ) or insulin solution ( 10mukgmin during hec ( hyperinsulinemic euglycemic clamp ) , wanbang biopharmaceuticals ) and another for infusion of 20% glucose solution ( during hec ) . an additional catheter was placed in a carotid artery for blood sampling ( also seven days before the experiments ) . the free ends of both catheters were attached to long segments of steel tubing and tunneled subcutaneously on the back of the neck . the catheters were flushed with isotonic saline containing 50 iu / ml heparin ( qianhong bio - pharma co. ) and filled with a viscous solution of heparin ( 500 iu / ml ) and 300 g / l polyvinyl pyrolidone ( pvp-10 ; sigma ) to prevent refluxing of blood into the catheter lumen . when performing liquid infusions , the catheters were carefully connected to the infusion pumps ( smiths medical ) . 25% glucose solution or insulin /20% glucose solution ( during hec ) was infused for determining gene expressions or for assessing insulin sensitivity , respectively . additionally , liquid was infused via tail vein in two parallel experiments which were performed to avoid the interference of the hec test on gene expression . in the studies of rosiglitazone and/or infusion of 25% glucose solution on gene expressions , the rats were dosed daily with 0.25% ( w / v ) sodium carboxymethycellulose ( cmc , sinopharm chemical reagent co. , ltd ) or rosiglitazone ( higher biotech co. , ltd , 4mgkg , containing 0.25% cmc ) via oral gavage for 4 - 5 days . the hec technique was applied for assessing insulin sensitivity in rats ( n=8 for each group ) that were gavaged with 0.25% ( w / v ) cmc or rosiglitazone ( dissolved in 0.25% cmc , at a concentration of 4mgkgd ) for 4 days , then infused with either 5% or 25% glucose solution intravenously for 5hrs . in another set of experiments without assessment of insulin sensitivity , rats ( n=6 ) were gavaged with 0.25% ( w / v ) cmc or rosiglitazone ( dissolved in 0.25% cmc , with the concentration of 4mgkgd ) for 5 days , then infused with either 5% or 25% glucose intravenously for 6hrs . after glucose infusion , blood samples and liver tissues were collected for plasma ffas and apom mrna levels detection , respectively . total rna in rats ' tissues was extracted according to the manufacturer 's instructions using a total rna purification kit ( omega bio - tek ) . the quality of the rna samples was determined by the absorbance measurements at 260/280 nm . using the first strand cdna synthetic kit ( qiagen ) according to the manufacturer 's instructions , the mrna levels of the target and reference genes were measured under real - time pcr using taqman technology . the pcr primer sets were designed according to the information of genbank , as listed in table 1 . the real - time pcr reaction for each gene was performed in a 25l volume , in a glass capillary containing 0.1l 100m each primer and probe , 2l cdna , 2.5l 10xbuffer , 1.5l mgcl2 ( 25 mm ) , 0.5l dntp ( 10mmol / l ) , and taq dna polymerase 0.5l . thermal cycling conditions included the following steps : initial denaturation at 95 c for 3 min , followed by 40 cycles at 95 c for 5 sec and 60 c for 15 sec ( rat lxra , 62 c for 15 sec ; rat apom , 58c for 12 sec ; rat b - actin , 61c for 10 sec ) . all pcrs were performed on the lightcycler ( roche , switzerland ) real - time pcr system . ffas were determined with the nonesterified fatty acid ( nefa ) colorimetric method ( applygen technologies inc , beijing , china ) . briefly , total plasma ffas were extracted with chloroform : n - heptane : methanol ( 56:42:2 ) , coupled with copper , reacted with color reagent and measured with a colorimeter at 550 nm . statistical analyses were performed with the graphpad prism 6.0 software ( graphpad software , inc . , san diego , california , usa ) . multiple comparisons were performed with one - way anova , and comparisons between two groups were statistically evaluated by the unpaired t - test . both 25% glucose solution ( p<0.0001 ) and rosiglitazone ( p<0.0001 ) affect the glucose infusion rates ( gir ) ( fig . furthermore , the marked inhibition of gir by 25% glucose could be reversed by administration of rosiglitazone ( p<0.001 ) ( fig . 1b shows that hepatic apom mrna levels in rats were significantly decreased after infusion of 25% glucose solution ( p=0.0356 ) . rosiglitazone significantly increased the hepatic apom mrna levels in groups with 5% ( p=0.0132 ) or 25% ( p=0.0007 ) glucose administration . however , the interaction of rosiglitazone and glucose on apom mrna expression was not statistically significant ( p=0.8981 ) . 1c , the plasma ffas were clearly lower in rats infused with 25% glucose solution than in rats infused with 5% glucose solution ( p=0.0005 ) , and rosiglitazone had no significant effect on plasma ffa levels in these rats ( p=0.9790 ) . two - way anova indicated that there was no interaction between rosiglitazone and glucose on plasma levels of ffas ( p=0.2656 ) . as shown in figure 2 , when rats infused with 25% glucose solution , hepatic mrna levels of lxrb were significantly inhibited ( p=0.0002 ) , and small heterodimer partner 1 ( shp1 ) ( p<0.0001 ) , liver receptor homologue-1 ( lrh1 ) ( p=0.0012 ) , atp - binding cassette transporter 1 ( abca1 ) ( p=0.0012 ) and pparb / d ( p=0.0043 ) were also significantly reduced , while rosiglitazone only decreased mrna levels of shp1 ( p=0.0074 ) and abca1 ( p=0.0171 ) ( fig . two - way anova analysis showed that the interactions between rosiglitazone and infusion of 25% glucose solution on shp1 ( fig . 4e , p=0.0004 ) mrna expression was statistically significant . and , the interactions on lxra ( fig . both 25% glucose solution ( p<0.0001 ) and rosiglitazone ( p<0.0001 ) affect the glucose infusion rates ( gir ) ( fig . furthermore , the marked inhibition of gir by 25% glucose could be reversed by administration of rosiglitazone ( p<0.001 ) ( fig . 1b shows that hepatic apom mrna levels in rats were significantly decreased after infusion of 25% glucose solution ( p=0.0356 ) . rosiglitazone significantly increased the hepatic apom mrna levels in groups with 5% ( p=0.0132 ) or 25% ( p=0.0007 ) glucose administration . however , the interaction of rosiglitazone and glucose on apom mrna expression was not statistically significant ( p=0.8981 ) . 1c , the plasma ffas were clearly lower in rats infused with 25% glucose solution than in rats infused with 5% glucose solution ( p=0.0005 ) , and rosiglitazone had no significant effect on plasma ffa levels in these rats ( p=0.9790 ) . two - way anova indicated that there was no interaction between rosiglitazone and glucose on plasma levels of ffas ( p=0.2656 ) . as shown in figure 2 , when rats infused with 25% glucose solution , hepatic mrna levels of lxrb were significantly inhibited ( p=0.0002 ) , and small heterodimer partner 1 ( shp1 ) ( p<0.0001 ) , liver receptor homologue-1 ( lrh1 ) ( p=0.0012 ) , atp - binding cassette transporter 1 ( abca1 ) ( p=0.0012 ) and pparb / d ( p=0.0043 ) were also significantly reduced , while rosiglitazone only decreased mrna levels of shp1 ( p=0.0074 ) and abca1 ( p=0.0171 ) ( fig . two - way anova analysis showed that the interactions between rosiglitazone and infusion of 25% glucose solution on shp1 ( fig . 4e , p=0.0004 ) mrna expression was statistically significant . and , the interactions on lxra ( fig . in the present study , the rats in the control group were administrated with 5% glucose solution , to avoid the starving on normal physiological metabolic processes . in agreement with previous reports 22 - 26 , the insulin sensitivity was reduced in rats treated with high concentrations of glucose and this effect could be reversed by rosiglitazone . the present study shows that apom expression is also significantly affected by either rosiglitazone or hyperglycemia alone without cross interaction with each other , which suggests that the pathway of apom expression regulated by hyperglycemia might be differed from that by rosiglitazone . rosiglitazone is well documented , it acts through the ppar pathway and alleviates insulin resistance by reducing uptake of free fatty acids as well as enhancing lipometabolism 27 . however , in the present study , plasma ffa levels did not increase as expected , but rather decreased plasma ffas occurred when rats were infused with 25% glucose solution . it is possible that hyperglycemia can elicit insulin secretion 28 and insulin therefore suppress the fatty acid release through inhibiting lipolysis 29 in this experimental model . we previously reported that activation of neither ppar nor ppar influenced apom expression in hepg2 cells 30 . while interestingly , our present data demonstrated that activation of ppar by the rosiglitazone could up - regulate hepatic apom expression in rats , which suggests that the signal pathway of ppar on regulation of apom expression might be much more complicated in vivo than in vitro , or perhaps , the difference between rat apom gene and human apom gene contributes to the regulation patterns of ppar. abca1 is an important member of the atp - binding cassette - transporter family and is involved in the apoai - mediated cholesterol efflux from macrophages 31 . ppar activator i.e. , rosiglitazone and troglitazone , could enhance abca1 expression in primary human monocyte - derived macrophages 32 , whereas ciglitazone had no effect in cultured human keratinocytes 33 . in this study , hepatic abca1 mrna expression was down - regulated by either rosiglitazone or 25% glucose , but rosiglitazone could totally reverse the hyperglycemia - induced down - regulation of abca1 expression , which demonstrated that down - regulation of abca1 expression induced by hyperglycemia , might be mediated via the ppar pathway in rats . so abca1 down - regulated by rosiglitazone should suppress apom in rat accordingly , but in present study , rosiglitazone significantly increased apom expression , which suggested that upregulation of apom induced by rosiglitazone might not be regulated through abca1 , which is possible that rosiglitazone or ppar could bind to apom promoter region directly regulating its expression . more detailed mechanism needs further investigation . to explore the mechanism of down - regulation of apom by hyperglycemia , we analyzed mrna expressions of genes related to the pathway of liver x receptor . infusion of 25% glucose solution significantly decreased hepatic mrna levels of lxrb , shp1 , lrh1 , abca1 and pparb / d in rats . we previously reported that palmitic acid - induced upregulation of pparb / d expression could significantly inhibit apom expression in hepg2 cells 34 . so by inference , inhibition of pparb / d mediated by infusion of 25% glucose solution could elevate mrna levels of apom . however , the final result showed that infusion of 25% glucose solution significantly decreased apom expression in rats . one reasonable explanation is that hyperglycemia might suppress apom expression through multiple signal pathways in vivo . venteclef , et al . , have demonstrated that lrh1 could directly regulate human and mouse apom transcription by binding to the lrh1 response element located in the proximal apom promoter region , and bile acids suppressed apom expression by inhibiting lrh1 transcriptional activity 35 . we have demonstrated that activation of lxr triggers upregulation of abca1 and subsequently increases apom expression 21 . the results of present study showed that downregulation of genes ( lxrb , shp1 , lrh1 ) of lxr signaling pathway and its target genes , abca1 by hyperglycemia could be inhibited by rosiglitazone , although the interactions between rosiglitazone and hyperglycemia on lxrb ( fig . we therefore speculated that hyperglycemia suppresses apom expression mainly via decreasing expression of pparg and followed by inhibiting lxrb in rat . | apolipoprotein m ( apom ) has been suggested as a vasculoprotective constituent of high density lipoprotein ( hdl ) , which plays a crucial role behind the mechanism of hdl - mediated anti - atherosclerosis .
previous studies demonstrated that insulin resistance could associate with decreased apom expressions . in agreement with our previous reports , here
, we further confirmed that the insulin sensitivity was also reduced in rats treated with high concentrations of glucose ; such effect could be reversed by administration of rosiglitazone , a peroxisome proliferator - activated receptor- ( ppar ) .
the present study shows that apom expression is significantly affected by either rosiglitazone or hyperglycemia alone without cross interaction with each other , which indicates that the pathway of apom expression regulating by hyperglycemia might be differed from that by rosiglitazone .
further study indicated that hyperglycemia could significantly inhibit mrna levels of lxrb ( p=0.0002 ) , small heterodimer partner 1 ( shp1 ) ( p<0.0001 ) , liver receptor homologue-1 ( lrh1 ) ( p=0.0012 ) , atp - binding cassette transporter 1 ( abca1 ) ( p=0.0012 ) and pparb / d ( p=0.0043 ) . two - way anova analysis demonstrated that the interactions between rosiglitazone and infusion of 25% glucose solution on shp1 ( p=0.0054 ) and abca1 ( 4e , p=0.0004 ) mrna expression was statistically significant .
it is concluded that rosiglitazone could increase apom expression , of which the detailed mechanism needs to be further investigated .
the downregulation of apom by hyperglycemia might be mainly through decreasing expression of pparg and followed by inhibiting lxrb in rats . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
osteoarthritis ( oa ) in knee joint is the most common reason behind functional disability that leads to lowered quality of life in old age people of india . some of the objective factors that may influence oa disease severity include but are not limited to age , height , weight , and bmi . in physiotherapy practice , lowering the pain , other symptoms , improving the activities of daily living ( adl ) , and quality of life ( qol ) are main outcome criteria for oa knee rehabilitation . to achieve this rehabilitative goal , physiotherapists use both self - reported questionnaires as well as performance - based tests to monitor prognosis in the above said parameters , that is , pain , symptoms , adl , and qol . self - reported questionnaires give subjective information about the disease process without examiner bias within short period of time , whereas , performance - based tests objectively measures patient 's ability of perform adl activities . examples for self - reported questionnaire are womac , sf-36 , koos , and so forth . examples for physical performance tests are timed up and go test ( tug ) , six - minute walk test ( 6-mwt ) , stair climbing test , and so forth . physical performance tests are affected by motivation and not affected by psychogenic factors such as beliefs , expectations , cognitive impairments , and cultural , lingual , and educational level [ 3 , 4 ] . possible difference between the two may be performance - based tests measure functional limitation , whereas self - reported questionnaire reveals disability , that is , combination of social and psychological side of the functional limitation . functional limitation is sooner detected by performance - based tests than self - reported questionnaires [ 5 , 6 ] . there is no consensus regarding the use of tests while some prefer to use self - reported questionnaires because they are easy to administer and have high internal consistency features ; others prefer performance - based tests as they consider that these tests are essential for adl evaluation of the patient . ideally , both self - reported and functional tests should be used in knee rehabilitation setting [ 7 , 8 ] . in order to ascertain more valid results , performance - based tests should always be correlated with self - reported measures . in previous studies , womac , sf-36 , and koos are compared with timed up and go ( tug ) test [ 7 , 911 ] . however there is no study that compares self - reported questionnaire with 6-mwt which is more deals with adl as this measures both walking ability as well as endurance . koos is a relatively newer self - reported questionnaire that was developed from womac by roos et al . for oa knee patients . thus , primary objective of present study was to see the correlation of subjectively measured koos questionnaire with objectively measured 6-minute walk test ( 6-mwt ) , age , height , weight , and bmi . present study was a cross - sectional survey study in which data was extracted from individuals with clinical and nonradiographic idiopathic or primary knee acr criteria for clinical diagnosis of idiopathic knee oa were based on knee pain in either knee on most days for at least 1 month in the previous year and at least two of the following signs / symptoms : stiffness , crepitus , bony tenderness , and bony enlargement . exclusion criteria were ( 1 ) self - reports of currently doing lower - extremity exercise 2 times per week ; ( 2 ) self - reports of currently fitness walking 90 minutes per week ; ( 3 ) being unable to read english / urdu questionnaire ( koos ) ; ( 4 ) inflammatory arthritis ; ( 5 ) self - reports of having current knee conditions such as meniscus tears and knee ligament ruptures ; ( 6 ) fracture of spine or lower extremities ; ( 7 ) being scheduled to undergo a major surgical procedure in the next 6 months ; ( 8) those with neurological conditions ; ( 9 ) having contraindications for exercise testing based on american college of sports medicine criteria . total of 251 patients ( 117 males , 134 females ) met the above said criteria and were included for the present study . koos is a self - reported questionnaire consisted of 42 questions in total addressing five patient - related domains including pain ( 9 questions ) , other disease - specific symptoms ( 7 questions ) , activity of daily living ( adl ) ( 17 questions ) , sport and recreation function ( 5 questions ) , and knee - related quality of life ( 4 questions ) . the walking track was a 30 m long empty corridor with marks on every 5 meters . patients were asked to walk back and forth along the 30 m track and to cover the longest possible distance in 6 minutes . at the end of every minute patients two weekly test - retest reliability of walking distance was reported to be 0.87 for patients with knee oa . patients stood on a firm surface in their bare feet to have their height measured . body mass was measured at the end of examination with a calibrated bathroom - type digital scale , on a firm surface . patients were weighed in the standing position , wearing light indoor clothes , but no shoes , jewellery , or heavy clothing . body mass index ( bmi ) was calculated with the formula ( weight/(height ) ) . results are given in mean , standard deviation ( sd ) , and range ( minimum maximum ) . correlation was done using spearman rank correlation since self - reported data was ordinal variable . the spearman correlation coefficient was interpreted as follows : < 0.3 : none ; 0.310.5 : weak ; 0.510.7 : strong ; 0.710.9 : very strong ; and > 0.9 : excellent . table 2 shows mean and standard deviation along with range of all subscales of koos and 6-mwt in primary oa knee patients . overall koos - sports and recreation had a minimum mean score followed by qol subscale . 6-mwt had a weak correlation with koos - adl ( rho 0.461 ) and strong correlation with koos - symptom , koos - pain , and koos - sports ( rho 0.578 , 0.619 , and 0.536 , resp . ) and very strong correlation with koos - qol ( rho 0.733 ) . bmi had a strong correlation with koos - pain , koos - symptom , koos - adl , and koos - sports ( rho 0.683 , 0.641 , 0.523 , and 0.640 , resp . ) and very strong correlation with koos - qol ( rho 0.816 ) . weight had a weak correlation with koos - symptom , koos - adl , and koos - sports ( rho 0.485 , 0.333 , and 0.413 , resp . ) and strong correlation with koos - pain and koos - qol ( rho 0.542 and 0.582 , resp . ) . there was no correlation between age and any of koos subscales except age and koos - qol subscale ( rho 0.159 , p < 0.05 ) . the aim of the present study was to see the correlation between koos five subscales and some of the objective measures , that is , 6-mwt , age , height , weight , and bmi . the results show there is weak ( none ) correlation of koos subscales with height , progressively increase with weight and bmi . mean score of koos all subscales were less than present study results but trend is similar between the two studies meaning sports and recreation subscale is the least followed by qol subscale and symptom subscale was the maximum in both studies . the present study results are in agreement with sabirli et al . who reported strong correlation between timed up and go ( tug ) and all subscales of koos . they reported 0.66 , 0.521 , 0.531 , 0.694 , and 0.561 for pain , symptom , adl , sports , and qol whereas present results for them to 6-mwt was 0.619 , 0.578 , 0.461 , 0.536 , and 0.733 , respectively . . found strong correlation between womac and 5-mwt ( r 0.485 , 0.525 , and 0.577 for pain , stiffness , function subscales , respectively , p < 0.001 for all ) . reported negative correlation between womac pain , function subscales , and 6-mwt ( r 0.205 for pain , p < similarly , maly et al . reported mild but significant correlation between 6-mwt , womac pain , and stiffness subscales ( r 0.39 for pain and r 0.48 for stiffness ) . lin et al . found mild correlation between womac and physical performance tests in oa knee patients ( r 0.330.54 ) . . observed mild but significant correlation between observed and self - reported physical performance ( r 0.200.26 ; p < 0.01 ) . kennedy et al . found mild to moderate correlation ( r 0.210.50 ) between self - report and actual physical performance on 1044 knee arthroplasty patients . stratford et al . reported moderate correlation between self - reported lower extremity function scale ( lefs ) and tug time ( r 0.42 ) on patients waiting for knee arthroplasty . . reported positive correlation between gait cycle and sf-36 pain domain ( r 0.6 - 0.7 , p < 0.001 ) as well as physical function domain ( r 0.5 , p < 0.05 ) . recently , adegoke et al . reported a positive correlation ( r = 0.56 ) between self - reported function and actual physical performance ( stair climbing and tug test ) which is similar to our result ( r = 0.461 ) . reported that weight gain is associated with worsening pain , stiffness , and function in knee pain patients . miller et al . reported that 6 monthly changes in weight is correlated with womac pain ( r 0.346 , p < 0.01 ) , stiffness ( r 0.204 ) , and function ( r 0.310 , p < 0.05 ) , respectively . penserga and tanque reported a positive correlation between womac ( function ) and weight ( r = 0.260 ) . correlation between weight and bmi is similar to that of marks ( 0.764 in present study versus 0.83 and 0.896 in marks ' study ) and their reported r = 0.63 for self - determined walking pace with bmi is similar to our koos - adl with bmi ( r = 0.523 ) . however contradictory to our finding , marks reported lower values for vas pain scale with bmi ( r = 0.352 ) . marks concluded that bmi was significantly correlated with pain using vas ( r 0.270 , p < 0.01 ) and disability using aims ( r 0.357 , p < 0.01 ) . reported bmi significantly correlated with all subscales of womac ( p < 0.001 ) and sf-36 but their correlation was < 0.30 . previous studies also report similar correlation between bmi and womac ( sanghi et al . ; r = 0.592 , 0.634 , 0.749 for pain , stiffness , and adl subscales in klc et al . except cubukcu et al . creamer et al . reported positive correlation ( r = 0.42 ) between womac function subscale and bmi . reported mild positive correlation between bmi and sit to stand performance ( r 0.47 , p < 0.01 ) . marks concluded that age was not significantly correlated with pain using vas ( r 0.122 ) and disability using aims ( r 0.175 ) . penserga and tanque reported lack of correlation between age and womac disability subscales ( r 0.077 ) . lack of correlation between koos pain ( r 0.093 ) , symptom ( r 0.071 ) , and adl ( r 0.036 ) subscales with age and weak correlation between age and koos qol ( r 0.159 ) subscale in oa knee patients have already been published in our previous publication with larger sample size . age found to be insignificant correlation with womac pain ( r 0.01 ) and function ( r 0.06 ) subscales in 257 knee arthroplasty patients . elbaz et al . also reported similar results in symptomatic oa knee patients using womac ( 0.028 , 0.023 , 0.09 for pain , stiffness , and function subscales , resp . ) . reported similar result using womac ( correlations between age and womac pain , stiffness , and function were 0.081 , 0.49 , 0.114 , and resp . ; all were statistically insignificant ) . recently , maly et al . in their study found insignificant correlation between age and pain intensity ( r 0.03 ) and physical performance ( r 0.09 ) . the present study results are in confirmation with previous studies and affirms the usage of koos in indian oa knee patients . | purpose . objective of the present study was to see the correlation of subjectively measured koos questionnaire with objectively measured 6-minute walk test ( 6-mwt ) , age , height , weight , and bmi .
participants .
251 subjects with oa knee based on american college of rheumatology criteria . methods . after passing inclusion and exclusion criteria ,
the following parameters were recorded : age , height , weight , and bmi . then subjects were asked to fill koos questionnaire ; then all subjects were asked to do self - paced walk for 6 minutes .
analysis .
spearman rank test was done to see the correlation .
significant level was set at p < 0.05 .
results .
