Datasets:

anumafzal94
/

pubmed_full_finetuning

Dataset card Viewer Files Files and versions Community

Split (2)

train · 104k rows

text stringlengths 699 822k	summary stringlengths 205 4.34k
You are an expert at summarizing long articles. Proceed to summarize the following text: human resources are the most strategic resource of any organization ( 1 ) and are arguably the most significant input for a health system . their behavior and motivation can strongly affect the overall performance of the health system ( 25 ) . motivation can be defined as the process responsible for the intensity , orientation , and continuity of individual effort to achieve an objective ( 3 ) arising from the interactions between individuals , the workspace , and society ( 2 ) . motivation results from a need that must be satisfied , and this , in turn , results in a specific behavior ( 3 ) . motivation is a behavioral , affective , and cognitive process that affects employees trends to perform their tasks to achieve personal and organizational goals ( 4 ) . aside from the effect of the shortage of healthcare workers , the lack of motivation in healthcare providers constitutes a major crisis for the health sector . it critically affects the performance , quality , effectiveness , equity , and service delivery of a health system ( 2 , 4 , 6 ) . ignoring the motivation of providers can hinder the development of health systems ( 2 ) . the negative results of a lack of motivation include inadequate knowledge translation , underutilization of resources , and weak performance of the health system ( 2 ) . studies on job motivation have found that a lack of motivation decreases job satisfaction and efficiency , increases absenteeism and turnover , and decreases the quality and the quantity of the work ( 7 ) . motivation directly influences the performance of the healthcare providers and their loyalty towards the organization ( 8) . motivation is important for patient satisfaction and also is required to retain high - performing employees and maintain job satisfaction ( 2 , 9 ) . lack of motivation is a push factor for the migration of providers from rural to urban areas and abroad ( 2 , 4 ) . motivated staff is the key to high - quality and accessible health services and achieving millennium development goals ( 6 ) . employee motivation is affected by intrinsic factors ( autonomy , competence , social interaction , responsibility , and self - esteem ) and extrinsic factors ( remuneration , relationship with supervisor and colleagues , recognition ) ( 4 ) . the world health organization recommends a combination of intervention in education , regulations , and financial , personal , and professional support to improve the motivation of health workers ( 10 ) . motivation is a primary task of managers ; thus , they must have an awareness of employee perspectives on the factors that affect motivation in order to improve it . awareness of the determining factors that affect the motivation of employees aids implementation of targeted strategies for continuous improvement . administrators of each organization must achieve organizational objectives by identifying the determining factors in the motivation of their employees . frontline employees are at the forefront of providing services to patients ; they have the closest personal contact with the patients in the hospital . their service and interaction with patients have an important role in patients perceptions of the quality of service and in patients satisfaction and loyalty ( 11 ) . although workforce motivation is an important issue in the performance of the health system , few studies have examined its determining factors , especially in developing countries and hospital settings ( 2 , 4 ) . this study identified the determining factors of motivation in frontline employees at teaching hospitals affiliated with shahid beheshti university of medical sciences ( sbmu ) in tehran , iran . the study population was comprised of frontline employees ( nurses , physiotherapists , radiology and laboratory technicians , staff of operating room and pharmacy ) of hospitals affiliated with sbmu . the studied sample consisted of 300 people selected from two general and teaching hospitals . first , the personnel were divided into nurse and non - nurse strata and then random sampling was conducted in each stratum . three - quarters of the samples were allocated to the nurse group , and the remainder was allocated to non - nurse employees . the data collection tool was a questionnaire entitled determining factors of job motivation from the employee perspective , which had been developed and validated in a previous study ( 12 ) . this questionnaire contained 42 questions in 7 domains , i.e. , working relationships , remuneration , recognition , job content , autonomy , social respect , and career development . the reliability of the questionnaire was measured using cronbach s alpha coefficient ; the coefficients of the domains ranged from 0.68 to 0.86 and indicated acceptable stability of the questionnaire . the items on the questionnaire were ordered as follows : in your opinion , to what extent do the following factors improve your motivation in your job ? the responses for each item ranged from very much ( 5 ) to very little ( 1 ) and the minimum to maximum average score for each motivational domain was 1 to 5 , respectively . descriptive statistics ( mean and standard deviation ) and independent - samples t - test were used to determine the difference between motivational factors among groups using ibm - spss software , version 23 . the confidentiality of respondents was preserved during data gathering , and all personnel were free to decide whether to participate in the study . the study was approved by the research ethics committee of the shahid beheshti university of medical sciences ( ref , no . : among the 300 questionnaires that were distributed , 258 were completed and returned ( response rate : 86% ) . analysis of the demographic features of the study sample showed that 168 employees ( 65% ) were female , 204 ( 79% ) were over 30 years of age , 140 ( 54% ) had less than 10 years of job experience , 227 ( 86% ) had a university degree , 184 ( 74% ) were nurses , and 74 ( 26% ) worked in other professions . the findings indicated that , among the motivational factors , working relationships ( mean of 3.95 ) had the greatest influence on the job motivation of frontline employees . career development , social respect , job content , and autonomy were the next four affective factors . recognition and remuneration had the least influence on motivation of frontline employees ( table 1 ) . the results of the friedman test indicated that the difference between mean scores among different dimensions was significant ( (6 ) = 607.00 , p < 0.001 ) . a comparison of motivational factors based on the demographic variables showed that the effects of suitable working relationships , remuneration , job content , and career development differed according to gender ( table 2 ) . female employees attached greater importance to remuneration , and males attached greater importance to other factors ( p < 0.001 ) . the effect of job content , autonomy , and social respect on motivation was greater in employees under 30 years of age than in employees over 30 years of age ( p < 0.05 ) . employees with university degrees allocated greater importance to career development and job content ( p = 0.04 ) . employees with high school diplomas or less education assigned greater importance to working relationships , remuneration , autonomy , and social respect ( p < 0.05 ) . a comparison of motivational factors on the basis of job experience ( table 2 ) showed that employees with less than 10 years of job experience attached more significance to job content , social respect , and career development ( p < 0.05 ) . for more experienced employees , remuneration , recognition , and autonomy were more in motivation . a comparison of the motivational factors versus job type ( table 2 ) showed that nurses attached higher importance to working relationships and job content and that other frontline employees attached greater importance to remuneration , recognition , and social respect ( p < 0.05 ) . this study determined the factors that affect job motivation of frontline employees in teaching hospitals in tehran , iran . four motivational factors ( working relationships , career development , social respect , and job content ) had the strongest effect on job motivation of the respondents . intrinsic factors had a greater effect on motivation than extrinsic factors , which was consistent with the results of previous studies in iran ( 13 , 14 ) , estonia ( 9 ) , and pakistan ( 2 ) . ( 15 ) found that pre - hospital emergency technicians believed psychological factors , such as perceived job responsibility , meaningful work , and job success , were the most important factors that affect motivation . the herzberg theory ( 16 ) states that intrinsic factors have the greatest potential for motivating employees . the employee s relationship with her or his supervisor and colleagues and management support proved to be the most important motivational factors in the present study , which was consistent with the results of previous studies . the leadership style of managers and good working relationship with the supervisor and colleagues played a significant role in the motivation of health workers ( 4 , 17 , 18 ) . the lack of managerial skills was cited as a factor that decreased motivation ( 16 ) . results of other studies have shown that management support , relationship with the supervisor , and working relationships were the most important motivational factors for nurses ( 13 , 14 ) , hospital managers ( 19 ) , and healthcare workers ( 20 ) . suitable working relationships with colleagues and the supervisor are necessary for hospital personnel who work in teams . a systematic review revealed that 85% of studies on healthcare worker motivation cited career development and educational opportunities as important factors for job motivation ( 17 ) . a study in pakistan showed that lack of opportunities for higher qualifications and professional growth were the most important factors that decreased the motivation of physicians ( 2 ) . previous studies of iranian nurses ( 21 ) , hospital workers in ghana ( 22 ) , and primary care providers in china ( 8 , 23 ) indicated the importance of job advancement and the existence of educational opportunities on motivation . when the employees believe they have opportunities for advancement in their profession , they remain motivated . hamoudzade et al . ( 19 ) found that social respect was an important factor that motivates hospital managers . ( 20 ) found that social respect was influential on the job motivation of health workers . malek et al . ( 2 ) recognized social reward as a socio - cultural motivator of pakistani physicians . these findings indicate that respect for healthcare professions plays an important role in the motivation of employees . meaningful work was reported as an important motivational factor among greek nurses ( 5 ) and cypriot nurses and physicians ( 3 ) . a study in iran showed that achieving hospital goals , existence of challenging goals , and participation in determination of goals were important factors that motivated hospital managers ( 19 ) . the presence of a goal and a specific result for work are important factors for motivation . in the healthcare sector in particular , witnessing the results and effects of efforts by an employee on a patient can provide strong positive motivation . recognition and remuneration had less effect on motivation than other factors , which was consistent with the results of previous studies in iran ( 20 ) . tsounis showed that financial incentives did not increase physicians motivation in the public sector of greece ( 24 ) . findings of studies in estonia ( 9 ) and greece ( 5 ) also were indicative of the low effect of financial factors and salary on motivation in nurses . a systematic review revealed that recognition was less important as a motivational factor than other factors for the primary healthcare providers ( 17 ) . this finding was consistent with the herzberg theory that remuneration is a hygiene factor and lacked high motivational potential ( 16 ) . financial incentives had an effect on employee motivation , but money was rarely the most important motivational factor ( 2 , 5 ) . it appears that developing and using the incentives aimed at fulfilling goals , job enrichment , and recognition in the workplace are more fruitful . the effect of job content , autonomy , and social respect on motivation was greater for younger employees . the findings of previous studies indicated that age has a significant relationship with motivation and motivational factors ( 21 ) . one study showed that responsibility had a greater effect on the motivation of young workers ( 23 ) . in our study , it was determined that female employees attached more importance to the role of remuneration in motivation . similar results have been reported in studies showing that female physicians and nurses regard financial factors as more important than other factors ( 2 , 3 ) . a study in cyprus indicated that nurses attached less importance to financial factors than physicians ( 3 ) . it appears that , for nurses , job content and good working relationships with the treatment team had a stronger effect on motivation . accordingly , hospital management should take appropriate measures to establish good working relationships among the treatment team members to increase the motivation of nurses . the less - experienced employees assigned higher effects for job content , social respect , and career development on motivation . more experienced employees believed that remuneration , recognition , and autonomy had greater effects on motivation . the findings of a study in estonia showed that experienced nurses were more motivated by extrinsic aspects of their jobs ( 9 ) . this seems rational ; less - experienced employees require professional advancement and promotions ; thus , opportunities for advancement are considered appropriate motivational factors for them . this finding indicates that managers must develop well - thought - out plans for promoting the motivation of their more - experienced employees . career development and job content had more significant roles in the motivation of employees with higher education . employees with less education attached more importance to suitable working relationships , remuneration , autonomy , and social respect . staff with less education receive lower salaries and often have less autonomy because of the nature of their work . employees with higher education have higher expectations from their job and their abilities . for them , jobs that have defined objectives , challenges , and opportunities for growth are more important than other factors , such as remuneration and working relationships . our study had some limitations . first , apart from the factors examined in this study , there are other factors for job motivation that should be studied in future research to get a clearer picture of employees perspective on job motivation . second , our findings were obtained from a quantitative study , however , in order to get better results , it should be improved using qualitative studies . therefore , using qualitative methods in addition to quantitative methods in future studies could provide a better understanding of the factors that enhance job motivation . the results of this study showed that the intrinsic aspects of a job were stronger motivators on motivation than the extrinsic aspects , such as salary and financial incentives . facilitating communication between personnel and management , supporting employees in the community , and promoting social respect for health professions , providing educational opportunities and career development , development of appropriate promotional policies , employee participation in goal setting , facilitating a good working environment and job security , job enrichment , and delegation must be part of the human resource strategy of a hospital that seeks to engender increased motivation of its frontline employees .	introductionhuman resources are the most strategic resource and the most significant input for health systems . their behavior and motivation can strongly affect the overall performance of the health systems . the aim of this study was to determine the factors that affect motivation in frontline employees at teaching hospitals affiliated with shahid beheshti university of medical sciences ( sbmu ) in tehran , iran.methodsthis cross - sectional study was conducted in 2015 . the participants ( nurses , physiotherapists , radiology and laboratory technicians , operating room and pharmacy staff ) were 300 employees selected by the stratified random sampling method from two general and teaching hospitals . the data collection instrument was a questionnaire that consisted of 42 questions in the 7 domains of motivational factors . data analysis was performed using descriptive statistics and independent samples t - test by spss software , version 23.resultsthe findings indicated that working relationships ( mean of 3.95 ) were the main determinant of job motivation of frontline employees . job content ( 3.76 ) career development ( 3.75 ) , social respect ( 3.75 ) , and autonomy ( 3.30 ) were the next four affective factors . recognition and remuneration had the least influence on the job motivation of frontline employees . the results of the friedman test indicated that the difference between the mean scores of different dimensions was significant ( 2(6 ) = 607.00 , p < 0.001).conclusiona hospital that seeks to engender increased motivation of its frontline employees should have in place a human resources strategy that includes facilitating communication between personnel and management , supporting employees in the community , and promoting social respect for health professions , providing educational opportunities and career development , development of appropriate promotional policies , employee participation in goal setting , facilitating a good working environment and job security , job enrichment , and delegation .
You are an expert at summarizing long articles. Proceed to summarize the following text: there has been an increase in the use of motorcycles in nigeria largely on account of their rising popularity as a form of commercial transport.1 this growing popularity is attributed to relative ease of maintenance , flexibility in traffic , offering convenient door - to - door services and rapid rate of urbanisation in the face of inadequate means of transportation.2 poor licensing and disregard of road traffic regulations by riders have brought about a significant increase in motorcycle injuries.3 motorcycle - related injuries are associated with considerable morbidity and mortality.4 the inherent nature of motorcycles offers riders and passengers no protection like cars making them potentially dangerous.4 riders often absorb all kinetic and compressive energy resulting from a motorcycle crash contrary to a car crash.5 motorcyclists are about three times more likely than car occupants to be injured in a crash , and 16 times more likely to die.6 a number of hospital - based studies have demonstrated a considerable contribution by motorcycle - related injuries to the overall incidence of road traffic injuries in developing countries.789 elucidating factors involved in motorcycle injuries will help in formulating measures to reduce the global road traffic injury epidemic . the objective of this study was to determine the injury patterns and outcome of patients with motorcycle - related injuries who were attended to at the accident and emergency department of benue state university teaching hospital , makurdi . the clinical records of all patients with road traffic injuries who presented to the accident and emergency department between july 2012 and june 2013 were retrieved from the medical records department . those with motorcycle - related injuries were examined for age , gender , occupation , injury host status ( i.e. rider , pillion , or pedestrian ) , nature of collision ( motorcycle versus other vehicles , motorcycle versus motorcycle , motorcycle versus pedestrian , or lone riders ) , body region injured , injury severity score ( iss ) , length of hospital stay ( los ) and mortality . data collected were analysed using the statistical package for social sciences for windows version 15.0 ( spss , inc . , chicago , illinois ) . descriptive statistics were applied to determine means , frequencies and ranges . a confidence interval of 95% was assumed , and the difference was considered significant at p 0.05 . one hundred and eighty - nine patients presented with road traffic injuries within the study period . seventy - nine ( 41.8% ) were victims with motorcycle - related injury consisting of 63 males ( 61.8% ) and 16 females ( 15.7% ) with a male - female ratio of 3.9:1 . their ages ranged from 5 years to 65 years with a mean of 32.4 14.0 and a peak age incidence of 20 - 29 years . about 70% of victims were less than 40 years of age . distribution of motorcycle related injury patients by age groups riders constituted majority of the injured ( n = 44 , 55.7% ) , followed by pillions ( passengers ) ( n = 24 , 30.4% ) and pedestrians ( n = 11 , 13.9% ) . motorcycle versus vehicle collisions were the most common mechanism of injury ( n = 46 , 58.2% ) . this was by followed by motorcycle versus pedestrian ( n = 21 , 26.6% ) , motorcycle versus motorcycle ( n = 10 , 12.7% ) and lone motorcyclists ( n = 2 , 2.5% ) . musculoskeletal injuries constituted the most common injuries sustained ( n = 50 , 47.6% ) . this was followed by head injuries ( n = 46 , 43.8% ) and chest injuries ( n = 9 , 8.6% ) . the lower limbs were the most injured with the tibia being the most commonly fractured bone ( n = 14 , 35.9% ) . distribution of fractures sustained by the patients the overall los ranged from few hours to 147 days ( mean 8.01 days ) . twenty five per cent of patients were admitted for not more than an overnight stay . the majority of patients ( 57.0% ) sustained mild or moderate injuries ( iss 15 ) . there was no statistically significant difference between the sexes for sustaining mild / moderate injuries or severe / profound injuries ( p > 0.05 ) . this study showed a significant young male preponderance to motorcycle - related injuries , a finding that aligns with prior studies.41011 risk - taking behaviours of young riders contributing to crashes include speeding , disobedience of traffic regulations , drugs and alcohol intoxication , and neglecting safety measures.12 almost all commercial motorcycle riders are males and constitute a major risk group . males are more often exposed to traffic , travel longer distances to work and are more often involved in use of automobile for leisure activities.13 involvement of the productive age group of the society places an adverse effect on the economy . musculoskeletal injuries were the most common motorcycle - related injuries from this study and this corresponds with findings from other series.1012 these injuries occur when exposed limbs become trapped between the motorcycle and the ground or impacting vehicle . use of motorcycle crash bars and protective clothing is known to reduce the rate of occurrence of these injuries . the protective clothing is made of leather and is designed to offer near frictionless impact between the body and ground . they are , however , uncomfortable in hot climes making them a poor compliance in tropical countries.11 enforcing use of motorcycle crash bars and designing protective clothing for use in hot and humid conditions may go a long way in reducing the number and severity of lower limb injuries . the use of approved safety helmets at the time of injury is said to significantly reduce the morbidity and mortality from head and neck injuries from motorcycle accidents.1415 in fact , severe head injury is generally a reflection of low usage of helmets by motorcyclists.1 dismal results of compliance with helmet usage have been reported in developing countries.116 lack of traffic law enforcement , unawareness of value of helmet use , hot tropical weather and prohibitive costs are some of the reasons put forward for poor compliance with helmet usage in nigeria.11 educational campaigns should be launched targeting all motorcycle riders . stricter enforcement of traffic rules and development of tropics - friendly safety helmets may help improve compliance . collisions between motorcycles and motor vehicles were the most common mechanism of injury in this study followed by motorcycle versus pedestrian collisions . this finding is similar to those of earlier studies.1011 disregard of road safety measures by riders.1 namely riding under the influence of alcohol and drugs , low motorcycle conspicuity , or the inability of the motorcyclist to be seen by other road users.1617 is thought to be an important factor associated with risk of motorcycle accidents . using fluorescent or reflective clothing , wearing white or light - coloured helmets , and voluntary daytime use of headlight were associated with reduced risks of motorcycle crashes in a study.18 unavailability of pedestrian walkways on most roads has been cited as a reason for significant involvement of pedestrians in motorcycle - related accidents in a number of developing countries.1011 the los has been reported to be an important measure of morbidity among trauma patients.10 long hospital stay results in a lot of constraints on both human and material resources of the healthcare delivery system and reduction in productivity from lost man - hours . the average los obtained in this study was shorter than the findings in a similar study.10 this may not be unconnected to the fact that the majority of patients had mild and moderately severe injuries with about a quarter of all the patients not requiring more than an overnight stay in the hospital . the mortality rate of 6.3% obtained is comparable to the findings of other researchers.1219 head injuries are the leading cause of death in fatal crashes , contributing to about half of all the motorcycle - related deaths.12 they accounted for all the deaths in this study . they are likely to stem from poor compliance with usage of helmets which is common in developing countries . public education on the importance of the use of helmets by motorcyclists and stricter enforcement of crash helmet legislations may help reduce the mortality from motorcycle crashes .	background : motorcycle - related injuries lead to considerable morbidity and mortality . the aim of this study is to determine the pattern and outcome of motorcycle - related injuries at benue state university teaching hospital , makurdi , nigeria.patients and methods : case records of all patients who presented to the accident and emergency department with motorcycle - related injuries between july 2012 and june 2013 were analysed for age , gender , injury host status ( i.e. rider , pillion or pedestrian ) , nature of collision ( motorcycle versus other vehicles , motorcycle versus motorcycle , motorcycle versus pedestrian or lone riders ) , body region injured , injury severity score ( iss ) at arrival , length of hospital stay ( los ) and mortality.results:seventy - nine patients with motorcycle - related injuries were included in the study . they consisted of 63 males ( 61.8% ) and 16 females ( 15.7% ) . the age range was 5 - 65 years with a mean of 32.4 14.0 . motorcycle versus vehicle collisions were the most common mechanism of injury ( n = 46 , 58.2% ) . musculoskeletal injuries constituted the most common injuries sustained ( n = 50 , 47.6% ) and the tibia was the most frequently fractured bone ( n = 14 , 35.9% ) . the majority of patients ( 57.0% ) sustained mild / moderate injuries ( iss 15 ) . there was no statistically significant difference between the sexes for sustaining mild / moderate injuries or severe / profound injuries ( p > 0.05 ) . mortality rate was 6.3% with head injuries being involved in all cases.conclusion:young males were mostly injured in motorcycle - related trauma . musculoskeletal injuries were the most common injuries sustained and head injuries were involved in all the deaths . enforcement of motorcycle crash bars and helmet usage is recommended .
You are an expert at summarizing long articles. Proceed to summarize the following text: nitric oxide ( no ) is a soluble gaseous molecule with numerous biological activities that has multiple influences on the physiology and pathophysiology of the cells including cytotoxic and cytoprotective effects ( 1 ) . in human and animals bodies , it is produced by nitric oxide synthase ( nos ) enzyme isoforms and by no donors . three isoforms of nos are so far introduced ; calcium dependent and membrane associated endothelial nos , calcium dependent neuronal nos ( nnos ) , and calcium independent cytosolic inducible nos ( inos ) . these enzymes oxidize l - arginine to produce no and l - citrulline ; nadph is electron donor and acts as co - substrate and is strictly required for this enzymatic reaction ( 2 ) . pancreatic -cells constitutively express nnos , which is required for survival and physiological function ( 3 ) . inducible nos is not usually expressed in these cells , but produces constantly large amount of no in responses to inflammatory mediators ( 4 ) . no participates in regulation of - cell mass in islets of pancreas ( 5 ) . in this context , it should be mentioned that relation to its concentration and origin , no has a dual biological functions ; both proliferative ( 6 ) and apoptotic ( 7 ) . low amount of no derived from nnos has beneficial effects , but higher concentration resulting from inos activity induces inflammatory process , and is toxic both for host cells and invading biological organisms [ d1](8 , 9 ) . exposure to pathogens increases with aging ; on the other hand metabolic activities especially carbohydrate metabolism deteriorates during aging processes ( 10 ) . also , the prevalence of glucose intolerance and type ii diabetes is markedly increased with aging . in this situation , furthermore , inos activity in pancreatic islets of type ii diabetes noticeably increases ( 12 ) . according to research based theory , increase in inos activity and subsequent production of nitric oxide is associated with aging ( 13 ) . on the other hand , no can be considered a true inflammatory mediator ( 14 ) . in the course of inflammation , consequently increase in inos activity has been reported in the wide range of inflammatory condition including ; type2 diabetes , metabolic syndrome and alzheimer s disease ( 16 ) . due to important role of inos activity in above mentioned conditions and especially in type 2 diabetes , which increases during aging processes , the aim of this study was to find out the possible relation between changes in inos activity and aging and also establish / modify a rapid and sensitive hplc method of assay for nos activity in tissue homogenate . a total of twelve male wistar rats ( 15 weeks old , 200 to 250 g ) were supplied from pasture institute , tehran , iran and then were divided into two experimental groups ; adult young group : six rats of four months of age ; and six of four months age rats in old groups were kept in animal house for extra 8 months that in final became 12 months of age . the animals were housed under standard conditions ( 12 hr light12 hr dark cycle starting at 07:00 am at 24c in a controlled humidity ) with free access to food and water during one week of adaptation to laboratory situation . this study was approved by the local ethics committee of the research institute for endocrine sciences , shahid beheshti university of medical sciences , tehran , iran , and all experiments were conducted in accordance with standard ethical guidelines . animals either after two weeks of adaptation or 8 months of housing ( old group ) were anesthetized by intraperitoneal injection of sodium pentobarbital , 60 mg / kg body weight after an overnight fasting ( 17 ) . blood samples were obtained from heart for nox , insulin and glucose measurement , and then followed by median laparotomy for pancreatic islets isolation . for nos assay , groups of 200 islets were collected in ice - cold lysis buffer ( 200 l ) containing hydroxyethyl piperazine ethane sulfonic acid ( hepes ; 20.0 mm , ph 7.4 , sigma ) as a buffer , l - dithiothreitol ( l - dtt ; 1.0 mm , sigma ) and cocktail of protease inhibitor with edta supplement ( 1tablet dissolved in 10 ml buffer , cat . no.11836153001 , roche company germany ) and then aliquots were stored at -80c ( 18 ) . insulin and glucose were measured using glucose oxidase and elisa procedures , respectively . insulin and glucose kits were supplied from zistchimi ( iran ) and mercodia ( sweden ) companies , respectively . the intra - assay coefficients of variations for insulin , glucose and nox were 8.42% , 2.5% and 3.87% , respectively . for islet isolation , 10 ml ice - cold hanks balanced salt solution ( hbss ) ( ph , 7.4 ; containing nacl , 136 ; kcl , 5.36 ; cacl2 , 1.26 ; mgso4 7h2o , 0.8 ; na2hpo4 2h2o , 0.33 ; kh2po4 , 0.44 ; nahco3 , 4.16 ) all in mm concentration including 0.5 mg / ml of collagenase p ( roche , cat . number 1213 , germany ) was injected into the pancreatic duct , and then the islets were removed , and transferred to a sterile 50 ml falcon tube and then digested in a 37c water bath for 15 min ( 19 ) . reaction was terminated by adding ice - cold hbss , and then tube was shaken for 1 min . after 2 washes with cold hbss , the suspension was filtered through a 500 m plastic mesh to discard any undigested tissue particles . followed by one washing , then the islets were hand - picked under a stereomicroscope ( kyowa optical , sdz - tr - pl model , japan ) . for evaluation of insulin secretion in vitro , batches of 5 islets ( three replicas for each condition from 4 animals ) were incubated in tubes containing 1 ml of krebs ringer solution [ ( ph , 7.4 ) ; nacl 115 ; kcl 5 ; mgcl2 6h2o 1 ; cacl2 2.5 ; nahco3 24 and hepes , 16 all in mm ] and 5 g / dl bovine serum albumin ( bsa ; fluka , usa ) ( 19 ) with different glucose concentrations ( 5.6 , 8.3 , 16.7 mm ) for 60 min in 37 c water bath , and gassed with 95% o2 /5% co2 for 5 min at the beginning , groups of five islets were incubated for 60 min with various concentration of glucose containing 5 mm of nos inhibitor l - ng - nitro arginine methyl ester ( l - name , sigma ) ( 20 ) . for indirect measurement of nos activity briefly , serum proteins were precipitated using znso4 ( merck ) , and then the reduction of nitrate to nitrite was performed by saturated solutions of vcl3 ( vanadium chloride ) ( 0.8% w / v ) in 1 m hcl ( merck ) and then the color generating solution containing n - l(naphthyl ) ethylenenndiamine dihydrochloride ( nedd ; 0.1% w / v , merck ) in h2o and sulfanilamide ( 2% w / v , merck ) in 5% hcl ( griess reagents ) were added to the reaction vessels . after 20 min of incubation at room temperature , the absorbance was read in 540 nm ( 21 ) using spectrophotometer . after centrifugation at 35,000 g for 10 min , the supernatant was kept on ice for determination of protein concentrations using bradford method for protein and enzyme assay ( 22 ) . for inos activity assay , 100 l of supernatant was added to reaction mixture containing hepes , 20.0 mmol / l ( ph 7.4 ) , 0.2 mm l - arginine ( sigma ) and 2 mm nadph ( sigma ) in a total volume of 0.5 ml and was then incubated under constant air bubbling ( 1 ml / min ) at 37c for 120 min . inducible nitric oxide synthase activity was calculated from the difference between samples and blank reading . chromatographic separation was performed using an agilent 1100 series high - performance liquid chromatography ( hplc ) system . the accompanying agilent lc chemstation software program was used for instrument control , data acquisition , and processing . an analytical nucleodur rp- column ( 100 - 5 c18 ec , 1504.6 mm machery - nagel , germany ) gave the best results . hplc analysis was performed by isocratic elution with a flow rate of 1 ml / min . the mobile phase was 10 mm kh2po4 buffer solution containing acetonitrile - methanol - tetrahydrofuran ( 76:11.5:11.5:1 all in v / v ) . the temperature was maintained at 20c and the excitation and emission wavelengths in the fluorescence detector were set to 338 and 455 nm , respectively . for determination of l - citrulline , first 100 l of the incubated pancreatic islets extract were derivatized with o - phtaldialdehyde ( opa ) . both the extracts and l - citrulline ( sigma ) standards were separately injected ( injection volume : 100 l ) into the c18-reverse phase column immediately or after 2 , 10 and 15 min of derivatization in room temperature or 37c . l - citrulline quantification was carried out using comparison of retention times of the pancreatic islets extracts with standards of citrulline and also spiking the known concentration of standards to the sample . calibration curves were constructed by plotting the measured peak in the range of 10 to 500 pmol of l - citrulline standards . linearity of the standard curves was assessed by the coefficient of determination ( r ) , equally 0.995 in this analysis . accuracy was determined using high purity standard and precision was expressed as the relative standard deviation which was calculated in percentage for each of the replicate concentrations ( n = 3 ) . 2-mercaptoethanol ( 2-me ) , opa and the other minerals were > 95% purity from merck chemicals ( darmstadt , germany ) . all the solvents ( hplc gradient grade ) were purchased from samchun chemical ( pyeongtaek , korea ) . ultrapure water ( from a direct q uv-3 millipore system ) was used in all experiments . all analysis were validated by dagostino and pearson ( omnibus k2 test performed with prism version 5 ) normality test . statistical study between groups of data was assessed by using unpaired student s t - test or , where applicable , one way analysis of variance ( anova ) followed by bonferroni post- hoc tests using graph pad prism software ( version 5 ) . a total of twelve male wistar rats ( 15 weeks old , 200 to 250 g ) were supplied from pasture institute , tehran , iran and then were divided into two experimental groups ; adult young group : six rats of four months of age ; and six of four months age rats in old groups were kept in animal house for extra 8 months that in final became 12 months of age . the animals were housed under standard conditions ( 12 hr light12 hr dark cycle starting at 07:00 am at 24c in a controlled humidity ) with free access to food and water during one week of adaptation to laboratory situation . this study was approved by the local ethics committee of the research institute for endocrine sciences , shahid beheshti university of medical sciences , tehran , iran , and all experiments were conducted in accordance with standard ethical guidelines . animals either after two weeks of adaptation or 8 months of housing ( old group ) were anesthetized by intraperitoneal injection of sodium pentobarbital , 60 mg / kg body weight after an overnight fasting ( 17 ) . blood samples were obtained from heart for nox , insulin and glucose measurement , and then followed by median laparotomy for pancreatic islets isolation . for nos assay , groups of 200 islets were collected in ice - cold lysis buffer ( 200 l ) containing hydroxyethyl piperazine ethane sulfonic acid ( hepes ; 20.0 mm , ph 7.4 , sigma ) as a buffer , l - dithiothreitol ( l - dtt ; 1.0 mm , sigma ) and cocktail of protease inhibitor with edta supplement ( 1tablet dissolved in 10 ml buffer , cat . no.11836153001 , roche company germany ) and then aliquots were stored at -80c ( 18 ) . insulin and glucose were measured using glucose oxidase and elisa procedures , respectively . insulin and glucose kits were supplied from zistchimi ( iran ) and mercodia ( sweden ) companies , respectively . the intra - assay coefficients of variations for insulin , glucose and nox were 8.42% , 2.5% and 3.87% , respectively . for islet isolation , 10 ml ice - cold hanks balanced salt solution ( hbss ) ( ph , 7.4 ; containing nacl , 136 ; kcl , 5.36 ; cacl2 , 1.26 ; mgso4 7h2o , 0.8 ; na2hpo4 2h2o , 0.33 ; kh2po4 , 0.44 ; nahco3 , 4.16 ) all in mm concentration including 0.5 mg / ml of collagenase p ( roche , cat . number 1213 , germany ) was injected into the pancreatic duct , and then the islets were removed , and transferred to a sterile 50 ml falcon tube and then digested in a 37c water bath for 15 min ( 19 ) . reaction was terminated by adding ice - cold hbss , and then tube was shaken for 1 min . after 2 washes with cold hbss , the suspension was filtered through a 500 m plastic mesh to discard any undigested tissue particles . followed by one washing , then the islets were hand - picked under a stereomicroscope ( kyowa optical , sdz - tr - pl model , japan ) . for evaluation of insulin secretion in vitro , batches of 5 islets ( three replicas for each condition from 4 animals ) were incubated in tubes containing 1 ml of krebs ringer solution [ ( ph , 7.4 ) ; nacl 115 ; kcl 5 ; mgcl2 6h2o 1 ; cacl2 2.5 ; nahco3 24 and hepes , 16 all in mm ] and 5 g / dl bovine serum albumin ( bsa ; fluka , usa ) ( 19 ) with different glucose concentrations ( 5.6 , 8.3 , 16.7 mm ) for 60 min in 37 c water bath , and gassed with 95% o2 /5% co2 for 5 min at the beginning . , groups of five islets were incubated for 60 min with various concentration of glucose containing 5 mm of nos inhibitor l - ng - nitro arginine methyl ester ( l - name , sigma ) ( 20 ) . for indirect measurement of nos activity , nitrite concentration was measured using griess protocol . briefly , serum proteins were precipitated using znso4 ( merck ) , and then the reduction of nitrate to nitrite was performed by saturated solutions of vcl3 ( vanadium chloride ) ( 0.8% w / v ) in 1 m hcl ( merck ) and then the color generating solution containing n - l(naphthyl ) ethylenenndiamine dihydrochloride ( nedd ; 0.1% w / v , merck ) in h2o and sulfanilamide ( 2% w / v , merck ) in 5% hcl ( griess reagents ) were added to the reaction vessels . after 20 min of incubation at room temperature , the absorbance was read in 540 nm ( 21 ) using spectrophotometer . after centrifugation at 35,000 g for 10 min , the supernatant was kept on ice for determination of protein concentrations using bradford method for protein and enzyme assay ( 22 ) . for inos activity assay , 100 l of supernatant was added to reaction mixture containing hepes , 20.0 mmol / l ( ph 7.4 ) , 0.2 mm l - arginine ( sigma ) and 2 mm nadph ( sigma ) in a total volume of 0.5 ml and was then incubated under constant air bubbling ( 1 ml / min ) at 37c for 120 min . the blank sample contained all reaction components except nadph . inducible nitric oxide synthase activity was calculated from the difference between samples and blank reading . chromatographic separation was performed using an agilent 1100 series high - performance liquid chromatography ( hplc ) system . the accompanying agilent lc chemstation software program was used for instrument control , data acquisition , and processing . an analytical nucleodur rp- column ( 100 - 5 c18 ec , 1504.6 mm machery - nagel , germany ) gave the best results . hplc analysis was performed by isocratic elution with a flow rate of 1 ml / min . the mobile phase was 10 mm kh2po4 buffer solution containing acetonitrile - methanol - tetrahydrofuran ( 76:11.5:11.5:1 all in v / v ) . the temperature was maintained at 20c and the excitation and emission wavelengths in the fluorescence detector were set to 338 and 455 nm , respectively . for determination of l - citrulline , first 100 l of the incubated pancreatic islets extract were derivatized with o - phtaldialdehyde ( opa ) . both the extracts and l - citrulline ( sigma ) standards were separately injected ( injection volume : 100 l ) into the c18-reverse phase column immediately or after 2 , 10 and 15 min of derivatization in room temperature or 37c . l - citrulline quantification was carried out using comparison of retention times of the pancreatic islets extracts with standards of citrulline and also spiking the known concentration of standards to the sample . calibration curves were constructed by plotting the measured peak in the range of 10 to 500 pmol of l - citrulline standards . linearity of the standard curves was assessed by the coefficient of determination ( r ) , equally 0.995 in this analysis . accuracy was determined using high purity standard and precision was expressed as the relative standard deviation which was calculated in percentage for each of the replicate concentrations ( n = 3 ) . 2-mercaptoethanol ( 2-me ) , opa and the other minerals were > 95% purity from merck chemicals ( darmstadt , germany ) . all the solvents ( hplc gradient grade ) were purchased from samchun chemical ( pyeongtaek , korea ) . ultrapure water ( from a direct q uv-3 millipore system ) was used in all experiments . all analysis were validated by dagostino and pearson ( omnibus k2 test performed with prism version 5 ) normality test . statistical study between groups of data was assessed by using unpaired student s t - test or , where applicable , one way analysis of variance ( anova ) followed by bonferroni post- hoc tests using graph pad prism software ( version 5 ) . as shown in table 1 , fasting plasma glucose and nox levels of aged rats was significantly increased compared to adult rats ( p<0.01 ) , but aging had no significant effect on plasma insulin level . plasma glucose , insulin and nox levels in different experimental groups statistical comparison between groups was made using an unpaired t test , values are mean sem , n= 6 in adult ( 4 month old ) and old ( 12 month old ) . figure 1 shows that the basal glucose concentration ( 5.6 mm ) has no significant influence on insulin secretion in each condition ( adults and aged ) of experimental groups . stimulation of pancreatic islets with 8.3 mm glucose increased insulin secretion in both experimental groups . furthermore , l - name a nos inhibitor improved insulin secretion , but this improvement was not statistically significant . the results also showed that insulin secretion , especially in supra physiological high concentration of glucose ( 16.7mm / l ) did not increase in senescent rats , in which insulin release was significantly lower compared to adult rats ( figure 2 , p<0.05 ) . in contrast , using nos inhibitor - l - name ( 5 mm for 60 min ) concomitantly with glucose ( 16.7 mm / l ) in incubation medium of pancreatic islets , markedly increased islet insulin secretion ( figure 2 , p<0.05 ) . this enhancement was considerably prominent in aged rats compared to adults rats ; 42.39% 4.73% versus 15.27% 5.41% in adult rats ( p=003 ) . calibration curve of the opa derivative of l - citrulline lu : arbitrary luminescence unit glucose stimulated insulin secretion on isolated islets of langerhans . values are mean sem for 8 cups ( 2 cups each containing 5 islets for each condition from each animal ; 4 animals in each group ) ; * p < 0.05 statistically significant differences between adult ( 4- month- old ) and old ( 12- month- old ) . # p<0.05 , statistically significant differences between inhibitor and glucose 16.7 mm / l the inos activity in intact pancreatic islets of aged rats compared to adult rats was significantly increased ( 1.082 0.084 and 6.277 0.475 pmol / min per mg protein in adult and aging rats respectively , p<0.001 , figure 3 ) . the specific activity of the enzyme in pancreatic islets of adult rats was too low , which in one of the samples it was not detectable with current assay . statistical comparison between groups was made using an unpaired student t - test . * * * p<0.001 , statistically significant differences between groups . n=3 in adult ( 4- month- old ) and n= 4 in old ( 12- month- old ) groups time ( immediately or after 2 , 5 , 10 and 15 min ) and temperature ( room temperature and 37c ) of incubation had no effect on the fluorescence intensity . retention time of citrulline was 8.5 to 8.9 min and samples were run 15 min . column was cleaned and regenerated by sequentially washing with water and methanol 50% ( 15 min with each ) . this procedure had the best results on column cleaning and citrulline detection compared to other solvent such as acetonitrile . concentrations of 25 , 50 , 100 , 500 pmols of l - citrulline were used to establish a calibration curve ( figure 1 ) . precision is the measure of the degree of repeatability of the assay which is performed by using enter and intra assays coefficient of variation ( cv % ) . in our study , intra and inter assay of cv for l - citrulline assay were 2.976% ( 0.654 ) and 7.645% ( 1.325 ) , respectively . as shown in table 1 , fasting plasma glucose and nox levels of aged rats was significantly increased compared to adult rats ( p<0.01 ) , but aging had no significant effect on plasma insulin level . plasma glucose , insulin and nox levels in different experimental groups statistical comparison between groups was made using an unpaired t test , values are mean sem , n= 6 in adult ( 4 month old ) and old ( 12 month old ) . figure 1 shows that the basal glucose concentration ( 5.6 mm ) has no significant influence on insulin secretion in each condition ( adults and aged ) of experimental groups . stimulation of pancreatic islets with 8.3 mm glucose increased insulin secretion in both experimental groups . furthermore , l - name a nos inhibitor improved insulin secretion , but this improvement was not statistically significant . the results also showed that insulin secretion , especially in supra physiological high concentration of glucose ( 16.7mm / l ) did not increase in senescent rats , in which insulin release was significantly lower compared to adult rats ( figure 2 , p<0.05 ) . in contrast , using nos inhibitor - l - name ( 5 mm for 60 min ) concomitantly with glucose ( 16.7 mm / l ) in incubation medium of pancreatic islets , markedly increased islet insulin secretion ( figure 2 , p<0.05 ) . this enhancement was considerably prominent in aged rats compared to adults rats ; 42.39% 4.73% versus 15.27% 5.41% in adult rats ( p=003 ) . calibration curve of the opa derivative of l - citrulline lu : arbitrary luminescence unit glucose stimulated insulin secretion on isolated islets of langerhans . values are mean sem for 8 cups ( 2 cups each containing 5 islets for each condition from each animal ; 4 animals in each group ) ; * p < 0.05 statistically significant differences between adult ( 4- month- old ) and old ( 12- month- old ) . the inos activity in intact pancreatic islets of aged rats compared to adult rats was significantly increased ( 1.082 0.084 and 6.277 0.475 pmol / min per mg protein in adult and aging rats respectively , p<0.001 , figure 3 ) . the specific activity of the enzyme in pancreatic islets of adult rats was too low , which in one of the samples it was not detectable with current assay . statistical comparison between groups was made using an unpaired student t - test . * * * p<0.001 , statistically significant differences between groups . n=3 in adult ( 4- month- old ) and n= 4 in old ( 12- month- old ) groups time ( immediately or after 2 , 5 , 10 and 15 min ) and temperature ( room temperature and 37c ) of incubation had no effect on the fluorescence intensity . retention time of citrulline was 8.5 to 8.9 min and samples were run 15 min . column was cleaned and regenerated by sequentially washing with water and methanol 50% ( 15 min with each ) . this procedure had the best results on column cleaning and citrulline detection compared to other solvent such as acetonitrile . concentrations of 25 , 50 , 100 , 500 pmols of l - citrulline were used to establish a calibration curve ( figure 1 ) . precision is the measure of the degree of repeatability of the assay which is performed by using enter and intra assays coefficient of variation ( cv % ) . in our study , intra and inter assay of cv for l - citrulline assay were 2.976% ( 0.654 ) and 7.645% ( 1.325 ) , respectively . in accordance to the documented studies on human ( 23 ) and animals ( 11 ) , hyperglycemia increases with aging . variation in nox level in relation with aging has shown controversial results on previous studies . some of the studies are in favors of the results obtained in this study ( 24 , 25 ) , and some other studies shows different contrast results ( 26 ) . controversy in the results might dependent on the kind of studies and or change in other parameters associated with aging such as body weight and fat . change in plasma insulin level in this study ( table 1 ) associated with decreased insulin secretion may be followed by decreased insulin clearance as have previously been reported ( 27 , 28 ) . the study also showed decrease in insulin secretion , especially in high concentration of glucose ( 16.7 mm / l ) , which was significantly lower in aged rats ( figure 2 , p<0.05 ) . pancreatic islet size and beta cell number increase with age ( 29 ) , which compensate islet insulin secretion in basal state . despite these structural changes in the endocrine pancreas , islet insulin capacity , insulin content and insulin mrna levels decrease in aging animals ( 27 , 29 ) . with regard to above explanation , in high concentration of glucose , it seems that the reduced insulin secretion of pancreatic islets in this condition is inevitable and no may be involved in this process . use of nos inhibitor increased insulin secretion in both groups , especially in aged rats . according to no as a negative modulator of islet insulin release ( 20 ) , inos activity is induced and increased in high glucose concentration 10 mm / l ( 31 ) . it is suggested that no production from inos is prominent in aged rats , and it is responsible for decrease in insulin secretion , which is compensated by nos inhibitor l - name . in respect to inos activity , the previous studies had investigated an increase in inos activity and the gene / protein expression on aorta and heart of aged 14- month- old mice , respectively ( 32 , 33 ) . inducible nos activity is involved in the antiproliferative /apoptotic effect of proinflamatory cytokines that cause islet destruction and inhibit insulin secretion from pancreatic -cells ( 6 , 34 ) . based on the oxidation - inflammation theory of aging ( 35 ) , these conditions are associated with an impairment in the physiological functions , especially in homeostatic systems including the immune system . therefore , rise in inos activity which results in no production is associated with decreased islet insulin secretion , which is implicated in impaired glucose metabolisms . this presumably increases the prevalence of type ii non - insulin dependent diabetes during aging . in this study for the first time we have established a modification in the procedure of the nos activity assay in rat islets . in our laboratory , we have employed the l - citrulline assay for measuring no synthase activity in rat islets with minimal sample manipulation ; without stop solution and using a cation exchange column . although in his procedure also l - arginine was used as the substrate , but the enzymatic reaction was stopped by the addition of acidic solution and finally aliquots of incubation medium were passed through the additional steps using an amprep cbs cation - exchange column- and then processed samples were used for hplc analysis . finally l - citrullin elated from the amprep column was determined by hplc analysis ( 18 ) . the direct measurement of no is complex and difficult because no is unstable and highly reactive molecule ( the half - life of a few tenths of a sec ) . nonetheless , several indirect methods have been used to measure no metabolites including : nox measurement by griess reagent , which can be measured by spectrophoto - metric procedure ( 21 ) , and chemiluminescence procedure in which no is assayed by measurement of the difference in the absorption spectrum for oxyhemoglobin ( 36 ) ( no oxidize oxyhemoglobin to methemoglobin ) . in addition , nos activity can be determined with great reliability , sensitivity , and specificity by conversion of l - arginine to l - citrulline . l - citrulline is a stable by - product and is equimolar of no production from l - arginine . due to its stability , the measurement of l - citrulline production provides a much more accurate assessment of nos enzymatic activity . previous studies have shown that the inos activity measurement is more sensitive and superior to protein measurement using western blotting or elisa methods ( 31 , 37 ) . for hplc analysis , incubation with opa is performed in room temperature ( temperature of incubation had no effect on the fluorescence intensity ) . as mentioned previously , opa required a few min of reaction time ( 38 ) . column conditioning before analysis is a critical step to obtain good recovery and better separation ( 39 ) of the l -- citrulline . in this study , the column was initially conditioned by methanol solution ( 50% ) for 50 min at a flow rate of 0.5 ml / min followed by 60 min the mobile phase . in chromatography , thus , in order to prevent contamination of the column and possibly memory effect , after each sample run ( 15 min ) , the columns were washed sequentially with water / methanol 50% ( 15 min with each ) . wu and meininger ( 38 ) used column washing with methanol solution for satisfactory separation of l - arginine and l - citrulline in plasma and biological fluids . also schwarz et al ( 40 ) for analysis of plasma amino acids by hplc with fluorescence detection used a mixture of 90% isopropanol and 10% methanol in order to maintain column integrity . our results showed that inos activation and increase in no production might be responsible for decreased in insulin secretion in aging . the study emphasizes the link between reduced capacity of carbohydrate metabolism and increase in no signaling pathway in senescence . inducible nitric oxide synthase activity assay using l - citrulline measurement by hplc method was achieved by minimum sample handling , short time of assay , and maximum precision and accuracy .	objective(s):some pathologic situations such as diabetes and metabolic syndrome are associated with alternation in nitric oxide level . incidence of these condition increases with aging . on the other hand , insulin secretion is modulated by nitric oxide , and nitric oxide synthase ( nos ) activity is also altered in diabetes . in this study , modification in the enzyme activity associated with aging and also optimized procedure for islet nos assay was investigated.materials and methods : male wistar rats were randomly divided in two experimental groups : a : adult rats ; were 4 month old and b : old rats ; were 12 month old . in all groups , plasma glucose , insulin and nox ( nitrite + nitrate = nox ) were measured , and also insulin secretion in isolated pancreatic islet with or without l - name was investigated . furthermore , the inducible nos activity with l - citrulline measurement in islets was measured.results:l-citrulline was quantified using one step hplc column . aging induced hyperglycemia ( p<0.05 ) and excess plasma nox ( 17.74 1.664 and 26.25 2.166 mol / l in a and b groups respectively , p<0.05 ) with unaltered plasma insulin . islet insulin secretion was significantly reduced in aging rats . l - name induced islet insulin secretion especially in aging rats ( p=0.003 ) . inducible nos activity in islets of aging rats was significantly higher than adult rats ( 1.082 0.084 and 6.277 0.475 pmol / min per mg protein in adult and aging rats , respectively , p<0.001).conclusion : these findings show that decreased in islet insulin secretion may be related to increase in inos activity in islets , which follows impaired carbohydrate metabolism in aging .
You are an expert at summarizing long articles. Proceed to summarize the following text: kirschner wires ( k - wires ) and threaded wires are widely used devices for fixation of proximal humeral fractures . cases of metallic wire migration through the thoracic cavity have been described since 1943 . a more recent review of the literature has shown intrathoracic migration in 68 patients . to our knowledge , most of the cases described in the literature were diagnosed with substantial delay , when an organ damage had occurred . we report a case of asymptomatic early intrathoracic migration of a percutaneously inserted anterograde threaded wire used in the setting of pinning fixation of a 3-part humeral fracture . technical errors and risk factors a 69-year - old woman was admitted to the emergency department after an accidental fall . she presented with left shoulder pain and functional impairment . clinical history included essential hypertension and obesity . traditional x - ray series and computed tomography ( ct ) scan with three - dimensional reconstruction were performed . examinations showed a 3-part fracture of the proximal left humerus , accounting to the neer 's classification ( ao / asif : 11-b2 ) [ figure 1a and b ] . two days after patient acceptance to our department , fracture was treated by closed reduction and fixation with two retrograde k - wires and one threaded wire , by mean of a modified en palmire technique : the first two wires were retrograde nonthreaded bent wires inserted at the deltoid v level , while the latter was an anterograde threaded wire percutaneously introduced to fix the great tuberosity [ figure 1c and d ] . one month after surgery , the patient came back for routine clinical and radiographic control , to evaluate the fracture healing and eventually plan the wires removal . in that setting , she referred about global well - being and no pain at the shoulder . x - rays demonstrated the intrathoracic migration of the threaded wire used for tuberosity fixation [ figure 2a and b ] . a complementary ct scan was immediately performed to better show the spatial relationship between the wire and intrathoracic vital organs . it revealed the device was migrated through the fifth intercostal space to the left lung parenchyma , without the signs of pneumothorax , nor bleeding [ figure 2c and d ] . she only referred about episodic intercostal mild pain that onset 1 week after surgery and was elicited by a cough . due to low severity of the symptom , it was completely underestimated by the patient . the patient was immediately managed by mean of video - assisted thoracoscopic approach to remove the migrated wire from the lung parenchyma . intraoperatively , a fibrin - coated spot was identified on the lung surface and excised . this allowed the foreign body to be visualized and easily removed [ figure 3 ] . neither parenchymal bleeding nor pneumothorax was observed . the postoperative outcome was free of complications , and the patient was discharged 3 days after surgery with a normal chest radiogram . one month after surgery , the patient underwent new thoracic and left shoulder x - rays , confirming the healing of the shoulder fracture and the absence of radiographically evident sequelae about the lung . a specialist consultation by thoracic surgeons was performed , assessing the complete recovery of lung function without complications or negative outcomes . ( a and b ) preoperative x - rays and three - dimensional computed tomography studies demonstrating a 3-part proximal humeral fracture ; ( c and d ) postoperative x - rays in anteroposterior and transthoracic views ( a and b ) one month follow - up x - ray control showing migration of the anterograde threaded wire ; ( c and d ) computed tomography study performed to defi ne the relationship between the wire and intrathoracic vital organs , demonstrating the wire close to the diaphragm and posterior and inferior to the left ventricle , without organ damage ( a ) fibrin - coated entry point of the wire in the left lung ; ( b ) thoracoscopic views of the wire removal ; ( c ) the removed wire thecases of metallic wire migration through the thoracic cavity have been described since 1943 : lyons and rockwood described 49 cases of k - wire migration in 47 patients , reported over 38 years , from 1943 to 1981 . most of these cases dealt with early migrations in which the time between the introduction of the wires and the migration to the thorax varied from 1 to 21 days . many predisposing or contributing factors to pin dislocation could be identified , such as the breathing movements , the intrathoracic negative pressure , the gravitational force , the regional bony re - absorption , the freedom of shoulder movements , and inadequate wire positioning . however , a unique reproducible causal mechanism has not been described yet . some authors reported about axillary migration with or without nervous lesions and intrathoracic migration often followed by devastating sequelae such as pneumothorax , hemothorax , lung consolidation , and hemoptysis ; others described often fatal cardiac and vascular perforation , while in two cases , an intraabdominal migration through diaphragm with or without intestinal perforation was reported . migration could become evident when an important organ lesion has already occurred , and this negatively affects the outcome and survival . similarly to the case we described , only a few authors reported occasional diagnosis during programmed x - ray controls : the fortuitous finding allowed a prompt management , then preventing further complications to the patient . of note , several cases of k - wire migration in the literature involved an anterograde pin often used for great tuberosity fixation . in such circumstances , the migration could be facilitated by secondary fragment dislocation , partial bony re - absorption of the humeral head , preexisting poor bone mineral density , and micro - movements are occurring despite the immobilization of the shoulder . in thiscase too , the migration involved the anterograde wire : despite being a threaded wire , an improper positioning should be taken into account as a contributing factor to the complication to occur . the thread of the wire appeared not properly anchored to the bone , vanishing the significance of the thread itself , and the possibility the wire engaged the inferior fracture line is plausible , with further reduction of hardware stability . fixation techniques for proximal humeral fractures using metallic wires represent a suitable and minimally invasive therapeutic option , but some precautions should be taken to prevent highly dangerous hardware loosening and migration . first , it is warmly advised bending the extremities of the wires to involve the periosteum , or positioning the wires with percutaneous technique avoiding , if possible , anterograde wire positioning ; for tuberosity fixation , the use of a cannulated screw should be considered . during fixation , pins positioning should be accurate and , after pinning , hardware stability should be always checked through dynamic maneuvers . despite attractive , the use of pinning techniques should be carefully discussed in the setting of complex and comminuted humeral fractures , especially in cases of elder patients with presumably low bone quality and low compliance to the immobilization regimen . moreover , it is worth submitting patients to close periodic follow - up visits and standard shoulder x - ray controls to detect eventual early migration , also in the absence of clinical signs and symptoms suggestive for complications . if any sign of hardware migration is detected , a thorough radiological and ct study should be made , and the surgical removal should be promptly performed . the surgeon should always keep in mind the imminent risk of devastating organ damages and the reported risk , as well , of displacements of considerable distance in only a few hours after the diagnosis . the video - assisted thoracoscopic approach is a useful solution for retrieving and removing an intrapulmonary migrated pin .	pinning with metallic wires is a suitable therapeutic option for proximal humeral fractures . loosening and migration of such devices from this site is uncommon . despite infrequently occurring , however , the literature reports dramatic and potentially lethal complications related to wires dislocation . a 69-year - old woman underwent closed reduction and fixation of a proximal 3-part humeral fracture by mean of two retrograde kirschner wires and one anterograde threaded pin . one month after surgery , during a routine follow - up control , it was diagnosed the migration of the threaded pin in the left lung parenchyma . in the meantime , the only symptom the patient complained was an episodic intercostal pain of mild intensity , with referred onset 1 week after surgery . the migrated pin was removed through thoracoscopic approach in the emergency setting , without intra- or post - operative complications . only a few authors reported similar complications after fixation of proximal humeral fractures . immediate surgical removal of the device is always mandatory . when considering pinning fixation for shoulder girdle 's fractures , orthopedic surgeons should take into account the risk for wire dislocation , and take up adequate precautions during surgery and follow - up control visits .
You are an expert at summarizing long articles. Proceed to summarize the following text: the small sample size and lack of control group are the main limitations of the study . treatment of recurrent or resistant warts is still a very difficult proposition.immunotherapy is an exciting treatment option for such cases.multiple skin test antigens have been used in immunotherapy of warts.there are still no clinical studies from india on candida immunotherapy in the management of warts . there are still no clinical studies from india on candida immunotherapy in the management of warts . warts are a common sight in dermatology opds and they constitute the commonest cutaneous manifestation of human papilloma virus ( hpv ) infection . warts ( verrucae ) are primarily treated by destructive therapies such as topical keratolytics , electro fulguration or radiofrequency ablation , liquid nitrogen cryotherapy , and laser vaporization with either pulsed dye laser or co2 laser . other options include intralesional chemotherapeutic agents such as bleomycin , oral immune modulators like cimetidine , levamisole , or even oral antivirals like cidofovir . thus , we have patients in whom the warts resolve spontaneously with the simplest treatment or even without any medical treatment , and at the other extreme , there are patients in whom the warts seem to be resistant to every possible mode of treatment . moreover , even after an individual patient has responded to any of these treatment options , there are chances of relapse and it is quite common to come across patients with multiple troublesome recurrences . in patients with unresponsive or recurrent warts , immunotherapy is an exciting treatment option and over the last few years , various treatment methods have been described that basically stimulate the immunologic response to hpv . the first and the simplest method is topical application of certain inorganic molecules that are capable of eliciting a contact hypersensitivity reaction with secondary activation of an immunological response , or even topical applications of immune modulators like imiquimod . another way is to inject the immunotherapeutic agent into the wart tissue itself . in case of multiple warts , it is usually the mother wart or the wart that appeared first that is injected . the possible mechanism of action of immunotherapy is that the injection or application of the immunotherapeutic agent leads to proliferation of hpv - specific mononuclear cells that mediate an immunologic attack against the wart tissue . what is interesting is that this immune attack has a potential to resolvethe distant warts as well and not the wart alone that has been primarily injected . studies have been conducted on the effectiveness of immunotherapy with single as well as multiple test antigens in treatment of warts . the first such study documented the efficacy of candida skin - test antigen in wart resolution . subsequent studies were conducted on this antigen and also on other antigens such as mumps , trichophyton , and even a combination of multiple test antigens . all of these studies have shown that immunotherapy not only causes a resolution of the treated wart but also leads to clearance of distant warts , at least in a subset of the responders . this study was conducted from november 2010 to january 2012 at our institute on patients suffering from resistant or recurrent veruccae anywhere on the body . a proper permission was obtained from the local ethics committee before the initiation of the study . inclusion criteria included patients with multiple veruccae vulgaris that were either resistant to treatment or had relapsed at least once after treatment with any of the tissue - destructive modalities . the veruccae were termed as resistant only if they failed to show any response to at least one destructive mode of treatment . patients with any evidence of immunosuppression including hiv infection , patients with any eczematous skin disorder , those with any history of hypersensitivity to candida albicans antigen , pregnant or lactating women , patients on immunosuppressant or immune modulatory drugs , and patients younger than 12 years of age were excluded from the study . patients were informed about all the modalities of treatment available for warts and the relative merits and demerits of c. albicans immunotherapy including a possible non - response to the treatment regimen . an informed consent form was then given to the patients and they were made to sign it themselves or by their guardians . the warts were then photographed and counted and the size of the injected wart was also noted down . before inclusion into the study , a test dose of the candida antigen was given intradermally on the flexor aspect of the forearm and the area of injection was marked with a permanent marker pen . the patient was called after 2 days ( 48 h ) and the reaction at the intradermal injection site was noted down . erythema and induration at the site were observed , and the response to the test dose was taken as positive if the area of erythema and induration was at least 5 mm in diameter . only those patients who showed a positive response to the candida test antigen were enrolled and taken up for treatment with c. albicans antigen injections . a cohort of 40 such patients was thus selected for the study and each of these patients received intralesional injection of purified c. albicans antigen solution into the mother wart , i.e. , the earliest or initial wart on the body . if the patient was not sure about the initial wart , then the largest wart was injected irrespective of its temporal association . the candida test antigen used was the credisol skin test solution marketed by creative drug industries , mumbai , india . injections were given into the substance of the wart using a 27-guage needle , and a total of three injections were administered at 3-week intervals . the volume of the test antigen used was 0.1 ml on every occasion irrespective of the severity of response to the initial intradermal test dose . thus , a total of 0.3 ml of the test antigen was used in each patient . the patients were examined at each follow - up injection and any regression in the size of the warts was noted down . digital photographs were also repeated at every follow - up visit , and adverse events , if any , were also noted down . each patient was told about the possibility of a febrile reaction after the injection and was advised to take antipyretics in case of such an eventuality . patients who showed no or a partial response after three injections were called for a final follow - up 1 month after the date of the final injection for eventual evaluation of the therapeutic result . however , all positive responders were further followed up for a period of 6 months after the treatment , and recurrences , if any , were noted down . in those patients where the shaving area of the face was involved , shaving blades were prohibited during the treatment as well as for the next 12-weeks of follow - up . response to treatment was noted down at every follow - up visit with clinical examination of the treated as well as untreated warts along with photographic documentation . the wart was said to have completely resolved only when there was complete disappearance of the hyperkeratosis and thickening of the skin . the wart was considered to have shown a partial resolution if there was 50 - 75% reduction in the original diameter of the treated wart . reduction in the size of the treated wart by < 50% was considered to be a non - response . patients who did not show any response to the immunotherapeutic regimen were offered alternative treatment options . of the 40 patients enrolled for the study , six could not complete the course of three injections as they did not come for further injections after their first dose only . these patients were dropped from the study and thus we had 34 patients available for assessment at the end of the study . age of these patients ranged from 14 to 36 years , with a mean of 24.3 years . male patients were more commonly represented in the study group as there were 20 male and only 14 female patients in the study population . the duration of warts ranged from a minimum of 3months to a maximum of 8 years , with a mean of 1.2 years . sites where the warts were present included the face ( 22 ) , hands ( 18 ) , feet or legs ( 14 ) , and forearms ( 4 ) . pain at the injection site was the commonest adverse effect reported and this was reported by majority of the patients . the pain occurred at the time of injection only and was the most severe in intensity when the fingers were injected . in fact , all patients in whom the fingers , especially the peri - ungual warts were injected , complained of severe pain at the time of injection . fever or myalgias was reported by three patients only and none of them required any analgesics or antipyretics for this purpose . of the total 34 patients available for analysis of study results , 19 ( 55.9% ) showed a complete resolution of the treated as well as untreated warts [ table 1 ] . the usual scenario seen in these patients was a progressive reduction in the size of the treated wart that usually started after the first injection only with complete resolution by the third injection [ figures 1 and 2 ] . simultaneously , with the changes in the surface area of the treated wart , the untreated warts also disappeared gradually without any inflammatory sequalae [ figure 3a and b ] . response to intralesional candida injection immunotherapy ( a ) recurrent warts on face after multiple destructive procedures . ( b ) same patient after candida immunotherapy ( a ) resistant warts on the face . ( d ) same patient showing resolution of distant warts on the leg ( a ) extensive veruccae on feet since > 8 years . ( c ) almost complete resolution after three doses in two more patients ( 6% ) , the treated wart was seen to respond partially to treatmentregimen , but there were no changes observed in the untreated warts . in these two patients , warts were seen on the face and hands and it was only the injected wart on the hand that showed a partial resolution after treatment . both of these patients had multiple verruca plana on the face that failed to show any responseto the treatment regimen . however , there were five patients who had verucca plana on the face in addition to the presence of common warts on either the hands or the feet . in these patients , only the mother wart on hands or feet was injected with the candida test antigen . three of these five patients showed a positive response to the treatment regimen with resolution of the plane warts on the face along with resolution of common warts on the extra - facial sites . in the follow - up period of 6 months , none of the non - responders showed any further reduction in size or number of warts , and none of the patients in whom the warts had resolved with the treatment regimen showed any relapse anywhere on the body . we encountered some technical difficulties while performing the intralesional injections and would like to point them here . the first and the most important is the possibility of the intralesional drug to ooze out of the wart while injecting . while injecting , the antigen solution tends to come out of the upper surface or the other side of the wart . this is especially common if one has to inject a wart of smaller size . to overcome this difficulty , it is better to inject the wart from the upper surface and not from the lateral side . second , during the second and third injections , it becomes difficult to inject and accommodate the whole volume of the solution in some cases as the injected wart is already resolved to a great extent at that time . we encountered some technical difficulties while performing the intralesional injections and would like to point them here . the first and the most important is the possibility of the intralesional drug to ooze out of the wart while injecting . while injecting , the antigen solution tends to come out of the upper surface or the other side of the wart . this is especially common if one has to inject a wart of smaller size . to overcome this difficulty , it is better to inject the wart from the upper surface and not from the lateral side . second , during the second and third injections , it becomes difficult to inject and accommodate the whole volume of the solution in some cases as the injected wart is already resolved to a great extent at that time . treatment of warts is not always a simple affairas many patients fail to respond to all conventional modes of treatment . in addition , there are patients in whom warts do respond but there are multiple troublesome recurrences . the chances of a relapse are especially high when the warts are present on any part of the face . the lips and the area around the eyebrows in women and the shaving area in men are the most notorious for these troublesome recurrences to occur ( personal observation ) . repeating the same destructive procedure again and again in such patients is definitely not a feasible thing to do . logically , the best possible treatment option in the above - mentioned cases is some form of immunotherapy that will boost the immune response to hpv infection in general . immunotherapy has been tried with oral immune modulators such as cimetidine and levamisole and also with topical immiquimod and intralesional interferons . immunotherapy with different skin test antigens like candida , mumps , or trichophyton antigen is a relatively new treatment option for warts that has been studied over the last decade or so . the first antigen that was tried for immunotherapy of warts was that of candida and the investigators reported success in majority of patients treated with this test antigen . in a subsequent study , intralesional candida injections were compared with cryotherapy in the treatment of warts . the study reported complete resolution of the wart treated with candida injections in 74% patients and complete resolution of even the untreated warts in 78% of these responders . intralesional candida immunotherapy has also been tried in children with recalcitrant warts with a response rate of 47% for the treated wart and 34% for all the body warts . in addition to candida , some other skin test antigens have been tried with success in treatment of warts . these include mumps antigen , trichophyton antigen , and even a combination of multiple antigens . treatment with multiple antigens has , however , shown no advantages over single - antigen injections in terms of efficacy of treatment . different regimens have been described regarding the candida antigen immunotherapy for warts [ table 2 ] . in one clinical study , the dose used has been correlated with the amount of induration observed after the test dose . when the induration observed with the test dose antigen was more than 40 mm , the therapeutic dose administered was 0.1 ml on each occasion , whereas those showing an induration of 20 - 40 mm and 5 - 20 mm were given a dose of 0.2 ml and 0.3 ml , respectively . we used a similar dose regimen in all patients regardless of the extent of induration achieved after the test dose injection . this dosage regimen seems to be equally effective as we also achieved a positive response in more than half of our patients . similarly , some authors have used up to five injections at 3-week intervals , whereas we used only three injections at 3-week intervals for the study . we found that the person who ultimately shows a resolution of the injected and/or distant warts shows some response after the first or at the most after the second injection only . persons who fail to show any response after the first or even the second injection are less likely to respond after the third dose as well . follow - up visit of these patients for the subsequent injections becomes a problem if they fail to see any visible results even after the third dose of candida injection . the limiting factor in prescribing this treatment option is the absence of any reaction to the test dose of the antigen in a subset of patients . however , patients showing a negative response to one antigen can be tested with other antigens solutions such as those of trichophytonor mumps . comparison with select studies on test antigen immunotherapy it is a well - known fact that trauma of any sort including the trauma associated with an intralesional injection can lead to a non - specific immune response against the wart antigens with subsequent resolution of the traumatized wart . however , going by the high proportion of patients showing a positive response to intralesional immunotherapy , there seems to be a definite role of the test antigens in resolution of warts . even the eradication of untreated warts after injecting a single wart goes in favor of a systemic immune response against hpv after introduction of the test antigens . adverse effects that have been reported with candida immunotherapy include febrile reactions , myalgias , erythema , and edema at the injection site and painful purple digit syndrome . we did not encounter any of these adverse events except mild fever in few patients . however , majority of our patients did complain of pain at the time of injection , which was severe in some instances . candida immunotherapy seems to be a promising treatment option in patients in whom the warts are either resistant or not amenable to destructive modes of treatment . there is no risk of any scarring at the sites of intervention or at the site of warts . furthermore , treatment of a single wart needs to be done even if there are hundreds of warts on the body . risk of relapse also seems to be really low , and this is so important in patients suffering from troublesome recurrences of warts . absence of a control group and small sample size of the study population were important limitations of the study . therefore , we would definitely recommend more extensive , randomized controlled studies on this subject in larger population groups and with different dosage regimens to make it a routine treatment option to be offered to patients . multiple intralesional injections with candida test antigen is an effective treatment option in the treatment of recurrent or resistant warts.a single uniform dose can be used for injection irrespective of the extent of induration with the test dose of the injection . multiple intralesional injections with candida test antigen is an effective treatment option in the treatment of recurrent or resistant warts . a single uniform dose can be used for injection irrespective of the extent of induration with the test dose of the injection . absence of a control group and small sample size of the study population were important limitations of the study . therefore , we would definitely recommend more extensive , randomized controlled studies on this subject in larger population groups and with different dosage regimens to make it a routine treatment option to be offered to patients . multiple intralesional injections with candida test antigen is an effective treatment option in the treatment of recurrent or resistant warts.a single uniform dose can be used for injection irrespective of the extent of induration with the test dose of the injection . multiple intralesional injections with candida test antigen a single uniform dose can be used for injection irrespective of the extent of induration with the test dose of the injection .	background : warts are sometimes resistant or they tend to recur after every possible destructive therapy . immunotherapy with skin - test antigens has been used as a viable therapeutic option in such recalcitrant cases.aim:the aim of the study was to evaluate the response of resistant or recurrent warts to intralesional candida albicans antigen immunotherapy.materials and methods : a total of 40 patients with resistant or recurrent warts who showed a positive test reaction to c. albicans antigen were given intralesional injections of purified c. albicans antigen solution in a single wart at 3-weekly intervals for a total of three doses . the patients were monitored for resolution of the injected wart as well as other untreated warts . the patients who responded positively were then followed up for any relapses over the next 6 months . adverse events , if any , were also documented.results:of the 40 patients enrolled in the study , 34 completed the total treatment protocol of three injections and 6 months of follow - up . in these 34 patients , 19 ( 56% ) showed a complete resolution of warts at all places on the body . in addition , two patients ( 6% ) showed a partial or complete resolution of the treated wart , but there was no effect on the untreated warts . thirteenpatients ( 38% ) failed to show any response to the treatment regimen . in all patients showing resolution of all the warts , there were no relapses at any site over the next 6 months of follow - up . the most common adverse effect seen was pain during the intralesional injection.conclusions:intralesional candida immunotherapy seems to be an effective treatment option in more than half of the patients who fail to show a positive response to destructive modes of treatment or in whom there are multiple recurrences.limitations:the small sample size and lack of control group are the main limitations of the study .