6-mwt had a weak correlation with koos - adl ( rho 0.461 ) and strong correlation with koos - symptom , koos - pain , and koos - sports and very strong correlation with koos - qol .
bmi had a strong correlation with koos - pain , koos - symptom , koos - adl , and koos - sports and very strong correlation with koos - qol .
weight had a weak correlation with koos - symptom , koos - adl , and koos - sports and strong correlation with koos - pain and koos - qol .
all the above values were significant with p < 0.001 . conclusion .
koos is strongly positively correlated with 6-mwt and negatively correlated with bmi .
its correlation strength has decreased with weight . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the term musculoskeletal disorders ( msds ) refers to conditions that affect muscles ,
nerves , tendons , and other soft tissues1 . work - related musculoskeletal disorders ( wmsds )
have become a major social concern , which affect a company s bottom line2 , 3 . problems related to wmsds pose a significant threat to employees health and well - being
across a wide range of industries and occupations4,5,6 . workers involved in static low loads or repetitive work frequently
have complaints associated with wmsd7,8,9 . in
france , it is estimated that upper limb msds account for approximately two - thirds of the
reported work - related disorders10 . in
malaysia , the upper limb is the most commonly affected region in work - related injuries , with
22,978 cases constituting 39.5% of the total in the year 201011 . therefore , there is a critical need to prevent wmsds among workers
with the use of ergonomic interventions12
and by integrating ergonomic measures for upper extremities in the assembly line design13 . most tasks in the manufacturing industry , particularly assembly tasks , are repetitive and
performed manually14 , 15 . the tasks become more repetitive with harder production standard
times and may predispose workers to a higher risk for wmsds . the muscle fatigue rate may
also vary according to the levels of the production standard time . hence , the ability to
assign maximum task duration according to the levels of the production standard time may
reduce the risk of wmsds . however , there is a lack of established references concerning
variations in muscle fatigue , time to fatigue , and maximum task duration at different levels
of production standard time . therefore , this is a timely investigation of the variations in
muscle fatigue at different levels of production standard time to predict the time to
fatigue and maximum task duration , which are important factors in task design for minimizing
the risk of wmsds . twenty industrial workers ( 10 females and 10 males ) were recruited to participate in this
study . the subjects were between the ages of 22 and 45 years ( 30.97.711 ) . muscle activity was recorded using noraxon surface electromyography ( emg ) and
telemyo 2400 gen2 telemetric real time 8 channel semg system ( noraxon , inc , usa ) with
disposable ag / agcl pregelled electrodes . the subjects were then instructed to adopt a comfortable
sitting posture , and the sitting height was adjusted individually so that the subjects
knees were flexed to 90. the working height was standardized by placing the table surface
5 cm below the position of the wrist , with the elbow flexed to 9016 . the subjects were instructed to perform a maximum voluntary contraction ( mvc ) task as soon
as the signals from all sensors were stable . the subjects performed the mvc task three times
in the seated position ; the duration of each task was approximately 10 seconds , with 30
seconds of rest provided in between contractions . a stable forearm support was arranged , and manual resistance was used .
the mvc measurement procedure used in this study mvc refers to the highest emg amplitude
obtained from the three recordings and is expressed as the percentage of mvc ( % mvc ) . the mvc
was used to normalize the surface emg signals that were recorded during the series of
experimental tasks . the subjects were required to perform the experimental tasks after familiarizing themselves
with the tasks for 30 minutes . they performed the tasks according to assigned production
standard times over a one - hour period for each production standard time . the tasks involved repetitive assembly actions , similar to the
actual industrial assembly task . the subjects were given two types of components : plastic
clips and plastic foam rings . the subjects were instructed to assemble the ring foam onto the
plastic clip using a jig , which pushes the foam onto the clip . the subjects performed the
tasks according to the production standard times assigned to them . the production standard
times used in the experimental tasks were 100% normal standard time ( normal , psn ) , 126%
normal standard time ( hard , psh ) and 140% normal standard time ( very hard , psvh ) . the normal
standard time was determined to be 5 s from the methods - time - measurement ( mtm ) analysis , and
the task was categorized as a highly repetitive light task18 . emg signals were recorded from four forearm muscles : the flexor carpi radialis ( fcr ) and
extensor carpi radialis ( ecr ) on the right and left arms . raw emg signals were sampled
during the test contraction with a sample frequency of 1,500 hz and were band - pass filtered
( 20400 hz ) . the emg data were normalized with mvc to obtain the root - mean - square ( rms , % mvc ) . the rms
value corresponds to the square root of the average power of the raw emg signal over a given
period of time19 . the normalized rms
( % mvc ) was averaged for every 5 minutes . in this study , the mean value of the normalized rms
represents the muscle activity , while the rate of muscle fatigue is represented by the
linear regression slope of the normalized rms . the mean value and standard deviation of the normalized rms for all muscles are summarized
in table 1table 1.mean and standard deviation of normalized rmsproduction standardfcrrfcrlecrrecrlmeansdmeansdmeansdmeansdpsn8.8 * 1.811.0 * 2.810.4 * 2.311.4 * 3.4psh9.6 * 2.211.9 * 2.511.0 * 2.511.9 * 3.4psvh9.9 * 2.412.4 * 2.911.9 * 3.112.7 * 3.5*production standard time has a significant effect on the mean rms for all muscles ,
p<0.05 .. * production standard time has a significant effect on the mean rms for all muscles ,
p<0.05 . the highest rms value was obtained for ecr - left ( ecrl ) followed by fcr - left
( fcrl ) , ecr - right ( ecrr ) , and fcr - right ( fcrr ) . repeated measures anova was conducted to
investigate the effect of production standard time on muscle activity , and the results
revealed that the production standard time has a significant effect on the mean rms ( muscle
activity ) for all muscles ( table 1 ) . 1.percentage of increment in muscle
activity for different levels of production standard time presents the percentage of increment in muscle activity at different levels of
production standard times . the increment in muscle activity for a hard production standard
time was in the 4.98.7% range . the provision of an assigned very hard production standard
time showed that the muscle activity was higher than that for an assigned normal production
standard time and hard production standard time , with an increment in the 11.314.7% and
3.47.8% ranges , respectively , depending on the type of muscles . on average , the muscle
activity increased 6.9% for the hard production standard times and 12.9% for the very hard
production standard times . percentage of increment in muscle
activity for different levels of production standard time the muscle fatigue rate was determined from the normalized rms versus time , and the values
are summarized in table 2table 2.muscle fatigue rateproduction standardmuscle fatigue ratefcrrfcrlecrrecrlpsn0.0450.0610.0880.059psh0.0460.0860.0920.105psvh0.0500.0880.1030.115 . it can be seen that the muscle fatigue rate is higher for harder production
standard times . based on the prediction of time to fatigue at 15%mvc , it was found that muscle fatigue
occurs earlier for hard and very hard production standard times compared to the normal
production standard time . 2.9
hours , and 2.2 hours for continuous work at normal , hard , and very hard production standard
times , respectively . muscle activity , expressed as the rms value ( % mvc ) , was observed to increase significantly
with harder production standard times . the results of this study reveal that the average
muscle activity increases by 6.9% and 12.9% for hard and very hard production standard
times , respectively , whereby the values are determined relative to the normal production
standard time . this indicates that the muscle activity is twice its initial value as the
production standard time shifts from hard to very hard . this result is consistent with the
findings of previous studies , which reported that an increase in work pace leads to an
increase in muscle activity20 , 21 . the maximum muscle activity occurred at the ecrl , with a value of 12.7%mvc at 140% of the
normal standard time . the ecrl muscle exhibited the highest muscle activity , followed by the
fcrl , ecrr , and fcrr . the results are also consistent with the findings of previous studies ,
which were focused on repetitive hand tasks , during which the forearm extensor muscle
activity increases with respect to time20 , 21 . it was found that the rms value increases with respect to time for all muscles , which
signifies the development of muscle fatigue . the left - sided muscles were found to be more active compared to the
right - sided muscles , which was possibly due to all subjects being right - handed . moreover ,
the left - sided muscles are used to grip and hold the components while carrying out a task ,
and thus they have a greater number of active motor units22 . the greater the motor unit recruitment and firing rate , the
greater is the generated force23 . the
force generated shows a rapid decline when the muscles are stimulated continuously at a
frequency close to the maximal force and leads to muscle fatigue24 . therefore , these findings explained the highest
indication of muscle fatigue detected in the left extensor muscle . muscle activity was also found to increase over time for different production standard
times . this result is in agreement with that of previous studies , which found that increment of
muscle activity over time indicated a sign of muscle fatigue25 . in addition , muscle fatigue rates were found to be higher as the
production standard time became harder . the result showed that higher muscle activity
corresponds to a higher muscle fatigue rate26 . manifestation of muscle fatigue was detected during the one - hour
task duration , and the result was in agreement with previous studies , which reported muscle
fatigue and reduction in worker performance due to wmsds associated with tasks that were one
hour27 or less28 in duration . previous studies also found that muscle
fatigue develops over time29 , and the
accumulation of muscle fatigue caused functional disability resulting in musculoskeletal
disorders30 . therefore , long - term
effects and longitudinal studies are required to further investigate wmsds . however , the
ability to control muscle fatigue , which is an indicator of wmsds , will help to minimize the
risk of developing wmsds and maintain worker performance . in general , it can be deduced that the muscle fatigue rate is higher for harder production
standard times due to the shorter task time and higher frequency of movement . these results are in agreement
with the results of previous studies in which an increase in muscle activity resulted in an
increase in muscle fatigue and wmsd risks25 , 30 . however , recent studies reported that muscle fatigue
and fatigue - related changes occur at lower force levels32 . to date , there is no consensus regarding the acceptable levels of
muscle fatigue at the workplace , and fatigue risks are still debated33 . the time to fatigue in this study was predicted at
15%mvc , and it was found that time to fatigue occurs earlier for harder production standard
times compared to the normal production standard time . the time to fatigue at 15%mvc is
predicted after 5.6 , 2.9 , and 2.2 hours for normal , hard , and very hard production standard
times , respectively , assuming that the workers perform the repetitive tasks
continuously . in the manufacturing industry previous studies suggested that recovery from muscle fatigue can be achieved with
appropriate rest breaks , such as a one - hour break34 ,
35 . shin and kim36 suggested that an appropriate rest break can be used as an
early intervention to prevent muscle fatigue at the workplace . meanwhile , other studies have
shown that setting a limit for the task duration is more useful than improving break
allowance37 . based on these findings ,
we suggest that the maximum task duration for normal , hard , and very hard production
standard times should be limited before time to fatigue . hence , the maximum task duration
should not exceed 5.6 , 2.9 , and 2.2 hours for normal , hard , and very hard production
standard times , respectively . the maximum task duration for different levels of production
standard time is an important factor in the work design for sustaining the desired work
performance and for minimizing the risk of developing wmsds . | [ purpose ] this study investigated the variations in muscle fatigue , time to fatigue , and
maximum task duration at different levels of production standard time .
[ methods ] twenty
subjects performed repetitive tasks at three different levels of production standard time
corresponding to normal , hard and very hard . surface electromyography was used to
measure the muscle activity .
[ results ] the results showed that muscle activity was
significantly affected by the production standard time level .
muscle activity increased
twice in percentage as the production standard time shifted from hard to very hard ( 6.9%
vs. 12.9% ) .
the muscle activity increased over time , indicating muscle fatigue .
the muscle
fatigue rate increased for the harder production standard time ( hard : 0.105 ; very hard :
0.115 ) , which indicated the associated higher risk of work - related musculoskeletal
disorders .
muscle fatigue was also found to occur earlier for hard and very hard
production standard times .
[ conclusion ] it is recommended that the maximum task duration
should not exceed 5.6 , 2.9 , and 2.2 hours for normal , hard , and very hard production
standard times , respectively , in order to maintain work performance and minimize the risk
of work - related musculoskeletal disorders . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in female patients , the standard treatment for invasive carcinoma of the bladder is anterior pelvic exenteration including the bladder , anterior vagina , uterus , distal ureters , ovaries , fallopian tubes , and representative lymph nodes . in cases in which the tumor is not in the bladder neck area or in the urethra cystectomy for non muscle invasive bladder cancer is considered for patients who are at high risk of progression . these patients have multiple recurrences , high grade t1 , t1 patients with concomitant cis , and/or failed bcg . delayed cystectomy in this category would lead to diminished disease there are previous reports on genital sparing cystectomy with preservation of genital organs and the construction of orthotopic ileal neobladder [ 35 ] . there is cumulative data questioning the necessity of removing a long portion of the anterior vaginal wall , where orthotopic neobladder was possible in women with good oncological and functional outcome [ 69 ] . this study is aimed at examining the survival up to 515 years , with analysis of oncological and functional outcome in 13 young women undergoing genital sparing radical cystectomy and orthotopic ileal neobladder . between 1995 and 2004 , thirteen female patients underwent radical cystectomy ( rc ) with preservation of genital organs and orthotopic ileal neobladder urinary diversion . the female genital organs that were preserved were the entire vagina , uterus , fallopian tubes , and ovaries . all patients were informed of the detailed procedure and provided informed consent , and the study was approved by the ethics committee . inclusion criteria were urothelial carcinoma of stage t1 tumours that were recurrent , of high grade , as well as failed bcg therapy , with no concomitant cis . muscle invasive urothelial carcinoma of t2 and t3a were included in the series provided that the tumor was completely removed by trans urethral resection and was away from the trigonal area and the urethra . in all cases , there were no associated cis or dysplasia in the rest of the bladder , which was confirmed by mapping histology of the bladder on cystoscopy . abdominal ultrasonography and ct urography showed that the tumor was localised to the bladder , had no perivesical fat extension and was not at t3b or t4 tumor stage . vaginal examination and vaginal ultrasonography showed no tumours or papilloma in the cervix uteri , no detectable diseases of the uterus and ovaries . five women out of the 13 were not married , and were wishing to have a normal marital life when getting married , and approved the procedure of genital sparing cystectomy . age range was 2028 years ( mean 24 years ) in four women 4/13 ( 30.77% ) , three women 3/13 were of age range 3237 ( mean 35 years ) . to identify the uvj during cystectomy , a cystoscopic injection needle was used and guided by the alberan bridge and 30 optical telescope to inject 0.5 ml methylene blue solution in the positions 12 , 3 , 6 , 9 in the region of the uvj . an indwelling urethral catheter was passed to the bladder and filled with 10 ml saline solution . an infra umbilical incision was done , lymphadenectomy on both sides included iliac lymph nodes below the bifurcation of the common iliac vessels to the end of the external iliac vessels as well as obturator lymph nodes with clearance of the obturator fossa . the ureter was identified and followed down to the crossing of the superior vesical vessels that were ligated and divided close to the bladder wall . further down , the inferior vesical vessels were ligated and divided close to the bladder wall . the bladder was turned interiorly to get access to the vesico uterine peritoneal reflection that was opened and sharp dissection was performed to reach the posterior bladder , trigonal area . opening the vesico uterine and vesico vaginal spaces with sharp dissection would separate the posterior bladder wall from the anterior vaginal wall ( figure 1 ) . the blue colour of the methylene blue previously injected in position 6 , 3 , 9 of the uvj would be the landmarks where the bladder would be removed in the posterior level . the bladder was pushed posteriorly and careful dissection was made in the retro pubic space to reach the anterior portion of the uvj ( figure 1 ) . the bladder was separated from the uvl after application of a vascular clamp following deflation of the balloon catheter . the ileal pouch was anastomosed to the urethra with four interrupted 3/0 polyglycolic acid sutures . the two ureters were drained externally via two ureteral stents , the bladder was drained with an 18 f silicone catheter , which was anchored to the anterior abdominal wall with a harris stitch to guard against slipping of the indwelling catheter if the balloon was accidently deflated , and to avoid pressure on the anastomotic site between the ileal pouch and the urethra . sacral periosteal fascia and the two horns of the u shaped ileal neobladder were anchored to the iliopsoas fascia on either sides . these fixation steps were done to prevent anterior angulation of the neobladder with subsequent acute angulation of the neobladder anatomy of the female pelvis with relations of the urinary bladder to the female genital organs . it shows the surgical anatomy : vesico uterine space , vesico vaginal space , and urethro vesical junction . b : bladder , ur : uterus , u : urethra , v : vagina , o : ovary , f : fallopian tube , c : colo rectum , sc : sacrum , vurs : vesico uterine space , vvs : vesico vaginal space , vuj : vesico uretheral junction . final view of the procedure of female genital sparing cystectomy with construction of u shaped orthotopic ileal neobladder . sacral fascia , as well as the anchoring sutures of the horns of the u shaped ileal neobladder to the psoas muscle fascia . n : neobladder , ur : uterus , u : urethra , v : vagina , o : ovary , f : fallopian tube , sc : sacrum , ps : psoas muscle fascia ; nua : neobladder urethral anastomosis . patients were seen in the outpatient clinic as follow up 3 months , 6 months , 12 months and then annually . up included : abdominal ultrasonography , urine cytology , ct urography , annual cystoscopy , chest and abdominal radiograph . overall survival was calculated from the time of operation to the cut off date of the study ( mid 2014 ) . women who had hypercontinence were instructed to perform clean intermittent catheterisations ( cic ) five times per day and once by night.sexual function . sexual function was assessed using the female sexual function index ( fsfi ) , after 6 months from the date of the operation . reporting measure of female sexual function structured in six domains : desire , subjective arousal , lubrication , orgasm , satisfaction , and pain , with scores ranging from 3 to 36 . women who had hypercontinence were instructed to perform clean intermittent catheterisations ( cic ) five times per day and once by night . sexual function . sexual function was assessed using the female sexual function index ( fsfi ) , after 6 months from the date of the operation . reporting measure of female sexual function structured in six domains : desire , subjective arousal , lubrication , orgasm , satisfaction , and pain , with scores ranging from 3 to 36 . between 1995 and 2004 , thirteen female patients underwent radical cystectomy ( rc ) with preservation of genital organs and orthotopic ileal neobladder urinary diversion . the female genital organs that were preserved were the entire vagina , uterus , fallopian tubes , and ovaries . all patients were informed of the detailed procedure and provided informed consent , and the study was approved by the ethics committee . inclusion criteria were urothelial carcinoma of stage t1 tumours that were recurrent , of high grade , as well as failed bcg therapy , with no concomitant cis . muscle invasive urothelial carcinoma of t2 and t3a were included in the series provided that the tumor was completely removed by trans urethral resection and was away from the trigonal area and the urethra . in all cases , there were no associated cis or dysplasia in the rest of the bladder , which was confirmed by mapping histology of the bladder on cystoscopy . abdominal ultrasonography and ct urography showed that the tumor was localised to the bladder , had no perivesical fat extension and was not at t3b or t4 tumor stage . vaginal examination and vaginal ultrasonography showed no tumours or papilloma in the cervix uteri , no detectable diseases of the uterus and ovaries . five women out of the 13 were not married , and were wishing to have a normal marital life when getting married , and approved the procedure of genital sparing cystectomy . age range was 2028 years ( mean 24 years ) in four women 4/13 ( 30.77% ) , three women 3/13 were of age range 3237 ( mean 35 years ) . patients underwent urethro cystoscopy to localise the urethro vesical junction ( uvj ) . to identify the uvj during cystectomy , a cystoscopic injection needle was used and guided by the alberan bridge and 30 optical telescope to inject 0.5 ml methylene blue solution in the positions 12 , 3 , 6 , 9 in the region of the uvj . an indwelling urethral catheter was passed to the bladder and filled with 10 ml saline solution . an infra umbilical incision was done , lymphadenectomy on both sides included iliac lymph nodes below the bifurcation of the common iliac vessels to the end of the external iliac vessels as well as obturator lymph nodes with clearance of the obturator fossa . the ureter was identified and followed down to the crossing of the superior vesical vessels that were ligated and divided close to the bladder wall . further down , the inferior vesical vessels were ligated and divided close to the bladder wall . the bladder was turned interiorly to get access to the vesico uterine peritoneal reflection that was opened and sharp dissection was performed to reach the posterior bladder , trigonal area . opening the vesico uterine and vesico vaginal spaces with sharp dissection would separate the posterior bladder wall from the anterior vaginal wall ( figure 1 ) . the blue colour of the methylene blue previously injected in position 6 , 3 , 9 of the uvj would be the landmarks where the bladder would be removed in the posterior level . the bladder was separated from the uvl after application of a vascular clamp following deflation of the balloon catheter . the ileal pouch was anastomosed to the urethra with four interrupted 3/0 polyglycolic acid sutures . the two ureters were drained externally via two ureteral stents , the bladder was drained with an 18 f silicone catheter , which was anchored to the anterior abdominal wall with a harris stitch to guard against slipping of the indwelling catheter if the balloon was accidently deflated , and to avoid pressure on the anastomotic site between the ileal pouch and the urethra . sacral periosteal fascia and the two horns of the u shaped ileal neobladder were anchored to the iliopsoas fascia on either sides . these fixation steps were done to prevent anterior angulation of the neobladder with subsequent acute angulation of the neobladder anatomy of the female pelvis with relations of the urinary bladder to the female genital organs . it shows the surgical anatomy : vesico uterine space , vesico vaginal space , and urethro vesical junction . b : bladder , ur : uterus , u : urethra , v : vagina , o : ovary , f : fallopian tube , c : colo rectum , sc : sacrum , vurs : vesico uterine space , vvs : vesico vaginal space , vuj : vesico uretheral junction . final view of the procedure of female genital sparing cystectomy with construction of u shaped orthotopic ileal neobladder . sacral fascia , as well as the anchoring sutures of the horns of the u shaped ileal neobladder to the psoas muscle fascia . n : neobladder , ur : uterus , u : urethra , v : vagina , o : ovary , f : fallopian tube , sc : sacrum , ps : psoas muscle fascia ; nua : neobladder urethral anastomosis . patients were seen in the outpatient clinic as follow up 3 months , 6 months , 12 months and then annually . up included : abdominal ultrasonography , urine cytology , ct urography , annual cystoscopy , chest and abdominal radiograph . overall survival was calculated from the time of operation to the cut off date of the study ( mid 2014 ) . women who had hypercontinence were instructed to perform clean intermittent catheterisations ( cic ) five times per day and once by night.sexual function . sexual function was assessed using the female sexual function index ( fsfi ) , after 6 months from the date of the operation . reporting measure of female sexual function structured in six domains : desire , subjective arousal , lubrication , orgasm , satisfaction , and pain , with scores ranging from 3 to 36 . women who had hypercontinence were instructed to perform clean intermittent catheterisations ( cic ) five times per day and once by night . sexual function . sexual function was assessed using the female sexual function index ( fsfi ) , after 6 months from the date of the operation . reporting measure of female sexual function structured in six domains : desire , subjective arousal , lubrication , orgasm , satisfaction , and pain , with scores ranging from 3 to 36 . details of the 13 patients are in table 1 . age distribution was as follows : patients between 20 and 28 years ( mean 24 years ) were 4/13 ( 30.77% ) . women of age range of 3237 ( mean 35 years ) were 3/13 ( 23.07% ) . women of age range of 4054 ( mean 49 years ) were 6/13 ( 48.5% ) . demographic data of patients , survival , and quality of life of women treated with radical cystectomy with preservation of genital organs and had up to 15 years survival female sexual function ( index fsfi ) , ranging from 2 to 36 all tumours were urothelial carcinoma ; stage t1 were 4/13 ( 30.77% ) , stage t2 were 5/13 ( 38.46% ) , stage t3a were 3/13 ( 23.07% ) . the grades of the tumours were g1 2/13 ( 15.38% ) , g2 10/13 ( 77% ) , g3 1/13 ( 7.69% ) . surgical margins of the lower ureters and the trigonal area were negative for carcinoma in situ or dysplasia . it was evaluated as overall survival and disease free survival . women who are still alive in the year 2014 and are in good health with no evidence of disease recurrence or metastases equals 4/13 cases ( 30.77% ) ; they are numbers 1 , 2 , 8 and 9 in table 1 . two of these four women had tumor stage t1 , the other two were stage t2 . their age at the time of surgery was 20 , 25 , 28 , and 53 yrs . women who had reported good sexual function had dsfi score ranging from 20 to 32 , which was reported by 11/13 cases ( 84.61% ) . one woman had a score of 15 , while another woman was not married and had no partner and she reported a score of zero . urodynamic examination of continent women on the annual follow up showed that the neobladder capacity was mean of 315 ml ( range 280375 ) , mean maximum urethral closure pressure was 22.6 8.2 cm h2o , for a mean flow rate of 21.9 mi / s . details of the 13 patients are in table 1 . age distribution was as follows : patients between 20 and 28 years ( mean 24 years ) were 4/13 ( 30.77% ) . women of age range of 3237 ( mean 35 years ) were 3/13 ( 23.07% ) . women of age range of 4054 ( mean 49 years ) were 6/13 ( 48.5% ) . demographic data of patients , survival , and quality of life of women treated with radical cystectomy with preservation of genital organs and had up to 15 years survival female sexual function ( index fsfi ) , ranging from 2 to 36 all tumours were urothelial carcinoma ; stage t1 were 4/13 ( 30.77% ) , stage t2 were 5/13 ( 38.46% ) , stage t3a were 3/13 ( 23.07% ) . the grades of the tumours were g1 2/13 ( 15.38% ) , g2 10/13 ( 77% ) , g3 1/13 ( 7.69% ) . surgical margins of the lower ureters and the trigonal area were negative for carcinoma in situ or dysplasia . women who are still alive in the year 2014 and are in good health with no evidence of disease recurrence or metastases equals 4/13 cases ( 30.77% ) ; they are numbers 1 , 2 , 8 and 9 in table 1 . two of these four women had tumor stage t1 , the other two were stage t2 . their age at the time of surgery was 20 , 25 , 28 , and 53 yrs . women who had reported good sexual function had dsfi score ranging from 20 to 32 , which was reported by 11/13 cases ( 84.61% ) . one woman had a score of 15 , while another woman was not married and had no partner and she reported a score of zero . urodynamic examination of continent women on the annual follow up showed that the neobladder capacity was mean of 315 ml ( range 280375 ) , mean maximum urethral closure pressure was 22.6 8.2 cm h2o , for a mean flow rate of 21.9 mi / s . this work is an observational retrospective study for 15 years , examining survival and quality of life in 13 women of ages between 20 and 54 years ( mean 37 years ) . our results are compatible with the results of other published works of genital sparing radical cystectomy in women [ 35 ] . the work of koie et al . where they spared the uterus , fallopian tube , and ovary during cystectomy followed by u shaped ileal neobladder in 30 women treated for carcinoma of the bladder , had a follow up of 35.7 months . they recommended that orthotopic neobladder reconstruction with preservation of gynaecologic organs is feasible for female bladder cancer patients . they recommended this technique as it provided an acceptable oncological outcome and good voiding function . when comparing our results to koie 's , we had 8 patients with survival up to 1015 years . reported 2 cases of women undergoing sexuality preserving cystectomy for urothelial carcinoma of the bladder . these two women were 33 and 28 years , they became pregnant and had healthy children . in our series , no woman became pregnant although they reported high index of sexual function in 84.61% in their follow up after genital sparing cystectomy ali el den et al . reported 15 cases of women undergoing genital sparing cytectomy . 2 patients developed local recurrence and metastasis after 4 months of the procedure , another patient developed metastasis after 15 months . they reported that sexual function in this group was better than those who had not had genital sparing cystectomy . in the present work , free survival in early cystectomy in low stage , low grade urothelial tumor emphasises the previous work of others who advocated cystectomy in superficial urothelial carcinoma , as delayed cystectomy in these patients may lead to decreased disease specific survival . in the present study , four patients ( 30.77% ) were of stage t1 , g12 , and their survival was within the range of 915 years . the good oncological and functional results might be bias introduced by the high selection of patients . this study provides strong evidence of safety and efficacy of female genital organ sparing cystectomy in young women . the oncological and functional outcome including continence and sexual life were excellent . this procedure should be considered in highly selected women patients where surgical approach is feasible . this procedure is of significant value for young women who developed invasive carcinoma of the bladder with low stage and low grade tumours . | introductionthis is an observational retrospective study utilising long term patient follow
up for 15 years to determine the survival and quality of life in women ( age range 2054 years ) after having been treated for carcinoma of the bladder by radical cystectomy with preservation of genital organs.material and methodsthe study included 13 female patients with urothelial carcinoma of the bladder treated with genital sparing radical cystectomy during the period of 1995 until 2006 .
they had orthotopic ileal neobladder .
follow
up included recurrence
free survival , metastases free survival , overall survival , continence , and sexual function.resultsgenital sparing cystectomy was done in 13 women .
seven women were between the ages of 2037 , and 6 women were aged 3854 .
overall survival of 1015 years was 61.53% , survival from 5 to 9 years was 38.46% .
the procedure was done in 9 women with a muscle invasive tumor of stage t2 t3a .
non
muscle invasive t1 tumor was present in four patients .
quality of life was assessed by continence , which was good in 10/13 patients .
three women needed cic .
sexual function was tested by female sexual function index > 2030 and was scored at 84.61%.conclusionsthe study provides evidence of safety and efficacy of radical cystectomy with sparing of genital organs in women aged 20 to 54 with urothelial carcinoma of the bladder .
oncological outcome for 515 years was good ; continence and sexual function were good .
this procedure should be considered when surgical approach appears to be feasible .
the limitation of our findings is the small sample size of this case series . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the study protocol was approved by the committee on human studies before participants were contacted at both assessment times . baseline inclusion criteria for study participation were female sex , diagnosis of type 1 diabetes for at least 1 year , aged between 13 and 60 years , not currently pregnant , and no severe visual impairment . for the follow - up study , we sent each participant from the original study a letter explaining the project and later contacted her by telephone to describe the project in detail and answer questions . we made several attempts to locate original participants who were lost to follow - up . clinic records were searched for possible contact information , and we attempted to mail information to all addresses and emergency contacts when listed . we also searched the national death index to identify and confirm participants who died during the follow - up period . finally , we used internet search engines and a private search agency to help locate participants most up - to - date addresses . of these , 26 were known to have died , 49 declined to enroll in the follow - up study , and 108 were lost to follow - up . thus , the follow - up sample consisted of 207 women , which represents 57% of the living cohort . all subsequently described data analyses refer to the current study cohort of 207 women , unless described otherwise . at follow - up , mean age was 44 12 years and mean diabetes duration was 28 11 years . mean bmi was 25 5 kg / m , and mean a1c was 7.9 1.3% . women who participated in the follow - up study and those who declined participation or who were lost to follow - up did not differ with respect to insulin restriction status , age , diabetes duration , a1c , bmi , diabetes complications , or any of the survey measures administered at baseline . we gathered demographic and clinical information by record abstraction at baseline , including age , diabetes duration , bmi , and presence of diabetes complications . all hba1 laboratory results were converted to a1c using a formula developed through comparative testing on paired samples : a1c = ( hba1 0.19)/1.21 ( 8) . at follow - up , we completed record abstractions on participants who were still receiving their care at the clinic . those no longer being treated at the clinic received a brief record review form to be completed by their health care team . data gathered using both methods included the most recent a1c and bmi assessments and the presence of diabetes complications . i take less insulin than i should , to determine insulin restriction status in this cohort . responses were on a 6-point likert scale ranging from never , rarely , sometimes , often , usually , to always . we decided on the following definition of insulin restriction , because we believed that social desirability pressures could influence women to underreport insulin restriction as a symptom , particularly as part of research being done in a specialty diabetes center . we used their responses at baseline to categorize women as insulin restrictors if they reported any form of restriction from , rarely to always . we used a similar approach to classify participants into four categories according to their responses to the same screening question at follow - up : those who did not endorse insulin restriction at baseline and continued not to endorse insulin restriction at follow - up were categorized as never restricted . those who did not endorse insulin restriction at baseline but did endorse insulin restriction at follow - up were categorized as new insulin restriction . those who endorsed insulin restriction at baseline and continued to endorse insulin restriction at follow - up were categorized as continued insulin restriction . those who endorsed insulin restriction at baseline but no longer endorsed insulin restriction at follow - up were categorized as stopped insulin restriction . participants completed the same battery of psychosocial surveys at baseline and follow - up ; however , they completed a revised version of the self - care inventory ( sci - r ) at follow - up . for all surveys described subsequently , higher scores indicate higher levels of the variable being measured . the sci - r ( 9,10 ) measures self - reported frequency of adherence to diabetes self - care tasks , including blood glucose monitoring frequency and insulin administration . the problem areas in diabetes ( paid ) survey ( 11,12 ) is a 20-item problem questionnaire that assesses a broad range of feelings related to living with diabetes . the hypoglycemia fear survey worry subscale ( 13 ) is a 17-item questionnaire that assesses level of worry about hypoglycemia . the brief symptom inventory ( bsi ) ( 14 ) is a 53-item questionnaire that measures psychiatric symptoms . here , we examined scores on the depression and anxiety subscales as well as the global severity index . bulimia test - revised ( 15 ) is a 36-item questionnaire to measure attitudes and behaviors central to eating disorders , such as weight and shape preoccupation , fear of weight gain , restrictive eating , binge eating , and purging behaviors . we measured self - reported diabetes - specific eating and weight concerns on a 5-point and 6-point likert scale survey created specifically for the original project . participants rated how much their weight or body shape influenced how they felt about themselves as people ( not at all influenced , slightly influenced , somewhat influenced , moderately influenced , attitudes toward diabetes treatment and its relationship to weight were assessed using answers to two statements : i am afraid that getting my blood sugars in good control will cause me to gain weight always , for some analyses never was coded as no and rarely through always were coded as yes ) . this survey also included four items evaluating problems with diabetes self - management , such as poor blood glucose control , not monitoring blood glucose frequently , not taking medications at the recommend times , and not following nutrition or exercise recommendations . data are presented as means sds for continuous variables and percentages for categoric variables . the and fisher exact tests were used to compare proportions in categoric variables between 1 ) women who continued to report insulin restriction and those who stopped insulin restriction at follow - up and 2 ) women who never reported insulin restriction and those with new insulin restriction at follow - up . paired t tests were used to compare mean differences in change scores within the four groups described previously . because of multiple analyses , we used a conservative p value of < 0.01 to indicate statistical significance and p values between 0.01 and 0.05 to indicate statistical trends for group comparisons . finally , we used logistic regression analyses to predict insulin restriction status at follow - up . statistical analyses were performed using sas 9.2 software ( sas institute , cary , nc ) . the study protocol was approved by the committee on human studies before participants were contacted at both assessment times . baseline inclusion criteria for study participation were female sex , diagnosis of type 1 diabetes for at least 1 year , aged between 13 and 60 years , not currently pregnant , and no severe visual impairment . for the follow - up study , we sent each participant from the original study a letter explaining the project and later contacted her by telephone to describe the project in detail and answer questions . we made several attempts to locate original participants who were lost to follow - up . clinic records were searched for possible contact information , and we attempted to mail information to all addresses and emergency contacts when listed . we also searched the national death index to identify and confirm participants who died during the follow - up period . finally , we used internet search engines and a private search agency to help locate participants most up - to - date addresses . the original participant sample consisted of 390 women with type 1 diabetes . of these , 26 were known to have died , 49 declined to enroll in the follow - up study , and 108 were lost to follow - up . thus , the follow - up sample consisted of 207 women , which represents 57% of the living cohort . all subsequently described data analyses refer to the current study cohort of 207 women , unless described otherwise . at follow - up , mean age was 44 12 years and mean diabetes duration was 28 11 years . mean bmi was 25 5 kg / m , and mean a1c was 7.9 1.3% . women who participated in the follow - up study and those who declined participation or who were lost to follow - up did not differ with respect to insulin restriction status , age , diabetes duration , a1c , bmi , diabetes complications , or any of the survey measures administered at baseline . we gathered demographic and clinical information by record abstraction at baseline , including age , diabetes duration , bmi , and presence of diabetes complications . all hba1 laboratory results were converted to a1c using a formula developed through comparative testing on paired samples : a1c = ( hba1 0.19)/1.21 ( 8) . at follow - up , we completed record abstractions on participants who were still receiving their care at the clinic . those no longer being treated at the clinic received a brief record review form to be completed by their health care team . data gathered using both methods included the most recent a1c and bmi assessments and the presence of diabetes complications . we used responses to the screening statement , i take less insulin than i should , to determine insulin restriction status in this cohort . responses were on a 6-point likert scale ranging from never , rarely , sometimes , often , usually , to always . we decided on the following definition of insulin restriction , because we believed that social desirability pressures could influence women to underreport insulin restriction as a symptom , particularly as part of research being done in a specialty diabetes center . we used their responses at baseline to categorize women as insulin restrictors if they reported any form of restriction from , we used a similar approach to classify participants into four categories according to their responses to the same screening question at follow - up : those who did not endorse insulin restriction at baseline and continued not to endorse insulin restriction at follow - up were categorized as never restricted . those who did not endorse insulin restriction at baseline but did endorse insulin restriction at follow - up were categorized as those who endorsed insulin restriction at baseline and continued to endorse insulin restriction at follow - up were categorized as continued insulin restriction . those who endorsed insulin restriction at baseline but no longer endorsed insulin restriction at follow - up were categorized as stopped insulin restriction . participants completed the same battery of psychosocial surveys at baseline and follow - up ; however , they completed a revised version of the self - care inventory ( sci - r ) at follow - up . for all surveys described subsequently , higher scores indicate higher levels of the variable being measured . the sci - r ( 9,10 ) measures self - reported frequency of adherence to diabetes self - care tasks , including blood glucose monitoring frequency and insulin administration . the problem areas in diabetes ( paid ) survey ( 11,12 ) is a 20-item problem questionnaire that assesses a broad range of feelings related to living with diabetes . the hypoglycemia fear survey worry subscale ( 13 ) is a 17-item questionnaire that assesses level of worry about hypoglycemia . the brief symptom inventory ( bsi ) ( 14 ) is a 53-item questionnaire that measures psychiatric symptoms . here , we examined scores on the depression and anxiety subscales as well as the global severity index . bulimia test - revised ( 15 ) is a 36-item questionnaire to measure attitudes and behaviors central to eating disorders , such as weight and shape preoccupation , fear of weight gain , restrictive eating , binge eating , and purging behaviors . we measured self - reported diabetes - specific eating and weight concerns on a 5-point and 6-point likert scale survey created specifically for the original project . participants rated how much their weight or body shape influenced how they felt about themselves as people ( not at all influenced , slightly influenced , somewhat influenced , moderately influenced , attitudes toward diabetes treatment and its relationship to weight were assessed using answers to two statements : i am afraid that getting my blood sugars in good control will cause me to gain weight always , for some analyses never was coded as no and rarely through always were coded as yes ) . this survey also included four items evaluating problems with diabetes self - management , such as poor blood glucose control , not monitoring blood glucose frequently , not taking medications at the recommend times , and not following nutrition or exercise recommendations . data are presented as means sds for continuous variables and percentages for categoric variables . the and fisher exact tests were used to compare proportions in categoric variables between 1 ) women who continued to report insulin restriction and those who stopped insulin restriction at follow - up and 2 ) women who never reported insulin restriction and those with new insulin restriction at follow - up . paired t tests were used to compare mean differences in change scores within the four groups described previously . because of multiple analyses , we used a conservative p value of < 0.01 to indicate statistical significance and p values between 0.01 and 0.05 to indicate statistical trends for group comparisons . finally , we used logistic regression analyses to predict insulin restriction status at follow - up . statistical analyses were performed using sas 9.2 software ( sas institute , cary , nc ) . a total of 60 women endorsed insulin restriction at baseline ; of these , 40 continued insulin restriction at follow - up , and 20 stopped insulin restriction . of those women who continued insulin restriction at follow - up , 55% reported doing so sometimes , often , or usually . at baseline , 147 women reported appropriate insulin use , and at follow - up , 113 continued to report appropriate insulin use ; however , 34 women endorsed new insulin restriction , of whom 53% reported the behavior occurred sometimes or often . table 1 reports comparisons between women who continued to endorse insulin restriction and those who stopped insulin restriction at follow - up . the groups did not differ at baseline . at follow - up , however , women who no longer endorsed insulin restriction reported less diabetes - specific distress ( p < 0.01 ) , fewer problems with diabetes self - management ( p < 0.001 ) , higher levels of diabetes self - care ( p < 0.01 ) , lower levels of overall psychologic distress ( p < 0.01 ) , and lower levels of eating disorder symptoms ( p < 0.01 ) . women who stopped insulin restriction did not differ from women who continued to restrict with regard to the number who reported commercial weight loss attempts in their lifetimes ( 35 vs. 33% , p = 0.85 ) . specifically , relative to women who continued insulin restriction , a smaller percentage of those who stopped restricting endorsed the statement that they were afraid that getting my blood sugars in good control will cause me to gain weight women who stopped insulin restriction were also less likely to agree with the statement , taking insulin makes me gain weight ( 20 vs. 58% , p < 0.01 ) . characteristics of women who continue to endorse insulin restriction and those who stopped insulin restriction at follow - up continuous data are shown as mean sd , and categoric data as percentage . * p value symbols in this column indicate differences between means for the two groups at follow - up . prescribed diabetes management plans did not differ between groups . both reported an average of two prescribed insulin injections per day at baseline and an average of three at follow - up . those women who stopped insulin restriction reported an average of four diabetes medical appointments per year at baseline compared with six at baseline in the other group , but this was not statistically significant . the two groups also did not differ on this variable at follow - up , with a respective average of 4.8 and four diabetes medical appointments per year at follow - up . no additional differences were found between diabetes treatment plans at follow - up : 27% reported insulin pump use , 58% reported using carbohydrate counting , and 28% reported using the exchange method for meal planning . no differences were noted in the reported average number of mild hypoglycemic events in the past month , with 6.7 reported by those who stopped insulin restriction and 7.1 reported by those who continued to restrict . at baseline and follow - up , the two groups did not have different rates of women reporting one or more diabetes complications ( 47% at baseline and 63% at follow - up ) . within - group analyses of women who stopped insulin restriction showed that they also reported improvements in diabetes self - care ( p < 0.01 ) , diabetes - specific distress ( p < 0.001 ) , and problems with diabetes self - management ( p < 0.001 ) at follow - up . within - group analyses of continued insulin restrictors also showed lower average a1c ( p < 0.01 ) ; however , their average bmi increased by 2.3 points ( p < 0.001 ) , whereas the average bmi of women who stopped restricting insulin remained stable at follow - up . between - group analyses showed that problems with diabetes self - management improved more among those who stopped insulin restriction than those who continued ( 0.9 vs. 0.2 , p < 0.001 ) . after we controlled for age and follow - up bmi in a logistic regression model , fewer problems with diabetes self - management reported at follow - up ( odds ratio [ or ] 0.59 for each 10-point increase , p < 0.03 ) and less fear of weight gain associated with healthier blood glucose ranges reported at follow - up ( or 0.4 , p < 0.02 ) predicted stopping insulin restriction . table 2 summarizes comparisons between women who never endorsed insulin restriction and those who reported new insulin restriction . more new insulin restrictors than those never restricting endorsed the statement that they were afraid that getting my blood sugars in good control will cause me to gain weight ( 62 vs. 36% , p < 0.01 ) . only 23% of women who never reported insulin restriction versus 50% of women who endorsed new reported restriction reported commercial weight loss attempts in their lifetimes ( p < 0.01 ) . characteristics of women who never endorsed insulin restriction and those who newly endorse it at follow - up continuous data are presented as mean sd , and categoric data as percentage . * p value symbols in this column indicate differences between means for the two groups at baseline . p value symbols in this column indicate differences between means for the two groups at follow - up . prescribed diabetes management plans did not differ between groups . both reported an average of two prescribed insulin injections per day at baseline and an average of three at follow - up . they also reported an average of 3.5 diabetes medical appointments per year at baseline and four at follow - up . in addition at follow - up , 36% reported insulin pump use , 60% reported using carbohydrate counting , and 30% reported using the exchange method for meal planning . despite this lack of differences in prescribed diabetes management plans , there was a difference at follow - up in the reported average number of mild hypoglycemic events in the past month , with 8.4 7.9 reported by those who stopped insulin restriction and 5.6 5.6 reported by those who continued to restrict ( p < 0.05 ) . at baseline and follow - up , the rates of women reporting one or more diabetes complications ( 36% at baseline and 64% at follow - up ) were similar in the two groups . within - group analyses of women newly reporting insulin restriction showed that these women had an increase in bmi ( p < 0.01 ) and also reported an increase in fear that improved glycemia would result in weight gain ( 0.7 vs. 0.2 , p < 0.001 ) . within - group analyses of women who never reported insulin restriction also showed increased bmi ( p < 0.001 ) , improvements in diabetes - specific distress ( p < 0.001 ) , improved anxiety ( p < 0.01 ) , and fewer reported problems with diabetes self - management ( p < 0.001 ) . between - group analyses showed that women who never reported insulin restriction showed improvements in self - reported problems with diabetes self - management ( p < 0.01 ) . women endorsing new insulin restriction indicated more fear of weight gain associated with healthier blood glucose ranges relative to women who never endorsed insulin restriction who showed little change ( p < 0.01 ) . after controlling for age and follow - up bmi in a logistic regression model , problems with diabetes self - management predicted new insulin restriction ( or 1.5 for each 10-point increase , p < 0.001 ) . table 1 reports comparisons between women who continued to endorse insulin restriction and those who stopped insulin restriction at follow - up . the groups did not differ at baseline . at follow - up , however , women who no longer endorsed insulin restriction reported less diabetes - specific distress ( p < 0.01 ) , fewer problems with diabetes self - management ( p < 0.001 ) , higher levels of diabetes self - care ( p < 0.01 ) , lower levels of overall psychologic distress ( p < 0.01 ) , and lower levels of eating disorder symptoms ( p < 0.01 ) . women who stopped insulin restriction did not differ from women who continued to restrict with regard to the number who reported commercial weight loss attempts in their lifetimes ( 35 vs. 33% , p = 0.85 ) . specifically , relative to women who continued insulin restriction , a smaller percentage of those who stopped restricting endorsed the statement that they were afraid that getting my blood sugars in good control will cause me to gain weight women who stopped insulin restriction were also less likely to agree with the statement , taking insulin makes me gain weight ( 20 vs. 58% , p < 0.01 ) . characteristics of women who continue to endorse insulin restriction and those who stopped insulin restriction at follow - up continuous data are shown as mean sd , and categoric data as percentage . * p value symbols in this column indicate differences between means for the two groups at follow - up . prescribed diabetes management plans did not differ between groups . both reported an average of two prescribed insulin injections per day at baseline and an average of three at follow - up . those women who stopped insulin restriction reported an average of four diabetes medical appointments per year at baseline compared with six at baseline in the other group , but this was not statistically significant . the two groups also did not differ on this variable at follow - up , with a respective average of 4.8 and four diabetes medical appointments per year at follow - up . no additional differences were found between diabetes treatment plans at follow - up : 27% reported insulin pump use , 58% reported using carbohydrate counting , and 28% reported using the exchange method for meal planning . no differences were noted in the reported average number of mild hypoglycemic events in the past month , with 6.7 reported by those who stopped insulin restriction and 7.1 reported by those who continued to restrict . at baseline and follow - up , the two groups did not have different rates of women reporting one or more diabetes complications ( 47% at baseline and 63% at follow - up ) . within - group analyses of women who stopped insulin restriction showed that they also reported improvements in diabetes self - care ( p < 0.01 ) , diabetes - specific distress ( p < 0.001 ) , and problems with diabetes self - management ( p < 0.001 ) at follow - up . within - group analyses of continued insulin restrictors also showed lower average a1c ( p < 0.01 ) ; however , their average bmi increased by 2.3 points ( p < 0.001 ) , whereas the average bmi of women who stopped restricting insulin remained stable at follow - up . between - group analyses showed that problems with diabetes self - management improved more among those who stopped insulin restriction than those who continued ( 0.9 vs. 0.2 , p < 0.001 ) . after we controlled for age and follow - up bmi in a logistic regression model , fewer problems with diabetes self - management reported at follow - up ( odds ratio [ or ] 0.59 for each 10-point increase , p < 0.03 ) and less fear of weight gain associated with healthier blood glucose ranges reported at follow - up ( or 0.4 , p < 0.02 ) predicted stopping insulin restriction . table 2 summarizes comparisons between women who never endorsed insulin restriction and those who reported new insulin restriction . more new insulin restrictors than those never restricting endorsed the statement that they were afraid that getting my blood sugars in good control will cause me to gain weight ( 62 vs. 36% , p < 0.01 ) . only 23% of women who never reported insulin restriction versus 50% of women who endorsed new reported restriction reported commercial weight loss attempts in their lifetimes ( p < 0.01 ) . characteristics of women who never endorsed insulin restriction and those who newly endorse it at follow - up continuous data are presented as mean sd , and categoric data as percentage . * p value symbols in this column indicate differences between means for the two groups at baseline . p value symbols in this column indicate differences between means for the two groups at follow - up . prescribed diabetes management plans did not differ between groups . both reported an average of two prescribed insulin injections per day at baseline and an average of three at follow - up . they also reported an average of 3.5 diabetes medical appointments per year at baseline and four at follow - up . in addition at follow - up , 36% reported insulin pump use , 60% reported using carbohydrate counting , and 30% reported using the exchange method for meal planning . despite this lack of differences in prescribed diabetes management plans , there was a difference at follow - up in the reported average number of mild hypoglycemic events in the past month , with 8.4 7.9 reported by those who stopped insulin restriction and 5.6 5.6 reported by those who continued to restrict ( p < 0.05 ) . at baseline and follow - up , the rates of women reporting one or more diabetes complications ( 36% at baseline and 64% at follow - up ) were similar in the two groups . within - group analyses of women newly reporting insulin restriction showed that these women had an increase in bmi ( p < 0.01 ) and also reported an increase in fear that improved glycemia would result in weight gain ( 0.7 vs. 0.2 , p < 0.001 ) . within - group analyses of women who never reported insulin restriction also showed increased bmi ( p < 0.001 ) , improvements in diabetes - specific distress ( p < 0.001 ) , improved anxiety ( p < 0.01 ) , and fewer reported problems with diabetes self - management ( p < 0.001 ) . between - group analyses showed that women who never reported insulin restriction showed improvements in self - reported problems with diabetes self - management ( p < 0.01 ) . women endorsing new insulin restriction indicated more fear of weight gain associated with healthier blood glucose ranges relative to women who never endorsed insulin restriction who showed little change ( p < 0.01 ) . after controlling for age and follow - up bmi in a logistic regression model , problems with diabetes self - management predicted new insulin restriction ( or 1.5 for each 10-point increase , p < 0.001 ) . to our knowledge , this study is the first to address the natural course of insulin restriction by examining factors associated with both its resolution and new emergence over time . these findings may help inform current treatment of patients struggling with insulin restriction by providing evidence that the behaviors can improve and by identifying characteristics associated with improvement . logistic regression analyses revealed that fear of weight gain associated with improved blood glucose and problems with diabetes self - care are core issues related to both the emergence and resolution of insulin restriction . women who stopped insulin restriction and those who continued the behavior showed no between - group differences at baseline ; however , the two groups did differ at follow - up . notably , women who stopped restricting reported a higher frequency of diabetes self - care behaviors and lower levels of diabetes - specific distress and problems with self - management than women still restricting insulin at follow - up . women who stopped also endorsed fewer eating disorder symptoms and lower levels of overall psychologic distress . more importantly , among women who stopped insulin restriction , a smaller proportion continued to endorse fears that improving blood glucose control or even taking insulin would cause weight gain . although it did not reach statistical significance ( p < 0.01 ) , the mean a1c improved in women who stopped insulin restriction from 9.4% at baseline to 7.9% at follow - up , and their bmi was maintained during the same period . paradoxically , mean aic levels also improved in women who continued to restrict insulin , from 9.2 to 8.3% ; however , their bmis increased from 23.2 to 25.5 kg / m . a1c improvements in both groups may reflect the emphasis clinicians are placing on improved glycemic control since the publication of the diabetes control and complications trial results ( 17 ) . at follow - up , new insulin restrictors endorsed higher levels of problems with diabetes self - management and lower levels of overall diabetes self - care . more new insulin restrictors acknowledged using their weight as a means of judging their self - worth and also endorsed fears that improving blood glucose control would result in weight gain . despite insulin restriction , new insulin restrictors had an increase in bmi between baseline and follow - up . in fact , both groups of insulin restrictors those who continued and those newly restricting endorsed fear of weight gain associated with improved blood glucose ; however , both groups actually experienced weight gain despite insulin restriction . increases in bmi in the context of body image concerns may reinforce a cycle of negative diabetes self - care behaviors that will , for some women , include insulin restriction and disordered eating . unlike the women who never restricted insulin , whose bmis increased over time , those women who stopped insulin restriction did not increase their average bmi between baseline and follow - up . this may be due to a relative lack of weight concern among those who never restricted insulin as opposed to continued , albeit significantly healthier , weight concerns among those women who stopped insulin restriction . this interpretation may be supported by our data showing that more insulin restrictors endorse lifetime participation in commercial weight loss programs than those women who do not report insulin restriction . other studies report higher bmi as a child or teen as a risk factor for developing eating disorder behaviors ( 5,6 ) ; however , we did not find this in the adults who newly restricted at follow - up . in fact , baseline bmi did not differ among the four groups in our study . perhaps by older adolescence through adulthood , higher bmi is no longer observed as a risk factor because eating disorder behaviors have already begun by this point in women s development . this study confirms earlier research indicating that body weight and shape concerns are strongly related to insulin restriction women with type 1 diabetes ( 18,19 ) . indeed , clear differences emerged between women who stopped insulin restriction and those who newly restricted or continued to restrict ; namely , those reporting restriction identified weight as an important marker of self - worth and reported fears about insulin treatment and improvements in glycemia causing weight gain . women who stopped insulin restriction were less likely to endorse these types of weight and shape concerns relative to women who were newly restricting insulin or continuing to restrict . these findings highlight the importance of diabetes clinicians taking women s weight concerns seriously and addressing them as part of their overall diabetes treatment plans . diabetes treatment teams can actively engage women who they believe may be newly struggling with adherence problems and insulin restriction in open communication about their weight and shape concerns as they relate to diabetes adherence and insulin use . our data indicate that women who restricted insulin experienced increases in bmi , while those who stopped restricting did not . these findings could be used by diabetes clinicians as a potential tool for psychoeducation to prevent or help women to stop insulin restriction . we strongly recommend closer follow - up with nurse educators and dietitians and referrals to mental health specialists with expertise in eating disorders when needed . unfortunately , our research did not evaluate potential differences in diabetes self - care behaviors as they might pertain to the nature of the patient - diabetes team relationships and continuity of care versus transitioning between multiple care providers . we regret that our data did not allow us to analyze the influence of these factors as they may relate to the emergence or improvement of insulin restriction over time . our findings are limited by low power due to small group sizes and unbalanced numbers in each of the four comparison groups and through the use of a cross - sectional design . in addition , our data are based on self - report assessments and did not include the opportunity for interviews to more formally establish active insulin restriction . for this reason , we were also unable to ask women about their own understanding of how and why their insulin use changed over time . it may be that by limiting our evaluations to questionnaire assessments , we have missed important and as yet unrecognized variables . thus , we see a need for prospective , longitudinal research of this issue that includes frequent assessments throughout such a study s duration . there is also a need for qualitative research involving focus groups or open - ended interview questions , or both , to gain a better understanding of how women themselves understand what led them to stop insulin restriction and also what led them to start the behavior . given the important changes in attitudes about diabetes treatment , insulin use , and its relationship to weight , we also see an additional need for future research evaluating intervention strategies that directly address these core attitudes among women with type 1 diabetes who restrict insulin . such strategies could include cognitive restructuring of fears that appropriate insulin use and improved glycemia lead to weight gain and of the importance that these women place on weight as a marker of their self - worth . designing and empirically validating such treatments is critical for this high - risk population . | objectiveto determine the distinguishing characteristics of women who report stopping insulin restriction at 11 years of follow - up from those continuing to endorse insulin restriction as well as those characteristics differing in patients who continue to use insulin appropriately from new insulin restrictors.research design and methodsthis is an 11-year follow - up study of 207 women with type 1 diabetes .
insulin restriction , diabetes self - care behaviors , diabetes - specific distress , and psychiatric and eating disorder symptoms were assessed using self - report surveys.resultsof the original sample , 57% participated in the follow - up study .
mean age was 44 12 years , diabetes duration was 28 11 years , and a1c was 7.9 1.3% . at follow - up , 20 of 60 baseline insulin restrictors
had stopped restriction .
women who stopped reported improved diabetes self - care and distress , fewer problems with diabetes self - management , and lower levels of psychologic distress and eating disorder symptoms .
logistic regression indicated that lower levels of fear of weight gain with improved blood glucose and fewer problems with diabetes self - management predicted stopping restriction . at follow - up , 34 women ( 23% ) reported new restriction , and a larger proportion of new insulin restrictors , relative to nonrestrictors , endorsed fear of weight gain with improved blood glucose.conclusionsfindings indicate that fear of weight gain associated with improved blood glucose and problems with diabetes self - care are core issues related to both the emergence and resolution of insulin restriction .