You are an expert at summarizing long articles. Proceed to summarize the following text: angiogenesis and vasculogenesis are widely accepted processes of tumor vascularization , particularly for endothelium - dependent vessels . in both processes , tumor vascular endothelial cells develop from host cells located in normal tissues around the tumor or from endothelial progenitor cells . during the transition from endothelium - dependent vessels to mimicked vessels , mosaic vessels occur as a transitional type between endothelium - dependent vessels and vm channels , wherein both the host endothelium and tumor cells participate in tumor vascularization . vm is completely different from angiogenesis and vasculogenesis , in another word , the blood supply to tumors is proposed to involve three types : tumor - cell - lined vessels , mosaic vessels , and endothelium - dependent vessels . a study suggest that vm channels the tumor - cell - lined vessels could be the main source of blood supply in the early stage of tumor growth . endothelium - dependent vessels could then replace vm channels via a transitional step as mosaic vessels to become the dominant blood supply pattern at the late stage of tumor growth . cancer stem cells ( cscs ) , or tumor - initiating cells , were identified as a unique subpopulation with stem cell features in many types of cancer . current csc studies provide novel insight into tumor angiogenesis and its interplay with the tumor microenvironment . cscs have been shown to promote tumor angiogenesis by secreting vascular endothelial growth factor ( vegf ) and via their potential for transdifferentiation into endothelial cells . . showed that cd133 cells could originate from either tumor blood vessels or gliomas . in another study . found that blood vessels near cd133 or nestin niches as well as some cd31 vessels co - expressed cd133 or nestin . dong et al . reported that glioma stem cells ( gscs ) were involved in tumor tissue remodeling in a xenograft model . wang et al . found that a subpopulation of cells within glioma can give rise to endothelial cells . in summary , the angiogenesis capacity of gscs has been demonstrated ; however , the detailed relationship of gscs and the phenomenon vm in glioma is still unclear . vm channels are negative for cd34 ( and other endothelial blood vessel markers , such as cd31 ) and positive for periodic acid - schiff ( pas ) . vm can be identified histologically based on three elements : the plasticity of malignant tumor cells , the remodeling of the ecm , and the connection of vm channels to the host microcirculation system , . vm has been observed in many human tumors , including melanoma , , clear cell renal cell carcinoma , breast cancer , ovarian carcinoma , primary gallbladder carcinoma , malignant esophageal stromal carcinoma , mesothelial sarcoma and alveolar rhabdomyosarcoma , hepatocellular carcinoma , prostatic carcinoma , bladder carcinoma , osteosarcoma , and pheochromocytoma . we used cd34 staining to identify the endothelium in glioma tissue sections and pas staining to determine the basement membrane of tumor blood vessels . real tumor vessels stained positive for cd34 on their luminal surface and for pas in their walls . however , in a subset of gliomas , we observed pas - positive tubular structures that contained red blood cells but were lined by cd34-negative cells in the luminal surface , i.e. , vm . vm was also found in human glioma cell line xenografts . as described by folberg et al . , seven morphologic patterns of vm channels were identified in uveal melanoma : straight channels , arrangements of parallel straight channels , straight channels that cross - link , arcs ( incompletely closed loops ) , arcs with branching , closed loops , and networks ( networks were defined arbitrarily as at least three back - to - back , closed , pas - positive loops ) . in our study , we found that vm channels can be sorted into two distinct types : tumor cell - dependent ( wherein cd34-negative tumor cells imitate the functions of the endothelium ; figure 1 ) and ecm - dependent ( which involves only pas - positive ecm without tumor cells ; figure 1 ) . neither type of tubing is dependent on the endothelium , but both contribute to microcirculation in gliomas . however , different approaches have since confirmed that vm channels provide a mechanism of perfusion and a dissemination route within the tumor that functions either independently of or simultaneously with angiogenesis . studies have demonstrated the functional role of vm channels in tumor circulation using several methods , including microinjection , , , doppler ultrasonography , magnetic resonance imaging ( mri ) , laser scanning confocal angiography , , and injection of absorbite particles ( figure 2 ) . in our study , we found that the distribution of vm channels in gliomas looked patchy and abundant by the cd34-pas double staining . furthermore , vm channels were always located in regions where endothelium - dependent vessels were not found , and no necrosis or surrounding inflammatory cells were observed nearby . we investigated the potential association between vm and mvd in 48 glioblastomas and found that the mvd was comparably less in vm - positive tumors than in vm - negative tumors . this evidence supports that vm channels may be a complementary system to ensure tumor blood supply , especially in regions with less mvd . these representative images show gliomas dual stained for cd34 and periodic acid - schiff ( pas ) using immunohistochemistry . a , endothelial cells are detected with anti - cd34 ( dark brown ) , and vascular basement membrane is detected with pas ( purple magenta ) in normal tubular blood vessels . the channels are located in a viable area of the tumor , far from necrosis . d and f , vm channels containing red blood cells positive for pas but negative for cd34 : large cross section ( d ) and longitudinal section ( f ) . magnification : a , b , d , e , and f , 400 ; c , 100 . ( cited from yue et al .. the authors have got the permission to reprint this image . ) for cancer patients , vm is associated with poor prognosis , as the unique structure of vm channels facilitates tumor cell metastasis . tumor cells , which line the inner surface of vm channels , are directly exposed to blood flow , allowing them to leak out , migrate through the blood stream , and metastasize to other regions . furthermore , tumor cells that line the vm channel are highly malignant , are poorly differentiated , and have high plasticity . these cells can degrade adjacent connective tissue and penetrate the basement membrane of blood vessels by secreting proteins that mediate tumor invasion and metastasis . this phenomenon has been confirmed in liver cancer , breast cancer , gastrointestinal stromal tumors , and glioblastoma . then , the dual stained samples were stained for ki-67 , cyclooxygenase-2 ( cox-2 ) , and matrix metalloproteinase-9 ( mmp-9 ) . vm was detected in 13 of 101 samples and was more frequent in high - grade gliomas than in low - grade gliomas . patients with vm - positive tumors survived a shorter period of time than did patients with vm - negative tumors . in 1971 , folkman reported that tumors require a blood supply for survival , growth , and metastasis , and argued , for the first time , that anti - angiogenic therapy would have significant efficacy on tumors . anti - angiogenic therapy aims at inhibiting endothelial cell proliferation and/or migration to hypoxic tumor regions , thereby diminishing the supply of oxygen and nutrition to tumor cells and inducing cell death . traditional anti - angiogenesis drugs such as angiostatin and endostatin , which target normal endothelial cells , have little effect on vm channels , which lack normal endothelial cells . how , then , can the supply of oxygen and nutrition to tumor cells be blocked effectively and completely ? one solution is to focus on both endothelium - dependent vessels and non - endothelium - dependent vessels . recently , several genes such as matrix metalloproteinase-2 ( mmp-2 ) , membrane type-1 matrix metalloproteinase ( mt1-mmp ) , vascular endothelial growth factor ( vegf ) , cox-2 , and vascular endothelial cadherin ( ve - cadherin ) have been implicated in vm channel formation in human tumors , making them potential targets for therapy with anti - sense oligonucleotides or monoclonal antibodies . celecoxib , a cox-2 inhibitor , may block vascular channel formation , but addition of prostaglandin e2 ( pge2 ) abrogates these inhibitory effects . chemically modified tetracycline-3 inhibits the expression of ve - cadherin , mmp-2 , and mt1-mmp . other strategies to inhibit vm in preclinical studies include suppressing tyrosine kinase activity , knocking out the erythropoietin - producing hepatocellula a2 ( epha2 ) gene , down - regulating ve - cadherin , targeting human mmps and the laminin-52 chain , and inhibiting the phosphatidylinositol 3-kinase ( pi3k ) pathway . furthermore , gscs are suggested to be critical for vm formation , which will have significant implications for the design of novel anti - tumor therapies . a , this longitudinal section dual stained for cd34 and periodic acid - schiff ( pas ) shows a blood vessel with distinctive cd34 ( dark brown ) and cd34 but pas portions ( purple magenta ) ( magnification : 400 ) . ( cited from el hallani et al .. the authors have got the permission to reprint this image . ) b , absorbite particles , injected into the jugular vein , could be seen at human glioma stem cells , derived intracranial tumor vessels of various sizes . the inner lumens of these tumor vessels were irregular and discontinuous , and absorbite particles aggregated with red blood cells ( he staining , magnification : 400 ) . ( cited from dong et al .. the authors have got the permission to reprint this image . ) in 1971 , folkman reported that tumors require a blood supply for survival , growth , and metastasis , and argued , for the first time , that anti - angiogenic therapy would have significant efficacy on tumors . anti - angiogenic therapy aims at inhibiting endothelial cell proliferation and/or migration to hypoxic tumor regions , thereby diminishing the supply of oxygen and nutrition to tumor cells and inducing cell death . traditional anti - angiogenesis drugs such as angiostatin and endostatin , which target normal endothelial cells , have little effect on vm channels , which lack normal endothelial cells . how , then , can the supply of oxygen and nutrition to tumor cells be blocked effectively and completely ? one solution is to focus on both endothelium - dependent vessels and non - endothelium - dependent vessels . recently , several genes such as matrix metalloproteinase-2 ( mmp-2 ) , membrane type-1 matrix metalloproteinase ( mt1-mmp ) , vascular endothelial growth factor ( vegf ) , cox-2 , and vascular endothelial cadherin ( ve - cadherin ) have been implicated in vm channel formation in human tumors , making them potential targets for therapy with anti - sense oligonucleotides or monoclonal antibodies . celecoxib , a cox-2 inhibitor , may block vascular channel formation , but addition of prostaglandin e2 ( pge2 ) abrogates these inhibitory effects . chemically modified tetracycline-3 inhibits the expression of ve - cadherin , mmp-2 , and mt1-mmp . other strategies to inhibit vm in preclinical studies include suppressing tyrosine kinase activity , knocking out the erythropoietin - producing hepatocellula a2 ( epha2 ) gene , down - regulating ve - cadherin , targeting human mmps and the laminin-52 chain , and inhibiting the phosphatidylinositol 3-kinase ( pi3k ) pathway . furthermore , gscs are suggested to be critical for vm formation , which will have significant implications for the design of novel anti - tumor therapies . a , this longitudinal section dual stained for cd34 and periodic acid - schiff ( pas ) shows a blood vessel with distinctive cd34 ( dark brown ) and cd34 but pas portions ( purple magenta ) ( magnification : 400 ) . ( cited from el hallani et al .. the authors have got the permission to reprint this image . ) b , absorbite particles , injected into the jugular vein , could be seen at human glioma stem cells , derived intracranial tumor vessels of various sizes . the inner lumens of these tumor vessels were irregular and discontinuous , and absorbite particles aggregated with red blood cells ( he staining , magnification : 400 ) . ( cited from dong et al .. the authors have got the permission to reprint this image . ) abnormal , dysfunctional tumor vasculature and gscs are believed to be major obstacles for effective glioma treatment . vm may represent an important tumor survival mechanism and may contribute to the failure of current anti - angiogenic therapy , which aims to completely deprive tumors of their blood supply . targeting vm along with endothelium - dependent vessels may thus block the supply of oxygen and nutrition to tumor cells effectively and completely . furthermore , the unique structure of vm channels directly exposes tumor cells , which line the channels ' inner surface , to blood vessels , thereby facilitating metastasis . vm is frequently seen in the regions between the tumor and surrounding normal tissues and is associated with poor prognosis . therefore , therapies targeting vm channels have the potential to destroy the niche that maintains gscs , block the passage through which tumor cells metastasize , and reduce cancer recurrence . nevertheless , tumor vascularization is a complex process that involves concomitant activity of several distinct pathways that may vary according to the patient , tumor type , tumor grade , and therapeutic effect . successful treatment of gliomas should involve targeting one or more stages in the vm signaling cascade . three factors affect vm channel formation : the plasticity of vm channel associated tumor cells , the remodeling of extracellular matrix , and the connection of vm channels with the host microcirculation . thus , anti - vm therapy should focus on inhibiting tumor cell plasticity as well as remodeling the ecm and tumor microenvironment by blocking the biochemical and molecular pathways underlying vm . however , further studies on the mechanisms of vm are needed to determine the potential for future translational studies and clinical applications for glioma treatment .	anti - angiogenic therapy has shown promising but insufficient efficacy on gliomas . recent studies suggest that vasculogenic mimicry ( vm ) , or the formation of non - endothelial , tumor - cell - lined microvascular channels , occurs in aggressive tumors , including gliomas . there is also evidence of a physiological connection between the endothelial - lined vasculature and vm channels . tumor cells , by virtue of their high plasticity , can form vessel - like structures themselves , which may function as blood supply networks . our previous study on gliomas showed that microvessel density was comparably less in vm - positive tumors than in vm - negative tumors . thus , vm may act as a complement to ensure tumor blood supply , especially in regions with less microvessel density . patients with vm - positive gliomas survived a shorter period of time than did patients with vm - negative gliomas . although the detailed molecular mechanisms for vm are not fully understood , glioma stem cells might play a key role , since they are involved in tumor tissue remodeling and contribute to neovascularization via transdifferentiation . in the future , successful treatment of gliomas should involve targeting both vm and angiogenesis . in this review , we summarize the progress and challenges of vm in gliomas .
You are an expert at summarizing long articles. Proceed to summarize the following text: adult small bowel intussusceptions occur almost always due to a demonstrable lead point , mostly benign , at times malignant . these malignant lesions can be either a primary small bowel tumor or a metastatic tumor from a distant primary . metastatic tumors arise mostly from breast , lungs or melanomas . on the other hand , urinary bladder malignancies spread usually to lymph nodes , bones , lung , liver , and peritoneum . we report a rare case of small bowel intussusception due to metastasis from urinary bladder carcinoma . a 40-year - old male patient was admitted to the hospital for work up of hematuria . ultrasonography of the abdomen revealed a lesion with mixed echogenicity in the urinary bladder suggestive of carcinoma urinary bladder . the patient was provisionally diagnosed as a case of carcinoma urinary bladder and planned for further imaging . during the course of hospital stay , however , he developed features of acute intestinal obstruction . repeat ultrasonography of the abdomen at this point showed dilated and thickened small bowel loops with bowel within the bowel appearance , suggestive of intussusception . the patient underwent an exploratory laparotomy and was found to have an ileoileal intussusception two feet proximal to ileocecal junction [ figure 1 ] . on reduction of the intussusception , a growth of size 3 cm operative picture showing small bowel intussusception tumor marked with a hemostat histopathological examination of the resected bowel showed a 2.5 cm 2 cm 1.5 cm growth , microscopic examination of which revealed metastatic urothelial carcinoma involving serosa and reaching up to the mucosa with lymphovascular invasion . intussusception refers to a condition whereby a segment of intestine becomes drawn into the lumen of the adjacent distal bowel . the most common locations of intussusception are at the junctions between the freely moving segments of bowel and segments fixed due to adhesions or retroperitoneal attachments . adult intussusception on the other hand is a rare disease and accounts for only 5% of all cases of intussusception . it is also a rare cause of intestinal obstruction in adults accounting for less than 1% of all cases of bowel obstruction . the presentation of pediatric intussusception often is acute with sudden onset of intermittent colicky pain , vomiting , and bloody mucoid stools , and the presence of a palpable mass . in contrast , the adult entity may present with acute , subacute , or chronic non - specific symptoms . the usual clinical presentation of adult intussusception is with features of intestinal obstruction and in many of these cases a preoperative diagnosis of intussusception can not be made . in a study of 44 cases of adult intussusception by barussaud et al . the sensitivities of the different radiological methods in diagnosing intussusception preoperatively were abdominal ultrasounds ( 35% ) , upper gastrointestinal barium study ( 33% ) , abdominal computed tomography ( ct ) ( 58% ) and barium enema ( 73% ) . adult intussusceptions have been found to have an organic lead point in 70 - 90% of the cases in various studies . small bowel intussusceptions may occur due to adhesions , meckel 's diverticulum , inflammatory bowel disease , lymphoma , primary malignancy or metastatic disease , as opposed to large bowel intussusceptions , which are due to an underlying malignancy in the majority of the cases . malignant lesions as the cause of small bowel intussusception have been reported in 17 - 30% of the cases in various studies as opposed to 66% of large bowel intussusceptions . metastatic spread to small intestine can occur by direct invasion , hematogenous spread , or intraperitoneal seeding . peritoneal seeding may arise from any intra - abdominal malignancy including gastric , hepatic , ovarian , appendiceal , and colonic primary tumors . in a study of 392 cases of bladder cancer by shinagare et al . , lymph nodes , bones , lung , liver , and peritoneum were the most common sites of metastasis . although there have been other case reports of carcinoma bladder metastasizing to intestines and causing obstruction , we could identify only one reported case of bowel intussusception due to metastasis from a bladder carcinoma to large bowel . the management of adult intussusception is essentially surgical in view of high probability of the presence of an organic lead point . some authors recommend an en bloc resection without initial reduction in view of high incidence of underlying malignancy as reduction in these cases carries a risk of intraluminal seeding and venous embolization . others recommend en bloc resection in all cases of colonic intussusception and a selective approach in small bowel in view of lower rate of malignancy . recently , laparoscopic approach has also been advocated in these cases especially in view of often doubtful preoperative diagnosis .	the common sites of metastasis from a urinary bladder carcinoma include lymph nodes , bones , lung , liver , and peritoneum . only a few cases of small bowel metastasis from urinary bladder malignancy have been reported in the english literature . only one of these cases presented with bowel intussusception . we report a case of an adult small bowel intussusception due to metastasis from a urinary bladder carcinoma which is extremely rare as small bowel metastasis occur mostly from breast , lungs or melanomas .
You are an expert at summarizing long articles. Proceed to summarize the following text: retrograde single - balloon enteroscopy ( rsbe ) is an established modality for diagnosis and treatment of distal small bowel lesions that are beyond the reach of standard ileocolonoscopy . however , it is a challenging and complicated procedure requiring significant time and skill beyond standard endoscopy . a major barrier to retrograde enteroscopy is intubation of the terminal ileum ( ti ) , with failure rates documented as high as 30 % 1 . this is due to the lack of stiffness in the relatively small - caliber enteroscope , which often results in looping of the instrument when trying to intubate the ti . cap - assisted endoscopy has previously proven beneficial for several aspects of endoscopy , including cecal intubation , adenoma detection , and visualization of the ampulla of vater by peeling away mucosal folds 2 3 4 . similarly , we have found that a distal cap aids in many aspects of retrograde balloon enteroscopy , including intubation of the ti , by facilitating opening of the ileocecal valve ( icv ) . therefore , we set out to determine the terminal ileal intubation rate during rsbe while utilizing a distal cap , as well as procedural outcome variables . we reviewed all rsbes performed at our institution between july 2011 and may 2014 . all rsbes were performed or supervised by our center s adult small bowel endoscopist ( asb ) under general or monitored anesthesia care ( mac ) with the exception of one performed with moderate sedation . all procedures were performed with an enteroscope ( sif - q180 ; olympus usa , center valley , pennsylvania , usa ) with the single - balloon overtube . patient demographics , procedural indication , procedure time , depth of insertion beyond the icv , exam findings , treatments performed , and complications were reviewed . we then calculated ti intubation rate , median procedure time , mean depth of maximal insertion beyond the icv , technical success , diagnostic yield , therapeutic yield , and complication rate . the ti intubation rate was defined as the proportion of procedures in which we were able to intubate the ti at least 5 cm . technical success was defined as previously by the proportion of procedures in which we were able to evaluate at least 20 cm beyond the icv 5 . diagnostic yield was defined as previously by the proportion of technically successful procedures in which a diagnosis was determined . therapeutic yield was defined as previously by the proportion of technically successful procedures in which a therapy was applied . this study was approved by the medical university of south carolina s institutional review board for human research . indications included bleeding , anemia , mass or polyp seen on capsule endoscopy or imaging , ulcers seen on capsule endoscopy , stricture , and other . median procedure time was 54 minutes , and the mean depth of maximal insertion was 68 cm beyond the icv . a diagnosis was identified in 22 of 36 cases , giving a diagnostic yield of 61 % . therapy was provided in 9 of 36 cases , giving a therapeutic yield of 25 % . one limiting step in the ability to perform rsbe is intubation of the ti . to our knowledge , this is the first study to demonstrate the utility of a distal cap in rsbe . our results suggest that use of a distal attachment seems to aid in the success of rsbe by facilitating ti intubation . in addition , the technical success rate was 86 % , due to two failures noted to have poor prep , including the aforementioned complete obstruction of the cecum with stool , and three noted to have looping due to floppy colons . the diagnostic yield was 61 % , with findings typical of rsbe , including primarily arteriovenous malformations , as also polyps , nodules , and ulcers . , therapeutic yield was calculated to be 25 % , consisting only of argon plasma coagulation ( apc ) for hemostasis of bleeding lesions , and polypectomy . one limitation of this case series is that it reflects the experience of a single endoscopist at a single center . further , we had no comparison group as very few rsbes have been performed without a distal attachment at our institution . however , our procedure time , depth of maximal insertion , diagnostic and therapeutic yields , and rates of technical success and complications are comparable to published values 6 7 8 . we believe that this case series shows that the use of a distal cap is likely to aid in the success of rsbe by facilitating intubation of the ti . although rsbe will certainly remain challenging , the attachment of a distal cap is one tool that other small - bowel endoscopists may find beneficial , without obvious compromise to efficacy or safety .	background and study aims : retrograde single - balloon enteroscopy ( rsbe ) facilitates evaluation of the distal small bowel and provision of appropriate therapy when necessary . intubation of the terminal ileum ( ti ) is a major rate - limiting step , with failure rates as high as 30 % . cap - assisted endoscopy has proven beneficial in other aspects of endoscopy . we have noticed that it similarly aids in ti intubation during rsbe by facilitating opening of the ileocecal valve ( icv ) . the primary aim of this study was to measure the ti intubation rate using cap - assisted rsbe . other procedural details and outcomes were also measured . patients and methods : a total of 36 consecutive rsbes performed between july 2011 and may 2014 at the medical university of south carolina were retrospectively reviewed . all procedures were performed or supervised by our center s small bowel endoscopist ( asb ) . outcomes measured included ti intubation rate , procedure time , depth of maximal insertion ( dmi ) , diagnostic yield ( dy ) , therapeutic yield ( ty ) , and complications . results : the ti intubation rate was 97 % ( 35 /36 ) . the one failure was due to stool completely obscuring the cecum . median procedure time was 54 minutes , with a mean dmi of 68 cm beyond the icv . the technical success rate was 86 % , whereas dy and ty were 61 % and 25 % , respectively . there were no complications . the study was limited in that it involved a single endoscopist at a single center . conclusions : cap - assisted rsbe results in a high ti intubation rate , without compromise to safety or procedural yield .
You are an expert at summarizing long articles. Proceed to summarize the following text: chronic obstructive pulmonary disease ( copd ) is a major cause of morbidity and mortality worldwide1 despite increased health care efforts , financial costs , and research concerning its early diagnosis and proper management . copd epidemiology continues to display a steep increasing trend in mortality , contrary to the other leading causes of death like cancer and cardiovascular disease.2 the most relevant event affecting copd mortality is the acute exacerbation of copd ( aecopd ) , a catastrophic event during the clinical course of the disease.3 the frequency and severity of aecopd is the major modifier of the management and outcome of copd . this was the reason that global initiative for chronic obstructive lung disease ( gold ) current initiatives emphasized it even in its copd definition.3 the gold definition of aecopd is characterized by clinical empiricism , but is too vague to be useful in the clinical interpretation of copd patients developing acute exacerbations . the fact is that copd prevalence , which is on the rise in developing and developed countries , results in enlarged direct and indirect costs of copd on the health care systems worldwide . according to several reports , in the us , direct costs have escalated from $ 18 billion in 2002 to $ 29.5 billion in 2010 , consisting mainly of hospital expenses , whereas indirect costs account for 27%61% of the total costs , with the higher estimates shown by studies focusing on working age populations.46 average costs for individuals retiring early due to copd have been estimated to be $ 316,000 per individual.7 in europe , a remarkable annual cost of 38.7 billion was caused by copd.8 hospitalizations are the greatest contributor to total copd costs , and account for up to 87% of the total copd - related costs.9 exacerbations are the main cause of the hospital admissions and subsequently account for between 40% and 75% of copd s total health care costs , despite improvement in new maintenance medications.10,11 the health care systems worldwide need to endorse the health policies aiming at prevention and appropriate management of copd exacerbations . in this review , we focus on the evidence that supports the claim that aecopd , especially when accompanied by respiratory failure and leads to hospitalization , is the stroke of the lungs leading to accelerated loss of lung function and contributes remarkably to increase in morbidity and mortality . we present an overview of the effects of an acute exacerbation in the disease s clinical course , characterized by triggering a catastrophic cascade that is actually a killer , especially when it presents as a relapsed event . contrary to the common perception that lung function decline is a gradual steady process that can be visualized by the fletcher peto diagram,12 evidence shows that lung function decline is not a constant , stable process . it is the accumulated result of mild losses during steady state and sharp losses , due to acute exacerbations , that accelerate as exacerbations become more frequent and more severe over time , during the disease s natural course ( figure 1 ) . even since the end of the 1970s , exacerbations have been implicated as a possible independent factor associated with lung function decline.13 but only after large cohort studies were performed , the relationship between exacerbations and forced expiratory volume in 1 second ( fev1 ) decline was established . the lung health study reported that each additional exacerbation was associated with a greater annual decline of 7 ml.14 the london copd cohort study investigators showed a greater annual decline of 8 ml in frequent exacerbators , compared to non exacerbation - prone patients.15 patients with higher rates of exacerbations showed more rapid lung function decline in the uplift study also.16 this exacerbation frequency lung function decline relationship has also been reported in ex - smokers.17 part of this decline may be attributed to increased airway inflammation caused by exacerbations,18 systemic inflammation,19 and incomplete symptomatic and physiological resolution , as observed in a significant percentage of copd patients after an acute exacerbation.20 exacerbations may contribute to as much as 25% of lung function decline.21 if no further exacerbations occur in the following 6-month period , health status seems to recover to levels similar to those in patients with no exacerbations . but this is not a common rule.22 in the support study , a prospective cohort of 1,016 patients with an exacerbation of copd and a paco2 of 50 mmhg or more were enrolled.23 at 6 months , only 26% of the cohort was both alive and capable of reporting a good , very good , or excellent quality of life.23 if recurrent events occur , they inhibit full recovery and accelerate health status deterioration.24,25 exacerbations show seasonal distribution26 and tend to cluster together in time , suggesting a high - risk period of 8 weeks for recurrent exacerbations after the initial exacerbation.27 the european respiratory society ( ers ) copd audit survey revealed high 90-day readmission rates across europe , reaching almost 40%.28 the time period after an exacerbation is also a high - risk period for all - cause mortality.29 there is a striking similarity in the catastrophic pathophysiologic cascade triggered by acute copd exacerbations and acute myocardial infarctions ( mis ) ( table 1 ) . the latter , in the context of coronary heart disease ( chd ) , lead to more symptoms , recurrent events,30 worsening of extraction fraction , lower ability for exercise , more frequent hospital admissions,31 lower quality of life scores,32 and increased mortality.33 acute exacerbations of copd lead to more symptoms , lung function decline,14,15 lower exercise capacity,34 higher hospitalization rates,35,36 lower quality of life,37 as well as poorer prognosis.38,39 copd and vascular diseases do not just share common risk factors like smoking and aging.40 the crosstalk between copd exacerbations and acute events of vascular diseases is impressive , only as copd has been reported as a contributing factor for endothelial inflammation,41,42 it may induce arterial stiffness , aggravate atherosclerosis,43 and increase the risk of cardiovascular disease . reduced lung function correlates with a higher cardiovascular mortality44,45 and the risk of ventricular arrhythmias.46 a reduced fev1 has been considered a prognostic marker for cardiovascular and all - cause mortality,47 which may increase as much as 28% for every 10% decrement in fev1 value.48 in a study analyzing , over a 2-year period , 25,857 patients with copd from the health improvement network database , copd exacerbation was associated with a significant increase in risk for mi during a 5-day postexacerbation period.49 the presence of copd is reported to worsen the long - term outcomes in patients who underwent percutaneous coronary intervention or coronary artery bypass graft.50,51 in a study of 81,191 mi patients , of whom 4,867 ( 6% ) had a baseline copd hospital discharge diagnosis , the copd patients were reported to have a significantly higher 1-year mortality.52 acute copd exacerbations are among the strongest predisposing factors for future exacerbations , as recognized even in smaller cohort studies.53 our knowledge regarding aecopd management was widely extended by large cohort studies like torch,54 uplift,55 and eclipse,56 which illustrated that exacerbation frequency increases alongside disease severity . but the rate at which exacerbations occur highlights a distinct phenotype of patients , recognized by the eclipse study , in moderate and severe copd.56 besides disease progression , increased exacerbation frequency may be attributed to inadequate treatment , intrinsic factors like lower airway bacterial load,57,58 lower levels of physical activity,59 or exposure to environmental triggers , especially viral or bacterial infections.60 the frequent exacerbator , a distinct and well - described phenotype of the disease , tends to have reduced responses to treatment for acute exacerbations concerning inflammatory indices and quality of life,61 and higher airway inflammation in the steady state and quicker elevation of systemic inflammation levels over time.62 acute vascular events such as mi tend to present a similar pattern of relapse.30 in a study of 3,010 patients with first episode of mi , 30-day readmission rate after discharge was as high as 18.2%,63 42.6% of which was associated with a new mi event , while copd presence was also related to an increased risk of readmission.63 the postinfarction period is a high risk period for new - onset atrial fibrillation ( af ) as well as all - cause mortality.64 aecopd is not considered just an acute event characterized by worsening of the patient s respiratory symptoms ; it presents an overwhelming situation leading to more frequent serious adverse events . patients participating in the uplift study55 were observed over a 4-year period , and exacerbations or adverse events were recorded throughout the period in patients receiving the study drug . the researchers of the uplift study examined in a later time point this large clinical trial database ( 5,992 copd patients ) to assess the relationship between exacerbations and the occurrence of nonrespiratory morbidity recorded as adverse events.65 a total of 3,960 patients had an exacerbation and were analyzed . non - lower respiratory serious adverse events ( nrsaes ) incidence rates ( irs ; per 100 patient - years ) were recorded before and after the first exacerbation . comparison of ir 30 days before and after an exacerbation showed significant changes ( 20.2 vs 65.2 with rr [ 95% confidence interval ] = 3.22 [ 2.404.33 ] ) . similar ir changes were observed for the 180-day period ( 13.2 vs 31.0 with rr [ 95% confidence interval ] = 2.36 [ 1.932.87 ] ) . all nrsaes including cardiac events were more frequent after the first exacerbation , irrespective of the cardiac comorbidity of the patient at baseline . the combination of worsening respiratory symptoms and increased systemic events after exacerbations , particularly shortly after the event , has a dramatic impact in patients quality of life and feelings . this impact was studied by a qualitative interview - based study , which was conducted to gain an insight into patients comprehension and experience of copd exacerbations and to explore their perspective on the burden of exacerbations.66 patients ( n=125 ) with moderate - to - very severe copd with two or more exacerbations during the previous year underwent a 1-hour face - to - face interview with a trained interviewer . although commonly used by physicians , only 1.6% of patients understood the term exacerbation , preferring to use simpler terms such as chest infection or about two - thirds of patients stated that they were aware when an exacerbation was imminent and , in most cases , symptoms were consistent among exacerbations . some patients ( 32.8% ) the majority of patients ( 64.8% ) cited that exacerbations affected their mood , causing a variety of negative feelings such as anxiety , isolation , depression , irritability / bad temper , anger , and guilt . overall , patients most commonly reported lack of energy , depression , and anxiety when describing their feelings about exacerbations . these effects seem to have adverse consequences in their personal and family relationships , leading to prevention of social activities and isolation . it is remarkable that physicians tended to underestimate the psychological impact of exacerbations , when compared to patient reports . it is also remarkable that patients with coronary disease experienced the same feelings as copd patients , as reported by the heart and soul study.67 out of 1,024 participants , 201 ( 20% ) had depressive symptoms . depressive participants were more likely to report at least mild symptom burden ( 60% vs 33% ) , mild physical limitation ( 73% vs 40% ) , mildly diminished quality of life ( 67% vs 31% ) , and fair or poor overall health ( 66% vs 30% ) . depressive symptoms were strongly related to greater physical limitation , greater symptom burden , worse quality of life , and worse overall health , when using multivariate analyses adjusting for cardiac function and other patient characteristics . based on the aforementioned data , depressive symptoms , after a heart attack , are strongly associated with patient - reported health status in patients with coronary disease , which is similar to the case of copd patients after an acute exacerbation of the disease . according to gold guidelines , exacerbations of copd requiring hospitalization are associated with significant mortality.3 in - hospital mortality of copd patients admitted for a hypercapnic exacerbation with acidosis i10%.23,68,69 in the support study,23 as aforementioned , 1,016 patients were enrolled , who were admitted with an exacerbation of copd and a paco2 of 50 mmhg or more . the 60-day , 180-day , 1-year , and 2-year mortality was high ( 20% , 33% , 43% , and 49% , respectively ) and at 6 months , only 26% of the cohort was both alive and capable of reporting a satisfactory quality of life . similar results were reported in another study where 205 consecutive patients hospitalized with aecopd were prospectively assessed and were followed up for 3 years.68 in total , 17 patients ( 8.3% ) died in hospital and the overall 6-month mortality rate was 24% , with 1- , 2- , and 3-year mortality rates of 33% , 39% , and 49% , respectively.68 the 1-year mortality rates after an aecopd seem to be affected by the presence of respiratory failure.69 in a cohort of 171 patients , the mortality rate during hospitalization was 8% , going up to 23% after 1 year of follow - up.69 despite a comparable in - hospital mortality rate ( 6% ) , the 1-year mortality rate was reported to be significantly higher for patients admitted to the intensive care unit due to respiratory failure ( 35% ) . the high rates of mortality after an aecopd have been also reported in the ers copd audit survey.28 the ers copd audit was a cross - sectional , multicenter study that analyzed the outcomes of copd patients admitted to hospital with an exacerbation across europe . finally , 16,000 patients and 400 centers across 13 european countries were included in this project . mortality among copd patients discharged from hospital and within 90 days of the initial admission date was 6.1% ( 5.8% in males and 6.8% in females ) . the composite mortality rate ( in - hospital plus 90 days follow - up period ) was 11.1% . similarly , the incidence rates of sudden cardiac death and recurrent ischemic events post - mi were examined in a large cohort study.70 between 1979 and 1998 , 2,277 mis occurred ( 57% in men ) . after 3 years , the event - free survival rate was 94% for sudden cardiac death and 56% for recurrent ischemic events . both outcomes were more frequent with older age and greater comorbidity.70 as the authors concluded , in the community , recurrent ischemic events are frequent post - mi , while sudden cardiac death is less common . thus , a copd exacerbation is related to higher mortality rates than an mi in the general population . aecopd is a severe medical condition demanding immediate action.3 the initial management includes : assessment of medical history and clinical signs of severity , administration of supplemental oxygen therapy , increasing the dose or / and frequency of inhaled bronchodilators , and addition of oral or intravenous corticosteroids and antibiotics ( oral or intravenous ) if signs of bacterial infection are present.3 in cases of acute respiratory acidosis , noninvasive mechanical ventilation ( niv ) is considered . niv has been shown to improve severity of breathlessness and acute respiratory acidosis and decrease the respiratory rate , work of breathing , complications such as ventilator - associated pneumonia , and the length of hospitalization.3 more importantly , niv decreases the intubation rates and mortality.71,72 if a patient is unable to tolerate niv , or in case of niv failure , invasive mechanical ventilation is mandated . indications of initiating invasive mechanical ventilation include respiratory or cardiac arrest , respiratory pauses with loss of consciousness or gasping for air , massive aspiration , severe ventricular arrhythmias , severe hemodynamic instability , and persistent inability to remove respiratory secretions.3 at all times of the management of an acute exacerbation , the medical stuff has to monitor the fluid balance and nutrition of the patient ; subcutaneous heparin or low - molecular - weight heparin must be considered , and most importantly , associated conditions ( eg , heart failure , arrhythmias ) must be identified and treated.3 when an acute exacerbation has to be managed , a serious problem is that the copd patient is rarely only copd patient . comorbidities are frequent in copd and 12 of them negatively influence survival.73 for example , copd and chd share a common major risk factor , which is smoking . the coexistence has been reported as high as 30% or even higher in copd patients.74 in some studies of copd patients medical records , the undiagnosed cases of chd have reached 70%.75 also , af and copd are two common morbidities and often coexist.76 the presence and severity of copd are associated with increased risk for af / atrial flutter and nonsustained ventricular tachycardia . the prevalence of af and nonsustained ventricular tachycardia among copd patients has been reported to be as high as 23.3% and 13.0% , respectively.77 hypertension , diabetes and metabolic syndrome , cachexia , myopathy , mental disorders , osteoporosis , and chronic renal failure are also common comorbidities in copd patients.78 finally , studies show that up to 94% of copd patients have at least one comorbid disease and up to 46% have three or more.79 thus , during an aecopd , the coexistence of comorbidities creates a lethal cocktail that has to be faced by the physicians . despite the underestimation by the physicians and the patients themselves , aecopd is a really catastrophic event in the natural course of the disease , similar to acute mi in patients suffering from chd ( table 1 ) . aecopd can be considered as the stroke of the lungs and it can be viewed as : a semicolon or disease s full - stop period , triggering a catastrophic cascade , usually a relapsing and overwhelming event , acting as a killer , needing emergent treatment ( figure 2 ) . acknowledging the pivotal role of aecopd in progression of the disease is crucial in order to design and incorporate a multimodality preventive approach that focuses not only on prevention of exacerbations , but also on the comorbidities that can transform even a minor respiratory exacerbation into a potentially lethal event .	chronic obstructive pulmonary disease ( copd ) is one of the top five major causes of morbidity and mortality worldwide . despite worldwide health care efforts , costs , and medical research , copd figures demonstrate a continuously increasing tendency in mortality . this is contrary to other top causes of death , such as neoplasm , accidents , and cardiovascular disease . a major factor affecting copd - related mortality is the acute exacerbation of copd ( aecopd ) . exacerbations and comorbidities contribute to the overall severity in individual patients . despite the underestimation by the physicians and the patients themselves , aecopd is a really devastating event during the course of the disease , similar to acute myocardial infarction in patients suffering from coronary heart disease . in this review , we focus on the evidence that supports the claim that aecopd is the stroke of the lungs . aecopd can be viewed as : a semicolon or disease s full - stop period , triggering a catastrophic cascade , usually a relapsing and overwhelming event , acting as a killer , needing emergent treatment .
You are an expert at summarizing long articles. Proceed to summarize the following text: the alkylating agent ifosfamide is an anti - neoplastic used in both pediatric and adult age groups to treat various malignancies . although its potential for urologic toxicity is tempered by mesna ( sodium 2-mercaptoethane sulphonate ) pretreatment , glomerulopathy , tubulopathy , and hemorrhagic cystitis still occur as adverse events in a considerable number of patients ( 1,2 ) . fanconi 's syndrome , a proximal tubulopathy marked by excessive urinary excretion of glucose , phosphate , bicarbonate , amino acid and protein , is likewise a noted complication , with rickets and growth retardation as long - term consequences . adults are rarely affected , but this syndrome is not infrequent in children as a clinical expression of ifosfamide - induced nephrotoxicity ( 3,4 ) . several published reports have also linked a combination of ifosfamide and cisplatin to persistent renal function decline requiring hemodialysis ( 5 ) . we report here a 67-year - old patient who received a regimen of ifosfamide , adriamycin and mesna for epithelioid sarcoma and soon thereafter developed a proximal renal tubulopathy , in conjunction with hemorrhagic cystitis . to our knowledge , this is the first documented instance where fanconi 's syndrome ( nephrotoxicity ) and hemorrhagic cystitis ( urotoxicity ) jointly resulted from one - time ifosfamide exposure , without contributory cisplatin . the patient , a 67-year - old male , presented at our clinic with dysuria and gross hematuria . he had a 6-month history of type 2 diabetes mellitus , treated with an oral hypoglycemic agent . more recently , a malignancy was discovered when he sought treatment ( debridement ) for an inflamed right fifth toe . following amputation of the right fourth and fifth toes and right inguinal lymphadenectomy , a histologic diagnosis of epithelioid sarcoma was rendered . following pretreatment with mesna ( 4,350 mg / m ) , he subsequently received one course of adriamycin plus ifosfamide ( 5 g / m for one day ) . laboratory values at baseline included a serum creatinine of 1.3 mg / dl and a glomerular filtration rate of 51.5 ml / min/1.73 m. his urine had tested negative for both protein and occult blood , with a specific gravity of 1.1 . seven days after chemotherapy , the patient was admitted with a blood pressure of 130/80 mmhg , a pulse rate of 80/min , a respiratory rate of 20/min and a body temperature of 36.3. percussion at the costovertebral angle was pain - free , but palpation of the abdomen elicited mild tenderness . the complete blood count showed white blood cells ( wbc ) at 310/mm ; lymphocytes , 220/mm ; monocytes , 40/mm ; neutrophils , 40/mm ; eosinophils , 10/mm ; hemoglobin , 13.1 g / dl ; and hematocrit , 50,000/mm . a serum profile revealed a creatinine of 1.9 mg / dl ; sodium 129 meq / l ; potassium 2.4 meq / l ; inorganic phosphorus 1.1 mg / dl ; total magnesium 1.2 mg / dl ; and uric acid 0.7 mg / dl . urinalysis displayed 1 + protein , 3 + glucose , and red blood cells > 100/hpf . arterial blood registered a ph of 7.28 ; hco3 9.7 mmol / l ; and anion gap , 10.3 mmol / l ( table 1 ) . the size and shadow of both kidneys were normal by ultrasound , and a diffuse thickening of the bladder wall was noted ( fig . 1 ) . by the second hospital day , the patient was febrile ( 39 ) . antibiotics and granulocyte - colony stimulating factor ( g - csf ) were initiated , and he was given supportive fluid therapy . bladder irrigation was also scheduled , but was discontinued after one attempt due to severe pain and discomfort . most of the patient 's symptoms subsided by day 6 of hospitalization , when he was afebrile with a normal neutrophil count , and the gross hematuria had resolved . his urine samples were microscopically devoid of organisms , and cultures of the urine and blood ( each in triplicate ) were consistently negative . without laboratory evidence of acute cystitis or pyelonephritis ( i.e. , negative urinary nitrite and normalized wbc / crp ) , urinalysis and a 24-hour urine test were unremarkable seven days postdischarge , but his serum creatinine had climbed to 1.5 mg / dl . a score of 8 by naranjo adverse drug reaction probability scale indicated a strong likelihood that the proximal renal tubular dysfunction experienced in this setting was linked to ifosfamide therapy . risk factors for the nephrotoxicity of ifosfamide include cumulative dosing , unilateral nephrectomy , and concomitant use of cisplatin ( 1 - 3 ) . some studies , conducted with children or relative youths , have also proposed that the associated risk may be age - dependent ( 1 ) . our patient , while diabetic , was treatment nave with respect to cancer therapy and was not otherwise at risk as currently defined . he nonetheless developed a proximal tubulopathy and hemorrhagic cystitis ( gross hematuria and lower abdominal pain ) seven days following a single course of ifosfamide - containing chemotherapy , but finally recovered after two weeks of conservative treatment . this certainly upholds the concept that ifosfamide may prove nephrotoxic in the absence of reported risk factors . the spectrum of ifosfamide nephrotoxicity is broad , ranging from asymptomatic tubulopathy to overtly impaired renal function or outright renal failure , and has been well documented ( 4 ) . even after discontinuation of this drug , the tubulopathy may progress to end - stage disease , so that hemodialysis is sometimes required . our patient displayed features typical of fanconi 's syndrome ; hypophosphatemia , hypokalemia , hypouricemia , proteinuria and glucosuria . although beta-2 microglobin and amino acids were not monitored , the 24-hour urine results confirmed a proteinuria of 1.5 g / day and high phosphorus output , together suggesting proximal tubular damage . the mechanism of ifosfamide nephrotoxicity has been attributed to the metabolites 4-hydroxyl ifosfamide , chloracetaldehyde and acrolein . chloracetaldehyde , especially , suppresses activation of complex - i ( nadh - ubiquinone oxidoreductase ) in the mitochondrial respiratory chain , resulting in decreased intracellular glutathione and atp and inhibiting ca signaling , thus inducing cell death . the cellular impact of chloracetaldehyde , and hence the threat of nephrotoxicity , can not be averted with preventative use of mesna ( 5 ) . hemorrhagic cystitis is a fairly regular accompanimont of ifosfamide , manifested by dysuria , suprapubic discomfort , and gross or microscopic hematuria . although this complication is often circumvented with mesna , it still occurs in a considerable number of patients ( 6 ) . it augments the production of nitric oxide synthase in urothelium and generates various cytokines ( tnf- and il-1 ) through intracellular transcription modulation to increase reactive oxygen species and nitric oxide levels . hemorrhagic cystitis thereby results , variably involving mucosal edema , hemorrhage , necrosis and ulceration . the sulfhydryl radical of mesna combats ifosfamide urotoxicity by combining with and eliminating acrolein ( 1 ) . proper hydration , of course , is required ; but the fact that mesna prophylaxis does not uniformly prevent hemorrhagic cystitis in ifosfamide recipients implies that direct urothelial insult by acrolein may not be the sole pathogenic determinant . perhaps cytokines such as tnf- and il-1 and their roles in nitric oxide production provide an over - riding mechanism for the urotoxicity of this drug ( 7 ) . however , at follow - up , his serum creatinine level had edged up to 1.5 mg / dl , and the nephropathy of diabetes was implicated . because his renal status may continue to deteriorate , he is monitored periodically , with strict attention to blood glucose control . it is consequently our view that diabetic nephropathy , in addition to age as a risk factor , may trigger adult susceptibility to ifosfamide nephrotoxicity .	the alkylating agent ifosfamide is an anti - neoplastic used to treat various pediatric and adult malignancies . its potential urologic toxicities include glomerulopathy , tubulopathy and hemorrhagic cystitis . this report describes a case of proximal renal tubular dysfunction and hemorrhagic cystitis in a 67-year - old male given ifosfamide for epitheloid sarcoma . he was also receiving an oral hypoglycemic agent for type 2 diabetes mellitus and had a baseline glomerular filtration rate of 51.5 ml / min/1.73 m2 . despite mesna prophylaxis , the patient experienced dysuria and gross hematuria after a single course of ifosfamide plus adriamycin . the abrupt renal impairment and serum / urine electrolyte imbalances that ensued were consistent with fanconi 's syndrome . however , normal renal function and electrolyte status were restored within 14 days , simply through supportive measures . a score of 8 by naranjo adverse drug reaction probability scale indicated these complications were most likely treatment - related , although they developed without known predisposing factors . the currently undefined role of diabetic nephropathy in adult ifosfamide nephrotoxicity merits future investigation .
You are an expert at summarizing long articles. Proceed to summarize the following text: macrodystrophia lipomatosa ( mdl ) is an unusual form of local hypertrophy also called local gigantism . there is marked increase in all mesenchymal elements such as bone , tendons , nerves , vessels , and particularly fibro - adipose tissue . we report a case of mdl , with altered soft tissue growth resulting from an earlier surgery , making clinical diagnosis difficult . however , after radio - clinical work - up and review of the history , a provisional diagnosis of mdl was made , which was subsequently confirmed by histopathology . a 22-year - old man presented with a disproportionate enlargement of the second , third , and fourth toes of the left foot since birth . there was no history of pain , neurovascular symptoms , or family history of neurofibromatoses . the patient had undergone surgical procedure in the left foot during childhood for the same complaint , and the scar of the earlier surgery was present over the plantar aspect of the foot . on physical examination , a non - tender , non - pulsatile , firm soft tissue mass was palpable over the dorsum of the left foot , with true macrodactyly of the second , third , and fourth toes with plantar deviation . the overlying skin was thick , pale , and glossy without any pitting edema or bruit [ figure 1 ] . photograph shows macrodactyly of the left foot involving second , third , and fourth toes with plantar angulation of the toes . a plain x - ray of the left foot was performed that revealed soft tissue swelling along the dorsal aspect of the foot , over the second , third , and fourth toes , with diffuse enlargement of the third metatarsal and proximal phalanges of the second , third , and fourth toes with fusion of the third and fourth metatarsal bases . osteoarthritic changes were noted in metatarsals and metatarsophalangeal joints of the involved toes . a small osseous protuberance over the lateral aspect of the second metatarsal was also noted . there was no evidence of osteolytic or sclerotic lesions , periosteal reaction , or any abnormality in any other bone [ figure 2 ] . plain radiograph shows soft tissue swelling involving second , third , and fourth toes with hypertrophy of phalanges and plantar angulation of the distal end of the affected toes . gray - scale ultrasound and colour flow doppler revealed diffuse soft tissue thickening , without any abnormal calcifications or abnormal blood flow . computed tomography ( ct ) of the left foot was performed , which showed marked proliferation of fat containing soft tissue [ figure 3 ] . a radiological diagnosis of mdl was made in view of the findings described earlier . computed tomography shows abundant soft tissue with fat density , and fanning of phalanges . after making the diagnosis , fishmouth incision revealed marked hypertrophy of fat , with adhesions between the skin and periosteum ( dermato - osseous bands ) . a trans - metatarsal amputation was done for the elongated extremity [ figure 4 ] . hypertrophied metatarsal bones were cut from the neck and myoplasty was performed between dorsal and plantar compartments [ figure 5 ] . postoperative histopathology of the tissue revealed abundant adipose tissue , thus confirming the diagnosis of mdl [ figure 6 ] . cases reported so far have shown excessive soft tissue growth at the distal end and volar aspect of the digit , with dorsal deviation and splaying of digits . but the case in our study is an exception , with marked soft tissue growth over the dorsal aspect of the digit with plantar deviation . some of the unique features of our case include plantar flexion of the toes , elongation of the extremity including all tarsal bones , fanning of toes , callosity in plantar aspect of the foot , presence of dermato - osseous bands , and thickened periosteum . macrodactyly is an unusual congenital anomaly in which there is hamartomatous proliferation of soft tissue of the affected digit , which is also called local gigantism . it is characterised by excessive growth of fibro - fatty tissue with unusually large fatty lobules , apparently fixed by a mesh of dense fibrous tissue . hypertrophy and tortuosity of the digital nerve , a striking feature in macrodactyly of the hand , is notably absent in cases affecting the foot . exact etiology of the disorder is not known ; however , inglis has described three probable mechanisms : abnormal nerve supply , abnormal blood supply , or abnormal humoral mechanisms . it can be present at birth along with syndactyly , digital deviation , thenar eminence hypertrophy , palmar and forearm hyperplasia . association with small osseous protuberances resembling osteochondromas and lipomas in other parts of the body have also been reported . the lower limb is more frequently involved than upper limb , which is typically along a specific sclerotome , with the most common sites being second and third digits corresponding to the median nerve and medial plantar nerve in upper and lower limbs , respectively . the differential diagnoses include neurofibromatosis , hemangiomatosis , lymphangiomatosis , proteus syndrome , and fibrolipomatous hamartoma ( flh ) . neurofibromas are visible in neurofibromatosis , which demonstrate a marked hyperintensity on magnetic resonance imaging ( mri ) in t2-weighted ( t2w ) images . presence of positive family history , cutaneous lesions , and bilaterality favour the diagnosis of neurofibromatosis , while in macrodystrophia , lipomatosa hypertrophy occurs along a nerve territory . lymphangiomas are present as focal or diffuse swellings with pitting edema . on ct scan , these appear as multiseptated hypodense masses . on mri , these appear hyperintense to muscle on t1w and hyperintense to fat on t2w images . a bruit may be palpable in hemangiomatosis , and on mri , long repetition time / echo time ( tr / te ) sequences show a septate configuration of high - signal intensity channels , corresponding to the vascular channels and fibrous strands . klippel - trenaunay - weber syndrome is a rare condition , usually present from birth . it involves port wine stains , excess growth of bones and soft tissue , and varicose veins . , hemi - hypertrophy occurs that may simulate mdl , but other associated abnormalities like calvarial changes , pulmonary cysts , pigmented nevi , and intra - abdominal lipomas favour the diagnosis of proteus syndrome . flh of the nerve is a rare tumour - like condition . in this condition , mature fat infiltrates the neural sheath , with most lesions occurring in the median nerve . pathologically , in flh , the deposition of fat occurs within the nerve sheath , while in mdl it occurs throughout the involved part of the digits / extremity . in flh , amputation is the ultimate therapeutic modality and it is indicated in most cases involving the large digits . other surgical procedures performed in macrodactyly include stripping of the nerves from their branches or removal of a part of the nerve and end - to - end anastomosis to relieve pain . radiological findings help distinguish this condition from other causes of localised gigantism . differentiating between these conditions is important , as they differ in their course , prognosis , complications , and treatment .	macrodystrophia lipomatosa ( mdl ) is a rare cause of congenital macrodactyly , characterised by progressive proliferation of all mesenchymal elements , with disproportionate increase in fibro - adipose tissue . it occurs most frequently in lower limbs along the distribution of the medial plantar nerve . mdl presents as localised gigantism of the hand or foot and comes to clinical attention for cosmetic reasons , mechanical problems secondary to degenerative joint disease , or development of neurovascular compression . here , we report a case of mdl , with altered soft tissue growth due to an earlier surgery , making clinical diagnosis difficult . however , with a complete radio - clinical work - up and review of the history , a provisional diagnosis of mdl was made , which was confirmed by histopathology and during surgery .
You are an expert at summarizing long articles. Proceed to summarize the following text: in this issue of critical care , robinson and colleagues investigate the effect of increasing doses of the low molecular weight ( lmw ) heparin enoxaparin ( commonly used as prophylaxis against venous thromboembolism ( vte ) ) on systemic heparin concentrations , expressed as anti - factor xa levels . reported rates for deep venous thrombosis in patients admitted to the icu range from 22 to 80% depending on patient characteristics . thromboprophylaxis with unfractionated or lmw heparin lowers the risk for deep venous thrombosis by more than 50% . nevertheless , the risk of vte in critically ill patients receiving lmw heparin prophylaxis is still much higher than in other patient groups . amongst several factors that may explain the higher incidence of vte in critically ill patients , such as full immobilisation or withholding anticoagulant prophylaxis is still much higher than in other patient groups . amongst several factors that may explain the higher incidence of vte in critically ill patients , such as full immobilisation or withholding anticoagulant prophylaxis because of a high bleeding risk , it was hypothesized that limited bioavailability ( that is , lower plasma anti - factor xa activity ) of subcutaneously administered heparin in those patients with impaired peripheral circulation , due to vasopressor medication to maintain central blood pressure , might be important . indeed , in a first comparative trial it was shown that critically ill patients on high dose vasopressor medication had much lower anti - factor xa concentrations after the subcutaneous administration of lmw heparin in comparison with intensive care patients that had lower doses of vasopressor or in comparison with patients in the surgical ward . a subsequent study also found consistently lower anti - factor xa levels after subcutaneous heparin in critically ill patients . in another similar study , critically ill patients with excessive subcutaneous oedema had lower anti - factor xa concentrations compared to a control group without oedema . this observation was confirmed in a group of critically ill multiple trauma patients , who showed variable and low heparin concentrations after subcutaneous injections . robinson and colleagues compared plasma anti - factor xa levels after the subcutaneous administration of the lmw heparin enoxaparin at the conventional dose ( 40 mg ) and at increasingly higher doses ( up to 70 mg ) in intensive care patients . they found a dose - dependent increase in peak anti - factor xa levels ( 4 hours after the injection ) ranging from 0.13 iu / ml at the conventional 40 mg dose to 0.29 iu / ml at the 70 mg dose . considering that optimal efficacy and safety of lmw heparin for thromboprophylaxis in orthopaedic and abdominal surgery was achieved with dosages of heparin resulting in peak plasma anti - factor xa activities ranging between 0.25 and 0.30 iu / ml , it may be concluded that critically ill patients need much higher doses of lmw heparin than other patients . based on the findings of robinson and colleagues , the subcutaneous dose of lmw heparin should be increased to 60 mg daily . alternatively , direct intravenous administration of ( lmw ) heparin may be considered ; however , experience with this type of thromboprophylaxis is limited . the mechanism by which critically ill patients have lower anti - factor xa levels after subcutaneous administration of heparin is not completely understood . the initial hypothesis was that patients on high dose vasopressor medication had impaired subcutaneous blood flow and thereby limited ability to adsorb the subcutaneous heparin . an alternative explanation is that the presence of oedema hinders the absorption of heparin , although that hypothesis was not proven . in addition , it has been suggested that systemic inflammation and associated multiple organ dysfunction may have an impact on heparin binding to plasma proteins and drug metabolism . the clinical relevance of lower anti - factor xa levels after conventional doses of ( lmw ) heparin in critically ill patients is also not totally clear . theoretically , the low anti - factor xa levels may lead to suboptimal prophylaxis and could indeed be a contributory factor to the higher incidence of thromboembolic complications in critically ill patients despite routine thromboprophylaxis based on the observations of robinson and colleagues and others , a randomized controlled trial with conventional versus higher doses of thrombosis prophylaxis in critically ill patients aiming at the reduction of the incidence of vte and other clinically relevant outcomes is justified . such a study would also enable the evaluation of bleeding complications related to the administration of prophylactic heparin , as intensive care patients are at higher risk for hemorrhage as well . in summary , there is ample evidence that conventional thromboprophylaxis leads to lower systemic heparin levels in critically ill patients . it is not clear whether this contributes to the relatively high incidence of vte in intensive care patients . a clinical trial evaluating higher doses of heparin for prevention of vte and assessing the bleeding risk of such an approach is justified .	venous thromboembolism is a relatively frequently occurring complication in critically ill patients admitted to the icu despite prophylactic treatment with subcutaneous low molecular weight heparin . several studies show that critically ill patients have significantly lower plasma anti - factor - xa activity levels compared to control patients after administration of subcutaneous heparin . robinson and colleagues show in this issue of critical care dose - dependent but relatively low levels of anti - factor xa activity at increasing doses of enoxaparin . anti - factor xa levels thought to be required for adequate thromboprophylaxis are observed only at doses of enoxaparin that are one and a half times higher than the conventional dose ( 40 mg ) .
You are an expert at summarizing long articles. Proceed to summarize the following text: hemangiomas are tumors characterized by increased numbers of normal or abnormal vessels filled with blood . occasionally , hemangiomas can occur internally , and nearly one - third of these internal lesions are found in the liver . pancreatic hemangiomas are especially rare ; pancreatic vascular neoplasms collectively account for only 0.1% of all pancreatic tumors.1 these tumors are usually diagnosed fortuitously by laparotomies performed to diagnose a large , palpable abdominal mass.2345 we presented a very rare case in which a woman without specific symptoms was found with a cavernous hemangioma in the pancreas tail that mimicked metastatic tumor . a 68-year - old woman was found with a mass in her left kidney on medical checkup . she had no significant past medical history except hypertension and no symptoms ( e.g. , hematuria , abdominal pain , or abdominal discomfort ) . an axial contrast - enhanced computed tomography ( ct ) scan showed a heterogeneous solid mass in the left kidney , suggesting the presence of renal cell carcinoma ( rcc ) . there was a strongly enhancing tiny nodule in the tail of the pancreas that was most likely either a neuroendocrine tumor or a rcc metastasis ( fig . because she had no specific symptoms or abnormal laboratory findings , the possibility of rcc metastasizing into the pancreas could not be ruled out . there were no significant postoperative events , and the patient was discharged home on postoperative day 7 without any morbidity or complications . gross pathologic examination revealed a 0.60.5 cm - sized hemangioma confined to the pancreas , and the tissue had a tumor - free margin ( fig . immunohistochemical analysis showed that the tumor was positive for cd31 , cd34 , and factor viii - related antigen , and negative for d2 - 40 , rcc , and cd56 ( sclc ) , supporting the diagnosis of hemangioma ( fig . hemangiomas rarely occur in the pancreas and often are not suspected clinically ; only 14 patients are reported in the literature since 1939 . review of the previous literature reports on pancreatic hemangioma indicated that most hemangiomas occur in females ( 12/15 patients , including our patient ) and are symptomatic ( 9/15 patients had abdominal pain , and one patient each had melena , thrombocytopenia , abdominal distension , and palpitation , suggesting bleeding ) . only 1 tumor was found incidentally , in 1939 upon autopsy.234567 the hemangioma was found incidentally at a preoperative evaluation for rcc . unlike previous studies , we found no symptoms suggesting pancreatic hemangioma , likely because it was a tiny pancreatic tail mass . typically , hemangiomas are strongly contrast enhancing in the arterial phase of conventional contrast - enhanced ct imaging;8 however , our case did not present these findings , likely because of the small lesion size . the pancreatic hemangioma thus mimicked metastatic cancer originating from the rcc . to our knowledge , this case was the first report of pancreatic hemangioma without a symptomatic event , and the tumor is the smallest of the reported cases . microscopic findings revealed a typical feature of hemangioma i.e. , blood - filled spaces separated by fibrous connective tissue . for a definite diagnosis , immunohistochemistry is required to assess the presence of the factor viii - related antigen , a marker for vascular endothelium that was reported by chang and colleagues.9 subsequently , mundinger and colleagues reported that neoplastic cells in hemangioma also express the endothelial markers cd31 and cd34.5 in our patient , immunohistochemical findings were positive for all 3 markers ; whereas , d2 - 40 , a marker for lymphatic endothelium , and cd56 , a marker for neural cell , were both negative , further indicating that the tumor mass was a hemangioma . because of its rarity , there is no standard treatment for pancreatic hemangioma . reviewing the previous literature on pancreatic hemangioma , we found that multiple different treatments were administered , from observation to surgical resection.234567 furthermore , the possibility of abdominal pain or hemorrhagic events is typically increased in patients with larger hemangioma masses . however , other clinicians suggested that if the patient 's symptoms are minimal , observation is a possible treatment option , because pancreatic hemangiomas are benign . the location of the pancreatic hemangioma is variable , and may be important for determining the best treatment option . upon reviewing previous literature , we found that pancreatic hemangiomas were located at the head ( 8/15 patients ) , neck ( 1/15 patients ) , or body / tail ( 6/15 patients).234567 when the tumor is located at the body / tail , distal pancreatectomy is an option . however , if the tumor is located at the proximal site of the pancreas , pylorus - preserving pancreaticoduodenectomy is indicated . patients who underwent pylorus - preserving pancreaticoduodenectomy had a higher rate of morbidity than patients who underwent distal pancreatectomy ( 34.7% vs. 27.8% , p<0.05).10 therefore , if a patient has a pancreas head hemangioma with minimal symptoms that can be controlled , close observation and regular follow - up can be one of the treatment options according to risk - benefit analysis . because our case was confined to a tiny mass at the distal pancreas , and we could not rule out distant metastasis from the rcc tumor , we decided to perform a distal pancreatectomy . the literature review indicated that treatment decisions require assessment of the severity of symptoms and location of the tumor . when all the cases were collectively considered , determining the timing of surgery based on comparison of surgical risk - benefit analysis emerged as an important factor .	adult pancreatic hemangioma is a rare disease . we presented a case of a woman with pancreatic tail mass mimicking a distant metastasis from the kidney . a 68-year - old woman was found with a left kidney mass on medical checkup . computed tomography scan showed a 4.3 cm - sized mass in the left kidney , suggesting renal cell carcinoma ( rcc ) , and a strongly enhancing tiny nodule in the pancreatic tail . we could not rule the possibility of rcc metastasis , hence , surgical resection of the pancreatic mass simultaneously with radical nephrectomy for rcc was conducted . gross pathologic examination revealed hemangioma . immunohistochemistry revealed that the tumor was positive for cd34 , cd31 and factor viii - related antigen . there were no significant postoperative events , and the patient was discharged on postoperative day 7 without any complications . treatment strategies for pancreatic hemangioma have not been established . to our knowledge , this was the first case report of asymptomatic pancreatic hemangioma . in previous literature , treatment differed on a case - by - case basis , ranging from observation to surgical resection . the most important factor in deciding whether to perform surgery is possibly risk - benefit effectiveness ; however , tumor location , patient symptoms , and other factors are also important .