greater attention to these concerns may help treatment teams to better meet the unique treatment needs of women struggling with insulin restriction . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
incidence and mortality of neonatal - acquired brain damage , especially hypoxic - ischemic brain damage ( hibd ) , have an increasing trend . brain damage of prematurity is the predominant form of the acquired brain damage in neonates who undergo neurological morbidity . administration of the recombinant human - erythropoietin ( rh - epo ) into extremely preterm infants at neonatal intensive care unit improved neurodevelopmental outcomes . however , the underlying mechanisms that support the neuroprotective effects of the rh - epo following premature brain damage remain unclear . the present study therefore used an animal model to investigate the role of rh - epo in enhanced neurological recovery , which was thought to be related to the promotion of angiogenesis . some in vitro experiments suggest that epo enhances vascular endothelial growth factor ( vegf ) secretion in neural progenitor cells through the activation of phosphatidylinositol 3 kinase ( pi3k)/akt signaling pathway . the neural progenitor cells , treated with the rh - epo , upregulate vascular endothelial growth factor receptor 2 ( vegfr2 ) expression in the cerebral endothelial cells ( ecs ) . in addition , the pi3k / akt signaling also mediates angiogenesis and vegf expression in the ecs . wang et al . found that the rh - epo increased the mobilization of endothelial progenitor cells ( epcs ) and subsequent promotion of angiogenesis . based on these studies , we hypothesized that : ( 1 ) rh - epo may increase the amount of epcs or ecs in the hypoxia - ischemic ( hi ) region of the neonatal rat model of premature brain damage through the pi3k / akt signaling pathway by promoting neovascularization ; ( 2 ) rh - epo may induce the secretion of vegf in the hi region in the neonatal rat model of premature brain damage through the pi3k / akt signaling pathway and then promote neovascularization through the vegf / vegfr system . to verify our hypothesis , we tested the phospho - akt , cd34 , vegfr2 proteins ( the surface markers for ecs and epcs ) , and vegf mrna after administration of the rh - epo . the rh - epo injection was obtained from zhongda hospital affiliated to southeast university ( china ) . antibodies were obtained from the following sources : phospho - akt ( ser 473 , d9e ) xp rabbit mab from cst ( usa ) ; rat cd34 antibody from r and d ( usa ) ; and anti - vegf receptor 2 antibody from abcam ( uk ) . pregnant sprague - dawley rats were obtained from nanjing medical university of china and were allowed to deliver . the animals were double housed with food and water supply ad libitum at a temperature- and light - controlled environment ( 12-h light / dark cycle , daily humidity , and temperature monitoring ) . all the protocols were approved by the institutional animal care and use committee of southeast university . five - day - old ( pd5 ) postnatal rats underwent permanent ligation of the right common carotid artery ( cca ) . the infant rats were then exposed to hypoxia ( 94% n2 , 6% o2 ) for 2 h as described by back et al . all the rat pups were randomized into five groups as follows : ( 1 ) control group ( i ) : without hi , rh - epo , and ly294002 ( c19h17 no3 ; a pi3k inhibitor ) ; ( 2 ) hi group ( ii ) : underwent permanent ligation of the right cca and exposed to hypoxia , but without rh - epo and ly294002 ; ( 3 ) hi + ly294002 group ( iii ) : underwent permanent ligation of the right cca ; exposed to hypoxia ; and given ly294002 , without rh - epo ; ( 4 ) hi + rh - epo group ( iv ) : underwent permanent ligation of the right cca , exposed to hypoxia , and given rh - epo , without ly294002 ; ( 5 ) hi + rh - epo + ly294002 group ( v ) : underwent permanent ligation of the right cca ; exposed to hypoxia ; given rh - epo and ly294002 . coronal sections ( 10 m ) from the brains were cut using a freezing microtome ( leica cm3050 ; leica instruments , germany ) . the slides were then baked for 1 h at 50c . after repairing antigen of the slides , the slides the slides were then incubated overnight at 4c with the primary antibody : anti - cd34 ( 10 g / ml ) , and then followed by treatment with appropriate secondary antibody for cd34 for 1 h at room temperature . each of the aforementioned steps was followed by 5-min rinses in pbs for three times . the nuclear staining procedures using dapi ( abcam , uk ) were the same as above . the cd34 protein ( red ) and nucleus ( blue ) were examined with an epifluorescence microscope ( nikon , japan ) . three sections from each rat were taken from the right white matter region and the cells in the white matter were counted ( per 400 ) in three areas by two blinded independent observers . protein concentration was determined by the bca protein assay kit ( keygen biotech , china ) . homogenate protein ( 30 l ) was heated for 5 min at 99c and then subjected to 10% sodium dodecyl sulfate - polyacrylamide gel electrophoresis gel . after electrophoresis , the proteins were electroblotted on the nitrocellulose ( nc ) membrane and blocked with 5% skim milk . the immobilized proteins were exposed to commercially available antibodies such as phospho - akt ( 1:2000 ) , cd34 ( 0.1 g / ml ) , and vegfr2 ( 0.2 g / ml ) . specific proteins were detected with secondary antibody and visualized by high - sig ecl reagents ( tanon , china ) . western blotting for the glyceraldehyde-3-phosphate dehydrogenase ( gapdh , 1:1000 ; abcam , uk ) was performed as loading control , and band densities were semi - quantified using image - j software ( national institutes of health , bethesda , usa ) . total rna was extracted from the right brains of rats using trizol ( invitrogen , california , usa ) , and cdna was synthesized using a kit ( invitrogen ) . polymerase chain reaction ( pcr ) was performed using the sybr green opcr mix kit ( invitrogen ) , and -actin was used as an internal control . the reverse transcription conditions were 10 min at 25c , 30 min at 42c , and 5 min at 85c . the amplification program consisted of activation at 94c for 30 s , followed by 45 amplification cycles , each consisting of 94c for 10 s , 60c for 12 s , and 72c for 30 s. primer pairs used for amplification were as follows : vegf , forward 5-aacgtcactatgcagatcatgc-3 , reverse 5-ctccgctctgaacaaggct-3 ; -actin , forward 5-ctgaaccctaaggccaacc-3 , and reverse 5-agcgcgtaaccctcatagat-3. data were analyzed using gel - pro32 analyzer ( thermo fisher scientific , usa ) . the relative value of mrna = the absorbance value of objective fragment / the absorbance value of -actin . multiple comparisons were conducted using one - way analysis of variance ( anova ) followed by student newman a statistically significant difference between means was considered when p < 0.05 . data in the figures and text are expressed as means standard deviation ( sd ) . the rh - epo injection was obtained from zhongda hospital affiliated to southeast university ( china ) . antibodies were obtained from the following sources : phospho - akt ( ser 473 , d9e ) xp rabbit mab from cst ( usa ) ; rat cd34 antibody from r and d ( usa ) ; and anti - vegf receptor 2 antibody from abcam ( uk ) . pregnant sprague - dawley rats were obtained from nanjing medical university of china and were allowed to deliver . the animals were double housed with food and water supply ad libitum at a temperature- and light - controlled environment ( 12-h light / dark cycle , daily humidity , and temperature monitoring ) . all the protocols were approved by the institutional animal care and use committee of southeast university . five - day - old ( pd5 ) postnatal rats underwent permanent ligation of the right common carotid artery ( cca ) . the infant rats were then exposed to hypoxia ( 94% n2 , 6% o2 ) for 2 h as described by back et al . all the rat pups were randomized into five groups as follows : ( 1 ) control group ( i ) : without hi , rh - epo , and ly294002 ( c19h17 no3 ; a pi3k inhibitor ) ; ( 2 ) hi group ( ii ) : underwent permanent ligation of the right cca and exposed to hypoxia , but without rh - epo and ly294002 ; ( 3 ) hi + ly294002 group ( iii ) : underwent permanent ligation of the right cca ; exposed to hypoxia ; and given ly294002 , without rh - epo ; ( 4 ) hi + rh - epo group ( iv ) : underwent permanent ligation of the right cca , exposed to hypoxia , and given rh - epo , without ly294002 ; ( 5 ) hi + rh - epo + ly294002 group ( v ) : underwent permanent ligation of the right cca ; exposed to hypoxia ; given rh - epo and ly294002 . coronal sections ( 10 m ) from the brains were cut using a freezing microtome ( leica cm3050 ; leica instruments , germany ) . the slides were then baked for 1 h at 50c . after repairing antigen of the slides , the slides the slides were then incubated overnight at 4c with the primary antibody : anti - cd34 ( 10 g / ml ) , and then followed by treatment with appropriate secondary antibody for cd34 for 1 h at room temperature . each of the aforementioned steps was followed by 5-min rinses in pbs for three times . the nuclear staining procedures using dapi ( abcam , uk ) were the same as above . the cd34 protein ( red ) and nucleus ( blue ) three sections from each rat were taken from the right white matter region and the cells in the white matter were counted ( per 400 ) in three areas by two blinded independent observers . protein concentration was determined by the bca protein assay kit ( keygen biotech , china ) . homogenate protein ( 30 l ) was heated for 5 min at 99c and then subjected to 10% sodium dodecyl sulfate - polyacrylamide gel electrophoresis gel . after electrophoresis , the proteins were electroblotted on the nitrocellulose ( nc ) membrane and blocked with 5% skim milk . the immobilized proteins were exposed to commercially available antibodies such as phospho - akt ( 1:2000 ) , cd34 ( 0.1 g / ml ) , and vegfr2 ( 0.2 g / ml ) . specific proteins were detected with secondary antibody and visualized by high - sig ecl reagents ( tanon , china ) . western blotting for the glyceraldehyde-3-phosphate dehydrogenase ( gapdh , 1:1000 ; abcam , uk ) was performed as loading control , and band densities were semi - quantified using image - j software ( national institutes of health , bethesda , usa ) . total rna was extracted from the right brains of rats using trizol ( invitrogen , california , usa ) , and cdna was synthesized using a kit ( invitrogen ) . polymerase chain reaction ( pcr ) was performed using the sybr green opcr mix kit ( invitrogen ) , and -actin was used as an internal control . the reverse transcription conditions were 10 min at 25c , 30 min at 42c , and 5 min at 85c . the amplification program consisted of activation at 94c for 30 s , followed by 45 amplification cycles , each consisting of 94c for 10 s , 60c for 12 s , and 72c for 30 s. primer pairs used for amplification were as follows : vegf , forward 5-aacgtcactatgcagatcatgc-3 , reverse 5-ctccgctctgaacaaggct-3 ; -actin , forward 5-ctgaaccctaaggccaacc-3 , and reverse 5-agcgcgtaaccctcatagat-3. data were analyzed using gel - pro32 analyzer ( thermo fisher scientific , usa ) . the relative value of mrna = the absorbance value of objective fragment / the absorbance value of -actin . multiple comparisons were conducted using one - way analysis of variance ( anova ) followed by student newman data in the figures and text are expressed as means standard deviation ( sd ) . the content of phospho - akt in the right white matter of premature brains was determined by western blot assays . nineteen minutes after the whole operation , the results revealed a significant increase in phospho - akt in group iv compared with the other groups [ p < 0.05 ; figure 1a ] . group iii was less than groups iv , v , and ii [ p < 0.05 ; figure 1a ] . however , there was no significant statistical significance when we compared group i and group iii ( p > 0.05 ) . group ii was higher than group i [ p < 0.05 ; figure 1a ] . expressions of p - akt , cd34 , and vegfr2 in the right white matter of premature brain were analyzed by western blot analysis . ( a ) representative bands and bar graph showing expression of p - akt 90 min after the whole operation . ( b ) representative bands and bar graph showing expression of cd34 2 days after the whole operation . ( c ) representative bands and bar graph showing expression of vegfr2 2 days after the whole operation . group iv showing significant difference from other groups ( p < 0.05 ) ; group iii showing significant difference from groups iv , v , and ii ( p < 0.05 ) ; group ii showing significant difference from group i ( p < 0.05 ) . the content of cd34 and vegfr2 proteins in the right white matter of premature brain was also determined by western blot assays . two days after the whole operation , the amount of cd34 and vegfr2 proteins in group iv was higher than in the other groups [ p < 0.05 ; figure 1b and 1c ] . group v was lower than group iv [ p < 0.05 ; figure 1b and 1c ] but higher than group iii [ p < 0.05 ; figure 1b and 1c ] . group iii was lower than group ii [ p < 0.05 ; figure 1b and 1c ] but had no significant statistical significance when compared with group i [ p > 0.05 ; figure 1b and 1c ] . group ii was a little higher than group i [ p < 0.05 ; figure 1b and 1c ] . the trends of the cd34 and vegfr2 proteins in the five groups were consistent with the amount of phospho - akt in the right white matter of premature brains . two days after the whole operation , the trends of cd34 cells count in the five groups after the immunofluorescence experiments were consistent with results for the cd34 protein in the western blot assays [ figure 2a and 2b ] . at the same time , group ii was a little higher than group i [ p < 0.05 ; figure 2a and 2b ] and group iii [ p < 0.05 ; figure 2a and 2b ] . expressions of cd34 cells and vegf in the right white matter of premature brain 2 days after the whole operation . ( a ) immunofluorescence staining for cd34 cells ( red : cd34 ; blue : nucleus ) . group iv showing significant difference from other groups ( p < 0.05 ) ; group iii showing significant difference from groups iv , v , and ii ( p < 0.05 ) ; group ii showing significant difference from group i ( p < 0.05 ) . gapdh : glyceraldehyde-3-phosphate dehydrogenase ; vegf : vascular endothelial growth factor ; qrt - pcr : quantitative real - time - polymerase chain reaction . the vegf mrna level was assessed by quantitative real - time pcr during hi in the right white matter of premature brains . two days after the whole operation , the vegf mrna level in group iv was significantly higher than in the other four groups [ p < 0.05 ; figure 2c ] . group iii was significantly lower than in the other four groups [ p < 0.05 ; figure 2c ] . the exogenous rh - epo could have upregulated the expression of vegf through the pi3k / akt signaling pathway during the hi in the white matter of premature brains . group ii was a little higher than group i [ p < 0.05 ; figure 2c ] and group iii [ p < 0.05 ; figure 2c ] . the content of phospho - akt in the right white matter of premature brains was determined by western blot assays . nineteen minutes after the whole operation , the results revealed a significant increase in phospho - akt in group iv compared with the other groups [ p < 0.05 ; figure 1a ] . group iii was less than groups iv , v , and ii [ p < 0.05 ; figure 1a ] . however , there was no significant statistical significance when we compared group i and group iii ( p > 0.05 ) . group ii was higher than group i [ p < 0.05 ; figure 1a ] . expressions of p - akt , cd34 , and vegfr2 in the right white matter of premature brain were analyzed by western blot analysis . ( a ) representative bands and bar graph showing expression of p - akt 90 min after the whole operation . ( b ) representative bands and bar graph showing expression of cd34 2 days after the whole operation . ( c ) representative bands and bar graph showing expression of vegfr2 2 days after the whole operation . group iv showing significant difference from other groups ( p < 0.05 ) ; group iii showing significant difference from groups iv , v , and ii ( p < 0.05 ) ; group ii showing significant difference from group i ( p < 0.05 ) . the content of cd34 and vegfr2 proteins in the right white matter of premature brain was also determined by western blot assays . two days after the whole operation , the amount of cd34 and vegfr2 proteins in group iv was higher than in the other groups [ p < 0.05 ; figure 1b and 1c ] . group v was lower than group iv [ p < 0.05 ; figure 1b and 1c ] but higher than group iii [ p < 0.05 ; figure 1b and 1c ] . group iii was lower than group ii [ p < 0.05 ; figure 1b and 1c ] but had no significant statistical significance when compared with group i [ p > 0.05 ; figure 1b and 1c ] . group ii was a little higher than group i [ p < 0.05 ; figure 1b and 1c ] . the trends of the cd34 and vegfr2 proteins in the five groups were consistent with the amount of phospho - akt in the right white matter of premature brains . two days after the whole operation , the trends of cd34 cells count in the five groups after the immunofluorescence experiments were consistent with results for the cd34 protein in the western blot assays [ figure 2a and 2b ] . at the same time , 0.05 ; figure 2a and 2b ] and group iii [ p < 0.05 ; figure 2a and 2b ] . expressions of cd34 cells and vegf in the right white matter of premature brain 2 days after the whole operation . ( a ) immunofluorescence staining for cd34 cells ( red : cd34 ; blue : nucleus ) . group iv showing significant difference from other groups ( p < 0.05 ) ; group iii showing significant difference from groups iv , v , and ii ( p < 0.05 ) ; group ii showing significant difference from group i ( p < 0.05 ) . gapdh : glyceraldehyde-3-phosphate dehydrogenase ; vegf : vascular endothelial growth factor ; qrt - pcr : quantitative real - time - polymerase chain reaction . the vegf mrna level was assessed by quantitative real - time pcr during hi in the right white matter of premature brains . two days after the whole operation , the vegf mrna level in group iv was significantly higher than in the other four groups [ p < 0.05 ; figure 2c ] . group iii was significantly lower than in the other four groups [ p < 0.05 ; figure 2c ] . the exogenous rh - epo could have upregulated the expression of vegf through the pi3k / akt signaling pathway during the hi in the white matter of premature brains . group ii was a little higher than group i [ p < 0.05 ; figure 2c ] and group iii [ p < 0.05 ; figure 2c ] . administration of the rh - epo after ischemia , either peripherally or centrally injected , suggested beneficial effects on brain edema by delaying the neuronal death and resulted in functional improvement of neurons in neonatal animal models . the injection of rh - epo centrally is not a practical approach in clinical settings , and indeed , systemic delivery of the rh - epo has advantages in that it is universally available to the capillary endothelium and thus potentially present everywhere in the brain . in addition , the receptors of epo are extensively expressed in the mature brain , including hippocampus . a study showed that the peak time of administrating epo peripherally was 3 h in the brain tissue of rodents . based on this finding , in our experiments , we administered the rh - epo by intraperitoneal injection before hi ( 2 h ) . akt was originally identified by staal in 1987 , which was also known as pkb . the akt is the downstream protein for the pi3k and can be activated by growth factors and other extracellular stimulators . ly294002 can inactive the sites ( ser473/thr308 ) of the akt to inhibit its phosphorylation . in this study , the rh - epo increased the number of cd34 cells in the hi zone of rat brain through the pi3k / akt signaling pathway . moreover , the rh - epo induces epcs immigration into the hi zone and then the epcs proliferation and differentiation to form the new blood vessels . this physiological process is called vasculogenesis , whereby the new blood vessels are formed where no preexisting vessels were present . on the other hand , the ecs from the capillaries in the hi zone of brain proliferate and form the new blood vessels . this physiological process is called angiogenesis , which involves the growth and development of new blood vessels from preexisting vessels . the rh - epo may therefore regulate blood vessels growth through two mechanisms : vasculogenesis and angiogenesis . vegfr2 can combine with the vegf and can be activated to induce neovascularization . in this study , the expression of vegfr2 protein and vegf mrna levels were significantly upregulated by the rh - epo through the pi3k / akt pathway in the hi zone of the brain . first , this result indicated that the rh - epo could activate the vegf / vegfr2 signaling pathway through the pi3k / akt pathway . second , the increased expression of vegfr2 could combine with more vegf and then enhance neovascularization of the vegf . third , the vegfr2 is 100% expressed in the mature ecs but not in the epcs . our study has showed that the rh - epo could significantly stimulate the ecs proliferation by the pi3k / akt pathway in the hi brain . in our study , the protein levels of p - akt , cd34 , vegfr2 , and mrna level of vegf in the hi group were a little higher than in the same group . hence , we hypothesized that these changes were induced by the endogenous epo which was induced by hypoxia . the expressions of p - akt , cd34 , vegfr2 , and vegf in group v were all between group iii and group iv in our study . there may also be some other signaling pathways which were activated by the rh - epo that could not be inhibited by ly294002 . moderate neovascularization is beneficial to the hi zone of premature brain which can provide enough oxygen and energy to the surrounding cells . this information offers hope for the potential neovascularization by these molecules for clinical benefits . in conclusion , our study has demonstrated that the pi3k / akt signaling pathway is one of the essential mechanisms for neovascularization of rh - epo . the rh - epo induces cd34 cell immigration into the hypoxic and ischemic zone of premature rat brain and also upregulates the expression of vegfr2 protein and vegf mrna level through the pi3k / akt signaling pathway . this work was supported by a grant from the national natural science foundation of china ( no . this work was supported by a grant from the national natural science foundation of china ( no . | background : recombinant human - erythropoietin ( rh - epo ) has therapeutic efficacy for premature infants with brain damage during the active rehabilitation and anti - inflammation . in the present study , we found that the rh - epo was related to the promotion of neovascularization .
our aim was to investigate whether rh - epo augments neovascularization in the neonatal rat model of premature brain damage through the phosphatidylinositol 3 kinase ( pi3k)/protein kinase b ( akt ) signaling pathway.methods:postnatal day 5 ( pd5 ) , rats underwent permanent ligation of the right common carotid artery and were exposed to hypoxia for 2 h. all the rat pups were randomized into five groups as follows : ( 1 ) control group ; ( 2 ) hypoxia - ischemic ( hi ) group ; ( 3 ) hi + ly294002 group ; ( 4 ) hi + rh - epo group ; and ( 5 ) hi + rh - epo + ly294002 group .
the phospho - akt protein was tested 90 min after the whole operation , and cd34 , vascular endothelial growth factor receptor 2 ( vegfr2 ) , and vascular endothelial growth factor ( vegf ) were also tested 2 days after the whole operation.results:in the hypoxic and ischemic zone of the premature rat brain , the rh - epo induced cd34 + cells to immigrate to the hi brain zone ( p < 0.05 ) and also upregulated the vegfr2 protein expression ( p < 0.05 ) and vegf mrna level ( p < 0.05 ) through the pi3k / akt ( p < 0.05 ) signaling pathway when compared with other groups.conclusions:the rh - epo treatment augments neovascularization responses in the neonatal rat model of premature brain damage through the pi3k / akt signaling pathway . besides , the endogenous epo may exist in the hi zone of rat brain and also has neovascularization function through the pi3k / akt signaling pathway . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
cornea is mostly composed of collagen and water and is enveloped by epithelium and endothelium . in addition , a concomitant nerve regrowth and a controlled neovascularization of the damaged surface may occur [ 2 , 3 ] . the mechanism driving the epithelialization involves a multiplicity of cells stimulated by serum growth factors ( gfs ) ( table 1 ) [ 46 ] , mostly contained in platelet- granules and issued by the same gfs into the blood during stress and tissue repair [ 410 ] . the great quantity and accessibility of gfs and other signaling proteins in platelets with a consequent inhibition of cell apoptosis and improvement of cell proliferation , differentiation , and migration suggested the extensive use of platelet derivatives for clinical and surgical aims in regenerative medicine ( table 1 and figure 1 ) [ 7 , 11 ] . indeed , gfs , binding to tyrosine kinase or g protein - coupled receptor families , drive both the inflammatory process and the stroma remodeling through autocrine , juxtacrine , or , most commonly , paracrine means . thus , the transcription of critical proteins for cell cycle returning to prewounding levels after the tissue healing occurs ( table 1 ) [ 12 , 13 ] . particularly , serum gfs such as epidermal growth factor ( egf ) , hepatocyte growth factor ( hgf ) , and keratinocyte growth factor ( kgf ) stimulate corneal wound closure accelerating the healing time . moreover , transforming growth factor-1/2 ( tgf 1/2 ) induces myofibroblast from fibroblast differentiation coupled to corneal opacification ( corneal haze ) ( table 1 ) [ 1416 ] . moreover , cytokines derived from the trigeminal nerve like substance p , neuropeptide y , catecholamines , and acetylcholine are positively involved in corneal healing . besides , an aged decreased response to mitogens mediated by alterations in the expression and activity of cyclin - dependent kinase inhibitors ( p27kip1 , p16ink4a , and p21cip1 ) appears to be involved in a lacking or a damaging of cellular repair processes . toward this context , the lachrymal film plays a critical role such as resource of gfs [ 1824 ] since the lack of tear epitheliotropic support promotes corneal opacity onset with consequent visual impairment . on the other hand , tear upregulation drives corneal epithelial hyperplasia , excessive deposition of extracellular matrix , and hypervascularization with cornea conjunctivalization . here , we report the different concentrations of each gf in the human serum with respect to tears . the levels of transforming growth factor ( tgf- ) , hepatocyte growth factor ( hgf ) , tgf1/2 , and nerve growth factor ( ngf ) resulted to be even more elevated in serum than in tears . failure of the corneal repair mechanisms leads to a chronic pathologic condition as persistent epithelial defects ( ped ) or dry eye syndrome ( des ) . ped result from several factors such as aging , chemical burns , systemic disorders , and drugs ( figure 1 ) nevertheless , des , associated to tear deficit or tear inefficiency , is able to promote the corneal epithelial instability and inflammation [ 27 , 28 ] supporting ped syndrome . des is caused by lacrimal gland imbalance often connected to systemic inflammatory diseases [ 2932 ] , such as sjogren 's syndrome , rheumatoid arthritis , diabetes , systemic lupus erythematosus , acne rosacea , and graves ' disease . in addition , hormonal modifications , drugs ( e.g. , systemic antihistamines , diuretics , and topical beta blockers for glaucoma therapies ) , and surgeries ( e.g. , photorefractive keratectomy and laser in situ keratomileusis ) as well as the repeated use of contact lenses could be involved in des development . on the basis of mechanistic criteria , international dry eye workshop has characterized two main subtypes of the disorder ( aqueous deficiency and evaporative dry eye ) both interested by tear film instability and symptoms of discomfort [ 28 , 37 ] . ocular dryness or irritation might increase light sensitivity , foreign body sensation , red eyes , poor vision , and daily life limitations which are the most referred symptoms which have great impact on patient quality of life [ 37 , 38 ] . the best clinical marker for des diagnosis and for the severity assessment is represented by the improved tear osmolarity . in addition , tear production is currently evaluated by schirmer 's testing , fluorescein clearance , and fluorescein tear break - up time ( tbut ) . the ocular surface damage is estimated through dye staining ( fluorescein and lissamine green ) while the severity of subjective symptoms is assessed by subjective scored questionnaires ( like oxford score and ocular surface disease index ) [ 37 , 38 ] . up to now , there is no gold standard therapy for des or ped [ 4042 ] . current therapeutic strategies require the accurate identification of etiologic mechanisms that cause the corneal injury by providing epitheliotropic factors and enhancing tear replacement [ 26 , 43 , 44 ] . when standard therapeutic options fail , the main treatment purpose is the increased patient comfort and corneal moisture through the instillation of artificial tears , corticosteroids , antibiotics , and use of bandage contact lenses [ 30 , 4547 ] . however , natural tears have a particular composition of water , salts , hydrocarbons , proteins , and lipids that can not be restored by pharmacological alternatives . furthermore , artificial tear substitutes contain chemical preservatives associated with toxic and allergic reactions , especially for those patients with sensitive eyes . moreover , the repeated instillation of topical corticosteroids could be associated with long - term side effects including cataracts and increased intraocular pressure . for these motivations , alternative therapies like silicone punctal plug insertion , botulinum neurotoxin type a , nutritional supplements ( essential fatty acids , including omega-3 , linoleic acid , and gamma - linoleic acid ) , and topical 0.05% solution of cyclosporine a have been proposed [ 4955 ] . however , changes in life style as an increased water intake and reduction of alcohol consumption , indoor humidifiers , and air filters or cleaners have been recommended . a debated aspect of the treatment of corneal diseases is focused on the use of novel regenerative instruments for corneal regeneration [ 5760 ] . the evidence regarding the key role of several gfs for the integrity of the ocular surface ( table 1 ) fits the use of single recombinant gfs in several human corneal degenerative disorders [ 5761 ] . nerve growth factor ( ngf ) alteration in corneal diseases has been largely evaluated ; ngf pathway alteration has been tested in an animal model by demonstrating ngf to be involved in corneal healing and in sensory denervation . moreover , in studies evaluating human being , low tears level of ngf has been proved to be reduced in eyes affected by dry eye and has been proved to be effective in several corneal diseases such as neurotrophic keratitis , immune corneal ulcer , and hsv keratitis and after cataract surgery . clinical trials are ongoing to evaluate therapy with ngf eye drops in corneal diseases and first results seem to be very promising . in addition , a conditioned medium derived from human uterine cervical stem cells has been tested for corneal epithelial healing , and a therapeutically ocular surface medium , routinely used to culture epithelial cells , was suggested as novel eye drops for des and ped . among these emerging therapies , the use of biologic eye drops derived from both human peripheral [ 44 , 50 , 6875 ] and umbilical cord blood serum [ 7678 ] plays a crucial role in several corneal diseases . previous in vitro experiments showed that corneal epithelial cell morphology and cell functions are better maintained by human serum eye drops ( se ) than pharmaceutical tear substitutes . the first applications of human se to support corneal regeneration were performed in 1975 in corneal alkali injury cases ; later , in 1984 , fox et al . reported the use of se in a des . later , se have gained a therapeutic dignity in ophthalmology as a new concept to manage wounded cornea [ 82 , 83 ] . to date , despite the fact that se therapy could avoid drug side effects , its use is restricted and is not universally recognized as therapeutic option although several aspects of the whole regenerative medicine are still debated . here , we critically analyzed the current applications of se in corneal diseases like des and ped by focusing on crucial topics for its production and the current legislative restrictions in support of its use . to analyze the se therapeutic achievement , we reported the most recent published randomized clinical trials ( rtcs ) and ongoing studies where this kind of treatment has been applied and compared to standard and other emergent treatments in severe ocular conditions . the use of se obtained from patient peripheral whole blood ( autologous ) or from healthy donor ( nonautologous or allogenic ) represents a biological therapeutic strategy influencing and promoting the corneal restitution [ 11 , 68 , 83 ] . the rationale for its use arises from its strong similarity to tears , in regard to ph ( 7.4 ) and osmolarity ( 298 mml for tears and 296 mml for serum ) as well as its biochemical constitution . in addition , se offer the same platelet derived antibacterial and anti - inflammatory effect in vivo . despite the fact that multiple studies supported the safety and efficacy of se over standard treatments , se have not yet been considered for approval by food and drug administration , in the united states . for this reason , se are not a recognized treatment and are not covered by most of medical insurances . in addition , despite the improved reliability of current serologic tests for hbs - ag , anti - hcv , anti - hiv-1/2 , and syphilis detection , the use of allogenic se is associated with the immunologic and infectious implications of donor exposure . however , even though autologous se should be considered the best choice , patients with absolute contraindications to provide blood as a result of specific diseases or conditions ( e.g. , bacteremia ) or who are unable to tolerate frequent venipunctures are eligible for the treatment with healthy donor se . the allogenic se , subjected to severe laboratory checks , can be used as an effective alternative treatment showing comparable clinical results to the autologous one [ 73 , 86 ] . the established criteria for donor enrollment and for blood collection include hemoglobin level higher than 11 g / dl ( hematocrit > 33% ) and exclude subjects presenting risk of bacteremia and cardiovascular diseases deferring pregnant women and children . despite the absence of absolute prohibitions , the use of se in children is restricted to avoid repeated required venipunctures and limiting instillation of potentially infectious donor sera in such patients [ 86 , 87 ] . in these cases , if traditional therapy with artificial tears , antibiotics , or steroids is not effective , the topical cyclosporine or the conjunctival flap can be applied to improve the corneal conditions . according to the current protocols , blood samples should be collected with previous informant consent and transferred into a sterile kit or blood bag without anticoagulant and treated under sterile conditions ( laminar flow hood ) ( table 2 ) . a sufficient time has to be dedicated to the patient to illustrate properly the treatment and the need for repeated blood sampling . as shown in table 2 , the routine production of se is frequently affected by the lack of recognized procedures [ 11 , 85 ] . however , the proper management , handling , and storage of final product are essential for the successful treatment avoiding side effects . to date , many laboratory protocols have been published for se production with variable dilutions of serum ( from 20% to 100% ) and with differences in clotting phase , centrifugation time , and speed [ 88 , 89 ] ( table 2 ) . according to previous studies , clotting time is critical to obtain ideal concentrations of egf , tgf--1 , and fibronectin in the collected serum . in addition , a proper serum dilution is recommended to reduce the antiproliferative effect of tgf- which results five times higher in human serum than in tears . usually , 0.9% sodium saline or balanced salt solutions are utilized as diluents and preservatives solutions are not usually added to decrease the risk of induced toxicity . for the lack of preservatives , microbial cultures as well as the antibiotic therapy are recommended . finally , to preserve the biologic activity , the se should be frozen in blood banks at 70c until its use or at 20c for a month and protected from light to prevent the degradation of vitamin a ( table 2 ) . depending on clinical conditions , the frequency of instillations of se may go from every 15 minutes to two times per day ; also the duration of the reported treatment widely ranged from 3 days to a maximum of 36 months . in most cases , the improvement appears after a brief period of therapy ( from 1 to 4 weeks ) . studies reported one case of corneal immunoglobulin deposition , scleral vasculitis , epithelial erosion , conjunctivitis , decreased corneal sensitivity , inflammatory response , infections , and an isolated case of mycosis . recently , to avoid immunity complications , anitua et al . have characterized a plasma rich in gf without ige and complement suggesting its use in autoimmune diseases . until now , the few published data on clinical complications associated with se have demonstrated the safety of this therapy . as shown in table 2 , several studies investigated the role of se treatment mostly in corneas affected by des and ped . despite the fact that most of the authors found objective and subjective wellbeing after the treatment with se , the comparison of clinical results is complex because data have been obtained from nonhomogeneous populations affected by several unrelated corneal diseases . in addition , the technical preparation of se shows different dilutions obtained with different solutions , clotting phases , centrifugation forces , and time intervals , as well as different storage temperatures and times that can modify the final clinical outcomes and healing times as shown in table 2 . recent results have confirmed the efficacy of se with respect to conventional therapy in patients with severe des or ped [ 79 , 92 ] both by improving tear film stability and providing subjective comfort . moreover , two recent prospective interventional studies [ 93 , 94 ] , on large cohorts of patients with ped treated with se after ocular surgery , showed a significant or moderate improvement of delayed heal . in particular , chen et al . showed that 165 patients treated with 20% se after penetrating keratoplasty drastically reduced postoperative ped when compared to patients that received artificial tears . in addition , lekhanont et al . evaluated se for ped in 181 patients showing a high proportion ( 93.92% ) of complete corneal epithelialization in only 4 days with low rate of adverse reactions . case reports have been described about the use of se in other corneal diseases like ocular graft versus host disease [ 95 , 96 ] , bullous keratopathy , fulminant bilateral haemophilus influenzae keratitis , neurotrophic corneal ulcer , anterior tissue necrosis after porous orbital implant , and mooren 's ulcer . in all these cases , se allowed a complete corneal healing with an effective improvement of the clinical conditions . despite many promising results , some recent studies have questioned the validity of this treatment . a prospective cross - sectional study on 34 patients did not find that se could be effective in secondary sjogren 's syndrome due to elevated serum proinflammatory cytokine levels . moreover , a single prospective study on 17 patients with des demonstrated the short - term benefit of se , which persisted up only to three months after the end of therapy . in 2013 , pan et al . performed a meta - analysis identifying four randomized clinical trials , which compared se with artificial tear treatment or saline solutions in patients with sjogren 's syndrome - related des , non - sjogren 's syndrome des , and postoperative des . in conclusion , they advocated the need of recognized measures to define subjective symptoms and to assess the real effect of se therapy for des . the use of se was compared in randomized trials to unconventional biologic therapies , which have gained a growing interest , such as umbilical cord blood serum ( cbs ) [ 103 , 104 ] and amniotic membrane transplant . cbs is collected from umbilical vein after fetal delivery , manipulated , and collected similarly to peripheral serum . cbs is considered a reliable source of undifferentiated mesenchymal stem cells [ 106 , 107 ] , which are self - renewal elements that are able to replace directly corneal keratocytes and conjunctival , limbal , and retinal nerve cells . in addition , cbs contains consistent levels of cytokines , gfs , fibronectin , prealbumin , and fatty oils that provide useful instruments for corneal differentiation [ 74 , 108 ] . moreover , cbs includes antibacterial agents as igg , lysozyme , and complement but lower levels of vitamin a compared to peripheral serum . despite the reduced immunogenicity of cbs with respect to peripheral serum due to the lower levels of igm anti - a , anti - b , and igg2 [ 78 , 107 ] , the use of the first is naturally associated to donor exposure and increased infectious risk and subjected to obstetric factors which could modify gf levels . some authors tested cbs for ped [ 77 , 103 ] , des , corneal diseases due to chemical burns , and surgeries associated [ 113 , 114 ] . due to prominent gfs , anti - inflammatory cytokines , and mesenchymal stem cell levels in cbs , some authors demonstrated the main effectiveness of cbs with respect to both conventional treatment and traditional se in severe corneal diseases [ 77 , 104 , 109 , 112 ] . for this reason , clinical ongoing trials are mostly focused on the comparative evaluation of the use of se and cbs , especially in des , ped , and ocular gvhd as summarized in table 3 . in six ongoing studies reported on cbs eye drops , four are comparing cbs versus traditional se and only one study analyzes amniotic membrane transplant versus se in 180 patients with ped . probably , promising results will arise from a large cohort randomized intervention single blind study which has enrolled 165 patients with diabetic retinopathy and penetrating keratoplasty comparing se with standard treatments like corticosteroids and antibiotics . to date , there are no follow - up studies on se or cbs eye drops treatment . several fields of medicine are focusing on a regenerative approach to treat pathologic conditions affected by insensitivity and toxic reactions to standard therapies . in this context , tissue engineering and regenerative medicine are the present and the future aim of clinical therapy , especially where traditional treatments fail or promote severe adverse events . a number of corneal conditions are often not fully managed by standard treatments and are characterized by intolerances and systemic effects . subjective and objective results suggest that biologic therapies for corneal surface alterations like se treatment could be an effective option . indeed , the use of biologic eye drops provides the beneficial effects of vitamins , gfs , and cytokines by correcting delayed corneal healing pathways and by restoring balanced mechanisms [ 76 , 78 , 79 ] . however , the technical preparation of human serum for ocular instillation should require a well - equipped laboratory with specialized trained personnel as well as the respect of aseptic and quality procedures . in addition , methods for se production ( clotting time , centrifugation , and concentration ) including the proper additive and gf doses should be optimized according to well - established guidelines and standardized quality controlled protocols [ 9 , 36 , 111 ] . specifically , a proper serum dilution should be performed to reduce the tgf 1/2 levels ( present in more than 5 times in serum compared to tears ) , which would promote corneal scar formations and a delayed reepithelialization ( table 1 ) . additionally , informed consent should be obtained from each patient in case of allogenic somministration to avoid ethical and juridical implications owing to blood transfusion practices and legislative restrictions should be carefully respected to minimize the immunological and infectious risks [ 11 , 84 ] . to date , clinical benefits of se therapy have been demonstrated by some published studies . most of the recent analyzed trials have tested the clinical results coming from se treatment through the comparison with traditional therapeutic approaches such as artificial tears , antibiotics , or corticosteroids [ 79 , 91 , 92 ] . several randomized studies suggest that se treatment leads to an improved tear film stability and subjective comfort [ 29 , 69 , 83 , 88 , 91 , 93 , 94 ] by determining a faster epithelial healing time and a better corneal transparency without increase of vascularization or fibrosis . moreover , several data have confirmed the safety and the almost absolute absence of toxic and side effects , especially in severe case of des or in ped ( except those related to an improper handling ) . a critical point of these published studies concerns the number of patients enrolled which are recurrently less than 100 [ 4 , 13 , 16 , 35 , 38 , 39 , 43 , 84 , 85 , 95 , 96 ] and the almost absence of long follow - up studies . on the other hand , the evaluation of the ongoing studies on this therapy showed that the newer fields of clinical research are focusing on alternatives to se like cbs . in this regard , many studies are testing cbs and its therapeutic properties and safety . however , further studies with large populations comparing biological therapies with the traditional ones in corneal diseases are needed to provide the best treatment tailored to the singular patient . they will clarify the therapeutic limits and resources of these emergent biologic therapies for corneal surface alterations , especially for refractory patients . we performed a computerized literature search on studies and trials by using the following search terms in various combinations : serum eye drops , cord blood serum , dry eye , and persistent epithelial defects . this search was achieved without any time and language restrictions in the following databases : pubmed , http://www.controlled-trials.com/ , https://www.clinicaltrialsregister.eu/ , https://eudract.ema.europa.eu/ , and https://www.clinicaltrials.gov/. the complete reference list of the most relevant studies was compared for the methodology of serum eye drops collection , preparation , and storage . clinical trials reported in table 2 were selected from studies published in the last 5 years ( 20102014 ) . | human serum contains a physiological plethora of bioactive elements naturally released by activated platelets which might have a significant effect on the regeneration of corneal layers by stimulating the cell growth .
this mechanism supported the use of human serum eye drops in some ocular diseases associated with dystrophic changes and alterations of the tear film , such as persistent corneal epithelial defects and dry eye syndrome .
we focused our effort on potential benefits and limitations of the use of human serum eye drops when conventional therapies failed .
we reviewed the recent literature by reporting published studies from 2010 to 2014 . despite the limited evaluated study populations ,
most of the clinical studies have confirmed that serum eye drop therapy is effective in corneal healing by reducing ocular symptom , particularly during the short - term follow - up .
in addition , three recent published studies have shown the efficacy of the serum eye drop therapy in comparison to traditional ones in intractable patients . besides , reported ongoing clinical studies confirmed the open debate regarding the use of biologic tools for cornea regeneration .
results from these studies might open novel challenges and perspectives in the therapy of such refractory patients . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
capsule endoscopy is a safe and well - tolerated procedure allowing the direct , noninvasive mucosal investigation of the small bowel . capsule retention is a source of major concern because it may lead to intestinal obstruction or perforation . patency capsules were developed to assess and assure the small bowel patency prior to diagnostic capsule endoscopy . identical in size to the actual capsule endoscope , it is designed to dissolve on contact with intestinal fluids to avoid small bowel obstruction . in patients who successfully passed the patency capsule , accidental capsule endoscope aspiration into the upper respiratory tract , which is a less anticipated consequence , has been reported with increasing frequency . in most cases , however , in several cases , induced respiratory distress necessitates using general anesthesia to remove the aspirated capsule by bronchoscopy . there are no accepted means to accurately predict and therefore prevent capsule endoscope aspiration . herein , we report a case of accidental capsule endoscope aspiration , preceded by repeated attempts to ingest the patency capsule . presumably , repeated attempts for ingesting the patency capsule might have predicted capsule endoscope aspiration . we present the case of an 85-year - old man with type 2 diabetes , hypertension , and atrial fibrillation who was referred to the hematology unit of our hospital for evaluation of anemia 2 months before . he was diagnosed with iron deficiency anemia ; thus , he was recommended to cease the use of an antithrombotic agent , receive iron replacement therapy , and undergo investigation of the digestive tract . on presentation , he was asymptomatic and chair bound due to lower extremity muscle weakness with advanced age . he had blurred vision because of severe diabetes retinopathy , but he and his wife denied hemorrhagic vomiting , melena , and hematochezia . he had a distal gastrectomy with billroth i reconstruction secondary to gastric ulcer at the age of 46 . physical examination showed a thin and frail - appearing male , pale palpebral conjunctiva , and no remarkable findings on chest and abdomen . laboratory studies revealed the following : hemoglobin , 9.3 g / dl , which improved from 6.9 g / dl at last visit ; leucocyte count , 5,400/l ; platelet count , 207,000/l ; serum iron , 44 l / dl , and ferritin , 480 ng / ml . colonoscopy showed that some phlebectasia , approximately 2 - 3 mm in diameter , was scattered at the sigmoid colon , but these were not considered as the bleeding source . an abdominal computed tomography scan with dynamic contrast enhancement did not show any bleeding source in the small intestine . the patient was diagnosed with obscure gastrointestinal bleeding . for further evaluation of the small intestine , capsule endoscopy was recommended . because of his wish to avoid retaining the capsule endoscope , a patency capsule ( pillcam patency capsule ; given imaging , yokneam , israel ) was administered ; it was excreted intact within 30 h after swallowing . he complained of difficulty while ingesting the patency capsule : he had the sensation that it was lodged in his throat and hardly went down to the esophagus , failed to ingest it despite multiple attempts over 5 min , and never coughed during that time . finally , he ingested it successfully by taking some sips of water as an aid by direction of the physician . five days later , he underwent capsule endoscopy ( pillcam sb 2 plus ; given imaging ) . at that time , he experienced very similar symptoms in swallowing the capsule . he did not cough , and eventually , the capsule went down the pharynx . on reviewing the study , the capsule endoscope entered the trachea shortly after administration and moved to the bronchus , where it remained for approximately 220 s before it popped up into the oral cavity . images of the esophagus and stomach then appeared ( fig . 1 ; online suppl . he denied any experiences of aspirating food , water , or tablets at his interview during his next visit to the outpatient clinic . our case experienced accidental capsule endoscope aspiration into the bronchus , preceded by patency capsule ingestion 5 days before . recently , there has been an increasing number of reported capsular aspirations . in an early study , only 1 of 600 consecutive patients experienced this complication . in a series of 733 capsule endoscopy procedures , one patient aspirated the capsule , followed by spontaneous expulsion by coughing . from 2003 to 2015 , 29 cases of capsule endoscopy aspirations were reported . to our knowledge , this is the first report of a patient who experienced capsule endoscopy aspiration after a patency capsule was swallowed . here , a possible explanation of the repeated attempts for ingesting the patency capsule is that he was aspirating it into the respiratory tract . not all patients aspirating a capsule endoscope demonstrate severe manifestations . of the previously reported aspirations , more than half of the patients presented with minor symptoms . five patients remained asymptomatic for hours until the capsule endoscope was removed or expelled from the respiratory tract . speculated that if a capsule endoscope is placed lengthways in the trachea , enough space for adequate oxygenation of the patient is left because the capsule endoscope has a size of 11 26 mm . the average anteroposterior and transverse diameters of an adult trachea are 16 and 14 mm , respectively . dysphagia is a common symptom accompanying capsule endoscope aspiration and is reported in approximately one - third of aspirating patients . these patients took several or lengthy attempts to swallow the capsule , needed some sips of water as an aid , or complained that it was hard to swallow . similar to our case , dysphagia was the only symptom that the 85-year - old patient experienced when he aspirated the capsule endoscope remaining in his respiratory tract for approximately 8 h . similar complaints during both patency capsule and endoscope ingestion in our case suggest that the patient aspirated the patency capsule and capsule endoscope . another explanation of the repeated attempts for ingesting the patency capsule is that an underlying swallowing disorder could be present in the patient . swallowing disorders are a potential risk factor for accidental capsule endoscope aspiration . in the previous literature , emphasis has been placed on the importance of obtaining detailed medical histories especially in the geriatric population to prevent capsule endoscope aspiration . however , a patient 's subjective symptoms can not always predict capsule endoscope aspiration . of 29 previously reported cases of capsule endoscope aspiration , at least 17 patients denied a history of dysphagia . our patient was interviewed upon presentation and fully examined after capsule aspiration ; no swallowing disturbance was revealed . the only prior indications of swallowing disorder were the multiple attempts for ingesting the patency capsule . we presume that this patient 's repeated attempts for ingesting the patency capsule , whether caused by its aspiration or indicative of occult swallowing dysfunctions , might have been predictive of the subsequent capsule endoscope aspiration . patients who are highly likely to aspirate a capsule endoscope should not ingest it periorally but rather should have it placed into the duodenum via upper endoscopy . in such circumstances , delivery of the capsule endoscope has been reported using an oroesophageal overtube , a polypectomy snare , or foreign object retrieval devices . some choose to use the delivery device to place the capsule endoscope into the proximal small bowel . proposed that if a patient appears to have difficulty in swallowing the capsule endoscope after 2 - 3 attempts , the capsule should be placed endoscopically . in our case , the capsule endoscope aspiration could have been prevented if we paid enough attention to his complaint while ingesting patency capsule and took appropriate measures , including delivering the capsule endoscope into the duodenum endoscopically . the patency capsule 's designed dissolvability prevents its retention at an intestinal stricture , but it does not prevent its aspiration into the respiratory tract . to make an early diagnosis of capsule endoscope aspiration , the following precautions were recommended in previous literature . the capsule endoscope should be administered in areas where oxygen and other resuscitation facilities are accessible , if possible , in a physician 's presence . when a real - time video monitor is available , the passage of the capsule endoscope into the stomach should be confirmed before the patient leaves the clinic . although there is no reported case of a patient who aspirated a patency capsule , our experience led us to believe that the same precautions should be observed when administering the patency capsule . in conclusion , this is the first reported case of a patient who experienced accidental capsule endoscope aspiration preceded by ingesting the patency capsule . we presume that the repeated attempts he required when ingesting the patency capsule might have been predictive of the subsequent capsule endoscope aspiration . paying sufficient attention to symptoms of the patient who ingests a patency capsule could help us prevent serious complications such as aspiration of the capsule endoscope . . we must be aware that the patency capsule could also be aspirated and that there may be more unrecognized aspiration cases . the video capsule entered the trachea and moved to a bronchus , where it remained for approximately 220 s before it popped up into the oral cavity . | capsule endoscope aspiration into the respiratory tract is a rare complication of capsule endoscopy . despite the potential seriousness of this complication ,
no accepted methods exist to accurately predict and therefore prevent it .
we describe the case of an 85-year - old male who presented for evaluation of iron deficiency anemia .
he complained of dysphagia while ingesting a patency capsule , with several attempts over a period of 5 min before he was successful .
five days later , he underwent capsule endoscopy , where he experienced similar symptoms in swallowing the capsule .
the rest of the examination proceeded uneventfully .
on reviewing the captured images , the capsule endoscope was revealed to be aspirated , remaining in the respiratory tract for approximately 220 s before images of the esophagus and stomach appeared . to our knowledge , this is the first documented case of a patient who experienced capsule endoscope aspiration after ingestion of a patency capsule .
this case suggests that repeated attempts required for ingesting the patency capsule can predict capsule endoscope aspiration .
we presume that paying sufficient attention to the symptoms of a patient who ingests a patency capsule could help us prevent serious complications such as aspiration of the capsule endoscope .
in addition , this experience implies the potential risk for ingesting the patency capsule
. we must be aware that the patency capsule could also be aspirated and there may be more unrecognized aspiration cases . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
meckel - gruber syndrome ( mgs ) is a triad of occipital encephalocele , large polycystic kidneys , and postaxial polydactyly . it is a rare , lethal autosomal recessive condition mapped to 6 different loci in different chromosomes . meckel - gruber syndrome is a condition characterized by ciliopathies caused by dysfunction of cilia and flagella . polycystic liver and kidney disease , bardet - biedl syndrome , alstrom syndrome , and joubert syndrome also belong to the same group . a full term baby born of a non - consanguineous marriage , in non - gujarati ( sindhi ) community was brought with a swelling over occipital region . antenatal ultrasonography ( usg ) was suggestive of occipital encephalocele , polyhydramnios and dysplastic kidneys . on examination there was a fleshy mass of size 5 5 cm with exposed meninges with flat anterior fontanel [ figure 1 ] . left hand and foot each had an extra digit on medial side [ figure 2 ] . usg brain showed normal brain parenchyma , mildly dilated third ventricle and bone defect in posterior part of calvarium with herniation of brain tissue . computerized tomography ( ct ) brain was suggestive of large occipital encephalocele with normal ventricles [ figure 4 ] . patient needed mechanical ventilation postoperatively , and the baby expired due to ventilator associated pneumonia . large fleshy mass of size 5 5 cm with exposed meninges usg picture showing multicystic dysplastic kidneys plain ct scan brain showing occipital encephalocele meckel - gruber syndrome ( mgs ) was first described by johann friedrich meckel in 1822 in two siblings who died of identical malformations of occipital encephalocele , polycystic kidneys and polydactyly . george b gruber in 1934 reported many familial cases with similar features and coined the term meckel syndrome. the worldwide incidence of mgs varies from 1 in 13,250 to 1 in 140,000 live births . the highest incidence of 1 per 1,300 live births ( carrier rate of 1 in 18 ) was reported in gujarati indians by young et al . in perinatal mortality survey for the years 1976 to 1982 . there is evidence which indicates that the gene frequency of meckel 's syndrome is particularly high in the leicestershire asian hindu community originating from the gujarat state in western india . the incidence is also high among belgians and bedouins in kuwait ( 1 in 3,500 with a carrier rate of 1 in 30 ) , finnish population ( 1 in 9000 with a carrier rate of 1 in 50 ) . john d. vince in 1998 first documented a papua new guinean family affected by meckel - gruber syndrome . three babies in the family met diagnostic criteria for the syndrome but first two cases were not documented . , there is one report of a long survivor who died at the age of 28 months . in 1995 , paavola reported another atypical case of a long survivor who died at 18 months of life . reported cases of meckel - gruber syndrome meckel - gruber syndrome inherits in families as autosomal recessive disease with a 25% chance of recurrence in each pregnancy . although meckel - gruber syndrome has been reported commonly in consanguineous marriages , it is also known to occur in children from non - consanguineous marriages suggesting that the single gene defect occurs more commonly in the latter population than mutant genes associated with other autosomal recessive disorders that are usually related with consanguineous marriages . it is mapped to 6 different loci in different chromosomes 17q21 - 24 ( mgs1 ) , 11q13 ( mgs2 ) , 8q21.3-q22.1 ( mgs3 ) , 12q21.31-q21.33 ( mgs4 ) , 16q12.2 ( mgs5 ) , and 4p15.3 ( mgs6 ) . the major diagnostic criteria of mgs include at least 2 of these 3 classic manifestations , cystic renal dysplasia , occipital encephalocele or other anomalies of central nervous system and polydactyly ( found in 100% , 90% and 83.3% respectively ) . mgs is associated with many other anomalies , which form minimal diagnostic criteria and include facial abnormalities , ambiguous genitalia , cardiac septal defects , gastro intestinal anomalies like omphalocele and cns abnormalities like agenesis of corpus callosum , dandy - walker cyst , arnold - chiari malformations . mgs can be diagnosed as early as 14 weeks of gestation by ultrasound by characteristic findings of occipital encephalocele , polycystic kidneys and post axial polydactyly . these findings are easier to pick on usg in early gestation ; as later on it is difficult due to severe oligohydramnios . measurement of alpha fetoprotein levels in maternal serum or amniotic fluid after 12 weeks of gestation may help to detect encephalocele or any neural tube defects . in an autopsy review of 9 cases , blankenberg concluded that following hepatic lesions are consistent features like arrested development of the intrahepatic biliary system , reactive bile duct proliferation , bile duct dilatation , portal fibrosis and vascular obliteration . meticulous autopsy in the suspected cases is necessary to establish the diagnosis of various possible anomalies associated with this syndrome . the high mortality and morbidity is due to non functional kidneys , liver and pulmonary hypoplasia . the parents can be counseled about the outcome and prognosis of the fetus and recurrence risk for the next pregnancy . meckel - gruber syndrome is a lethal and rare autosomal recessive condition characterized by occipital encephalocele , polycystic kidneys and post axial polydactyly . counseling forms an integral part of management especially about the recurrence risk of subsequent pregnancies . our aim of this review is to enhance the knowledge and spread awareness about this rare and lethal anomaly . | meckel - gruber syndrome is a rare autosomal recessive lethal malformation characterized by typical manifestations of occipital encephalocele , bilateral polycystic kidneys and post axial polydactyly .