You are an expert at summarizing long articles. Proceed to summarize the following text: geminiviruses are emerging as one of the most economically important plant viruses in agricultural production ( abou - jawdah et al . , 2006 ; briddon et al . , 2008 ; zhou et al . , begomovirus is the largest genus of the family of geminiviridae and is phylogenetically and geographically divided into two groups ; the old world viruses and the new world viruses . the new world begomovirus consists of two viral genomes , dna - a and dna - b , while most of the old world begomovirus just has one partite dna - a ( briddon et al . , 2008 ) . about a decade ago , a satellite molecule called dna- was found to associate with some of the old world geminivirus ( saunders et al . dna- has a genome approximately 1.31.5 kb long , and depends on the helper virus dna - a for its replication , movement , and transmission ( saunders et al . , 2000 ; it is grouped into sub - viral agents by the international committee on taxonomy of viruses ( ictv ) . the most typical plant symptoms caused by geminivirus are due to an association of dna- with dna - a , whereas dna - a alone does not lead to severe damage to crops ( cui et al . , 2004 ; briddon et al . , c1 gene encoded by dna- were found to suppress host defense systems ( cui et al . , 2005 ) and modulate host development ( yang et al . , 2008 ) , and was believed to be one of the determining factors for geminivirus - induced disease symptom development ( briddon et al . , 2008 ) . dna- has not been found in the new world ( north american and south american continents ) and is believed to be associated with old world begomoviruses after the geographical divergence of old and new continents ( mansoor et al . , 2003b ) . although dna- has relatively a large range of its selection on different species of the helper virus dna - a ( mansoor et al . , 2003a ) , it is proposed to co - evolve with the dna - a component ( briddon et al . , 2008 ) . recombination plays an important role in geminivirus ( lefeuvre et al . , 2009 ) and dna- evolution ( amin et al . , 2006 ; lefeuvre et al . , 2007 ) . a fragment of dna- genome infecting tomato was reported to migrate to cotton via recombination with other adaptive dna- molecules ( amin et al . , 2006 ) , indicating the role of a recombination event in evolution of dna- molecules . because of the important role of recombination in dna- evolution , analysis on recombination events of dna- becomes specially important for understanding this viral evolution and disease epidemic as well as development of potential control strategies . in this paper , we apply a statistical phylogenetic analysis using a bayesian stochastic method to infer changes in phylogeny along multiple sequence alignments while accounting for rate heterogeneity developed by webb et al . ( 2009 ) to estimate potential recombination spots of dna-. it is the first time that this statistic method has been used on dna- recombination study and give a clear recombination history of dna- recombination . in order to confirm our results , we also apply a statistical phylogenetic method developed by martin et al . one strain of tomato leaf curl maharashtra betasatellite ( tolcmab ) has a recombination pattern and is possibly recombinant molecule between two strains from two distinct species , papaya leaf curl betasatellite ( palcub ) and tomato leaf curl betasatellite ( tolcb ) , palcub-[in : chi:05 ] ( major parent ) and tolcb-[in : cp:04 ] ( minor parent ) . a proposed taxonomy of dna- using 78% nucleotide sequence identity as demarcation threshold was accepted and widely used for distinguishing species from strains of dna- ( briddon et al . , 2008 ) . a recent report showed that different species of dna- associated with tolcd in india are geographically isolated and distributed ( sivalingam et al . , 2010 ) . the dna- molecules in southern and central india are more closely related to each other than those in northern india . to observe potential recombination events among these geographically related dna- species , we chose four strains from four distinct species of dna- associated with tolcd in india . among the four strains , tolcbdb-[in;luk;05 ] ( taxon-0 ) and tolcb-[pk;ryk;97 ] ( taxon-1 ) are from northern india , while palcub-[in;chi;05 ] ( taxon-2 ) and tolcmab-[in;pun;04 ] ( taxon-3 ) are from southern india . in the same report as well as another report ( mazhar et al . , 2009 ) , species of tolcbdb and tolcb are closely related in phylogenetic tree , while palcub and tolcmab are sisters ( neighbors ) . another tolcd associated dna- from indonesia ( taxon-4 ) was chosen as an out group . other five species of non - tolcd related dna- from eastern asia and southeastern asia ( taxa-5 , 6 , 7 , 8 , and 9 ) were also chosen for the out group . a proposed taxonomy of dna- using 78% nucleotide sequence identity as demarcation threshold was accepted and widely used for distinguishing species from strains of dna- ( briddon et al . , 2008 ) . a recent report showed that different species of dna- associated with tolcd in india are geographically isolated and distributed ( sivalingam et al . , 2010 ) . the dna- molecules in southern and central india are more closely related to each other than those in northern india . to observe potential recombination events among these geographically related dna- species , we chose four strains from four distinct species of dna- associated with tolcd in india . among the four strains , tolcbdb-[in;luk;05 ] ( taxon-0 ) and tolcb-[pk;ryk;97 ] ( taxon-1 ) are from northern india , while palcub-[in;chi;05 ] ( taxon-2 ) and tolcmab-[in;pun;04 ] ( taxon-3 ) are from southern india . in the same report as well as another report ( mazhar et al . , 2009 ) , species of tolcbdb and tolcb are closely related in phylogenetic tree , while palcub and tolcmab are sisters ( neighbors ) . another tolcd associated dna- from indonesia ( taxon-4 ) was chosen as an out group . other five species of non - tolcd related dna- from eastern asia and southeastern asia ( taxa-5 , 6 , 7 , 8 , and 9 ) were also chosen for the out group . first , a data set of 10 dna- genome sequences in fasta format was aligned using clustalw - multialign software with the following parameters : ( gap opening penalty 10.0 , gap extension penalty 0.2 , gap separation penalty range 8 , dna weight matrix : iub ) ( thompson et al . , 1994 ) . to analyze recombination for dna- from geminiviruses , we used the software package from webb et al . they applied a hidden markov model ( hmm ) to infer changes in phylogeny along multiple sequence alignments while accounting for rate heterogeneity . under the hmm , the hidden states are all possible unrooted tree topologies with the number of leaves n fixed along each site . the observed state space is { a , c , g , t , }. under the evolutionary model , the evolution of homologous dna / rna sequences ( or protein - coding sequences where the state space is of size 61 ) can be described by continuous time markov chains on a phylogenetic tree . a continuous time markov chain is characterized by a substitution rate matrix , and the phylogenetic tree summarizes the relationships between the species in terms of edge lengths ( times since divergence ) and common ancestors . the dna sequences are only observed in the leaves , and information on the phylogenetic tree , substitution events ( time and type ) and edge lengths is missing . the transition matrix p(t ) for a continuous time markov process can be written as exp(qt ) , where q is a parametrized substitution rate matrix which determines the markov process . in this method the evolutionary model was set as hasegawa kishino yano ( hky ) model ( hasegawa et al . , 1985 ) . the rate matrix q under hky model is written as the following : let = { a , c , g , t } and let a , a , a a = 1 , denote the stationary distribution of the markov chain . hky model has substitution rate matrix : where the diagonal elements are such that each row sums to 0 and the two unknown parameters are and . the software from webb et al . ( 2009 ) estimates the posterior distribution using monte carlo markov chain ( mcmc ) method under the hmm and then it outputs each tree topology with its posterior probability along each site ( see webb et al . , 2009 for details ) . we have used hky model for phylogenetic analysis on our data sets in this paper , since the hmm software in webb et al . ( 2009 ) uses hky model . also note that we have used the generalized time reversible ( gtr ) + gamma + invariant model , which is within the 95% confidence interval computed via akaike 's information criteria ( aic ) in the software jmodeltest ( guindon and gascuel , 2003 ; posada , 2008 ) , to reconstructing a ml tree and the ml tree under the gtr + gamma + invariant model has the same tree topology as the ml tree under hky model in figure 5 as well as the consensus tree under hky model in figure 4 . the generated alignment file in phylip format was put in to the hmm software ( webb et al . , java -jar st-hmm.jar with the following parameter ( iterations : 50000 , burn - in : 25000 , rates : 0.001 , 0.003 , 0.01 , 0.03 , 0.1 , 0.3 , 1.0 , 3.0 , 10.0 , 100.0 , lambda : 5 , kappa : 2.0 , tuningpar 0.4 ) . java -jar sthmmposterior.jar was used to summarize the posterior distribution , and trees with posterior probability above 0.05 were selected using the command the region 11000 nucleotide ( nt ) was found to have a clear pattern of recombination , while the region 10001505 nt seems to have a massive pattern of tree probability . in order to apply phylogenetic analysis to the sequences of 11505 and 10001505 nt of the 10 viral sequences after aligning with the clustalw - multialign software into nexus format , we estimated the posterior distribution under the generalized time reversible ( gtr ) + model and hky model , and we estimated the maximum likelihood estimators . first we applied a software mrbayes ( bronquist and huelsenbeck , 2003 ) to analyze the split of different taxa on the most consensus tree under the gtr + and hky models . 647300 generations were sampled for 11505 nt alignment , while 3600000 generations were sampled for 10001505 nt alignment . we followed the recommendation of mrbayes which suggests running the chains until the standard deviation of the chains split frequencies is less than 0.01 . in addition , to verify our results we applied the software rdp3 ( martin et al . , 2005b ) to the same data sets . sequence alignment in phylip format was used as input for rdp3 . parameters were set to default used by rdp3 . in the software rdp3 they have implemented several different methods to find recombination sites , rdp ( martin and rybicki , 2000 ) , geneconv ( padidam et al . , 1999 ) , bootscan ( martin et al . , 2005a ) , maxchi ( smith , 1992 ) , chimaera ( posada and crandall , 2001 ) , siscan ( gibbs et al . , 2000 ) , and 3seq ( boni et al . , 2007 ) . the software rdp takes basically three steps : first they discard non - informative sites from the input data sets and then for every triplet of taxa { a , b , c } , from the data set , choose the sister a and b. second , they use a window of user - defined width moved among the aligned sub - sequences one nucleotide at a time and take an average percentage identifying each of the three possible sequence pairs among { a , b , c } at the each position . third , the probability that the nucleotide arrangement in the identified region that results in a , b appearing more closely related to c may have occurred by chance is computed using a binomial distribution . the software geneconv is based on an earlier statistical approach for detecting gene conversion ( sawyer , 1989 ) . they use the term fragment for an aligned or homologous pair of segments in the input alignment . in the process , the highest - scoring fragments in the given alignment are listed and assigned p - values based on the assumption of a random distribution of polymorphic sites . they assign scores as follows : first , all sites that are monomorphic in the alignment are discarded so that only polymorphic sites are considered . secondly , for a given pair of sequences , matching bases are scored as + 1 and mismatches as m , where m depends on the pair of sequences . fragments are assigned p - values similar to the blast procedure ( altschul et al . , 1990 ; karlin and altschul , 1993 ) . this p - value is an approximation of the proportion of permutations of the polymorphic sites for which that pair of sequences has some fragment with the observed score or larger ( sawyer , 1989 ) . the software bootscan takes two phases : scanning phase and detection phase . in scanning phase first they discard non - informative sites from the input data sets and in each window of user - defined width move among the given aligned sequences . it makes bootstrap samples and compute rooted upgmas by definition rooted or mid - pointed neighbor - joining ( nj ) trees . in detection phase every combination of triplets is individually examined for bootstrap evidence that one of the sequences may be alternatively more closely related to each of the other two sequences at different positions along its length . the probability that the pattern of sites within a potential recombinant region could have occurred by a chance distribution of mutations is approximated using a bonferroni corrected version of the binomial distribution . the software maxchi considers only polymorphic sites : for a given position of the moving window on the input sequence alignment and for a given pair of sequences , a chi - square statistic is computed to compare two proportions : the proportion of sites at which the sequences agree in the left half - window and the proportion of sites at which the sequences agree in the right half - window . discordance between these two proportions may reflect a recombination event in the history of the two sequences . the maximum chi - square over all sequence pairs is recorded as a summary of the evidence for recombination at the window center . significance of observed chi - square statistics is assessed by a monte carlo permutation test . the software chimaera is also a modification of maynard smith 's maximum method ( wiuf et al . , 2001 ) with only variable sites . the p - value equals the number of times the original statistic is smaller than the statistic from permuted alignments divided by the number of permutations . for all calculations , a sliding window was used , with the width of the window set to the number of polymorphic sites divided by 1.5 . the software siscan uses a similar idea as algorithms implemented in maxchi and chimaera , but instead of using contingency tables they use gaussian distribution and use z - score to compute the p - value . the software 3seq is similar to rdp discards non - informative sites from the input data sets and then for every triplet of taxa { a , b , c } , from the data set , it chooses the sister a and b : two parent sequences that may have recombined , with one or two breakpoints , to form the third sequence ( the child sequence ) . excess similarity of the child sequence to a candidate recombinant of the parents is a sign of recombination ; they take the maximum value of this excess similarity as the test statistic . then they rapidly calculate the distribution of the excess similarity and using this method they estimate the p - value . the most consensus trees found with the 11505 and 10001505 nt alignment were the same as the most dominant tree found with the hmm software ( the pink tree in figure 1 ) . this is the tree topology written in pink ( series 14 ) in figure 2 . this is the most likely tree topology from position 1 to 140 and position 300 to 1000 . ( 2005b ) indicate a potential recombination event among taxa 0 , 1 , 2 , and 3 in the red rectangle . also the ml tree estimated by the software phyml has the same tree topology under hky model as well as the consensus tree estimated by the software mrbayes under hky and gtr + . then we estimated the maximum likelihood ( ml ) tree from the whole alignment ( including position 1 through position 1505 ) . next we infer phylogenetic tree using maximum likelihoods method , using phyml v3.0 software ( guindon and gascuel , 2003 ) , with all settings default , namely the evolutionary model is hky model , the tree topology search operation method is nearest neighbor interchange ( nni ) , and the starting tree was computed using bionj ( gascuel , 1997 ) . to analyze the splits of different taxa on the ml tree we applied bootstrapping on the columns of each alignment with the bootstrap sample size 1000 . the ml tree found with the 11505 nt alignment was the same as the most dominant tree found with the hmm software ( the pink tree in figure 1 ) . from position 1 to position 141 and from position 312 to position 1000 , the tree topology in figure 1 has almost probability 1.0 ( see figure 2 ) . note that the estimated ml tree and the estimated consensus tree reconstructed with the whole sequences from an estimated posterior distribution have the same tree topology . however , from position 141 to position 311 in the alignment , the tree topology in figure 3 has almost probability 1.0 ( see figure 2 ) . the robinson foulds ( rf ) distance ( robinson and foulds , 1981 ) between the tree topology in figure 3 and tree topology in figure 1 is 6 . note that the largest possible rf distance for trees with n taxa is 2n 6 which is 14 in our case ( the normalized rf distance between these tree topologies is 0.43 ) . thus we do not think this happened because of the low support of a split but this seems to indicate strongly that around position 142 and position 311 there are possible recombination sites . the figure shows an estimated probability of each tree topology along each site computed using the software from webb et al . the label of series i for i = 1, ,17 in the figure represents each different tree topology . the y - axis represents the probability for each tree topology and the x - axis represents position number . the tree written in pink is in figure 1 and the tree written in the dark blue dominating from position 140 to 300 is in figure 3 . ( 2005b ) indicate a potential recombination event among taxa 0 , 1 , 2 , and 3 in the red rectangle . in order to compute the support for each split we have also computed the consensus tree using the software mrbayes ( figure 4 ) and the ml tree using phyml ( figure 5 ) . for the consensus tree we used the posterior distribution and for the ml tree we use the bootstrap with the sample size 1000 to compute the support for each split . they have the same tree topology as the tree in figure 1 and the support for each split in the ml tree and the consensus tree has very high probability . especially , the probability of each split on the consensus tree estimated with the whole sequences under hky is 1.0 ( 100% ) . ( even though one of the splits on the ml tree reconstructed with the whole sequences under hky has about 90% of its support all other splits have strong support ; figure 5 . ) . the consensus tree estimated by the software mrbayes under hky from the whole alignment ( including position 1 through position 1505 ) . the consensus tree estimated under the gtr + also has the same tree topology but it has smaller probabilities of some splits . note that the tree topology of the consensus tree is the same as the tree topology of the ml tree in figure 5 and the tree topology in figure 1 . the ml tree estimated by the software phyml under hky model from the whole alignment ( including position 1 through position 1505 ) . the number in each split represents the probability of the split estimated by bootstrapping with the bootstrap sample size 1000 . note that the tree topology of the ml tree is the same as the tree topology of the consensus tree in figure 4 and the tree topology in figure 1 . the mutation rates along each site are also estimated by the software from webb et al . ( 2009 ) and it seems that the mutation rates are between 0.1 and 0.3 ( figure 6 ) . the figure shows an estimated probability of each mutation rate along each site computed using the software from webb et al . the y - axis represents the probability for each mutation rate and the x - axis represents position number . rdp3 estimated a similar recombination event , where a small genome fragment of tolcmab-[in;pun;04 ] ( taxon-3 ) ( position 142311 in alignment ) is migrated from tolcb-[pk;ryk;97 ] ( taxon-1 ) , as circled by red rectangle in figure 7 . rdp3 uses multiple methods for recombination estimation , and the average p - value from different methods are listed below ( table 2 ) . red rectangles indicate the same event inferred by a hmm method from webb et al . 2005b ) inferring the recombination event between tolcmab-[in;pun;04 ] and tolcb-[pk;ryk;97 ] at position of 142311 . we used rdp ( martin and rybicki , 2000 ) , geneconv ( padidam et al . , 1999 ) , bootscan ( martin et al . , 2005a ) , maxchi ( smith , 1992 ) , chimaera ( posada and crandall , 2001 ) , and 3seq ( boni et al . , 2007 ) . we set parameters for each software as follows ; rdp reference sequence no : window size : 30 ; detect recombination between sequence identity : 0100% ; geneconv : sequence option : treat blocs as one polymorphism ; g - scale : 1 ; maximum number of global fragments listed per sequence pair : 2000 ; maximum number of pairwise fragments listed per sequence pair : 0 ; minimum aligned fragment length : 1 ; minimum polymorphisms in fragments : 2 ; minimum pairwise fragments score : 2 ; maximum number overlapping fragments : 1 ; bootscan : window size : 200 ; step size : 20 ; use distances ; number of bootstraps replicates : 100 ; random number seed : 3 ; cutoff percentage : 70 ; transversion rate ratio : 0.5 ; coefficient of variation : 1 ; maxchi : window size : 70 ; gaps : no ; chimaera : window size : 60 ; and 3seq : sequences are circular ; highest acceptable p - value : 0.05 ; bonferroni correction ; number of permutations : 0 ; use seqgen parametric simulations . we first reported a potential recombination event between taxa 1 , 2 , and 3 , indicating that the strain tolcmab-(in;pun;04 ] ( taxon-3 ) from tolcmab is a recombinant of two strains from two different species , tolcb-[pk;ryk;97 ] ( taxon-1 ) and palcub-[in;chi;05 ] ( taxon-2 ) . as one study reported , tolcmab-[in;pun;04 ] ( taxon-3 ) and palcub-[in;chi;05 ] ( taxon-2 ) are closely related in their phylogeny compared to other species ( sivalingam et al . , 2010 ) . our study showed that tolcmab-[in;pun;04 ] ( taxon-3 ) shares sequence identity mainly with palcub-[in;chi;05 ] ( taxon-2 ) , while a small portion of its genome ( position 141312 nt in the alignment ) is potentially migrated from another species , tolcb-[pk;ryk;97 ] ( taxon-1 ) . our results indicate a recombination event happened between a northern india dna- strain tolcb-[pk;ryk;97 ] ( taxon-1 ) and a southern india dna- strain palcub-[in;chi;05 ] ( taxon-2 ) , resulting a new strain tolcmab-[in;pun;04 ] ( taxon-3 ) which was found in southern india . different geographic locations provide different physiology of host , weather conditions , helper viruses , and so on . the phylogenetic relationship among tolcb-[pk;ryk;97 ] ( taxon-1 ) , palcub-[in;chi;05 ] ( taxon-2 ) , and tolcmab-[in;pun;04 ] ( taxon-3 ) coincides with their distinct geographic relationship , suggesting that different genetic information on the viral genome from northern india or southern india may already adapt to their geographic distribution ( figure 8) . however , although the recombination event lead to the possible emergence of a new strain in a different epidemic location in india , it still has a stronger relationship within its parents geographically and phlegmatically than other strains which are epidemic in other asian countries . the geographic distribution of four betasatellites , tolcbdb-[in;luk;05 ] , tolcb-[pk;ryk;97 ] , palcub-[in;chi;05 ] , and tolcmab-[in;pun;04 ] , associated with tolcd in the india sub - continent . c1 protein , product of the c1 gene , can alter leaf development and suppress plant defense systems during infection ( cui et al . the recombination happened in approximate 100220 nt of the genome ( 141312 in alignment ) , which partially covers the c - terminal of c1 gene on the betasatellite . tolcb-[pk;ryk;97 ] ( taxon-1 ) c1 has 118 amino acids , while c1 of palcub-[in;chi;05 ] ( taxon-2 ) has 122 amino acids . the recombination event leads to a c1 protein of tolcmab-[in;pun;04 ] ( taxon-3 ) with 118 amino acids , missing the 6 amino acids from major partent palcub-[in;chi;05 ] ( taxon-2 ) on the c - terminal of c1 , instead having 2 amino acids from c - terminal of c1 on minor parent tolcb-[pk;ryk;97 ] ( taxon-1 ) . although functions of different domains of c1 were unknown , the recombination on c - terminal of c1 might modulate its function involving in virus dna- was known to be capable to adapt to a new helper virus from distinct geographic location by modifying its genome ( nawaz - ul rehman et al . , 2009 ) . the genetic modification on this southern indian dna- strain tolcmab-[in;pun;04 ] ( taxon-3 ) via a recombination event may contribute to the fitness of this dna- strain on its host . the advantage of our study is that estimating of phylogenetic tree through out the alignment by hmm method provide a clear history of dna- recombination . it is the first time that researches on dna- recombination use such statistic method and give this clear recombination history . our study also provides a way to understand dna virus evolution through recombination events . from our results , it is likely that the specie of tolcmab is a result of recombination from two different species , namely tolcb and palcub . such recombination event contributed to the occurrence of new dna- species as well as the evolution of dna-. by providing the recombination history together with geographic information , we could link the phylogeny information to the geographic information of dna- strains , thus help us understand evolution and epidemic of the virus . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .	although exchange of genetic information by recombination plays an important role in the evolution of viruses , it is not clear how it generates diversity . understanding recombination events helps with the study of the evolution of new virus strains or new viruses . geminiviruses are plant viruses which have ambisense single - stranded circular dna genomes and are one of the most economically important plant viruses in agricultural production . small circular single - stranded dna satellites , termed dna- , have recently been found to be associated with some geminivirus infections . in this paper we analyze several dna- sequences of geminiviruses for recombination events using phylogenetic and statistical analysis and we find that one strain from tolcmab has a recombination pattern and is a recombinant molecule between two strains from two species , palcub-[in : chi:05 ] ( major parent ) and tolcb-[in : cp:04 ] ( minor parent ) . we propose that this recombination event contributed to the evolution of the strain of tolcmab in south india . the hidden markov chain ( hmm ) method developed by webb et al . ( 2009 ) estimating phylogenetic tree through out the whole alignment provide us a recombination history of these dna- strains . it is the first time that this statistic method has been used on dna- recombination study and give a clear recombination history of dna- recombination .
You are an expert at summarizing long articles. Proceed to summarize the following text: bioactive materials [ 1 , 2 ] are known to bond to living bone in the body through formation of an apatite layer on their surface . bioactive glasses and glass ceramics find a variety of biological applications such as in cell separation , drug delivery , and magnetic intracellular hyperthermia treatment of cancer [ 46 ] . the success of bioglass , ceravital , a - w glass ceramic , and dense hydroxyapatite ceramic materials in clinical applications has propelled the search for bioactive glasses and glass ceramics with enhanced properties . recently , development of bioglass ceramics containing a magnetic phase has received attention for application as thermoseed in hyperthermia treatment of cancer [ 911 ] . the interest in these materials started when sio2-cao - p2o5 glasses containing iron oxide were found to yield ferrimagnetic glass ceramics upon heat treatment at elevated temperatures . the magnetic properties of this bioceramic arise from magnetite ( fe3o4 ) crystallized from hematite present in the glass during heat treatment . when this bioceramic is placed in the region of the tumor and is subjected to an alternating magnetic field , heat is generated by magnetic hysteresis loss . the tumor is effectively heated and selectively destroyed when local temperatures of 4245c are attained by this process [ 1214 ] . magnetic glass ceramics with zinc ferrite in a cao - sio2 glass matrix , fe3o4 in na2o - cao - sio2-p2o5 glass matrix [ 1316 ] , and fe3o4 in a cao - sio2 glass matrix have also been developed for this purpose . thus , the ferromagnetic bioactive glass ceramics can be used not only for the hyperthermia treatment of cancer but also as a substitute for a cancerous / damaged bone . a number of ferromagnetic glass ceramic systems have been developed for this purpose like feo - fe2o3-cao - sio2 , zno - fe2o3-cao - sio2 , sio2-na2o - cao - p2o5-feo - fe2o3 , li2o - mno2-cao - p2o5-sio2 , fe2o3-cao - zno - sio2-b2o3 , magnetite / hydroxyl apatite composite , and cao - sio2-p2o5-na2o - fe2o3 [ 9 , 10 ] . bioactivity tests have shown that apatite forming ability increases in cao - sio2-p2o5-na2o glasses with an increase in fe2o3 content with proper choice of constituent compositions . in previous work , we applied heat treatment to study the crystallization behavior and magnetic properties of ferromagnetic glass ceramics in the system fe2o3caoznosio2 . another systematic study was applied to investigate the phase formation , microstructure , and both the amount and grain size of the crystallized magnetite after gradual addition of different types of nucleating agents to ferromagnetic glass ceramics . the aim of this work was to evaluate the bioactivity of ferrimagnetic glass ceramics in the system fe2o3-tio2-p2o5-sio2 with the addition of different types of metal oxides ( mgo - cao - mno - zno - ceo2-cuo ) . the bioactivity was evaluated in vitro by examining the formation of bone - like apatite layer on their surfaces when treated in simulated body fluid ( sbf ) . the glass ceramics were prepared from dry mixtures of reagent grade sio2 , fe2o3 , tio2 , and p2o5 with the batch composition 40fe2o3 - 15p2o5 - 20sio2 - 5tio2 in addition to 20% changeable metal oxides ( cao as caco3 , mno , mgo , ceo2 , cuo , and zno ) . our target was to obtain a glass ceramic , not a ceramic material , so a melting step was necessary to achieve the nucleation of magnetite in a liquid - derived amorphous phase . the batches were placed in a platinum crucible and melted in an electric furnace at 1450c for 2 h. the melts were poured onto a stainless steel plate at room temperature and pressed into a plate 1 - 2 mm thick by another cold steel plate . each sample was soaked in a cellular simulated body fluid ( sbf , 50 ml ) , with ion concentrations and ph nearly equal to those of human blood plasma as shown in table 1 . the sbf was prepared according to kokubo by dissolving reagent grade nacl , nahco3 , kcl , k2hpo4 - 3h2o , mgcl2 - 6h2o , cacl2 , and na2so4 in an ion exchanged water contained in a polystyrene bottle . the solution was buffered at ph value 7.25 with 50 mm of tris-(hydroxymethyl)-amino methane ( ( ch2oh)3cnh2 , hereafter as tris ) and 45 mm hydrogen chloride and its temperature was kept at 37c . the soaking was carried out at 37c , under continuous stirring and for various times ( 0 , 15 , and 30 days ) . after the specimens were removed from the soaking solutions , changes in the concentrations of calcium and phosphorous of these solutions were measured by inductively coupled plasma ( icp ) spectrometer , equipped with ultrasonic useful for trace elements . scanning electron microscopy ( sem ) and edax techniques were performed on the glasses before and after soaking in sbf solution . the samples were removed from this solution , washed with pure acetone , and dried at room temperature . the morphological analyses were carried out by means of sem technique : the microscope was equipped with an energy dispersive x - ray analyser for compositional study . the samples were mounted on a stainless steel stub using double stick tape and then coated with a thin layer of au . figures 1(a)6(a ) show the sem micrographs of the present series of glass ceramic of the system fe2o3-tio2-p2o5-sio2 after immersion in sbf for 0 , 1 , 2 , and 4 weeks . the results have been used to understand the evolution of the apatite surface layer as a function of glass composition and immersion time in sbf as follows.it can be seen from figures 1(a)6(a ) that combination of metal oxides ( mg , ca , cu , mn , zn , and ce ) with the basic composition produces no apatite formation on the surface before the immersion in the simulated body fluid ( 0 week ) . on the other hand , within 14 weeks of immersion , the apatite layer was clearly observed.it was observed that the acceleration of forming the apatite layer within the early period depends on the type of the metal ion . figures 1(a ) , 2(a ) , 5(a ) , and 6(a ) show that ca , mg , zn , and ce accelerate the formation of apatite layer within one week while both mn- and cu - doped samples ( figures 3(a ) and 4(a ) ) accelerate the formation of apatite layer within 24 weeks.ca- and zn - doped glass ceramic exhibit the best results among the glasses tested in vitro in the sbf solution.the edax analysis confirmed the formation of apatite ( figures 1(b)6(b ) ) . it can be seen from figures 1(a)6(a ) that combination of metal oxides ( mg , ca , cu , mn , zn , and ce ) with the basic composition produces no apatite formation on the surface before the immersion in the simulated body fluid ( 0 week ) . on the other hand , within 14 weeks of immersion , the apatite layer was clearly observed . it was observed that the acceleration of forming the apatite layer within the early period depends on the type of the metal ion . figures 1(a ) , 2(a ) , 5(a ) , and 6(a ) show that ca , mg , zn , and ce accelerate the formation of apatite layer within one week while both mn- and cu - doped samples ( figures 3(a ) and 4(a ) ) accelerate the formation of apatite layer within 24 weeks . ca- and zn - doped glass ceramic exhibit the best results among the glasses tested in vitro in the sbf solution . these results might be interpreted as follows : apatite formation on the surfaces of the heat - treated glasses in the simulated body fluid is governed by the chemical reaction of the surface of the matrix with the fluid . in the present series of glass ceramics , the major constituent is fe2o3 and the addition of sio2 and p2o5 in the matrix allows the formation of bioactive ferrimagnetic bioglass ceramics [ 1724 ] . the previous assumption is confirmed by singh and srinivasan ; in their study , they assumed that the addition of metal ions to ferrimagnetic bioglass ceramics ( weight ratio ) accelerated the formation of apatite on the surfaces of the glasses in the simulated body fluid by increasing the ph of the surrounding fluid due to the dissolution of m ions . in the present case , apatite formation on the surface of the glass ceramics was accelerated by the addition of both cao and zno . . postulated the formation mechanism of an apatite - like layer on materials and assumed that this might be due to the release of ca ions , which results in the rapid increase in the ph of the solution . in such materials , an exchange of ions ca of material with h3o of the sbf is produced . the ca dissolved from the glass ceramics increases the ca concentration in the sbf , and the consumption of h3o results in the increase of ph value . similarly , the addition of zno to the present basic composition is also assumed to accelerate the formation of apatite on the glass ceramics . zinc ions migrate into the fluid as zn(oh)2 contributes more oh ions required for the crystallization of the amorphous ca - p from the solution to form the apatite layer . icp analysis shows the evolution of ion extraction by the simulated body fluid solution ( sbf ) with time in relation to the initial elemental composition in the prepared samples . it was observed that a marked release of ca and p ions takes place , which governs , by the bioactivity behavior of the glass , the effect of ions releasing on ph value of the solution and the composition of the bioactive glass . the corrosion behavior data of the studied samples are exhibited in table 2 , which shows the concentrations of calcium and phosphorous species presented in the sbf solution . from table 2 , one can deduce that by soaking the samples separately in sbf , the concentrations of both ca and p increase as they dissolve rapidly from the bulk glass samples ; then , they were consumed for hca layer formation on the glasses surfaces ; by continuous immersion in the solution , all the samples dissolved and lead to higher concentrations of both ca and p in the solution ; also table 2 shows the effect of adding different metal ions on the hca layer formation through the difference in ca and p concentrations in the sbf solution . table 2 exhibits the concentration values of ca and p in sbf solution after soaking the samples which contain one of the following metal oxides : cao , mno , mgo , ceo2 , cuo , and zno for 7 , 14 , and 30 days ; from that table , we can find that by adding cao or zno to sample the bioactivity of samples is increased and it accelerates hca layer formation through the fast consuming of ca and p ions . the quantitative analysis of the ca and p ions during and after sbf immersion tests is important to understand the kinetics of surface reaction in bioactive materials . the decrease or increase in ca and p concentrations with glass soaking in sbf solution is consistent with the formation and growth or inhibition of ca - p2o5 layer on the glass surface . a quantitative analysis of the ions in the solution after in vitro tests is very useful to complement the understanding of surface kinetic reactions in bioactive materials . the data recorded in table 2 revealed that the concentrations of calcium and phosphorous elements in sbf solutions of glass samples decreased or increased with the ability of the glass samples to form hca layer on their surfaces and that consequently affects their bioactive behavior . in the early stage of immersion ( 2 days ) , the concentrations of ca , p , and si ions were increased in the sbf solution . these results suggested that a relative interaction between sbf solution and the glass samples occurred . this may be due to the release of alkali and alkaline earth ions , loss of soluble sio2 from the surface of the glass specimens to the sbf solution , condensation , and repolymerization of sio2-rich layer . calcium and phosphorous concentrations then fell in the sbf solution with increasing the silicon ion concentration after 7-day duration , and this may be due to the formation of amorphous cao - p2o5 layer on the surface of the glass sample . with increasing the silicon , the subsequent rapid decrease in phosphorous and calcium ion concentrations in sbf solution after 14-day immersion indicated that crystallization and growth of the cao - p2o5 rich layer occurred . studies of carbonate containing hydroxy - carbonate apatite ( hca ) layer formed on the surface of bioactive glasses have shown that the reactions occur on the material side in five stages . homogeneous glass ceramics of the chemical composition 40fe2o3 - 15p2o5 - 20sio2 - 5tio2 doped with 20 mol% of varieties of metal ions like mgo , cao , mno , cuo , zno , and ceo2 were obtained . in vitro analysis was applied to show the bioactivity of the samples after immersion in the simulated body fluid . sem and edax studies show that the prepared glass ceramics behave as a bioactive material and the formed apatite - like layer on the surface accelerated depending on the type of the metal oxide . inductive coupled plasma ( icp ) analysis shows the evolution of ion extraction by the simulated body fluid solution ( sbf ) with time in relation to the elemental composition . the combination of metal oxides ( mg , ca , cu , mn , zn , and ce ) with the basic composition produces no apatite formation on the surface before the immersion in the simulated body fluid ( 0 week ) , while within 14-week immersion the apatite layer was clearly observed . the formation of the apatite layer depends on both time of immersion and type of the metal ion . ca- , mg- , zn- , and ce - doped samples accelerate the formation of apatite layer within one week , while mn- and cu - doped samples accelerate the formation of apatite layer within 24 weeks . ca- and zn - doped glass ceramics exhibit the best results among the glasses tested in vitro in the sbf .	the present study aimed at studying the acceleration of the bioactive layer on the surface of ferrimagnetic glass ceramic with a basic composition 40fe2o315p2o520sio25tio2 through the addition of 20% of different types of metal oxides like mgo or cao or mno or cuo or zno or ceo2 . sem , edax , and icp were applied to present the results of the study . sem and edax measurements indicated the presence of apatite layer formed on the surface of the prepared glass ceramics after immersion in sbf within 7 to 30 days . the investigation of the results clarified that the addition of cao or zno accelerated the formation of apatite on the surfaces of the samples in the simulated body fluid faster than other metal oxides . inductive coupled plasma ( icp ) analysis shows the evolution of ion extraction by the simulated body fluid solution ( sbf ) with time in relation to the elemental composition .
You are an expert at summarizing long articles. Proceed to summarize the following text: the mainstay of any ovarian cancer therapy is a cytoreductive surgery , with optimal reduction the desirable outcome or with suboptimal reduction the achievable outcome . however , some patients presents in advanced stage , poor general condition and with mucinous histology . there is a wide range of therapeutic challenges and dilemmas in managing these patients . here we present a case of advanced ovarian mucinous cystadenocarcinoma with pseudomyxoma peritonei who was considered to be inoperable in view of her clinical finding and computed therapy scan finding in consultation with oncologist and surgeon . the patient subsequently underwent cytoreductive debulking surgery in a palliative approach and had significant improvement in symptoms . a 58-year - old postmenopausal female ( p9l9 ) patient presented to gynae outpatient department with progressive distension of abdomen for 6 months . she had no bowel or bladder complains . on examination , vitals were stable , there was slight pallor , and no lymphadenopathy . on per abdominal examination , abdomen was uniformly distended , but fluid thrill was not elicited . no definite mass was palpable . on per speculum examination , the cervix and vagina were healthy . on per vaginal examination , the uterine size and adnexal mass could not be well appreciated due to tense ascites . the complete blood count , liver function test , kidney function test were within normal limit . magnetic resonance imaging abdomen showed ascites , large bilateral multiloculated adenexal mass with a large sheet of omental cake . usg guided fine - needle aspiration cytology from the ovarian mass was suggestive of mucinous adeenocarcinoma of the ovary . based on above findings , a diagnosis of advanced nonresectable ovarian cancer was established and collective decision made by gynecologist , oncologist and surgeon to start the patient on primary neoadjuvant chemotherapy . however , the patient did not respond well to chemotherapy and was taken for cytoreductive surgery . intraoperatively , approximately 5 l of thick mucinous material was removed [ figure 1 ] . the bilateral ovarian tumor [ figure 2 ] and the omental cake [ figure 3 ] were removed . the uterus , bladder , bowel were extensively studded and there was loss of plane between uterus and bladder , so hysterectomy was not done . this case is being reported to highlight the therapeutic dilemmas in the management of an advanced mucinous ovarian cancer . the standard initial treatment of patients with advanced ovarian cancer is cytoreductive surgery , followed by combination chemotherapy with paclitaxel and a platinum agent . however , despite the advances in surgery and chemotherapy , the overall 5-year survival rate remains quite low . this is mainly attributed to the fact that patients usually present with advanced stage disease as well as to the lack of effective therapies . in advanced epithelial ovarian cancer , the aim is complete cytoreduction of all macroscopic visible disease , since this has been shown to be associated with a significantly increased overall survival and progression - free survival . a recent meta - analysis of more than 3000 patients evaluating the surgical outcome in ovarian cancer showed that residual tumor is a more powerful prognostic determinant than federation of gynecology and obstetrics stage . a large prospective trial showed that in advanced bulky stage iiic or iv disease , three cycles of platinum - based neoadjuvant chemotherapy followed by interval debulking surgery was not inferior to primary debulking surgery followed by chemotherapy . as a result of these data , the use of primary chemotherapy with interval surgery is becoming more widely accepted . however , the dilemma and challenge for the surgeon is that improper assessment about the operability of the case may lead to open and shut situation and cause further deterioration of the patient 's condition . we faced similar dilemma for the index case while choosing for primary debulking surgery verses neoadjuvant chemotherapy and subsequently it was planned for neoadjuvant chemotherapy . however , it has been shown in a few series that advanced mucinous ovarian carcinoma has a poor outcome with a significantly worse survival . the standard chemotherapy regimen used in advanced ovarian carcinoma comprises of paclitaxel and platinum agents , but in mucinous tumors of the ovary , these agents have inferior response rates due to inherent chemoresistance . this might be the reason for inferior response in the index case to neoadjuvant chemotherapy . the recent studies suggests the role of oxaliplatin and 5fu in the management of mucinous tumors of the ovary because of its biological similarity with cancer of colon . the quality of life of the patients in advanced mucinous tumors of the ovary deteriorates with non - response to chemotherapy and gradual progression of the disease . due to poor response to chemotherapy , these patients often have distressing symptoms in form of huge abdominal distension , thick mucinous ascites not amenable to routine abdominal paracentesis , respiratory distress , constipation and decreased appetite . as the thick mucinous ascites is difficult to aspirate with routine abdominal paracentesis , a thick bore needle is required for aspiration but the maximum benefit from all these distressing symptoms can be achieved from removal of mucinous ascites and maximal surgical debulking . the index case had significant relief postsurgery and her quality of life has improved significantly . there is an increased focus on treatment of these patients with a new strategy combining maximal cytoreductive surgery with maximal regional chemotherapy ( hyperthermic intraperitoneal chemotherapy , hipec ) . hipec combines the direct effects of hyperthermia against the cancer cells with the effects of locoregional chemotherapy . hyperthermia has been known to have direct cytotoxic effects in both temperature and time - dependent manner with a greater depth of penetration of the chemotherapy agents into the tumors . in addition , heat synergizes the cytotoxic drugs selected for intraperitoneal use at the time of surgery . advanced mucinous tumors of ovary is a separate entity and has different biological behavior and drug sensitivity . palliatve cytoreductive surgery has a very important role in the management of these patients because of the inherent chemoresistance and poor response to standard chemotherapy .	advanced mucinous ovarian cancer is a separate entity and has different biological behaviour . there is a wide range of therapeutic challenges and dilemmas in the management of these patients . the authors present a case of advanced ovarian mucinous cystadenocarcinoma with pseudomyxoma peritonei who had poor response to standard neoadjuvant chemotherapy . this case is highlighted to emphasize the challenges in the decision making for the management of advanced mucinous ovarian cancer .
You are an expert at summarizing long articles. Proceed to summarize the following text: the activities of firefighters mainly include the use of firehoses , manual lifting , or tools for fire rescues . factors that cause low back pain may include , ascending a ladder , lifting weights , moving the body , stretching the body , or excessive firefighting work . musculoskeletal disorders of firefighter , in particular low back pain is believed to be originated from their emergency duties1 . low back - pain is a high - relapse rating chronic disease influenced compositively by strength , flexibility , balance , and posture2,3,4,5 . chronic low back pain is a pain syndrome appearing in the region from the lumbar area to the sacroiliac joint , regardless of lower extremity radiating pain6 , 7 . previous studies have attempted to reduce lower back pain using exercise programs and have also included several patient education sessions and many different types of stretching and strengthening . however , it has been still remained controversial that a few findings regarding the effect of exercises on fire fighter with low back pain who had experienced health risks due to exposure to various adult diseases and illnesses , but the number of studies on back strength are still rare . thus , the aim of this study was to investigate the effect of conventional low back pain rehabilitation programs on firefighters who complained of low back pain by analyzing how the program affects their back strength . they were selected based on a body fat rate of over 30% obtained using a bioelectric impedance method . the subjects had not participated in physical activity or training for at least 6 months . they were randomly assigned to two groups , the experimental group , n=8 , and the control group , n=8 ( table 1table 1.characteristics of the subjectsgroupage ( yrs)height ( cm)weight ( kg)experimental45.12.23171.45.2371.16.56control41.64.27171.03.2369.32.87 ) . all subjects were educated about the contents and purpose of the experiment prior to its beginning and were asked to provide written informed consent prior to participating . our low back pain rehabilitation programs ( table 2table 2.low back pain rehabilitation programeight - week rehabilitation programwarming - up exerciseriding a stationary bicycle-10 minutes stretching-5minutes2 times a day,30 minutes each time,4 days a weekcore exerciseflexion reinforcementsit - upsknee chesttoe touchsquat trainingextension reinforcementpronepush back arch backback arch backfour weekstimes-10 seconds/3 timessix weekstimes-12 seconds/3 timeseight weekstimes-15 seconds/3 timesfinish exercisestretching-5 minutes ) were based on the korea occupational safety and health agency s program6 . the study of park attempted to reduce lower back pain using exercise programs and included several patient education sessions and many different types of stretching and strengthening1 . the exercises focused on muscular strength ( abdominal muscles , back muscles ) , flexibility , and balance . the exercise duration was 10 seconds per repetition with three for weeks 14 , 12 seconds per repetition with three repetitions for weeks 56 , and 15 seconds per repetitions with three repetitions for weeks 78 , and the exercises were performed twice a day , four days a week . we ensured that the subjects performed all of the exercises before and after the 8 weeks of the exercise program . all the subjects underwent measurement of abdominal muscular strength , and back muscular strength was measured by sit - ups holding and sit - arch back holding . subjects were each told their body to attach on the floor with knees at a right angle upright . they were then told to hold their pose with raise upper body and hands on their chest . for back muscular strength , subjects were told to lay face down and attach their body to the floor . they were then told to put their hands on their head with their pose hold with shoulders upward with maximally . all experiments were reviewed and approved by the committee of the ethics kangwon national university . the pre - intervention and post - intervention data were examined using the paired t - test for comparisons within each group of subjects , and the independent t - test was used for comparisons between the groups . there was an increase in abdominal muscular strength after the exercise , and also a change in muscular strength between the control and experimental groups . for the experimental group , abdominal muscular strength increased from 24.33.4 sec before the exercise to 27.93.1 sec after the exercise ( p<0.05 ) . for the control group , abdominal muscular strength decreased from 22.61.9 sec before the exercise to 21.91.2 sec after the exercise ( p>0.05 ) . in case of the experimental group , back muscular strength was increased from 24.25.8 sec before the exercise to 26.45.2 after the exercise ( p<0.05 ) . in the case of the control group , back muscular strength decreased from 15.65.1 sec before the exercise to 15.64.7 sec after the exercise ( p > 0.05 ) ( tables 3table 3.comparison of abdominal muscular strength within groups ( units : sec)groupprepostexperimental24.23.427.93.1*control22.61.921.91.2meansd , * : p<0.01 , 4table 4.comparison of abdominal muscular strength between groups ( units : sec)groupchanges in muscular strengthexperimental25.64.8*control22.21.6meansd , * : p<0.01 , 5table 5.comparison of sit - arch back holding within group ( units : sec)groupprepostexperimental24.25.926.35.2control15.65.115.64.7meansd , * : p<0.01 , 6table 6.comparison of sit - arch back holding between groups ( units : sec)groupchanges in sit - arch back holdingexperimental25.05.9*control15.64.8meansd , * : p<0.01 ) . the mechanical factors of lower back pain are the spine , muscles surrounding the spine , ligaments , the sacroiliac joint , nerves , the periosteum , and discs8 . it is essential for people with chronic low back pain to strength the low back muscles and to increase in lumbar flexibility . the treatment for chronic low back pain can vary depending on the type and source of pain . considering their job duties , low back pain in firefighters low back pain may originate from injuries , job stress , or loading on different structures of the body . weight training is a physical activity that raises contractible or extensible contraction by using fixed or adjustable resistance and utilizes free weight equipment including barbells or dumbbells , or contractible or adjustable resistance machines . many researchers use a weight training program to investigate the effects of exercise on low back pain . pollock and gettman9 reported that weight training was a significant method for people with low back pain . similar to this finding , lee10 used a resistance exercise and lumbar stabilizing exercise in increase lumbar strength and to reduce pain . these two researchers found the effects of weight bearing exercise enhanced lower back muscle strength . the present study analyzed whether a rehabilitation program for firefighters with chronic low back pain would reduce muscle pain and enhance muscle function in subjects complaining of back pain for more than 6 months without surgical treatment and neurologic abnormalities . how do you think the results of the isometric strength test will relate to the muscular strength necessary for firefighting ? it is well documented that isometric strength exercises only show an increase in strength within a 20 degree range on either side of the position at which it was measured . in the present study , the experimental group showed significantly increased abdominal muscular strength compared with the control group . this finding indicated that the stretching type rehabilitation program would have some additional benefits for firefighters . they analyzed the effects of an exercise program on patients with chronic low back pain who had completed functional multidisciplinary rehabilitation . the participants underwent 12-weeks of exercise program and showed improvements in disability score and trunk muscle strength . compared with previous studies , weight training exercises were found to enhance isometric muscle function , which hints that there would be various factors relating to this finding . the improvement of muscle strength can come with the increase of muscle size as a priority . although , weight bearing exercise programs have many additional health benefits for low back patients , our study focused on 8-types of back stretching exercise . an increase in low back muscle flexibility would maximize the low back muscular strength , preventing low back pain and reducing the risk of injuries10 . therefore , muscular flexibility and balanced growth of muscular strength are the fundamental elements for of building a correct posture9 . it is necessary to increase muscular strength and muscular endurance of the lumbar region including the abdominal muscular strength and back muscular strength to help maintain correct postures , and this will reduce the dynamic loads on the vertebra and tissues around the spine10,11,12,13,14 . this current study used the exercise program conducted by the korea occupational safety and health agency . although the results indicated that patients improved their low back pain , further , more specific and diverse experiments and research are necessary with regard to how exercises can be integrated into an ideal physical activity program that is suitable for a person s own characteristics . the results might indicate that low back pain suffers change their posture by increasing the strength of the back muscle . this could mean that those with increasing pelvic tilt are more at risk of having back pain . further study is recommended to investigate this relationship in subjects with moderate to severe disabilities .	[ purpose ] the purpose of this study was to determine how an exercise program focusing on muscular strength could aid firefighters with chronic lower back pain . [ subjects ] the research subjects were randomly assigned to two groups , the experimental group ( n=8 ) and the control ( n=8 ) . [ methods ] the experimental group performed two types of exercise programs four times per week for 8 weeks under supervision . tests were performed before and after the 8 weeks of exercise in accordance with the korea occupational safety and health agency s program . [ results ] at the end of the 8 weeks of the rehabilitation program , abdominal muscular strength were significantly increased in the experimental group , and this indicates that the exercise therapy was effective for improvement of muscular strength . [ conclusion ] we found that exercise therapy is an effective intervention that can reduce the pain of patients with chronic lower back pain . the firefighters with chronic lower back pain who participated in this study exhibited enhanced lower back muscular strength and obtained some additional benefits . they need regular exercise .
You are an expert at summarizing long articles. Proceed to summarize the following text: a 16-year - old girl presenting fever , cough and sore throat for one day was admitted to the emergency room of our institution . she had no history of recent travel abroad , and nobody was positive on novel influenza a ( h1n1 ) among her family or classmates . on examination , the patient had an elevated temperature ( 39.0 ) and tachycardia ( 117/min ) . the results of initial laboratory evaluation were as follows ; wbc count 6,900/mm , neutrophil 91% and crp 4.85 mg / dl . 1a ) showed an ill - defined increased opacity in right lower lung zone . real time reverse - transcriptase - polymerase - chain - reaction ( rt - pcr ) test revealed positive result for novel influenza a ( h1n1 ) . the blood culture or other examinations to detect the coinfected pathogens were all negative . therefore , she was diagnosed to have novel influenza a ( h1n1 ) pneumonia , and treated with oseltamivir phophate , levofloxacin and ceftriaxone . three days later , because the chest radiograph showed aggravation in extent of pneumonia , high - resolution chest ct ( hrct ) was performed and showed ill - defined ground - glass opacities with interlobular septal thickening and some ill - defined nodules in right middle and lower lobes ( fig . these findings of ct scans were consistent with the findings of viral pneumonia . after the continuation of medical treatment , the symptoms and infiltration on chest radiograph ( fig . a 42-year - old woman was admitted to our emergency room for dyspnea and hemoptysis . myalgia , cough and sore throat developed 6 days ago , and she was diagnosed to have an upper respiratory infection ( uri ) in primary clinic , and took medicine . however the symptoms persisted and dyspnea , hemoptysis and foul - ordered sputum developed newly . on admission , the results of laboratory findings were as follows ; wbc 6,800 /mm , neutrophil 84% and crp 0.11 mg / dl . initial chest radiograph showed ill - defined infiltrates in both lower lung zones ( fig . ct scans , lobar - distributed ill - defined consolidation and surrounding ground - glass opacities were noted in right middle lobe and left lower lobe ( fig . the pneumococcal urine antigen assay was positive and gram - positive cocci were identified on sputum culture . therefore , she was diagnosed to have a novel influenza a ( h1n1 ) pneumonia with secondary pneumococcal pneumonia and treated with oseltamivir phosphate , levofloxacin and ceftriaxone . with five - day medication , symptoms improved and follow - up chest radiograph also showed improvement of infiltration in both lower lung zones . a 16-year - old girl presenting fever , cough and sore throat for one day was admitted to the emergency room of our institution . she had no history of recent travel abroad , and nobody was positive on novel influenza a ( h1n1 ) among her family or classmates . on examination , the patient had an elevated temperature ( 39.0 ) and tachycardia ( 117/min ) . the results of initial laboratory evaluation were as follows ; wbc count 6,900/mm , neutrophil 91% and crp 4.85 mg / dl . 1a ) showed an ill - defined increased opacity in right lower lung zone . real time reverse - transcriptase - polymerase - chain - reaction ( rt - pcr ) test revealed positive result for novel influenza a ( h1n1 ) . the blood culture or other examinations to detect the coinfected pathogens were all negative . therefore , she was diagnosed to have novel influenza a ( h1n1 ) pneumonia , and treated with oseltamivir phophate , levofloxacin and ceftriaxone . three days later , because the chest radiograph showed aggravation in extent of pneumonia , high - resolution chest ct ( hrct ) was performed and showed ill - defined ground - glass opacities with interlobular septal thickening and some ill - defined nodules in right middle and lower lobes ( fig . these findings of ct scans were consistent with the findings of viral pneumonia . after the continuation of medical treatment , the symptoms and infiltration on chest radiograph ( fig . a 42-year - old woman was admitted to our emergency room for dyspnea and hemoptysis . myalgia , cough and sore throat developed 6 days ago , and she was diagnosed to have an upper respiratory infection ( uri ) in primary clinic , and took medicine . however the symptoms persisted and dyspnea , hemoptysis and foul - ordered sputum developed newly . on admission , the results of laboratory findings were as follows ; wbc 6,800 /mm , neutrophil 84% and crp 0.11 mg / dl . initial chest radiograph showed ill - defined infiltrates in both lower lung zones ( fig . ct scans , lobar - distributed ill - defined consolidation and surrounding ground - glass opacities were noted in right middle lobe and left lower lobe ( fig . the pneumococcal urine antigen assay was positive and gram - positive cocci were identified on sputum culture . therefore , she was diagnosed to have a novel influenza a ( h1n1 ) pneumonia with secondary pneumococcal pneumonia and treated with oseltamivir phosphate , levofloxacin and ceftriaxone . with five - day medication , symptoms improved and follow - up chest radiograph also showed improvement of infiltration in both lower lung zones . a new strain of triple - reassortant influenza a ( h1n1 ) virus containing genes from swine , avian and human influenza viruses were identified in mexico in april 2009 , and then rapid spread of this pathogen has been observed over the world . according to the world health organization , pandemic influenza phase 6 was declared on 11 june 2009 , and over 296,471 cases were reported and at least 3,486 patients expired as related with this pathogen by 13 september 2009 , ( www.who.int/csr/don/2009_09_18 ) . in korea , more than 1,400 patients have been diagnosed including nine mortality cases by 21 september 2009 ( www.cdc.go.kr ) . during the early phase of this pandemic , there was a shift in the age distribution when compared with that of seasonal influenza virus . 87% of patients infected novel influenza a ( h1n1 ) were between the ages of five and 50 years , and only 5% of patients were 51 years of age or older ( 1 ) . this observation suggests that children and young adults may be more susceptible to novel influenza a ( h1n1 ) . the reason is proposed as a proportion of elderly people have some level of cross - reactive neutralizing antibodies to the pandemic h1n1 virus ( 4 ) . it is also possible that there is a case - ascertainment bias because more of the young people are tested as part of outbreaks in schools than elderly people ( 5 ) . the most common clinical manifestations of the novel influenza a ( h1n1 ) are similar to the symptoms of seasonal influenza ; fever ( 94% ) , cough ( 92% ) and sore throat ( 66% ) , whereas diarrhea ( 25% ) and vomiting ( 25% ) are more common in the patients infected with the novel influenza a ( h1n1 ) ( 1 ) . the clinical outcomes are various from subclinical illness to severe outcomes such as respiratory failure and death , and are similar to that observed in cases with seasonal influenza viruses . the influenza virus infections may cause primary influenza viral pneumonia , lead to secondary bacterial pneumonia or exacerbate underlying chronic illness ( 6 ) . the chest radiographic findings described in a clinical report were bilateral patch alveolar opacities with basal lung predominance or interstitial opacities such as linear , reticular , or nodular shadows ( 2 ) . however the ct findings have not yet been described , to the best of our knowledge . the common ct findings of viral pneumonia are known as poorly - defined air - space nodules and patchy areas of peribronchial ground - glass opacities and air - space consolidation . the ct findings of first case , showing the ill - defined ground - glass opacity nodules and patch areas of ground - glass opacities , were thought to be typical pattern of viral pneumonia . on the other hand , the findings of second case , showing lobar - distributed consolidation and peripheral ground - glass opacities , were somewhat different from typical pattern of viral pneumonia and were thought to have combined component of bacterial lobar pneumonia . in conclusion , we report two cases of novel influenza a ( h1n1 ) pneumonia , focusing on radiologic findings including chest ct findings . the radiologists should be aware of the radiographic and ct findings of this viral infection so that the diagnosis of novel influenza a ( h1n1 ) pneumonia should be considered promptly .	novel influenza a ( h1n1 ) virus is the pathogen of recent global outbreaks of febrile respiratory infection . we herein report the imaging findings of pulmonary complication in two patients with novel influenza a ( h1n1 ) infection . the first patient without secondary infection showed the ill - defined ground - glass opacity nodules and patch areas of ground - glass opacities . the second patient with secondary pneumococcal pneumonia showed areas of lobar consolidation in the right middle lobe and left lower lobe and ground - glass opacities .
You are an expert at summarizing long articles. Proceed to summarize the following text: ellis - van creveld ( evc ) syndrome is an autosomal recessive skeletal dysplasia , which is characterized by short stature , retarded growth , polydactyly , and ectodermal and heart defects . the first case of evc syndrome was reported by mcintosh in 1933 , but richard w.b . ellis of edinburgh and simon van creveld of amsterdam in 1940 , first described this condition and defined it as evc syndrome . birth prevalence of evc has been estimated to be 7 per 10,00,000 population and more than 300 cases has been reported in the literature . described that about 150 cases were reported between 1940 and 2008 , whereas zanwill km et al . evc syndrome is found predominantly in amish community , pennsylvania , us , where largest pedigree has been described , that is , 52 cases in 30 sib ships . in this community , the incidence is estimated to be 5 cases per 1000 live births and the frequency of carriers may be as high as 13% . this syndrome does nt have any gender predilection but parental consanguinity was reported in 30% of cases . evc syndrome is one of a group of diseases called ciliopathies , which is caused by abnormalities in the primary cilia ( these are vibrating , hair - like projections on the surface of cells ) . cilia dysfunction in evc syndrome has been linked to a mutation in two adjacent genes on chromosome 4 . the genes are evc and evc2 , which play a role in the development of cilia . the evc gene , which was identified in 2000 , controls the development of ( codes for ) evc protein , while evc2 , which was identified in 2002 , codes for a protein called limbin . it has been found that the affected evc individuals with mutations in evc or evc2 are phenotypically indistinguishable . a 10-year - old girl of indian origin reported to our institution with the chief complaint of malformed teeth in front region of upper and lower jaws . medical history revealed that she had some atrial septal defect and was undergoing treatment for that problem . her psychosomatic and mental developmental were within normal limits . on general physical examination , the patient had short stature with 110 cm height . examination of the hands and feet revealed bilateral postaxial polydactyly [ figures 1 and 2 ] . lower limbs were deformed with outward bending of knee ( genu valgum ) [ figure 3 ] . hands revealing postaxial polydactyly feet revealing postaxial polydactyly outward bending of knees ( genu valgum ) intra - oral examination along with panoramic radiography revealed multiple missing teeth ( 12 , 22 , 31 , 32 , 41 , 42 ) in mandibular and maxillary anterior region and a retained mandibular deciduous incisor ( 81 ) [ figures 4 and 5 ] . maxillary central incisors ( 12 , 21 ) were malformed and 21 had a deep carious labial fissure . intraoral photograph revealing multiple missing and malformed teeth in both maxillary and mandibular arches orthopantomogram showing missing teeth i.r.t 12,22 , 31,32,41,42 and retained deciduous tooth i.r.t 81 routine blood investigations like hemoglobin ( 11.5 g% ) , total leukocyte count ( 7000/cu mm ) , blood urea ( 13.0 mg% ) , serum creatinine ( 0.6 mg% ) , serum calcium ( 9.9 mg% ) , serum protein ( 6.4 g% ) , serum albumin ( 3.8 mg% ) , and serum globulin ( 2.6 g% ) were within normal limits with exception of slightly elevated serum alkaline phosphatase ( 135.7 i.u / l ) . the diagnosis of evc syndrome can be made prenatally or immediately after birth , but our case was diagnosed at the age of 10 years because our patient belonged to a rural hilly area where medical services were lacking . some important clinical features of this syndrome are : 1 ) disproportionate small stature with increasing severity from the proximal to distal portions of the limbs , and shortening of the middle and distal phalanges 2 ) polydactyly affecting hands , which can be unilateral or bilateral and occasionally , the feet 3 ) hidrotic ectodermal dysplasia mainly affecting the nails , hair , and teeth 4 ) congenital heart malformations occurring in about 50 - 60% of cases and comprising of single atrium , defects of the mitral and tricuspid valves , patent ductus , ventricular septal defect , atrial septal defect , and hypoplastic left heart syndrome . other uncommon anomalies may include urinary tract anomalies , strabismus , congenital cataracts , cryptorchidism , and epi- and hypospadias . oral manifestations of evc syndrome may include enamel hypoplasia , hypodontia , conical teeth , diastema , multiple labial gingival frenulae , labiogingival adherence , submucosal clefts , short upper lip , presence of neonatal teeth , premature eruption , and/or exfoliation , etc . , the diagnosis in our case became easy because of presence of most of the classical signs of evc . the involvement of all the three embryonic layers can be seen by the presence of malformed and missing teeth , hypoplastic nails , thin and sparse hair , short stature , genu valgum , bilateral polydactyly of hand and feet , and cardiac abnormality . only in 10% of cases of evc , polydactyly is present in feet bilaterally and ours is one among them . the presence of typical oral manifestations , which helped us to distinguish it from several other syndromes , were malformed and missing teeth , multiple frenum , labio - gingival adherence , maxillary and mandibular labial vestibule obliteration , etc . , the clinical variability of the oral abnormalities in evc syndrome could be due to the fact that its genetic effect on the teeth and other oral structure development occurs during a relatively long period , and could be the result of other genetic and environmental phenotype - modifying factors . the differential diagnosis of evc syndrome includes saldino - noonan syndrome , majewski syndrome , verma - naumoff syndrome , beemer - langer syndrome , jeune dystrophy , mckusick - kaufman syndrome , and weyers syndrome . prenatal diagnosis of evc syndrome is usually made by ultrasonography after the 18 gestation week , which shows narrow thorax , marked shortening of the long bones , hexadactyly of hands and feet , and cardiac defects . increased first - trimester fetal nuchal translucency thickness in association with evc has been described at 13 week of gestation . diagnosis at birth can be made by observing the typical symptoms of the disease and an x - ray of the skeleton . chest radiography , ecg , and echocardiography may also help in diagnosis of evc syndrome . the definitive diagnosis can be made by molecular diagnostic methods , which is based on homozygosity for a mutation in the evc and evc2 genes by direct sequencing . patients generally need the consultation of pulmonologist , cardiologist , orthopedist , physiotherapist , plastic surgeon , dentist , psychologist , etc . patients with cardiac abnormality should be first referred to pediatric cardiologist for surgical or non - surgical management of the defect . an early referral to pediatric orthopedic may play an important role in improving the quality of life . treatment of polydactyly , i.e. surgical removal of extra finger or toe is usually carried out in 1 year of life . orthopedic surgeon along with physiotherapist improves the strength and movement of fingers / toes . a dentist not only improves the aesthetics by replacing missing teeth , treating cleft lip , and aligning the teeth in dental arch , but also improves the masticatory efficiency of dentition . dental health education for patients and their parents should include diet counseling , methods of plaque control , oral hygiene instructions , and importance of timely dental check - up . the treatment of present case includes the extraction of retained deciduous mandibular incisor , restoration of carious fissure on 21 , and replacement of edentulous spans with removable artificial prosthesis . therefore , we have planned to refer the patient to orthopedic surgeon and physiotherapist for treatment of polydactyly and knock - knee . evc syndrome is a rare autosomal recessive disorder , which can be diagnosed by its clinical features like postaxial polydactyly of the hands , short limb dwarfism , and dysplastic fingernails and teeth . in year 2000 , evc , and in year 2002 , evc2 gene was identified to be associated with this syndrome . moreover , along with some constant clinical features , this syndrome also has some variable components in different patients .	ellis - van creveld ( evc ) syndrome is a genetic disorder with autosomal recessive transmission , which may clinically present as small stature , short limbs , fine sparse hair , hypoplastic fingernails , multiple musculofibrous frenula , conical teeth , hypoplasia of the enamel , hypodontia , and malocclusion . heart defects , especially abnormalities of atrial septation , have been found in about 60% of cases . the mutation in evc and evc2 gene is responsible for this syndrome . the presence of multiple orodental findings makes this syndrome important for dentists . the aim of this article is to present a rare case of evc syndrome in a 10-year - old girl along with the review of literature .