the worldwide incidence varies from 1 in 13,250 to 1 in 140,000 live births .
highest incidence was reported in gujarati indians .
we report a rare case of meckel - gruber syndrome and review of literature . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
hajj is the fifth pillar of islam and though it should usually be performed once in one 's lifetime , many muslims perform the hajj several times . this season is the period from 15/11 to 15/12 of the lunar calendar with the peak period between 3 to 14/12 . health problems during hajj are due to the following reasons : 1 ) hajies are usually elderly , of different nationalities , social backgrounds , with diverse health problems . 2 ) the same rituals are performed by everyone over a short period of time , resulting in over - crowding and mass movement from one place to another . many patients , who normally come to the emergency room , do not have serious complaints . the hospital staffs get overworked as a result of the sheer weight of numbers , thus prolonging the waiting period for the patients . several health problems including heat stroke and exhaustion,13 medical,4 surgical,5 renal6 and epidemic problems79 have been studied during hajj period . however , very few studies if any have dealt with the problems of the emergency room . the aim of this study is to identify : 1 ) the major surgical and medical problems during hajj as a means towards the improvement of care and the reduction of the morbidity and mortality . 2 ) simple cases that could be dealt with at an outpatient clinic or primary health care center instead of the emergency department . the study was conducted prospectively during the 1413 ( 1993 ) hay pilgrimage from 20.11.1413 to 20.12.1413 . all saudi and non - saudi pilgrims presenting to al - noor specialist hospital 's emergency department were included . al - noor specialist hospital is 500-bed modern hospital with all sub - specialties and the main hospital in makkah . most emergency cases were brought to this hospital either by red crescent or medical hajj missions or by relatives and friends . the data were entered into a pc computer file of access program and the statistical analysis was done using statistical package for social sciences version 7 ( spss ) . the number of patients attending emergency department from 20.11 to 20.12.1413 was 7,676 patients , 55.1% ( 4228 ) of whom were males . out of those patients 1426 ( 18.6% ) were admitted . the age distribution was from newborns to 120 years old , with a mean age of 48 . there were 1230 patients ( saudi national and expatriates ) , 735 egyptians , 732 pakistanis and 368 indonesians . patients with abdominal pain and cuts were the commonest , 377 and 178 respectively and the lowest number of admissions . as shown in table 3 , there were many medical problems that could have been treated in the outpatient clinic or primary health care centers . the commonesst urgical problems attending emergency department the commonest medical problems attending emergency department the commonest medical problems attending emergency department with minimum admissions the emergency department is one of the most difficult departments run since it deals with different types of medical emergencies as well as cold cases . hajj creates a unique medical situation because of the huge number of patients presenting at the emergency department with different types of medical emergencies . hajies are usually elderly who participate in several strenuous physical activities . beside medical problems , other problems including the language barrier , different cultural backgrounds are evident . similar to a previous study done in al madinah al - munawara5 the commonest surgical cause for hospital admission in our study was trauma with or without fractures . though abdominal pain and cuts were the commonest surgical reasons for attending emergency room , they formed the smallest number of reasons for admission and they could have been dealt with at the outpatient clinic or primary health care centers . similar to previous study done in al madinah al - munawarah4 the commonest medical cause for admission was pneumonia . as shown in table 2 , asthma and gastroenteritis were the commonest cause for attendance at emergency room though they could have been treated in due outpatient clinic or primary health care centers and constituted the least important cause for admission . as these patients were in need of oxygen or intravenous fluid , they occupied emergency room beds for a few hours , which unnecessarily aggravated the problem of overcrowding . table 3 shows cases that should have gone to the primary health care centers instead of the emergency room since they were not serious enough for admission . in an overcrowded unit such as emergency room , a great deal of the work is urgent and any unnecessary overload affects the quality of care given to the sick patients . over 50% of patients in this study did not need to go to the emergency room and could have been managed in primary health care centers . in conclusion , the following are the observations of the researcher : 1 ) an important subject for further research is trauma , which was the commonest surgical problem requiring admission . 3 ) several medical and surgical problems could be dealt with in primary health care centers , leaving the staff to care for real emergency cases more effectively . | objective : hajj usually presents a unique medical crisis especially for the emergency department .
this study will identify the surgical and medical cases that presented at the emergency department during hajj and percentage admitted.design:a prospective study of the pattern of surgical and medical cases that presented at the emergency department of the largest tertiary care hospital in makkah city and holy lands during hajj.methods:the study was conducted prospectively during the 1413 ( 1993 ) hajj pilgrimage from 20.11.1413 to 20.12.1413 .
all saudi and non - saudi pilgrims presenting at the emergency department of al - noor specialist hospital were included.results:from the 7,676 patients who came to the emergency department , 1426 were admitted .
the commonest cause for surgical admission was trauma , while the commonest cause for medical admission was pneumonia.conclusion:more than 50% of cases could have been dealt with in the outpatient department or primary health care centers . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
dopamine - replacement therapy at the early stage of parkinson 's disease ( pd ) improves motor and nonmotor complications . in the advanced stage , however , motor fluctuation is a frequent and disabling problem . up to 50% of patients exhibit motor fluctuation and resistance to medication after the first five years of treatment [ 13 ] . motor fluctuation is estimated by explanations or patients ' diaries , though they are subjective and not quantitative [ 4 , 5 ] . how far are the complaints of patients reliable , that is , how far do they reflect the actual motor fluctuation ? to address this question , motor fluctuation must be objectively quantified for comparison . gait disorders are cardinal symptoms in pd and can be easily quantified since gait movements are defined by three parameters : the cadence ( steps / min ) , the floor reaction force , and stride [ 6 , 7 ] . thus , gait disorders can be physiologically a good model for the quantitative analysis of difficulties in motor execution . to examine motor fluctuation , we developed a long - term monitoring portable device , gait rhythmogram ( pgr ) that measures distinguishably the accelerations induced by gaits [ 811 ] . our previous studies using this new device showed that the range of changes in cadence and gait acceleration was narrow , suggesting that pd patients find it difficult to shift gait parameters in response to varying situations during walking [ 10 , 11 ] . furthermore , we reported a decrease in cadence during the off time , when the pd patients manifested bradykinesia or marked instability , and an increase in the cadence while the patients walked with short - stepping , festination , or freezing of gait [ 8 , 9 ] . the results suggested that various complex pathophysiological changes underlying parkinsonian symptoms can be simply expressed as changes in cadence . long - term monitoring of changes in gait cadence , therefore , can theoretically be used to provide a quantitative measure of motor fluctuation . since this method appears to detect deficits in motor execution , it can , therefore , detect motor fluctuation with a higher sensitivity than the examination of movement poverty by monitoring acceleration by various movements . the aim of the present study was to determine the relationship between complaints of pd patients and true motor fluctuation . for this purpose , daily profiles of motor symptoms must be identified . in the present study , in addition to measuring the cadence , we simultaneously measured changes in the amplitude of gait accelerations , since such amplitude correlates with floor reaction forces and the floor reaction forces are known to decrease during off time [ 8 , 9 ] . by simultaneously tracing alterations in cadence and acceleration , a better identification of motor fluctuation would be possible . using this pgr , we recorded continuously the daily profiles of 54 patients with pd ( age : 71.4 7.0 years , mean sd , 30 men and 24 women ) . they represented all patients admitted to tokyo medical university hospital between june 2009 and may 2010 , who could walk unaided and showed no peak - dose dyskinesia during on time . they included 4 patients with modified hoehn and yahr stage 1.5 , 14 with stage 2 , 10 with stage 2.5 , 24 with stage 3 , 1 with stage 3.5 , and 1 with stage 4 . the clinical status was examined using unified parkinson 's disease rating scale ( updrs ) motor score on state ( table 1 ) . we also included 17 height - matched normal control subjects ( age : 64.7 4.5 years , 8 men and 9 women ) . matching for age and height was based on the finding that gait cycle and floor reaction forces are influenced by these two parameters . all procedures were conducted in accordance with the guidelines of the ethics committee of our institution . the pgr is a small device ( size , 8 6 2 cm , weight , 80 g ) that measures three dimensionally ( ax , ay , and az ) the accelerations accompanied by ( 1 ) limb and trunk movements and ( 2 ) those induced by step - in and kick - off during gait , as reported previously [ 8 , 9 ] . the pgr is attached to the waist of the patient and records the above signals at a sampling rate of 10 msec . when recording is completed , the absolute values of acceleration vectors ( a ; a = ax + ay + az ) are calculated and graphically displayed on the pc . the acceleration vectors caused by stepping can be distinguished from those by other limb and trunk movements or by unexpected artifacts , based on the mathematical method of pattern matching [ 8 , 9 ] . since the acceleration wave induced by gait motion was morphologically similar in each patient , correlation was mathematically tested between the concerned waves and the template . after the identification of gait - induced acceleration , the peak - to - peak interval is automatically detected to calculate the duration of a single gait cycle , in addition to the amplitude of gait accelerations . changes in gait cadence ( steps per minute ) and gait acceleration cycle were examined during 24 hrs . probable gait off group and probable gait good group , based on changes in the cadence throughout the day . when corresponding changes were observed between the two gait parameters , we classified these patients into definite gait off group and definite gait good group . in patients of the latter two groups , we examined the relationship between the gait findings and subjective complaints . in contrast , if no corresponding change was observed , we reserved the assessment of the gait profile and excluded these patients for comparison between gait and subjective records . gait fluctuation was suspected when patients walked with a large fluctuation of the cadence , that is , deviation from the intersubject mean 1sd of the normal controls . the interindividual mean sd of the normal controls was 110 12 steps / min . thus , the cutoff levels set in the present study were < 98 and > 122 steps / min . first , all activity - related changes were excluded . a simultaneous increase in cadence and acceleration second , gait off was considered to occur only when the cadence change was accompanied with a decrease in acceleration under the interindividual mean 2sd of the normal control . since the interindividual mean sd of the normal control was 2.78 0.42/sec , the cut - off level was set < 1.94 m / sec . patients were considered to walk well throughout the day without motor fluctuation when walking was achieved with a small fluctuation that was within the interindividual mean 1sd of the normal control . since the interindividual mean sd of the normal control was 110 12 steps / min , the cut - off levels were set between 98 and 122 steps / min . absence of gait fluctuation was considered when the cv ( coefficient variance ) of the acceleration was less than the interindividual mean + 1sd of the control . we considered that the unusual fluctuation occurred when the acceleration cv was beyond mean + 1sd of the control . since the interindividual mean sd of the normal controls was 0.20 0.04 patients were asked to classify their symptoms into good , not good , and bad . at every hour , patients recorded in their diaries these subjective comments . forty - one of the 54 patients showed a large cadence fluctuation that deviated from the interindividual mean 1sd of the normal controls ( patients with probable gait off ) . for example , in the patient shown in figure 1(a ) , both the cadence and acceleration increased at 1000 and 1100 , when she was doing housekeeping work and walking outside according to patient 's diary . after excluding the activity - related changes , we checked whether or not the cadence change was accompanied by a decrease in gait acceleration , that is , below the interindividual mean 2sd of the normal control . the decreased cadence corresponded to the decrease in the amplitude of the acceleration ( figures 1(a ) and 1(b ) ) . the bradykinetic decrease in cadence was associated with a simultaneous decrease in acceleration at 1800 . in patient 31 shown in figure 1(b ) , the cadence slowed at 1500 , 1700 , 1900 , 2000 , 2400 , 800 , and 900 , and the acceleration decreased throughout these times . thus , simultaneous changes were confirmed at 1500 , 1700 , 1900 , 2000 , 2400 , 800 , and 900 . another type of fluctuation was observed in patients with the marked short stepping or freezing of gait . 5 ( figure 1(c ) ) walked with marked short - stepping at 1400 , 1500 , 1700 , and 600 . at 600 , the patient appeared to walk with short stepping or freezing and the acceleration simultaneously decreased in amplitude . however , the increase in cadence at 1700 was an activity - related change since acceleration increased at the same time . of the 41 patients with probable gait off , 37 patients were assessed as definite gait off based on the simultaneous changes in cadence and acceleration . no simultaneous changes were observed in the two parameters in the other four patients ( figure 1(d ) ) . thirteen patients of the 54 patients showed small cadence fluctuation that was within the interindividual mean 1sd of the normal controls ( patients with probable gait good ) . examination of these patients showed cv of acceleration below the mean + 1sd ( 0.24 ) in 7 patients . 2 ( figure 2(a ) ) with cv = 0.13 showed small fluctuation also in acceleration . the cv of the other 6 patients was more than the mean + 1sd ( 0.24 ) . figure 2(b ) shows an example of a patient with cv = 0.27 in whom the acceleration showed larger fluctuations . finally , we examined the subjective complaints of the 37 patients with definite gait off and 7 patients with definite gait good . four patients ( 17.3% ) reported no changes in the cadence and acceleration ( patients no . 14 ) . the results of patient no . 2 are shown in figure 3(a ) . however , the pgr showed a distinct fluctuation in gait rhythm in the other 19 ( 82.7% ) patients ( patients no . 15 shown in figure 3(b ) walked a with slow gait cycle and decreased acceleration at 2000 , 2100 , and 100 due to a marked bradykinesia . during the objective gait off time the time during which the patients were not aware of gait fluctuation varied , and included the morning , early afternoon , evening and night ( see patients no . no significant difference was observed in updrs - iii between the patients with synchronization and those lacking such synchronization . the other 21 ( 48% ) patients reported motor fluctuation . in 10 of these 21 patients ( 47.6% ) , there was a good synchronization between subjective off and gait off ( see patients no . 28 ( figure 4(a ) ) felt good between 1000 and 1200 and between 800 and 900 . these symptoms correlated well with the increase in cadence and acceleration ( activity - related changes ) , suggesting high physical activity . between 1400 and 1600 and at 1800 , and not good between 1700 and 21002200 . coinciding with the subjective off , the cadence and acceleration decreased simultaneously at 1500 , indicative of bradykinetic walking . 27 ( figure 4(b ) ) felt not good or bad due to the frequent occurrence of the freezing of gait between 0600 and 1200 . the pgr showed changes that coincided with the freezing of gait : an increase of cadence and decrease of acceleration , at 0800 and 900 . in the other 11 ( 52.4% ) patients , the gait parameters did not correlate with the subjective complaints . in three patients ( patients no . 3436 ) , the pgr findings of gait off were not synchronized with the subjective off findings . for example , patient no . 35 ( figure 4(c ) ) felt bad between 1200 and 1500 , whereas no changes were noted in cadence . in the other eight patients ( no . however , the gait cadence and acceleration were within the normal ranges at 1500 . at 1800 , no significant difference was observed in updrs - iii between patients with matched and unmatched symptoms pgr . taken together , desynchronization was observed between the gait fluctuation and subjective fluctuation in 30 of the 44 ( 68.2% ) patients whose 2- hours profiles were determined by pgr . the aim of the present study was to examine the relationship between complaints of pd patients and motor fluctuation . we focused on the parkinsonian gait disorder which can be quantified easily by extracting data from the gait cadence and acceleration . previous studies showed that ( 1 ) any increase in the cadence beyond the mean + 1sd is associated with a marked short stepping or freezing and ( 2 ) any decrease in cadence below the mean 1sd is associated with a walking pattern characterized by a marked bradykinetic stepping . thus , the off period reflects the time when the cadence deviates from the range of mean 1sd of the control subjects . in contrast , it is difficult to determine the on or off based on the value of gait acceleration alone . this is based on the extremely wide range of the acceleration in daily life walking ( figure 3 of ) . furthermore , the absolute value of the acceleration could be variable depending on the measurement conditions . these features of the two parameters allowed the definition of criteria for identifying gait bradykinetic fluctuation . we first defined candidates of gait off and gait good based on changes in the cadence . second , we tested this validity by examining whether corresponding changes were observed in the gait acceleration . cadence fluctuations beyond the intersubject mean 1sd of the normal control ( normal range ) were presumed to represent motor fluctuation ( probably gait off ) . physical activity was associated with increased cadence and acceleration , due to fast stepping during walking and augmentation of floor reaction force . in the second stage of the study , we matched the changes in cadence to those in acceleration . during the off period , the amplitude of the acceleration should decrease , since the ability to disturbances in force production . in the present study , the cut - off level was defined as the mean 2sd of the control subjects . we demonstrated in our previous studies that acceleration below the mean 2sd was associated with severe disturbances in the production of floor reaction forces ( figure 3 of ) , indicating that this range reflects the off - related changes . based on the above criteria , we examined whether deviations of the cadence beyond the normal range were associated with a simultaneous decrease in the acceleration less than the cut - off level . no such relationship was identified in 4 of 41 patients . in the other 37 ( 90.2% ) patients , however , a total harmony was observed between the cadence and the acceleration changes . cadence within the normal range throughout the day suggested the absence of motor fluctuation during the recording . in patients with probable gait for this purpose , we calculated the coefficient variance ( cv ) of acceleration in control subjects . we defined the cut - off level as 0.24 , corresponding to the intersubject mean + 1sd of the control subjects . any change in acceleration beyond this cut - off level should mean unlikely fluctuation in the control subjects . based on these definitions , 6 of the 13 patients with probable constant showed fluctuation that hardly occurred in the control subjects . the other 7 patients ( 53.8% ) with cv values below the cut - off level were assessed as definite gait good . based on the changes in cadence and acceleration ( gait fluctuation ) interestingly , no such agreement was observed in 30 of the 44 patients ( 68.2% ) . definite gait fluctuation occurred in 19/23 ( 82.7% ) patients who subjectively felt no fluctuation . on the other hand , gait fluctuation was not recorded or did not synchronize with the subjective symptoms in 11/21 ( 52.4% ) patients . one reason for the discrepancy could be that the patient concerns or priorities varied from one patient to another . in some patients , the target of attention might be other types of movement disorders . for example , some patients might feel good when they could easily manipulate their hands . other patients might feel subjectively good upon the improvement of hypokinesia ( difficulty in initiation of movements ) . in such patients , they would estimate to be on time when they easily initiated their movements without hesitation . moreover , other patients might weigh mood disorders such as apathy , rather than movement disorders . thus , the present finding of desynchronization between subjective off and gait off could represent the inherent features of pd itself . another alternative explanation is that some pd patients did not notice motor fluctuation due to deficits in attention to motor deficits . in such a condition , fluctuation in the gait parameters would have occurred even though the patients felt good throughout the day . further studies are needed to perform an advanced statistica analysis , for example , a logistic regression analysis to adjust for these confounding factors . the limitation of the present methodology also should be noticed since our device will only be useful in individuals who have specific gait disorders . the present results showed that subjective assessment does not necessarily match the findings of quantitative objective assessment in pd patients with gait disorders . the results highlight the importance of true assessment of the patients ' complaints to identify the wearing off . for this purpose , an objective long - term monitoring system , including pgr , would be helpful . | in advanced - stage parkinson 's disease ( pd ) , motor fluctuation is a frequent and disabling problem .
assessment of motor fluctuation depends on patient 's subjective self - statement .
we examined whether the subjective fluctuation matched the objective motor fluctuation defined by gait disorders . using a new device , the portable gait rhythmogram , we recorded gait cadence and acceleration continuously over the 24-hour period in 54 patients with pd and 17 normal controls , for the quantitative evaluation of motor fluctuation .
the patients were asked to estimate motor fluctuation every hour . in 44 of 54 patients , changes in the cadence were associated with simultaneous changes in acceleration .
we examined the subjective fluctuation in these 44 patients who were confirmed to have motor fluctuation .
nineteen ( 82.7% ) of 23 patients who felt no fluctuation showed distinct gait disorders . during off time
, they walked with marked short or bradykinetic stepping .
no matching changes were observed in either the cadence or acceleration in 11 ( 52.4% ) of 21 patients who perceived motor fluctuation .
no synchronization was noted in 30 ( 68.2% ) of the 44 patients , between the times of subjectively assessed motor fluctuation and those of quantitative analysis of gait disorder .