You are an expert at summarizing long articles. Proceed to summarize the following text: binocular rivalry has long been of fascination to researchers largely because it is a captivating phenomenon that dissociates sensory stimulation from conscious perceptual experience . during binocular rivalry , incompatible images are presented one to each eye , but instead of perceiving a blend of the two images , observers typically report slow , irregular perceptual alternations of the two stimuli ( figure 1 ) . the neural processes underlying the resolution and temporal dynamics of this visual conflict have been the subject of numerous studies and debates over the past century ( blake and logothetis , 2002 ; tong et al . , one issue of particular interest is the influence of selective attention over the dynamics of binocular rivalry . because binocular rivalry involves an inherent dissociation between sensory input and visual experience , the study of attentional influences over the ebb and flow of perceptual dominances during rivalry holds the allure of shedding light on the extent to which we may determine our own conscious visual experience . moreover , an understanding of attentional control over binocular rivalry may reveal important insights about the neural mechanisms involved in resolving the conflict that arises during rivalry and , more generally , during other forms of visual competition . in this situation , observers do not perceive a blend of the two stimuli , but instead experience irregular perceptual alternations between the two images such that only one image is typically perceived at a time . prominent scientists have reached vastly different conclusions as to the extent to which an observer can voluntarily control perception while viewing incompatible dichoptic patterns . notably , helmholtz ( 1925 ) reported that he could completely determine his perception during binocular rivalry while performing a demanding task , such as counting the lines in one of the rival patterns . on the contrary , others believed that no voluntary control over alternations in binocular rivalry was possible ( hering , 1879/1942 ; levelt , 1968 ; moray , 1970 ) . breese ( 1899 ) reported controlling rivalry in a task similar to that used by helmholtz , but concluded that the effects were simply the result of eye movements when he carefully fixated , attentional control diminished . however , washburn and gillette ( 1933 ) did find a degree of voluntary control over rivalry between afterimages , thereby supporting helmholtz s assertion that attention can influence rivalry . one of the earliest systematic explorations of this research question was by lack ( 1978 ) , who found a very strong modulatory effect of voluntary attention over rivalry alternation rates . in lack s study , participants were asked either to speed the rivalry alternations , or to slow them . this turned out to be an easy task : lack s subjects were able to increase or decrease the rate of rivalry switches in accordance with their instructions , suggesting a degree of voluntary control over alternations in binocular rivalry . however , from the onset , a distinction must be made between voluntary control of alternation rates and attentional modulations that are selective to one of the two competing images . the ability to modulate alternation rates during rivalry ( lack , 1978 ; van ee et al . , 2005 ) does not necessarily imply selective control over rivalry ( meng and tong , 2004 ) . in other words , a change in alternation rate can occur without a change in the predominance of one of the two inputs with respect to the other . furthermore , simple physiological factors can cause changes in the rivalry switch rate . for example , the number of eye blinks is correlated with switch rate ( peckham , 1936 ) , while paralyzing one eye can reduce its dominance during binocular rivalry ( mcdougall , 1903 ) . these results reveal a simple , and arguably less interesting , link between eye blinks / eye movements and switch rates , and consequently , an easy way to willfully affect the rivalry alternation rate . for these reasons , the present review will mostly focus on studies that have investigated the role of selective attention over rivalry , defined here as cases in which attention boosts predominance of the attended item and/or decreases predominance of the unattended item . however , even in selective control studies , non - attentional factors may influence rivalry dynamics ( see box 1 ) . before changes in rivalry dynamics are attributed to attentional mechanisms per se , other factors should be considered . for instance , even a simple increase in the frequency of eye blinks can speed up rivalry ( peckham , 1936 ) . faster rivalry switching has also been linked to increasing instability of eye fixation ( van dam and van ee , 2006 ) and increases in arousal ( george , 1936 ) . experimental control of such factors is particularly important in studies that investigate the effects of attention on the alternation rates in rivalry as they constitute easy ways to either consciously or subconsciously affect rivalry dynamics . another important issue is the relationship between attention and changes in effective stimulus contrast ( see paffen and alais , 2011 for review ) . both exogenous and endogenous attention to a stimulus increase its effective contrast ( carrasco , 2006 ) . for example , increasing the contrast of both rival images will cause them to switch more rapidly , while increasing the contrast of one rival stimulus will decrease dominance durations of the other stimulus ( levelt , 1968 ) . thus , when one finds an effect of attention on rivalry , that effect may be a direct effect of attention or an indirect effect that is due to attention - dependent changes in stimulus contrast . indeed , slowing of alternation rates under conditions of diverted attention may be explained by a corresponding decrease in effective stimulus contrast ( paffen et al . interestingly , the magnitude of the slowing seems to depend on the nature of the stimuli , with higher - level stimuli such as faces and houses showing more slowing with diverted attention than orthogonal gratings ( van ee et al . , 2005 ; alais et al . , 2010a ; also see section effects of attention on binocular rivalry dynamics ) . on the other hand , attention - dependent increases in effective stimulus contrast may explain triggering of rivalry alternations caused by exogenous attentional cuing ( paffen and van der stigchel , 2010 ) . changes in effective contrast , however , do not explain all effects of diverting attention away from rival stimuli ( pastukhov and braun , 2007 ) . indeed , there are several instances where rivalry slowing occurs when attention is directed toward rival stimuli ( chong et al . , 2005 ; van ee et al . , 2009 ) , and additional examples of more complex patterns of results that can not be easily explained by attention - dependent changes in stimulus contrast ( alais et al . changes in effective stimulus contrast should also be considered in studies that investigated selective attentional control of rivalry , that is , studies where attention was directed to only one of the rival targets ( chong et al . , 2005 ; hancock and andrews , 2007 ; see section behavioral relevance promotes attentional control ) . while both of these studies found an increase in the predominance of the attended item , each was caused by different factors . ( 2005 ) found that selective attention boosted the average dominance durations of the attended item , with no change to the unattended item . on the other hand , hancock and andrews reported a decrease in the average dominance duration of the unattended item , with no change to the attended item . if attention simply increased the effective stimulus contrast of the attended item throughout the experiment then , in accordance with levelt s ( 1968 ) second proposition , one would expect to see results similar to those reported by hancock and andrews . however , in these studies observers attended to the target stimulus only when it was dominant , making it unlikely that its effective contrast was affected while it was suppressed from awareness . indeed , when a stimulus contrast is physically increased only during its dominance periods , its dominance durations increase with no changes to the dynamics of the other rival stimulus ( mueller and blake , 1989 ; chong et al . , 2005 ) . in summary , there are a number of indications that attention - dependent changes in effective stimulus contrast may explain some effects of attention on rivalry . this simple explanation , however , does not fully account for all of the results , indicating that attention per se likely has additional effects on rivalry . it will be important for future research to isolate both indirect and direct effects of attention . importantly , simply demonstrating that attentional modulation effects can be mimicked by changes in physical stimulus contrast is insufficient to conclude that the observed effects of attention are indirect . such a conclusion will require actual measurement of attention - induced changes in stimulus contrast during rivalry and subsequent testing of whether measured contrast changes are sufficient to replicate the effects of attention on rivalry dynamics . the general aim of this review is to propose a unifying attentional framework that can provide an explanation for the wide range of results from studies that investigated the effects of selective attention on rivalry . although binocular rivalry is a rare perceptual experience , it is fair to assume that rival stimuli are at least in part processed by mechanisms that participate in everyday perception ( see arnold , 2011 for an insightful discussion of this issue ) . therefore , we sought an attentional framework developed for visual competition in general that was also able to explain the results obtained during rivalrous viewing . our general hypothesis , then , is that attentional modulations over binocular rivalry should adhere to the same principles that have been established for visual competition in other , more typical forms . as detailed below , we argue that the biased competition theory of attention ( desimone and duncan , 1995 ) can provide an adequate understanding of a seemingly disparate set of findings from studies of rivalry and attention . a fundamental property of binocular rivalry is that it involves sustained visual competition whose outcome fluctuates over time ( figure 1 ) . the processes leading to the dynamic resolution of this conflict and , consequently , to the determination of an observer s visual percept , are thought to reside at multiple levels of the visual hierarchy , with contributions from both low- and high - level mechanisms ( ooi and he , 1999 , 2003 ; blake and logothetis , 2002 ; tong et al . , 2006 ) . similarly , a key characteristic of attention is that it involves selection among multiple competing alternatives a process whose outcome results in preferential processing of the winning alternative(s ) ( james , 1890 ; broadbent , 1958 ; desimone and duncan , 1995 ; egeth and yantis , 1997 ; kastner and ungerleider , 2000 ; reynolds and chelazzi , 2004 ; lavie , 2005 ) . furthermore , like binocular rivalry , effects of attention occur throughout the visual system ( kastner and ungerleider , 2000 ; treue , 2001 ; hochstein and ahissar , 2002 ; serences and yantis , 2006 ) . these parallels between key properties of rivalry and attention suggest the likely existence of mutual interactions ( leopold and logothetis , 1999 ; stoner et al . , 2005 ) . indeed , as this review shows , a wide variety of attentional effects on rivalry have been documented . however , there is currently no general framework that integrates these empirical results . here , our aim is to discuss these findings within the theoretical context of a set of rules that have been proposed to govern attentional modulations during typical visual experience ; specifically , we apply the principles established by the biased competition theory of attention ( desimone and duncan , 1995 ; desimone , 1998 ) . we find that this framework provides a satisfactory explanation of a range of results . for reasons of simplicity and readability , we do not present a critical evaluation of other theories of attention , but largely take a more focused approach . the fundamental role of attention is to modulate neural processes in order to prioritize attended items . in nearly all visual scenes , the biased competition theory of attention ( desimone and duncan , 1995 ; desimone , 1998 ) argues that the very existence of this competition is central to the understanding of attention . accordingly , the effects of attention can only be understood in so far as they lead to the resolution of conflict between stimuli without competition there is no need for attention . for example , attention can easily modulate neural responses to spatially overlapping stimuli ( serences et al . similarly , when two stimuli fall within the same neural receptive field , attention can boost the processing of the attended item relative to the other unattended items ( moran and desimone , 1985 ; reynolds et al . , 1999 ) . importantly this attentional boost is the strongest when the competing stimuli fall inside the neuron s receptive field , as compared to the case when the unattended stimuli are outside the receptive field ( motter , 1993 ; luck et al . , 1997 ) . when multiple items are presented in a visual scene , attentional modulations of bold responses are seen only in visual areas in which the items fall within the same neural receptive fields ( i.e. , compete within a receptive field ) , but not in earlier visual areas where receptive fields are too small to see more than one item ( i.e. , competition is across multiple receptive fields ; kastner et al . , 1998 ; overall , these results highlight the importance of competitive interactions between stimuli in enabling attentional modulations , and suggest that only unresolved conflict should be subject to attentional modulation . this hypothesis was recently tested by mcmains and kastner ( 2011 ) , who manipulated perceptual grouping in order to modulate stimulus conflict . spatially distributed stimuli will compete when they are placed such that multiple stimuli fall within the receptive field of a single neuron ; however , perceptual grouping can reduce the magnitude of competitive interactions by integrating multiple stimuli into a single unified whole ( wertheimer , 1938 ; tadin et al . , 2002 ) . indeed , when perceptual grouping was strong , attentional modulations of the bold signal were much smaller than when the same stimuli formed weak perceptual groups ( mcmains and kastner , 2011 , see figure 2 ) . this simple study shows that the degree of stimulus conflict determines the magnitude of attentional effects . taken together , these findings show that unresolved competition in the visual system is important , and likely necessary , to observe selective attentional modulation of neural processing . a study by mcmains and kastner ( 2011 ) demonstrates that susceptibility to attentional modulation is dependent on the degree of unresolved stimulus conflict . ( a c ) inducer stimuli used in the experiment , which varied in the strength of perceptual grouping , ranging from strong grouping ( a ) to no perceptual grouping ( c ) . in these displays , ( d , e ) illustrations of experimental conditions and tasks . in the sequential condition ( d ) , inducers are presented in sequence , which precludes competitive interactions among stimuli . in the simultaneous condition ( e ) this typically results in suppressive interactions among stimuli a result thought to indicate their competition for neural resources ( kastner et al . , 1998 ; reynolds et al . , 1999 ) . to estimate susceptibility to attentional modulation , observers were asked to perform either a demanding rsvp task at fixation ( attention diverted task ) or luminance detection task on one of the inducers ( attention deployed task ) . this allowed computation of attentional modulation indices ( ami ) , which quantified how much responses increased when attention was directed toward the inducer stimuli . ( f ) the results showed that attentional modulation was strongest in the simultaneous condition and when inducer stimuli did not from a perceptual group . this key finding indicates that the unresolved competition between stimuli is linked with strong susceptibility to attentional modulation . adopted from mcmains and kastner ( 2011 ) with permission from the society for neuroscience . these principles have direct implications for understanding attentional modulations of binocular rivalry . by definition , according to the biased competition theory of attention , attentional control over rivalry dynamics should depend first on the presence of stimulus conflict , and also on how and when this conflict is resolved . for example , conflict in binocular rivalry remains unresolved for a brief period after the stimuli are initially presented ( wolfe , 1983 ) , which predicts a large degree of attentional control over early rivalry dynamics ( see section effects of attention on initial selection ) . in contrast , ongoing rivalry contains periods of clear conflict resolution ( when perceptual dominance of one stimulus occurs ) , and , consequently , should be less susceptible to attentional control ( see section effects of attention on binocular rivalry dynamics ) . the second assumption of the biased competition theory is that attentional modulations occur within the same neural substrate where stimulus competition takes place . for example , if the resolution of conflict during rivalry is limited to low - level , bottom - up mechanisms , then there are few opportunities for attentional modulation . moreover , any attentional modulation should be biased toward the location in the visual system at which the rival stimuli compete ( beck and kastner , 2009 ) , which in this case should be early visual mechanisms . on the other hand , if conflict resolution ( i.e. , determination of perceptual dominance ) is a high - level process , that suggests the presence of unresolved conflict throughout the visual hierarchy , and consequently more opportunities for attentional modulation . finally , as an added benefit , applying the framework outlined in this paragraph should help explain not only the effects of attention on rivalry , but also give insight into the mechanisms of binocular rivalry per se . specifically , determining the degree of attentional control over a certain aspect of binocular rivalry , might give insights into the nature of underlying visual competition ( cf . the straightforward application of this framework , however , is complicated by two important factors . first , as discussed below , rivalry almost certainly does not involve exclusively low- or high - level processes ( blake and logothetis , 2002 ) . second , treating rivalry as a process carried out by a single mechanism is overly simplistic . instead , binocular rivalry seems to be mediated by an aggregate of related processes that determine different aspects and stages of its dynamics , including the instigation of rivalry , the initial perceptual selection , and subsequent alternations of dominance and suppression ( alais and blake , 2005 ) . each of these processes may be differentially susceptible to attentional modulation , precluding a simple conclusion about effects of attention on rivalry . in this review when two stereoscopically compatible images are presented , the visual system almost instantly fuses the two images into a 3d percept ( cumming and deangelis , 2001 ; blake and wilson , 2011 ) . however , when two incompatible images are presented , it takes some time for binocular rivalry to begin . perhaps because of the overwhelming amount of binocularly compatible information that we receive throughout our lives , the visual system first attempts to fuse the inputs from the two eyes by default . for example , orthogonal dichoptic gratings that are presented very briefly will abnormally fuse , giving rise to a percept of a plaid ( wolfe , 1983 ; de belsunce and sireteanu , 1991 ) . with typical stimuli , exclusive dominance of one of the stimuli occurs only after about 150 ms ( the fusion period can be shorter for pairs of stimuli where one is perceptually much stronger , su et al . , 2011 ) . this fusion period indicates the presence of unresolved conflict throughout the visual system , and a possible role for higher - level factors to influence rivalry initiation . for example , imagine a real - world circumstance in which an object is occluded , but the observer stands such that his left eye is able to see the occluded object , while the right eye can not . in such cases , binocular rivalry does not occur , even though each eye s input is incompatible with the other ( shimojo and nakayama , 1990 ; arnold , 2011 ) . on the other hand , even identical inputs can be made to rival or fuse depending on how they are interpreted in context ( andrews and lotto , 2004 ) . these results indicate that there is some flexibility in how compatible and incompatible binocular inputs are initially processed , which may result from low - level ( i.e. , shimojo and nakayama , 1990 ) or higher - level ( i.e. , andrews and lotto , 2004 ) factors . importantly , in relation to the framework proposed in this review , this suggests a possible role for attentional modulation during initial selection . indeed , numerous investigations have shown strong attentional modulations over initial selection in binocular rivalry ( ooi and he , 1999 ; mitchell et al . , 2004 ; chong and blake , 2006 ; hancock and andrews , 2007 ; kamphuisen et al . , 2007 ) . ( 2004 ) , object - based exogenous ( i.e. , involuntary ) attention was shown to bias initial dominance in binocular rivalry . the experimental paradigm started with the presentation of two superimposed transparent surfaces to both eyes ( figure 3a ) . on each trial , one surface was cued by a brief translation a manipulation designed to exogenously draw attention to the cued surface . after 150 ms , one of the surfaces was removed from each eye , leaving two incompatible surfaces in the two eyes and resulting in the initiation of binocular rivalry . the key result was that the cued grating was about three times more likely to be perceived as dominant during the initial period of binocular rivalry ( figure 3b ) . this effect of attention was specific to initial dominance , disappearing 2 s after the presentation of the exogenous cue . subsequent study by chong and blake ( 2006 ) reported similar results for endogenous ( i.e. , voluntary ) attention . their paradigm involved the binocular presentation of two superimposed gratings , with subjects instructed to track either rotation or spatial frequency changes of one of the two gratings . after 5 s , one grating was removed from each eye to initiate binocular rivalry ( again , by leaving two incompatible surfaces in two eyes ) . results revealed a twofold bias of the initial dominance in favor of the cued stimulus . this effect was only observed on trials where subjects correctly tracked stimulus changes , indicating an important role of sustained endogenous attention . exogenous attention biases initial dominance in binocular rivalry . in a study by mitchell et al . ( 2004 ) , rivalry was initiated between conflicting rotating surfaces , one of which was cued during preceding binocular presentation by a brief translation period ( a ) . after rivalry was initiated , observers reported which of the two surfaces was dominant at the end of variable dichoptic viewing periods ( b ) . after 150 ms of dichoptic viewing , in most cases observers did not perceive exclusive dominance of either surface , consistent with previous reports ( wolfe , 1983 ) . however , for viewing periods between 300 and 1500 ms , the cued surface was the predominant percept , indicating a strong effect of attention on the initial dominance during rivalry . these studies convincingly demonstrate that both exogenous and endogenous attention can bias initial selection during binocular rivalry . this susceptibility to attentional modulation may be explained by the temporal dynamics that characterize the initial presentation of incompatible binocular stimuli . here , the delayed onset of exclusive dominance of one of the rival targets provides a period of unresolved conflict between two rival stimuli . moreover , because neither stimulus is perceptually dominant in the first 150 ms , there is unresolved competition throughout the visual hierarchy . thus , there are a range of levels at which attentional modulations may occur ( beck and kastner , 2009 ) . interestingly , with some stimuli it is possible to resolve interocular competition in as little as 30 ms ( su et al . , 2011 ) . our proposal is that for such stimuli , the magnitude of attentional control over initial dominance would be much smaller . additionally , recent eeg results ( zhang et al . , 2011 ) suggest that , in fact , attention may be necessary for the abnormal fusion of two rival stimuli to transition into rivalry alternations ( but see roeber et al . , 2011 for a different result ; also see box 2 ) . however , even though this argument may explain why attentional modulation of initial dominance is strong , it also makes it harder to pinpoint the exact neural mechanisms that are involved ( see box 3 for future directions that may resolve this issue ) . the resolution of binocular rivalry requires selection of one rival image for dominance , and another for suppression . since selection is a fundamental feature of the attentional system , this fact raises the question of whether the processes giving rise to perceptual fluctuations during binocular rivalry actually require that attention be deployed to the rival stimuli . however , getting a clear answer to this question is precluded by a fundamental problem in all behavioral investigations of attention and rivalry . if one wants to investigate how two processes interact , one should first understand each process in isolation , and then examine what happens when the two are combined . however , such a clean design can not be applied to the behavioral study of attentional effects on binocular rivalry due to the simple fact that reporting a subjective perceptual state during rivalry requires directing attention toward rival stimuli . therefore , it is impossible to behaviorally measure rivalry dynamics in the absence of attention . some studies have tried to circumvent this limitation by asking observers to attend to rival stimuli only sporadically , and then using the observers reports during these brief periods of attending to infer rivalry dynamics during preceding periods of diverted attention ( cavanagh and holcombe , 2006 ; he et al . the results suggest that rivalry either considerably slows down or possibly stops alternating outside of the scope of attention . however , because attention must be periodically directed to the rival stimuli ( in order for observers to make responses ) , these studies do more to highlight the impossible task of behaviorally measuring rivalry dynamics without attention than to actually circumvent this limitation . this fundamental problem , fortunately , can be avoided by using non - behavioral methods of assessing rivalry dynamics . specifically , neuroimaging methods can be used to characterize neural signature(s ) of rivalry alternations , which then can be examined with and without attention . ( 2011 ) , who found that when attention was directed away from the rival stimuli , rivalry stopped . these intriguing findings suggest that attention may be necessary for the resolution of conflict in binocular rivalry . however , an opposite finding was reported in an event - related potential ( erp ) study by roeber et al . following a brief period of abnormal fusion and subsequent determination of initial dominance in binocular rivalry , rivalry enters its characteristic dynamic of perceptual alternations between the two incompatible stimuli . because there is considerable evidence that the mechanisms underlying the dynamics of sustained binocular rivalry are at least partially distinct from those underlying initial selection ( wolfe , 1983 ; de belsunce and sireteanu , 1991 ; carter and cavanagh , 2007 ; bartels and logothetis , 2010 ; stanley et al . , 2011 ) , it is important to determine whether the nature of selective attentional modulation might also differ . the first modern study to address this question was by meng and tong , who instructed subjects to hold one of the two rival stimuli dominant for as long as possible . consistent with the older hypothesis by moray ( 1970 ) , the results showed essentially no effect of attention ( figure 4 ) . there were no changes in the average dominance durations or total predominance in favor of the held item or against the ignored stimulus . evidently , simply directing endogenous attention toward one of the rival stimuli has little effect over the dynamics of binocular rivalry ( as discussed in the following section , different results are found if attended stimuli are behaviorally relevant ) . in contrast , when the same subjects were asked to perform an analogous task with the bistable necker cube , strong attentional modulation was observed ( figure 4 ; meng and tong , 2004 ; also see toppino , 2003 ) . similar results are found for other types of ambiguous visual stimuli , including apparent motion ( suzuki and peterson , 2000 ) and 3d structure - from - motion ( hol et al . , 2003 ) . in fact , voluntary attention to the alternate perceptual explanation is often required see ambiguous figure reversals ( personal in - class observation with e. g. boring s young girl / mother - in - law image ) . one explanation of these results is that the nature of competition in ambiguous stimuli is high - level , and therefore it is easily affected by attentional control . overall , this contrast between rivalry and ambiguous figures supports the hypothesis that conflict during binocular rivalry is resolved at early stages of visual processing in a bottom - up fashion ( blake , 1989 ) , thereby limiting the degree of attentional modulation ( mcmains and kastner , 2011 ) . in a study by meng and tong ( 2004 ) , observers were asked to willfully affect dynamics of necker cube reversals ( a ) and binocular rivalry ( b ) by trying to hold one of two possible perceptual interpretations . this was an easy task for the necker cube stimulus ( c ) . when asked to attempt to perceive the cube from the bottom view for as long as possible , observers were able to do that regardless of the fixation position [ denoted by crosses in ( a ) ] . however , the degree of attentional control over binocular rivalry was considerably smaller ( d ) . when asked to try to maintain the percept of the face for as long as possible , observers exhibited only weak ability hold the face dominant over a range of stimulus contrasts . adopted with permission from meng and tong , 2004 ; arvo ) . competition during binocular rivalry , however , is not exclusively confined to early , monocular mechanisms , but may involve different levels of the visual system depending on the nature of the competition ( blake and logothetis , 2002 ; lee , 2004 ) . one notable case that reveals an important role of higher - level processes is stimulus rivalry ( logothetis et al . each eye receives conflicting input , but the ocular configuration is rapidly swapped between the eyes ( 3 hz ) . under these specific conditions , 1996 ; lee and blake , 1999 ) , precluding an eye - based explanation . importantly , visual competition leading to these dynamics by definition involves a conflict between two stimuli rather than a conflict between two eyes and likely involves higher visual areas ( pearson et al . , 2007 ) . modeling studies indicate that stimulus rivalry occurs for stimuli that bypass the low - level competition that normally occurs at early , monocular stages ( wilson , 2003 ; freeman , 2005 ; tong et al . , 2006 ) . another example involves composite stimuli created by fragmenting two larger images and pseudorandomly assigning the corresponding fragments to two eyes ( i.e. , each eye would see a mosaic containing complementing components of two source images ) . for such stimuli , rather than perceiving rivalry between two mosaic images , subjects often perceive the unfragmented source images ( diaz - caneja , 1928 , translated by alais et al . , 2000 ; kovcs et al . , in addition , globally grouped motion ( alais and blake , 1998 ) , surface contours ( ooi and he , 2003 ; van bogaert et al . , 2008 ) , textures with common luminance or color ( silver and logothetis , 2004 ) , as well as other grouped stimuli ( logothetis , 1998 ) can influence locally competing rival stimuli . these effects indicate involvement of object - based processes operating at multiple stages throughout the visual hierarchy . because of the higher - level nature of visual competition in these examples , the framework introduced in this review predicts a greater degree of attentional control . while this specific hypothesis remains to be tested , there are some indications that these forms of visual rivalry are more susceptible to top - down factors . for example , unlike eye rivalry , stimulus rivalry requires high levels of pattern coherence , indicating a key role of object - based mechanisms ( bonneh et al . , 2001 ) . an analogous dissociation is evident in the perceptual stabilization that occurs when rival stimuli are presented intermittently ( leopold et al . , 2002 ) . object features , such as color , are the primary factor determining perceptual stabilization during intermittent stimulus rivalry ( pearson and clifford , 2004 ) . on the other hand , low - level eye of origin is almost the sole determinant of perception during intermittent binocular rivalry ( chen and he , 2004 ; pearson and clifford , 2004 ) . additional evidence that the level where stimuli compete affects their susceptibility to attentional modulation comes from studies that investigated the slowing of rivalry that occurs when attention is diverted ( see box 1 ) . observed effects are larger for rivalrous face / house stimuli than for orthogonal gratings ( van ee et al . , 2005 ; this is likely due to the fact that conflict between faces and houses arises later in the visual hierarchy than does conflict between gratings ( cf . , arguably the strongest indication that stimulus rivalry may be more susceptible to attentional modulation comes from a recent study by silver and logothetis ( 2007 ) . here , one of two dichoptically presented orthogonal gratings was embedded with a conspicuous visual tag . throughout the course of a trial , this tag either remained with the same stimulus ( and switched eye at every eye swap ) or remained in the same eye ( and switched stimulus on each eye swap ) . when the tag remained in one eye , subjects were biased toward perceiving fast stimulus switches , indicating sustained periods of eye dominance . importantly , when one of the two stimuli was tagged , subjects tended to experience slow , irregular stimulus alternations ( i.e. , they perceived stimulus rivalry ) . in this study , participants likely used attentional tracking strategies to follow the cue . during conditions where the tag remained with one stimulus , this effectively deployed selective attention to that tagged stimulus . although the goal of this study was not to study attentional modulations , it does suggest stronger attentional control over stimulus rivalry than binocular rivalry . evidently , as the visual competition is biased toward higher - level mechanisms , the susceptibility to attentional modulation increases . the predominantly low - level nature of conflict during binocular rivalry , however , should not by itself preclude attentional modulations . although attentional modulations are more closely associated with higher visual processes , attentional effects in early visual areas , including v1 and lgn , are well documented ( treue , 2001 ; oconnor et al . , 2002 ; roberts et al . , 2007 ; fischer and whitney , 2009 ) . so , what then may be a reason for weak attentional modulation of conventional binocular rivalry ? one reason binocular rivalry continues to fascinate is that it is not a common perceptual experience . this also indicates that we are rarely in situations where we have to select between conflicting inputs arising from two eyes . on the other hand , we frequently select between higher - level stimulus features , such as objects . but , what if one eye s stimulus is behaviorally relevant , for instance through an eye - specific , attentionally demanding task ? evidence supporting the load theory of attention indicates that the efficacy of attentional deployment critically depends on the effort involved in processing of the attended target , with high loads yielding stronger attentional modulations ( lavie , 2005 ) . another key question is whether continuing behavioral relevance of one eye s stimulus gradually strengthens any modulatory effects of attention . while we do not normally select between two eyes , the visual system does have the capability to do so . a striking example is amblyopia , a condition where the brain essentially ignores poor visual input from one eye in favor of behaviorally relevant input from the other eye ( campos , 1995 ; simons , 2005 ; levi and li , 2009 ) . in a way , amblyopia can be thought of as a limiting case of binocular rivalry , where both eyes are sending differing inputs to the brain , but the visual system learns to ignore the information from the weak eye , thereby resulting in a profound and possibly complete dominance of the stronger eye . although amblyopia is clearly a special case and may not involve attentional mechanisms , it demonstrates that an effort to maintain the most relevant visual information may alter the relative dominance of two monocular images . indeed , recent studies with typical observers have shown that relative dominance can be biased in favor of an attended stimulus if an appropriate attentionally demanding task is used . in one study that addressed this question , participants were instructed to identify small aspect ratio changes in a bullseye pattern presented to one eye , while completing no task when the other eye s stimulus was dominant ( figure 5a ; chong et al . , 2005 ) . the results revealed an approximately 50% increase in the dominance durations of the attended stimulus ( figure 5b ) . importantly , for this attentional effect to occur , attention needed to be directed toward the features of one of two rival stimuli simply performing a demanding task at the same spatial location during dominance periods of the target stimulus was insufficient to bias rivalry dynamics . in a related study , one of two orthogonal dichoptic gratings was cued , and participants were instructed to identify small rotations of the cued grating ( hancock and andrews , 2007 ) . ( interestingly , these two studies measured opposite factors giving rise to this outcome . see box 1 for more details ) . these findings indicate that behavioral relevance of a rival stimulus facilitates its attentional susceptibility , a process that likely involves attentional modulation of early visual processes . this argument is supported by recent erp results indicating that neural changes associated with a demanding attentional task occur at earlier stages when the attended stimulus is engaged in binocular rivalry ( khoe et al . specifically , the p1 component , an early erp component that is believed to reflect extrastriate neural activity , was modulated by attention only when the attended stimulus was presented under dichoptic conditions and rivaled with the unattended stimulus , and not during monocular presentation of the same stimuli . however , even with the utilization of demanding attentional tasks , the magnitude of attentional modulation in these studies ( chong et al . , 2005 ; hancock and andrews , 2007 ) was considerably smaller than attentional effects on initial dominance ( see above ) , indicating that initial selection is more susceptible to attentional control than sustained binocular rivalry . one eye views a control stimulus ( a radial checkerboard ) , while the other eye is shown a bullseye pattern . in two separate attentional tasks , observers were instructed to track either shape changes ( black arrows ) or shading changes ( gray arrows ) of the bullseye pattern . these tasks were demanding and required sustained attention . for illustration purposes , the magnitudes of the shape and shading changes are greatly exaggerated . results ( b ) indicate that completing a demanding task that directs attention toward a rival stimulus lengthens its average dominance duration . on the other hand , an equally demanding task where attention was directed to the same location in space but not to rival stimulus per se did not affect rivalry dynamics . the use of demanding attentional tasks , however , is not the only way to increase behavioral relevance of a rival target . other paradigms that increase the relative importance of a rival stimulus also increase its predominance . for example , faces with emotional content dominate over neutral faces during binocular rivalry ( alpers and pauli , 2006 ; bannerman et al . , 2008 ) and emerge faster from perceptual suppression ( yang et al . , 2007 ) . neutral faces that are paired with negative gossip predominate over faces paired with neutral statements ( anderson et al . , 2011 ) . in addition , observers ability to control the alternation rate during rivalry is greatly enhanced if a rival stimulus is paired with a congruent auditory stimulus ( van ee et al . , 2009 ) . even implicitly learned stimulus usefulness biases initial selection in binocular rivalry ( chopin and mamassian , 2010 ) . in summary , different ways of introducing behavioral relevance ( i.e. , without using explicit attentional tasks ) one hypothesis is that at least some of these manipulations work because they enable more effective direction of attention to a rival stimulus a conclusion consistent with the load theory of attention ( lavie , 2005 ) . evidence that an eye - specific behavioral task can boost the predominance of the task - relevant stimulus raises two interesting questions . first , increased predominance of the attended stimulus could be as a result of either an attentional boost to the high - level stimulus representation and/or an attentional modulation of low - level monocular processes . second , the link between behavioral relevance and attentional control raises the question of whether the magnitude of the observed effects could be increased . recent research has revealed that plasticity indeed occurs during prolonged viewing of binocular rivalry ( suzuki and grabowecky , 2007 ; klink et al . , 2010 ) , in turn opening a possibility that prolonged attentional control over rivalry may alter its own effectiveness . moreover , any permanent change in the effectiveness of attentional control allows subsequent determination of whether observed changes are specific to the trained eye and/or the trained stimulus . an early series of studies by lack indicated that voluntary control over rivalry alternation rate may be subject to training . lack s observers were asked to view rival stimuli and to either speed up or slow down their alteration rates a task that is relatively easy to accomplish ( lack , 1978 ; van ee et al . , 2005 ) . interestingly , over the course of 10 days , observers became considerably better at controlling their own switch rates ( lack , 1978 ) . as discussed above ( also see box 1 ) , non - attentional factors may explain such changes in alternation rates . still , lack s results warrant a more controlled investigation into the plasticity of attentional control during rivalry . more recent work ( suzuki and grabowecky , 2007 ) revealed that long - term observation of binocular rivalry indeed modulates alternation rates . however , observers in this study passively viewed rival stimuli , so it remains unclear how these changes might be altered by the addition of attentional influences . additional suggestions that attentional modulation of rivalry is subject to plasticity come from two recent studies . in a study by paffen et al . ( 2008 ) , observers were trained on a direction - specific speed discrimination task over the course of 5 days . after training , the task - relevant ( trained ) direction and task - irrelevant ( ignored ) motion direction were pitted against one another in binocular rivalry . perceptual learning resulted in a decrease in the predominance of the task - irrelevant motion . furthermore , initial dominance was biased in favor of the task - relevant motion direction . evidently , prolonged training with a specific stimulus changes its predominance during binocular rivalry . another study examined whether the pairing of exogenous attention and binocular rivalry could alter sensory eye dominance ( xu et al . sensory eye dominance describes a condition , akin to handedness , in which the input from one eye is stronger than that from the other eye , resulting in increased dominance of the stronger eye . in this study , an exogenous attentional cue to the weak eye push pull training led to a significant decrease in the magnitude of sensory eye dominance . the training effects only minimally transferred to other retinal locations and other stimuli , indicating high specificity . importantly , no changes were found in push only training where no rival stimulus was shown to the stronger eye , suggesting that the involvement of inhibitory interactions during rivalry was key to obtain this low - level plasticity . preliminary results from our lab ( dieter et al . , 2010 ) show that prolonged training in which observers perform an attentionally demanding task on one rival stimulus ( same task as in chong et al . , 2005 ; see figure 5a ) can lead to increasing voluntary control of rivalry dynamics . the changes giving rise to this additional control were partially eye - specific , as indicated by transfer to untrained stimuli presented to the trained eye . while more research is needed to understand the plasticity of attentional control over rivalry , it is becoming clear that the limits of attentional effects can be changed through appropriate perceptual training . one striking example is that tibetan buddhist monks with over 25 years of practice at one - point meditation were able to almost completely control their perception during rivalry ( carter et al . , 2005 ) , even though they had no prior experience with binocular rivalry . this unique observation indicates a possibility that complete control over binocular rivalry may be possible with extensive training . the influence of selective attention over the dynamics of binocular rivalry has been of interest to researchers for over a century . early investigations came to vastly different conclusions foreshadowing the seemingly diverse set of findings seen in modern studies . the aim of this review is to introduce an attentional framework that can help facilitate the understanding and synthesis of these results . perhaps reassuringly , the effects of attentional control over binocular rivalry seem to mimic those seen in other paradigms of attentional modulation . namely , the degree of attentional modulation over rivalry dynamics seems to depend on the presence of stimulus conflict , and the level of the visual system at which conflicting stimuli first compete . this framework predicts strong attentional control under conditions of unresolved stimulus conflict ( e.g. , initial selection ) and conditions where conflict is resolved at higher levels of processing ( e.g. , stimulus rivalry ) . in addition , limits on attentional control can be alleviated by the utilization of demanding , behaviorally relevant tasks , and likely through perceptual training paradigms . future research on this topic ( box 3 ) will likely reveal not only the extent to which an observer may voluntarily control his or her own perceptual experience , but also new insights into the mechanisms that resolve conflict during binocular rivalry . the attentional framework outlined in this review can help synthesize results from a number of behavioral studies that examined the effects of attention on binocular rivalry . however , in most cases , it does not specify where these attentional effects are occurring in the brain ( one exception would be eye - specific effects of attentional training ) . the key complication is that binocular rivalry is a complex mechanism that involves processes spreading out throughout the visual hierarchy ( blake and logothetis , 2002 ; tong et al . , 2006 ) . the uncertainties of where exactly rivalry competition takes place carry over to the uncertainty in where behaviorally measured attentional effects occur . brain imaging , however , holds promise to provide some specificity as to where attentional modulation of rivalry occurs , and , in turn , to help us understand the brain mechanisms involved in rivalry competition . the simple hypothesis motivated by attentional studies ( luck et al . , 1997 ; beck and kastner , 2009 ; mcmains and kastner , 2011 ) is that the biggest effects of attention should be seen at the stages where rival stimuli are first in competition and not before . it is also possible that some brain areas may play a special role in attentional modulation of rivalry . one such region is the parietal cortex , which is involved in both top - down attention ( behrmann et al . , 2004 ) and has been linked with binocular rivalry ( lumer et al . , 1998 ; while biased competition can provide a post hoc explanation of published results on attentional modulation of binocular rivalry , direct empirical tests of this framework are needed . the general hypothesis is that the degree of attentional modulation of rivalry will depend on the unresolved competition between rival stimuli . one specific prediction is that attentional modulation over rivalry dynamics will vary over the course of a single dominance epoch , being weaker at the beginning and stronger near the end . , 2010b ) that show that suppression depth decreases over the course of a dominance period . as strong suppression indicates relatively resolved visual competition , the effects of attentional deployment should vary accordingly . however , even after localization of brain area(s ) where attentional modulation of rivalry occurs , the exact mechanisms of attentional control over rivalry might still remain a mystery . while physiological changes such as increased alertness and attention - dependent changes in effective stimulus contrast almost certainly play a role ( see box 1 ) , these effects likely do not fully account for attentional modulations of binocular rivalry , particularly under conditions of behavioral relevance of one of the two stimuli . an important goal for future research will be to determine the limits of attentional control over rivalry . was helmholtz actually correct , after all , about the possibility of complete control over rivalry ? currently , demonstration of complete voluntary control seems elusive , except perhaps after 25 years of intensive meditation training ( carter et al . , 2005 ) . understanding of this limitation will shed light on the conditions under which we may determine our own conscious visual experience . if the degree of unresolved stimulus conflict indeed determines susceptibility to attentional modulation , then does an observer s ability to exert attentional control over rivalry fluctuate during different periods of rivalry dynamics ? for example , are mixed periods rivalry periods where an observer perceives a mixture of two stimuli more susceptible to attentional modulation ? if so , could targeted deployment of attention during mixed periods be an effective strategy to significantly prolong predominance of a rival stimulus ? although this review focused on modulatory effects of attention on rivalry , a recent study ( zhang et al . , 2011 ) indicates that attention may also have a fundamental enabling role in the initiation of rivalry alternations finally , it will be important to explore possible practical benefits of attentional control over rivalry , particularly its plasticity . 2010 ) recently demonstrated that perceptual training that combines binocular rivalry and an attentional task can result in improvements of stereopsis . it remains to be determined whether similar paradigms may be used as a behavioral treatment for amblyopia . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .	starting from early scientific explorations of binocular rivalry , researchers have wondered about the degree to which an observer can exert voluntary attentional control over rivalry dynamics . the answer to this question would not only reveal the extent to which we may determine our own conscious visual experience , but also advance our understanding of the neural mechanisms underlying binocular rivalry . classic studies , intriguingly , reached contradictory conclusions , ranging from an absence of attentional control , as advocated by breese , to nearly complete control of rivalry dynamics , as reported by helmholtz . recent investigations have revisited this question , but the results have continued to echo the conflicting findings of earlier studies , seemingly precluding a comprehensive understanding of attentional effects on rivalry . here , we review both classic and modern studies , and propose a unifying framework derived from the biased competition theory of attention . the key assumption of this theory is that the nature of stimulus conflict determines the limits of attentional modulation . for example , a condition in which unresolved stimulus conflict transpires through many levels of visual processing should be very susceptible to attentional control . when applied to binocular rivalry , this framework predicts strong attentional modulations under conditions of unresolved stimulus conflict ( e.g. , initial selection ) and conditions where conflict is resolved at higher levels of visual processing ( e.g. , stimulus rivalry ) . additionally , the efficacy of attentional control over rivalry can be increased by utilization of demanding , behaviorally relevant tasks , and likely through perceptual training paradigms . we show that this framework can help facilitate the understanding and synthesis of a diverse set of results on attentional control over rivalry , and we propose several directions for future research on this interesting topic .
You are an expert at summarizing long articles. Proceed to summarize the following text: intramedullary tuberculoma ( imt)are extremely rare lesions should be distinguished from other space occupying lesions like neoplasms . although it is a treatable condition delaying diagnosis leads to significant morbidity . we report a case of intramedullary thoracic tuberculoma with paraparesis showing deterioration of neurological status during medical treatment . the possibility of imt should be seriously considered when an intraspinal mass is found with evidence of tuberculosis . anti - tuberculous therapy ( att ) is the mainstay of treatment and had shown good results . surgical removal is to be considered in cases of worsening neurological status while the patient is on att . intramedullary spinal tuberculosis ( tb ) is a rare disease entity , which was first described by abercrombie in 1828 . it can be seen at any level of the cord but usually involves dorsal spinal cord . a 25-year - old male presented with low back pain , progressive weakness in lower limbs since 1-month and bladder incontinence since 2 weeks . neurological examination revealed grade 3 power in both lower limbs and hypoesthesia below d8 level . plain radiograph of the spine showed paradiscal lesion l2 - 3 level , while rest of the spine was normal . magnetic resonance imaging ( mri ) of the spine demonstrated paradiscal lesion with paravertebral abscess at l2 - 3 . at the level of d8 vertebra , there was an intramedullary lesion of 12 mm 9 mm which was hypointense on t1 , isointense lesion in t2 , and demonstrated ring enhancement on gadolinium contrast ( fig . 1 ) . based on this clinico - radiological picture , a diagnosis of l2-l3 tb with intramedullary tuberculoma ( imt ) at d8 level was made and patient was started on multidrug treatment ( isoniazid , rifampicin , ethambutol , and pyrazinamide ) and a short course of dexamethasone . at 6 weeks , patient was deteriorated neurologically with grade 2 power in both lower limbs . at 12 weeks patient did not show any signs of improvement . at this point , we found a grayish mass with a good plane of cleavage from the surrounding cord ( fig . a grey , irregular , multilobulated soft mass measuring 12 mm 10 mm 6 mm was removed completely ( fig . histopathology examination showed diffuse & dense infiltrate compromising of lymphocytes , plasma cells , and neutrophils with large areas of caseous necrosis surrounded by sheets of the epithelioid cell and langerhans type of giant cells . z - n stain showed no acid - fast bacillus , while tissue culture was negative . patient slowly showed signs of neurological recovery after 6 weeks however his bladder disturbance persisted . at 3 months after surgery , his lower limb power in hip and knee was completely recovered , with recovered bowel and bladder retention . post - operative after 6 months patient was walking without support and had functional power in both lower limbs . intraoperative picture showing grayish mass with a good plane of cleavage from the surrounding cord . intracranial tuberculomas are still a common cause of space occupying lesion ( sol ) in india . imt are seen in only 2 out of 100,000 cases of tb and 2 out of 1000 cases of central nervous system tb . imt most commonly is hematogenous , secondary to the tb elsewhere in the body , commonly pulmonary tb , but some cases may present only with isolated extrapulmonary forms . imts tend to occur predominantly in young people , most commonly found in thoracic region . the commonest symptom is subacute spinal cord compression with the appropriate motor and sensory findings , depending on the level of the lesion . mri is gold standard diagnosis modality , as it accurately shows the site , size , number in such lesions . , there is an abundance of giant cells and poor collagenous capsule with variable surrounding edema . at this stage , tuberculoma is isointense on both t1w1 and t2w1 and shows homogenous enhancement with gadolinium contrast . later on surrounding capsule become richer in collagen and surrounding inflammatory reaction starts disappearing . this results in an isointense lesion on t1w1 and isointense or hypointense lesion on t2w1 images and ring enhancement with hypointense center with gadolinium contrast . with the development of caseation center on treatment with chemotherapy the lesion regresses in size and disappears , to be replaced by an area of gliosis , which probably is seen as an area of hypointensity on mri [ 8 - 10 ] . the most important finding is worsening of the patient s neurologic condition while being treated with adequate anti - tuberculous drugs . an immune reaction has been suggested . in tuberculoma , anti - tuberculous chemotherapy destroys the bacilli and releases tuberculous protein , which mediates lymphocyte proliferation , resulting in expansion of the tuberculoma . surgical excision is recommended in cases of severe cord compression , increasing neurological deficit in the presence of akt . this allows surgical removal without excess trauma to surrounding functional spinal cord tissue . the mycobacterium tb isolated from the tuberculoma will help in deciding the akt in the present scenario of drug resistance to akt akt with four drugs hrze having good cerebrospinal fluid penetration recommended for 12 months post - operative . we suggest a combination of surgical excision of tuberculoma along with akt for imt not responding to akt for a good outcome . tuberculoma should be considered in the differential diagnosis of all intramedullary sol s irrespective of age or presence of extracranial focus of tb in countries endemic to tb . most of these patients respond well to anti - tuberculous drug therapy with good functional recovery . however , timely surgical decompression in selected cases , provide an excellent long - term outcome . this case report highlights role of surgical treatment in management of intramedullary tuberculoma . surgical excision should be performed i patient not responding or deteriorating with medical management .	introduction : intramedullary tuberculoma ( imt)are extremely rare lesions should be distinguished from other space occupying lesions like neoplasms . although it is a treatable condition delaying diagnosis leads to significant morbidity.case report : we report a case of intramedullary thoracic tuberculoma with paraparesis showing deterioration of neurological status during medical treatment . surgical resection had shown the excellent result.conclusion:the possibility of imt should be seriously considered when an intraspinal mass is found with evidence of tuberculosis . anti - tuberculous therapy ( att ) is the mainstay of treatment and had shown good results . surgical removal is to be considered in cases of worsening neurological status while the patient is on att .
You are an expert at summarizing long articles. Proceed to summarize the following text: proton pump inhibitors ( ppis ) , which irreversibly inhibit gastric acid pump ( h + /k + atpase ) function are the most potent gastric acid - suppressing agents in clinical use . ppis are widely used for prevention and treatment of various acid - related diseases including gastrointestinal reflux disease ( gerd ) , duodenal ulcers , peptic ulcers , reflux esophagitis and other hyper acidic conditions . of these , gerd is the frequently reported gastrointestinal disease worldwide causing significant societal and economic burden ( shaheen et al . , 2006 ) , auguring treatment with ppis . however , up to 40% of gerd patients report partial or complete lack of relief of their symptoms in response to treatment with ppis . polymorphisms in drug metabolizing enzymes is listed as one of the factors responsible for the demonstrated ppi resistance ( cicala , 2013 , clarke and pandolfino , 2012 ) , apart from other factors ( zerbib et al . , all of the ppis are usually metabolized in the liver involving different isoenzymes of the cytochrome p 450 ( cyp ) family before their elimination ( hagymasi et al . , 2011 ) . genes encoding cyp2c19 and cyp3a4 are extensively polymorphic with 34 variant alleles known for cyp2c19 and > 30 variant alleles for cyp3a4 ( http://www.cypalleles.ki.se/cyp2c19.html , 2016 , http://www.cypalleles.ki.se/cyp3a4.html , 2016 ) including both synonymous and non - synonymous variants . earlier studies have classified subjects as extensive and poor metabolizers based on their ability to metabolize ppis ( goldstein , 2001 , desta et al . , 2002 ) . extensive metabolizers were subjects with wild type allele for the enzyme whereas subjects who carry polymorphisms cyp2c19 * 2 and cyp2c19 * 3 were classified as poor metabolizers . these polymorphisms have been studied widely in different populations ( goldstein et al . , 1997 ) with reported frequencies ranging from 6 to 39% . subsequent studies led to identification of other loss of function polymorphisms ( cyp2c19 * 4 to * 12 ) in the same gene , leading to production of a defective enzyme and conferring poor metabolizer phenotype to their carriers ( rosemary and adithan , 2007 ) ( table 1 ) . in 2006 , a new polymorphism ( cyp2c19 * 17 ) was identified , which showed gain of function ( increased enzyme activity ) with a reported frequency of 18% both in swedes and ethiopians and 4% in chinese population ( sim et al . , 2006 ) . cyp3a4 * 1b , reported as a 290a > g substitution in the 5-flanking region of cyp3a4 may result in reduced activity of cyp3a4 enzyme . while few studies have reported a decrease in the activity of the enzyme ( min and ellingrod , 2003 ) , few others have shown an increase ( rebbeck et al . , 1998 ) or no effect ( westlind et al . , 1999 cyp3a4 has other non - synonymous polymorphisms like * 3 , * 15 and * 18 resulting in increased metabolism of vitamin d2 ( gupta et al . , 2005 ) , testosterone ( dai et al . , 2001 ) and midazolam ( kang et al . , 2008 ) respectively . cyp3a4 * 17 reportedly showed decreased metabolism of nifedipine ( lee , 2004 ) and cyp3a4 * 19 shows activity similar to wild type protein ( westlind et al . , 1999 ) ( table 1 ) . pharmacokinetic analysis revealed that the systemic drug exposure ( area under curve ; auc ) varies widely between groups ; auc for omeprazole , lansoprazole and rabeprazole were found to be 7.5 , 4.5 and 4-fold higher in poor metabolizers than in extensive metabolizers ( klotz , 2006 ) . since the pharmacodynamic response to ppis is related to their auc , intra - gastric ph is usually more elevated in poor metabolizers ( pms ) in comparison with other groups . studies with subjects treated with omeprazole and pantoprazole demonstrated that a * 17 polymorphism may lead to less acid - inhibition and decreased auc when compared with wild type ( hunfeld et al . , 2008 ) . though further studies indicated cyp2c19 * 17 to be associated with increased enzymatic activity , it is still not clear as to whether carriers of this polymorphism are to be classified as ultra - rapid ( urm ) metabolizers or rapid metabolizers ( rm ) ( li - wan - po et al . , 2010 ) . though the mechanism of action of all ppis is similar , the physicochemical properties of these drugs result in variations in the degree of acid suppression , as well as the speed of onset of acid inhibition ( robinson and horn , 2003 ) . further polymorphisms in drug metabolizing genes result in different genotypes causing inter - individual variation in the rate of metabolism of ppis . in addition , much less is known about polymorphisms of cyp2c19 in indian tribal populations with extensive consanguinity . since such differences may impact the clinical performance of ppis in different populations , we designed the present study to ( 1 ) estimate the frequencies of different polymorphisms in cyp2c19 and cyp3a4 in urban and tribal indian populations and ( 2 ) study the effect of these polymorphisms on pharmacokinetic and pharmacodynamic properties of commonly administered ppis such as esomeprazole and pantoprazole , ( epz and ppz ) . this is a study involving healthy indian subjects from urban and tribal areas of telangana state . subjects were categorized into five different phenotypes ( normal , intermediate , poor , rapid and ultra - rapid metabolizers ) of ppis based on their genotype . subjects from each phenotype were also administered ppis ( esomeprazole and pantoprazole ) under fasting conditions and the plasma ppi levels were measured subsequently . healthy urban and tribal subjects ( koya and naik tribes ) were recruited for genotyping and for pharmacokinetic and pharmacodynamic analysis . all participants were clinically evaluated and confirmed to be healthy . written informed consent was obtained from all subjects and all protocols used in the study were approved by the institutional ethics committee . peripheral blood ( 4 ml ) dna was isolated from leucocytes using qiaamp dna blood maxi kit ( qiagen , netherlands ) , quantified and stored at 20 c until further use . dna samples were genotyped for all the polymorphisms of cyp2c19 and cyp3a4 mentioned in table 1 . genotyping was performed using competitive allele specific pcr system ( kaspar ) kit obtained from kbiosciences ( lcgc genomics , london ) using step one real time pcr ( life technologies , usa ) . klustercaller software was used to determine genotypes based on clusters and an online excel based software ( version 1.05 ) was used for haplotype analysis of cyp2c19 alleles ( eliades and eliades , 2009 ) . subjects were categorized into 5 groups based on their genotype ( normal , intermediate , poor , rapid & ultra - rapid metabolizers ) for the pharmacokinetics / dynamics ( http://www.cypalleles.ki.se/cyp2c19.html , 2016 , goldstein et al . , 1997 ) . volunteers from each category were orally administered individual ppis ( esomeprazole and pantoprazole ; 40 mg / day with 240 ml of water at 9.00 am ) for 5 days . blood samples were collected periodically for the determination of plasma ppi concentration at 0 , 1 , 2 , 4 , 6 and 24 h after the dose on first and last day of administration . a mandatory wash out period of two weeks was maintained when more than one drug was administered . ( noubarani et al . , 2010 ) using a waters e2695 alliance hplc system ( medford , ma , usa ) . the maximum plasma concentration ( cmax ) of each drug and the time to reach cmax ( tmax ) was determined directly from the individual concentration - time data . the area under the plasma concentration - time curve from time zero to the last sampling time ( auc 0-t ) was calculated by the trapezoidal rule using pksolver ( ver 2.0).(zhang et al . , 2010 ) intra - gastric ph was recorded on day 1 ( baseline prior to taking the ppi ) and day 6 ( 24 h after taking ppi on the 5th day ) of the study using the comfortec z ph monitoring unit ( sandhill scientific , colorado , usa ) equipped with a single channel reference probe introduced per - nasally into the body of the stomach ( about 4045 cm beyond the oral cavity ) . statistically significant differences among pharmacokinetic parameters of different cyp2c19 genotypes were determined using the kruskal student 's t - test and chi square test were used for continuous and categorical variables based on the sample size . the analysis was carried out using the trial version of medcalc for windows , ( medcalc software , ostend , belgium ) and graph pad quickcalc ( graphpad.com , 2015 ) . this is a study involving healthy indian subjects from urban and tribal areas of telangana state . subjects were categorized into five different phenotypes ( normal , intermediate , poor , rapid and ultra - rapid metabolizers ) of ppis based on their genotype . subjects from each phenotype were also administered ppis ( esomeprazole and pantoprazole ) under fasting conditions and the plasma ppi levels were measured subsequently . healthy urban and tribal subjects ( koya and naik tribes ) were recruited for genotyping and for pharmacokinetic and pharmacodynamic analysis . all participants were clinically evaluated and confirmed to be healthy . written informed consent was obtained from all subjects and all protocols used in the study were approved by the institutional ethics committee . peripheral blood ( 4 ml ) was collected from all subjects in edta vaccutainers . dna was isolated from leucocytes using qiaamp dna blood maxi kit ( qiagen , netherlands ) , quantified and stored at 20 c until further use . dna samples were genotyped for all the polymorphisms of cyp2c19 and cyp3a4 mentioned in table 1 . genotyping was performed using competitive allele specific pcr system ( kaspar ) kit obtained from kbiosciences ( lcgc genomics , london ) using step one real time pcr ( life technologies , usa ) . klustercaller software was used to determine genotypes based on clusters and an online excel based software ( version 1.05 ) was used for haplotype analysis of cyp2c19 alleles ( eliades and eliades , 2009 ) . subjects were categorized into 5 groups based on their genotype ( normal , intermediate , poor , rapid & ultra - rapid metabolizers ) for the pharmacokinetics / dynamics ( http://www.cypalleles.ki.se/cyp2c19.html , 2016 , goldstein et al . , 1997 ) . volunteers from each category were orally administered individual ppis ( esomeprazole and pantoprazole ; 40 mg / day with 240 ml of water at 9.00 am ) for 5 days . blood samples were collected periodically for the determination of plasma ppi concentration at 0 , 1 , 2 , 4 , 6 and 24 h after the dose on first and last day of administration . a mandatory wash out period of two weeks was maintained when more than one drug was administered . ( noubarani et al . , 2010 ) using a waters e2695 alliance hplc system ( medford , ma , usa ) . the maximum plasma concentration ( cmax ) of each drug and the time to reach cmax ( tmax ) was determined directly from the individual concentration - time data . the area under the plasma concentration - time curve from time zero to the last sampling time ( auc 0-t ) was calculated by the trapezoidal rule using pksolver ( ver 2.0).(zhang et al . , 2010 ) intra - gastric ph was recorded on day 1 ( baseline prior to taking the ppi ) and day 6 ( 24 h after taking ppi on the 5th day ) of the study using the comfortec z ph monitoring unit ( sandhill scientific , colorado , usa ) equipped with a single channel reference probe introduced per - nasally into the body of the stomach ( about 4045 cm beyond the oral cavity ) . statistically significant differences among pharmacokinetic parameters of different cyp2c19 genotypes were determined using the kruskal student 's t - test and chi square test were used for continuous and categorical variables based on the sample size . the analysis was carried out using the trial version of medcalc for windows , ( medcalc software , ostend , belgium ) and graph pad quickcalc ( graphpad.com , 2015 ) . healthy urban subjects ( n = 400 ) and tribals ( n = 100 ) from two different tribes ( koya n = 56 and naik n = 44 ) were recruited for the genotyping study apart from the 60 subjects recruited for pharmacokinetic and pharmacodynamics studies . out of the 60 subjects recruited for the latter studies , 23 subjects volunteered for the study with a single drug and 6 volunteered for both drugs . out of these 29 subjects , out of the 17 snps studied in the 560 subjects , only 4 variants ( * 2 , * 3 , * 17 in cyp2c19 gene and * 1b in cyp3a4 gene ) were observed with all the other studied alleles belonging to the wild type . the minor allele frequencies of cyp2c19 * 2 , * 3 , * 17 and cyp3a4 * 1b were 0.41 , 0.01 , 0.17 and 0.06 respectively and were found to be in hardy weinberg equilibrium . based on the cyp2c19 genotype , the 560 subjects were divided into five phenotype groups , namely normal ( * 1/1 , 2/17 , 3/17 ) , poor ( 2/2 , 2/3 ) , intermediate ( 1/2 , 1/3 ) , rapid ( 1/17 ) and ultra - rapid metabolizers ( 17/17 ) ( http://www.cypalleles.ki.se/cyp2c19.html , 2016 , goldstein et al . , 1997 , furuta et al . , 2005 ) . cyp3a4 1b genotype was not considered for classification of the subjects since it would not influence enzyme expression ( westlind et al . , 1999 ) . cyp2c19 * 2 was the most frequently identified variant allele both in urban and tribal subjects . however , the percentage of subjects in each phenotype group differed among urban and tribal subjects . the percentage of normal , intermediate , rapid and ultra - rapid metabolizers was less in tribal subjects when compared to the urban subjects ( table 3 ) . tribal subjects also had a significantly higher number ( p = 0.0003 ) of poor metabolizers ( 31% ) as compared to the urban population ( 15% ) . upon estimating plasma drug concentration at different time points , auct , cmax and tmax were calculated to obtain a measure of the pharmacokinetic profile for each drug . in comparison to other ppis , pantoprazole was found to be most effective for poor metabolizers since the drug was found to be absorbed in much lesser time as evidenced by the observed auct and tmax values . there was a significant difference among the groups in auct at day 1 pharmacokinetics of esomeprazole ( p = 0.04 ) and also for tmax ( p = 0.035 ) on day 5 of esomeprazole ( table 4 ) . since pantoprazole was found to be more effective as mentioned above , we compared its influence on intra - gastric ph with that of esomeprazole , a preferred frontline ppi in clinical practice . administration of pantoprazole for 5 days resulted in improved gastric acid suppression as compared to esomeprazole in poor and intermediate metabolizers . in normal metabolizers , the change in intra - gastric ph was similar in case of pantoprazole and esomeprazole . interestingly , noteworthy differences could not be observed in the intra - gastric ph at baseline and on day 6 in response to administration of esomeprazole or pantoprazole in rapid and ultra - rapid metabolizers who are carriers of gain of function polymorphism cyp2c19 * 17 ( table 5 ) . several studies have clearly demonstrated an association between polymorphisms in cyp2c19 and cyp3a4 genes and the drug metabolizing enzyme activity ( collet et al . , 2009 , geisler et al . , 2008 , taubert et al . , 2009 ) . in this study we evaluated the frequencies of these polymorphisms in indian population , studied their effect on ppi metabolism and gastric acid suppression apart from obtaining insights into related aspects in tribal populations . we found that 16.5% ( 76/460 ) of the urban subjects are rapid metabolizers , 3.2% ( 15/460 ) are ultra - rapid metabolizers ( table 3 ) , who did not respond to standard dose of ppis ( table 5 ) . to our knowledge , this is the first study from india which has comprehensively genotyped the well characterized , non - synonymous variants in the cyp2c19 and cyp3a4 genes . further , most of the earlier studies have focused more on cyp2c19 * 2 and cyp2c19 * 3 alleles only but not on other loss of function polymorphisms that have been included in the present study . efforts have also been made to correlate results obtained upon genotyping with ppi metabolism . in view of the importance of cytochrome p450 enzymes in drug metabolism , several studies have earlier been conducted to establish frequency of related gene polymorphisms in different populations . in our study focusing on ppi metabolism , cyp2c19 * 2 was found to be the most common allele occurring at a higher frequency of 41% , as compared to other asian populations ( 2830.3% ) ( he et al . , 2002 , sugimoto et al . , 2008 ) and african americans ( 25% ) ( kudzi et al . , 2009 ) . cyp2c19 * 3 variant allele was also detected at a lesser frequency of 0.8% in our study as opposed to other asian populations ( 3.410% . ) ( he et al . we found cyp2c19 * 17 genotype ( associated with increased enzyme function ) to occur at a higher allelic frequency ( 17% ) in comparison 24% reported in other asians ( pedersen et al . , 2010 ) . the allelic frequency of cyp3a4 * 1b , which was not detected earlier in asians like korean , chinese and japanese populations ( lee et al . , 2013 ) was found to be 6% in the present study . in order to correlate the results of genotyping with ppi metabolism studies with pantoprazole showed that poor metabolizers had the highest auc and ultra - rapid metabolizers had the lowest auc on both day i and day v. poor metabolizers had significantly higher values of auc and cmax ( p = 0.03 and 0.02 respectively ; unpaired t - test , 2 tailed p value ) when compared to normal metabolizers . this data is in consonance with observations made with caucasians ( hunfeld et al . , 2010 ) . subjects with cyp2c19 * 17 polymorphism had lower auc values on both day i and day v when compared to those without detectable polymorphism , akin to findings made with caucasians ( hunfeld et al . , 2008 ) . another study conducted on caucasian volunteers after single oral dose of pantoprazole also reported similar results , concluding that the cyp2c19 * 2 and * 17 polymorphisms have significant impact on pantoprazole pharmacokinetics ( gawronska - szklarz et al . , 2012 ) . after ascertaining the impact of these polymorphisms on pharmacokinetics of pantoprazole , we studied its effect on intra - gastric ph and observed that pantoprazole showed genotype dependent acid inhibition with less acid inhibition in subjects with * 1/1 genotype and stronger acid inhibition in subjects with 1/2 and 2/2 genotype . there were , however , no differences observed in the intra - gastric ph at baseline and on day 6 in subjects with 17/17 genotype . similar studies with esomeprazole showed that normal metabolizers had highest value of auc whereas ultra - rapid metabolizers showed lower value of auc on day v. these results are in contrast to those made with caucasians ( hunfeld et al . , 2012 ) where auc was observed to be maximum in poor metabolizers , indicating differences in the metabolism of esomeprazole . pharmacokinetic parameters were found to be similar between the two genotypes in normal metabolizers , ( subjects carrying 1/1 and 2/17 ) . this was further confirmed by unpaired t - test that revealed no significant difference between the two genotypes ( p > 0.5 , unpaired t - test ) . the effect of cyp2c19 17 polymorphism was observed only in homozygous condition ( * 17/17 ) . we studied the frequency of these polymorphisms in subjects belonging to two tribal groups from our state which are endogamous populations , ethnically and culturally distinct from the urban population . this difference was replicated in the results obtained , the frequency of cyp2c19 2 polymorphism in tribal subjects ( 0.49 ) was more than the urban subjects , whereas the frequency of cyp2c19 * 17 ( 0.12 ) was lesser . the number of poor metabolizers in the tribal subjects was significantly ( p = 0.0003 ) higher than the urban subjects . based on pharmacokinetics data we observed that the effect of cyp2c19 * 2 polymorphism seems to be more dominant in the studied population , especially in the compound heterozygous condition ( * 2/3 and 2/17 ) . cyp2c19 17 polymorphism was found to be more effective in homozygous mutant condition than heterozygous state . no significant difference ( two tailed p value > 0.07 for auct , cmax and tmax ; unpaired t - test ) was observed in the pharmacokinetics of rm ( * 1/17 ) and nm ( 1/1 ) . carriers of cyp2c19 17 allele did not show much change in intra - gastric ph from baseline to day 6 post ingestion . healthy urban subjects ( n = 400 ) and tribals ( n = 100 ) from two different tribes ( koya n = 56 and naik n = 44 ) were recruited for the genotyping study apart from the 60 subjects recruited for pharmacokinetic and pharmacodynamics studies . out of the 60 subjects recruited for the latter studies , 23 subjects volunteered for the study with a single drug and 6 volunteered for both drugs . out of these 29 subjects , out of the 17 snps studied in the 560 subjects , only 4 variants ( * 2 , * 3 , * 17 in cyp2c19 gene and * 1b in cyp3a4 gene ) were observed with all the other studied alleles belonging to the wild type . the minor allele frequencies of cyp2c19 * 2 , * 3 , * 17 and cyp3a4 * 1b were 0.41 , 0.01 , 0.17 and 0.06 respectively and were found to be in hardy weinberg equilibrium . based on the cyp2c19 genotype , the 560 subjects were divided into five phenotype groups , namely normal ( * 1/1 , 2/17 , 3/17 ) , poor ( 2/2 , 2/3 ) , intermediate ( 1/2 , 1/3 ) , rapid ( 1/17 ) and ultra - rapid metabolizers ( 17/17 ) ( http://www.cypalleles.ki.se/cyp2c19.html , 2016 , goldstein et al . , 1997 , furuta et al . , 2005 ) . cyp3a4 1b genotype was not considered for classification of the subjects since it would not influence enzyme expression ( westlind et al . , 1999 ) . cyp2c19 * 2 was the most frequently identified variant allele both in urban and tribal subjects . however , the percentage of subjects in each phenotype group differed among urban and tribal subjects . the percentage of normal , intermediate , rapid and ultra - rapid metabolizers was less in tribal subjects when compared to the urban subjects ( table 3 ) . tribal subjects also had a significantly higher number ( p = 0.0003 ) of poor metabolizers ( 31% ) as compared to the urban population ( 15% ) . upon estimating plasma drug concentration at different time points , auct , cmax and tmax were calculated to obtain a measure of the pharmacokinetic profile for each drug . in comparison to other ppis , pantoprazole was found to be most effective for poor metabolizers since the drug was found to be absorbed in much lesser time as evidenced by the observed auct and tmax values . there was a significant difference among the groups in auct at day 1 pharmacokinetics of esomeprazole ( p = 0.04 ) and also for tmax ( p = 0.035 ) on day 5 of esomeprazole ( table 4 ) . no significant difference was observed in any of the parameters for pantoprazole . since pantoprazole was found to be more effective as mentioned above , we compared its influence on intra - gastric ph with that of esomeprazole , a preferred frontline ppi in clinical practice . administration of pantoprazole for 5 days resulted in improved gastric acid suppression as compared to esomeprazole in poor and intermediate metabolizers . in normal metabolizers , the change in intra - gastric ph was similar in case of pantoprazole and esomeprazole . interestingly , noteworthy differences could not be observed in the intra - gastric ph at baseline and on day 6 in response to administration of esomeprazole or pantoprazole in rapid and ultra - rapid metabolizers who are carriers of gain of function polymorphism cyp2c19 * 17 ( table 5 ) . several studies have clearly demonstrated an association between polymorphisms in cyp2c19 and cyp3a4 genes and the drug metabolizing enzyme activity ( collet et al . , 2009 , geisler et al . , 2008 , taubert et al . , 2009 ) . in this study we evaluated the frequencies of these polymorphisms in indian population , studied their effect on ppi metabolism and gastric acid suppression apart from obtaining insights into related aspects in tribal populations . we found that 16.5% ( 76/460 ) of the urban subjects are rapid metabolizers , 3.2% ( 15/460 ) are ultra - rapid metabolizers ( table 3 ) , who did not respond to standard dose of ppis ( table 5 ) . to our knowledge , this is the first study from india which has comprehensively genotyped the well characterized , non - synonymous variants in the cyp2c19 and cyp3a4 genes . further , most of the earlier studies have focused more on cyp2c19 * 2 and cyp2c19 * 3 alleles only but not on other loss of function polymorphisms that have been included in the present study . efforts have also been made to correlate results obtained upon genotyping with ppi metabolism . in view of the importance of cytochrome p450 enzymes in drug metabolism , several studies have earlier been conducted to establish frequency of related gene polymorphisms in different populations . in our study focusing on ppi metabolism , cyp2c19 * 2 was found to be the most common allele occurring at a higher frequency of 41% , as compared to other asian populations ( 2830.3% ) ( he et al . , 2002 , sugimoto et al . , 2008 ) and african americans ( 25% ) ( kudzi et al . , 2009 ) . cyp2c19 * 3 variant allele was also detected at a lesser frequency of 0.8% in our study as opposed to other asian populations ( 3.410% . ) ( he et al . , 2002 , we found cyp2c19 * 17 genotype ( associated with increased enzyme function ) to occur at a higher allelic frequency ( 17% ) in comparison 24% reported in other asians ( pedersen et al . , 2010 ) . the allelic frequency of cyp3a4 * 1b , which was not detected earlier in asians like korean , chinese and japanese populations ( lee et al . , 2013 ) was found to be 6% in the present study . in order to correlate the results of genotyping with ppi metabolism studies with pantoprazole showed that poor metabolizers had the highest auc and ultra - rapid metabolizers had the lowest auc on both day i and day v. poor metabolizers had significantly higher values of auc and cmax ( p = 0.03 and 0.02 respectively ; unpaired t - test , 2 tailed p value ) when compared to normal metabolizers . subjects with cyp2c19 * 17 polymorphism had lower auc values on both day i and day v when compared to those without detectable polymorphism , akin to findings made with caucasians ( hunfeld et al . , 2008 ) . another study conducted on caucasian volunteers after single oral dose of pantoprazole also reported similar results , concluding that the cyp2c19 * 2 and * 17 polymorphisms have significant impact on pantoprazole pharmacokinetics ( gawronska - szklarz et al . , 2012 ) . after ascertaining the impact of these polymorphisms on pharmacokinetics of pantoprazole , we studied its effect on intra - gastric ph and observed that pantoprazole showed genotype dependent acid inhibition with less acid inhibition in subjects with * 1/1 genotype and stronger acid inhibition in subjects with 1/2 and 2/2 genotype . our results are similar to the pharmacodynamics data of caucasians ( hunfeld et al . , 2010 ) , where they found similar genotype dependent acid inhibition with pantoprazole . there were , however , no differences observed in the intra - gastric ph at baseline and on day 6 in subjects with 17/17 genotype . similar studies with esomeprazole showed that normal metabolizers had highest value of auc whereas ultra - rapid metabolizers showed lower value of auc on day v. these results are in contrast to those made with caucasians ( hunfeld et al . , 2012 ) where auc was observed to be maximum in poor metabolizers , indicating differences in the metabolism of esomeprazole . pharmacokinetic parameters were found to be similar between the two genotypes in normal metabolizers , ( subjects carrying 1/1 and 2/17 ) . this was further confirmed by unpaired t - test that revealed no significant difference between the two genotypes ( p > 0.5 , unpaired t - test ) . the effect of cyp2c19 17 polymorphism was observed only in homozygous condition ( * 17/17 ) . we studied the frequency of these polymorphisms in subjects belonging to two tribal groups from our state which are endogamous populations , ethnically and culturally distinct from the urban population . this difference was replicated in the results obtained , the frequency of cyp2c19 2 polymorphism in tribal subjects ( 0.49 ) was more than the urban subjects , whereas the frequency of cyp2c19 * 17 ( 0.12 ) was lesser . the number of poor metabolizers in the tribal subjects was significantly ( p = 0.0003 ) higher than the urban subjects . based on pharmacokinetics data we observed that the effect of cyp2c19 * 2 polymorphism seems to be more dominant in the studied population , especially in the compound heterozygous condition ( * 2/3 and 2/17 ) . cyp2c19 17 polymorphism was found to be more effective in homozygous mutant condition than heterozygous state . no significant difference ( two tailed p value > 0.07 for auct , cmax and tmax ; unpaired t - test ) was observed in the pharmacokinetics of rm ( * 1/17 ) and nm ( 1/1 ) . carriers of cyp2c19 17 allele did not show much change in intra - gastric ph from baseline to day 6 post ingestion . we demonstrate that it is important to identify and optimize appropriate dosage regimen for rapid and ultra - rapid metabolizers , as the standard dosage does not seem to efficiently inhibiting acid secretion . although the sample size for pharmacokinetic and pharmacodynamic studies is a limitation , our study indicates the impact of these polymorphisms not only on ppi metabolism but also on other drugs that are metabolized by cyp2c19 . despite limitations , our study has established the impact of various alleles of cyp2c19 on metabolism of ppis in our population . out of the 36.3% variants , 20% are carriers of the cyp2c19 * 17 allele who did not respond to the standard dose . therefore , we conclude that screening and identification of subjects carrying variant alleles is necessary for personalization of dosage . neha deshpande and sharanya vuddagiri collected samples , performed research , data analysis , data interpretation and drafted the paper . dr . sasikala mitnala contributed to the design of the study and revised the paper . d. nageshwar reddy contributed to the design of the study , data analysis and approval of the final version of the paper . all authors have given their approval for the final version of the paper and the authorship list .	introduction and objectivepolymorphisms in genes encoding drug metabolizing enzymes may lead to varied enzyme activity and inter - individual variability in drug efficacy and/or toxicity . since cyp2c19 and cyp3a4 genes code for enzymes involved in metabolizing wide variety of drugs including proton pump inhibitors , we sought to identify polymorphisms in these genes in order to study their impact on drug metabolism in subjects.methodsdna was isolated from healthy individuals including tribals and genotyped for 11 single nucleotide polymorphisms in cyp2c19 and 6 polymorphisms in cyp3a4 . individuals were categorized into different phenotypes based on their drug metabolizing genotype . volunteers from each group were administered proton pump inhibitors ( esomeprazole , pantoprazole ; 40 mg / day ) for 5 days followed by pharmacokinetic studies and measurement of intra - gastric ph.resultsof the 17 polymorphisms studied , only cyp2c19 * 2,3,17 and cyp3a4 * 1b polymorphisms were observed . in comparison to urban individuals , a significantly ( p = 0.0003 ) higher number of poor metabolizers were noted in the tribal individuals . pantoprazole was found to be most effective in poor metabolizers in terms of area under the curve and tmax . no significant difference was observed in the intra - gastric ph at baseline and day 6 in rapid and ultra - rapid metabolizers.conclusionour study has demonstrated that 19.7% of our subjects are carriers of the cyp2c19 * 17 allele who did not respond to the standard dose of proton pump inhibitors . genetic screening to identify subjects with variant alleles would thus be useful for personalization of therapy with proton pump inhibitors .
You are an expert at summarizing long articles. Proceed to summarize the following text: the study was approved by the emory university institutional review board and used data from 1,573 adults in the sigt study , described previously ( 5 ) . briefly , this study recruited participants without known diabetes between january 2005 and march 2008 . the participants first visits were at different times of the day , without an overnight fast . rcg and rpg were measured , a 50-g glucose drink was given , and gctcap and gctpl glucose levels were measured 1 h later . at a second visit , a1c was measured and a 75-g oral glucose tolerance test ( ogtt ) was begun before 11:00 a.m. , after an overnight fast . diabetes included fasting glucose 126 mg / dl ( 7 mmol / l ) or 2-h ogtt glucose 200 mg / dl ( 11.1 mmol / l ) ; a1c 6.5% ( 48 mmol / mol ) was included in sensitivity analyses . our definition of prediabetes110 included the following : ifg110 , which is fasting glucose 110125 mg / dl ( 6.16.9 mmol / l ) and 2-h ogtt glucose < 140 mg / dl ( 7.8 mmol / l ) ; igt , which is fasting glucose < 110 mg / dl and 2-h ogtt glucose 140199 mg / dl ( 7.811.1 mmol / l ) ; and ifg110 with igt ( ifg plus igt ) , which is fasting glucose 110125 mg / dl ( 6.16.9 mmol / l ) and 2-h ogtt glucose 140199 mg / dl ( 7.811.1 mmol / l ) . cost components and base - case cost assessment also are shown in supplementary table 1 . health system costs were costs that would be incurred in a united states health care system with the government - funded medicare program as the primary health insurer . included were direct medical costs associated with testing , direct medical costs of false - negative results , and direct medical costs for treatment of true - positive results ( including cases of prediabetes110 and diabetes ) with generic metformin . two cost scenarios were considered , health system costs of screening and treatment for dysglycemia110 and health system costs for screening and treatment of diabetes only . all cost scenarios were calculated for a 3-year period of time . the direct medical costs of testing included 2007 medicare costs for the laboratory tests , the cost of the glucose challenge test glucose drink , as well as staff costs based on 2007 united states bureau of labor services wages . we assumed that blood draws for gctpl , rpg , and ogtt assessments would be obtained on - site , and that medical staff would measure rcg and gctcap . because we assumed that initial screening would be opportunistic during a visit , the visit time was not included . we used 70% specificity cut - offs to define positive screen results for each test to detect diabetes or dysglycemia110 , using the ogtt data , to determine these cut - offs . for our cost analyses , we assumed that those participants with a positive screen result would have a subsequent confirmatory ogtt with fasting and postchallenge glucose cut - offs for prediabetes110 and diabetes as defined . the cost of a false - positive result for each screen included the cost of the follow - up ogtt test as per protocol . for the base - case analyses undetected prediabetes110 or diabetes as 10% of the projected incremental 3-year medical costs for that condition , assuming that these incremental costs could be decreased by appropriate management , as they were in the diabetes prevention program ( dpp ) ( 8,9 ) . we assumed that the cost of a false - negative result would include the 3-year direct medical cost of diabetes , prediabetes110 , or prediabetes110 that progressed to diabetes . we based the direct medical costs for diabetes on medical expenditure panel survey costs from 2000 to 2004 , which was $ 4,174 per year in 2005 united states dollars for a 50-year - old with new - onset diabetes ( 10 ) . we calculated the costs for prediabetes based on the cost of patients with ifg110 in kaiser permanente northwest who had incremental direct medical costs of $ 1,316 per year ( 11 ) , although igt might incur higher costs ( 12 ) . we based the direct medical costs for a true positive result ( prediabetes110 or diabetes ) on 3-year costs for the dpp metformin group . this group s incremental costs for laboratory tests , physician visits , and follow - up were $ 703 ( 9 ) . we assumed that all true - positive results would be treated with metformin , and we substituted recent pharmacy - based generic costs for metformin 850 mg twice per day . the direct medical cost incurred outside of the study for the dpp metformin versus placebo arms was used as the other component for the health system cost of true - positive results ( 9 ) ; the direct medical cost outside the study was $329 for the metformin versus placebo arms . we analyzed costs for subgroups of our study population based on the presence of the following risk characteristics : age < 40 , age 4055 , and age > 55 years ; bmi < 25 , 2535 , > 35 kg / m ; waist circumference with cut - offs of < 88 cm in men and < 102 cm in women ( low - risk ) or 88 cm in men and 102 cm in women ( high - risk ) ; triglycerides < 150 mg / dl ( 1.695 mmol / l ; low - risk ) or 150 mg / dl ( 1.695 mmol / l ; high - risk ) ; hdl 40 mg / dl ( 1.036 mmol / l ) in men and 50 mg / dl ( 1.295 mmol / l ) in women ( low - risk ) or < 40 mg / dl ( 1.036 mmol / l ) in men and < 50 mg / dl ( 1.295 mmol / l ) in women ( high - risk ) ; presence or absence of a family history of diabetes in first - degree relatives ; and presence or absence of elevated blood pressure , defined as systolic blood pressure < 130 ( low - risk ) or 130 mmhg ( high - risk ) . for each characteristic , we examined the costs when we included a1c results of 6.5% ( 48 mmol / mol ) in the definition of diabetes . we examined the following alternatives for the cost components to determine whether our findings were robust : substituting veterans affairs system costs for testing and treatment with metformin to provide a single - payer perspective ; using lower costs for false - negative results , assuming 5% of projected incremental 3-year medical costs , similar to the outside medical care costs of participants in the dpp ( 8) ; and using costs for treatment with lifestyle modification rather than metformin , assuming group intervention costs and costs for other lifestyle changes as described in the dpp protocol ( 13 ) . societal costs included the additional nonmedical costs of testing , indirect ( lost labor productivity ) costs of false - negative results , and direct nonmedical and indirect costs of true - positive results . indirect costs for false - negative results ( absenteeism , reduced productivity at work and for those who did not work ) were derived from the american diabetes association 2007 economic assessment and were attributed only to those with diabetes or whose prediabetes progressed to diabetes during the 3 years ( 14 ) . costs of screening and treatment were expressed as mean sem for the five types of screens for each risk group . we compared overall high - risk versus low - risk group costs as average costs for the seven higher - risk or highest - risk versus lower - risk or lowest - risk groups . we used nonparametric mann - whitney tests for statistical comparisons of cost variables using sas 9.1.3 ( sas institute , cary nc ) ( 15 ) . diabetes included fasting glucose 126 mg / dl ( 7 mmol / l ) or 2-h ogtt glucose 200 mg / dl ( 11.1 mmol / l ) ; a1c 6.5% ( 48 mmol / mol ) was included in sensitivity analyses . our definition of prediabetes110 included the following : ifg110 , which is fasting glucose 110125 mg / dl ( 6.16.9 mmol / l ) and 2-h ogtt glucose < 140 mg / dl ( 7.8 mmol / l ) ; igt , which is fasting glucose < 110 mg / dl and 2-h ogtt glucose 140199 mg / dl ( 7.811.1 mmol / l ) ; and ifg110 with igt ( ifg plus igt ) , which is fasting glucose 110125 mg / dl ( 6.16.9 mmol / l ) and 2-h ogtt glucose 140199 mg / dl ( 7.811.1 mmol / l ) . cost components and base - case cost assessment also are shown in supplementary table 1 . health system costs were costs that would be incurred in a united states health care system with the government - funded medicare program as the primary health insurer . included were direct medical costs associated with testing , direct medical costs of false - negative results , and direct medical costs for treatment of true - positive results ( including cases of prediabetes110 and diabetes ) with generic metformin . two cost scenarios were considered , health system costs of screening and treatment for dysglycemia110 and health system costs for screening and treatment of diabetes only . the direct medical costs of testing included 2007 medicare costs for the laboratory tests , the cost of the glucose challenge test glucose drink , as well as staff costs based on 2007 united states bureau of labor services wages . we assumed that blood draws for gctpl , rpg , and ogtt assessments would be obtained on - site , and that medical staff would measure rcg and gctcap . because we assumed that initial screening would be opportunistic during a visit , the visit time was not included . we used 70% specificity cut - offs to define positive screen results for each test to detect diabetes or dysglycemia110 , using the ogtt data , to determine these cut - offs . for our cost analyses , we assumed that those participants with a positive screen result would have a subsequent confirmatory ogtt with fasting and postchallenge glucose cut - offs for prediabetes110 and diabetes as defined . the cost of a false - positive result for each screen included the cost of the follow - up ogtt test as per protocol . for the base - case analyses , we evaluated the cost of a false negative result undetected prediabetes110 or diabetes as 10% of the projected incremental 3-year medical costs for that condition , assuming that these incremental costs could be decreased by appropriate management , as they were in the diabetes prevention program ( dpp ) ( 8,9 ) . we assumed that the cost of a false - negative result would include the 3-year direct medical cost of diabetes , prediabetes110 , or prediabetes110 that progressed to diabetes . we based the direct medical costs for diabetes on medical expenditure panel survey costs from 2000 to 2004 , which was $ 4,174 per year in 2005 united states dollars for a 50-year - old with new - onset diabetes ( 10 ) . we calculated the costs for prediabetes based on the cost of patients with ifg110 in kaiser permanente northwest who had incremental direct medical costs of $ 1,316 per year ( 11 ) , although igt might incur higher costs ( 12 ) . we based the direct medical costs for a true positive result ( prediabetes110 or diabetes ) on 3-year costs for the dpp metformin group . this group s incremental costs for laboratory tests , physician visits , and follow - up were $ 703 ( 9 ) . we assumed that all true - positive results would be treated with metformin , and we substituted recent pharmacy - based generic costs for metformin 850 mg twice per day . the direct medical cost incurred outside of the study for the dpp metformin versus placebo arms was used as the other component for the health system cost of true - positive results ( 9 ) ; the direct medical cost outside the study was $329 for the metformin versus placebo arms . we analyzed costs for subgroups of our study population based on the presence of the following risk characteristics : age < 40 , age 4055 , and age > 55 years ; bmi < 25 , 2535 , > 35 kg / m ; waist circumference with cut - offs of < 88 cm in men and < 102 cm in women ( low - risk ) or 88 cm in men and 102 cm in women ( high - risk ) ; triglycerides < 150 mg / dl ( 1.695 mmol / l ; low - risk ) or 150 mg / dl ( 1.695 mmol / l ; high - risk ) ; hdl 40 mg / dl ( 1.036 mmol / l ) in men and 50 mg / dl ( 1.295 mmol / l ) in women ( low - risk ) or < 40 mg / dl ( 1.036 mmol / l ) in men and < 50 mg / dl ( 1.295 mmol / l ) in women ( high - risk ) ; presence or absence of a family history of diabetes in first - degree relatives ; and presence or absence of elevated blood pressure , defined as systolic blood pressure < 130 ( low - risk ) or 130 mmhg ( high - risk ) . for each characteristic , we examined the costs when we included a1c results of 6.5% ( 48 mmol / mol ) in the definition of diabetes . we examined the following alternatives for the cost components to determine whether our findings were robust : substituting veterans affairs system costs for testing and treatment with metformin to provide a single - payer perspective ; using lower costs for false - negative results , assuming 5% of projected incremental 3-year medical costs , similar to the outside medical care costs of participants in the dpp ( 8) ; and using costs for treatment with lifestyle modification rather than metformin , assuming group intervention costs and costs for other lifestyle changes as described in the dpp protocol ( 13 ) . societal costs included the additional nonmedical costs of testing , indirect ( lost labor productivity ) costs of false - negative results , and direct nonmedical and indirect costs of true - positive results . indirect costs for false - negative results ( absenteeism , reduced productivity at work and for those who did not work ) were derived from the american diabetes association 2007 economic assessment and were attributed only to those with diabetes or whose prediabetes progressed to diabetes during the 3 years ( 14 ) . costs of screening and treatment were expressed as mean sem for the five types of screens for each risk group . we compared overall high - risk versus low - risk group costs as average costs for the seven higher - risk or highest - risk versus lower - risk or lowest - risk groups . we used nonparametric mann - whitney tests for statistical comparisons of cost variables using sas 9.1.3 ( sas institute , cary nc ) ( 15 ) . baseline characteristics of participants have been reported previously and are shown in table 1 ; 366 ( 23% ) had dysglycemia110 and 72 ( 5% ) had diabetes . more than 75% of participants were 45 years of age or older or had bmi 25 kg / m . however , only 12% had a triglyceride level 150 mg / dl ( 1.695 mmol / l ) , 26% had systolic blood pressure 130 mmhg , and 46% had a family history of diabetes . the higher - risk groups were more likely to have diabetes or dysglycemia110 ; the latter was present in 35% of participants with age > 55 years , bmi > 35 kg / m , or systolic blood pressure 130 mmhg compared with 1019% in the corresponding lower - risk groups . baseline characteristics of 1,573 participants from the sigt study the health system cost components and overall assessment for screening ( and 3 years of treatment ) for dysglycemia110 are shown in supplementary table 1 . these health system costs and the differences in health system costs for screening versus no screening are shown by risk group for each screening test in table 2 and fig . 1 ; in these analyses , negative cost differences for screening versus no screening indicate projected net cost - savings . the relative cost - savings of screening versus no screening would be greater ( more negative ) for the higher - risk groups for every risk group assessed ( p < 0.01 for each higher - risk or highest - risk versus lower - risk or lowest - risk group ) , with average cost - savings of 19% for the highest bmi and 18% for the elevated blood pressure groups ( both p < 0.01 compared with lowest - risk and lower - risk groups ) . among the different tests , screening of the higher - risk groups was generally least expensive when gctpl was used for screening , with cost - savings of 21% for the highest bmi and elevated blood pressure groups . screening lower - risk groups would result in less cost - savings , or a net increase in costs , and in those groups rpg or rcg tended to be the least expensive tests . health system costs for screening and treatment of dysglycemia110 of 1,573 participants by risk group and percent cost difference for screening and treatment compared with no screening * the average percent cost differences between health system costs for screening and treatment of dysglycemia110 by risk group compared with no screening . shown are the average percent differences in cost for screening with the five different screens and management of dysglycemia110 compared with no screening for different risk groups . the 95% cis are depicted by the upper or lower lines or both . for each risk group , the prevalence of dysglycemia110 is shown along the top of the chart , and the costs of no screening per person are shown along the bottom of the chart . the prevalence of dysglycemia110 and the cost of no screening per person increased with higher - risk characteristics among the risk groups . sbp , systolic blood pressure ; tg , triglycerides ; fam hx , family history . the health system costs for screening ( and treatment ) for diabetes are shown in table 3 , with the differences in costs for screening versus no screening in table 3 and supplementary fig . 1 . for all of these groups , screening would produce cost - savings compared with no screening , and cost - savings with targeting of diabetes would be greater than with dysglycemia110 ( for all subjects , cost - savings of 26 vs. 9% ; p < 0.01 ) . as with dysglycemia110 , cost - savings resulting from screening for diabetes would be greater with higher - risk and highest - risk groups compared with lower - risk and lowest - risk groups ( 34 vs. 12% , over all groups ; p < 0.01 ) ; screening those with elevated blood pressure , the highest bmi , and the oldest age groups would provide the greatest cost - savings ( 39 , 38 , and 36% , respectively ; all p < 0.01 versus the relevant lowest - risk group ) . gctpl testing would provide the lowest costs for the higher - risk groups , with cost - savings of up to 46% for those with elevated blood pressure , and rcg or rpg would provide the lowest costs with the lowest - risk groups . health system costs for screening and treatment of diabetes of 1,573 participants by risk group and percent cost difference for screening and treatment compared with no screening * the impact of screening on overall costs depends on the prevalence of the disease in the population , the cost of undetected disease ( false - negative results ) , the cost of screening , and characteristics of different screening tests . with our study population and base - case assumptions , cost - savings for screening with gctpl versus rcg would be achieved in screening for diabetes when the prevalence in the population is 4% and for dysglycemia110 when the prevalence is 20% ( supplementary fig . is shown in supplementary table 2 and is illustrated for screening with gctpl versus rcg in supplementary fig . greater cost - savings are achieved with gctpl , a more accurate but more expensive test , either when cost of undetected disease is high or when prevalence of disease is high , and especially when both are high . testing costs per true - positive result also decrease as prevalence of the disease in the population increases . in screening for dysglycemia110 , average testing costs for the five screens for those with bmi < 25 kg / m would be $ 203 40 per true - positive result compared with $ 64 7 for those with bmi > 35 kg / m ( p < 0.01 ) . in screening for diabetes , average testing costs per true - positive result would be $ 836 156 for those with bmi < 25 kg / m compared with $ 185 17 for those with bmi > 35 kg / m ( p < 0.01 ) . when we included a1c 6.5% ( 48 mmol / mol ) in our definition of diabetes , we identified 10 additional participants with diabetes in this cohort ; however , the total number of participants with dysglycemia110 did not change . screening the higher - risk groups for diabetes continued to be significantly more cost - saving compared with no screening and compared with screening the equivalent low - risk group . for example , screening with gctpl for those with an elevated blood pressure versus those without an elevated blood pressure resulted in cost - savings of 37.5 versus 2.5% , respectively ( p < 0.01 ) , both compared with no screening . for both higher - risk and lower - risk groups , screening for dysglycemia110 or diabetes from a veterans affairs perspective would result in greater cost - savings compared with medicare - based costs ( supplementary tables 4 and 5 ) if false - negative result costs were only 5% of projected incremental medical costs over 3 years , then health system costs would be cost - neutral for screening for diabetes compared with no screening for some but not all of the higher - risk groups ( supplementary table 6 ) , but screening and treatment of dysglycemia110 would not produce cost - savings for any group ( not shown ) . the health system costs with a lifestyle change intervention would be similar to costs with generic metformin , with cost - savings particularly for higher - risk groups ( supplementary tables 7 , 8) . from a societal perspective , screening ( and treatment with metformin ) for dysglycemia110 ( supplementary table 9 ) would result in cost - savings compared with no screening only in the highest - risk groups with substantial prevalence of disease , particularly for those with bmi > 35 kg / m or elevated blood pressure , with 11% savings compared with no screening . in contrast , societal costs for screening and treatment of diabetes ( supplementary table 10 ) would produce broader cost - savings in both high - risk and lower - risk groups . when we included a1c 6.5% ( 48 mmol / mol ) in our definition of diabetes , we identified 10 additional participants with diabetes in this cohort ; however , the total number of participants with dysglycemia110 did not change . screening the higher - risk groups for diabetes continued to be significantly more cost - saving compared with no screening and compared with screening the equivalent low - risk group . for example , screening with gctpl for those with an elevated blood pressure versus those without an elevated blood pressure resulted in cost - savings of 37.5 versus 2.5% , respectively ( p < 0.01 ) , both compared with no screening . for both higher - risk and lower - risk groups , screening for dysglycemia110 or diabetes from a veterans affairs perspective would result in greater cost - savings compared with medicare - based costs ( supplementary tables 4 and 5 ) if false - negative result costs were only 5% of projected incremental medical costs over 3 years , then health system costs would be cost - neutral for screening for diabetes compared with no screening for some but not all of the higher - risk groups ( supplementary table 6 ) , but screening and treatment of dysglycemia110 would not produce cost - savings for any group ( not shown ) . the health system costs with a lifestyle change intervention would be similar to costs with generic metformin , with cost - savings particularly for higher - risk groups ( supplementary tables 7 , 8) . from a societal perspective , screening ( and treatment with metformin ) for dysglycemia110 ( supplementary table 9 ) would result in cost - savings compared with no screening only in the highest - risk groups with substantial prevalence of disease , particularly for those with bmi > 35 kg / m or elevated blood pressure , with 11% savings compared with no screening . in contrast , societal costs for screening and treatment of diabetes ( supplementary table 10 ) would produce broader cost - savings in both high - risk and lower - risk groups . our previous analyses demonstrated that screening the sigt study population for either diabetes or dysglycemia110 would be cost - saving from a health system perspective over a 3-year horizon ( 4 ) . we now show that the majority of cost - savings would come from screening individuals with higher risk , based on any one of the characteristics of age , bmi , triglycerides , hdl cholesterol , waist circumference , systolic blood pressure , or family history of diabetes . in most of the higher - risk groups , however , the greatest cost - savings would be attained with screening of individuals with bmi > 35 kg / m or systolic blood pressure 130 mmhg . of the five screening tests considered , the gctpl appears to be the least expensive screening test in most higher - risk groups . higher - risk groups would have higher costs associated with no screening . because these groups have a higher prevalence of diabetes and dysglycemia110 , failure to screen would result in more patients with missed diagnoses , with associated increases in downstream treatment costs . and as the costs of no screening increase , greater cost - savings can be obtained with a more accurate test , i.e. , gctpl compared with rcg ( supplementary fig . one review concluded that it would be very cost - effective to screen for diabetes using current american diabetes association guidelines among african americans 4554 years of age ( 16 ) . another study examined screening with fasting plasma glucose on the basis of age or blood pressure or both and found that it would be more cost - effective to screen at 3045 years of age than at older age , and even more cost - effective to screen beginning at 30 years of age in people with hypertension ( 2 ) . two other studies found that targeted screening for diabetes with fasting or rcg based on hypertension , and for prediabetes based on obesity , would be more cost - effective compared with universal screening ( 17,18 ) , but those studies also did not consider other risk factors or other screening tests . whether screening should target prediabetes as well as diabetes also has been debated . most analyses have found that it should be cost - effective to screen for and treat prediabetes to reduce both the risk of cardiovascular disease and progression to diabetes ( 1820 ) . our study confirms that even over a 3-year time period , it should be cost - saving to screen for and treat dysglycemia110 ( prediabetes110 as well as diabetes ) , particularly among higher - risk groups . the study participants were volunteers , which might have resulted in selection bias from disproportionate participation of those at high risk . however , the prevalence of prediabetes and diabetes in the study population was similar to or lower than that in recent national surveys , such as nhanes 20052006 ( 21 ) . although we did gather information regarding risk of diabetes , information on history of gestational diabetes was not collected or used as a risk factor in our analyses . we also did not calculate costs associated with screening for either dysglycemia110 or diabetes with a fasting glucose alone . whereas a fasting glucose may be considered an acceptable test for patients who do not mind fasting before a visit , many cases of postchallenge dysglycemia would be missed , leading to a higher number of false - negative results and higher overall costs . our analyses rely on estimates of testing , treatment , and false - negative result costs , which may not be applicable to every health system . our estimates for the cost of false - negative results ( that 10% of projected incremental 3-year medical costs of diabetes or dysglycemia110 could be reduced with detection and management ) might be excessive . however , we project that cost - savings still could be achieved in higher - risk groups with a false - negative result cost of at least 5% , which was achieved in the tightly controlled environment of the dpp study ( 8) . some groups have found the cost of undiagnosed diabetes and prediabetes to be lower than the costs we used in our analyses , but it is still to be determined how much of these costs could be reduced with detection and management ( 22,23 ) . we are not aware of other sources for the costs of false - negative results . in sensitivity analyses addressing costs associated with lifestyle changes as treatment for dysglycemia110 or diabetes , we based our costs on group - based interventions designed by the dpp study . more recent studies have found that community - based interventions based on the dpp protocol could be performed with reduced costs . these studies generally have found that treatment with lifestyle interventions are cost - effective in the long - term ( 2426 ) and possibly even are cost - saving in the short - term ( 26 ) . finally , our cost estimates projected a 3-year time period . such a period might be relevant to employer - based health systems in which insurers are changed every few years , but lifetime cost analyses would be needed to determine if the cost - savings found in higher - risk groups are likely to be sustained . our findings show that screening and treatment for diabetes and dysglycemia110 should be cost - saving from a health system perspective in people with any single risk factor for these conditions . this likely is a large proportion of the united states adult population , because at least one such risk factor was present in 98% of our study subjects and in 96% of adult african american and white participants in nhanes 20052006 . we also found that the greatest cost - savings likely would be attained with screening of individuals with bmi > 35 kg / m , systolic blood pressure 130 mmhg , or age > 55 years . the gctpl , previously shown to have the greatest accuracy for detection of diabetes or dysglycemia110 , appears to be the least expensive screening test in most higher - risk groups and should be considered for use in clinical practice .	objectivealthough screening for diabetes and prediabetes is recommended , it is not clear how best or whom to screen . we therefore compared the economics of screening according to baseline risk.research design and methodsfive screening tests were performed in 1,573 adults without known diabetes random plasma / capillary glucose , plasma / capillary glucose 1 h after 50-g oral glucose ( any time , without previous fast , plasma glucose 1 h after a 50-g oral glucose challenge [ gctpl]/capillary glucose 1 h after a 50-g oral glucose challenge [ gctcap ] ) , and a1c and a definitive 75-g oral glucose tolerance test . costs of screening included the following : costs of testing ( screen plus oral glucose tolerance test , if screen is positive ) ; costs for false - negative results ; and costs of treatment of true - positive results with metformin , all over the course of 3 years . we compared costs for no screening , screening everyone for diabetes or high - risk prediabetes , and screening those with risk factors based on age , bmi , blood pressure , waist circumference , lipids , or family history of diabetes.resultscompared with no screening , cost - savings would be obtained largely from screening those at higher risk , including those with bmi > 35 kg / m2 , systolic blood pressure 130 mmhg , or age > 55 years , with differences of up to 46% of health system costs for screening for diabetes and 21% for screening for dysglycemia110 , respectively ( all p < 0.01 ) . gctpl would be the least expensive screening test for most high - risk groups for this population over the course of 3 years.conclusionsfrom a health economics perspective , screening for diabetes and high - risk prediabetes should target patients at higher risk , particularly those with bmi > 35 kg / m2 , systolic blood pressure 130 mmhg , or age > 55 years , for whom screening can be most cost - saving . gctpl is generally the least expensive test in high - risk groups and should be considered for routine use as an opportunistic screen in these groups .
You are an expert at summarizing long articles. Proceed to summarize the following text: epidemiological evidence suggests that drugs which counteract inflammation might have efficacy for the prevention and treatment of alzheimer s disease , but up to now clinical trials have failed to show any clear - cut benefits for nonsteroidal anti - inflammatory drugs ( nsaids ) , hydroxychloroquine , anti - leprosy agents or prednisone ( endoh et al 1999 ; aisen et al 2000 ; van gool et al 2001 ; adapt et al 2007 ) . in the case of prednisone , however , it may be that much higher doses might be effective where lower doses were not . in the largest clinical trial to date , patients were given prednisone starting at 20 mg per day for one month , followed by one year at 10 mg daily and then tapering off over another 4 months ( aisen et al 2000 ) . by contrast , in a series of 16 nondemented patients aged 25 to 82 who were given prednisolone 3060 mg per day for at least month for treatment of various conditions , there was significant reduction in cerebrospinal fluid amyloid beta peptides in 15 out of 16 patients , up to about a 50% decline for patients receiving 50 and 60 mg of prednisolone ( tokuda et al 2002 ) . if amyloid is indeed a cause of alzheimer s disease ( hardy 2006 ) , the above data suggests high dose steroids could suppress alzheimer s disease by reducing amyloid . along the same lines , there is a report of a patient where two single doses of dexamethasone 4 mg completely suppressed amyloid angiopathy , reversed white matter changes on brain imaging , and restored cognitive function ( harkness et al 2004 ) . in that patient , 8 mg of dexamethasone would correspond to 80 mg of prednisone , or four times the starting dose of prednisone used in the alzheimer s disease clinical trial but given in a single dose . if the above line of reasoning is on the right track , it is important to note that high dose corticosteroids are already used clinically for treatment of primary systemic amyloidosis , in amounts orders of magnitude greater than those used in the alzheimer s disease trial . for example , in one recently published study of a regimen combining dexamethasone and interferon , patients were given several days of dexamethasone in an amount of 40 mg per day , which would be equivalent to 400 mg of prednisone daily ( dhodapkar et al 2004 ) . even if amyloid is only a marker , not a cause , for alzheimer s disease ( lee 2006 ) , high - dose corticosteroids could have beneficial effects by reducing inflammatory cytokines , which have been strongly linked to alzheimer s disease pathogenesis ( town and nikolic 2005 ; cagnin et al 2006 ; galimberti et al 2006 ; mcgeer et al 2006 ; rota et al 2006 ) . finally , there is a case report of a 64-year - old man with multiple myeloma who had a temporary remission of alzheimer s disease while receiving chemotherapy with vincristine , carmustine , melphalan , cyclophosphamide , and prednisone ( keimowitz 1997 ) . obviously megadose steroids or cytotoxic chemotherapy as a treatment for alzheimer s disease would be hard to justify , but if one can knock down amyloid production , inflammation or both with corticosteroids alone , there should be at least some therapeutic effects . the key is delivering high enough doses of corticosteroids to have efficacy without devastating or killing patients with steroid - induced side effects in the process . building on several case reports of patients with central nervous system lupus erythematosus and multiple sclerosis who responded to intrathecal prednisolone , dexamethasone , or triamcinalone after failing oral and intravenous steroids ( funauchi et al 2003 ; hellwig et al 2004 , 2006 ) , this paper proposes that a similar therapeutic strategy could be pursued for patients with alzheimer s disease . studies in rhesus monkeys and pigs indicate that that intrathecal steroids maximize biodistribution within the brain and minimize it within the rest of the body ( marynick et al 1976 ; koszdin et al 2000 ) . a short pulse of high dose intrathecal methylprednisolone , dexamethasone or triamcinalone will result in detectable slowing of alzheimer s disease as assessed by neuropsychological testing , cerebrospinal fluid studies and functional brain imaging . it is further predicted that this route of administration will minimize the risk of steroid - induced side effects , which include diabetes , cataracts , glaucoma , poor wound healing , myopathy , increased susceptibility to infection , osteoporosis and altered fat distribution , based on the premise that the bioavailability of steroids would be almost exclusively within the central nervous system . steroid - induced dementia that remits once steroids are stopped has been described in case reports ( varney 1997 ; sacks and shulman 2005 ) , but memantine , a noncompetitive antagonist of n - methyl - d - aspartate glutamate receptors , should reduce or eliminate this risk . memantine , which acts by protecting against excitoxic neuronal cell death , is already a mainstay of treatment for alzheimer s disease , with disease modifying activity that is maximized when given alongside cholinesterase inhibitors ( tariot et al 2004 ) . corticosteroids down - regulate glutamate transporter protein in microglia ( jacobsson et al 2006 ) , which in turn increases excitoxicity , so memantine which blocks glutamate excitotoxicty would seem to be ideal for preventing this problem . these agents improve learning and memory by increasing synaptic levels of acetylcholine , and cholinesterase inhibitors produce symptomatic improvement not only for alzheimer s disease but vascular , multiple sclerosis , parkinsonian , and lewy body dementias and delirium . they in essence boost cognitive reserve to cope with cognitive impairment no matter what the etiology , which would presumably include the minority of patients who have cognitive impairment specifically from steroids . thus , by doing all pulse dose steroid regimens alongside both cholinesterase inhibitors and memantine , it is predicted that there will be no worsening of dementia but rather additive effects on top of the benefits of cholinesterase inhibitors and memantine have on their own . a protocol is outlined here based on regimens described for central nervous system lupus and multiple sclerosis , to be used as a starting point for designing future clinical trials . investigators should follow all recommended guidelines for research involving human subjects , such as institutional review board approval and informed consent . after obtaining a baseline positron emission tomography ( pet ) scan and neuropsychological tests , patients with early alzheimer s disease already taking a cholinesterase inhibitor and memantine would be given six intrathecal injections of 10 mg of dexamethasone , 100 mg of prednisolone , or 40 mg triamcinalone . intrathecal injections can be done in the office with a bedside spinal tap or under fluoroscopic guidance , if desired . patients should be followed for at least one year in the initial study , repeating pet scans , cerebrospinal fluid studies , and neuropsychological testing at the end of the study . pet scanning has emerged as an important modality for studying alzheimer s disease and its response to treatment ( alexander et al 2002 ) . alongside functional brain imaging , cerebrospinal fluid should be assayed for amyloid peptide and other alzheimer s disease biomarkers , such as neural thread protein ( chong et al 1992 ; mrak and griffin 2005 ) . it would be predicted that levels of these biomarkers should fall over time , if steroids indeed have efficacy for halting dementia progression . studies should focus on patients with the earliest signs of cognitive impairment so that they can be followed for longer periods of time . also , there may be a window of opportunity for use of steroids only earlier in the disease process . many of the inflammatory cytokines peak with mild cognitive impairment and early alzheimer s disease and are actually declining by the late stages ( galimberti et al 2006 ) . validation of the proposed hypothesis could be an important step towards the ultimate aim of curing alzheimer s disease . pulse dosed intrathecal corticosteroids might become part of a future multi - agent regimen for halting alzheimer s disease progression , along - side cholinesterase inhibitors , memantine , and other drugs currently under investigation . given that activated microglia are thought to play a role in the pathogenesis of other neurodegnerative diseases such as parkinson s disease , amyotrophic lateral sclerosis and hiv dementia ( wojtera et al 2005 ) , success of intrathecal corticosteroids for alzheimer s disease would encourage trials for these other disorders . for all these reasons , i am presenting this idea here for maximum exposure to the widest possible interested audience .	anti - inflammatory drugs for treatment and prevention of alzheimer s disease have to date proved disappointing , including a large study of low - dose prednisone , but higher dose steroids significantly reduced amyloid secretion in a small series of nondemented patients . in addition , there is a case report of a patient with amyloid angiopathy who had complete remission from two doses of dexamethasone , and very high dose steroids are already used for systemic amyloidosis . this paper presents the hypothesis that pulse - dosed intrathecal methylprednisolone or dexamethasone will produce detectable slowing of alzheimer s progression , additive to that obtained with cholinesterase inhibitors and memantine . a protocol based on treatment regimens for multiple sclerosis and central nervous system lupus is outlined , to serve as a basis for formulating clinical trials . ultimately intrathecal corticosteroids might become part of a multi - agent regimen for alzheimer s disease and also have application for other neurodegenerative disorders .
You are an expert at summarizing long articles. Proceed to summarize the following text: scleromyxedema is a rare chronic cutaneous fibromucinous disorder of unknown etiology , commonly associated with monoclonal gammopathy , usually immunoglobulin g with lambda light chains.1 dubreuilh first described this in 1906.2 this was further defined by rongioletti and rebora in 2001 as characterized by generalized papular and sclerodermoid eruption , mucin deposition , fibroblast proliferation and fibrosis , monoclonal gammopathy , and the absence of thyroid disorder.3 the patient provided written informed consent for the publication of this paper and accompanying images . we report a case of a 56-year - old man who was referred by his general practitioner for assessment and investigations of dyspnea and bilateral lower limb swelling . soon after , he developed lower limb swelling and painful lesions consistent but not diagnostic of erythema nodosum . he did not report any fever , night sweats , weight loss , or altered bowel habit . initially , his condition was attributed to an immunological reaction to a tooth abscess with likely streptococcal bacteremia causing the systemic skin eruptions . the course of antibiotics settled the tooth infection but his dyspnea and lower limb edema worsened with associated skin tethering . his past medical history was of benign heart murmurs diagnosed at the age of 2 . he did not smoke but admitted to previous heavy alcohol intake , but currently limited to one beer per day . there were a few 25 mm lesions with the appearance of lichenoid papules , which were tender over his abdomen and lower limbs . closer inspection of his skin showed that the skin was thickened in a linear distribution with the papules being skin - colored with scattered hyperpigmentation ( figure 1 ) . mg / l ( < 5 ) with a normal erythrocyte sedimentation rate of 12 mm / h . echocardiogram revealed a moderately dilated left ventricle with global impairment of systolic function with an estimated ejection fraction of 20% . there was a small to moderate pericardial effusion but no echo evidence of pericardial tamponade or constriction . computed tomography of chest / abdomen / pelvis showed significant mediastinal lymphadenopathy with mildly enlarged abdominal and inguinal lymph nodes . magnetic resonance imaging of pelvis and legs showed widespread lower abdominal trunk , pelvic girdle , and bilateral lower limb subcutaneous edema with prominence of the dermal thickness ( figure 2 ) . there was associated patchy tethering with increased t2 signal of the quadriceps , hamstring , and adductor muscle groups . the patient was started on diuretics with frusemide 40 mg bid , and spironolactone 25 mg daily , and carvedilol 3.125 mg daily for heart failure and fluid restricted to 1.5 l / day . his heart failure improved with this treatment and he lost 9 kg of weight during the hospital admission in the first 5 days there was an increase in fibroblastic cells and interstitial connective tissue mucin in the dermis associated with perivascular lymphocytic infiltrate . there was thickening of the dermal collagen bundles with loss of adipose tissues around the eccrine glands ( figure 3a d ) . the earlier findings were compatible with scleromyxedema.4 after the skin biopsy , he was encouraged to massage his skin regularly with sorbolene and vitamin e cream to improve vascular and lymphatic flow . he subsequently lost another 8 kg in 8 weeks and went back to his normal average weight . his creatinine remained normal at 67 mol / l and his estimated glomerular filtration rate ( egfr ) was > 90 ml / min/1.73 m . frusemide was reduced to 40 mg / day but he remained on the same dose of spironolactone and carvedilol . four weeks later , he became asymptomatic from congestive cardiac failure with no dyspnea , ascites , or peripheral edema . he developed two further episodes of a linear nontender papular mucinous rash in both his upper and lower limbs over the next 6 months with no flare of heart failure . the computed tomography scan of his chest and abdomen showed a significant improvement of his fluid retention . the ascites and mediastinal lymphadenopathy had resolved and the pericardial effusion had significantly reduced . clinically , his lower limb skin was less tethered ( figure 4 ) . repeat echocardiogram revealed a mildly dilated left ventricle with an overall mild impairment of systolic function with an estimated ejection fraction of 45% . there were a few 25 mm lesions with the appearance of lichenoid papules , which were tender over his abdomen and lower limbs . closer inspection of his skin showed that the skin was thickened in a linear distribution with the papules being skin - colored with scattered hyperpigmentation ( figure 1 ) . mg / l ( < 5 ) with a normal erythrocyte sedimentation rate of 12 mm / h . echocardiogram revealed a moderately dilated left ventricle with global impairment of systolic function with an estimated ejection fraction of 20% . there was a small to moderate pericardial effusion but no echo evidence of pericardial tamponade or constriction . computed tomography of chest / abdomen / pelvis showed significant mediastinal lymphadenopathy with mildly enlarged abdominal and inguinal lymph nodes . magnetic resonance imaging of pelvis and legs showed widespread lower abdominal trunk , pelvic girdle , and bilateral lower limb subcutaneous edema with prominence of the dermal thickness ( figure 2 ) . there was associated patchy tethering with increased t2 signal of the quadriceps , hamstring , and adductor muscle groups . the patient was started on diuretics with frusemide 40 mg bid , and spironolactone 25 mg daily , and carvedilol 3.125 mg daily for heart failure and fluid restricted to 1.5 l / day . his heart failure improved with this treatment and he lost 9 kg of weight during the hospital admission in the first 5 days . there was an increase in fibroblastic cells and interstitial connective tissue mucin in the dermis associated with perivascular lymphocytic infiltrate . there was thickening of the dermal collagen bundles with loss of adipose tissues around the eccrine glands ( figure 3a d ) . the earlier findings were compatible with scleromyxedema.4 after the skin biopsy , he was encouraged to massage his skin regularly with sorbolene and vitamin e cream to improve vascular and lymphatic flow . he subsequently lost another 8 kg in 8 weeks and went back to his normal average weight . his creatinine remained normal at 67 mol / l and his estimated glomerular filtration rate ( egfr ) was > 90 ml / min/1.73 m . frusemide was reduced to 40 mg / day but he remained on the same dose of spironolactone and carvedilol . four weeks later , he became asymptomatic from congestive cardiac failure with no dyspnea , ascites , or peripheral edema . he developed two further episodes of a linear nontender papular mucinous rash in both his upper and lower limbs over the next 6 months with no flare of heart failure . the computed tomography scan of his chest and abdomen showed a significant improvement of his fluid retention . the ascites and mediastinal lymphadenopathy had resolved and the pericardial effusion had significantly reduced . clinically , his lower limb skin was less tethered ( figure 4 ) . repeat echocardiogram revealed a mildly dilated left ventricle with an overall mild impairment of systolic function with an estimated ejection fraction of 45% . scleromyxedema has been further subclassified by rongioletti in 2006 into three categories : generalized form , localized form , including papular and nodular types , and atypical forms , which included scleromyxedema without monoclonal gammopathy.1 the skin eruption is commonly described as papular mucinosis or waxy papules with a predilection for sun exposed areas . the firm papules can converge into indurated plaques , causing marked sclerosis , skin induration , and decreased joint mobility in the generalized form of scleromyxedema . the mucous membranes and scalp are usually spared as was the situation with this patient . extra - cutaneous manifestations include neurological , gastrointestinal , respiratory , cardiovascular , rheumatological , renal , and hematological complications.3 in localized form , sclerotic features , systemic involvement , and monoclonal gammopathy are absent . our patient has an atypical form of scleromyxedema with cutaneous and cardiac involvement with prominent mediastinal lymphadenopathy . absence of paraproteinaemia has been described.3 a literature search of cutaneous manifestations of scleromyxedema showed that some patients exhibited red brown discoloration of the involved skin.5 scleromyxedema with cardiac involvement , for instance congestive cardiomyopathy , myocardial infarction , and inflammatory cardiomyopathy , has been previously reported.5 a cardiac biopsy could have confirmed myocardial involvement in this patient . this was considered too invasive but would have been performed if he had not responded adequately to cardiac failure treatment . as he is being monitored , this may be considered in future if his cardiac failure becomes refractory . in the absence of other causes of heart failure , normal troponins , and the relatively low b type natriuretic peptide , mucin deposition in the myocardium and heart vessels was noted in autopsy findings.6 enlarged mediastinal lymphadenopathy was uncommon and was observed in a patient associated with monoclonal gammopathy.7 as our patient clinically improved with heart failure treatment , we opted to monitor him rather than commence the patient on immunological treatment for scleromyxedema . suggested treatments include systemic steroids,5 plasmapheresis,8 interferon alpha,9 stem cell transplantation,10 intravenous immunoglobulin,11 thalidomide,12 bortezomib,5,12 and chemotherapy.12 however , the side effects limit the use of many options . studies show dramatic results with intravenous immunoglobulin as primary therapy11 but the effect may be short lasting as predicted from its mechanism of action . , the course of his disease has been favorable so far with spontaneous regression of skin changes . in conclusion , scleromyxedema is rare and can be chronic and progressive with high morbidity and mortality . the diversity of scleromyxedema clinical presentations means that clinicians should be aware of this possible diagnosis .	scleromyxedema is part of a group of cutaneous mucinoses , characterized by a generalized papular eruption , dermal mucin deposition , and an increase in dermal collagen . this condition can be localized as discrete papular lichen myxedematous skin or as a systemic condition usually associated with paraproteinaemia . to date , there is no unifying treatment and is limited by rarity , small number of case reports , and the lack of randomized controlled trials . we describe the case of a 56-year - old gentleman with features of scleromyxedema who had cutaneous and cardiac involvement , and significant mediastinal lymphadenopathy without monoclonal gammopathy .
You are an expert at summarizing long articles. Proceed to summarize the following text: the increasing prevalence of peripheral artery disease has expanded the use of endovascular therapy with nitinol stent implantation for femoropopliteal lesions during recent years.1,2 this is reflected in international guidelines such as the tasc ii3 document for endovascular therapy and the european society of cardiology4 recommendations , which underline the benefits of nitinol stents as treatment options in intermediate femoropopliteal lesions . one of the major advantages of endovascular stent placement over balloon angioplasty is the prevention of elastic recoil of the dilated vessel , the limitation of residual stenosis , and the lower risk of vessel dissection . first - generation nitinol stents had the drawback of stent fractures with high rates of restenosis . modern - generation nitinol stents for the treatment of femoropopliteal lesions have shown encouraging 12-month patency rates ( resilient trial,5 misago i6 and misago ii7 trials , supera sfa registry,8 zilver ptx trial,9 durability i,10 and durability ii11 trials ) and long - term freedom from restenosis rates in different prospective trials . there is also increasing evidence for interventions with modern nitinol stents in long femoropopliteal lesions ( tasc c and d lesions according to the tasc ii classification ) with encouraging patency and safety rates ( durability 200 trial,12 tasc d an intensive discussion regarding stent design is ongoing , where one of the central questions being addressed is whether the 4-french stent systems are equivalent to 6-french systems when treating complex and long femoropopliteal lesions . the use of the pulsar-18 self - expanding ( se ) nitinol stent for endovascular intervention of femoropopliteal disease was investigated in the peace i all - comers registry.14 patients with a mean lesion length of 111.5 mm showed promising primary patency and freedom from target lesion revascularization ( ftlr ) rates after 6 and 12 months . these very positive data of this all - comers registry led us to perform a prospective all - comers registry to analyze the patency rate and ftlr rate of this nitinol stent in patients with long sfa lesions . a two - center prospective registry study independent of the already published peace i registry trial14 was developed to evaluate the patency and ftlr rate of the pulsar-18 se nitinol stent in patients with long sfa occlusions > 20 cm ( tasc d lesions ) . the study was approved by the ethics committee of the aerztekammer westfalen - lippe , and was conducted in accordance with the principles of the declaration of helsinki . the nitinol stent used in this registry was the nitinol pulsar-18 self - expanding stent ( biotronik ag , buelach , switzerland ) , which is premounted on a 4-f , 0.018-inch over - the - wire delivery system . the pulsar-18 is a laser - cut , se nitinol stent loaded on a low - profile 4f compatible over - the - wire coaxial delivery system . the stent has a flexible , thin - strut , open - cell design with helically aligned peak - to - valley crowns and has six radiopaque markers at each end . it is completely covered with probio coating , an amorphous silicon carbide ( a - sic : h ) coating . revascularization of the occluded sfa was performed using either the subintimal recanalization technique or in the intraluminal way . after passing the guidewire into the true lumen in both recanalization techniques , a predilatation was performed using a correctly sized balloon to prepare for the pulsar-18 se stent implantation . post implantation of the pulsar-18 se stent , all patients received at least clopidogrel and aspirin in combination for 4 weeks . the recanalization of the femoropopliteal culprit lesion was based on the standard of care of the center . only the implantation of the pulsar-18 se stent strictly followed the manufacturer s instructions for use . stent overlapping was avoided whenever possible by using the appropriate stent length to cover the entire lesion with a single pulsar-18 se stent . as the pulsar-18 se is available in lengths of up to 200 mm , only lesions longer than 200 mm required overlapping stents . a successfully deployed stent was defined as a completely unfolded stent with a postimplantation residual stenosis of < 30% . at least one patent crural outflow vessel and a noncompromised hemodynamic inflow had to be documented in the angiography to assess the patient s eligibility for this registry . if indicated , an intervention of the inflow and outflow vessel was allowed prior to femoropopliteal implantation of the pulsar-18 se stent . patients were enrolled in this registry if they met the following inclusion criteria : signed informed consent, patient age 18 years, symptomatic de novo occlusion of the superficial femoral or popliteal artery ( rutherford 2 and 5 ) with occlusion length > 15 cm , and reference vessel diameter 47 mm . signed informed consent , patient age 18 years , symptomatic de novo occlusion of the superficial femoral or popliteal artery ( rutherford 2 and 5 ) with occlusion length there was no restriction on lesion length or the maximum number of pulsar-18 se implantations . exclusion criteria were the following : pregnancy or breast - feeding, contraindication for postinterventional antiplatelet therapy, treatment of a restenosis within a previously treated vessel segment, target lesion located within a ( synthetic ) graft , and use of a drug - eluting balloon ( deb ) or drug - eluting stent ( des ) pregnancy or breast - feeding , contraindication for postinterventional antiplatelet therapy , treatment of a restenosis within a previously treated vessel segment , target lesion located within a ( synthetic ) graft , and use of a drug - eluting balloon ( deb ) or drug - eluting stent ( des ) examinations and follow - up were performed at baseline and at 6 and 12 months according to a standard protocol . for the baseline , standard physical examination , blood sampling , assessment of walking capacity , ankle brachial index ( abi ) measurement , and duplex ultrasound examination were performed . after performing a diagnostic angiography , the patient was included in the registry if the decision was made to implant a pulsar-18 se stent . duplex ultrasound with peak systolic measurement , abi and walking capacity assessment , and rutherford categorization were required postprocedure and also for follow - up at 6 and 12 months . the primary endpoints of the peace i registry were the primary patency of the pulsar-18 se stent at 6 and 12 months after the intervention , defined as a binary duplex ultrasound ratio ( peak systolic velocity ratio ) < 2.5 at the stented target lesion(s ) , and ftlr . secondary endpoints included determination of the rutherford scale , measurement of the resting abi , and assessment of the walking capacity at 6 and 12 months . this registry enrolled 36 patients at two clinical centers in 2011 and 2012 , who were followed up after enrollment for 12 months . the patient cohort showed a high prevalence of cardiovascular risk factors , with hypertension in all patients and diabetes mellitus in eight patients ( 22.2% ) . more than two - thirds of the patients showed a clinical rutherford stage 3 ( rutherford 3 : 52.8% , rutherford 4 : 13.9% , and rutherford 5 : 16.6% ) . the primary endpoints of this registry were the primary patency of the pulsar-18 se stent at 6 and 12 months after the intervention , defined as a binary duplex ultrasound ratio ( peak systolic velocity ratio ) < 2.5 at the stented target lesion(s ) and ftlr . secondary endpoints included determination of the rutherford scale , measurement of the resting abi , and assessment of the walking capacity at 6 and 12 months . safety endpoints were death from any cause and limb amputation . using spss statistical analysis package , continuous data are presented as the mean standard deviation ; categorical data are given as percentages ( counts / sample ) . an unpaired t - test or chi - square test was used to compare continuous variables or proportions between groups , respectively ; statistical significance was set at p < 0.05 . primary patency and ftlr were estimated using the kaplan meier method and compared using the log - rank test . this registry enrolled 36 patients at two clinical centers in 2011 and 2012 , who were followed up after enrollment for 12 months . the patient cohort showed a high prevalence of cardiovascular risk factors , with hypertension in all patients and diabetes mellitus in eight patients ( 22.2% ) . more than two - thirds of the patients showed a clinical rutherford stage 3 ( rutherford 3 : 52.8% , rutherford 4 : 13.9% , and rutherford 5 : 16.6% ) . the primary endpoints of this registry were the primary patency of the pulsar-18 se stent at 6 and 12 months after the intervention , defined as a binary duplex ultrasound ratio ( peak systolic velocity ratio ) < 2.5 at the stented target lesion(s ) and ftlr . secondary endpoints included determination of the rutherford scale , measurement of the resting abi , and assessment of the walking capacity at 6 and 12 months . using spss statistical analysis package , continuous data are presented as the mean standard deviation ; categorical data are given as percentages ( counts / sample ) . an unpaired t - test or chi - square test was used to compare continuous variables or proportions between groups , respectively ; statistical significance was set at p < 0.05 . primary patency and ftlr were estimated using the kaplan meier method and compared using the log - rank test . between january 2012 and june 2012 , a total of 36 patients with tasc d femoropopliteal lesions were successfully treated . in these patients , a total of 48 pulsar-18 se implants were implanted , giving a mean implantation rate in this cohort of 1.33 pulsar-18 se stents per patient ( table 3 ) . overall primary patency after 6 months was 87.5% ; after 12 months , it was 85.4% ( fig . primary patency was assessed separately for diabetic and renal insufficiency patients , showing no significant differences in comparison to the overall primary stent patency rate . there was a trend toward higher restenosis rates after 12 months in overlapping stent implantation ( table 1 ) . the abi improved significantly after intervention , with an abi of 0.60 0.10 before the intervention and 0.92 0.05 afterward ( p < 0.0001 ) ; the abi remained stable after 6 months ( 0.87 0.11 ; p < 0.0001 ) and 12 months ( 0.88 0.08 ; p < 0.0001 ) . in addition , the pain - free walking capacity improved significantly to 594.1 339.5 m ( p < 0.0001 ) after 6 months and 654.2 419.1 m ( p < 0.0001 ) after 12 months in comparison to the preinterventional walking capacity of 56.1 34.9 m. likewise , the clinical rutherford category improved significantly during follow - up ( figs . 4 and 5 ) . between patients with rutherford <3 and > 3 category , the aim of our registry was to obtain information on the patency of the 4-french stent system in a daily routine setting in long ( tasc d ) femoropopliteal lesions . this daily routine registry demonstrated a primary patency rate of 85.4% and ftlr of 87.5% in patients with long sfa occlusion during a follow - up period of 12 months after recanalization and nitinol stent implantation with the pulsar-18 se stent . possible reasons for these encouraging data even in complex lesions in patients with diabetes and renal insufficiency could be partly explained by the thin - strut geometry of the 4-french system , which may reduce inflammatory vessel reaction after implantation another potential factor is the probio coating , which reduces platelet activation and aggregation and promotes faster endothelialization . recently published data of the peace i14 and the 4-ever15 trial support our positive outcome data . the peace i trial was designed to assess more clinical performance data in an all - comers registry with almost no exclusion criteria besides the use of drug - eluting devices . the average lesion length of the femoropopliteal segment was 111.5 71.4 mm with a primary patency rate after 6 and 12 months of 87.4% and 79.5% , respectively . the clinically driven overall ftlr was 93.2% after 6 months and 81% after 12 months . in the 4-ever15 trial recently published by bosiers et al , a primary patency rate of 81.4% was observed excluding femoropopliteal tasc d lesion . a clear reduction in access site complications using the 4-french pulsar-18 stent was documented in this trial , along with a reduced mean manual compression time of 8.1 minutes in comparison to compression times of 1022 minutes with 6-french stent systems . our study group recently published the superficial femoral tasc d trial,13 in which we showed that femoropopliteal lesions of up to 315 mm in patients with critical limb ischemia could be safely treated with the pulsar-18 se stent , with a primary patency rate of 77% and an ftlr rate of 86% after 12 months . until now , endovascular treatment recommendations for patients with long sfa occlusion did not reach evidence level in international guidelines ( tasc ii guidelines ) . on the other hand , recently published interventional registries and studies for different nitinol stent systems showed encouraging patency rates after reopening of sfa occlusions.512 these trials did not focus on tasc d lesions in particular . tasc d lesions were only subgroups in a broad range of indications . the durability ii11 clinical trial , presented recently , reported a proven stent patency rate of 69.6% in lesions longer than 80 mm with a 12-month stent fracture rate of 0.4% . this study , together with the durability i10 trial , clearly demonstrated that accurate stent implantation is imperative for avoiding stent fracture and subsequent associated restenosis . overlapping stents are at risk for a higher fracture rate , which means that long nitinol stents should be preferred over short , multiple , overlapping stents . the durability 200 mm trial12 demonstrated a significant 12% decrease of the primary patency rate after implantation of more than two stents . this could be considered as supporting data to avoid overlapping stents and to use long stents , which are available today up to length of 200 mm , whenever possible . although we did not analyze the fracture rate of the pulsar-18 se stent in our registry , we did not identify any stent fractures in those patients who had target lesion revascularizations . regarding the potential lower radial force of a 4-f nintinol stent compared to a 6-f stent system especially in calcified lesions , there seems to be no disadvantages , which was proven in the 4 ever15 trial as there was no significant lower patency rate in calcified lesions . lesion preparation ( eg , atherectomy , cutting balloon angioplasty , prolonged balloon angioplasty ) was mentioned as a key issue in calcified lesion to prepare a lesion for a 4-f , thin - strut nitinol stent . in our registry , after successful implantation , the stents were postdilated to nominal diameter even with high - pressure balloons . to determine if a combination of deb plus nitinol stent could even increase patency rates , we recently initiated a mulicenter prospective all - comers study , the bioflex - peace study . we aim to find answer for the following questions : whether spot - stenting plus drug - eluting angioplasty with or without prior atherectomy in calcified lesions can enhance clinical outcomes in this trial . the limitation of this registry is the two - center design and the small number of patients , which does not allow significant subgroup analysis . this all - comers registry for long femoropopliteal lesions with a mean lesion length of 182.3 mm proved a safe usage of the pulsar-18 se stent in this indication .	purposeto evaluate the patency and the freedom of target lesion revascularization of the 4-french pulsar-18 self - expandable ( se ) nitinol stent for the treatment of long femoropopliteal occlusive disease in a two - center , prospective , all - comers registry with a follow - up period of 12 months.methodsthis registry enrolled 36 patients with symptomatic femoropopliteal long lesions for recanalization and implantation of the 4-french pulsar-18 se nitinol stent . routine follow - up examination including duplex ultrasound was performed after 6 and 12 months . primary patency was defined as no binary restenosis on duplex ultrasound ( peak systolic velocitiy ration ( psvr ) < 2.5 ) and no target lesion revascularization was performed within 12 months follow - up . no drug - eluting devices were allowed in this registry.resultsaverage lesion length of the femoropopliteal segment was 182.3 51.8 mm . mean stent implantation length was 181.5 35.4 mm . total occlusion was present in 46 of the 48 ( 95.8% ) treated lesions . involvement of popliteal segment i iii was present in 3 ( 6.3% ) lesions . the primary patency after 6 and 12 months was 87.5% and 85.4% , respectively . the clinically driven overall freedom from target lesion revascularization ( ftlr ) was 89.6% after 6 months and 87.5% after 12 months . abi , pain - free walking distance and rutherford category , all improved significantly ( p < 0.001 ) after 6 and 12 months . the primary patency rate in patients with diabetes ( p = 0.18 ) and renal insufficiency ( p = 0.3 ) was not significantly lower as compared to the overall primary patency.conclusionsin this two - center , all - comers registry , the use of the pulsar-18 se nitinol stent for endovascular intervention of femoropopliteal disease with a mean lesion length of 182.3 51.8 mm showed promising primary patency and ftlr rates after 6 and 12 months . diabetes and renal insufficiency had no negative impact on the patency rate .
You are an expert at summarizing long articles. Proceed to summarize the following text: the concept and operational guidelines of village health and nutrition day ( vhnd ) was conceptualized by national rural health mission ( nrhm ) with support from maternal health division of government of india and united national population fund ( unfpa ) , india to address some of these issues . guidelines developed by government of india plans on providing an integrated service delivery of both reproductive and child health ( rch ) services and immunization on a fixed day in a month , i.e. wednesday . in the state of odisha , the guidelines were modified in 2009 and adopted as mamata diwas , in which mamta diwas was planned to he held on a fixed day not included with fixed immunization day ( fid ) , and health and nutrition services to the mother and children would form a priority in it . mamata diwas provides the first point of contact for essential primary health care and is a common platform for convergence among service providers of health and integrated child development scheme ( icds ) along with the community at large . within the purview of the program , the target beneficiaries are pregnant women , lactating mothers , children below 5 years and adolescent girls , through presently there are minor changes made to the guidelines in odisha . basic components of reproductive and child health services , including early antenatal registration , de - worming , counseling on early breastfeeding , identification and timely referral of high - risk cases of children and pregnant women , as well as antenatal and postnatal care are to be provided at community level in order to address the essential requirements of pregnancy , delivery , referral , childhood illnesses and adolescent health . vhnd is organized once in a month in every village at an anganwadi centre ( awc ) on a fixed day basis ( either tuesday or friday ) with joint efforts of health worker female ( hwf ) , anganwadi worker ( aww ) and accredited social health activist ( asha ) . on an average , a health sub - center ( hsc ) has 68 awcs and an equal number of vhnd sessions in a month ( now slightly more ) . the objectives of mamata diwas are to provide essential and comprehensive health and nutrition services to pregnant women , lactating mothers , children ( 05 years ) and adolescent girls ; early registration , identification and referral of high - risk children and pregnant women ; providing an effective platform for interaction of service providers and the community ( through gaon kalyan samiti or the mothers group ) ; providing information to families on care of mothers and children at the household and community level through discussion of various health topics ( as envisaged in the health calendar ) ; and establishment of linkage between health and icds so as to promote maternal and child survival programs . children identified with severe degree of malnutrition in each vhnd session are referred and treated at the pustikar diwas held at the block level health center accompanied by asha or aww . during a preliminary visit to a vhnd session , it was observed that the service providers were not aware of the guidelines and regarding the nature of various services to be delivered at vhnd . involving a lot of resources without having proper knowledge and awareness of workers and community at large would not yield expected results . hence , this study was planned with an objective to study the awareness , perception and practice ( app ) of service providers and beneficiaries regarding various aspects of vhnd . a cross - sectional study was designed to be carried out in jagatsinghpur district for a period of 1 year ( december 2009november 2010 ) for the evaluation of vhnd services . the study was mostly quantitative , with some qualitative aspects . since there have been no documented studies regarding awareness on vhnd in india , an awareness level of 40% regarding vhnd sessions held was selected with confidence limits of 10% that gives a sample size of 92 at 95% confidence levels . multistage stratified random sampling design was adopted and stratification was done based on the prevalence of severely malnourished children [ table 1 ] in each block . all vhnd sessions ( total of 426 ) held in the district were listed and included in the sampling frame . random sampling without replacement ( to avoid duplication of hsc area ) was used to identify 5% ( i.e. , 23 ) of the hscs where the study was planned . app study was planned though interviews with at least five beneficiaries , a hwf and an aww at each session site . this sample size was selected as it is considered adequate and feasible for evaluating health programs . pre - tested and pre - designed semi - structured interview schedules , differing for the service providers and beneficiaries , were used to assess the awareness , perception and practice . stratification of the blocks according to the distribution of severe malnutrition vhnd sessions were visited on tuesdays and fridays of the week and only one vhnd was evaluated in a single visit . beneficiaries were randomly selected from the sessions . written consent , in local language , was taken from the beneficiaries and service providers . interview with at least five beneficiaries in each vhnd session and one each with hwf and aww was done in these sessions . awareness , perception and practice of service providers and beneficiaries were assessed in these interviews . similarly , knowledge regarding their roles and responsibilities for the sessions was also assessed from individual service provider . awareness regarding the reasons for referral was also assessed during the process . the response from all the beneficiaries and service providers the data collected was cleaned and entered into microsoft ( ms ) access database 2007 . sub - group analysis was also done to find out if there was difference in awareness between the blocks . any answer close to an objective or purpose of vhnd was considered as having awareness regarding the same . awareness , perception and practice of service providers and beneficiaries were assessed at 5% of the sessions [ table 2 ] . a total of 23 interviews with the hwf and 22 with aww ( one was on leave ) of the sessions were done [ table 3 ] at the 23 sessions visited [ table 4 ] . similarly , 111 interviews were conducted among all the beneficiaries , including 11 with referral cases [ table 3 ] . number of vhnd sessions for evaluation ( sample size for the whole study ) number of interviews done to assess awareness , perception and practice of stake holders vhnd sessions visited in different blocks for assessment of functioning the service providers were assessed with respect to knowledge on the purpose and objectives of the vhnd ( refer table 5 for the five objectives of vhnd ) . more than 80% of the service providers [ table 5 ] were having awareness that the major purpose of the vhnd sessions was to create health awareness followed by more than 85% who cited comprehensive health and nutrition services . promotion of maternal and child health programs through linkage between health and icds , was being ignored by all the awws ( 100% not aware ) and by 65% of the hwfs . high - risk case identification as an objective could be recollected by only 50% of them [ figure 1 ] . all the service providers present at the session sites did not have complete knowledge about all their roles and responsibilities . knowledge of service providers regarding objectives / purpose of vhnd awareness of service providers regarding various objectives of vhnd my job during health day includes informing the beneficiaries , arranging the session site , weighing children [ an aww ] . during health day , we give health message and do pregnancy check up [ a hwf ] . in the morning when we come to the session , we ask the asha to call everyone [ a hwf and an aww ] . i have been told by health authorities to conduct between 8 am and 1 pm , but in this area the sarpanch requested me to conduct after 2 pm . 24.30 pm is the convenient time where mothers have finished their activities and mothers working in paddy fields also return home . hence , i conduct after 2 pm [ a hwf ] . on analyzing the awareness of service providers regarding the purpose of the vhnd sessions , it was found that service providers from a block ( block 1 ) were having significantly less knowledge on providing integrated health and nutrition services as a purpose , in comparison to other blocks [ table 6 ] . when the awws and hwfs knowledge were compared with respect to all the purposes , establishing linkage between health and icds to promote maternal and child survival programs was seen as a priority for hwfs as compared to awws [ table 5 ] . awarenes , perception and practice regarding objectives of vhnd among service providers : block wise analysis^ almost one third of the beneficiaries ( 38 beneficiaries or 34.2% ) had visited vhnd session for the first time [ table 7 ] . a total of 57 ( 51.4% ) beneficiaries were aware that vhnd is held every month in their area . awareness of the beneficiaries with regards to day , week and place of the program in their area was compared with that provided by the hwf ( and not with the vhnd micro plan ) . knowledge regarding the place and time where vhnd session was held was present in 71 ( 63.9% ) and 85 ( 76.6% ) respectively of the 111 beneficiaries interviewed . but only 57 respondents ( i.e. , 51.4% ) of the 111 interviewed were having knowledge regarding the day when vhnd was held ( i.e. , they could say that vhnd was held on tuesday / friday ) . of these , 19 beneficiaries ( 17% ) were not having knowledge about the exact day ( i.e. , 1 week/2 week etc . ) . hence , only 38 beneficiaries ( 34.3% ) interviewed were having correct knowledge regarding the fixed day on which sessions were held in their area . but 17% of the beneficiaries revealed that the sessions being conducted at an inconvenient time . key information from respondents about vhnd services ( n=111 ) when they were questioned regarding purpose of these sessions , the beneficiaries said that delivering health messages , followed by weighing for children and pregnant women was the main purpose for conducting vhnd session . large proportions ( 24% ) were not aware why the sessions are conducted . similarly , around 50% of the beneficiaries did not know if the vhnd sessions were held regularly . almost one fourth of them ( 24% ) were not having any knowledge regarding any of the purpose of vhnd . the beneficiaries who were at least aware that health meeting is done or some health message is being given at the sessions was 59 of the 111 responses ( 53.2% ) ( not shown in the table ) . weighing children ( 53 of 111 , i.e. , 47.7% ) and weighing pregnant woman ( 49 of 111 or 44.1% ) were the other most common answers . referral services availed by the beneficiaries within the last 3 months , were also assessed [ table 8 ] . referral services had been availed by 13 beneficiaries ( 12% ) , out of which only one had correct and complete knowledge regarding the cause for referral . awareness about the referral services ( n=13 ) about 81% of the beneficiaries were in favor that the vhnd program should continue with expectations to get additional services from the government . a meager 6% of the sessions had community participation with beneficiaries volunteering to organize the session . a few beneficiaries ( 2% ) , however , did not find vhnd sessions useful for them , probably as they were not aware regarding the services . no i do not know why the hwf told me to visit medical , i am not aware of the reason for referral [ a mother ] . we do not know when the meeting ( vhnd ) is held , whenever we are called we came to attend [ a pregnant woman ] . no one informs us day before the session , we are called in the morning [ a mother ] . we were told that some officer has come to visit , so came to the anganwadi center [ a mother ] . now we know that vhnd is held on friday in our village , which friday we do not know . [ a mother ] . we are not able to attend the session as we have to go to work , time is inconvenient [ a mother working as daily laborer and a mother working as a reaper in paddy fields ] . interesting thing to note was that awareness of beneficiaries belonging to block 3 regarding session site , day and time of the sessions was significantly less [ table 9 ] . added to these were few other practices with almost significant difference like beneficiaries not being mobilized by any one and beneficiaries attending the session for the first time in this same block . the service providers were assessed with respect to knowledge on the purpose and objectives of the vhnd ( refer table 5 for the five objectives of vhnd ) . more than 80% of the service providers [ table 5 ] were having awareness that the major purpose of the vhnd sessions was to create health awareness followed by more than 85% who cited comprehensive health and nutrition services . promotion of maternal and child health programs through linkage between health and icds , was being ignored by all the awws ( 100% not aware ) and by 65% of the hwfs . high - risk case identification as an objective could be recollected by only 50% of them [ figure 1 ] . all the service providers present at the session sites did not have complete knowledge about all their roles and responsibilities . knowledge of service providers regarding objectives / purpose of vhnd awareness of service providers regarding various objectives of vhnd my job during health day includes informing the beneficiaries , arranging the session site , weighing children [ an aww ] . during health day , we give health message and do pregnancy check up [ a hwf ] . in the morning when we come to the session , we ask the asha to call everyone [ a hwf and an aww ] . i have been told by health authorities to conduct between 8 am and 1 pm , but in this area the sarpanch requested me to conduct after 2 pm . 24.30 pm is the convenient time where mothers have finished their activities and mothers working in paddy fields also return home . hence , i conduct after 2 pm [ a hwf ] . on analyzing the awareness of service providers regarding the purpose of the vhnd sessions , it was found that service providers from a block ( block 1 ) were having significantly less knowledge on providing integrated health and nutrition services as a purpose , in comparison to other blocks [ table 6 ] . when the awws and hwfs knowledge were compared with respect to all the purposes , establishing linkage between health and icds to promote maternal and child survival programs was seen as a priority for hwfs as compared to awws [ table 5 ] . awarenes , perception and practice regarding objectives of vhnd among service providers : block wise analysis^ almost one third of the beneficiaries ( 38 beneficiaries or 34.2% ) had visited vhnd session for the first time [ table 7 ] . a total of 57 ( 51.4% ) beneficiaries were aware that vhnd is held every month in their area . awareness of the beneficiaries with regards to day , week and place of the program in their area was compared with that provided by the hwf ( and not with the vhnd micro plan ) . knowledge regarding the place and time where vhnd session was held was present in 71 ( 63.9% ) and 85 ( 76.6% ) respectively of the 111 beneficiaries interviewed . but only 57 respondents ( i.e. , 51.4% ) of the 111 interviewed were having knowledge regarding the day when vhnd was held ( i.e. , they could say that vhnd was held on tuesday / friday ) . of these , 19 beneficiaries ( 17% ) were not having knowledge about the exact day ( i.e. , 1 week/2 week etc . ) . hence , only 38 beneficiaries ( 34.3% ) interviewed were having correct knowledge regarding the fixed day on which sessions were held in their area . but 17% of the beneficiaries revealed that the sessions being conducted at an inconvenient time . key information from respondents about vhnd services ( n=111 ) when they were questioned regarding purpose of these sessions , the beneficiaries said that delivering health messages , followed by weighing for children and pregnant women was the main purpose for conducting vhnd session . large proportions ( 24% ) were not aware why the sessions are conducted . similarly , around 50% of the beneficiaries did not know if the vhnd sessions were held regularly . almost one fourth of them ( 24% ) were not having any knowledge regarding any of the purpose of vhnd . the beneficiaries who were at least aware that health meeting is done or some health message is being given at the sessions was 59 of the 111 responses ( 53.2% ) ( not shown in the table ) . weighing children ( 53 of 111 , i.e. , 47.7% ) and weighing pregnant woman ( 49 of 111 or 44.1% ) were the other most common answers . referral services availed by the beneficiaries within the last 3 months , were also assessed [ table 8 ] . referral services had been availed by 13 beneficiaries ( 12% ) , out of which only one had correct and complete knowledge regarding the cause for referral . the rest ( 92% ) had incomplete or incorrect knowledge . awareness about the referral services ( n=13 ) about 81% of the beneficiaries were in favor that the vhnd program should continue with expectations to get additional services from the government . a meager 6% of the sessions had community participation with beneficiaries volunteering to organize the session . a few beneficiaries ( 2% ) , however , did not find vhnd sessions useful for them , probably as they were not aware regarding the services . no i do not know why the hwf told me to visit medical , i am not aware of the reason for referral [ a mother ] . we do not know when the meeting ( vhnd ) is held , whenever we are called we came to attend [ a pregnant woman ] . no one informs us day before the session , we are called in the morning [ a mother ] . we were told that some officer has come to visit , so came to the anganwadi center now we know that vhnd is held on friday in our village , which friday we do not know . we are not able to attend the session as we have to go to work , time is inconvenient [ a mother working as daily laborer and a mother working as a reaper in paddy fields ] . interesting thing to note was that awareness of beneficiaries belonging to block 3 regarding session site , day and time of the sessions was significantly less [ table 9 ] . added to these were few other practices with almost significant difference like beneficiaries not being mobilized by any one and beneficiaries attending the session for the first time in this same block . awareness among the service providers about any program is a mandate to deliver quality services . awareness among beneficiaries is similarly highly essential as it ensures service utilization and health care - seeking behavior . there are no documented studies , at present , which evaluate the awareness , perception and practices of service providers and beneficiaries with regard to vhnd in india . as it was observed , most of the service providers considered creating health awareness among beneficiaries and providing comprehensive health and nutrition services as the major purpose of vhnd sessions . other important objectives like convergence between health and icds , even , were not stressed upon . hence , proper orientation activities were needed for the service providers from the hfw and wcd department . role clarity and delineation were not observed among the services providers and need to be improved . it was observed that training status of service providers was significantly poor in one of the blocks as compared to others ( block 2 , see table 10 ) . but the pattern of awareness , perception and practice found in this block was certainly not related to the training component . some other components like mobilization by asha , awareness generation by service providers in the area , etc . , rather may have been related to the results . training status of service providers in the blocks the centre of excellence ( coe ) has been established in the state under the banner of state institute of health and family welfare to plan and implement communication activities related to national health programs . hence , coe should take the lead role in creating awareness among the community members . sihfw exists in all states , under the banner of national institute of health and family welfare , which can take leadership to create awareness . swasthya kantha or health wall also need to be used for dissemination of upcoming events in the village . community participation was very less and involvement of panchayat raj institution ( pri ) members should be promoted . a referral was done without proper counseling on the reason for referral in many cases . some beneficiaries also insisted on conducting vhnd session taking into consideration their time convenience , especially where there were people depending on daily wages for livelihood . hence , vhnd planning should also involve community needs assessment which is actually practically neglected . it was interestingly observed that a health worker took deviation to benefit the beneficiaries by changing the time schedule of the sessions . this is a good practice to note , where pri members acted as facilitators in bestowing services . the evaluation of awareness and perception too might have been done too early in the stage of implementation and need to be revisited as on today for a better picture . village health and nutrition day ( vhnd ) session was found to be an important platform for rch service delivery . but awareness among various components of services among service providers and beneficiaries was not found up to the mark . important purposes of vhnd like integration of health with icds , high - risk case identification , etc . one third of the beneficiaries reported to have been mobilized to the sessions for the first time and were not a part of the sessions regularly which was a thing of concern . almost a quarter were also not aware of the purpose of such a gathering on vhnd , while almost half of them did not know if the vhnd sessions were held regularly . reasons , in case of referral , had not been clearly explained to the beneficiaries . there was significant difference in the level of awareness among service providers and beneficiaries with respect to certain components like few important objectives of vhnd and , schedule and place of conducting vhnd , respectively . in spite of all these , most of the beneficiaries believed that this setup should continue included with a stronger package and quality of services since people were definitely benefited by the sessions . hence , capacity building and orientation of service providers must be done along with that of pri members .	background : village health and nutrition day ( vhnd ) is a community - based health service package delivered on a fixed day approach . services like early registration of pregnancy , regular antenatal care and postnatal care , growth monitoring and referral of sick children , discussion of health topics to generate awareness , and convergence between health and icds , are delivered every month at vhnd at the anganwadi center . this study explores the awareness , perception and practice of service providers , and beneficiaries , regarding vhnd.materials and methods : it was a cross - sectional study conducted in odisha during december 2009november 2010 . personal interviews were conducted at the vhnd sessions with 111 beneficiaries and 45 service providers using a semi - structured schedule to know their awareness , perception and practice regarding vhnd sessions . data analysis was done and reported as simple percentages.results:most of the health worker females and anganwadi workers considered health awareness as a key component of vhnd . 52% of hwfs and 41% of awws had misconception about additional roles and responsibilities . 34% of beneficiaries had knowledge regarding fixed day approach of vhnd , while 24% did not have knowledge regarding any of its purpose . only 8% of referral cases had complete knowledge on the reason of referral . there was significant difference in between awareness and practice among the blocks.conclusion:service providers orientation should be improved . behavior change communication activities should also be increased by the state . referral cases should be properly counseled . the community believed that such a program should continue with better package and quality of services .