this discrepancy suggests that the objective continuous recording of the cadence and acceleration is necessary to understand motor fluctuation . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
chronic heart failure ( chf ) remains a disease associated with an unfavorable prognosis despite developments in pharmacological treatment , particularly in patients with dis - coordinate contraction due to left bundle branch block ( lbbb ) . cardiac resynchronization therapy ( crt ) applied to enhance synchrony has been beneficial in approximately 60% of patients , who have demonstrated improvement in clinical and hemodynamic parameters and reduced mortality [ 25 ] . one of the causes of failure of crt therapy in 40% of cases is suboptimal left ventricular lead placement . its recommended position is lateral or postero - lateral veins , but in individual cases a positive hemodynamic response was observed when stimulation of other sites was performed [ 810 ] . so far , attempts at intraoperatively reaching the suitable site for epicardiac pacing with an invasive hemodynamic technique or noninvasive echocardiographic methods have not been implemented on a regular basis because they are time - consuming . thus , it seems necessary to find new methods in order to assess the hemodynamic immediate response to left ventricular pacing . the aim of the study was to find the relationship between changes in pulse pressure ( pp ) and heart rate variability ( hrv ) components in frequency domain analysis caused by left ventricular pacing in patients with implanted crt . the study population consisted of patients with non - ischemic and ischemic cardiomyopathy , symptomatic and stable chf ( nyha iii / iv ) on optimal medical therapy , with sinus rhythm and qrs duration > 120 ms with lbbb in electrocardiogram ( ecg ) and left ventricular systolic dysfunction ( left ventricular ejection fraction , lvef ) 35% who were enrolled into a study with implanted crt . exclusion criteria were : atrioventricular ii / iii block , sick sinus syndrome , atrial fibrillation , premature ventricular and supraventricular extrasystoles ( > 1/min ) , diabetes mellitus , arterial hypertension , and current use of class iii antiarrhythmic drugs . the study was approved by the local ethics committee , and all patients gave their written informed consent . in all the patients , the device was switched off ( crt/0 ) in the early hours of the morning of the second day following the crt implantation and programmed in ddd mode with a lower rate limit of 40 ppm with maximal atrioventricular ( av ) delay . patients remained in a silent environment in a supine position for a period of 15 minutes . next , finger beat - to - beat arterial systolic blood pressure ( sbp ) and diastolic blood pressure ( dbp ) for 5 minutes with a finometer ( finapres medical systems , amsterdam , the netherlands ) were measured . the technique developed by peaz simultaneously , a standard 12-lead ecg ( 500 hz ) ( medeakardio pc , gliwice , poland ) was performed to measure frequency domain hrv components using in - house software based on the matlab mathematical language . then , sbp , dbp , and ecg recordings were repeated with av delay programmed 100 ms resulting in 100% left ventricular pacing ( crt / lv ) . the mean value of pp during crt/0 ( pp_crt/0=sbp_crt/0 dbp_crt/0 ) and crt / lv ( pp_crt / lv = sbp_crt / lv dbp_crt / lv ) was calculated . pp_crt / lv ) as well as the percentage change of pp ( % pp=pp / pp_crt/0 100% ) . the components of hrv low - frequency power ( lf ) , high - frequency power ( hf ) , and low - to - high frequency ratio ( lf / hf ) during crt/0 ( lf_crt/0 , hf_crt/0 , lf / hf_crt/0 ) , and next during crt / lv ( lf_crt / lv , hf_crt / lv , lf / hf_crt / lv ) were computed . then , the change of hrv values the parameters of blood pressure were expressed in mmhg and the components of hrv in absolute units ( ms ) . the shapiro - wilk test was used for measurable variables to verify whether the variable had a normal distribution . for the normal distribution , the results were given as mean and standard deviation ( sd ) and for the lack of normal distribution measures of position , median ( me ) , and interquartile range ( iqr ) ( q25 quartile i and q75 quartile iii ) . the chi square test was used for categorical variables . to compare variable values in the studied groups , we used the student s t - test for linked samples if the variable distribution in both cases was normal . for non - normality analysis the study population consisted of patients with non - ischemic and ischemic cardiomyopathy , symptomatic and stable chf ( nyha iii / iv ) on optimal medical therapy , with sinus rhythm and qrs duration > 120 ms with lbbb in electrocardiogram ( ecg ) and left ventricular systolic dysfunction ( left ventricular ejection fraction , lvef ) 35% who were enrolled into a study with implanted crt . exclusion criteria were : atrioventricular ii / iii block , sick sinus syndrome , atrial fibrillation , premature ventricular and supraventricular extrasystoles ( > 1/min ) , diabetes mellitus , arterial hypertension , and current use of class iii antiarrhythmic drugs . the study was approved by the local ethics committee , and all patients gave their written informed consent . in all the patients , the device was switched off ( crt/0 ) in the early hours of the morning of the second day following the crt implantation and programmed in ddd mode with a lower rate limit of 40 ppm with maximal atrioventricular ( av ) delay . patients remained in a silent environment in a supine position for a period of 15 minutes . next , finger beat - to - beat arterial systolic blood pressure ( sbp ) and diastolic blood pressure ( dbp ) for 5 minutes with a finometer ( finapres medical systems , amsterdam , the netherlands ) were measured . the technique developed by peaz simultaneously , a standard 12-lead ecg ( 500 hz ) ( medeakardio pc , gliwice , poland ) was performed to measure frequency domain hrv components using in - house software based on the matlab mathematical language . then , sbp , dbp , and ecg recordings were repeated with av delay programmed 100 ms resulting in 100% left ventricular pacing ( crt / lv ) . the mean value of pp during crt/0 ( pp_crt/0=sbp_crt/0 dbp_crt/0 ) and crt / lv ( pp_crt / lv = sbp_crt / lv dbp_crt / lv ) was calculated . pp_crt / lv ) as well as the percentage change of pp ( % pp=pp / pp_crt/0 100% ) . the components of hrv low - frequency power ( lf ) , high - frequency power ( hf ) , and low - to - high frequency ratio ( lf / hf ) during crt/0 ( lf_crt/0 , hf_crt/0 , lf / hf_crt/0 ) , and next during crt / lv ( lf_crt / lv , hf_crt / lv , lf / hf_crt / lv ) were computed . the parameters of blood pressure were expressed in mmhg and the components of hrv in absolute units ( ms ) . the shapiro - wilk test was used for measurable variables to verify whether the variable had a normal distribution . for the normal distribution , the results were given as mean and standard deviation ( sd ) and for the lack of normal distribution measures of position , median ( me ) , and interquartile range ( iqr ) ( q25 quartile i and q75 quartile iii ) . the chi square test was used for categorical variables . to compare variable values in the studied groups , we used the student s t - test for linked samples if the variable distribution in both cases was normal . for non - normality analysis the 40 analyzed patients were 638.5 years old , 65% were male and 65% had non - ischemic etiology of heart failure , 92.5% were in iii class of nyha , the qrs width was 17527 ms , and mean lvef was 25.76.6% . the left ventricular lead was positioned anterior ( 5% ) , antero - lateral ( 15% ) , lateral ( 55% ) , posterior ( 10% ) , and poster - lateral ( 10% ) . short - term crt / lv caused a statistically significant increase in the values of sbp ( p<0.05 ) and pp ( p<0.05 ) . short - term crt / lv caused a statistically significant increase in the lf power ( p<0.05 ) and hf power ( p<0.05 ) , but the lf / hf ratio did not change significantly ( ns ) ( table 3 ) . figure 1 presents the example of the measurement of hrv components . during short - term crt / lv , a statistically significant correlation between pp and hf ( r=0.7384 , p<0.05 ) was observed ( figure 2 ) . there were no statistically significant correlations between pp and lf ( r=0.2821 , ns ) or pp and lf / hf ( r= 0.0711 , ns ) . positive immediate individual hemodynamic response ( pp 10% ) was observed in 19 ( 47.5% ) patients , whereas 21 ( 52.5% ) patients did not show such a response . we observed that hf ( auc=0.882 , p<0.05 ) is a component which best differentiates changes during short - term crt / lv in patients who demonstrated pp 10% ( figure 3 ) . moreover , we determined the referential value for hf , which will allow predicting an increase for pp 10% . hf 6 ms with a sensitivity of 84.21% and specificity of 85.71% implies a possibility of immediate positive hemodynamic response ( pp 10% ) during short - term left ventricular pacing ( figure 4 ) . of the 19 patients with pp 10% , 16 ( 84.21% ) demonstrated a change in hf 6 ms ( p<0.05 ) ( table 5 ) . the 40 analyzed patients were 638.5 years old , 65% were male and 65% had non - ischemic etiology of heart failure , 92.5% were in iii class of nyha , the qrs width was 17527 ms , and mean lvef was 25.76.6% . the left ventricular lead was positioned anterior ( 5% ) , antero - lateral ( 15% ) , lateral ( 55% ) , posterior ( 10% ) , and poster - lateral ( 10% ) . short - term crt / lv caused a statistically significant increase in the values of sbp ( p<0.05 ) and pp ( p<0.05 ) . short - term crt / lv caused a statistically significant increase in the lf power ( p<0.05 ) and hf power ( p<0.05 ) , but the lf / hf ratio did not change significantly ( ns ) ( table 3 ) . short - term crt / lv caused a statistically significant increase in the values of sbp ( p<0.05 ) and pp ( p<0.05 ) . short - term crt / lv caused a statistically significant increase in the lf power ( p<0.05 ) and hf power ( p<0.05 ) , but the lf / hf ratio did not change significantly ( ns ) ( table 3 ) . during short - term crt / lv , a statistically significant correlation between pp and hf ( r=0.7384 , p<0.05 ) was observed ( figure 2 ) . there were no statistically significant correlations between pp and lf ( r=0.2821 , ns ) or pp and lf / hf ( r= 0.0711 , ns ) . positive immediate individual hemodynamic response ( pp 10% ) was observed in 19 ( 47.5% ) patients , whereas 21 ( 52.5% ) patients did not show such a response . we observed that hf ( auc=0.882 , p<0.05 ) is a component which best differentiates changes during short - term crt / lv in patients who demonstrated pp 10% ( figure 3 ) . moreover , we determined the referential value for hf , which will allow predicting an increase for pp 10% . hf 6 ms with a sensitivity of 84.21% and specificity of 85.71% implies a possibility of immediate positive hemodynamic response ( pp 10% ) during short - term left ventricular pacing ( figure 4 ) . of the 19 patients with pp 10% , 16 ( 84.21% ) demonstrated a change in hf 6 ms ( p<0.05 ) ( table 5 ) . positive immediate individual hemodynamic response ( pp 10% ) was observed in 19 ( 47.5% ) patients , whereas 21 ( 52.5% ) patients did not show such a response . we observed that hf ( auc=0.882 , p<0.05 ) is a component which best differentiates changes during short - term crt / lv in patients who demonstrated pp 10% ( figure 3 ) . moreover , we determined the referential value for hf , which will allow predicting an increase for pp 10% . hf 6 ms with a sensitivity of 84.21% and specificity of 85.71% implies a possibility of immediate positive hemodynamic response ( pp 10% ) during short - term left ventricular pacing ( figure 4 ) . of the 19 patients with pp 10% , 16 ( 84.21% ) demonstrated a change in hf 6 ms ( p<0.05 ) ( table 5 ) . we observed that in patients with implanted crt , short - term left ventricular pacing can immediately improve left ventricular systolic performance . based on invasive studies , dekker et al . observed that biventricular pacing with an optimal left ventricular lead position significantly increased stroke volume ( + 39% , p=.01 ) and ejection fraction ( + 30% , p=.007 ) . nelson et al . confirmed that left ventricular or biventricular pacing strongly enhances systolic function ( 184% rise in arterial pressure and 436% increase in dp / dtmax ) . observed that effective left ventricular pacing results in an immediate increase in pp , as evaluated with an invasive method . other authors confirmed that the increased value of pp positively correlates with improved left ventricular systolic performance , increased stroke volume , and cardiac output . the method of non - invasive evaluation of changes in pp was used in a study conducted by butter et al . the authors confirmed that the values of the pp parameter , evaluated with the application of non - invasive photoplethysmography , were correlated with the values of the pp parameter , evaluated with the application of an invasive aortic pp . the results we obtained in our study increased systolic pressure by 4.6 mmhg and increased pp value by 3.5 mmhg confirmed the above observations . in the clinical observation , it is manifested by decreased activity of the parasympathetic system and increased sympathetic activity . patients with cardiac insufficiency demonstrate decreased values of hrv parameters evaluated in both the time domain and frequency analyses , and results of these measurements have high repeatability . in our study , we observed that patients with crt/0 demonstrated low values of hrv components , which were evaluated with short - term frequency domain analysis , both in the lf and hf spectral components . observed 10-fold lower values of frequency parameters ( lf and hf ) in patients with crt in comparison with healthy subjects . values of parameters of the frequency domain analysis are closely related to the progression of the disease . some authors have noted that in an early stage of a disease , patients demonstrate higher spectral values of the lf component and lower spectral values of the hf component , which confirms a shift in the balance of the autonomic system towards the sympathetic component [ 2628 ] . other authors have made similar observations while conducting studies on patients with advanced heart failure . it was confirmed that there is a relationship in the long - term improvement in hemodynamic parameters and improvement in decreased hrv parameters . they evaluated the impact of the therapy on the tone of the autonomic system by analyzing 5-minute ecg records with the use of the frequency domain method . it positively influenced the ventricular systolic performance , which immediately resulted in a change of pp values . in our study , short - term left ventricular pacing caused a statistically significant increase in the hrv value of lf and hf components . percentage change of pp ( pp% ) was used to evaluate the immediate hemodynamic response to left ventricular pacing . auricchio et al . noted that a change in pp higher than 5% evaluated by an invasive method proves an immediate positive response to resynchronization therapy . butter et al . observed that an 8% change in the pp value proves an immediate positive hemodynamic response to effective left ventricular pacing . in the group of patients we studied , an immediate individual positive hemodynamic response to short - term left ventricular pacing was observed in 47.5% of the patients . vogt et al . noted that a 10% increase in the pp value might facilitate the identification of the suitable site for epicardiac pacing , and patients who have had electrodes implanted in this site demonstrate clinical and echocardiographic improvement in long - term observation . thus , an increased value of hf might imply the possibility of an immediate individual positive hemodynamic response ( pp 10% ) during short - term left ventricular pacing . in the literature , there is no thorough analysis of any relationships between pp and hf measured during short - term left ventricular pacing . a significant correlation between pp and hf was observed during short - term left ventricular pacing in patients with crt . hf 6 ms may serve as a tool in the selection of a suitable site for placement of a left ventricular lead . the present study provides important new data that might be useful in a potential application of changes in hf spectral components of hrv . hf power might facilitate the selection of a left ventricular lead placement site when we assume that a positive hemodynamic response ( i.e. , a change in the pp value ) is the evaluation criterion . the limitations of the study include the small number of patients because of the exclusion of patients with diabetes , hypertension , a great number of premature ventricular and supraventricular extrasystoles , and disorders of av conduction of the 2 and 3 degree . the obtained hrv results were not verified with any available commercial software . pressure parameters were evaluated with the use of only one 5-minute non - invasive measurement . with regards factors affecting arterial tension and hrv might have affected the obtained results to some extent . the present study provides important new data that might be useful in a potential application of changes in hf spectral components of hrv . hf power might facilitate the selection of a left ventricular lead placement site when we assume that a positive hemodynamic response ( i.e. , a change in the pp value ) is the evaluation criterion . the limitations of the study include the small number of patients because of the exclusion of patients with diabetes , hypertension , a great number of premature ventricular and supraventricular extrasystoles , and disorders of av conduction of the 2 and 3 degree . pressure parameters were evaluated with the use of only one 5-minute non - invasive measurement . with regards factors affecting arterial tension and hrv might have affected the obtained results to some extent . | backgroundthe aim of the study was to explore the relationship between changes in pulse pressure ( pp ) and frequency domain heart rate variability ( hrv ) components caused by left ventricular pacing in patients with implanted cardiac resynchronization therapy ( crt).material / methodsforty patients ( mean age 638.5 years ) with chronic heart failure ( chf ) and implanted crt were enrolled in the study .
the simultaneous 5-minute recording of beat - to - beat arterial systolic and diastolic blood pressure ( sbp and dbp ) by finometer and standard electrocardiogram with crt switched off ( crt/0 ) and left ventricular pacing ( crt / lv ) was performed .
pp ( pp = sbp - dbp ) and low- and high - frequency ( lf and hf ) hrv components were calculated , and the relationship between these parameters was analyzed.resultsshort-term crt / lv in comparison to crt/0 caused a statistically significant increase in the values of pp ( p<0.05 ) , lf ( p<0.05 ) , and hf ( p<0.05 ) . a statistically significant correlation between pp and hf ( r=0.7384 , p<0.05 ) was observed .
the hf of 6 ms2 during short - term crt / lv predicted a pp increase of 10% with 84.21% sensitivity and 85.71% specificity.conclusionsduring short - term left ventricular pacing in patients with crt , a significant correlation between pp and hf was observed .
hf 6
ms2 may serve as a tool in the selection of a suitable site for placement of a left ventricular lead . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
pseudofolliculitis is an inflammatory disorder that occurs most frequently in men with a dense and curly beard . pseudofolliculitis barbae occurs when emerged terminal hairs , particularly the thick , curly hairs of the beard , grow back towards the surface . it can be a simple cosmetic problem or a disturbing medical condition for which the dermatologist must be prepared . the submandibular area is most frequently affected due to the higher hair density and the oblique direction of hair growth in this area . it can develop in areas of shaving or depilation and has been seen in the pubic region or the axillas , where it is common to find curly hair that emerges at an acute angle . in individuals with very curly body hair , pseudofolliculitis can also occur after depilation of other areas such as the chest , back , or legs . a 32-year - old male presented with mildly pruritic lesions over back since 3 years [ figure 1 ] . previously he was diagnosed as truncal acne and treated with oral isotretinoin and multiple courses of antibiotics . he was a driver by occupation . on clinical examinations , there were follicular papules over mid portion of the back . on dermoscopy , the hairs were seen like loops [ figure 2a ] and some of the lesions were solid papules [ figure 2b ] . few of the lesions were removed with a curette and examined on a piece of paper under dermoscope . hairs coming out of the skin and again reentering in few lesions [ figure 3a ] and the solid papules had bend hairs inside [ figure 3b ] . the diagnosis of pseudofolliculitis corporis was made . on further questioning , he revealed that he used to put a pillow in the mid portion of his back while driving . he was explained of the fact that the lesions were due to the chronic friction and advised to stop that practice . he was advised adapalene and clindamycin combination gel for 15 days . on follow - up at 6 months and 1-year pruritic follicular papules over back ( a ) on dermoscopy the hairs were seen like loops . ( b ) solid papules over back seen on dermoscopy ( a ) hairs coming out of the skin and again re - entering . pseudofolliculitis mainly affects the beard area , but it can occur in any area of hair - bearing skin when traumatic methods like shaving or plucking are used to remove the hair . the sharp ends of the hairs left by the oblique cut of the razor make contact with the epidermis at an angle of 90 and on penetration to the epidermis looks like a hair follicle , referred to as a pseudofollicle . a very close shave may also cause the hair to pierce the epidermis before reaching the surface . shaving against the grain while tensing the skin and on releasing the tension , the hair is drawn back below the skin surface may pierce the epidermis before reaching the surface leading to pseudofolliculitis . this phenomenon is less likely to occur with finer , less curved hairs or when the angle at which the hair is cut during shaving is perpendicular to the skin . if a person with pseudofolliculitis stops shaving , hair growth to a length of 10 mm usually pulls the hair out of the inflammatory papule , and the process tends to resolve spontaneously . a recent study found a a12 t polymorphism of the gene coding for keratin k6hf , found in a thin layer of cells between the inner and outer sheaths of the root of the hair follicle gives rise to a six - fold increase in the risk of suffering pseudofolliculitis barbae . abnormalities in this keratin constitute a risk factor for pseudofolliculitis , and when thick wavy or curly hair is involved , hair ingrowth after shaving is more likely . another study has demonstrated that curly hair and the presence of whorls increase the risk of developing pseudofolliculitis barbae by more than 50% . pseudofolliculitis has been reported in the nose , caused by plucking the stiff nasal hairs or cutting them with scissors very close to the surface of the skin . pseudofolliculitis can also be related to certain occupations in which the subject has to maintain a device or hard surface against the cheek for long periods of time . fiddler 's neck , a form of pseudofolliculitis barbae caused by the pressure of the violin under the mandible . other causes of occupational pseudofolliculitis include the use of constricting objects , devices , or clothing that rub on hair - bearing areas and produce depilation by friction . there have also been reports of cases related to the administration of medicines that can favor the acne , such as corticosteroids and ciclosporin . dermoscopy can be used to confirm the diagnosis . in our case , we used dermoscopy for visualization of in growing hairs . curetting the papule and putting the tissue over a white paper and again examining under dermoscope will give the diagnosis . as this is an office based procedure , can be done in any sitting and invasive procedures like biopsy can be avoided . the aim of treatment is to reduce extrafollicular and transfollicular hair penetration and to reduce chronic inflammation . avoidance of the cause is most important as our case improved due to the simple advice ( stopped using pillow behind back while driving ) . it is advisable to stop shaving for around 4 weeks and attempts can be made to remove the ingrown hairs by freeing them with a sterile needle . when these methods are insufficient , or the inflammation becomes severe , medical treatment is required . the only published randomized clinical trial included 88 men who were treated with a gel containing 5% benzoyl peroxide plus 1% clindamycin or a placebo gel for 10 weeks . though driving with a pillow behind the back is very common , this entity is less recognized . once confirmed , avoidance of pressure factor and topical treatment will give cure to the patient . | pseudofolliculitis mainly affects the beard area , but it can occur in any area of hair - bearing skin when traumatic methods like shaving or plucking are used to remove the hair . it can be a simple cosmetic problem or a disturbing medical condition for which the dermatologist must be prepared .
it can develop in areas of shaving or depilation and has been seen in the pubic region or the axilla , where it is common to find curly hair that emerges at an acute angle . here
, we are reporting a case of pseudofolliculitis over back , termed as pseudofolliculitis corporis .
he used to put a pillow behind the back while driving and the pressure caused the pseudofolliculitis .
the diagnosis was confirmed by dermoscopy , which is a simple office procedure . patient was advised to stop using the pillow and improved with topical adapalene and clindamycin gel for 15 days .
this entity has not been described in the literature . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in a recent article in ecam ( 1 ) , azeemi and raza reviewed the field of chromotherapy , providing a history of the subject since ancient days ( 2 ) , and its use in modern times ( 3 ) . in the past 8 years , virtual scanning , a new russian system of medical assessment and treatment , has revolutionized the use of precise light frequencies in the visible spectrum for preventive treatment , and where possible cure , of specific pathologies . the new system is still little known in countries outside the former soviet union , explaining its omission from azzeemi and rasa 's review ( 1 ) . such is virtual scanning 's revolutionary significance that no review of color therapy could be considered complete without describing it . the fundamental influence of light in stimulating organismic function , and thus health , is well known ( 4 ) , but modern medical science mostly attributes this to its effect on the pineal ( 5 ) , since the hormones of that master gland regulate pituitary and endocrine function and are thus necessary for the healthy functioning of the whole organism , yielding a safe , reductionist model for the beneficial influence of light on health . more subtle forms of chromotherapy reviewed by azeemi and raza ( 1 ) hold that different colors influence organismic function differently , so that specific colors may benefit particular pathological conditions . such forms of chromotherapy may depend on the influence of light on the system of nadis / acumeridians ; they lack known mechanisms , and belong to cam . azeemi and rasa attempt to remedy this lack of mechanism , making their work of interest to those seeking biologies of cam ( 6,7 ) . to understand how different colors may differently influence organismic function , they hypothesize that colored light may be able to influence the internal structure of water . should they be correct , their hypothesis links to recent suggestions by tiller et al . ( 8) , that so - called water - memory originates in the internal structural arrangements of its hydrogen - bond linked oxygen atoms . vibrational properties , by which they could influence health through principles of vibrational medicine linked to homeopathy ( 9,10 ) . the significance of virtual scanning to this debate is that it represents a completely new , medical technology of light , based on discoveries of new mechanisms and neural pathways , by which light may influence organ and organismic function . virtual scanning is an empirically established system of health assessment and treatment ( 12 ) , using specific effects of organ function on color cognition , and color stimulation on organ health . it is based on principles discovered at the university of krasnoyarsk by professor igor grakov ( 13 ) , who subsequently developed his system into its present form ( 14 ) . it was evaluated at the university of st petersburg by vysochin ( 15 ) , and at other medical centers ( 16 ) . on the basis of a 1015 min color cognition test taken on a computer screen , virtual scanning yields an assessment of the health of 30 organs ( of which 3 are sex - specific ) , an amazing achievement backed up by clearly delineated concepts , well observed case studies ( 12 ) , and considerable research data ( 15 ) . grakov discovered how the structure of cortical information processing and analysis , permits systematic errors in color cognition to be used for accurate health assessment ; and conversely , how administering precise sequences of colors , at precise frequencies of repetition , for given periods of time , can stimulate healing in designated organs . more precisely , the discoveries that enabled grakov to develop his system were as follows :
organs transmit precise information concerning their functional state to the brain.the information from each organ precisely expresses the degree of its degeneration towards various kinds of pathology different sets of pathologies for each organ.for each such pathology developing in any organ , the brain has the capacity to transmit neural signals to stimulate the organ , precisely compensating for any loss of function caused by the pathology , thus restoring organ function to normal.the brain stores information about all such signals : ( i ) concerning organ pathologies and ( ii ) concerning their compensation ; in such a way thateach signal gives rise to its own specific , identifiable influence on color cognition . the information from each organ precisely expresses the degree of its degeneration towards various kinds of pathology different sets of pathologies for each organ . for each such pathology developing in any organ , the brain has the capacity to transmit neural signals to stimulate the organ , precisely compensating for any loss of function caused by the pathology , thus restoring organ function to normal . the brain stores information about all such signals : ( i ) concerning organ pathologies and ( ii ) concerning their compensation ; in such a way that each signal gives rise to its own specific , identifiable influence on color cognition . this means that particular pathologies in particular organs , together with the degree to which each is being compensated , influence brain color processing in precise , distinguishably different , ways . grakov 's genius was to design , first , a test measuring deviations from normal color cognition , which can assess the magnitude of all these processes , and second , a therapy using related brain circuits to direct precise , corrective , healing influences to the brain and organs concerned for each condition detected . thus , the virtual scanning health assessment test uses the influence of the brain 's own information processing on color cognition to measure the following :
health information transmitted from each organ to the brain , andthe amount the brain is stimulating each organ to compensate for such problems . health information transmitted from each organ to the brain , and the amount the brain is stimulating each organ to compensate for such problems . virtual scanning 's system of treatment uses correspondingly selected colors delivered at specific frequencies of repetition in the delta band of eeg , used by the brain to direct healing to the organs during the night . virtual scanning : the system uses the virtual reality of the brain 's information processing , to provide both body scan and remedial treatment . to most people , the idea that precisely selected colors can help specific pathologies , on occasion producing remarkable cures , may sound unlikely . however , the following case histories from the uk and russia , show the system can produce remarkable results : a uk businesswoman of 47 with her own company had reported upper abdominal discomfort to her gp . she had also been taking aspirin for a year as a secondary prevention measure against platelet aggregation . the gp had not detected any identifiable pathology , and suggested the cause was stress . virtual scanning health assessment detected a developing ulcerative process in the duodenum , requiring urgent treatment . she returned to her gp who reiterated his opinion , suggesting a good rest and holiday . within a week she was admitted to hospital for 10 days with upper gastrointestinal bleeding diagnosed as a duodenal ulcer . assessment of a man of 57 in the uk , suffering from bouts of disorientation , revealed inter alia vertebral artery syndrome , poor blood flow to the back of the brain and undue pressure on the cervical vertebrae . it was determined that the pressure on the head bones was being caused by overexertion on hala asana , the yoga position known as the plough , suggesting that this was causing overstretching of the arteries in the neck ( as well as the muscle tendons the posture is intended to stimulate and rebalance ) . on stopping all such yoga postures , the feelings of giddiness and disorientation went away within 2 weeks . retesting showed both pressure on the head bones and the restricted blood flow to have been eliminated . a russian epileptic , who had been invalided from age 5 , suffered up to 10 attacks per day in spite of taking all prescribed medication . virtual scanning diagnosis led to a prescription of virtual scanning therapy with the brain module . after her first 21 day course of treatment all attacks ceased , and she was able to stop taking any medication . some time later , she was given a further preventative course of virtual scanning treatment , after which no further attacks were reported . clinical investigation showed that the activity in the cortex responsible for the attacks had disappeared . the patient ceased to be categorized as disabled.assessment of a 59-year - old woman , who had suffered migraine attacks from age 11 , worsening in recent years , confirmed migraine and also indicated vertebral artery syndrome , impaired spinal blood flow , osteochondropathy with neurological effects and idiopathic hypotension ( fig . figure 1.(case history treatment ( ii ) : 59-year - old patient with migraine . ) this example illustrates how virtual scanning can yield an overall picture of a patient 's pathology , including its underlying causes . here , signals from brain ( a ) , spinal chord ( b ) , peripheral nervous system ( c ) and blood ( d ) show indications of uncompensated vertebral artery syndrome ( a ) , impaired spinal circulation ( b ) , osteochondropathy with neurological effects ( c ) and idiopathic hypotension ( d ) . together these form a connected set of underlying causes for the pathology : the osteochondropathy ( c ) can lead to the vertebral artery syndrome ( a ) , which in turn leads to impaired spinal blood flow ( b ) and so to the ideopathic hypotension ( d ) . conclusion : these associated pathologies form the probable causes of the migraine . ( a ) brain : note the migraine signal ( 14/7 ) , and other indications of problems in brain function . the signal for vertebral artery syndrome [ signals ( 14/6 ) ] , in particular , is often seen as one of the possible causes for migraine . ( b ) spinal cord : the signals for uncompensated impairment of spinal circulation ( 26/0 ) show that the osteochondrosis ( c ) and consequent vertebral artery syndrome ( a ) connect into a specific pattern of causes of the migraine . ( c ) peripheral nervous system : the poorly compensated osteochondrosis signal ( 56/36 ) indicates a probable cause for the vertebral artery syndrome signal in ( a ) . ( d ) blood and peripheral blood vessels : compensatory signals for idiopathic hypotension ( 6/14 ) , are often seen in migraine cases , particularly when circulation problems are present [ see ( b ) ] . a russian epileptic , who had been invalided from age 5 , suffered up to 10 attacks per day in spite of taking all prescribed medication . virtual scanning diagnosis led to a prescription of virtual scanning therapy with the brain module . after her first 21 day course of treatment all attacks ceased , and she was able to stop taking any medication . some time later , she was given a further preventative course of virtual scanning treatment , after which no further attacks were reported . clinical investigation showed that the activity in the cortex responsible for the attacks had disappeared . assessment of a 59-year - old woman , who had suffered migraine attacks from age 11 , worsening in recent years , confirmed migraine and also indicated vertebral artery syndrome , impaired spinal blood flow , osteochondropathy with neurological effects and idiopathic hypotension ( fig . ( case history treatment ( ii ) : 59-year - old patient with migraine . ) this example illustrates how virtual scanning can yield an overall picture of a patient 's pathology , including its underlying causes . here , signals from brain ( a ) , spinal chord ( b ) , peripheral nervous system ( c ) and blood ( d ) show indications of uncompensated vertebral artery syndrome ( a ) , impaired spinal circulation ( b ) , osteochondropathy with neurological effects ( c ) and idiopathic hypotension ( d ) . together these form a connected set of underlying causes for the pathology : the osteochondropathy ( c ) can lead to the vertebral artery syndrome ( a ) , which in turn leads to impaired spinal blood flow ( b ) and so to the ideopathic hypotension ( d ) . ( a ) brain : note the migraine signal ( 14/7 ) , and other indications of problems in brain function . the signal for vertebral artery syndrome [ signals ( 14/6 ) ] , in particular , is often seen as one of the possible causes for migraine . ( b ) spinal cord : the signals for uncompensated impairment of spinal circulation ( 26/0 ) show that the osteochondrosis ( c ) and consequent vertebral artery syndrome ( a ) connect into a specific pattern of causes of the migraine . ( c ) peripheral nervous system : the poorly compensated osteochondrosis signal ( 56/36 ) indicates a probable cause for the vertebral artery syndrome signal in ( a ) . ( d ) blood and peripheral blood vessels : compensatory signals for idiopathic hypotension ( 6/14 ) , are often seen in migraine cases , particularly when circulation problems are present [ see ( b ) ] . one week prior to the test , the patient had been admitted to hospital fainting from severe pain , and given seven different medications in a 6 h period . after 10 months of virtual scanning treatment , she had not suffered a single further migraine attack . assessments following successive periods of treatment indicated the underlying tendencies causing her migraine to be slowly reducing . the significance of these case histories is not just that the health assessment was able to confirm previous diagnoses , but that it was also able to identify underlying causes . together these imply that grakov 's basic theory must be correct , constituting a series of important discoveries about ( i ) the structure and function of neural signals between the brain and peripheral organs and ( ii ) the brain 's mechanisms of data processing . a uk businesswoman of 47 with her own company had reported upper abdominal discomfort to her gp . she had also been taking aspirin for a year as a secondary prevention measure against platelet aggregation . the gp had not detected any identifiable pathology , and suggested the cause was stress . virtual scanning health assessment detected a developing ulcerative process in the duodenum , requiring urgent treatment . she returned to her gp who reiterated his opinion , suggesting a good rest and holiday . within a week she was admitted to hospital for 10 days with upper gastrointestinal bleeding diagnosed as a duodenal ulcer . assessment of a man of 57 in the uk , suffering from bouts of disorientation , revealed inter alia vertebral artery syndrome , poor blood flow to the back of the brain and undue pressure on the cervical vertebrae . it was determined that the pressure on the head bones was being caused by overexertion on hala asana , the yoga position known as the plough , suggesting that this was causing overstretching of the arteries in the neck ( as well as the muscle tendons the posture is intended to stimulate and rebalance ) . on stopping all such yoga postures , the feelings of giddiness and disorientation went away within 2 weeks . retesting showed both pressure on the head bones and the restricted blood flow to have been eliminated . a russian epileptic , who had been invalided from age 5 , suffered up to 10 attacks per day in spite of taking all prescribed medication . virtual scanning diagnosis led to a prescription of virtual scanning therapy with the brain module . after her first 21 day course of treatment all attacks ceased , and she was able to stop taking any medication . some time later , she was given a further preventative course of virtual scanning treatment , after which no further attacks were reported . clinical investigation showed that the activity in the cortex responsible for the attacks had disappeared . the patient ceased to be categorized as disabled.assessment of a 59-year - old woman , who had suffered migraine attacks from age 11 , worsening in recent years , confirmed migraine and also indicated vertebral artery syndrome , impaired spinal blood flow , osteochondropathy with neurological effects and idiopathic hypotension ( fig . 1 ) , for all of which treatment was prescribed .