You are an expert at summarizing long articles. Proceed to summarize the following text: head and neck squamous cell carcinoma ( hnscc ) is one of the most common cancers with more than 4,00,000 new cases and 2,00,000 deaths worldwide annually . oral squamous cell carcinoma ( oscc ) , as a subgroup of hnscc and the most common oral cancer , is estimated to be the eighth most common cancer in human population . despite recent advances in treatment and early diagnosis of oscc , although several histologic and clinical criteria have been proposed to evaluate the prognosis of oscc , the most important prognostic factor is still clinical stage of the tumor . also recently , there is much interest in novel molecular markers for predicting patient prognosis and estimating of overall survival rate . cd24 is a heavily glycosylated mucin - like surface protein which has been proposed as a specific ligand for p - selectin . although in breast cancer , ambiguity exists about the role and expression pattern of cd24 , as a cancer stem cell ( csc ) associated marker , several studies have shown that cd24 is highly expressed in some human malignancies and its higher level of expression might enhance the metastatic potential of tumor cells and lead to a poor prognosis . cd44 is a transmembrane glycoprotein that forms a member of cell adhesion molecules and provides its crucial roles , including cell proliferation , migration and survival . cd44 is the first marker used to introduce csc theory , which describes a small population of tumor cells , as cancer - initiating cells , demonstrate stem cell properties and they are responsible for progression in some malignant tumors . therefore , many recent studies propose this marker in both cscs detection and molecular cancer therapy . also a combined evaluation of cd24/cd44 immunohistochemical expression has been proposed in some recent studies to estimate the presence of cscs in a tumor and predict the prognosis of patients . cd74 is a transmembrane glycoprotein that associates with the major histocompatibility complex ( mhc ) class ii and plays many important roles in the immune system . cd74 expression has been found on hla class ii - positive normal cells including b cells , macrophages and dendritic cells . also , in some hematologic and non - hematologic malignancies , including gastric and renal cell carcinomas , cd74 is expressed . furthermore , recent studies have suggested that cd74 can be used as a prognostic factor and eventually a potential therapeutic target in cd74 + malignancies . during recent years , many investigations have focused on the novel methods for treatment of oscc to increase the efficacy of therapeutic procedures and reduce the consequent morbidity . the aim of this study was the evaluation of immunohistochemical expression of three suggested prognostic markers ( cd24 , cd44 , cd74 ) and also potentially introduced molecular target for cancer therapy in oscc and analyze their correlations with several clinicopathological factors . in this analytical cross - sectional study , forty primary oscc patients , consisting of 17 specimens from tongue and 23 specimens from other sites of the oral cavity ( 7 labial mucosa , 5 floor of the mouth , 4 gingiva or edentulous ridge , 3 hard palate , 3 buccal mucosa and 1 soft palate ) with no prior chemo - radiotherapy were included in this study . the mean age of the patients , consisting of 20 males ( ranging from 26 to 79 with a mean age of 50.5 ) and 20 females ( ranging from 28 to 80 with a mean age of 60.5 ) was 55 . tissue specimens of the patients were provided from archival 10% formalin - fixed paraffin blocks of the pathology laboratory of cancer institute ( tehran university of medical sciences ) between 2007 and 2011 and the tumors were histopathologically graded by two independent pathologists using bryne 's grading system ( 16 grade i , 13 grade ii , 11 grade iii ) . in controversial cases , the lesions were graded by the third pathologist to confirm one of the previous viewpoints . this study was approved by the ethical committee of babol university of medical sciences ( 30/5720 ) . anti - cd24 ( mouse monoclonal , clone sn3b , bio care medical llc , ca , usa ) , anti - cd44 ( mouse monoclonal , clone vff-327 v3 , leica bio systems ltd , newcastle , uk ) and anti - cd74 ( mouse monoclonal , clone ln2 , sky tek laboratories inc . , ut , usa ) were applied to deparaffinized and hydrated 4 m thick tissue sections . prior to antibody application , endogenous peroxidase activity was blocked using 5% ( v / v ) h2o2 in methanol . slides were then washed with tris - buffered saline and heated for 15 min at 100c in 10 mm sodium citrate buffer ( ph 6.0 ) and boiled in a microwave oven ( 700 w ) for antigen retrieval . also , nonspecific binding was blocked by incubation of slides with 1% bovine serum albumin for 1 h. it was followed by application of secondary streptavidin - biotin - peroxidase complex method and then primary antibody was visualized with diaminobenzidine . finally , they were counter - stained with mayer 's hematoxylin and mounted with dpx mountant . negative control samples were processed in parallel to test samples by replacing the primary antibody with phosphate buffer saline . as a positive control , we used colorectal carcinoma , lymph node and normal tonsil for cd24 , cd74 and cd44 , respectively ( based on the manufacturer 's instructions ) . for immunohistochemical analysis , membranous staining for cd44 and cytoplasmic and/or membranous staining for cd24/cd74 were blindly and independently evaluated by two observers using a semi - quantitative system [ table 1 ] . expression index was determined based on the mean percentage of stained neoplastic cells in 10 representative fields . the system used for evaluation of the markers ( mean percentage of stained neoplastic cells in 10 representative fields ) data were analyzed using spss v16.0 ( spss inc . , mann - whitney nonparametric test was conducted to determine the differences between the antibody expressions . in this analytical cross - sectional study , forty primary oscc patients , consisting of 17 specimens from tongue and 23 specimens from other sites of the oral cavity ( 7 labial mucosa , 5 floor of the mouth , 4 gingiva or edentulous ridge , 3 hard palate , 3 buccal mucosa and 1 soft palate ) with no prior chemo - radiotherapy were included in this study . the mean age of the patients , consisting of 20 males ( ranging from 26 to 79 with a mean age of 50.5 ) and 20 females ( ranging from 28 to 80 with a mean age of 60.5 ) was 55 . tissue specimens of the patients were provided from archival 10% formalin - fixed paraffin blocks of the pathology laboratory of cancer institute ( tehran university of medical sciences ) between 2007 and 2011 and the tumors were histopathologically graded by two independent pathologists using bryne 's grading system ( 16 grade i , 13 grade ii , 11 grade iii ) . in controversial cases , the lesions were graded by the third pathologist to confirm one of the previous viewpoints . this study was approved by the ethical committee of babol university of medical sciences ( 30/5720 ) . anti - cd24 ( mouse monoclonal , clone sn3b , bio care medical llc , ca , usa ) , anti - cd44 ( mouse monoclonal , clone vff-327 v3 , leica bio systems ltd , newcastle , uk ) and anti - cd74 ( mouse monoclonal , clone ln2 , sky tek laboratories inc . , ut , usa ) were applied to deparaffinized and hydrated 4 m thick tissue sections . prior to antibody application , endogenous peroxidase activity was blocked using 5% ( v / v ) h2o2 in methanol . slides were then washed with tris - buffered saline and heated for 15 min at 100c in 10 mm sodium citrate buffer ( ph 6.0 ) and boiled in a microwave oven ( 700 w ) for antigen retrieval . also , nonspecific binding was blocked by incubation of slides with 1% bovine serum albumin for 1 h. it was followed by application of secondary streptavidin - biotin - peroxidase complex method and then primary antibody was visualized with diaminobenzidine . finally , they were counter - stained with mayer 's hematoxylin and mounted with dpx mountant . negative control samples were processed in parallel to test samples by replacing the primary antibody with phosphate buffer saline . as a positive control , we used colorectal carcinoma , lymph node and normal tonsil for cd24 , cd74 and cd44 , respectively ( based on the manufacturer 's instructions ) . for immunohistochemical analysis , membranous staining for cd44 and cytoplasmic and/or membranous staining for cd24/cd74 were blindly and independently evaluated by two observers using a semi - quantitative system [ table 1 ] . expression index was determined based on the mean percentage of stained neoplastic cells in 10 representative fields . the system used for evaluation of the markers ( mean percentage of stained neoplastic cells in 10 representative fields ) data were analyzed using spss v16.0 ( spss inc . , chicago , il , usa ) . mann - whitney nonparametric test was conducted to determine the differences between the antibody expressions . as shown in table 2 , the cd44 and cd74 proteins were significantly over - expressed in oscc patients with high grade ( grade iii ) ( p = 0.001 and p = 0.001 ) [ figures 1 and 2 ] as compared to those with low grade ( grade i ) . also , cd44 immunoreactivity showed significantly higher expression in patients with lower age ( < 50 years ) ( p = 0.039 ) . considering lymph node metastasis , we observed significant overexpression of cd74 in oscc patients with no lymph node involvement ( p = 0.033 ) . correlation of cd24 , cd44 and cd74 expression with clinicopathological variables in oscc high immunohistochemical reactivity for cd44 ( score iv ) in oral squamous cell carcinoma ( grade ii ) ; ( a ) original magnification 100 ; ( b ) original magnification 400 high immunohistochemical reactivity for cd74 ( score iii ) in oral squamous cell carcinoma ( grade ii ) ; ( a ) original magnification 100 ; ( b ) original magnification 400 furthermore , cd24 expression [ figure 3 ] revealed no significant association with the mentioned clinicopathologic criteria [ table 2 ] . low immunohistochemical reactivity for cd24 ( score ii ) in oral squamous cell carcinoma ( grade i ) ; ( a ) original magnification 100 ; ( b ) original magnification 400 we found a significant association between immunohistochemical expression of cd44 and cd74 and several clinicopathological criteria in oscc specimens . over recent years this preference is mainly derived from the cancer cell resistance to routine chemotherapeutic agents in many malignancies and also the substantial morbidity of patients suffering from the side - effects and complications related to conventional cancer treatments . considering oral cancer therapy , several other advantages of this modality of treatment have been described as little accumulation of the agents , rare bone marrow suppression , etc . due to several aberrant signaling pathways introduced in the pathogenesis of oscc , the combination of various molecular targeted agents is highly recommended to attain the maximum effectiveness of treatment outcomes and reduction of therapeutic complications . therefore , beside conventional targets for immunotherapy such as epidermal growth factor and cyclooxygenase-2 , novel promising combinations of molecular targets have been attracted much attention from investigators . in addition to cd44 , a well - known csc marker , we proposed cd74 as a novel target for cancer therapy in oscc . a significant association between cd74 overexpression and tumor grade has previously been revealed in renal cell carcinoma , which represents this marker as a potential therapeutic target . the role of cd74 in regulating class ii mhc folding and its related functions may depict this marker in close relation with underlying inflammatory process described in the grading of oscc . therefore , we highlight the role of inflammatory cells and probably associated cytokines in evolution and progression of oscc . although it should be mentioned that this role may be tumor dependent , such as b - cell neoplasms , and may significantly differ between various patients ; therefore , it is recommended that before any therapeutic intervention , the clinicians evaluate the immunohistochemical expression of cd74 in the tumoral tissue . although recent investigations have focused on cd44/cd24 expression in several carcinomas , in our study , cd24 expression revealed no relation with clinicopathological criteria . this difference may be associated with the type of carcinomas and consequently their various molecular pathways , which affect the pathogenesis of the tumors . also , our findings confirmed the results of several recent studies in which cd44 expression has shown a significant correlation with tumor grade and consequently introduced it as a csc marker in hnscc . in recent decades , this subpopulation of tumoral cells has been depicted as the cells with capabilities of sustaining neoplastic growth and many investigations have been performed to clarify the detectable molecular characteristics of these cells . it seems to achieve a more effective treatment and minimizing tumor recurrence , cscs should be considered as a potential target and therefore cd44 could be a reliable marker in hnscc . also , the role of cd44 in the initiation and progression of oscc is mainly emerges from physiologic function of this membranous protein in cellular adhesion and homing , which conceptually describe metastatic migration of the neoplastic cells . the significant increase of cd44 and cd74 expressions in high grade oscc supports the role of these proteins in the progression of oscc and introduces them as targets in molecular therapy . also , we observed that lymph node metastasis and increasing patients age led to a significant decrease of cd74 protein expression , which the former may be associated with a limited number of the cases and the latter could present age of the patients as an independent prognostic factor considering the role of cd74 in the pathogenesis of oscc . therefore , it is encouraged to follow these markers utilizing advanced experimental methods to sustain enough documents to represent them as an effective molecular target in oscc therapy .	background : considering molecular target therapy concept in the treatment of oral squamous cell carcinoma ( oscc ) , many attempts have been performed to introduce an effective molecular marker during recent years . several investigations have emphasized on the role of cd44 in various cancers and few studies have mentioned cd24 and cd74 . the purpose of this study was to investigate the relationship between cd44 , cd24 and cd74 expressions and several clinical or histopathological factors in oscc patients.materials and methods : in our analytical cross - sectional study , forty primary oscc specimens were immunohistochemically stained for cd44 , cd24 , and cd74 proteins . then , the relationship between their expressions and age , sex , lymph node metastasis , and histopathologic grading was statistically analyzed using mann - whitney nonparametric and t - test . furthermore , p < 0.05 was considered as significant.results:cd44 and cd74 proteins were significantly over - expressed in oscc patients with high grade ( p = 0.001 and p = 0.001 ) as compared to those with low grade . furthermore , cd74 immunoreactivity showed significantly higher expression in patients with lower age ( p = 0.039 ) . considering lymph node metastasis , we observed significant overexpression of cd74 in patients with no lymph node involvement ( p = 0.033).conclusion : our observations support the significant role of membranous cd44 protein in progression of oscc and also introduce cd74 protein as a probable interfering factor in different aspects of oscc .
You are an expert at summarizing long articles. Proceed to summarize the following text: the collagenous fibroma ( cf ) , is a slow - growing , benign , soft tissue lesion that was first described as recent as 1995 by evans , under the rubric , as the term fibroblastoma may be construed as an immature or potentially malignant neoplasm , nielsen et al proposed the name collagenous fibroma as being not only more descriptive of its histological composition but also more reflective of its benign prognosis . approximately 78 additional cases have been reported since then , describing the lesion better.[27 ] miettinen and fetsch have till date discussed 63 cases , the largest series ever . the results obtained from all reports indicate clearly that cf has a propensity to occur in males in the fifth to sixth decades of life , presenting as subcutaneous or intramuscular lesions , having a wide anatomic distribution . mesquita et al have recently claimed that their case was the first such cf seen intraorally . the cf presents as a slow - growing neoplasm of more than 6 months duration , measuring anywhere between 1 cm and 20 cm . clinically , the lesion is seen as a firm , well - circumscribed , round to oval , or lobulated mass , which on cut surface appears fibrous with a glistening gray - to - white aspect . microscopically , the overlying surface epithelium of cf is normal , although fat or skeletal muscle may be seen either entrapped between the rete pegs or in the center of the lesion . the neoplasm consists of sparsely distributed , medium to large , spindle- to stellate - shaped fibroblastic cells , interspersed among abundant intercellular collagen fibers . in dense fibrotic areas , cellularity is scarce and the cells do not exhibit any mitotic activity , nor is there any necrosis . a few cells may show a positive immunoreactivity for muscle - specific and alpha - smooth muscle actin . sciot et al studied two cfs and found that both exhibited an abnormality of the same band of the long arm of chromosome 11 , more specifically , a rearrangement of 11 q 12 . because the fibroma of the tendon sheath showed the same chromosomal aberration as that of the oral lesion a 58-year - old female patient was referred to the department of oral and maxillofacial surgery , at nims dental college , jaipur , rajasthan , due to a complaint of a firm , slow - growing , pedunculated lesion measuring 2 cm 1 cm , in the lingual gingival region in relation to the permanent mandibular left 3 molar since 3 months . intraoral examination showed a well - circumscribed , firm mass , covered by normal mucosa . the related teeth were not mobile , ruling out underlying bone involvement , and intraoral radiographs confirmed the same . the lesion was completely excised under local anesthesia and the specimen was sent to the department of oral pathology , nims dental college , jaipur , rajasthan , for histopathological evaluation . 5m sections were made and stained with hande , and 3 m sections were made for immunohistochemical analysis , by subjecting the sections to the streptavidin method . the immunohistochemical analysis was performed by using primary antibodies against vimentin ( 1:200 ) ( biogenex , san ramon , california ) . antigen retrieval for vimentin was accomplished by microwave treatment ( 3 times for 5 minutes ) at 700 w in citric acid ( 10 mmol / l , ph 6.0 ) . the above - mentioned immunohistochemical analysis was performed in the department of histopathology at santokba durlabhji memorial hospital , jaipur , rajasthan . the tissue received after the excisional biopsy was white in color , firm , shiny on cut surface with a soft yellowish area in the center of the cut surface . sections stained with hande were observed under 4 , 10 , and 40 to reveal a surface mucosa which was normal , overlying a dense , homogenous , eosinophilic connective tissue . the connective tissue consisted of dense collagen bundles in which were seen scarcely distributed spindle to stellate fibroblastic cells [ figure 1 ] . multinucleated giant cells were also observed . a peculiar , yet unique feature , seen in our case , was an area in the center of the section , consisting of fat cells [ figure 2 ] . sections were also subjected to the masson 's trichrome stain which revealed areas positive for collagen ( blue - green ) and some areas positive for muscle ( red ) . the cytoplasm of the lesional cells took up a red stain [ figure 3 ] . scant distribution of lesional fibroblastic cells in dense collagenous matrix ( h and e , 10 ) fat cells in centre of section ( h and e , 4 ) section shows collagen ( blue - green ) and muscle ( red ) ( masson 's trichrome , 4 ) immunohistochemically , the lesional fibroblastic cells were strongly positive for vimentin [ figure 4 ] . the collagen bundles were seen as long and circular thick bundles , distributed in a random manner throughout the section . in the oral cavity , the differential diagnosis for cf should include a wide range of soft tissue lesions , especially inflammatory fibrous hyperplasia , traumatic fibroma , and giant cell fibroma . other oral soft tissue lesions that are seen less frequently , e.g. , soft tissue myofibroma , nodular fasciitis , fibromatosis , and neurofibroma , can also be considered in the differential diagnosis for oral cf . the clinical and histopathological features of our case comply with the criteria for the diagnosis of cf reported by evans and nielsen et al who delineated desmoplastic fibroblastoma and cf , respectively . clinically , our case appeared somewhat similar to the previously described cases . on gross examination , the lesion was seen as a firm mass , which on cut surface appeared shiny and included a central area of soft , yellowish tissue , which on histopathological evaluation turned out to be fatty tissue . a similar feature has been described by miettinen and fetsch who also observed entrapment of fat in 51% of their series of 63 cases . a doubt still persists as to the true nature of cf . according to evans and nielsen et al , cf is a neoplasm , as it does not have a preceding traumatic or inciting cause . our patient also did not give any history of trauma or any other triggering event . the nature of the neoplastic cells in cf has been described by evans and nielsen et al , which have features of both fibroblasts and myofibroblasts . in the oral cavity , the differential diagnosis should include giant cell fibroma as well as a whole range of soft tissue lesions such as , inflammatory fibrous hyperplasia and the simple fibroma . the last mentioned lesion , i.e. , the simple fibroma is of great significance , as we feel , that a large number of cf may have been diagnosed in the past as the simple fibroma . in cf , the collagen presents as long , thick , and wavy bundles with a random distribution . the fibroma also displays thick and wavy bundles of collagen with a random distribution , but the bundles are shorter than those seen in cf . moreover , entrapment of adjacent fat and muscle appears to be a unique feature of cf . our aim was to draw the attention of all oral pathologists to review cases in the past diagnosed as fibromas , which could possibly be cf / desmoplastic fibroblastomas instead . the current treatment of cf is complete surgical excision as the prognosis is good thereafter .	collagenous fibroma ( desmoplastic fibroblastoma ) is a distinctive yet uncommon fibrous soft tissue tumor . these tumors are rather nondescript in their morphological appearance and have been diagnosed as fibromas or some other benign mesenchymal lesions for years . the most common sites are the upper extremities , followed by the lower extremities . rare lesions arise in the head and neck region . we report a rare case in the oral cavity and present its unique histopathological features ( central fat entrapment ) besides others , and diffusely strong vimentin immunopositivity .
You are an expert at summarizing long articles. Proceed to summarize the following text: medullary thyroid carcinoma ( mtc ) is a neuroendocrine tumour originating from the parafollicular cells ( c cells ) of the thyroid , which is derived from the neural crest and secretes calcitonin as well as other polypeptides such as carcinoembryonic antigen ( cea ) . high serum calcitonin and cea levels that had previously been low following total thyroidectomy are the indicators of residual tumour or recurrence . [ in]pentetreotide localizes to somatostatin receptors found on the cell membranes of neuroendocrine tumours and is used to evaluate mtc . the expression of somatostatin receptors is not specific for neuroendocrine tumoral pathologies and may lead to the visualization of the various infectious and inflammatory processes due to the presence of somatostatin receptors on the surface membranes of white blood cells . a number of studies show that 2-deoxy-2-[f]fluoro - d - glucose positron emission tomography ( fdg - pet ) is a sensitive method for the detection of metastases or recurrence of mtc . a wide range of infectious or inflammatory processes can cause diffuse or focal fdg uptake in the lungs . we present the case of a 57-year - old female patient with mtc who had a false positive [ in]pentetreotide(octreoscan ) scintigraphy result in the lung which was likely related to acute exacervation of chronic bronchitis . a 57-year - old female patient who had total thyroidectomy and bilateral modified cervical lymph node dissection because of mtc was referred to our clinic with coughing and dyspnoea ongoing for the last 10 days . elevated plasma calcitonin and cea levels were found but without abnormalities in the leukocyte count . [ in]pentetreotide ( octreoscan ) scintigraphy was performed for 424 h after intravenous administration of 3 mci of radionuclide . the anterior posterior scan of the whole body at 4 h ( fig . 1a , b ) and anterior posterior static thorax images at 24 h ( fig . 1c , d ) ( clearer on the posterior images ) revealed mild increased uptake corresponding to the upper lobe of the right lung ( arrow ) . one week later , a positron emission tomography ( pet)/computed tomography ( ct ) scan was performed an hour after 15 mci of fdg were injected intravenously . the composite pet / ct scan ( sequence : pet ( figure 2a ) , ct ( figure 2b ) , fused pet / ct in coronal , sagittal and axial view ( fig . 2c ) ) revealed mild increased uptake of fdg corresponding to a consolidation zone in the upper lobe of the right lung ( black and white arrows , standardized uptake value ( suv ) 3.5 ) compatible with pathologic uptake of [ in]pentetreotide ( octreoscan ) . three months later , [ in]pentetreotide(octreoscan ) scintigraphy was performed for 424 h after intravenous administration of 3 mci of the radionuclide . there was no pathological uptake on either the anterior posterior scan of the whole body at 4 h ( fig . 3a , b ) and the anterior posterior static thorax images at 24 h ( fig . the false positive result on [ in]pentetreotide(octreoscan ) scintigraphy in the lung was likely related to acute exacervation of the chronic bronchitis . figure 1[in]pentetreotide ( octreoscan ) scintigraphy . the anterior posterior whole body scans at 4 h ( a , b ) and the anterior posterior static thorax images at 24 h ( c , d ) ( clearer in the posterior images ) revealed mild increased uptake corresponding to the upper lobe of the right lung ( arrow ) . figure 2composite pet / ct scan ( sequence : ( a ) pet , ( b ) ct , ( c ) fused pet / ct in coronal , sagittal , axial view ) revealed mild increased uptake of fdg corresponding to a consolidation zone in the upper lobe of the right lung ( black and white arrow , suv 3.5 ) . there was no pathological uptake on both anterior posterior scan of the whole body at 4 h ( a , b ) and the anterior posterior static thorax images at 24 h ( c , d ) . the anterior posterior whole body scans at 4 h ( a , b ) and the anterior posterior static thorax images at 24 h ( c , d ) ( clearer in the posterior images ) revealed mild increased uptake corresponding to the upper lobe of the right lung ( arrow ) . composite pet / ct scan ( sequence : ( a ) pet , ( b ) ct , ( c ) fused pet / ct in coronal , sagittal , axial view ) revealed mild increased uptake of fdg corresponding to a consolidation zone in the upper lobe of the right lung ( black and white arrow , suv 3.5 ) . there was no pathological uptake on both anterior posterior scan of the whole body at 4 h ( a , b ) and the anterior posterior static thorax images at 24 h ( c , d ) . somatostatin receptors are expressed by many neuroendocrine and non - neuroendocrine cells of the body . in patients with mtc , the sensitivity of somatostatin receptor scintigraphy to detect tumour localizations is 5070% . comparing fdg - pet results with somatostatin receptor scintigraphy in mtc patients in the literature , the sensitivity of fdg - pet was found to be superior to somatostatin receptor scintigraphy . patients with respiratory infections ( e.g. various pneumonias , lung abscess ) and non - neuroendocrine lung tumours ( e.g. pulmonary hamartoma ) show accumulation most probably due to radiopharmaceutical accumulation in the lymphocytes . these cells express a specific somatostatin membrane receptor which is recognized and specifically bound by the radiotracer . false positive [ in]pentetreotide ( octreoscan ) scintigraphy results due to respiratory infections and inflammatory processes like chronic bronchitis must be considered in the diagnosis and follow up of mtc patients .	abstractwe present a case of medullary thyroid carcinoma ( mtc ) with pulmonary symptoms , elevated calcitonin and cea levels . both [ 111in]pentetreotide ( octreoscan ) scintigraphy and 2-deoxy-2-[18f]fluoro - d - glucose positron emission tomography / computed tomography ( fdg - pet / ct ) scan revealed mild increased uptake of radionuclides in the upper lobe of the right lung compatible with metastases . histopathological analysis showed it to be chronic bronchitis . the patient was followed without any treatment . three months later , no pathological uptake on [ 111in]pentetreotide ( octreoscan ) was observed . false positive [ 111in]pentetreotide uptake in the lungs was likely related to acute exacervation of the chronic bronchitis .
You are an expert at summarizing long articles. Proceed to summarize the following text: nucleoside analogues ( nas ) can rapidly inhibit the transcription of hepatitis b virus ( hbv ) and suppress serum hbv dna to a very low or undetectable level , reduce hepatic inflammation , prevent the progression of liver fibrosis , and inhibit the progression of hepatocellular carcinoma . the tolerability , safety , and convenience of nas promoted their widespread use for chronic hepatitis b ( chb ) antiviral therapy . however , the development of drug resistance and the poor virological response after rescue therapy have become major limitations of nas . these issues remain obstacles to chb patients long - term clinical antiviral therapies , especially when treated with low genetic barrier nas . as a new antiviral drug for chb , tenofovir disoproxil ( tdf ) has recently been recommended as the first line of anti - hbv nas medication by domestic and international chb prevention and treatment guidelines . at present , little is known about the efficacy and safety of tdf for chb patients with genotypic resistance in china . therefore , our research aimed at investigating the clinical efficacy and safety of tdf monotherapy in chinese chb patients with genotypic resistance , which might provide a reference for our national antiviral therapy for chb patients . from september 2012 to september 2015 , data were collected from 33 patients diagnosed with chb and genotypic resistance who were treated at the first affiliated hospital , college of medicine , zhejiang university . the research protocol was approved by the human ethics committee of the first affiliated hospital , college of medicine , zhejiang university ( no . 2016 - 486 ) . in accordance with the guideline for prevention and treatment of chb in china in 2010 , enrollment and exclusion criteria were established , with the enrollment criteria including the following : ( 1 ) in accordance with the diagnostic criteria for chb in china in 2010 , including chb hepatitis b e antigen [ hbeag]-positive and hbeag - negative patients ; ( 2 ) patients who were 1865 years old ; ( 3 ) patients who took non - tdf nas antiviral therapy for more than 1 year and had occurrences of virological breakthrough and abnormal hepatic function ; ( 4 ) patients who had genotypic resistance loci determined by the detection of hbv p - region sites ; ( 5 ) patients who signed informed consent ; and ( 6 ) patients who had previous therapies replaced with tdf monotherapy and received follow - up observation and monitoring of relevant indicators for every 3 months . the exclusion criteria included the following : ( 1 ) presence of hepatitis c virus infection ; ( 2 ) presence of aids or other immunodeficiency diseases ; ( 3 ) presence of autoimmune diseases ; ( 4 ) alcoholism ; ( 5 ) presence of renal diseases ; and ( 6 ) having poor compliance to medication and outpatient follow - ups . all the 33 patients were followed up for every 12 weeks ( at day 0 , the 12 , 24 , 36 , and 48 weeks ) in hospital clinic of the first affiliated hospital , college of medicine , zhejiang university . the specific workers monitored and recorded these patients data at every follow - up point ( including age , sex , history of hbv therapy , hbeag status , hbv dna levels , alanine aminotransferase [ alt ] levels , serum creatinine , urinary protein , genotypic assay , clinical symptoms , and liver color ultrasound examinations ; these indicators were tested by the department of clinical laboratory of the first affiliated hospital , college of medicine , zhejiang university ) . all patients received tdf ( gilead sciences inc . , usa ) monotherapy that included an oral 300 mg , 1 time / day for at least 48 weeks . statistical analyses were carried out using rank sum test or rank correlation by spss 17.0 software ( spss inc . , continuous variables were described by mean standard deviation or median ( quartile range ) . hbv dna levels were logarithmically transformed for analysis ( to analyze the data , we assigned the undetectable hbv dna at a level of 2.00 log10u / ml ) . when we compared the data of different follow - up points , we used bonferroni correction method to adjust the probability ( p < 0.005 ) . from september 2012 to september 2015 , data were collected from 33 patients diagnosed with chb and genotypic resistance who were treated at the first affiliated hospital , college of medicine , zhejiang university . the research protocol was approved by the human ethics committee of the first affiliated hospital , college of medicine , zhejiang university ( no . 2016 - 486 ) . in accordance with the guideline for prevention and treatment of chb in china in 2010 , enrollment and exclusion criteria were established , with the enrollment criteria including the following : ( 1 ) in accordance with the diagnostic criteria for chb in china in 2010 , including chb hepatitis b e antigen [ hbeag]-positive and hbeag - negative patients ; ( 2 ) patients who were 1865 years old ; ( 3 ) patients who took non - tdf nas antiviral therapy for more than 1 year and had occurrences of virological breakthrough and abnormal hepatic function ; ( 4 ) patients who had genotypic resistance loci determined by the detection of hbv p - region sites ; ( 5 ) patients who signed informed consent ; and ( 6 ) patients who had previous therapies replaced with tdf monotherapy and received follow - up observation and monitoring of relevant indicators for every 3 months . the exclusion criteria included the following : ( 1 ) presence of hepatitis c virus infection ; ( 2 ) presence of aids or other immunodeficiency diseases ; ( 3 ) presence of autoimmune diseases ; ( 4 ) alcoholism ; ( 5 ) presence of renal diseases ; and ( 6 ) having poor compliance to medication and outpatient follow - ups . all the 33 patients were followed up for every 12 weeks ( at day 0 , the 12 , 24 , 36 , and 48 weeks ) in hospital clinic of the first affiliated hospital , college of medicine , zhejiang university . the specific workers monitored and recorded these patients data at every follow - up point ( including age , sex , history of hbv therapy , hbeag status , hbv dna levels , alanine aminotransferase [ alt ] levels , serum creatinine , urinary protein , genotypic assay , clinical symptoms , and liver color ultrasound examinations ; these indicators were tested by the department of clinical laboratory of the first affiliated hospital , college of medicine , zhejiang university ) . all patients received tdf ( gilead sciences inc . , usa ) monotherapy that included an oral 300 mg , 1 time / day for at least 48 weeks . statistical analyses were carried out using rank sum test or rank correlation by spss 17.0 software ( spss inc . , continuous variables were described by mean standard deviation or median ( quartile range ) . hbv dna levels were logarithmically transformed for analysis ( to analyze the data , we assigned the undetectable hbv dna at a level of 2.00 log10u / ml ) . when we compared the data of different follow - up points , we used bonferroni correction method to adjust the probability ( p < 0.005 ) . among the 33 chb patients , 21/33 ( 64% ) were male , and the mean age was 45.1 11.0 years . there were 25/33 ( 76% ) hbeag - positive patients and 8/33 ( 24% ) hbeag - negative patients . about 13/33 ( 39% ) treatment - experienced patients had taken one kind of non - tdf nas and 20/33 ( 61% ) treatment - experienced patients had taken two or more kinds of non - tdf nas . the median baseline hbv dna level was 5.48 ( 4.496.57 ) log10 u / ml [ table 1 ] . baseline characteristics of patients with chronic hepatitis b and genotypic resistance ( n = 33 ) values are presented as the mean standard deviation , median ( quartile range ) , or percentage . lam : lamivudine ; adv : adefovir dipivoxil ; ldt : telbivudine ; etv : entecavir ; hbeag : hepatitis b e antigen ; hbv : hepatitis b virus ; alt : alanine aminotransferase . the hbv dna levels of all the 33 chb patients were significantly decreased after tdf monotherapy . statistically significant differences were observed by comparing hbv dna levels during 48 weeks ( p < 0.001 ) [ figure 1 ] . there were significant differences by comparing hbv dna levels at day 0 , with the 12 , 24 , 36 and 48 weeks ( z = 5.01 , p < 0.001 ) . there were significant differences by comparing hbv dna levels at the 12 week with the 24 , 36 , and 48 weeks ( z = 4.02 , p < 0.001 ) . however , there were no significant differences by comparing hbv dna levels at the 24 week with the 36 and 48 weeks ( z = 1.83 , p = 0.068 and z = 1.83 , p = 0.070 ; respectively ) . moreover , there was no significant difference by comparing hbv dna levels at the 36 week with the 48 week ( z = 1.00 , p = 0.317 ) . during the follow - up period , there was a significant correlation between the time it took to achieve undetectable hbv dna and the number of hbv genotypic resistance loci in the 33 chb patients ( rs = 0.36 , p = 0.040 ) . if the patient had multiple genotypic resistance loci , it took more time to achieve undetectable hbv dna . the characteristics between hbv dna levels and tdf monotherapy time : all the 33 chb patients hbv dna levels were significantly decreased after tdf monotherapy . tdf : tenofovir disoproxil ; hbv : hepatitis b virus ; chb : chronic hepatitis b. the virological response time and the baseline hbv dna levels in the 33 chb patients were significantly related ( rs = 0.39 , p = 0.030 ) . specifically , if the baseline hbv dna levels were higher , the time it took to achieve undetectable hbv dna was longer . on the contrary , the lower the baseline hbv dna levels were , the correlation between baseline hbv dna levels and the time to reach undetectable hbv dna levels ( n = 33 ) . the baseline hbv dna levels were high , the time of hbv dna to reach undetectable level was longer . the ratio of hbeag negative conversion indicates the ratio of hbeag transforms from positive to negative ( including hbeag seroclearance and seroconversion ) . during the follow - up period , hbeag negative conversion was reached in 7 of the 25 ( 28% ) patients . among these patients , hbeag seroclearance was reached in 4 of the 25 ( 16% ) patients and hbeag seroconversion was reached in 3 of the 25 ( 12% ) patients . among them , one patient 's hbeab changed from negative to positive . during tdf monotherapy , the rate of alt normalization gradually increased from 12% at day 0 to 91% at the 48 week . there were significant differences in the comparison of alt levels at the 24 week with the 36 and 48 weeks ( z = 3.69 , p < 0.001 and z = 4.48 , p < 0.001 ; respectively ) . however , there were no significant differences in the comparison of alt levels at day 0 with the 12 and 24 weeks ( z = 1.68 , p = 0.092 and z = 3.31 , p = 0.010 ; respectively ) . moreover , there was no significant difference in the comparison of alt levels at the 36 with the 48 week ( z = 2.27 , p = 0.023 ) . the results showed that alt levels decreased rapidly from 24 to 36 weeks , but decreased slowly in the first 24 weeks and after the 36 weeks [ table 2 ] . treatment and response characteristics of patients hbv dna and alt levels ( n = 33 ) values are presented as median ( quartile range ) , or percentage . alt : alanine aminotransferase ; hbv : hepatitis b virus ; : not applicable . all the 33 patients achieved virological response and had no occurrence of virological breakthrough at the end of the 48 week . all the 33 patients tolerated the tdf monotherapy well , and there were no clinically significant side effects such as exacerbation of symptoms or death occurred during the follow - up period ; 31/33 ( 94% ) patients showed a normal level of serum creatinine and were negative for urinary protein throughout the treatment period , 2/33 ( 6% ) patients serum creatinine levels increased ; however , there were no significant changes in renal function confirmed by ultrasound examination . among the 33 chb patients , 21/33 ( 64% ) were male , and the mean age was 45.1 11.0 years . there were 25/33 ( 76% ) hbeag - positive patients and 8/33 ( 24% ) hbeag - negative patients . about 13/33 ( 39% ) treatment - experienced patients had taken one kind of non - tdf nas and 20/33 ( 61% ) treatment - experienced patients had taken two or more kinds of non - tdf nas . the median baseline hbv dna level was 5.48 ( 4.496.57 ) log10 u / ml [ table 1 ] . baseline characteristics of patients with chronic hepatitis b and genotypic resistance ( n = 33 ) values are presented as the mean standard deviation , median ( quartile range ) , or percentage . lam : lamivudine ; adv : adefovir dipivoxil ; ldt : telbivudine ; etv : entecavir ; hbeag : hepatitis b e antigen ; hbv : hepatitis b virus ; alt : alanine aminotransferase . the hbv dna levels of all the 33 chb patients were significantly decreased after tdf monotherapy . statistically significant differences were observed by comparing hbv dna levels during 48 weeks ( p < 0.001 ) [ figure 1 ] . there were significant differences by comparing hbv dna levels at day 0 , with the 12 , 24 , 36 and 48 weeks ( z = 5.01 , p < 0.001 ) . there were significant differences by comparing hbv dna levels at the 12 week with the 24 , 36 , and 48 weeks ( z = 4.02 , p < 0.001 ) . however , there were no significant differences by comparing hbv dna levels at the 24 week with the 36 and 48 weeks ( z = 1.83 , p = 0.068 and z = 1.83 , p = 0.070 ; respectively ) . moreover , there was no significant difference by comparing hbv dna levels at the 36 week with the 48 week ( z = 1.00 , p = 0.317 ) . during the follow - up period , the median time of hbv dna reaching undetectability was 24 ( 1224 ) weeks . there was a significant correlation between the time it took to achieve undetectable hbv dna and the number of hbv genotypic resistance loci in the 33 chb patients ( rs = 0.36 , p = 0.040 ) . if the patient had multiple genotypic resistance loci , it took more time to achieve undetectable hbv dna . the characteristics between hbv dna levels and tdf monotherapy time : all the 33 chb patients hbv dna levels were significantly decreased after tdf monotherapy . tdf : tenofovir disoproxil ; hbv : hepatitis b virus ; chb : chronic hepatitis b. the virological response time and the baseline hbv dna levels in the 33 chb patients were significantly related ( rs = 0.39 , p = 0.030 ) . specifically , if the baseline hbv dna levels were higher , the time it took to achieve undetectable hbv dna was longer . on the contrary , the lower the baseline hbv dna levels were , the correlation between baseline hbv dna levels and the time to reach undetectable hbv dna levels ( n = 33 ) . the baseline hbv dna levels were high , the time of hbv dna to reach undetectable level was longer . the ratio of hbeag negative conversion indicates the ratio of hbeag transforms from positive to negative ( including hbeag seroclearance and seroconversion ) . during the follow - up period , hbeag negative conversion was reached in 7 of the 25 ( 28% ) patients . among these patients , hbeag seroclearance was reached in 4 of the 25 ( 16% ) patients and hbeag seroconversion was reached in 3 of the 25 ( 12% ) patients . among them , one patient 's hbeab changed from negative to positive . during tdf monotherapy , the rate of alt normalization gradually increased from 12% at day 0 to 91% at the 48 week . there were significant differences in the comparison of alt levels at the 24 week with the 36 and 48 weeks ( z = 3.69 , p < 0.001 and z = 4.48 , p < 0.001 ; respectively ) . however , there were no significant differences in the comparison of alt levels at day 0 with the 12 and 24 weeks ( z = 1.68 , p = 0.092 and z = 3.31 , p = 0.010 ; respectively ) . moreover , there was no significant difference in the comparison of alt levels at the 36 with the 48 week ( z = 2.27 , p = 0.023 ) . the results showed that alt levels decreased rapidly from 24 to 36 weeks , but decreased slowly in the first 24 weeks and after the 36 weeks [ table 2 ] . treatment and response characteristics of patients hbv dna and alt levels ( n = 33 ) values are presented as median ( quartile range ) , or percentage . alt : alanine aminotransferase ; hbv : hepatitis b virus ; : not applicable . all the 33 patients achieved virological response and had no occurrence of virological breakthrough at the end of the 48 week . all the 33 patients tolerated the tdf monotherapy well , and there were no clinically significant side effects such as exacerbation of symptoms or death occurred during the follow - up period ; 31/33 ( 94% ) patients showed a normal level of serum creatinine and were negative for urinary protein throughout the treatment period , 2/33 ( 6% ) patients serum creatinine levels increased ; however , there were no significant changes in renal function confirmed by ultrasound examination . in chb antiviral therapy , tdf shows strong efficacy and fewer adverse reactions , and it is an ideal drug for the rescue treatment of chb patients with genotypic resistance . at present , there are many clinical studies of multicenter , large - scale samples of tdf here and abroad . among them , tdf in vitro experiments showed that it had a strong antiviral capacity against both hepatotropic viruses and retroviruses , and it can inhibit the activity of hbv dna polymerase , which had a good inhibitory effect on hbv dna replication in wild - type hbv . in vitro studies of tdf treatment for hbv infection with lamivudine ( lam ) and adefovir dipivoxil ( adv ) resistance also showed that tdf has a good inhibitory effect on viral replication . in vivo researches of tdf also showed strong inhibition of hbv dna replication in treatment - naive or treatment - experienced patients having resistance to other kinds of nas , and to some extent , tdf can prevent the progression of hepatic fibrosis and cirrhosis . however , these studies were carried out in american and european countries where the hbv genotype of human infections is a or d type , whereas chinese people were mostly infected by b or c type hbv . therefore , the efficacy and safety of tdf in antiviral treatment of chb patients have not yet been confirmed by further clinical trials in china . the research analyzed the efficacy and safety of the 33 chinese chb patients previously treated with non - tdf nas ( including lam , telbivudine [ ldt ] , entecavir [ etv ] , and adv monotherapy or combined therapy ) after 48 weeks of treatment . during the course of antiviral therapy , these patients experienced virological breakthrough and had clearly detected genotypic resistance loci and voluntarily switched to tdf monotherapy . the results showed that tdf still had an excellent antiviral effect and safety after 48 weeks for most chinese chb patients who were previously treated by nas and had genotypic resistance . in the study , we found that there was significant correlation between the duration of undetectable hbv dna and the number of genotypic resistance loci . the results that the more genotypic resistance loci , the longer it took to reach a complete response to the virus were similar to the current studies abroad . there was a positive correlation between the baseline hbv dna levels and duration of undetectable hbv dna . therefore , chb patients should detect serum hbv dna levels regularly during antiviral therapy , and once virological breakthrough occurs , patients should have the hbv p - resistant gene region inspected as early as possible . at the same time , patients should switch to tdf rescue treatment as soon as possible to suppress hbv replication in time and achieve a virological response as early as possible . the research results show that hbv dna levels were significantly decreased and reached undetectability at the end of the study . what is more , the therapeutic effect was achieved during 24 weeks . in our study , with the prolonged treatment duration , the range of hbv dna levels decline was increased , and hbv dna levels decline reached 3.48 ( 2.594.57 ) log10u / ml at the 48 week ; the result was essentially similar to a study by patterson et al . , which reported that the mean range of decline of hbv dna levels was ( 3.751.33 ) log10u / ml for chb patients with lam resistance who took tdf monotherapy for 48 weeks . in our study , the rate of hbv dna undetectability rose from 37% at the 12 week to 100% at the 48 week , the result was similar to a study by van bmmel et al . in tdf rescue therapy , the cumulative probability of hbv dna undetectability gradually increased , thus tdf showed an excellent antiviral efficacy . hbeag negative conversion shows the process of the clearance of hbv by the immune system , and it is also an important clinical reference of achieving virological response . the research showed that the rate of hbeag seroconversion was 12% in tdf rescue therapy after 48 weeks . however , a study abroad reported that the rate of hbeag seroconversion was 21% in tdf treatment - naive chb patients who were hbeag positive . our results were lower , and we consider that it may be related to our patients having been treated with nas as well as the small size of our cohort . we further analyzed the baseline characteristics of three patients who exhibited hbeag seroconversion , including one male and two females ( 34 , 46 , and 46 years old , respectively ) , with early symptoms that were less harsh . the baseline hbv dna levels of these individuals were between 6.00 and 7.00 log10 u / ml and their genotypic resistance locus was 240i . the liver color doppler ultrasound showed mild inflammation and their complete virological response times were 12 , 24 , and 36 weeks , respectively , with alt being mildly increased . from the above analysis , we may speculate that the realization of hbeag seroconversion may be related to the mild increase of alt , being female , having nonhepatic cirrhosis , and having a low hbv dna level . tdf shows not only potent inhibition of viral replication but also powerful alt recovery capacity for chb patients treated with nas and having genotypic resistance . with prolonged treatment duration the cumulative recovery rate of alt in our study was 33% at the 24 week , which was significantly different from 77% at the 24 week in european tdf - naive treatment for chb patients and is similar to the 76% observed at the 36 week in our study . the reasons may be that our research patients were all experience - treated and exhibited genotypic resistance . at present , many reports showed that tdf had no resistance in in vivo studies , but some in vitro studies reported that the a181v / t+n236 t mutation strains had decreased tdf sensitivity . koziel and peters found that the v214 and q215 mutations decreased tdf susceptibility by analyzing the related hbv resistance mutations in five kinds of nas ( including tdf ) . however , the patients with rtn236 t and rta181v double mutations were still sensitive to tdf in clinical practice . a number of studies showed that no matter what is used , tdf monotherapy or combined therapy , tdf has shown an excellent clinical efficacy . therefore , it is still unknown whether tdf resistance requires several genetic resistance loci at the same time . however , suzuki et al . recently reported the occurrence of virological breakthrough during the long - term follow - up period after tdf plus etv treatment of patients , suggesting that tdf rescue therapy for drug - resistant patients still need to be closely followed up . the study results , by detecting gene loci , did not show the loci that decreased tdf susceptibility . among them , there are three patients with the 181v resistance locus . we further analyzed complete virologic response durations and they all achieved hbv dna undetectability at the 24 and 36 weeks , demonstrating that the efficacy of tdf is excellent . in our study , all the 33 chb patients achieved completely virological response after 48 weeks and no virological breakthrough or drug resistance . the common adverse effects of taking tdf are nausea , vomiting , diarrhea , and abdominal distension . among these however , most researches showed that tdf had excellent tolerability and safety in recent years . for treatment - naive chb patients , studies have shown that the incidence of renal adverse events was < 2.2% after treating men with tdf for 8 years . for adv treatment - experienced chb patients who were treated with tdf monotherapy and ftc plus tdf treatment for 168 weeks , there were no patients diagnosed with renal adverse events in two groups . our study showed that the tolerability and safety of tdf were excellent for chb patients after 48 weeks in china . however , as for its long - term safety , tdf still needs further study . during the follow - up period , most of the serum creatinine levels of patients were stable or were not significantly increased after taking tdf . there were no instances of renal injuries , which was consistent with researches in other countries . in conclusion , tdf monotherapy is an effective and safe option for chb patients with genotypic resistance to other nas . however , this study had several limitations : it was a single - center study , the sample size was small , and the follow - up time was short that might cause few bias in the results . it is necessary to further study the long - term efficacy of tdf and to monitor adverse reactions .	background : tenofovir disoproxil ( tdf ) is a promising salvage therapy for patients with chronic hepatitis b ( chb ) who failed regimens of other nucleoside analogues ( nas ) . in this study , we aimed to investigate the clinical efficacy and safety of tdf monotherapy in chinese chb patients with genotypic resistance.methods:a total of 33 chb patients who had failed treatment with other nas and had genotypic resistance were switched to tdf monotherapy for 48 weeks . patients demographic data ( age , sex , history of hepatitis b virus [ hbv ] therapy ) , laboratory testing results ( hepatitis b e antigen [ hbeag ] status , hbv dna levels , alanine aminotransferase [ alt ] levels , serum creatinine , urinary protein , genotypic assay ) , clinical symptoms , and liver color ultrasound examinations were collected for evaluation at day 0 ( baseline ) and the 12th , 24th , 36th , and 48th weeks after initiating treatment . statistical analyses were carried out using rank sum test or rank correlation.results:with regard to efficacy , the study found that all patients who switched to tdf monotherapy had undetectable hbv dna levels after 48 weeks . in addition , patients with lower baseline hbv dna levels realized earlier virological undetectability ( rs = 0.39 , p = 0.030 ) . alt levels were normal in 30 of 33 patients ( 91% ) . hbeag negative conversion occurred in 7 of 25 patients ( 28% ) , among whom hbeag seroconversion ( 12% ) and hbeag seroclearance ( 16% ) occurred . the time of complete virological response was significantly affected by the number of resistance loci ( rs = 0.36 , p = 0.040 ) . concerning safety , the study found that no adverse events were observed during the 48 weeks.conclusion:tdf monotherapy is an effective and safe salvage treatment for chb patients who are resistant to other nas .
You are an expert at summarizing long articles. Proceed to summarize the following text: preservation of mechanisms underlying adaptation of beta cells mass and function is critical for glucose homeostasis , as the decline in functional beta cells mass is a key feature of the development of diabetes [ 15 ] . the incretin hormone glucagon - like peptide-1 ( glp1 ) plays an instrumental role in the control of beta cell mass and function [ 68 ] . alteration of beta cell sensitivity to glp1 is thought to contribute to the loss of functional beta cell mass in diabetes in both lean and obese individuals [ 911 ] . beta cell abnormalities in the glp1 sensitivity have been associated with a reduction in the glp1 receptor expression in some animal models of diabetes [ 12 , 13 ] . administration of glp1 improves beta cell survival in animal model of diabetes [ 14 , 15 ] . a wealth of in vitro and in vivo studies show that this prosurvival effect is achieved by inhibiting beta cells apoptosis elicited by diabetogenic stressors such as proinflammatory cytokines [ 6 , 1623 ] . the effect achieved by the glp1 and its analogs results from the activation of kinases and/or scaffold proteins , which in turn promote an antiapoptotic signaling cascade [ 6 , 18 , 19 , 2428 ] . one of the major kinases activated by glp1 and its mimetic exendin 4 is the protein kinase b / akt [ 16 , 17 , 27 ] . activation of akt by glp1 results from the increased abundance of the insulin receptor substrate 2 ( irs2 ) . in beta cells , the expression of irs2 is controlled by the mitogen activated protein kinase 10 also called c - jun amino - terminal kinase 3 ( jnk3 ) [ 29 , 30 ] . silencing of jnk3 by interference rna dramatically reduces the irs2 abundance in ins-1e cells . as a result of jnk3 depletion an increase in cytokine - induced apoptosis ensues the goal of this study was to investigate whether the jnk3 content is associated with beta cell protection achieved by the glp1 mimetic exendin 4 . the rat insulin - secreting cell line ins-1e was maintained in rpmi 1640 medium supplemented with 10% fetal calf serum ( fcs ) ( paa laboratories , ge healthcare , velizy - villacoublay , france ) , 1 mm sodium pyruvate , 50 m -mercaptoethanol , and 10 mm hepes . human pancreases were harvested from adult brain - dead donors in accordance with french regulations and with the local institutional ethical committee from the centre hospitalier rgional et universitaire de lille . pancreatic islets were isolated after ductal distension of the pancreas and digestion of the tissue as described previously . all experiments were carried out at least on islets with a purity of and viability > 80% . purified islets were cultured in cmrl 1066 medium ( gibco brl , life technologies ) containing 0.625% free fatty acid human serum albumin ( roche diagnostics ) , penicillin ( 100 ui / ml ) , and streptomycin ( 100 g / ml ) . the sirna duplexes directed against jnk3 ( sijnk3 ) or sirna control against gfp ( sigfp ) were previously described [ 2931 ] . the sirna duplexes were introduced using the lipofectamine 2000 ( life technology , saint aubin , france ) as described [ 29 , 30 ] . ins-1e and isolated human islets cells were scrapped in cold pbs buffer and cell pellets were incubated 30 min on ice in lysis buffer ( 20 mm tris acetate ph 7 , 0.27 mm sucrose , 1% triton x-100 , 1 mm edta , and 1 mm egta , 1 mm dtt ) supplemented with antiproteases and antiphosphatases ( roche , meylan , france ) . cell lysates were centrifugated 15 min at 18,000 g and supernatants were used to analyze proteins . protein extracts were solubilized in laemmli buffer ( 40% glycerol , 20% -mercaptoethanol , 8% sds , 0.02% bromophenol blue , 0.25 mm tris - hcl , ph 6.8 ) and denatured 10 min at 95c before loading onto the gel . proteins were separated on 10% sds - polyacrylamide gel and electrically blotted to nitrocellulose membranes . the proteins were detected after an overnight incubation of the membrane at 4c with the specific primary antibodies against jnk3 ( dilution 1 : 1000 ; cell signaling technology , ma , usa ) , jnk2 ( dilution 1 : 1000 ; cell signaling technology , ma , usa ) , -actin ( 1 : 5000 ; sigma , saint quentin , france ) , or -tubulin ( 1 : 5000 ; sigma , saint quentin , france ) , diluted in buffer containing 0.1% tween 20 with either 2% milk ( for jnk3 ) or 5% bsa ( for jnk2 ) or 5% milk ( for -actin and -tubulin ) . proteins were visualized with irdye800 or irdye700 ( eurobio , les ulis , france ) as secondary antibodies . quantification was performed using the odyssey infrared imaging system ( eurobio ) [ 29 , 30 ] . apoptosis was evaluated in cells transfected with the sirnas and exposed to a cytokine cocktail ( r&d systems , minneapolis , mn , usa ) of rat il-1 ( 10 ng / ml ) , mouse tnf ( 25 ng / ml ) , and rat ifn ( 150 ng / ml ) for 24 h. apoptosis was determined by scoring cells displaying pycnotic nuclei ( visualized with hoechst 33342 ) . the counting was performed blindly by three different experimenters . anova was used for statistical significance , followed by the post hoc bonferroni test ( dunnett 's test ) when experiments included more than two groups . the level of significance was set at p < 0.05 ( sas statistical package ; sas , carry , nc ) . several studies , including ours , have shown that the glp1 receptor agonists prevent apoptosis elicited by prolonged exposure with cytokines [ 21 , 23 , 31 ] . typically , the cytoprotective effect of the glp1 mimetic is achieved through induction of key prosurvival proteins [ 6 , 25 ] . in this regard we found that exposure of isolated human islets cells to exendin 4 elevated the jnk3 abundance as revealed by western blotting analysis ( figure 1(a ) ) . the increase in the jnk3 protein started as early as 2 hr and declined after 4 hr ( figure 1(a ) ) . induction of jnk3 by exendin 4 was observable at 10 nm but was optimal at 50 nm ( figure 1(b ) ) . western blotting experiment confirmed elevation of jnk3 protein by exendin 4 in ins-1e cells ( figure 1(c ) ) . however , induction of jnk3 by the glp1 receptor agonist came later ( after 4 hr of incubation ) and persisted until 24 h treatment ( figure 1(c ) ) . we next investigated whether jnk3 was required for the cytoprotective effect of exendin 4 . to this end , ins-1e cells were transfected with the duplex sirnas directed against jnk3 mrna ( sijnk3 ) [ 29 , 30 ] . the latter efficiently and selectively silenced the expression of jnk3 in ins-1e cells ( figure 2(a ) ) . as anticipated , incubation of the cells with cytokines for 24 hr elicited a 2-fold increase in apoptosis ( figure 2(b ) ) . exendin 4 efficiently reduced death evoked by culture conditions and cytokines ( figure 2(b ) ) . as previously observed [ 29 , 30 ] , silencing of jnk3 potentiated cytokines - induced apoptosis ( figure 2(b ) ) . in addition , diminution of jnk3 by sijnk3 abolished the protective effects accomplished by exendin 4 ( figure 2(b ) ) . these data point out that jnk3 levels are pivotal for the coupling of exendin 4 and protection of cells against apoptosis evoked by cytokines . there is a growing body of evidence that the glp1 and its mimetics trigger cytoprotective effects on beta cells by stimulating the abundance of antiapoptotic proteins [ 6 , 17 , 2527 , 31 , 33 ] . several reports have now delineated a role for jnk3 as a key player in protecting beta cells against apoptosis [ 29 , 30 ] . a hallmark of this claim is that selective silencing of jnk3 increases apoptosis induced by cytokines [ 29 , 30 ] . inversely , we questioned whether the jnk3 content could be stimulated by the glp1 mimetic exendin 4 . we found that exposure of isolated human islets to exendin 4 increases the jnk3 protein content . although the antiapoptotic mechanisms activated by the glp1 mimetics are globally similar between human islets and the rat insulin - secreting ins-1e cells [ 6 , 17 , 25 , 26 , 31 ] , the spatial and temporal regulation of certain pathways evoked by glp1 and its analogs may be species - specific . different temporal activation of the antiapoptotic erk pathway between isolated human islets and ins-1e cells has been shown in response to rf26a rfamide peptide . while erk is activated by the peptide in human islets and ins-1e cells , one study has shown that beta cells behaviour in response to glp1 is different between human and rodent islets . glp1 promotes cooperation and connectedness between beta cells within human islets whereas it does not do this in rodent cells . this difference may elicit some changes in the spatial and temporal regulation of genes expression and pathways . in this regard , we observed that induction of jnk3 content by exendin 4 was faster and declined more rapidly in human islets when compared to ins-1e cells . the induction of jnk3 in human islets and ins-1e cells led us to ask whether such phenomenon contributed to the protective effects elicited by exendin 4 against apoptosis . one clue was that the increase of jnk3 content in cultures of ins-1e cells for 24 h was associated with a significant reduction in apoptosis under normal culture condition . this antiapoptotic effect achieved by the glp1 mimetic was abolished when jnk3 content was reduced by sirna . we have previously published that cytokine treatment of ins-1e cells with cytokines worsens death caused by apoptosis . the rise of death induced by cytokines is alleviated by coculturing the cells with exendin 4 . the experiments unveiled that protection of ins-1e cells by exendin 4 against cytokine - induced apoptosis is abolished when the jnk3 abundance is attenuated . several key transcription factors and signalling proteins including protein kinase a ( pka ) , pkb / akt , pkc - zeta , erk , endoplasmic reticulum stress , and epidermal growth factor receptor are involved in the cytoprotective effects achieved by the glp1 mimetics [ 6 , 18 , 19 , 2426 ] . abdelli and coauthors have shown a reduction in the expression of insulin receptor substrate 2 ( irs2 ) and akt activation upon silencing of jnk3 [ 29 , 30 ] . however , jnk3 is mainly localized in the nucleus of beta cells [ 29 , 30 ] , suggesting that irs2 can not be the only target of the kinase . future studies are needed to identify other targets of jnk3 that are required for the antiapoptotic effects of exendin 4 . such investigation could uncover novel protective pathways of beta cells and eventually lead to innovative antidiabetic therapeutic targets .	preservation of beta cell against apoptosis is one of the therapeutic benefits of the glucagon - like peptide-1 ( glp1 ) antidiabetic mimetics for preserving the functional beta cell mass exposed to diabetogenic condition including proinflammatory cytokines . the mitogen activated protein kinase 10 also called c - jun amino - terminal kinase 3 ( jnk3 ) plays a protective role in insulin - secreting cells against death caused by cytokines . in this study , we investigated whether the jnk3 expression is associated with the protective effect elicited by the glp1 mimetic exendin 4 . we found an increase in the abundance of jnk3 in isolated human islets and ins-1e cells cultured with exendin 4 . induction of jnk3 by exendin 4 was associated with an increased survival of ins-1e cells . silencing of jnk3 prevented the cytoprotective effect of exendin 4 against apoptosis elicited by culture condition and cytokines . these results emphasize the requirement of jnk3 in the antiapoptotic effects of exendin 4 .
You are an expert at summarizing long articles. Proceed to summarize the following text: at present , where a lot of research is directed toward more sophisticated procedures for treatment and diagnosis of periodontal diseases , the research directed toward prevention is receiving much less attention . oral halitosis is a common complaint which has been recognized since ancient times but has only recently come forward as it can be a significant social handicap in this increasingly sophisticated world . the term oral halitosis is specific and is used to define halitosis with an origin within the oral cavity . information on the prevalence of oral halitosis ; however , is less due to the lack of epidemiological studies . in a study , it was found that up to 25% people of the population have volatile sulfur compounds ( vsc ) in the breath in amounts higher than what is considered to be the socially acceptable limit . various means for the reduction of oral malodor can be mechanical agents , chemical agents , rendering malodorous gases nonvolatile , and masking the malodor . because of its strong antibacterial effects and substantivity in the oral cavity chlorhexidine ( chx ) gluconate provides a significant reduction in the vsc levels and organoleptic ratings . , 1991 showed that a 0.2% chx regimen produced a 43% reduction in vsc values and a more than 50% reduction in the organoleptic ratings . however , the beneficial effects of chx come with an array of adverse effects of which change in taste perturbation and staining of teeth can produce discomfort to the patient and can also affect patient compliance . a chemical agent with an efficacy equivalent to that of chx and conducted a similar study where they compared the efficacy of oil pulling with sesame oil with that of 0.2% chx for the reduction of malodor and found it to be equally effective . although oil pulling may not be as palatable and acceptable for all the individuals , and a commercial formulation with such products may be more acceptable . thus , this study was conducted to compare the efficacy of a mouthrinse having herbal formulation with 0.2% chx gluconate mouthrinse in the reduction of oral malodor , and adverse effects caused by the herbal mouthrinse if any was noted . the power of the test was set at 80% with two - sided 5% significance level . the formula used for sample size calculation was following which a total of 96 subjects with chronic generalized gingivitis were taken with 32 subjects in each group . the study was in accordance with guidelines of the helsinki declaration as revised in 1975 . a written informed consent was taken for each participant after giving detailed information and explanation about the study , and the study was approved by the institutional review board committee of the institute . the subjects were included by the following criteria , ( 1 ) age range 15 - 55 years , ( 2 ) having chronic gingivitis , and ( 3 ) systemically healthy . whereas the following were excluded from the study : ( 1 ) subjects using any mouth rinse , ( 2 ) if they got scaling done in previous 6 months , ( 3 ) the ones who used antibiotics in previous 3 months , ( 4 ) smokers , and ( 5 ) the ones who were not willing to participate in the study . parameters noted for each subject at baseline , day 7 and day 14 were ( 1 ) gingival index ( gi ) ( 2 ) plaque index ( pi ) ( 3 ) organoleptic scores where a score of 0 - 5 was given after sniffing the breath odour ( 4 ) halimeter ( interscan co - operation ) * scores , by a single trained examiner . it was ensured that the patient did not consume anything in the previous 1 h as both the organoleptic and halimeter scores can get influenced by that . to record the organoleptic score , criteria and methodology by rosenberg and mcculloch were followed . halimeter score was recorded as per the manufacturer 's instructions . before recording the subject had to keep his / her mouth closed for 3 min after which a disposable plastic straw connected to the halimeter was placed 2 cm inside the patients mouth without touching any other part of the oral cavity , the patient was refrained from breathing , and the maximum reading shown by the halimeter was recorded . the selected subjects underwent baseline scaling procedure to avoid wide variations in scores and also because the mouthrinse acts only after an already formed biofilm is removed . after 15 min of scaling procedure , the organoleptic and halimeter scores were re - recorded , and these were considered as the baseline values . the subjects were then randomly and equally assigned into any of the three groups group a - positive control - received 0.2% chx mouth rinse ; they were asked to use 10 ml mouthrinse twice daily after brushing and were told to avoid eating or drinking for 20 min after the use of mouthrinse . group b - test - received commercially available herbal mouthrinse , they were asked to use 15 ml of mouthrinse twice daily as per the dosage and were given no other set of instructions , unlike group a subjects . the subjects were told to report back at the 7 and 14 day , respectively . during this period , they were called once in a week to reinforce the instructions and to ensure that they continued using the mouth rinse . they were also instructed to report back with the empty bottles to check the compliance . furthermore , patients were asked for any discomfort that they experienced and were examined for adverse effects if any . the statistical analysis was carried out using spss 20 software ( spss 20 , ibm , armonk , ny , usa ) . whitney u - test , and wilcoxon matched pairs test were applied for performing the analysis . the power of the test was set at 80% with two - sided 5% significance level . the formula used for sample size calculation was following which a total of 96 subjects with chronic generalized gingivitis were taken with 32 subjects in each group . the study was in accordance with guidelines of the helsinki declaration as revised in 1975 . a written informed consent was taken for each participant after giving detailed information and explanation about the study , and the study was approved by the institutional review board committee of the institute . the subjects were included by the following criteria , ( 1 ) age range 15 - 55 years , ( 2 ) having chronic gingivitis , and ( 3 ) systemically healthy . whereas the following were excluded from the study : ( 1 ) subjects using any mouth rinse , ( 2 ) if they got scaling done in previous 6 months , ( 3 ) the ones who used antibiotics in previous 3 months , ( 4 ) smokers , and ( 5 ) the ones who were not willing to participate in the study . parameters noted for each subject at baseline , day 7 and day 14 were ( 1 ) gingival index ( gi ) ( 2 ) plaque index ( pi ) ( 3 ) organoleptic scores where a score of 0 - 5 was given after sniffing the breath odour ( 4 ) halimeter ( interscan co - operation ) * scores , by a single trained examiner . it was ensured that the patient did not consume anything in the previous 1 h as both the organoleptic and halimeter scores can get influenced by that . to record the organoleptic score , criteria and methodology by rosenberg and mcculloch were followed . halimeter score was recorded as per the manufacturer 's instructions . before recording the subject had to keep his / her mouth closed for 3 min after which a disposable plastic straw connected to the halimeter was placed 2 cm inside the patients mouth without touching any other part of the oral cavity , the patient was refrained from breathing , and the maximum reading shown by the halimeter was recorded . the selected subjects underwent baseline scaling procedure to avoid wide variations in scores and also because the mouthrinse acts only after an already formed biofilm is removed . after 15 min of scaling procedure , the organoleptic and halimeter scores were re - recorded , and these were considered as the baseline values . the subjects were then randomly and equally assigned into any of the three groups group a - positive control - received 0.2% chx mouth rinse ; they were asked to use 10 ml mouthrinse twice daily after brushing and were told to avoid eating or drinking for 20 min after the use of mouthrinse . group b - test - received commercially available herbal mouthrinse , they were asked to use 15 ml of mouthrinse twice daily as per the dosage and were given no other set of instructions , unlike group a subjects . the subjects were told to report back at the 7 and 14 day , respectively . during this period , they were called once in a week to reinforce the instructions and to ensure that they continued using the mouth rinse . they were also instructed to report back with the empty bottles to check the compliance . furthermore , patients were asked for any discomfort that they experienced and were examined for adverse effects if any . the statistical analysis was carried out using spss 20 software ( spss 20 , ibm , armonk , ny , usa ) . whitney u - test , and wilcoxon matched pairs test were applied for performing the analysis . baseline scores were matched for all the subjects , and there was no statistically significant difference between the baseline values as mentioned in table 1 . a significant decrease in both the scores was seen in all the groups after scaling [ tables 2 , 3 and figures 1 , 2 ] . pi showed a slightly greater reduction in group b when compared to group a on the day 7 , but the overall reduction was more in group a on the 14 day although both the above - observed differences were not statistically significant . gi , on the other hand , was reduced slightly more in group a at both the recall intervals , but it was of no statistical significance when compared to group b. the least reduction in scores was shown by group c for both indices . intergroup comparison of plaque index at all - time intervals intergroup comparison of gingival index at all - time intervals on the day 7 , group b , which received the herbal mouthrinse showed slightly more reduction in organoleptic ( difference 0.03 ) and halimeter scores ( difference 0.10 ppb ) than group a , but it was not of any statistical significance , whereas group c showed the least reduction in both the values . on the day 14 group a showed the maximum reduction in both the scores but this was not of any statistical significance when compared to the test group b. group c subjects showed least reduction in the scores at both the point intervals [ table 4 and figure 3 ] . intergroup comparison of halimeter scores ( in ppb ) at all - time intervals halimeter scores ( in ppb ) chx mouthrinse ( positive control ) : commercially available nonalcoholic 0.2% chx mouthrinse ( rexidin ; warren pharmaceuticals pvt . , ltd . , india)herbal mouthrinse ( test ) : containing ( i ) extracts : bhibitaka ( terminalia bellerica , 10 mg ) , nagavali ( piper betle , 10.0 mg ) pilu ( salvadora persica , 5.0 mg ) ( ii ) powders : peppermint satva ( mentha spp . , 1.6 mg ) , yavani satva ( trachyspermum ammi , 0.4 mg ) and ( iii ) oils : gandhapura taila ( gaultheria fragrantissima , 1.2 mg ) , ela ( elettaria cardamomum , 0.2 mg ) . ( hiora ; himalaya herbal healthcare , bengaluru , india)placebo mouthrinse ( negative control ) : distilled water . chx mouthrinse ( positive control ) : commercially available nonalcoholic 0.2% chx mouthrinse ( rexidin ; warren pharmaceuticals pvt . , ltd . , india ) herbal mouthrinse ( test ) : containing ( i ) extracts : bhibitaka ( terminalia bellerica , 10 mg ) , nagavali ( piper betle , 10.0 mg ) pilu ( salvadora persica , 5.0 mg ) ( ii ) powders : peppermint satva ( mentha spp . , 1.6 mg ) , yavani satva ( trachyspermum ammi , 0.4 mg ) and ( iii ) oils : gandhapura taila ( gaultheria fragrantissima , 1.2 mg ) , ela ( elettaria cardamomum , 0.2 mg ) . ( hiora ; himalaya herbal healthcare , bengaluru , india ) placebo mouthrinse ( negative control ) : distilled water . a significant decrease in both the scores was seen in all the groups after scaling [ tables 2 , 3 and figures 1 , 2 ] . pi showed a slightly greater reduction in group b when compared to group a on the day 7 , but the overall reduction was more in group a on the 14 day although both the above - observed differences were not statistically significant . gi , on the other hand , was reduced slightly more in group a at both the recall intervals , but it was of no statistical significance when compared to group b. the least reduction in scores was shown by group c for both indices . intergroup comparison of plaque index at all - time intervals intergroup comparison of gingival index at all - time intervals on the day 7 , group b , which received the herbal mouthrinse showed slightly more reduction in organoleptic ( difference 0.03 ) and halimeter scores ( difference 0.10 ppb ) than group a , but it was not of any statistical significance , whereas group c showed the least reduction in both the values . on the day 14 group a showed the maximum reduction in both the scores but this was not of any statistical significance when compared to the test group b. group c subjects showed least reduction in the scores at both the point intervals [ table 4 and figure 3 ] . intergroup comparison of halimeter scores ( in ppb ) at all - time intervals halimeter scores ( in ppb ) chx mouthrinse ( positive control ) : commercially available nonalcoholic 0.2% chx mouthrinse ( rexidin ; warren pharmaceuticals pvt . , ltd . , india)herbal mouthrinse ( test ) : containing ( i ) extracts : bhibitaka ( terminalia bellerica , 10 mg ) , nagavali ( piper betle , 10.0 mg ) pilu ( salvadora persica , 5.0 mg ) ( ii ) powders : peppermint satva ( mentha spp . , 1.6 mg ) , yavani satva ( trachyspermum ammi , 0.4 mg ) and ( iii ) oils : gandhapura taila ( gaultheria fragrantissima , 1.2 mg ) , ela ( elettaria cardamomum , 0.2 mg ) . ( hiora ; himalaya herbal healthcare , bengaluru , india)placebo mouthrinse ( negative control ) : distilled water . chx mouthrinse ( positive control ) : commercially available nonalcoholic 0.2% chx mouthrinse ( rexidin ; warren pharmaceuticals pvt . , ltd . , india ) herbal mouthrinse ( test ) : containing ( i ) extracts : bhibitaka ( terminalia bellerica , 10 mg ) , nagavali ( piper betle , 10.0 mg ) pilu ( salvadora persica , 5.0 mg ) ( ii ) powders : peppermint satva ( mentha spp . , 1.6 mg ) , yavani satva ( trachyspermum ammi , 0.4 mg ) and ( iii ) oils : gandhapura taila ( gaultheria fragrantissima , 1.2 mg ) , ela ( elettaria cardamomum , 0.2 mg ) . ( hiora ; himalaya herbal healthcare , bengaluru , india ) placebo mouthrinse ( negative control ) : distilled water . subjects using chx showed maximum reductions in the halimeter and organoleptic scores at the end of the 14 day which were the primary outcomes of the study , whereas the group which was using herbal mouthrinse showed slightly lesser and nonstatistically significant difference in scores than the positive controls . secondary outcomes of the study including the plaque and gi were also in accordance with the primary outcomes . the control group showed least changes in all the parameters of the study which also varied statistically with both the positive control and the test group . the reduction in all the parameters in group a was due to 0.2% chx gluconate which has been set as the gold standard chemical in the reduction of breath odor . the almost equivalent reduction in the scores shown by the herbal mouthrinse can be attributed to its various constituents such as , s. persica , piper betel , peppermint satva , e. cardamomum , and g. fragrantissima all of which have been shown to have an anti - inflammatory and antibacterial action against various aerobic and anaerobic microorganisms . furthermore , these constituents help to increase the salivary secretion in the mouth and thus in the reduction of oral malodor . herbal agents have been compared with chx mouthrinses in the past with similar antibacterial effects . in this study , a single examiner performed all the tests and also dispensed the mouth rinses , and there were no dropouts although a double - blind , randomized control trial as opposed to this could have been performed for stronger evidence . the significant reductions as obtained by both the formulations in this study can be compared to studies with individual agents done in the recent past where the authors could attain a significant reduction in breath malodor using green tea and chlorine dioxide . the evidence of the efficacy of such chemical agents in a mouthrinse or dentifrice formulation on the control of oral malodor can be derived from the systematic reviews ; slot et al . , and blom et al . cochrane review in 2008 pointed that mouth rinses containing some antibacterial agents can reduce oral malodor to some extent , but the chx containing mouth rinse resulted in noticeable but temporary staining of the tongue and teeth . in accordance with the evidence of both the active ingredient containing mouthrinses showed a significant reduction in the breath malodor on the day 14 . thirty - four percent subjects using chx reported of a change in taste perturbation and stains on teeth by the end of the study . the set of instructions given to the subjects in group a to use it half an hour after brushing was due to the cationic nature of the compound which tends to interact with the anionic detergent in the tooth paste and thus is not effective if used immediately . furthermore , they were told to refrain from eating and drinking for 20 min after its use which was to avoid staining of the teeth as chx reacts with colored components in food items . subjects who were working / college students found it difficult to follow these instructions in the morning when they had limited time and thus , they presented with staining . since no such interactions of the herbal mouthrinse have been reported no specific instructions of usage were given to the group b subjects , which was thus more convenient to use as reported by the subjects of this group . furthermore , none of them showed staining or altered taste perturbation at the end of the 14 day . although 97% of these subjects reported of burning sensation on using the mouth rinse for the initial 3 days . this can be attributed to some specific constituents in the mouth rinse such as the essential oils . use of chemical agents for the reduction of oral malodor or as a breath freshener has an effect for a shorter duration and thus , a long - term prescription of these agents is needed . with the adverse effects and reduced patient compliance , due to the strict instructions , which come with chx it may be less preferred despite of its superior effects . although no significant adverse effects were reported by this study with the use of the herbal mouth rinse long - term studies need to be conducted to monitor the same , also since none of the systematic reviews provide a considerable evidence for the use of agents with an active herbal ingredient for reduction of oral malodor as opposed to chx long - term studies , and further evidence needs to be reported . within the limitations of the study , it can thus be concluded that the herbal mouth rinse which showed an equivalent reduction in the breath odor as seen by no statistically significant difference between group a and group b can be prescribed more safely and with predictable outcomes in patients with oral malodor .	objectives : despite the adverse effects of chlorhexidine ( chx ) in the oral cavity , it is still the most commonly prescribed mouthrinse for halitosis control due to its excellent results . the purpose of this study was to compare the efficacy of a mouthrinse with herbal formulation for halitosis control with 0.2% chx gluconate containing rinse and to simultaneously assess adverse effects caused by the herbal mouthrinse if any.materials and methods : ninety - six systemically healthy subjects with chronic generalized gingivitis were recruited in the study and divided into three groups receiving 0.2% chx gluconate mouthrinse , herbal mouthrinse , or negative control , respectively as group a , b , and c. the halimeter scores and organoleptic scores were recorded for each subject at baseline and after scaling . others parameters recorded were plaque index and gingival index . all scores were reassessed on the 7th and 14th day , respectively . statistical analysis was performed using kruskal wallis anova , mann whitney u - test , and wilcoxon matched pairs test.results:there was an overall reduction in the halimeter scores both in group a and b subjects which were not statistically significant within the groups ; this was in accordance with the decrease in the mean organoleptic scores . reduction in group c scores was the least and differed statistically from both group a and b scores.conclusions:the results indicate an equivalent reduction in breath odor by both the herbal mouthrinse and chx . furthermore , side effects were less , and patient compliance was more with the herbal mouthrinse , which can thus be prescribed more safely and with predictable outcomes for oral malodor .
You are an expert at summarizing long articles. Proceed to summarize the following text: many experimental and theoretical groups have dedicated efforts to studying fundamental phenomena governing transport at the nanoscale as well as pioneering devices using nanoscale effects . rectification of ion current with nanopores is an example of transport properties stemming from the nanoscale openings of the structures . rectifying nanopores feature ion currents that are higher for voltages of one polarity compared to currents recorded for voltages of the same absolute values but of opposite polarity . they can thus work as switches for ions and charged molecules in solutions and could become the basis for ionic circuits used in logic and sensory systems . glass pipettes and tapered cone shaped nanopores with negative surface charges were reported to be cation selective and conduct current with the preferential direction of the cation flow from the narrow opening to the wide base of the pore . current voltage curves of the pores were found to depend on the geometric characteristics of the small opening , the length of the pore , and the surface charge density of the pore walls . rectification properties of ionic systems were significantly improved by introducing surface charge patterns in which two zones of the pore walls were characterized by different surface characteristics . in a bipolar diode , there is a zone with positive surface charges in contact with a zone with negative surface charges ; a unipolar diode contains a junction between a zone that is charged and a zone that is neutral . both types of ionic diodes were able to suppress ionic flow in one direction almost entirely so that the currents for one polarity were hundreds of times higher than currents for the voltages of opposite polarity . fewer studies , however , have been performed on how rectification depends on the type of transported ions . the influence of cation charge has been reported for both man - made and biological pores . as an example , rectification of conically shaped , negatively charged polymer nanopores in kcl was compared with recordings in calcium and cobalt(iii ) ions . the multivalent ions were shown to induce the effect of charge inversion ; i.e. , in their presence , originally negatively charged pore walls became effectively positively charged . charge inversion was observed as a qualitative change in the current voltage curves , suggesting the pores became anion selective . much less is known on whether ions with the same charge state can have differing influence on ion transport through nanopores . one study explored rectification of the bacterial pore -hemolysin in various monovalent chloride salts ; pore rectification was strongest in cscl and weakest in licl , and the difference was attributed to interactions of lithium ions with negatively charged groups on the pore walls . a similar question , as to the importance of type of monovalent cations for the rectification of man - made nanopores , has not yet been asked . the opening diameters of man - made structures are often significantly larger than the narrowest constriction of the -hemolysin pore . understanding transport of various cations in pores characterized with different opening diameters will provide insight into which interactions between ions and surfaces influence and determine properties of ionic transport through nanopores . this question is especially timely , since type of cation has also been reported to influence detection of dna molecules using nanopores in the resistive pulse technique . studying interactions of ions with surfaces and walls in model nanopores is therefore important for understanding electrostatics at the nanoscale as well as making better nanopore sensors . ion transport through nanopores in contact with monovalent salts such as kcl , nacl , and licl is typically described using continuum models based on the poisson ions are treated as point charges and their interactions with charges on the walls are captured by the poisson we show limited application of this approach for the description of ionic transport through rectifying polymer nanopores in different monovalent salts . first we present experimental observations of ion current rectification of single conically shaped nanopores with opening diameters between 3 and 25 nm , measured in kcl , nacl , and licl . the measurements indicate the pores exhibit significantly lower rectification degrees in the lithium salt compared to the rectification in potassium and sodium chloride . the experimental findings are explained by all - atom simulations performed by molecular dynamics ( md ) tools . we use a modified version of the all - atom representation of a polymer pore created in ref ( 48 ) to reveal the effects of differential ion binding to surface charged groups of identical poly(ethylene terephthalate ) ( pet ) nanopores in kcl , nacl , and licl solutions . we assess the dependence of rectification on the effective surface charge densities modulated by kcl , nacl , and licl . single conically shaped nanopores were prepared in 12 m thick films of pet using the track - etching technique . briefly , the films were irradiated with single au or u ions accelerated to 11.4 mev / u at the unilac linear accelerator of the gsi helmholtzzentrum fr schwerionenforschung in darmstadt , germany . in the next step , the irradiated films were subjected to wet chemical etching performed in a homemade conductivity cell . one side of the film was in contact with 9 m naoh , while the other chamber of the conductivity cell was filled with an acidic stopping medium . after the etching had been completed , the membranes were rinsed with the stopping solution and water . the chambers of the conductivity cell were filled with 1 m kcl , and two homemade ag / agcl electrodes were used to record a current voltage curve . the small opening of the nanopore was estimated based on the linear portion of the recording and approximating the pore shape with a truncated cone . the large opening diameter created at the side that had been in contact with naoh could be found based on the rate of nonspecific etching of pet in the etchant and time of etching . diameters of pores used in this study were 325 and 300750 nm for the small and large opening , respectively . once the pore opening diameters were characterized , transport properties of each pore were measured in kcl , nacl , and licl in the concentration range 10200 mm . the side of the membrane with the large opening was in contact with a working electrode ; the other side was grounded ( figure 1 ) . ion current through a single conically shaped nanopore with opening diameters of 10 nm ( the tip ) and 1000 nm ( the wide opening ) was modeled by numerically solving the poisson we used a recently developed software package mssimpore , shown to be especially powerful in modeling pores with high surface charge densities . although mssimpore is based on 1d reduction of the pnp model , it still allows for an explicit treatment of the electrolyte reservoirs in contact with the membrane . all - atom representation of a conical pet nanopore in contact with 0.1 m nacl solution . sodium and chloride ions are depicted as yellow and teal spheres , respectively ; water is not shown . the nanopore tip is 3 nm in diameter as measured at the pet edge . the circuit diagram visualizes the electrode configuration used in experiments and in simulation ; for negative applied voltages , cations move from the tip ( shown at the bottom ) toward the wider opening of the pore . all - atom representation of a conical pet nanopore was adapted from a model designed previously with surface charge density of 1 e / nm , appropriate to simulate conditions at ph 7 . deletion of residues inside a geometric cone aligned with the existing hourglass - like pore resulted in a conical pore with an opening angle of 15 ( figure 1 ) . the pore was 3 nm wide at the tip and 5 nm wide at the base , embedded in a pet membrane that was 10 nm long , 8 nm wide , and 11 nm deep with periodic boundary conditions to simulate an extended membrane . this small system size , as compared to the 12 m long pores used in experiments , enabled us to run simulations for long times ( tens of nanoseconds ) without exceeding reasonable limits for required supercomputing resources . ions were added by replacement of randomly selected water molecules as necessary to neutralize the charge on the membrane and reach 0.1 m concentration in the bulk solution . three such systems were created to separately simulate the nanopore in licl , nacl , and kcl solutions . the size of the simulation - ready system was 26 nm 8 nm 11 nm and consisted of 221 778 atoms , including pet membrane and electrolyte solution . additional three systems consisting solely of 0.1 m bulk solution ( kcl , nacl , or licl ) were prepared , each of dimensions 26 nm 8 nm 11 nm with total of 220 542 atoms . all md simulations were performed using molecular dynamics program namd and with charmm36 parameters for atomic interactions supplemented by nbfix corrections to accurately describe ion pet interactions . particle mesh ewald full electrostatics computed over a cubic grid with spacing < 1 and a smooth ( 1012 ) cutoff for van der waals interactions were implemented . we used 2 fs time step , rigid hydrogen bonds , and periodic boundary conditions . andersen thermostat , rate 50 ps , at 295 k. the tip3p water model was used in each simulation . relative restraints , where necessary to maintain pet membrane integrity at the surface , were enforced using the extrabonds feature of namd and applied harmonic restraints between single carbon atoms of neighboring pet residues ; the spring constant of each restraint was 0.2 kcal mol . upon assembly the systems were then equilibrated for 0.5 ns in the npt ensemble ( constant number of particles n , constant pressure p , and constant temperature t ) at 1 atm pressure enforced by the langevin piston extendible along the pore axis , with decay and period of 800 fs . each of the systems was then simulated in the nvt ensemble ( constant number of particles n , volume v , and temperature t ) at a 2 v transmembrane bias induced by applying an electric field perpendicular to the membrane or along the longest axis for the bulk electrolyte systems . pet nanopore in each of kcl , nacl , and licl was modeled for both polarities of the bias for 20 ns ; the three bulk electrolyte systems were simulated for 20 ns each with only one polarity . 20 ns simulations in the absence of an external voltage bias further characterized the pet nanopore in the presence of the three salts . in each simulation of the pet nanopore , ionic current and distribution of ions throughout the system reached a steady state within the first 6 ns of the simulations ; our analysis uses only the remainder of each trajectory . enabling the zeromomentum parameter in namd prevented aberrant acceleration of the electro - osmotic flow , and postsimulation realignment of the pet membrane because of the low polarizability of the material , no special arrangements were made to match the dielectric polarizability of the simulated pet membrane . figure 2 presents example current voltage curves of two single conically shaped nanopores recorded in 50 mm solutions of kcl , nacl , and licl . the magnitude of the currents changes in accordance with the ionic mobility ; among kcl , nacl , and licl , lithium has the lowest mobility and consequently , the currents in licl were the lowest among the recordings in the three salts . the experiments were performed at ph 8 at which the pore walls carry negative surface charge due to deprotonated carboxyls . charge density of the pore walls of 1 e / nm was estimated based on measurements of pore conductance at a wide range of kcl concentrations between 1 mm and 1 m and ion conductance saturation at low ionic strengths . the measurements were performed for a cylindrical pore however preparation of pores of any geometry in pet involves etching irradiated foils in naoh . thus , we assumed the value of 1 e / nm to be valid for tapered cone - shaped pores as well . for simplicity , we also assumed the charge density was uniform throughout the whole length of the pore . the recordings in figure 2 also indicate the examined pores rectified ion current with the preferential direction of cation flow from the tip to the wide opening ( base ) of the cone . current rectification in kcl of conically shaped nanopores was examined in detail before and explained via voltage dependence of ionic concentrations in the pore . at the forward bias ( negative voltages in our experimental setup ) , concentration of both cations and anions increases above the bulk concentration , leading to a nonlinear current enhancement . as a result , negative currents are carried by both types of ions , and the pores at the forward bias are only weakly cation selective . at the reverse bias ( positive voltages in our electrode configuration ) , the ionic flow is limited by the formation of a depletion zone , whose width increases with the increase of reverse bias . the depletion zone contains mostly cations ; thus , positive currents can be treated as cationic currents only . rectification properties of nanopores are often described by a rectification degree defined as a ratio of currents recorded at a given magnitude of voltage but of opposite polarities . we were , however , surprised to see that rectification degrees of conically shaped nanopores in licl were consistently lower compared to the recordings in kcl ( figure 3 ) . this effect was observed in pores with a wide range of opening diameters between 3 and 25 nm . the difference in rectification properties in licl versus kcl was most pronounced in the range of salt concentrations between 50 and 200 mm . four out of seven examined pores also differentiated between kcl and nacl , i.e. , rectification degrees in nacl fell between rectification degrees in kcl and licl ; the four structures included three with sub-5 nm opening diameter . for the 22 nm pore , the lower rectification degrees observed in licl became pronounced only at voltages above 1 v ( figure 3d ) ; this behavior was reproduced in a 25 nm pore ( supporting information ) . we explain this observation by voltage - dependent enhancement of ionic concentrations in conical pores at negative voltages . for pores with a wider opening , larger magnitudes of voltage need to be applied to get a similar enhancement of cation and anion concentrations compared to the enhancement in narrower pores ( supporting information ) . the experiments suggest concentration of accumulated lithium ions in the pore has to reach a critical value to reduce the magnitude of negative currents and ion current rectification . we would also like to point to a weak dependence of the rectification degree on electrolyte concentration and pore opening diameter observed for sub-20 nm pores ( figure 3 ) . an existence of a range of concentrations with similar rectification degrees was reported before and explained by the formation of the depletion zone even in pores whose opening diameter is several times larger than the debye length . the dependence of ion current rectification on electrolyte concentration and pore diameter has a broad maximum because a depletion zone can not be fully created if the debye length overlap occurs over a significant portion of a pore . this leads to the nonintuitive observation of similar rectification properties of pores with a wide range of opening diameter , reported for kcl before . the increase of rectification degree in licl with voltage is weaker than in the case of sodium and potassium salts , again suggesting that accumulation of lithium ions in the pore might interfere with further enhancement of cation and anion concentrations . it is important to mention that each conically shaped nanopore even with the same tip diameter is unique and different . opening diameter of the base of the cone is determined by the etching time and for the set of pores used in this study varied between 300 and 750 nm . rectification degree of conical pores was found dependent on the cone opening angle , shape of the very tip of the pore , and even atomistic details of the pore walls . thus , by presenting data of four pores , we emphasize the qualitative reproducibility of lower rectification degrees in licl compared to kcl and quantitative variability of the magnitude of the effect . additional data for three nanopores are shown in the supporting information . in order to understand the origin of the dependence of rectification degree on type of salt , we looked first at ratios of ion currents recorded in kcl and nacl as well as kcl and licl ; the obtained values were compared with ratios of bulk conductivities of the salts ( kcl/nacl and kcl/licl ) as well as ratios of diffusion coefficients of the cations . the pore with 4 nm opening diameter was unstable at voltages beyond 3 v. thus , only data for lower voltages were considered for this sample ; the remaining pores were analyzed in the voltage range of 4 and + 4 v ( figure 4 ) . some rectifying nanopores with small opening diameters were shown before to exhibit intrinsic current fluctuations . as a consequence , current ratios for the 4 nm pore also have the largest error bars , especially pronounced in kcl . smaller variation of currents in nacl and licl might be related with their lower rectification degrees , suggesting lower electric fields at the pore tip compared to the case in kcl . concentration of electric field at the narrow opening was suggested to lead to current instabilities . because of the fluctuating current signal and large error bars of the current ratios , values in only two salts concentrations are shown for the 4 nm pore ( figure 4a ) . for nearly all examined pores , the ratio of negative currents in kcl and in licl was significantly higher than it would be expected from the ratio of bulk conductivities or diffusion coefficients . this finding indicates the currents of nanopores in licl were reduced compared to the predictions based on the bulk solution behavior , treating the recordings at kcl as a reference point . the ratio of negative currents in kcl and licl varied between different pores and was as high as 10 and as low as 3 for 4 v ; the ratio of positive currents was often close to the ratios of diffusion coefficients or bulk conductivities ( figure 4 ) . the difference in currents in kcl and nacl was typically voltage - independent and smaller than in the case of kcl and licl . voltage curves of single conically shaped nanopores with opening diameters of ( a ) 9 and ( b ) 14 nm . the recordings were performed in 50 mm solutions of kcl , nacl , and licl . rectification degrees of single conically shaped nanopores with opening diameters of ( a ) 4 and 350 nm , ( b ) 9 and 300 nm , ( c ) 14 and 520 nm , and ( d ) 22 and 570 nm . the 4 nm pore exhibited large fluctuations of ion current in 10 mm of kcl , nacl , and licl and above 3 v for all other studied concentrations ; thus , data for 50 , 100 , and 200 mm in the voltage range between 3 and + 3 v are presented . all remaining structures were analyzed in the voltage range 4 to + 4 v. for each pore , rectification degrees for three kcl , nacl , and licl concentrations are shown . ratios of ion currents recorded in kcl and nacl ( kcl / nacl ) and kcl and licl ( kcl / licl ) for single pores with an opening diameter of ( a ) 4 , ( b ) 9 , ( c ) 14 , and ( d ) 22 nm . ratios of diffusion coefficient , d , of cations are indicated as dotted lines . ratios of bulk conductivities are shown as black lines labeled in ( d ) . in order to determine if the observed differences in rectification degrees and values of currents measured in kcl , nacl , and licl can be explained by the differences in diffusion coefficients of potassium , sodium , and lithium ions , ion transport in conical pores was modeled using the continuum approach based on the poisson the purpose of the simulations was not to quantitatively fit the experimental data but rather check if the continuum approach predicts the lowest rectification in licl . the model did not include navier stokes equations ; thus , electroosmosis was not taken into account . conically shaped nanopipettes were shown to produce polarity - dependent electroosmotic fluid flow ; however , our earlier numerical modeling of rectifying nanoporous systems indicated the influence of electroosmosis on ion current rectification was small . the modeling was performed for a tapered cone pore with opening diameters of 10 and 1000 nm and surface charge density of 1 e / nm . we used the recently developed software package mssimpore , which uses a newton scheme to discretize the pnp equations . ions were treated as point charges , and their diffusion coefficients in the pore were assumed to be equal to their values in a bulk solution found in the literature . we justified the choice by an almost linear dependence of the salts bulk conductance on concentration up to 2 m. figure 5 presents modeled current voltage curves and resulting rectification degrees for licl , nacl , and kcl . the model indeed captured the rectification effect observed with conically shaped nanopores and the lowest values of currents in licl . the continuum approach , however , could not reproduce the lowest rectification degrees experimentally observed in the lithium salt . in fact , the continuum modeling predicted a modest increase of rectification in licl compared to kcl . we also plotted the ratio of pnp modeled currents in kcl and licl and kcl and nacl in a range of voltages between 1 and + 1 v ( figure 6 ) . our experiments showed the ratios of ion currents in kcl and licl to be higher for negative voltages compared to the ratios at positive voltages , while the continuum modeling predicted an opposite voltage dependence . the modeled data can be understood taking into account voltage - dependent ionic selectivity of conically shaped pores . positive currents are primarily carried by positive ions thus the ratio of the modeled currents in kcl and licl ( or kcl and nacl ) corresponds to the ratio of diffusion coefficients of potassium and lithium ions ( potassium and sodium ) . at negative voltages , the pore lumen is filled with both cations and anions ; thus , the ratio of currents approaches the ratio of bulk conductivities in 50 mm kcl . in 10 mm kcl , the ratio of transmembrane negative currents is higher than in bulk likely due to large enhancement of ionic concentrations in the pore . nernst planck equations solved numerically for a single conically shaped nanopore with opening diameters of 10 nm ( tip ) and 1000 nm ( base ) . the surface charge density of the pore walls was set to 1 e / nm . current voltages curves and rectification degrees are shown in ( a ) for 10 mm and ( b ) 50 mm kcl , nacl , and licl . ratio of ion currents predicted by the continuum modeling based on the poisson planck equations solved for a single conically shaped nanopore in ( a ) kcl and nacl and ( b ) kcl and licl . ratios of bulk conductivities ( kcl/nacl and kcl/licl ) in 10 and 50 mm as well as of diffusion coefficients d are also indicated . the continuum modeling was performed assuming the surface charge density of nanopores was not affected by the concentration or type of salt solution . both the ion current rectification of conically shaped pores and ion current values in all nanopores are known to be modulated by the electrical surface characteristics . we therefore hypothesized the experimental results in licl could be explained if lithium ions lowered the effective surface charge of the pores . lithium ions were recently found to reduce ion current rectification in a bacterial pore of -hemolysin ( -hl ) . although -hl is weakly anion selective , it has 63 carboxyl groups along the ionic path . all - atom molecular dynamics simulations revealed that differential affinities of cations to carboxyls are responsible for the reduction of current and rectification . better screening of negatively charged residues by lighter monovalent ions reduced the effective charge of the pore opening and consequently the degree of ion current rectification . in contrast to -hl , the polymer pores considered here are cation selective , and the pore walls are covered with carboxyl groups at a high density of 1 per nm . the effect of lithium ions on ion current values and rectification was a few times more pronounced compared to the effect measured in -hl . in order to elucidate the microscopic phenomena underlying differential rectification of ionic current in polymer nanopores , a set of md simulations were performed utilizing an all - atom representation of a pet nanopore . the primary goal of the simulations was to test for the differential binding of monovalent ions to charged pore walls . it is important to mention the md model captured both electrophoretic and electroosmotic effects on ions and water . all simulations were performed at ph 7 , which corresponded to the surface charge density of 1 e / nm . each system measured 26 nm 8 nm 11 nm and contained a 10 nm thick pet membrane in 0.1 m licl , nacl , or kcl solution . after equilibration , each of the three systems was simulated at 2 v of both polarities as well as in the absence of the external bias for a total of nine simulations of 20 ns length each . the coordinates of the system were recorded every 6000 frames , or 12 ps , to enable detailed analysis of the system dynamics and building trajectories of all ions . analysis of the trajectories revealed cations would bind to the pet membrane surface , resulting in the reduction of the effective surface charge density on the pore walls ( figure 7 ) . an ion was considered bound if it remained within 7 of the pore wall and failed to move a minimum distance expected due to diffusion . to find the number of bound ions as a function of time , we performed a frame - by - frame analysis of each cation s position , calculated the minimum expected cation displacement due to diffusion between frames , and compared it with the actual displacement . initial estimates of the minimum expected displacement , r , were found using the formula r = ( 6dt ) , where d is the diffusion coefficient of an ion and t is the considered time interval . we assumed values of d of 1.1 , 1.4 , and 2.0 nm / ns for lithium , sodium , and potassium ions , respectively , which are close to the experimental values for dilute solutions . further validation of the model revealed that sampling cations position every 30 recorded frames , or t 0.36 ns , and using a minimum expected displacement of 48 , resulted in an average number of bound cations at any given step that was insensitive to small parameter changes . the requirement that ions have to be within a certain distance from the surface to be considered bound was found to exclude only 1% of cations otherwise expected to be bound . the number of bound ions was subsequently used to calculate the effective surface charge density of the pore walls in the presence of the three salts ( table 1 and figure 7 ) . the simulations indicated li ions neutralized a higher fraction of the pet surface charge compared to na or k ions . these results indeed explain the experimental observation of the dependence of rectification degree on the type of electrolyte . ion current rectification of conically shaped nanopores is known to be modulated by the surface charge density . there is a range of surface charge densities where the decrease in the number of charged groups leads to the reduction of ion current rectification . thus , it is expected that licl currents will be rectified least when compared with the rectification in kcl and licl . the performed md simulations and effective surface charge reduction observed with nacl and licl can also explain why only a subset of studied pores showed differences in rectification in nacl and kcl ; in all studied pores , rectification in licl was the lowest . for high surface charge densities , the dependence of rectification on surface charge is relatively weak ; thus , the reduction of the surface charge by sodium can not always be detected as a change in rectification . interestingly , the two largest pores examined in this study with the opening of 22 and 25 nm exhibited the highest rectification degrees in nacl and not kcl , following predictions of the continuum modeling . density of cations bound to pet pore walls vs simulation time for each of the nine performed md simulations with kcl , nacl , and licl at 2 v of both polarities . zero on the x - axis corresponds to the beginning of the production md simulation run . number of bound lithium ions increases in the first 10 ns when it saturates and exhibits fluctuations around a steady average value . without ion ( a ) local molarity and ( b ) linear density of mobile ions along the nanopore axis obtained in md simulations performed in 0.1 m licl . plus and minus signs indicate polarity of the applied voltage , and arrows show the direction of cation flow in each case . local pore radius along the axis is shown in ( a ) and ( b ) ( black line , see right y - axis ) ; regions beyond 50 and + 50 are outside the pore . red circle indicates the constriction of the pore , where a depletion zone forms at 2 v. the existence of the depletion zone was observed in kcl and nacl solutions as well ( not shown ) . note that rectification degrees less than 1 indicate rectification direction opposite to that observed in experiments . the performed simulations also allowed us to quantify transmembrane currents carried by each type of ion . in contrast to experimental observations , ion currents obtained from md simulations exhibit an opposite rectification ; i.e. , positive currents are higher in magnitude than negative currents ( tables 2 and 3 ) . the discrepancy between the md and experimental results stems most probably from the dimensions of the pet pore used in the all - atom simulations . a prior analysis revealed that the formation of a depletion zone for positive voltages , and enhancement of ionic concentrations for negative voltages occurred only in pores that were at least 100 nm long , thus 10 times longer than the one used in our md simulation system . the concentrations of mobile ions are enriched when cations are moving from the wide opening to the tip of the pore . voltage modulation of ionic concentrations occurs near the tip : the density of mobile ions at 2 v is 3 times lower than the density at + 2 v. note : it is opposite to what is observed in long , conically shaped nanopores . we think the discrepancy in rectification of the md simulated and long pores occurs due to possibly different mechanisms responsible for voltage modulation of ionic concentrations . in long pores , the depletion zone is created when potassium ions are sourced from the wide opening and thus when they have to be transported through a long resistive element to reach the pore tip where the cation concentration is dominated by the surface charge . in a short pore , like the one modeled by md , the access of cations to the pore tip can be limited by the small opening . it will be interesting to test experimentally the magnitude and direction of rectification of sub-20 nm long nanopores . to provide further evidence ion currents in licl through conically shaped nanopores are reduced due to interactions of the ions with charges on the walls , we also simulated ion currents in bulk volumes of licl , nacl , and kcl . we used the same voltage and salt concentrations as these in the pet nanopore simulations and calculated ratios of currents in the modeled bulk solutions and pet nanopore ( table 4 ) . the simulations revealed a significant decrease of the current through the pore in licl compared to the reduction of the current observed in kcl . for both voltage polarities , the ratio of currents ikcl / ilicl through the pore was significantly higher than the currents ratio obtained in bulk kcl and licl ( table 4 ) . thus , in accordance with experiments ( figure 4 ) , our all - atom simulations suggest that interactions of lithium ions with the pet membrane reduce the nanopore conductance to a larger extent than in the case of potassium ions . the findings were supported by calculating the ratio of diffusion coefficients of cations in the pore and in the bulk using simulated ionic trajectories . the diffusion coefficient of li in the pore was reduced by 50% compared to the value in the bulk . the reduction of diffusion coefficient for k and na in the pore was smaller and equal to 30% and 40% , respectively . in this article we present experimental and modeling studies detailing the effect of three monovalent cations on ion current rectification of conically shaped nanopores . our experimental findings were explained by molecular dynamics simulations of an all - atom representation of a model polymer pet pore . the simulations revealed the differences in ionic rectification of conical nanopores measured in licl , nacl , and kcl resulted from differential binding of the cations to the pet membrane surface . the number of bound lithium ions was larger than the number of bound k or na . consequently , lithium ions caused the most significant reduction of the effective surface charge density , and pores in licl showed the lowest rectification and currents . the reduction of lithium currents in the pore was larger than what could be predicted based on differences in bulk diffusion coefficients of k , na , and li ions . the results suggest that all - atom representation of nanopores can provide invaluable information helping to understand interactions between transported ions and pore walls . the continuum modeling based on pnp equations is sufficient to explain the effect of rectification but can not capture properties of ionic current carried by different monovalent cations . it would be interesting to model ionic transport with coupled pnp and navier stokes equations including the effect of induced charge electroosmosis as well electroosmosis induced fluid flow instabilities . addition of the fluid flow effects might improve the agreement between the model predictions and experimental observations . modulation of effective surface charge density by transported ions has very important implications for designing artificial ion selective membranes , ionic diodes , and ionic circuits . this study alerts researchers that monovalent ions can also modulate surface charge density of surfaces and influence functioning of ionic devices .	rectifying nanopores feature ion currents that are higher for voltages of one polarity compared to the currents recorded for corresponding voltages of the opposite polarity . rectification of nanopores has been found to depend on the pore opening diameter and distribution of surface charges on the pore walls as well as pore geometry . very little is known , however , on the dependence of ionic rectification on the type of transported ions of the same charge . we performed experiments with single conically shaped nanopores in a polymer film and recorded current voltage curves in three electrolytes : licl , nacl , and kcl . rectification degrees of the pores , quantified as the ratio of currents recorded for voltages of opposite polarities , were the highest for kcl and the lowest for licl . the experimental observations could not be explained by a continuum modeling based on the poisson nernst planck equations . all - atom molecular dynamics simulations revealed differential binding between li+ , na+ , and k+ ions and carboxyl groups on the pore walls , resulting in changes to both the effective surface charge of the nanopore and cation mobility within the pore .
You are an expert at summarizing long articles. Proceed to summarize the following text: echinococcus multilocularis is the fox tapeworm and the most pathogenic one among the 4 zoonotic species of the genus echinococcus , and thus e. multilocularis can cause an infection resulting in a potentially fatal chronic liver infection called human alveolar echinococcosis ( ae ) . e. multilocularis has an extensive geographic range , mainly across the northern hemisphere , including endemic regions in central europe , most of northern and central eurasia , extending eastward to japan and parts of north america . the intermediate hosts , mostly rodents and ungulates including humans , are infected by accidental ingestion of eggs shed in the feces of the definitive hosts . the metacestodes go through the small intestine and mostly reach the liver , but also other organs such as the lung and brain . human ae is a potentially fatal , chronically progressive hepatic infection with e. multilocularis , that is characterized by a long asymptomatic incubation period during which an invasive tumor - like multi - vesicular and exogenously budding mass - like lesion is developed . the parasitic lesion composes of dense granulomatous infiltration and microcalcifications microscopically , and eventually necrotic cavitation may occur . in korea , ae has never been reported , and herein , we report the first written case of human hepatic ae in a southeastern korean district , gimhae - si ( city ) . a 41-year - old woman residing in gimhae - si , gyeongsangnam - do , korea transferred to dong - a university hospital on 5 april 2002 for evaluation of the known hepatic mass . she denied any contact history with domestic animals or pets as well as livestock , and has not visited zoo and never traveled abroad . on 17 september 2001 routine radiologic examinations revealed a hepatic mass , and the pathologic findings of needle biopsied mass were described as coagulation necrosis . at dong - a university hospital , the liver showed an 8 cm sized ill - defined mass with 1.5 cm and 3 cm sized satellite nodules at the left lateral segment of the liver without lymph node enlargement on ct imaging . although non - neoplastic mass was considered , malignancy such as cholangiocarcinoma should be ruled out radiologically . laboratory data from routine cbc , chemistry , serology , electrolyte profiles , hormone analysis of blood , tumor markers ( -fetoprotein , carcinoembryonic antigen , and ca 19 - 9 ) , and urine analysis were all within normal limits . to rule out any possibility of malignancy , left hepatectomy was done . during operation , the lobectomized liver showed a relatively demarcated mass , 11 cm in greatest dimension and abutted several nodular masses of 1 - 3 cm in diameter , which showed necrosis on cut surface , grossly . histologically , extensive coagulation necrosis , granulomas , and dispersed acellular membranous shells within cystic spaces were observed . these gross and histologic findings corresponded with a parasitic infection of the liver , but identification of the specific parasite species was not processed . she was discharged without complications . during follow - up , on 19 july 2005 , a new nodular mass , 4.53.0 cm was observed in s5/8 segment of post - hepatectomized liver on ct imaging , and a needle biopsy of the mass showed coagulation necrosis . the hepatic mass was checked to be enlarged to 6.34.5 cm and several small nodules in both basal lungs on 7 august 2007 . the hepatic mass showed extensive necrosis , and the pulmonary nodules represented calcification and focally impinged air , suggesting calcified granuloma rather than metastatic malignancy . on 7 may 2010 , the hepatic mass was more enlarged , up to 10 cm in diameter and right supradiaphragmatic lymph node enlargement was found on contrast enhanced ct scan . relatively well defined small nodules were seen in both lower lobes of the lung , suggestive for calcified granulomas , and metastasis , even less likely ( fig . the eosinophilic count was 8.9% ( reference value : 0 - 7% ) , total ige was 1,944 ku / l ( reference value : 0 - 200 ku / l ) , and parasitological studies were all negative for helminths , including ascaris lumbricoides , trichuris trichiura , enterobius vermicularis , hookworms , and protozoa . a second operation , including a partial anterior resection , was done but the hepatic mass was not completely removed . the resected liver mass , measuring 16.29.54.3 cm was rimmed by raggedy , thickened , fibrotic or myxoid glisson 's capsule , focally adhered with fat tissues , and underlying parenchyme showed total necrosis in greenish yellow color , and normal liver was not present . the cut surfaces on serial sections were spongy , with mostly small and occasionally large cystic spaces ( fig . the cystic spaces were empty or filled with mucoid exudates , and inner surface was rimmed by more yellow wall . between the cysts , microscopically , the mass showed diffuse and extensive necrosis with totally effaced liver tissues . among necrosis , numerous variable - sized multilocular cysts with discernible lining were observed . the cysts contained ribbon - like eosinophilic laminated layers , characteristic for e. multilocularis , which appeared more strongly red by periodic acid - schiff ( pas ) stain ( fig . chronic granulomatous inflammation , composing of proliferating epithelioid cells surrounding the organisms , and infiltration of lymphoplasma cells , a few eosinophils , and giant cells were observed at the periphery of the mass ( fig . we could approach this unusual hepatic mass , mimicking clinical features of malignancy after consultation to professor jong - yil chai , department of parasitology and tropical medicine , seoul national university college of medicine , seoul , korea . we concluded that these findings corresponded well with hepatic alveolar echinococcosis although korea is not an endemic area for this cestode disease . she was discharged after the second operation without comlpication . during about 14 months of follow - up period , she has taken 800 mg of albendazole , orally in 2 divided doses , without any symptom . follow - up radiologic tests showed unremarkable changes of the remaining mass on the remnant liver , and slightly decreased size of pulmonary nodules . although , hokkaido of japan 's northmost island is known as an endemic area and in these days , the endemic areas have expanded , in korea , human ae is not notified to our knowledge . furthermore , in non - endemic areas , ae is enough to be confused with malignant tumor and misdiagnosed . we experienced an unusual clinical case , complaining of a hepatic mass with histological features of non - neoplastic and suggestive of a parasite infection and continuous clinical suspicion of malignant tumor for 10 years . even she has been residing in gimhae city which is a recently developed and industrialized area , but was a rural community , she denied any history of contact with domestic animals or pets as well as livestock and has been never visited other countries . in this regard , it is strongly suggested that a possible infection route from imported animals may be underlaid . concerning a literature review of human cestode infections in korea , min recognized that most human hydatidosis cases have been imported ones , from outside of korea , except 1 possible indigenous case , and they were all caused by cystic hydatidosis ( ce ) due to echinococcus granulosus , not ae . it has a risk of metastasis in advanced stages , usually resulting in secondary lesions in the lung or brain . a fatal outcome may occur in over 95% of untreated patients within a 10-year period following diagnosis . when a slowly growing tumor , visualized by imaging techniques , is detected , a case is verified if at least 2 of the following 4 parameters are fulfilled , according to the who recommendations : 1 ) typical organ lesions detected by imaging techniques , e.g. , abdominal ultrasound , ct , and magnetic resonance imaging , 2 ) detection of e. multilocularis specific serum antibodies by serotests , 3 ) histopathology compatible with ae , 4 ) detection of e. multilocularis nucleic acid in a clinical specimen . ct imaging of slow growing and recurred mass in this case displayed ill - defined hypodense mass with poor or no enhancement after contrast injection and no differences on arterial and portal phase , which is characteristic for hepatic ae . during the follow - up period of our case however , it is sometimes difficult to rule out other parasitic infections , pathologically and clinically , especially in non - endemic areas . multiple cysts , mostly empty and histologically lamellated membrane along the inner side of the cysts with characteristic pas ( + ) stain , are compatible with ae . lymphatic spread has been hypothesized to constitute a route for dissemination , however , the actual human involvement of lymph nodes in ae has not been frequently reported . in our case , we had not performed serologic and molecular studies for detection of e. multicularis - specific serum antibodies and nucleic acids until just prior to publication of this paper . however , these studies were subsequently performed and the results will be published elsewhere . in endemic areas , ae is considered the most serious parasitic zoonosis and ae incidence may increase in the future though the incidence is different among regions . thus , molecular and immunological technology for detection of humans and animals infected with e. multicularis as well as integrated control measures have been advanced , centering around japan . since 1996 , guidelines for the treatment of human ae are suggested and documented as a manual and have recently been updated by who - iwge . the rules have been set : radical surgery is the first choice in all cases suitable for total resection of the lesion ; benzimidazoles as anthelmintic drugs are mandatory in all patients , temporarily after complete resection of the lesions , and for life in all other cases . interventional procedures should be preferred to palliative surgery whenever possible . in our patient , 2 times radical operations were proceeded because hepatic malignancy could not continuously excluded . albendazole has an efficacy similar to mebendazole , the first successfully used benzimidazole derivative together with some pharmacokinetic advantages . she has been visiting regularly for radiologic follow - up , but till now no remarkable changes have been reported . here , we report a case of human ae , representing unusual hepatic mass on clinical examination which showed necrosis with numerous sterile cysts and granulomas on pathologic examination , in a non - endemic area with uncertain infection route .	human alveolar echinococcosis ( ae ) , a hepatic disorder that resembles liver cancer , is a highly aggressive and lethal zoonotic infection caused by the larval stage of the fox tapeworm , echinococcus multilocularis . e. multilocularis is widely distributed in the northern hemisphere ; the disease - endemic area stretches from north america through europe to central and east asia , including northern parts of japan , but it has not been reported in korea . herein , we represent a first case of ae in korea . a 41-year - old woman was found to have a large liver mass on routine medical examination . the excised mass showed multinodular , necrotic , and spongiform appearance with small irregular pseudocystic spaces . microscopically , the mass was composed of chronic granulomatous inflammation with extensive coagulation necrosis and parasite - like structure , which was revealed as parasitic vesicles and laminated layer delineated by periodic acid - schiff ( pas ) stain . clinical and histologic features were consistent with ae . after 8 years , a new liver mass and multiple metastatic pulmonary nodules were found and the recurred mass showed similar histologic features to the initial mass . she had never visited endemic areas of ae , and thus the exact infection route is unclear .
You are an expert at summarizing long articles. Proceed to summarize the following text: in 2011 , canadians aged 45 to 64 years had the highest self - reported rates of being overweight or obese , as high as 60% . the annual cost of obesity - related diseases in canada is substantial and estimated to be between $ 4.6 and $ 7.1 billion . therefore , understanding how body weight changes over time , and the associated health conditions , is crucial for public health program development . changes in body weight can more accurately predict obesity - related health conditions when compared to static weight status [ 4 , 5 ] . however , the majority of studies on the topic typically use conventional growth modelling ( cgm ) to model bmi changes [ 610 ] . cgm uses one average pattern for the underlying population and estimates individual variability by random effects about the mean trend . in contrast to cgm , latent class growth modelling ( lcgm ) is a semiparametric statistical approach to quantify distinct bmi trajectories within a population [ 11 , 12 ] . previous studies have demonstrated the powerfulness and flexibility of lcgm for determining different bmi trajectory groups [ 1316 ] . lcgm has been used to identify multiple bmi trajectories among children [ 13 , 14 ] and adults [ 15 , 16 ] . however , data regarding whether there is heterogeneity in bmi development from middle - age onward is still unknown . an important aim of this study is to test if bmi patterns carry differential morbidity potentials . an awareness of distinct bmi trajectories allows identification of certain population groups as being at higher risk for obesity - related health conditions . however , only two other studies have addressed the heterogeneity of bmi development based on lcgm and the potential associations with adverse health outcomes in midlife [ 15 , 18 ] . these two studies reported that adverse health conditions were more prevalent in higher bmi trajectory groups ; however , both studies were based on the us population . they investigated the associations between bmi trajectories and health outcomes when the respondents turned 40 years old . likewise , finkelstein et al . identified four bmi trajectory groups for class i obese adults aged 2533 years . the primary aim of this study is to apply lcgm to analyze long - term bmi trajectories in an 18-year longitudinal study of middle - aged and older adults . this can then be used to examine the differential effects of bmi trajectories on health outcomes in midlife for the canadian population . the participants were household residents in the ten provinces of canada and were followed up biennially from 1994 to 2011 . persons living on reserves and crown lands , residents of healthcare institutions , full - time members of the canadian forces bases , and some of those who lived in remote areas of ontario and qubec were excluded . there were 3070 respondents , aged 4055 years at baseline , used to identify the bmi trajectories for middle - aged to older adults . respondents with at least four bmi records were included ; 15.7% of participants were excluded . for the excluded group , therefore , respondents were excluded in this analysis mainly due to nonresponse to the nphs . the respondents included were not significantly different from those excluded by the variables of age , gender , physical activity level at baseline , health conditions ( e.g. , asthma , arthritis or rheumatism ( excluding fibromyalgia ) , back problems ( excluding fibromyalgia and arthritis ) , high blood pressure , chronic bronchitis or emphysema , diabetes mellitus , and cognitive or emotional conditions ) , and overall self - rated health when they reached age of 55 years . on the other hand , differences were detected between the two groups in terms of ethnic / racial background , education level , mean bmi , family income , and smoking . an accelerated longitudinal design ( ald ) was adopted to construct the patterns of bmi changes over a period of 31 years ( age : 4070 years ) , using age as time axis . previous studies have evidenced the advantages of ald in studying age - related developmental changes over time through linking multiple cohorts together . the data should be less affected by dropout within an ald , compared to a single - cohort design , since sample attrition tends to accumulate over time during data collection . height and weight were self - reported in the nphs and bmi was calculated as weight in kilograms divided by height in meters squared . the imputed bmi data provided by statistics canada was used in this analysis to define measures of bmi at each age . gender ( women or men ) , race / ethnicity ( white or aboriginal or other races ) , and education ( education level less than high school , high school graduation , some college , or college and above ) were included as risk factors . it is assumed that risk factors have a potential impact on group membership of trajectories . therefore , the bmi trajectories were modelled in the same model for both men and women and gender was considered as a risk factor of group membership . other risk factors include the probability of being physically active , smoking , and living with low income . these three latent variables were defined from the trajectories of the physical activity ( pa ) level , smoking , and income status variable in each cycle of the nphs . during each cycle , the nphs also collected information on the respondents ' current smoking habits and total household income adjusted for the number of people living in the household . lcgm was used to identify different patterns of the probability of being physically active , smoking , and living with low income . to test whether the prevalence of and risk of developing a health condition varied with different bmi trajectory groups , the self - reported health outcomes of individuals , at the age of 55 years in the nphs , were used . the associations of health conditions and overall self - rated health with bmi trajectories were analyzed . the health outcomes included allergies , asthma , arthritis or rheumatism ( excluding fibromyalgia ) , back problems ( excluding fibromyalgia and arthritis ) , high blood pressure , migraine headaches , cancer , cataracts , chronic bronchitis or emphysema , diabetes mellitus , heart disease , and cognitive or emotional conditions . emotional problems ( self - perceived happiness ) were assessed using the following categories : happy and interested in life , somewhat happy , somewhat unhappy , unhappy with little interest in life , and so unhappy that life is not worthwhile . cognitive problems were ascertained by asking the questions how would you describe your usual ability to remember things ? and how would you describe your usual ability to think and solve day - to - day problems ? six categories of self - reported cognitive status were ranked from no cognition problems to unable to remember or to think . lcgm was used to identify the most likely bmi trajectories and the three latent variables for the studied population . the modelling selection process of bmi trajectories followed the criteria presented in the authors ' previous work . lcgm was also used to define three latent variables to identify different patterns of the probability of being physically active , smoking , and living with low income . a three - trajectory model for the probability of being physically active ( active , moderately active , and inactive trajectories ) , smoking ( smoking decreasing , smoking stable , and no smoking trajectories ) , and living with low income ( high income and low income trajectories ) was identified based on lcgm . detailed model results of these latent variables are available upon request . each individual was assigned to a specific bmi trajectory group for which he or she was most likely to follow . multinomial logistic regression analyses were used to examine the impact of potential risk factors on the membership of the identified bmi trajectory groups while controlling for the other risk factors . furthermore , to examine whether the prevalence of and relative risk for an adverse health condition differed by bmi trajectory group , chi - square tests and bivariate regression analyses were conducted . the analyses were appropriately weighted using the survey sampling weights and bootstrap weights recommended by statistics canada . most respondents self - identified as white ( 90.9% ) while 0.44% were from an aboriginal population . the majority ( 62.5% ) of this population had some postsecondary education . from 1994 to 2011 , the weighted prevalence of being overweight ( bmi 25.029.9 ) , obese class i ( bmi 30.034.9 ) , obese class ii ( bmi 35.039.9 ) , and obese class iii ( bmi 40.0 ) increased from 41.8% to 42.2% , 12.2% to 18.9% , 2.8% to 5.8% , and 1.2% to 2.4% , respectively . on the other hand , the weighted prevalence of being underweight ( bmi < 18.5 ) and normal weight ( bmi 18.524.9 ) declined from 1.6% to 1.1% and 40.5% to 29.5% , respectively . ( ob i - s ) , and obese ii - stable ( ob ii - s ) , were identified as most accurately characterizing the long - term patterns of bmi change . trajectory results , including estimated parameters , gmp and avepp , are shown in table 1 and figure 1 . the gmp of the n - s group was 23.7% ( marked by number 1 in figure 1 ) . most individuals assigned to this group remained underweight or of normal weight from age 40 to 70 years ( figure 2(a ) ) . the gmp of the ov - s group was 45.4% ( marked by number 2 in figure 1 ) . this group started with an average bmi of 24.8 at 40 years of age and then increased and remained overweight thereafter . within the ov - s group , the proportion of individuals who were overweight was greater than 50% at each age from 40 to 70 years . approximately 30% of the individuals had a bmi of less than 25 until the age of 50 years . the proportion of obese individuals in this group did not exceed 10% at any age ( figure 2(b ) ) . the gmp of the ob i - s group was 24.9% ( marked by number 3 in figure 1 ) . this group started with an average bmi of 27.9 ( overweight ) at age of 40 years and increased to an average bmi of 30.5 ( obese class i ) at age of 50 years . the proportion of underweight or normal weight individuals in this group was less than 20% at all ages . additionally , 45% of the individuals in this group were overweight around the age of 40 . furthermore , the proportion of obese respondents in this group was about 50% by age 27 years and exceeded 70% by age 60 years ( figure 2(c ) ) . the gmp of the ob ii - s group was 6.0% ( marked by number 4 in figure 1 ) . this group started with an average bmi of 34.7 at 40 years of age and increased and remained in the obese class ii category through ages 4070 years . the weighted prevalence of underweight , normal weight , and overweight individuals was negligible for all ages in this group . the proportion of obese individuals in this group kept increasing through ages 4070 years ( figure 2(d ) ) . after adjusting for multiple potential risk factors , other races ( non - white or aboriginal ) ( or , 0.15 ; 95% ci , 0.04 to 0.58 ) , some college ( or , 0.55 ; 95% ci , 0.42 to 0.73 ) , college graduation and above ( or , 0.61 ; 95% ci , 0.47 to 0.80 ) , the membership of the highest probability of being physically active ( or , 0.74 ; 95% ci , 0.57 to 0.95 ) , and smoking ( or , 0.74 ; 95% ci , 0.57 to 0.95 ) were associated with a decreased risk of being in the overweight - stable ( ov - s ) trajectory group ( table 2 ) . all of the above risk factors exerted similar effects on obese i - stable ( ob i - s ) and obese ii - stable ( ob i - s ) groups , except for other races and education . only the interaction term between gender and the probability of living with low income trajectory ( p = 0.001 ) was found to be significant ( data available upon request ) . female gender was associated with a decreased risk of ov - s ( or , 0.29 ; 95% ci , 0.23 to 0.37 ) , ob i - s ( or , 0.25 ; 95% ci , 0.19 to 0.32 ) , and ob ii - s ( or , 0.62 ; 95% ci , 0.40 to 0.95 ) among people who were assigned to the trajectory of high income ; similar findings were found among members of the low income trajectory except for the ob ii - s group . the prevalence of adverse health conditions was the highest among the ob ii - s group , followed by the ob i - s and ov - s groups , and the lowest among the n - s group . members of the ov - s , ob i - s , and ob ii - s groups were more likely than n - s group members to self - report asthma , arthritis , hypertension , diabetes , heart disease , cognitive issues , and reduced overall health . furthermore , members of the ob ii - s group were more likely to report chronic bronchitis or emphysema and emotional issues compared to members of the n - s group ( table 3 ) . the prevalence of allergies , migraine headaches , cancer , or cataracts was not significantly different among the four bmi trajectory groups ( data available upon request ) . compared to adults in the n - s group , those in the highest bmi trajectory group , ob ii - s , were two times more likely to report asthma ( or = 2.6 ; 95% ci , 2.562.63 ) , back problems ( or = 1.28 ; 95% ci , 1.261.29 ) , chronic bronchitis or emphysema ( or = 2.52 ; 95% ci , 2.482.57 ) , and cognitive limitations ( or = 1.58 ; 95% ci , 1.561.59 ) . additionally , individuals in the ob ii - s group were nearly four times more likely to experience arthritis or rheumatism ( or = 3.79 ; 95% ci , 3.763.83 ) and heart disease ( or = 3.75 ; 95% ci , 3.693.82 ) . furthermore , those in the ob ii - s group were eight times more likely to experience hypertension ( or=8.03 ; 95% ci , 7.958.11 ) and 26 times more likely to self - report diabetes ( or = 25.56 ; 95% ci , 25.1026.03 ) . those in the ob ii - s group were four times more likely to rate themselves as unhappy and two times more likely to rate themselves as somewhat happy compared to happy in the n - s group ( or = 3.90 ; 95% ci , 3.833.98 and or = 1.88 ; 95% ci , 1.871.90 , resp . ) . moreover , those individuals in the ob ii - s group were 9.53 times more likely to rate their overall health as poor , 11.48 times more likely to rate their overall health as fair , 5 times more likely to rate their overall health as good , and 2.27 times more likely to rate their overall health as very good compared to excellent in the n - s group ( 95% ci , 9.309.76 ; 95% ci , 11.2711.69 ; 95% ci , 4.915.08 ; 95% ci , 2.242.31 , resp . ) . overall , individuals in the ov - s , ob i - s , and ob ii - s groups had higher risk for adverse health outcomes when compared to the n - s group . some exceptions were that individuals in the ov - s group were 0.91 ( 95% ci , 0.900.91 ) times less likely to self - report back problems and that individuals in the ob i - s group were 0.38 ( 95% ci , 0.370.39 ) times less likely to report having chronic bronchitis or emphysema . additionally , respondents in the ob i - s group were 0.90 ( 95% ci , 0.890.90 ) times less likely to rate themselves as somewhat happy compared to there were four distinct bmi trajectory groups of middle - aged and older adults identified in this study . findings of this study are in agreement with other bmi trajectory research based on lcgm [ 5 , 16 ] . for instance , zheng et al . identified six trajectory groups with a slight bmi increase over time for adults aged 51 to 77 years . similarly , botoseneanu and liang demonstrated that the change in bmi over time was moderate for people aged 5161 years at baseline . further , people who were obese at the age of 40 were likely to keep excess weight during midlife without any interventions . it was found that people who were not white or aboriginal were less likely to follow higher bmi trajectory groups . this is in agreement with the documented evidence that the aboriginal and white populations tend to have higher bmi measurements than other racial / ethnic groups in canada . by contrast , previous studies have reported that african americans and hispanics were more likely to follow higher bmi trajectories compared to the white population [ 15 , 16 , 18 , 24 ] . this inconsistency may be due to the fact that these studies were based on the us population where there are cultural differences and larger populations of african americans and hispanics than in canada . in addition , respondents with some college education and college degrees were at a lower risk of being in the ov - s and ob i - s groups . this evidence is consistent with the study by stbye et al . which found that a higher educational level lowered the bmi trajectory within each group . the insignificance found in the highest bmi trajectory may be due to the small sample size of the ob ii - s group . the findings of this study contribute new evidence by using latent variables to capture the long - term impact of being physically active , smoking , and living with low income on bmi . people with the highest probability of being physically active during midlife were less likely to follow overweight and obese trajectories . previous studies have determined that , on average , smokers weigh less than nonsmokers [ 26 , 27 ] . also , it was reported that smoking was associated with a lower bmi at baseline and a slower rate of change over time [ 28 , 29 ] . additionally , it was found that women were less likely to belong to higher bmi trajectory groups compared to men , though with one exception in the ob ii - s group among people with low income ; this finding is consistent with previous trajectory analyses [ 15 , 16 ] . conversely , some bmi trajectory studies reported no gender differences [ 29 , 30 ] ; however , these studies typically used one average bmi pattern to represent the whole population , which may conceal possible gender differences . the interaction between gender and income also confirmed the previous evidence that sociodeterminants of obesity differ by gender [ 3134 ] . there is an increased risk for obesity - related health conditions among middle - aged and older adults with consistently high bmi measurements . it was found that people in the higher trajectory groups ( i.e. , ov - s , ob i - s , and ob ii - s ) were more likely to report asthma , arthritis , hypertension , diabetes , heart disease , cognitive conditions , and reduced overall health compared to their normal weight counterparts . however , only respondents in the highest bmi trajectory group ( ob ii - s ) were at greater risk for back problems , chronic bronchitis or emphysema , and emotional issues . these findings are mostly consistent with previous evidence that demonstrated that people following a higher bmi trajectory were at a greater risk for various adverse health outcomes [ 15 , 18 , 24 ] . found that higher bmi trajectory groups had a higher prevalence of health conditions , including hypertension , diabetes , heart disease , arthritis , joint pain , asthma , back problems , and overall reduced self - rated health . finkelstein et al . also reported that obesity - related health conditions were more prevalent in higher bmi trajectory groups . however , the prevalence of cognitive impairment , hypertension , and diabetes varied depending on the bmi trajectory group . clarke et al . demonstrated that respondents who were consistently overweight were at greater risk of being diagnosed with many chronic health conditions including hypertension , diabetes , asthma , lung disease , heart disease , and cancer . additionally , a systematic review showed that obesity was associated with developing asthma or worsening of asthma symptoms . crowson et al . concluded that obesity increased the odds of developing arthritis ; however neither garca rodrguez et al . nor cerhan et al . found this association based on case control and cohort studies [ 38 , 39 ] . these differing findings may be due to the different methods used by investigators and the fact that most prior studies did not consider the heterogeneity of bmi development . the results suggest that respondents in the two obese bmi trajectory groups ( ob i - s and ob ii - s ) were at greater risk for back problems ; however , this was not the case for respondents in the overweight trajectory group ( ov - s ) . consequently , weight loss interventions aimed at treating or preventing back problems may need to be more strongly targeted towards obese individuals and overweight individuals , respectively . furthermore , respondents in the higher bmi trajectory groups ( ov - s , ob i - s , and ob ii - s ) had substantially higher risks for diabetes . this result is consistent with previous research findings that suggest that being overweight , even moderately , is an independent risk factor for developing numerous chronic diseases , especially diabetes . therefore , weight management to aid in the prevention of diabetes should target both overweight and obese individuals . thus , an awareness of the different bmi trajectories is important in order to identify groups of people who are at the highest risk for certain conditions and diseases . programs and interventions can then be targeted towards these groups to appropriately reduce morbidity and mortality . firstly , the use of self - reported height , weight , and health outcomes can introduce inaccuracies . secondly , bmi can be an unreliable tool as a measure of a person 's health or as an indication of what is considered a healthy body weight . thirdly , the findings may underestimate the associations of excess weight and certain diseases since individuals under the age of 40 years were not included . some studies have found that adolescent bmi may be a stronger predictor of future heart disease rather than adulthood bmi . additionally , results of this study can not distinguish between type i and type ii diabetes . in the nphs , only the term diabetes was asked , but the reliability of self - reported diabetes mellitus has been previously validated [ 40 , 41 ] . lastly , the data were not adjusted to consider all confounders , such as genetic predisposition . opportunities for future research can include using actual measures of excess body fat to determine the effects on the prevalence of certain diseases , studying the associations between childhood bmi and the development of certain health conditions in adulthood , and taking into consideration other factors of disease development such as genetics or lifestyle factors . the findings suggest that being overweight or obese , especially over an extended period of time , adds risk for developing adverse health outcomes for the canadian population . individuals who are overweight or obese throughout their adulthood are at a greater risk for numerous health conditions compared with their healthy weight counterparts . therefore , an awareness of different bmi trajectories is important in order to identify those people who are at the highest risk for certain diseases or conditions due to obesity . interventions can then be effectively targeted to those people in order to reduce morbidity and mortality and to improve quality of life in adulthood .	background . whether there is heterogeneity in the development of bmi from middle - age onward is still unknown . the primary aim of this study is to analyze long - term obesity and how bmi trajectories are associated with health outcomes in midlife . methods . latent class growth modelling was used to capture the changes in bmi over time . in this study , 3070 individuals from the national population health survey ( nphs ) , aged 4055 years at baseline , were included . results . four bmi trajectory groups , normal - stable ( n - s ) , overweight - stable ( ov - s ) , obese i - stable ( ob i - s ) , and obese ii - stable ( ob ii - s ) , were identified . men , persons of white ancestry , and individuals who had no postsecondary education had higher odds of being in the latter three groups . moreover , members of the ov - s , ob i - s , and ob ii - s groups experienced more asthma , arthritis , hypertension , diabetes , heart disease , cognitive impairment , and reduced self - rated overall health . individuals in the ob ii - s group were at greater risk for back problems , chronic bronchitis or emphysema , and emotional issues when compared to the n - s group . conclusion . understanding different bmi trajectories is important in order to identify people who are at the highest risk of developing comorbidities due to obesity and to establish programs to intervene appropriately .