figure 1.(case history treatment ( ii ) : 59-year - old patient with migraine . ) this example illustrates how virtual scanning can yield an overall picture of a patient 's pathology , including its underlying causes . here , signals from brain ( a ) , spinal chord ( b ) , peripheral nervous system ( c ) and blood ( d ) show indications of uncompensated vertebral artery syndrome ( a ) , impaired spinal circulation ( b ) , osteochondropathy with neurological effects ( c ) and idiopathic hypotension ( d ) . together these form a connected set of underlying causes for the pathology : the osteochondropathy ( c ) can lead to the vertebral artery syndrome ( a ) , which in turn leads to impaired spinal blood flow ( b ) and so to the ideopathic hypotension ( d ) . ( a ) brain : note the migraine signal ( 14/7 ) , and other indications of problems in brain function . the signal for vertebral artery syndrome [ signals ( 14/6 ) ] , in particular , is often seen as one of the possible causes for migraine . ( b ) spinal cord : the signals for uncompensated impairment of spinal circulation ( 26/0 ) show that the osteochondrosis ( c ) and consequent vertebral artery syndrome ( a ) connect into a specific pattern of causes of the migraine . ( c ) peripheral nervous system : the poorly compensated osteochondrosis signal ( 56/36 ) indicates a probable cause for the vertebral artery syndrome signal in ( a ) . ( d ) blood and peripheral blood vessels : compensatory signals for idiopathic hypotension ( 6/14 ) , are often seen in migraine cases , particularly when circulation problems are present [ see ( b ) ] . a russian epileptic , who had been invalided from age 5 , suffered up to 10 attacks per day in spite of taking all prescribed medication . virtual scanning diagnosis led to a prescription of virtual scanning therapy with the brain module . after her first 21 day course of treatment all attacks ceased , and she was able to stop taking any medication . some time later , she was given a further preventative course of virtual scanning treatment , after which no further attacks were reported . clinical investigation showed that the activity in the cortex responsible for the attacks had disappeared . assessment of a 59-year - old woman , who had suffered migraine attacks from age 11 , worsening in recent years , confirmed migraine and also indicated vertebral artery syndrome , impaired spinal blood flow , osteochondropathy with neurological effects and idiopathic hypotension ( fig . ( case history treatment ( ii ) : 59-year - old patient with migraine . ) this example illustrates how virtual scanning can yield an overall picture of a patient 's pathology , including its underlying causes . here , signals from brain ( a ) , spinal chord ( b ) , peripheral nervous system ( c ) and blood ( d ) show indications of uncompensated vertebral artery syndrome ( a ) , impaired spinal circulation ( b ) , osteochondropathy with neurological effects ( c ) and idiopathic hypotension ( d ) . together these form a connected set of underlying causes for the pathology : the osteochondropathy ( c ) can lead to the vertebral artery syndrome ( a ) , which in turn leads to impaired spinal blood flow ( b ) and so to the ideopathic hypotension ( d ) . ( a ) brain : note the migraine signal ( 14/7 ) , and other indications of problems in brain function . the signal for vertebral artery syndrome [ signals ( 14/6 ) ] , in particular , is often seen as one of the possible causes for migraine . ( b ) spinal cord : the signals for uncompensated impairment of spinal circulation ( 26/0 ) show that the osteochondrosis ( c ) and consequent vertebral artery syndrome ( a ) connect into a specific pattern of causes of the migraine . ( c ) peripheral nervous system : the poorly compensated osteochondrosis signal ( 56/36 ) indicates a probable cause for the vertebral artery syndrome signal in ( a ) . ( d ) blood and peripheral blood vessels : compensatory signals for idiopathic hypotension ( 6/14 ) , are often seen in migraine cases , particularly when circulation problems are present [ see ( b ) ] . one week prior to the test , the patient had been admitted to hospital fainting from severe pain , and given seven different medications in a 6 h period . after 10 months of virtual scanning treatment , she had not suffered a single further migraine attack . assessments following successive periods of treatment indicated the underlying tendencies causing her migraine to be slowly reducing . the significance of these case histories is not just that the health assessment was able to confirm previous diagnoses , but that it was also able to identify underlying causes . together these imply that grakov 's basic theory must be correct , constituting a series of important discoveries about ( i ) the structure and function of neural signals between the brain and peripheral organs and ( ii ) the brain 's mechanisms of data processing . central to grakov 's theory is a two matrix model of how organ information influences cognition : an internal matrix mi recording information received from organs and organ systems , and an external matrix me monitoring the external environment , in constant communication with each other . the two matrices , together with their respective communication flows , are schematically depicted in fig . figure 2 depicts grakov 's internal and external matrices in communication with the organism 's internal and external environments , and with each other . it also transmits information to the external matrix concerning the levels of both sets of impulses . information about levels of pathological and compensatory impulses received from the internal matrix modifies cognitive processing of sense perception data received from the external environment in precise ways . conversely , specific sense perception data received by the external matrix can be made to stimulate the internal matrix to modify its levels of compensation , and to send healing impulses to the organs . this is the basis for virtual scanning treatment its specific form of chromotherapy , made precisely according to its assessment . figure 2 depicts grakov 's internal and external matrices in communication with the organism 's internal and external environments , and with each other . it also transmits information to the external matrix concerning the levels of both sets of impulses . information about levels of pathological and compensatory impulses received from the internal matrix modifies cognitive processing of sense perception data received from the external environment in precise ways . conversely , specific sense perception data received by the external matrix can be made to stimulate the internal matrix to modify its levels of compensation , and to send healing impulses to the organs . this is the basis for virtual scanning treatment its specific form of chromotherapy , made precisely according to its assessment . apparently , similar biomathematical models apply to most , if not all , sensory channels . grakov has applied it to others in addition to sight . in the case of color processing and cognition , the model is normalized for the weight , age and sex of each subject . its algorithms analyze colors in a grid , the grid point parameters being modified according to the signals transmitted to and from the brain and recorded in the internal matrix . changes in organ health shift the grid parameters , so that changes occur in color cognition , reflected by specific alterations in color test performance . in health , normal color processing ( according to sex , age and weight ) . for each organ , specific deviations from health result in identifiable changes in test performance . according to grakov , deviations from normal health in any organ result in information flows to the brain specific to each kind of deviation . his work indicates that such signals are present long before detectable pathology manifests , and that each kind of signal will increase to a point where a specific pathology becomes detectable . such pathologies are used to label signal types : if , as a particular signal from , e.g. the liver ( with a dozen or more signal types ) increases , neoplasm becomes detectable , then virtual scanning assessments and treatments could not begin to work unless the internal external matrix model of sensory information processing was correct : success rates reported by vysochin ( 15 ) are far higher than any placebo investigated . the only questions are ones of degree : degree of accuracy of the system 's medical assessments , and , when properly administered , degree of success of its treatments . one major implication of grakov 's work is that each organ transmits as many kinds of distinguishable neural signals to the brain as the different kinds of ailment his system can detect for the organ in question , i.e. approximately 15 different signal types related to the state of health of each organ . the next implication is that the analytical processing identified by grakov must take place in the physiology . this is for two reasons : first , the cortex contains structures able to retain the information designated for the internal and external matrices ; second , different layers of the cortex are interconnected in such a way that the required mathematical processing could be carried out ( the cortex is comprised of six separate layers , each with its own function and interconnections to other layers ) . grakov 's neural model has implications for ( i ) the function of the appropriate layers , and ( ii ) the way different levels of the cortex interact with each other . regions of cortex storing sensory input are possible locations for the external matrix me , while regions storing somatic information may be locations for the internal matrix mi . the length of the interconnections , with dendrites spreading considerable distances , make the relationship of the activity of one cortical region to that of another a uniquely interesting mathematical transformation . the linear transforms between cortical layers implied by grakov 's matrices and neural models would effectively enable the whole cortex to function in a holistic fashion . this is of great importance to complementary medicine , for it implies that higher organisms function holistically , providing support for the concept of a a final implication of grakov 's work is that some form of natural color therapy would have been possible in the wild . this is because improvements in organ condition result in improved sense of well - being . thus a creature 's attention would be specifically drawn to a color with remedial qualities for any problem in its organs , since looking at that color would produce a natural positive feedback . such a possibility is also the case for ordinary color therapy . on sunny days in spring time on the streets of stockholm and other nordic cities , citizens can traditionally be seen resting with their face in the sunshine for quite lengthy time periods , not because they may have been medically advised to do so , but because it makes them feel good they are activating the pineal after all the darkness of the winter months , and consequent melatonin deprivation . grakov 's model implies that any creature , which developed the neurological functions and connections required , would gain a competitive advantage : the possibility of naturally maintaining a higher level of health . in support of this , consider comparable examples of instinctive reactions leading to the identification of curative or health promoting materials :
domestic animals tend to eat plants of various kinds when they are sick , particularly grass not part of their normal , carnivorous diet;during pregnancy , females of a species may seek out unusual materials ( again , not their habitual foodstuffs ) rich in materials required by the fetus at that stage of development , e.g. calcium or other minerals , when bones and blood are forming;edward bach recorded that , in his discovery of the flower remedies named after him , he would begin to suffer from the condition , which a particular flower could assist , and , based on his feeling response , would identify the flower in question . domestic animals tend to eat plants of various kinds when they are sick , particularly grass not part of their normal , carnivorous diet ; during pregnancy , females of a species may seek out unusual materials ( again , not their habitual foodstuffs ) rich in materials required by the fetus at that stage of development , e.g. calcium or other minerals , when bones and blood are forming ; edward bach recorded that , in his discovery of the flower remedies named after him , he would begin to suffer from the condition , which a particular flower could assist , and , based on his these examples show that instinct leads various kinds of mammal , including humans , to seek out appropriate nourishment , both for special normal conditions , and to counteract pathology . there is every reason to believe that , although uncommon in this day and age , such abilities are part of the range of human abilities among the population ensuring long - term species survival that is to say that they are commonly present among a steady fraction of members of the species . the examples suggest that if organ health can be improved by experiencing particular stimuli , as grakov has demonstrated , that is good reason for physiological properties and structures promoting it to have developed naturally : the system has a valid biology ( 6,7 ) . reasons given above suggest that the structures include the brain cortex with all its layers for data processing , transformation and cognition . although the fundamental influence of light in stimulating organismic function , and thus health , are well known , most medical thinking attributes this to its effect on the pineal , pituitary and neuroendocrine system . chromotherapy is still a relatively obscure aspect of complementary medicine , particularly in the subtle forms reviewed by azeemi and raza ( 1 ) . although their hypothesis that colored light may be able to influence the internal structure of water may have substance , grakov 's account of his system of virtual scanning offers another way to understand the influence of color on health : the central nervous system is so constructed that there is a feedback between color cognition and organ monitoring and stimulation by the brain . when an organ is in the process of slowly developing a pathology , it emits increasingly strong neural signals to the brain indicating the degree of degeneration of its condition ; the brain responds by applying appropriate compensatory stimulation . color processing is among many aspects of cns function influenced in specific ways by all such signals , with the following results : ( i ) color tests can be used to identify both organ pathology and brain compensation . ( ii ) stimulation by appropriate colored light has a therapeutic effect on specific organs . specifically , grakov 's virtual scanning test of color cognition yields values for the following :
health information transmitted to the brain from each organ.neural signals transmitted by the brain to stimulate each organ and compensate for problems detected . neural signals transmitted by the brain to stimulate each organ and compensate for problems detected . the latter offer insights to understand other phenomena in different fields of biology and the health sciences , for example , how known benefits of meditation practice may benefit health ( 17,18 ) , or , in sense perception , the problem of the so - called anosmias , where a person with an otherwise well - functioning sense of smell may be completely unable to detect the aroma of particular molecules ( 19 ) virtual scanning is well established in russia , where it has been found to yield valuable results for many pathologies . since the mechanisms it proposes for the influence of different colored light on specific health problems lie within the structure of conventional science , virtual scanning deserves consideration by biomedicine and cam , as well as those interested in chromotherapy . | virtual scanning incorporates novel uses of colored light into its system of health assessment and therapy .
independent investigations of its effectiveness in russia and the uk have revealed unique abilities to correct incipient and fully developed chronic conditions . as such it forms an important new addition to the field of chromotherapy .
it differs from most others , in that its development depended on discoveries in neuroscience by its inventor , and subsequent application of new models in computational neuroscience . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
polycythemia is clinically defined as elevated red blood cell mass ( hemoglobin > 18.5 g / dl in men , 16.5 g / dl in women or other evidence of increased red cell volume or hemoglobin or hematocrit greater than 99th percentile of method - specific reference range for age , sex , altitude of residence or hemoglobin greater than 17 g / dl in men , 15 g / dl in women if associated with a documented and sustained increase of at least 2 g / dl from an individual 's baseline value that can not be attributed to correction of iron deficiency , or elevated red cell mass greater than 25% above mean normal predicted value 1 . polycythemia can be further classified as primary polycythemia , secondary polycythemia , or polycythemia due to abnormal hypoxia sensing . primary polycythemias are caused by intrinsic defects in the erythroid precursors that result in hyper responsiveness to normal level of serum erythropoietin ( epo ) . secondary polycythemias are driven by the factors ( predominantly epo but also insulin growth factor 1 and cobalt ) extrinsic to the erythroid progenitor cells . generally , in secondary polycythemia , the increased red cell mass represents a physiologic response to tissue hypoxia or abnormally increased level of serum epo 2 . polycythemias due to abnormal hypoxia sensing include chuvash polycythemia , polycythemias associated with von hippel - lindau mutations other than the chuvash polycythemia mutation , and polycythemia due to proline hydroxylase mutation 3 , 4 . acquired conditions that lead to increased epo production , such as chronic hypoxia and a variety of tumors , are the most common causes of secondary polycythemias . these include hemoglobin variants with high affinity for oxygen , congenitally low erythrocyte 2 , 3 biphosphoglycerate levels , and inherited methemoglobinemias . all these conditions are characterized by a left shift in hb dissociation curve which in turn leads to tissue hypoxia and a physiologically appropriate increase in epo levels . congenital cyanotic heart or lung disorders , which lead to tissue hypoxia and increased epo level are also examples of secondary congenital polycythemias but these are characterized by a normal hb dissociation curve . two subjects ( mother and daughter ) , from a family with multiple subjects with polycythemia , were available for evaluation : subject 1(mother ) : she is a 59 year old caucasian woman who presented with lifelong history of polycythemia . her medical history was remarkable for 1 ) multifocal ductal carcinoma in situ ( dcis ) of the breast in 2002 , treated with simple mastectomy and 2 ) colonic diverticula and internal hemorrhoids since 2005 . family history was remarkable for presence of lifelong history of polycythemia in her mother and two daughters . laboratory parameters revealed high hb ( 16 gm% ) , high hematocrit ( 48% ) , normal mcv , normal platelet and white blood cell counts , normal arterial oxygen saturation , and normal liver function tests . subject 2 ( daughter ) : she is a 30 year old caucasian woman who presented for further evaluation of lifelong history of polycythemia . family history was significant for lifelong history of polycythemia in her mother , maternal grandmother and her younger sister . laboratory parameters were remarkable for elevated hemoglobin ( 17.2 gm% ) and hematocrit ( 51.4% ) but normal mcv , normal platelets and white blood cell counts , normal arterial oxygen saturation , and normal liver function tests . both subjects underwent following laboratory tests : serum epo levels were normal in both subjects ( 15 miu / ml and 19 miu / ml respectively , normal range 4.1 - 19.5 miu / ml ) . venous blood gas parameters were obtained which included partial pressure of oxygen ( venous po2 ) , venous ph and venous oxygen saturation . calculation of affinity of hb for oxygen ( p50 ) was done using the mathematical formula as described 5 . routine hb electrophoreses , high performance liquid chromatography ( hplc ) 6 , 7 , isoelectric focusing ( ief ) in polyacrylamide gel , globin chain analysis 8 and peptide mapping 9 were performed . this was followed by beta globin gene sequencing which was performed by abi3730 96-capillary sequencer at the dna sequencing core facility at the university of utah school of medicine ( primers and conditions available upon request ) . the p50 was found to be low at 18 mm hg ( normal range 22.6 to 29.4 ) suggesting increased affinity of hb for oxygen . ief showed a band anodal to hb a and globin chain analysis by hplc revealed an unidentified beta globin variant in both subjects ( figure 1 ) . peptide mapping showed an extra peak at 26.9 min but showed no decrease in any peaks suggesting a mutation somewhere in the core ( figure 2 ) . beta globin gene sequencing revealed a novel mutation ( gtg->ttg ) of codon 109 of exon 3 of beta globin gene . this mutation leads to a previously reported high affinity hb variant known as hb johnstown ( beta109 val->leu ) 10 - 12 ; however , this nucleotide change is novel and previously unreported ; and it leads to a previously described amino acid substitution that was however , caused by a different nucleotide missense mutation . hb johnstown ( beta109 ( g11 ) val->leu ) is a high oxygen affinity hb variant and there are three reports in the literature . it was first reported by jones and colleagues in oregon , in 1990 , in a healthy asymptomatic subject with mild erythrocytosis and left - shifted hemoglobin - o2 dissociation curve10 . as with many other hb variants , hb johnstown is silent on standard hemoglobin electrophoretic analyses , and was identified and isolated by reverse - phase hplc of individual globin chains . structural analysis revealed the substitution beta 109 ( g11 ) val ->leu 10 . in 2000 , the underlying beta globin mutation [ beta - globin codon 109 ( gtg ->ctg ) ] was first reported by ropero and colleagues , in two unrelated families ( total four subjects ) of basque extraction in spain 11 . in one of these families , hb johnstown mutation was present in double heterozygosity with another beta 0 thalassemia mutation ivs-1-nt1 ( g->a ) . in 2004 , feliu - torres and colleagues reported hb johnstown [ beta - globin codon 109 ( gtg ->ctg ) ] in an eight year old girl , who had been referred for evaluation of erythrocytosis , in double heterozygosity with another beta globin mutation [ ivs - i-1(g->a ) ] . however , these reports described a causative g to c mutation that is different that mutation we describe in our subject with hb johnstown , namely g to t , both encoding the same amino acid ; i.e. leucine and present in subjects not known to be of spanish / basque extraction . the sigmoid shape of hb - oxygen dissociation curve is indicative of cooperative interaction between heme and oxygen . oxygen affinity and hb - oxygen dissociation is affected by blood ph , 2 , 3- biphosphoglycerate ( 2 , 3 bpg ) level in the red cell and temperature , and globin structure 13 . affinity of hb with oxygen is expressed as the p50 , which is the partial pressure of oxygen in blood at which 50% of the hb is saturated with oxygen . the venous p50 can be measured directly using a cooximeter which is no longer easily available in routine and even reference laboratories . lichtman and colleagues have reported a mathematical formula which can be used to calculate p50 reliably 5 . calculating p50 using this formula requires the following venous gas parameters : partial pressure of oxygen ( venous po2 ) , venous ph and venous oxygen saturation , and uses anti - log mathematical function that many clinicians find difficult to use for calculation 5 . the p50 of a healthy person with normal hb is 26 1.3 mm hg . the 99% confidence interval for individual observations has been reported to be 22.6 to 29.4 mm hg . an abnormally low p50 reflects an increased affinity of hemoglobin for oxygen and vice versa . elevations and reductions in 2 , 3- bpg level in the erythrocyte will also lead to corresponding changes in p50 values ; however , in only reported subjects this decrease was limited to a p50 value between 20 and 35 mm hg . there should be high suspicion for the presence of a high affinity hb variant if p50 value is < 20 mm hg 5 . during oxygenation and deoxygenation , there is considerable movement along the interface of alpha 1 and beta 2 chains of the hb tetramer . all these substitutions can affect the cooperative nature of oxygen binding with heme , and in turn , can change the affinity of hb for oxygen . the majority of mutations affecting oxygen affinity result in high affinity hb variants which result in leftward shift of the dissociation curve and relative tissue hypoxia 14 . there are 90 high affinity hb variants , listed on the globin server , known to be associated with high affinity for oxygen ( http://globin.bx.psu.edu/hbvar/menu.html accessed on may 04 , 2007 ) 15 . high affinity hb variants release oxygen in the tissue relatively slowly and create relative tissue hypoxia . this leads to increased production of epo from kidneys which results in increased red blood cell mass and polycythemia . at an elevated level of increased red blood cell mass ( which depends upon the oxygen affinity of a given variant ) adequate oxygenation of the tissue is reestablished and epo production plateaus and at this new steady state serum epo is often at normal level . this leads to stabilization of hb level after achieving a certain elevated level of hematocrit . family history of polycythemia in a subject with polycythemia should raise the suspicion for the presence of a high affinity hb variant 14 . a low p50 value ( obtained from venous gas parameters ) is supportive of high oxygen affinity hb variant or decreased 2 , 3 bpg level . in a polycythemic patient , establishing a correct diagnosis of a high affinity hb variant is important as these patients have normal life expectancy and do not require phlebotomy . the therapies used for polycythemia vera such as phlebotomy and chemotherapy should not be used in patients who have polycythemia due to high affinity hb variants . with this report , we are providing an electronic version ( using microsoft excel program ) of the mathematical formula 5 , with which p50 can be calculated in few seconds , provided venous gas parameters are available , without necessity of more sophisticated calculations using antilog parameters . with increased ease and rapidity of calculation using our excel program ( supplementary material ) , we hope that use of p50 will increase , leading to improved detection of hb variants in subjects with familial polycythemia . | two polycythemic subjects from a family with multiple polycythemic subjects were evaluated .
estimation of oxygen affinity of hb from venous blood gas parameters ( p50 ) revealed low p50 suggesting a high affinity hb variant .
further work up , which included beta globin gene sequencing , revealed a novel mutation changing a codon to the previously reported high affinity hb - hb johnstown ( beta109 val->leu ) .
polycythemic subjects with high affinity hb variant are asymptomatic with normal life expectancy .
their differentiation from polycythemia vera ( pv ) is crucial to avoid therapy which is otherwise reserved for pv patients .
we provide an electronic version ( in microsoft excel program ) of a previously reported mathematical formula for rapid calculation of p50 from venous blood gases .
estimation of p50 is an essential initial step in the evaluation of a subject with personal and family history of polycythemia . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
syrigocystadenoma papilliferum is a benign tumor of skin commonly appearing in the head and neck region . syringocystadenoma papilliferm ( scap ) is an uncommon benign tumor of disputed histogenesis with a predilection for the scalp and forehead . less common sites of involvement are chest , upper arms , ma le breast , eyelids , scrotum , and thigh . an 18 years old male reported to skin outpatient department with complaints of slowly progressive multiple raised nodular lesions on the medial side of his left leg since birth . at birth the lesions , there were 4 skin colored papulonodular lesions measuring from 0.6 0.6 cm to 1.2 1.2 cm in size on medial side of middle 1/3 of left leg . there was some atrophic scarring of skin near the larger nodule because of some trauma sustained during childhood . there was history of occasional serous discharge from the lesion since 8 years of age . the routine laboratory investigation including hemogram , monteux test and x - ray chest was found to be normal . excision biopsy of one of the nodule was done for histopathological examination ( hpe ) . multiple skin colored papulonodular lesions on the left leg with thick crusts in the centre of upper two lesions on hpe the epidermis showed papillomatosis . the papillary projections and lower part of invaginations were lined by two rows of glandular epithelium [ figure 3 ] . the outer row consisted of small cuboidal cells and inner row displaying columner cells . the papillary projections and dermis had dense infiltration of plasma cells [ figure 4 ] . photomicrograph showing papillomatosis of epidermis with cystic invagination and papillary projection ( h and e , 100 ) photomicrograph displaying papillary projections and cystic invagination lined by two rows of cells ( h and e , 100 ) photomicrograph depicting numerous plasma cells ( h and e , 400 ) scap was first described by john stokes in 1917 under the term nevus syringoadenomatous papilliferum . scap has been commonly described in head ( on scalp , forehead , cheeks , pinna and eyelids ) and neck region . it 's also rarely reported on several uncommon sites like axilla , lower back , abdomen , scrotum and thigh . as of now , there has been just one case report of scap on lower leg from japan . the evidence of decapitation secretion in the luminal cells of scap suggests an apocrine origin . but it is paradoxical to observe the fact that 90% of scap are found on location devoid of apocrine glands . pinkus stated that presence of more or less malformed pilosebaceous complex is obligatory and furnish the hamartomatous foundation on which the tumor develops . mammino and vidmar after reviewing 145 cases concluded that histogenesis of scap is a curious mix of eccrine and apocrine elements on the basis of microscopic , immunohistochemical and ultrastructural studies . studies by yamamoto using anticytokeratin antibodies and several other markers in scap support the classical concept that scap is a hamartomatous tumor that arises from pluripotent cells . in another study by kurokawa et al from japan based on cytokeratin expression ( ck ) , squamous epithelium in scap seems to differentiate towards infrainfundibulum . scap shows focal positivity to ck-15 a relatively specific marker of hair follicle stem cells in the bulge . moss et al . , showed mutation in ptca or p-16 tumor suppressor gene in scap . basal cell carcinoma , rarely secondary adenocarcinoma ( syringocystadenocarcinoma papilliferum ) and apocrine ductal carcinoma may develop in scap . . we must consider it in the differential diagnosis of any longstanding nodular lesion with crusted surface that may ooze serosanguinous fluid because this is a reflection of the fact that the papillae of a scap are in continuity with the epidermal surface permitting extrusion of secretory products . we must suspect the diagnosis irrespective of its location and consider histopathological examination for confirmation . | an 18 years old male presented with a slowly increasing multiple papulonodular lesions on his left leg since birth .
no definite diagnosis was made on clinical ground .
but verrucous epidermal naevus with secondary change and appendageal tumor was suspected on clinical examination .
histopathological examination revealed syringocystadenoma papilliferm ( scap ) .
scap is very rare on lower leg .
only one case of scap on lower leg has been reported in literature so far , which was superimposed on an organoid nevus .
the case is reported for unusual location and unusual presentation . |