You are an expert at summarizing long articles. Proceed to summarize the following text: in the last few years , prostate cancer ( pca ) has become one of the main research challenges for many medical studies . in europe alone , there are over a quarter million new cases recorded annually . on a worldwide scale , significant regional differences in the incidence of this cancer exist [ 2 , 3 ] . poland has recently experienced a significant increase in the number of men diagnosed with pca , but fortunately the number of deaths from this disease has not grown so dramatically . nevertheless , it has been estimated that in 2008 more than 3.8 thousand men died in poland because of pca . the development of pca is a multi - step process , the result of a sequence of molecular changes . the course of the disease is difficult to predict , and treatment failure is associated with the local infiltration of the gland and surrounding structures as well as distant metastases . metastases are the most common cause of death in pca [ 1 , 5 , 6 ] . the adhesion of cancer cells and their ability to migrate play a major role in formation of metastasis . a clear correlation between the level of adhesion molecules and the ability of these cells to metastasize was discovered in the mid - twentieth century [ 7 , 8 ] . the important role of -catenin associated with the cytoplasmic domain of e - cadherin for the functioning of intercellular adhesion complexes is widely known . the -catenin - cadherin complex recruits -catenin , which in turn binds the actin of the cytoskeleton . they are necessary for the creation and maintenance of epithelial cell layers by regulating cell growth and adhesion . -catenin is also responsible for transmitting the contact inhibition signal that causes cells to stop dividing once the epithelial sheet is complete . this pathway is a network of proteins best known for their roles in embryogenesis , but also their involvement in normal physiological processes in adult animals . the complex includes axin ( scaffolding protein ) , glycogen synthase kinase 3b ( gsk-3 ) , and the adenomatous polyposis coli ( apc ) protein . in the absence of the wnt - signal , the creation of the complex described above results in a substantial increase in the phosphorylation of -catenin by facilitating the action of gsk3. this leads to ubiquitination and proteasomal degradation of -catenin through the -trcp / skp complex . when wnt - signaling proteins bind their receptors , they inactivate gsk-3 , allowing -catenin to accumulate in both the cytoplasm and nucleus . within the nucleus , -catenin activates the tcf / lef transcription factors , which in turn act on genes including c - myc , tcf-1 , and cyclin d . during development , the wnt/-catenin pathway integrates signals from many other pathways including retinoic acid , fgf , tgf- , and bmp in many different cell - types and tissues . in addition , gsk-3 is also involved in glycogen metabolism and other key pathways , which has made its inhibition relevant to diabetes and neurodegenerative disorders . the participation of -catenin as a central protein in the wnt signaling pathway in the pathogenesis of many types of malignant and benign neoplasms has been a significant discovery of recent years . -catenin expression is regulated by the adenomatous polyposis coli ( apc ) gene , which can function as an oncogene . importantly , point - mutations in -catenin lead to its deregulated stabilization . mutations of the -catenin gene were detected in colonic , ovarian , pancreatic , and prostatic carcinomas as well as nonepithelial neoplasms such as synovial sarcoma , osteosarcoma , liposarcoma , and malignant fibrous histiocytoma [ 8 , 1215 ] . dysregulation of -catenin also occurs in gardner 's syndrome , where it leads to both familial adenomatous polyposis and fibromatosis . recent evidence suggests that -catenin plays an important role in various aspects of liver biology , including liver development ( both embryonic and postnatal ) , liver regeneration following partial hepatectomy , hgf - induced hepatomegaly , and pathogenesis of liver cancer . interest in the wnt / -catenin pathway in the context of therapy ( non - steroidal drugs , exisulind , vitamin a , endostatin , monoclonal antibodies , and low molecular weight inhibitors ) has resulted in an increasing number of studies indicating this complex as a crucial element in the etiology of many diseases . pharmacological inhibition of the wnt / -catenin signaling pathway can be an effective weapon in the battle against cancer by inducing apoptosis and inhibiting the proliferation of cancer cells . in normal epithelial cells , -catenin is found at the plasma membrane where it provides a mechanical linkage between cell - to - cell junctional and cytoskeletal proteins . in tumor cells , however , -catenin is often found in the cytoplasm and nucleus where it is associated with tcf family members to form a complex that activates transcription of pro - mitotic proteins . relocalization of -catenin also occurs as part of the epithelial - mesenchymal transition ( emt ) process and body axis specification , which are essential to organ development in the embryo [ 11 , 19 ] . the results of our study indicate that the presence of disorders in -catenin immunoexpression in pca cells corresponds with a high risk of death due to tumor progression and urges doctors to apply immediate and radical treatment procedures . changes in immunohistochemical staining of -catenin , in conjunction with the high value of the gleason score , appear to be a valuable prognostic parameter allowing the selection of a group of patients with aggressive forms of pca based on microscopic examination of tissue obtained from prostate biopsy . the materials were obtained by transrectal sextant core biopsy from 102 patients , who were hospitalized in the department of urology of the regional hospital in kalisz in the years 2001 - 2004 because of the suspicion of pca . core biopsies were performed according to a uniform procedure under the control of transrectal ultrasonography ( trus ) . statistical data from the hospital information system and the registry office in kalisz allowed us to establish that pca was the cause of death in 25 patients . all biopsy specimens were fixed in 4% buffered formalin solution and then embedded in paraffin according to standard procedures . serial sections ( 2 m thickness ) were used for hematoxylin and eosin staining and immunohistochemistry . the histopathological analysis of specimens was based on the following features : microscopic malignancy according to mostofi ; gleason score ; mitotic index ; volume percent of neoplastic infiltration in tissue specimen ; the presence of prostatic intraepithelial neoplasia ( pin ) in prostatic adjacent tissues ; infiltration of nerves , blood vessels and/or muscles by tumor cells ; inflammation in and around the cancer foci ; and the presence of tumor necrosis . immunohistochemical studies were performed using novocastra antibodies against -catenin ( dilution 1:300 , clone 17c2 ) according to the manufacturer 's protocol . in evaluating of the results of immunohistochemical staining in pca cells , we estimated them according to location and strength of reaction using a semi - quantitative analysis method . normal glandular epithelium from the vicinity of the cancer was used as a tissue of reference in estimating the strength of the reaction as reduced , comparable , or increased . as the reference point we established positive membrane staining when clearly visible in greater than 70% of cells . the presence of cytoplasmic staining and/or expression of cell membrane in a percentage less than 70% were qualified to the group of tumors with an impaired immunoexpression of -catenin . all data were collected in a database for statistical evaluation . a simple relationship between the investigated variables and the parameter of survival in patients with pca we used the kaplan - meier curves to assess survival differences between the groups of patients . cox proportional hazard regression statistical analysis was used to determine which of the factors significantly affect patients survival time . to assess the differences between the two groups derived from the ordinal scale we used the nonparametric mann - whitney u test , as in the case of comparing two groups with an interval scale . however , to compare more groups derived from an ordinal scale , the nonparametric kruskal - wallis test was used . gleason score greater than seven increased the risk of death by more than threefold ( rr = 3.12 ) . the kaplan - meier analysis showed a significant difference in possible survival between men suffering from pca with gleason score of seven and those with gleason score above seven ( p = 0.00048 ) . this confirms the value of the gleason score as an objective prognostic factor for pca . pin associated with the cancer was found in 64% of cases ( the dominated type was hg - pin ) . we did not notice the correlation between the occurrence or lack of pin , as well as the presence of hg - pin and survival ( p = 0.5832 ) . also , no statistical relationship was revealed with the value of gleason score ( p = 0.3025 ) . nerve infiltration was found in more than half of tumors ( 53% ) and , although the risk of death for patients with this feature increased almost twofold , we did not notice a statistical significance ( p = 0.0825 ) . there was also no significant dependence of value of gleason score ( p = 0.0687 ) . the infiltration of blood vessels was discovered in fewer cases ( 23% ) . in turn we did not show a significant correlation for neither of these microscopic changes and the risk of death of patients or gleason score . the presence of necrosis in tumor tissue and value of gleason score was significant ( p = 0.0252 ) . this feature was noted more than five times more often in poorly differentiated carcinomas ( gleason score above seven ) than in the group with moderately differentiated tumors ( gleason score 5 - 7 ) . the infiltration of muscles was disclosed in 51% of specimens , but there was no significant relationship between this parameter and patient survival ( p = 0.1339 ) . however , we found the strong correlation between value of gleason score and muscles invasion ( p = 0.0008 ) . this feature was observed in the majority of cancers with gleason score above seven ( 73% ) and in only 38% of the group with gleason score 5 - 7 . we found the mitotic index of the tumors to be highly significant when patients who died were compared with those still alive : 2.0 vs. 1.36 ( p = 0.0108 ) . also , the volume percent of tumor infiltration in the studied biopsies among the deceased patients was greater ( mean 65.6% ) than in the living ( 52.6% ) , however there was no significant correlation ( p = 0.054 ) . we also demonstrated a significant difference between the value of gleason score in terms of mitotic activity ( p = 0.0009 ) and in the volume percent of tumor infiltration ( p = 0.0028 ) . in poorly differentiated prostate tumors ( gleason score greater than seven ) , both the volume percent of tumor infiltration and the value of mitotic index were generally higher ( 67.9% vs. 48.5% , and 2.62 vs. 0.89 ) . in pca , both the localization and the intensity of -catenin immunoexpression disturbances in -catenin immunoexpression in association with the gleason score in the studied cases were characterized by a very strong statistical significance . the majority ( 94% ) of moderately differentiated pca ( gleason index 5 - 7 ) were characterized by normal immunoexpression of the tested protein . on the contrary , almost all tumors ( 97% ) in the group with a poor differentiation ( gleason 8 - 10 ) were characterized by a reduced intensity of immunohistochemical staining for -catenin compared to normal prostate epithelium ( fig . 1 ) . normal immunohistochemical staining for -catenin in prostate glandular epithelium ( magnification 200x ) . increased mortality in patients with pca was associated with significantly impaired localization and intensity of -catenin immunohistochemical expression in pca cells . the risk of death in patients with abnormal -catenin immunoexpression in the tumor ( cytoplasmic staining ) increased threefold ( rr = 3.26 ) , while the risk of death in patients with reduced intensity of immunohistochemical reaction of -catenin increased over 6-fold ( rr = 6.39 ) when compared to normal expression ( tables 1 and 2 ) . comparison of kaplan - meier analyses confirmed a significant difference in the probable survival for the group of patients with abnormal -catenin immunoexpression ( p = 0.00019 ) and with reduced -catenin immunohistochemical reaction in pca cells ( p = 0.0001 ) ( figs . 2 and 3 ) . localization of -catenin immunoreaction and patients survival intensity of -catenin immunoreaction and patients survival cox regression proportional hazard analysis for all tested parameters also revealed that the reduced intensity of -catenin immunoexpression significantly affects patients survival ( p = 0.007 ) . these patients presented with more than seven - fold higher ( 7.40x ) risk of dying from pca compared with men with normal tumor expression of this protein . thus , we consider these parameters ( the localization and intensity of -catenin immunoexpression ) as possible predictors of survival in patients with pca ( table 3 ) . model of cox proportional hazards regression we showed a significant correlation ( p < 0.0001 ) between mostofi aberrant ( localization ) -catenin immunoexpression increased from 5% for g1 to 67% for g3 tumors . in the group of neoplasms with reduced immunohistochemical staining we also observed a similar trend : 15% for g1 and 88% for g3 . we noted a significant correlation between the presence of pin and aberrant staining of -catenin ( localization p = 0.0373 ) ( intensity p = 0.0243 ) . characteristically , tumors without accompanying pin , were most represented in the group with reduced staining and incorrect localization of -catenin . in turn , we did not detect a significant relationship between -catenin immunoexpression and nerve invasion ( p = 0.1018 and p = 0.0639 ) , blood vessels invasion ( p = 0.3506 and p = 0.2109 ) , or inflammatory reaction ( p = 0.9999 and p = 0.0213 ) . the presence of necrosis in pca was correlated with the intensity of -catenin reaction ( p = 0.0213 ) , but we did not notice the connection with aberrant localization of immunohistochemical staining ( p = 0.9999 ) . analysis of the relationship between muscles invasion on pca cells and the results of -catenin immunohistochemical staining showed a significant correlation for both , localization ( p = 0.0192 ) and intensity ( p = 0.0026 ) . infiltration of muscles was observed twice as often in the group with decreased reaction , and nearly twice as often among patients with aberrant localization of -catenin immunostaining . we also showed a significant correlation between the mitotic index ( p = 0.0079 ) , volume percent of tumor infiltration ( p = 0.0241 ) , and location of -catenin immunohistochemical staining . physiological localization of the -catenin immunoreaction was associated with a mitotic index at half of mean value of ( 1.09 vs. 2.31 ) and a lower volume of malignant invasion ( 50.3% vs. 65.3% ) compared with tumors with aberrant expression of the protein . the decreased intensity of immunohistochemical staining was associated with nearly three times higher mitotic index than the mean value ( 2.30 vs. 0.88 , p = 0.0031 ) and a highly significant volume of neoplastic infiltration in the studied biopsies ( 65.5% vs. 47.5 , p = 0.0034 ) . gleason score greater than seven increased the risk of death by more than threefold ( rr = 3.12 ) . the kaplan - meier analysis showed a significant difference in possible survival between men suffering from pca with gleason score of seven and those with gleason score above seven ( p = 0.00048 ) . this confirms the value of the gleason score as an objective prognostic factor for pca . pin associated with the cancer was found in 64% of cases ( the dominated type was hg - pin ) . we did not notice the correlation between the occurrence or lack of pin , as well as the presence of hg - pin and survival ( p = 0.5832 ) . also , no statistical relationship was revealed with the value of gleason score ( p = 0.3025 ) . nerve infiltration was found in more than half of tumors ( 53% ) and , although the risk of death for patients with this feature increased almost twofold , we did not notice a statistical significance ( p = 0.0825 ) . there was also no significant dependence of value of gleason score ( p = 0.0687 ) . the infiltration of blood vessels was discovered in fewer cases ( 23% ) . in turn we did not show a significant correlation for neither of these microscopic changes and the risk of death of patients or gleason score . the presence of necrosis in tumor tissue and value of gleason score was significant ( p = 0.0252 ) . this feature was noted more than five times more often in poorly differentiated carcinomas ( gleason score above seven ) than in the group with moderately differentiated tumors ( gleason score 5 - 7 ) . the infiltration of muscles was disclosed in 51% of specimens , but there was no significant relationship between this parameter and patient survival ( p = 0.1339 ) . however , we found the strong correlation between value of gleason score and muscles invasion ( p = 0.0008 ) . this feature was observed in the majority of cancers with gleason score above seven ( 73% ) and in only 38% of the group with gleason score 5 - 7 . we found the mitotic index of the tumors to be highly significant when patients who died were compared with those still alive : 2.0 vs. 1.36 ( p = 0.0108 ) . also , the volume percent of tumor infiltration in the studied biopsies among the deceased patients was greater ( mean 65.6% ) than in the living ( 52.6% ) , however there was no significant correlation ( p = 0.054 ) . we also demonstrated a significant difference between the value of gleason score in terms of mitotic activity ( p = 0.0009 ) and in the volume percent of tumor infiltration ( p = 0.0028 ) . in poorly differentiated prostate tumors ( gleason score greater than seven ) , both the volume percent of tumor infiltration and the value of mitotic index were generally higher ( 67.9% vs. 48.5% , and 2.62 vs. 0.89 ) . in pca , both the localization and the intensity of -catenin immunoexpression are impaired in comparison to normal prostatic epithelium . disturbances in -catenin immunoexpression in association with the gleason score in the studied cases were characterized by a very strong statistical significance . the majority ( 94% ) of moderately differentiated pca ( gleason index 5 - 7 ) were characterized by normal immunoexpression of the tested protein . on the contrary , almost all tumors ( 97% ) in the group with a poor differentiation ( gleason 8 - 10 ) were characterized by a reduced intensity of immunohistochemical staining for -catenin compared to normal prostate epithelium ( fig . 1 ) . normal immunohistochemical staining for -catenin in prostate glandular epithelium ( magnification 200x ) . increased mortality in patients with pca was associated with significantly impaired localization and intensity of -catenin immunohistochemical expression in pca cells . the risk of death in patients with abnormal -catenin immunoexpression in the tumor ( cytoplasmic staining ) increased threefold ( rr = 3.26 ) , while the risk of death in patients with reduced intensity of immunohistochemical reaction of -catenin increased over 6-fold ( rr = 6.39 ) when compared to normal expression ( tables 1 and 2 ) . comparison of kaplan - meier analyses confirmed a significant difference in the probable survival for the group of patients with abnormal -catenin immunoexpression ( p = 0.00019 ) and with reduced -catenin immunohistochemical reaction in pca cells ( p = 0.0001 ) ( figs . 2 and 3 ) . cox regression proportional hazard analysis for all tested parameters also revealed that the reduced intensity of -catenin immunoexpression significantly affects patients survival ( p = 0.007 ) . these patients presented with more than seven - fold higher ( 7.40x ) risk of dying from pca compared with men with normal tumor expression of this protein . thus , we consider these parameters ( the localization and intensity of -catenin immunoexpression ) as possible predictors of survival in patients with pca ( table 3 ) . model of cox proportional hazards regression we showed a significant correlation ( p < 0.0001 ) between mostofi aberrant ( localization ) -catenin immunoexpression increased from 5% for g1 to 67% for g3 tumors . in the group of neoplasms with reduced immunohistochemical staining we also observed a similar trend : 15% for g1 and 88% for g3 . we noted a significant correlation between the presence of pin and aberrant staining of -catenin ( localization p = 0.0373 ) ( intensity p = 0.0243 ) . characteristically , tumors without accompanying pin , were most represented in the group with reduced staining and incorrect localization of -catenin . in turn , we did not detect a significant relationship between -catenin immunoexpression and nerve invasion ( p = 0.1018 and p = 0.0639 ) , blood vessels invasion ( p = 0.3506 and p = 0.2109 ) , or inflammatory reaction ( p = 0.9999 and p = 0.0213 ) . the presence of necrosis in pca was correlated with the intensity of -catenin reaction ( p = 0.0213 ) , but we did not notice the connection with aberrant localization of immunohistochemical staining ( p = 0.9999 ) . analysis of the relationship between muscles invasion on pca cells and the results of -catenin immunohistochemical staining showed a significant correlation for both , localization ( p = 0.0192 ) and intensity ( p = 0.0026 ) . infiltration of muscles was observed twice as often in the group with decreased reaction , and nearly twice as often among patients with aberrant localization of -catenin immunostaining . we also showed a significant correlation between the mitotic index ( p = 0.0079 ) , volume percent of tumor infiltration ( p = 0.0241 ) , and location of -catenin immunohistochemical staining . physiological localization of the -catenin immunoreaction was associated with a mitotic index at half of mean value of ( 1.09 vs. 2.31 ) and a lower volume of malignant invasion ( 50.3% vs. 65.3% ) compared with tumors with aberrant expression of the protein . the decreased intensity of immunohistochemical staining was associated with nearly three times higher mitotic index than the mean value ( 2.30 vs. 0.88 , p = 0.0031 ) and a highly significant volume of neoplastic infiltration in the studied biopsies ( 65.5% vs. 47.5 , p = 0.0034 ) . pca usually develops slowly , and direct causes of death in patients with this tumor vary , but the majority of treatment failures are associated with the dissemination of the disease and the presence of distant metastases . the cause of metastasis in pca appears to be a disorder in the structure and functioning of the molecular mechanisms responsible for cellular adhesion [ 5 , 6 , 15 ] . in the last decade , only a few articles concentrated on the results of pca studies conducted in terms of the importance of adhesion molecules and other elements of the signaling pathway of wnt / -catenins in the growth of this tumor . polish studies on this subject are also not abundant , and their results must be described as ambiguous . they demonstrated the prognostic value of impaired immunoexpression of e - cadherin and ezrin , especially in poorly differentiated cancers ( gleason score greater than seven ) . at the 40 congress of the american society of clinical oncology in new orleans , presented the results of their study of the prognostic value of low levels of -catenin immunoexpression in the nuclei of cancer cells in its early form as an independent parameter indicating a very poor prognosis for those patients whose initial prognosis seemed good and the tumor was qualified for radical surgery . assessed the expression of major disturbance in the adhesion complex components such as e - cadherin and -catenin . they examined serial sections from postoperative specimens after radical prostatectomy ( 17 for -catenin and 16 for e - cadherin ) by immunohistochemical analysis . the authors found that in poorly differentiated pca , the disorder of immunoexpression of -catenin and e - cadherin may be a useful biomarker of tumor aggressiveness . immunopositive reactions for -catenin and e - cadherin in pca were evaluated for their location and strength ( using a semi - quantitative scale ) , comparing them with normal glandular epithelium . statistical analysis was applied to the microscopic malignancy expressed in gleason score , stage of disease ( tnm ) , and results of immunohistochemical analysis . the strength of immunoreactions for -catenin and e - cadherin were decreased in pca compared with normal glandular epithelium and correlated with the increased malignancy expressed in gleason score , particularly at a ratio of greater than seven . similarly , aaltomaa et al . examined the immunohistochemical staining of -and -catenin in cancer cells and their correlation to patients survival ( observation period up to 7.3 years ) in 181 men after radical prostatectomy . they concluded that an unaffected location of the -catenin immunoreaction ( no cytoplasmic / nuclear staining ) was associated with the low clinical stage of the tumor , and a reduced strength of immunohistochemical expression of both catenins correlated with shorter patients survival . published the results of -catenin immunoexpression in 101 patients with pca and high grade pin ( hg - pin ) and compared them with normal prostate epithelium as well as 24 cases of colorectal tumors . furthermore , they studied the reactions of other proteins : cytokeratins 7 and 20 as well as psa . in 83% of samples from colorectal cancer they noted nuclear -catenin immunoreactivity , whereas membrane staining predominated in pca ( 88% ) . as for strength , they observed the reaction comparable to that of normal epithelium in 80% of pca , decreased in 4% and increased in 4% of tumors . in our study we did not find the increase in strength of reaction in any cancer and the reduction of immunoexpression was observed in a greater number of tumors ( 45% ) . the authors , however , failed to assess the relationship between outcomes and the degree of clinical progression and malignancy of the examined tumors . -catenin immunoreactivity in hg - pin was similar to that observed in normal prostate epithelium . due to the results of immunoexpression of other examined reagents , proved that there are differences in the role of the wnt/-catenin signaling pathway in the pathogenesis of prostate and colorectal cancers . in recent years , in vitro studies of pca have brought much to know about the molecular mechanism of tumor progression , including the formation of distant metastases . however , many aspects of this process remain unsolved and require further study . in locally advanced prostate tumors cell clones capable to metastasize arise , due to aberrations of structure and function of molecules involved in adhesion mechanisms , including : catenins , e - cadherin , and ezrin . van oort et al . studied the predictive value of disorders of the e - cadherin immunoexpression and molecules associated with a cadherin complex ( , , -catenins and p120 protein ) in pca . in 65 specimens obtained by radical prostatectomy or turp , they examined the strength of immunoexpression for each of the elements of the cadherin complex and evaluated survival curves using the kaplan - meier analysis and multivariate cox proportional hazards regression . their investigations have shown the correct expression of -catenin in 61.5% of cases , when compared to results obtained in our research ( 65% ) . a significant correlation between expressions of individual studied molecules was also confirmed . five - year survival rate of patients with impaired -catenin staining was 27.3% and it was significantly lower in comparison to the 73.1% in patients with normal immunoreaction of -catenin . as with our analysis , the difference between normal and impaired protein immunoexpression compared to survival ( log rank p < 0.0001 ) was statistically significant . however , the strength of -catenin expression proved to be a little more valuable as a prognostic factor in correlation with tumor stage and value of gleason score . multivariate analysis using proportional hazards regression revealed the predictive value for -and -catenin with slight advantage of the former . potti et al . examined specimens from 67 patients with metastatic and hormone - resistant pca , derived from the primary tumor and lymph node and bone metastases . these tissue samples were subjected to immunohistochemical analysis using antibodies against the urokinase receptor ( upar ) , wnt-1 , and -catenin . in regard to -catenin immunoexpression in the primary tumor , 34% of cancers showed the disturbed location of reaction ( 44% in our study ) , and the percentage of abnormal immunohistochemical staining increased to 77% for cancer metastasis to lymph nodes and 85% for bone metastases . the authors confirmed the prognostic usefulness of these markers and showed the direction of the therapeutic strategy by targeting gene interaction , because invasive cancer is regulated by their protein products . genes promoting tumor invasiveness encode , among others , enzymes hydrolyzing basement membrane and extracellular matrix , thereby increasing the ability of cells to migrate . recently , despite costs , studies using tissue microarrays are gaining popularity . whitaker et al . analyzed 77 specimens starting from benign prostatic hyperplasia to low , moderate , and high - grade carcinomas . they noted a gradual decline in -catenin immunoexpression with increasing malignancy of the tumors estimated by gleason score . interestingly , there were no changes in expression of -catenin in tumors treated with androgen ablation and in those without hormone therapy . the authors concluded that the decline of -catenin immunoexpression seems to be a better prognostic marker than the absolute value of its expression in pca cells . compared immunohistochemical coexpression of -catenin and e - cadherin in primary pca with metastases to bone , in association with the results from benign prostatic hyperplasia ( bph ) . they revealed a clear decrease in -catenin immunoexpression in cancer cells , as in our study . it is interesting that there are increases in the immunohistochemical reactions of both adhesion molecules in the cells obtained from bone metastases to values comparable to that observed in bph . these authors first showed an increased expression of these proteins in cancer cells from bone metastases suggesting a close relationship of these immunoexpressions with cell adhesion in metastases . it seems to be important to find a useful biological marker and a method for its identification in order to assess the aggressiveness of pca at the time of clinical diagnosis . still in the first place , is the pathological examination of the tissue obtained by prostate core biopsy , which decides the scope , nature , and even time of implementation of the clinical treatment . the results of this study suggest that -catenin is involved in pca tumorigenesis and progression . the aberrant or decreased expression of -catenin appears to be one of most promising markers of poor prognosis in localized pca . in addition , we established the survival in patients with pca depends on histopathological features , such as : the presence of necrosis , the value of mitotic index , and volume percent of tumor infiltration in transrectal core biopsy material .	introductionthe prostate cancer is difficult to predict , and treatment failure is associated with local infiltration , as well as distant metastases . adhesion and migration abilities to of cancer cells play a major role in formation of metastasis . the participation of -catenin in pathogene - sis of many types of cancer and benign processes has been an important discovery of recent years.material and methodsthe studied material was obtained by transrectal , sextant core biopsy from 102 patients hospitalized in department of urology , regional hospital in kalisz ( 2001 - 2004).the aim of our study was to determine the predictive value of -catenin immunoexpression in prostate cancer , to analyze the prognostic aspect of some histopathological features and finally to assess the relationship between -catenin immunoreactivity and the microscopic image of the tumor.relationships between the investigated variables were analyzed using the chi2 test of compatibility . we used the kaplan - meier curves to assess survival differences between groups of patients . finally we established which of the studied factors significantly affect the patient outcome , using the method of cox proportional hazard regression.resultsin prostate cancer in comparison with the normal epithelium , both the location and the strength of -catenin immunoexpression are impaired.conclusionsour results indicate that the presence of disorders in -catenin immunoexpression in prostate cancer cells indicates a high risk of death due to tumor progression and makes it imperative for immediate treatment procedures .
You are an expert at summarizing long articles. Proceed to summarize the following text: historically described in technetium sulfur colloid ( tsc ) scan , the liver hot - spot is a focal increased uptake of radiocolloid associated with superior vena cava ( svc ) obstruction . the computed tomography ( ct ) scan counterpart of this sign appears as an intense wedge - shaped enhancement of the quadrate lobe of the liver in arterial phase . physiology is specifically caused by collateral veins preferentially draining into the left portal vein via a recanalized paraumbilical vein . here , we present this imaging finding in a case of malignant thymoma causing superior vena cava syndrome . a 26-year - old lady with complaints of fever , breathlessness , and orthopnoea since 1 month , and 1 week history of swollen , plethoric face , and marked superficial venous distension over the chest presented to the emergency department . on clinical examination , chest radiography showed a lobulated mediastinal mass lesion with moderate right pleural effusion and basal consolidation . multidetector contrast - enhanced computed tomography ( cect ) of the chest and abdomen was subsequently done and the multiplanar reformatted ( mpr ) images were interpreted in various planes . imaging revealed an inhomogeneously enhancing lobulated mass lesion in the anterosuperior mediastinum causing invasion and tumoral expansion of the svc with extension into the right atrium [ figure 1 ] . multiple anterior abdominal wall and rectus sheath collaterals suggested svc obstruction [ figure 2 ] . cect abdomen revealed a wedge shaped area of intense arterial phase enhancement that represented the ct this area of enhancement showed partial washout and appeared slightly hyperdense in the venous phase and complete washout in the delayed phase imaging . axial contrast enhanced ct image showing a lobulated mass lesion in the anterosuperior mediastinum causing invasion and tumoral expansion of the svc with extension into the right atrium ( arrow ) . axial contrast enhanced ct image showing multiple anterior abdominal wall collaterals ( solid arrow ) and rectus sheath collaterals ( hollow arrow ) . axial contrast enhanced ct image demonstrating intense arterial phase enhancement in segment iv of the left lobe of liver representing the ct invasive malignant thymoma , bronchogenic carcinoma , lymphoma , and metastatic lymphadenopathy are some common conditions associated with svc syndrome due to extrinsic compression . in svc obstruction , there is preferential drainage of the umbilical and paraumbilical veins into the left branch of the portal vein leading to portosystemic shunting and is an attempt to bypass central venous obstruction . resultant increased blood flow in the arterial phase in the part of the liver supplied by the left branch of the portal vein forms the physiological basis of quadrant lobe hot spot quadrate lobe hot - spot sign is intense arterial phase enhancement noted on cect due to the development of cavoportal collaterals . other causes of focal hot spots on cect scans are budd - chiari syndrome ( caudate lobe ) , liver abscess , hemangioma , fnh - focal nodular hyperplasia , and hcc - hepatocellular carcinoma . however , the characteristic location , the wedge shape , arterial and venous phase characteristics , and associated findings of collateral vessels make this lesion highly specific as an indicator of svc syndrome . quadrate lobe hot - spot sign helps in the diagnosis of thoracic central venous obstruction and when performed in patients with clinically unapparent obstruction of svc , is highly specific for the diagnosis of svc obstruction . as cect is being performed frequently as a part of pet / ct , one needs to be aware of this radiological sign .	an area of increased activity in segment iv of liver ( quadrate lobe ) on 99mtc - sulfur colloid ( tsc ) scans has been well documented in patients with superior vena cava obstruction . similarly intense enhancement of the quadrate lobe in the arterial phase may be seen on computed tomography in patients of superior vena cava syndrome . we present this imaging finding in a case of malignant thymoma causing superior vena cava syndrome and discuss the physiological cause and importance of this sign .
You are an expert at summarizing long articles. Proceed to summarize the following text: dyslipidemias , especially characterized by high serum level of low density lipoprotein - cholesterol ( ldl - c ) , has been well documented as an important risk factor of atherosclerosis and its manifestation of atherosclerotic cardiovascular diseases ( cvd ) . in the past decades , accumulating evidence from clinical studies firmly demonstrates that ldl - c decreased by lipid - lowering drug , such as hmg - coa reductase inhibitor ( statins ) , is crucial for reducing the incidence of coronary heart diseases ( chd ) , ischemic stroke , and peripheral artery diseases [ 25 ] . however , some epidemiological studies show that , although target ldl - c level has been achieved by statins therapy , residual cardiovascular risk such as restenosis after stent placement in some population groups is still very high [ 68 ] , suggesting that , besides ldl - c , other risk factors could also play a contributory role in the progression and recurrence of cvd , and identifying those potential risk factors would be useful , helpful , and beneficial for further improving cardiovascular outcome . lipoprotein(a ) ( lp(a ) ) , composed of an ldl - c enriched core with one molecular of apolipoprotein b-100 ( apob-100 ) and apolipoprotein(a ) ( apo(a ) ) via a disulfide bond , is currently considered a potential important candidate as supported by previous epidemiological , animal , and genetic epidemiological studies [ 912 ] . in comparison with ldl - c , lp(a ) not only is capable of promoting atherosclerosis , but also has robust effects on enhancing thrombus formation by means of impairing fibrinolysis [ 13 , 14 ] . therefore , lp(a ) elevation is believed to be the very likely risk factor accounting for residual cardiovascular risk , especially in patients with target ldl - c level . nevertheless , findings from previous reported studies and meta - analysis are not consistent [ 1519 ] . for example , some epidemiological studies show that the risk lp(a ) imposes on cardiovascular system is overlapped with ldl - c [ 1618 ] , whereas other studies reveal a quite opposite outcome in which lp(a ) is an independent predictor for cardiovascular risk and traditional risk factor such as ldl - c plays no role in risk estimation for lp(a ) elevation [ 15 , 19 ] . in retrospect , these discrepancies regarding the predictive value of lp(a ) elevation on cardiovascular outcomes may be partially associated with the level of ldl - c which warrants further investigation . nowadays , percutaneous coronary intervention ( pci ) is the preferred choice for revascularization worldwide . however , it is noted that a large number of patients after stent placement , in spite of achieving recommended ldl - c level with statins therapy , have target vessel restenoses which require revascularization . therefore , preventing and reducing the incidence of coronary restenosis after stent placement is of paramount importance . notably , the pathophysiological process of coronary artery restenosis is featured by smooth muscle cells ' overproliferation , endothelial dysfunction , and fibrin accumulation , and with respect to lp(a ) unique features as to proatherosclerosis and prothrombosis , we speculated that lp(a ) elevation might be the potential factor responsible for increased incidence of cardiovascular events , particularly for coronary artery restenosis in patients after stent placement . furthermore , whether the effects of lp(a ) elevation on cardiovascular events ' recurrence after stent placement are dependent on ldl - c level or not would also be investigated . our current study has been registered in the chinese clinical trial registry ( registration number : chictr - och-11001198 ) . written informed consent was obtained and the ethics committee of the guangdong general hospital approved present study . demographic and clinical characteristics of all participants were collected at the initial clinical contact ( see table 1 ) , and all participants were followed up after stent placement via outpatient visit or telephone call for monitoring event occurrence for totally 1 year . accordingly , patient with poststent placement is recommended to achieve target ldl - c level of less than 1.8 mmol / l ; therefore , we used 1.8 mmol / l of ldl - c as cut - off point to categorize all patients into two subgroups . blood samples were drawn by venipuncture in the morning when participants were fasting for at least 8 hours for the variables measurement . of note , plasma level of lp(a ) was measured with sandwich enzyme - linked immune - sorbent assays ( elisa kit , yaji biosystems , shanghai , china ) . all the procedures were performed in accordance with the manual instructions and were evaluated by synchron lx20 unicel dxc800 analyzer ( beckman coulter inc . accordingly , plasma level of lp(a ) lower than 30 mg / dl is considered within the normal range and equal or higher than 30 mg / dl is recognized as abnormal . in our current study , clinical end points after stent placement were defined as cardiovascular death , nonfatal myocardial infarction , nonfatal ischemic stroke , and coronary revascularization . assessment of the incidence of clinical end points after stent placement was performed during followup by means of outpatient visit and/or telephone call after discharge . continuous data was presented as mean sd or median ( interquartile range ) appropriately and compared by student 's t - test when data was normally distributed , otherwise compared by the wilcoxon rank - sum test . statistical analyses were performed by using spss software version 16.0 ( spss , inc . , as shown in table 1 , the percentages of patients presented with acute coronary syndrome and three vessel stenoses were significantly higher in high lp(a ) group than those in low lp(a ) groups , indicating that patients with lp(a ) elevation were more prone to have more critical coronary artery stenoses . and the percentage of left main coronary artery lesion in high lp(a ) group was higher than that in the low lp(a ) group though without insignificant difference ( 14.3% versus 11.8% , p = 0.321 ) . all participants enrolled in our study were well followed up and were strictly adhering to recommended medications such as dual antiplatelet and statins therapies . selecting ldl - c level of 1.8 mmol / l as the cut - off point , 823 participants were divided into two groups . in the subgroup of ldl - c level lower than 1.8 mmol / l , there were 287 patients with lp(a ) level lower than 30 mg / dl , while another 92 were with lp(a ) level higher than 30 mg / dl . as shown in table 2 , no significant differences of mace were found between low and high lp(a ) groups ( 16.3% versus 18.5% , p = 0.755 ) . and each individual end point between these two groups was also comparable . notably , among each individual outcome , the incidence of coronary revascularization was higher than the others in both groups . another 383 patients with ldl - c level equal or higher than 1.8 mmol / l were divided into two groups according to the cut - off point of lp(a ) . as shown in table 2 , there was significant difference of incident mace after stent placement between high and low lp(a ) groups ( 26.1% versus 16.6% , p = 0.018 ) , and this difference was predominantly derived from the higher incidence of coronary revascularization in high lp(a ) group ( 15.4% versus 7.5% , p = 0.006 ) , and the odds ratio for coronary revascularization in high lp(a ) group was 2.05 , whereas the incidence of the other individual end point was similar between groups . similar to that with ldl - c lower than 1.8 mmol / l , the percentage of coronary revascularization in low and high lp(a ) groups was still higher than other clinical end points , indicating that in poststent placement , target vessel restenosis was the most significant residual cardiovascular risk , regardless of ldl - c level . our study totally enrolled 832 patients diagnosed with coronary artery disease who were eligible for stent placement after coronary angiography examination , and the results showed that ( 1 ) after stent placement , rather than an independent predictor , the predictive value of lp(a ) elevation on cardiovascular outcomes , especially coronary revascularization , was dependent on baseline ldl - c level ; ( 2 ) in the subgroup of baseline ldl - c 1.8 mmol / l , patients with high lp(a ) level have increased incidence of mace than patients with low lp(a ) level , and the between - group difference was mainly derived from coronary revascularization . nevertheless , in the subgroup of baseline ldl - c < 1.8 mmol / l , the incidence of mace after stent placement was comparable between high and low lp(a ) level groups ; ( 3 ) moreover , in comparison to patients with low lp(a ) level , patients with high lp(a ) level more often presented with acute coronary syndrome and three vessel stenoses . currently , percutaneous coronary intervention is broadly applied in patients with significant coronary artery stenosis , and this reperfusion strategy has profoundly improved cardiovascular outcomes in the past two decades . however , accumulating evidence from retrospective and perspective studies shows that , despite stent placement and strictly adhering to contemporary guideline recommended medications , a substantial number of patients still have a high residual cardiovascular risk , especially target vessel restenoses which necessitate revascularization . with respect to these findings , many strategies aiming to reduce residual cardiovascular risk have been introduced , and more aggressive ldl - c lowering is considered as one of the most attractive and promising strategies . in the prove it - timi 22 trial , cannon cp and colleagues observed that in patients with acute coronary syndrome , intensive therapy ( 80 mg of atorvastatin daily ) conferred greater benefits of mortality and mace than those of standard therapy ( 40 mg of pravastatin daily ) , which was believed attributed to further reduction of ldl - c by intensive lipid lowering therapy ( ldl - c 1.60 mmol / l versus 2.46 mmol / l , p < 0.001 ) . however , after nearly 2 years ' followup , the incidence of revascularization in intensive therapy group was still up to 16.3% . additionally , in the ideal and tnt trials , after approximately 5 years ' follow - up , 12.0% and 8.7% of mace were observed , respectively , [ 7 , 8 ] . findings of these large clinical trials consistently show that significant residual cardiovascular risks still remain in patient despise with aggressive ldl - c reduction , and ldl - c alone is inadequate to fully evaluate and predict the residual cardiovascular risk . in lieu of evidence from epidemiological studies [ 2022 ] , lp(a ) elevation has been recognized as a potential candidate at least partially responsible for high residual cardiovascular risk in patient achieving target ldl - c level . however , interaction between lp(a ) and ldl - c on cardiovascular outcome has been observed and whether the effects of lp(a ) elevation on cardiovascular outcome are independent of or dependent on ldl - c is still unclear . our current study showed that the predictive value of lp(a ) elevation for mace , exclusively for coronary revascularization , in chd patients with stent placement is predominantly dependent on baseline level of ldl - c . in the subgroup of baseline ldl - c level 1.8 mmol / l , the incidence of revascularization for patients in high lp(a ) group was significantly increased and the odds ratio was 2.05 when compared to low level group ( 15.4% versus 7.5% , p = 0.006 ) , whereas there was no significant difference of other individual outcome ( see table 2 ) . mmol / l , all cardiovascular outcomes between low and high lp(a ) groups were insignificantly different ( see table 2 ) . accordingly , the key component of lp(a ) in terms of ldl - c enriched core abounds with oxidized phospholipid ( oxpl ) which is a potent proinflammatory and prooxidative compound that can significantly enhance the pro - atherosclerotic potential of lp(a ) , while in patients with extreme low level of ldl - c ( less than 1.8 mmol / l accordingly ) , the risk of lp(a ) elevation on cardiovascular system is diminished or even disappeared , and the underlying mechanisms are not fully understood yet . to our best knowledge , there may be two aspects attributed . in the first place , it was reported that lp(a ) degradation is partially mediated by ldl - c receptor , although the role by this pathway is not fully conclusive yet . therefore , higher ldl - c level may compete for ldl - c receptor which in turn reduces lp(a ) catabolism and amplifies lp(a ) biological effects , and this may be one of the underlying mechanisms attributed to the synergistic effects of both ldl - c and lp(a ) elevations , while in very low ldl - c level ( < 1.8 mmol / l ) , this synergistic effect between ldl - c and lp(a ) may be waned and unappreciated as indicated by our current study and previous studies [ 18 , 21 ] . secondly , it has been identified that , in the normolipidemic individuals , lp(a ) is capable of removing oxidized phospholipids ( such as oxldl - c ) from circulation system via its ability to biding these proinflammatory and prothrombosis materials . therefore , with the higher level of ldl - c , increased lp(a ) level has higher risk of cardiovascular events than that with lower lp(a ) level , while in the lower level of ldl - c , presumed lower oxldl - c level , lp(a ) elevation may be beneficial both for oxldl - c clearance and cardiovascular outcomes , as supported by our current study that , in the subgroup of ldl - c lower than 1.8 mmol / l , the incidence of mace was slightly lower in high lp(a ) group than that in low lp(a ) group ( 16.3% versus 18.5% , p = 0.755 ) , though insignificantly . finally , our current study shows that , in the subgroup of high ldl - c level , the incidence of coronary revascularization after stent placement is positively associated with lp(a ) level . accordingly , lp(a ) is capable of impairing tissue growth factor beta ( tgf- ) activity which results in smooth muscle cells ' proliferation and migration . furthermore , the results from bruneck study support the notion that fibrinolysis attenuation by lp(a ) is crucial for stabilizing atheroma - attached fibrin thrombi . lastly , lp(a ) elevation promotes endothelial dysfunction which also contributes to the restenosis progress . the higher percentage of patients presented with acute coronary syndrome and three vessel stenoses also indicates that the thrombi burden in high lp(a ) groups is greater than that in low lp(a ) group . taken together , it is reasonable to make a conclusion that in patients with stent placement , high lp(a ) level may portend a high restenosis rate . in conclusion , our current study reveals that , in patients with stent placement , lp(a ) elevation is positively associated with coronary restenosis which requires revascularization . in patients with baseline level of ldl - c 1.8 mmol / l , the incidence of mace and coronary revascularization is significantly higher in high lp(a ) group than low lp(a ) group , indicating that , after stent placement , in patient with both baseline levels of ldl - c and lp(a ) elevation , more aggressive ldl - c reduction may mitigate the adverse effects imposed by lp(a ) elevation .	background and aim . incidence of coronary restenosis after stent placement is high . our study was going to investigate whether lp(a ) elevation was potential for predicting coronary restenosis and whether the effects of lp(a ) elevation on coronary restenosis were dependent on ldl - c level . methods and results . totally 832 participants eligible for stent placement were enrolled and followed up for monitoring clinical end points . baseline characteristics were collected . according to the cut point of lp(a ) , participants were divided into low lp(a ) group ( lp(a ) < 30 mg / dl ) and high lp(a ) group ( lp(a ) 30 mg / dl ) . furthermore , based on baseline ldl - c level , participants were divided into ldl - c < 1.8 mmol / l and 1.8 mmol / l subgroups . clinical end points including major adverse cardiovascular events ( mace ) , cardiovascular death , nonfatal myocardial infarction , ischemic stroke , and coronary revascularization ( cr ) were compared . patients in high lp(a ) groups more frequently presented with acute coronary syndrome and three vessel stenoses . in subgroup of ldl - c < 1.8 mmol / l , no significant differences of cardiovascular outcomes were found between low and high lp(a ) groups . while in the subgroup of ldl - c 1.8 mmol / l , incidences of mace and cr were significantly higher in high lp(a ) group , and odds ratio for cr was 2.05 . conclusion . with baseline ldl - c and lp(a ) elevations , incidence of cr is significantly increased after stent placement .
You are an expert at summarizing long articles. Proceed to summarize the following text: mammalian parthenotes are not viable , suggesting that differential and essential traits are contributed to the newly formed embryo by both egg and sperm . by generating embryos from two female pronuclei ( biparental gynogenetic embryo ) or from two male pronuclei ( biparental androgenetic embryos ) using pronuclear manipulation in mouse zygotes , the requirement of the genomic contribution nearly three decades later the true nature of this parental imprint is still elusive ; however , it is well established that asymmetric chromatin and cytosine methylation on dna at a number of genomic loci results in parent - of - origin specific gene expression in the progeny . thus , gynogenetic and androgenetic mammalian embryos differ from each other and from normal embryos in their expression of essential developmental genes , explaining their incompatibility with life . imprinted genes are usually arranged in clusters , with each cluster containing a local imprinting control region ( icr ) ( fig . different , independently evolved mechanisms ensure allele - specific expression at over 80 different imprinted regions , involving insulator proteins and micrornas , yet each of them ultimately depends on differential dna methylation at icrs . this methylation , established at specific loci in the maternal or the paternal germ line is conserved throughout development and is generally maintained in adult tissues . ( a ) gene expression from the h19 imprinted locus is controlled by an enhancer , whose activity is directed to the h19 promoter by binding the insulator ctcf to the unmethylated icr on the maternal allele . methylation of the icr on the paternal allele prevents ctcf binding , thus directing the enhancer activity to the igf2/igf2as promoters . zfp57 binds dna in a sequence- and methylation - dependent manner , attracting trim28 and several chromatin and dna modifying components . over the decades , genomic imprinting has served as an epigenetic paradigm , and many mechanistic aspects of imprinting control , establishment , maintenance and mitotic inheritance relate to general epigenetic principles ( for a review see ref . in particular , dna methylation is a prominent and globally applied mechanism and has crucial roles not only in imprinting but also in x - chromosome inactivation , retrotransposon repression , chromosome structure and gene silencing . however , epigenetic marks on imprinted loci , due to their heritability from generation to generation , exhibit unique characteristics , especially in regard to epigenetic reprogramming ( for reviews see refs . 7 and 12 ) . all cells in an individual organism ( with few exceptions ) carry identical genetic information . accordingly , functional specialization of cells during development is the outcome of differential transcriptional programs , not different genetic information . these programs are governed by the transcription / translation machinery , which in turn is guided and controlled by epigenetic ( i.e. , chemical ) modifications of both dna and chromatin . the cell s epigenome , which does not affect the genetic code , is itself heritable at each mitotic cell division . these epigenetic states and their consequent transcriptional programs engendered in each cell are acquired throughout development as each cell specializes , concomitantly sacrificing its developmental potential . to initiate a new life cycle , the epigenome must revert to a blank slate state . in vitro , this can be achieved by ectopic expression of transcription factors in somatic cells , forcing reprogramming to an induced pluripotency state . epigenetic reprogramming can also occur pathologically in somatic cells in vivo but , importantly , it is the key process in primordial germ cell ( pgc ) determination and the oocyte - to - embryo transition ( oet ) ( reviewed in ref . this process is absolute and includes reactivation of the second x - chromosome in females and full demethylation of all imprinted gene clusters . the demethylation in early pgcs is essential , as new all - paternal or all - maternal icr methylation patterns are , and must be , established in sperm and oocytes , respectively ( fig . 2 ) . this reacquisition of methylation is dna methyltransferase 3a ( dnmt3a)-dependent and occurs in males during late fetal development and begins in females postnatally in growing oocytes . the activity of dnmt3a relies on the enzymatically inactive regulatory factor dnmt3l , which enables binding and methylation of dna in the first place . the loss of dnmt3l equally results in loss of maternal and paternal imprints . in male germ cells , dnmt3l is also required to repress retrotransposons , potentially linking genomic imprinting and silencing of repetitive elements . this observation may help to answer how dnmt3a is specifically targeted to the icrs in the first place . maternal and paternal genomes are methylated during germ cell specification , including allele - specific methylation of imprinted genes by dnmt3a . the paternal genome becomes actively demethylated in the zygote and the maternal genome undergoes passive demethylation until the early blastocyst stage . the average dna methylation level in sperm is a remarkable ( 89.4% ) , reflective of its terminal differentiation and the dense packaging of genetic information in these highly specialized cells . methylation of the maternal genome in oocytes is less dense ( 40% ) , yet still remarkably high compared with blastocysts ( 21% ) and readily detectable by immunofluorescent analysis of 5-methyl - cytosine ( 5-mc ) . similar results have been reported recently from genome - wide sperm , other oocyte and embryo methylome studies . in contrast to the exceptionally restricted potential of germ cells , the zygote is the only truly totipotent entity in mammals . this dramatic turnabout of potency is initiated after fertilization when immediate , drastic epigenetic reprogramming ensues to produce the totipotent state , which is necessary for further embryonic development . the enormity of this step to the genome is most apparent when the dynamic of dna demethylation is examined . within 7 to 8 h of fertilization , conversely to this active demethylation , the maternally contributed genome undergoes replication - dependent , passive demethylation over several cell divisions ( fig . 2 ) . either way , in contrast to the epigenetic reprogramming in pgcs , reprogramming in preimplantation embryos is more selective , conserving dna methylation at icrs and thus allowing the inheritance of the parental imprints by the new embryo ( fig . 2 ) . although a control mechanism permitting the demethylation machinery to distinguish imprinted from non - imprinted regions and even paternal from maternal genomes was postulated early on , it is only recently that the pieces to this puzzling process have fallen into place . the first genetic evidence for a molecule with such a sentry function came from analysis of embryos derived from a maternal knockout of the developmental pluripotency - associated 3 protein ( dppa3 ) , also known as pgc7 or stella . zygotes lacking maternal contribution of stella do not differentiate the maternal from paternal genome , actively demethylating both as a result . whether active demethylation vs. the normal passive demethylation of the maternal pronucleus is the cause of this effect is still unclear , as some paternally and maternally methylated imprinted regions and retrotransposable elements are also errantly demethylated . a recent study has not resolved this question ; yet , it has shown that an underlying chromatin modification , h3k9me2 , specifically recruits stella to the maternal genome and to the subset of paternal icrs , preventing active dna demethylation by tet ( ten - eleven translocation ) enzymes at these loci . remarkably , stella is also expressed in primordial germ cells , detectable first in embryos at e7.5 and remaining expressed throughout pgc specification . its presence in pgcs , however , prevents neither active nor passive dna demethylation of icrs . the loss of stella , while only affecting a subset of the imprinted regions , globally affects the maternal genome . conversely , a chromatin - modifier complex has recently been shown to confer reprogramming resistance to imprinted regions in a global , but much more specific manner . trim28 ( also known as kap1 or tif1b ) is the central scaffolding component of this heterochromatin - inducing complex containing multiple chromatin - remodeling factors . along with other components , it binds the h3k9me3-catalyzing histone methyltransferase setdb1 ( or eset ) , the nucleosome remodeling and histone deacetylation ( nurd ) complex as well as heterochromatin protein 1 ( hp1 ) . recently , this list of interaction partners has been extended to include , at least in embryonic stem cells ( escs ) , the maintenance and de novo dna methyltransferases dnmt1 , dnmt3a and dnmt3b . the dna binding specificity of the complex is conveyed by interaction of trim28 with various , tissue - specifically expressed krppel - associated box - containing zinc - finger proteins ( krab - zfps ) , such as zfp57 . ablating maternal - zygotic expression of zfp57 in mouse embryos causes misexpression of imprinted genes and loss of methylation at both paternally and maternally methylated icrs . also in humans loss - of - function mutations in zfp57 cause hypomethylation at several icrs , ultimately resulting in transient neo - natal diabetes . the effect on imprint maintenance in mice is less pronounced and more variable in zygotic mutants and the loss of maternal zfp57 alone can be fully rescued by zygotic expression of the paternal allele . conversely , the deletion of maternal trim28 alone is lethal , though the phenotypes of affected individuals are variable . dna methylation analysis of post - implantation maternal trim28 mutants also revealed an effect on several maternally and paternally methylated icrs in genetically identical individuals . despite the fact that icrs are not all affected to the same extent in mutant trim28 or zfp57 embryos , the binding of trim28 and zfp57 and the presence of h3k9me3 , product of the histone methyltransferase setdb1 , were detected at all imprinted loci tested . this global , yet highly specific , binding was confirmed by genome - wide dna binding analysis in escs , showing that 91 loci , including all known icrs , are bound by the complex in a fully zfp57-dependent manner . predictably , deletion of zfp57 in escs also affects dna methylation , with five tested icrs ( snrpn , kvdmr , rasgrf1 , peg3 and gnas ) being fully demethylated . in contrast , deletion of trim28 in escs results in a rapid loss of pluripotency and growth arrest , preventing comprehensive analysis of dna - demethylation dynamics in these cells . interestingly , in maternal trim28 mutant embryos with hypomethylated icrs , trim28 and zfp57 binding and accumulation of h3k9me3 was lost and never recovered , even when trim28 from the paternal allele was expressed ( unpublished observation ) . this observation provided the first in vivo indication that dna - binding of zfp57 is 5-mc - dependent . once dna methylation at the icr is lost it can not be restored . in vitro , this irrevocability has been illustrated by forced expression of wild - type zfp57 in a zfp57 null embryonic stem cell line , which does not restore dna methylation at icrs . using an inducible deletion / expression system it was moreover demonstrated , that wild - type zfp57 , but not a trim28 interaction - deficient zfp57 protein , can prevent loss of dna methylation , further cementing the requirement for trim28 in this process . analysis of the binding sites discovered by chip - seq in escs revealed a hexanucleotide consensus zfp57-binding sequence ( tgccgc ) , which was highly conserved in 81 of 91 bound loci . further , in vitro gel - shift assays confirmed preferential binding of the zfp57 zinc - finger domain to the methylated oligonucleotide . genomic imprinting is regulated by dna methylation at control regions , which must be preserved throughout an individual s life span even in the face of epigenetic reprogramming at early embryonic stages . the zinc - finger protein zfp57 binds both maternally and paternally methylated icrs in a sequence- and methylation - specific manner . through the interaction of zfp57 with trim28 , the chromatin- and dna - modifying factors , which are all maternally expressed , are attracted to the methylated icrs . this complex remains bound to icrs throughout preimplantation development , preserving the 5-mcs in an environment poised to reprogram and demethylate genomes ( figs . 1 and 2 ) . genetic evidence from various knockout studies established the components required and , to some extent , their inter - relationships in this process . however , open questions remain especially regarding the actual mechanism employed by the trim28/zfp57 complex to preserve dna methylation . in fact , the most affected locus ( h19 ) is completely demethylated in only 50% of the analyzed embryos . other loci this could result from paternal trim28 rescue of the not yet demethylated icrs that still retain bound zfp57 . theoretically , after zygotic gene activation zfp57 could engage newly synthesized trim28 expressed from the paternal allele to attract the whole modifier complex and recover normal imprinting . it is therefore likely that the rate of demethylation and of trim28 transcription from the paternal genome dictates the severity and variability of the mutant phenotype . testing this hypothesis would require icr methylation analysis of individual , maternal - zygotic trim28 mutant embryos , which to date is prevented by technical limitations . the rate of dna demethylation in the embryo depends on whether it occurs actively or passively . it is tempting to consider that binding of the zfp57/trim28 complex to icrs could prevent active dna demethylation , similar to stella function . however , combined bisulphite restriction analysis ( cobra ) showed little effect on the h19 icr in 2-cell stage embryos , and loss of methylation only became apparent at the 4- to 8-cell stages , suggesting dna demethylation happens slowly . thus , active dna demethylation through base excision repair ( ber ) as observed in primordial germ cells and suggested to occur in zygotes is unlikely , suggestive of a passive mechanism . on the other hand , active dna demethylation by tet enzymes produces the intermediate 5-hmc , which can persist in preimplantation embryos until it is passively diluted by dna replication . since bisulfite conversion - based detection of dna methylation does not allow distinction between 5-mc and 5-hmc , i.e. , active from passive demethylation , it is necessary to analyze icrs in 2-cell stage embryos by other methods capable of such a distinction . however , the classical methods ( i.e. , medip / hmedip or immunofluorescent detection ) are not applicable to the small amounts of genomic material available from preimplantation embryos or do not allow the required resolution . two related , recently presented methods , however , permit the quantitative mapping of 5-hmc and data from preimplantation embryos will undoubtedly be available soon . whether or not active dna demethylation could affect imprinting maintenance at all will depend on whether zfp57 is also able to bind 5-hmc in its consensus sequence , which remains to be shown . the direct interaction of trim28 with several dnmts in escs argues in favor of a maintenance mechanism preventing the passive , replication - dependent dilution of 5-mc . in particular , the interaction of trim28 with dnmt1 and np95 , both previously shown to be involved in maintenance of imprints , is an intriguing finding . dnmt1 recognizes hemimethylated dna , propagating methylation on the newly synthesized , naked strand in mitotic cells . the absence of zfp57 , or the linker trim28 , during cell division would therefore prevent such maintenance and cause the observed dilution of methylated icrs . in a trim28 maternal - mutant embryo only two cells would carry one hemimethylated allele at any stage before zygotic rescue ( fig . 3b ) . with 91 loci bound by the complex , randomly distributed among the blastomeres , permutations of methylation defects could be vast , leading to a wide range of phenotypes . in this scenario , zfp57 recognizes hemimethylation on either dna strand in combination with its hexameric ( non - palindromic ) binding site , a hypothesis that remains to be tested ( fig . ( a ) zfp57-dependent recognition of icrs and trim28-mediated recruitment of dnmt1 during / after replication allows methylation of the newly synthesized strand . note that this mechanism requires zfp57-recognition of hemimethylated dna on either strand in combination with the non - palindromic hexanucleotide zfp57-binding sequence ( bold ) . ( b ) in the absence of trim28 , dnmt1 is not recruited to icrs , resulting in hemimethylated alleles in the 2-cell stage embryo . further dna replication , in absence of trim28 , produces two hemimethylated and two unmethylated alleles ( highlighted ) to be inherited at the 4-cell stage . ( for simplicity , only the methylated parental allele and only one daughter cell are depicted . ) the question as to whether the trim28/zfp57 complex inhibits active or passive demethylation can not be conclusively answered at this time . additional experiments , such as conditional deletion of zfp57 in escs and timed , comparative medip / hmedip experiments could , however , provide considerable insights . possibly , a combination of both active and passive demethylation contribute to the loss of imprinting in maternal trim28 mutants , especially since the paternally methylated h19 locus is most strongly affected . this combination of both demethylation mechanisms further enhances the unpredictability of the phenotypic and molecular outcome for individual blastomeres , and even more so for the embryos , fitting our in vivo observations . the implication that the zfp57/trim28/dnmt1 complex could maintain imprints in a regulated way in preimplantation embryos , rather than simply providing mere protection from demethylation , raises the question as to whether this mechanism could also affect later developmental stages and adult tissues . zygotic trim28 mutants die at gastrulation , failing to induce mesoderm differentiation and showing extreme upregulation of iap retrotransposons . however , a comprehensive analysis of the phenotype and its cause was not performed , and dna methylation at icrs has not been analyzed . intriguingly , conditional deletion of trim28 in the hippocampus of mice , a region also expressing zfp57 , led to disregulation of some imprinted loci , suggesting a similar function in adult tissues , which requires further investigation . yet , preimplantation embryos and esc are well known for their labile epigenetic states . the requirement for parental genome activation followed directly by the preparation of blastomeres for disparate cell fates in the first lineage segregations demands great epigenetic plasticity . this plasticity is recognizable in co - expression of both demethylating ( tets ) and methylating ( dnmts ) enzymes , and in the presence of bivalent chromatin marks . such an environment might just require specific , specialized targeting of a maintenance complex to icrs to ensure epigenetic integrity in these volatile cells . for instance , recent careful reexamination of methylation patterns of imprinted loci during preimplantation development has uncovered an unexpected loss of 5-mc , especially at the periphery of icrs . the new evidence , however , shows that as long as the specific 5-mc is maintained in the zfp57 binding site , such demethylation noise could be inconsequential , as these neighboring methyl marks can be recovered by attracting de novo dna methyltransferases to the icrs . taken together , the recent discoveries allow a remarkably complete insight of how imprints are conserved during epigenetic reprogramming in preimplantation embryos . yet , major discrepancies between the different genetic models , such as in the viability of maternal zfp57 mutants vs. lethality of maternal trim28 mutants and the non - overlapping effects on specific icrs ( e.g. , h19 icr ) in vivo , require further investigation . these differences might in part originate from independent functions beyond imprinting control ( mainly for trim28 ) , the timing of gene - specific zygotic activation and the just - in - time availability of newly translated proteins to the complex , but they could also derive from partial functional redundancy of zinc finger proteins ( there are over 400 krab - zfps encoded in the mouse genome ) . especially , the intriguing loss of methylation at the h19 dmr in maternal trim28 but not zfp57 mutants could be based on such redundancy . it would therefore be interesting to see if trim28 remains bound to the h19 dmr in the absence of zfp57 . unfortunately , due to the labile methylation state of the h19 locus in escs in general , this analysis was previously uninformative , and must therefore be performed in vivo on zfp57-null embryonic tissues . now that the major molecules involved in the process are identified and with the knowledge that maintenance of a single cpg island in a zfp57 binding site ensures the maintenance of imprinting , the experimental paradigm shifts . future assays must address dna methylation at these specific sites and reexamination of existing data might be required . finally , evidence from maternal zfp57 mutants suggests a role for zfp57 in establishing methylation at the snrpn icr in the maternal germ line . even though this finding was not confirmed in maternal trim28 mutants ( unpublished observation ) , it opens the exciting prospect that profound analysis of zfp57 function and its binding partners might shed light onto the other major , still unanswered , question of imprinting : how is dna methylation established at icrs in the first place ?	recent findings shed light on the coordination of two fundamental , yet mechanistically opposing , processes in the early mammalian embryo . during the oocyte - to - embryo transition and early preimplantation development nuclear reprogramming occurs . this resetting of the epigenome in maternal and paternal pronuclei to a ground state is the essential step ensuring totipotency in the zygote , the first embryonic stage . radical , global dna demethylation , which occurs actively in the paternal and passively in the maternal genome , is a prominent feature of nuclear reprogramming ; yet , this process poses a danger to a subset of methylated sequences that must be preserved for their germline to soma inheritance . genomic imprinting and its importance were demonstrated three decades ago by a series of experiments generating non - viable mammalian uniparental embryos . indeed , imprinted loci , gene clusters with parent - of - origin specific gene expression patterns , must retain their differential methylation status acquired during gametogenesis throughout embryogenesis and in adult tissues . it is just recently that the molecular players that protect / maintain imprinting marks during reprogramming in preimplantation embryos have been identified , in particular , an epigenetic modifier complex formed by zfp57 and trim28/kap1 . the interaction of these and other molecules with the newly formed embryonic chromatin and imprinted genes is discussed and highlighted herein .
You are an expert at summarizing long articles. Proceed to summarize the following text: oral health is a highly personalized concept the awareness , of which highly relies on an individual 's culture and socio - economic status . it can be defined as a standard of health of the oral and related tissues , which enables an individual to eat , speak and socialize without active disease , discomfort or embarrassment and which contributes to general well - being . keeping a healthy oral profile one of the most important factors that decide the dental health of a population is the outlook of its people toward their dentition . moreover , knowledge about oral health has been cited as an important factor that determines overall health . chronic diseases such as diabetes , obesity and caries , which share common risk factors are on an increase in developing countries leading to poor quality of dental as well as general health . treatment of the dental diseases involves high costs like many other diet and health related diseases . most of people tend to ignore their impending dental problems , which later on multiply and affect the overall health . failure of the people to realize this fact has led millions of them to suffer intractable toothache , poor quality - of - life ultimately ending up with few teeth . although many studies have been carried out from time to time to assess the knowledge and behavior of people about oral health , there is still a dearth of education regarding the same especially for rural people , who make up for more than 70% of the population in india . furthermore , even the people living in cities , in spite of having easy reach to dental care , fall prey to dental diseases due to their negligence in dietary habits and unhealthy life - style . very few researches dealing with knowledge and awareness regarding oral health have been carried out on indian population particularly in rural areas . therefore , aim of the present study was : to determine oral health awareness among the patients visiting the out - patient department ( opd ) of gian sagar dental college and hospitalto access their level of understanding in regard to oral health practices . to determine oral health awareness among the patients visiting the out - patient department ( opd ) of gian sagar dental college and hospital to access their level of understanding in regard to oral health practices . a cross - sectional study was conducted on the patients visiting the opd of gian sagar dental college and hospital , rajpura . ethical clearance was obtained from the ethical committee of gian sagar dental college and hospital for conducting the study . a pilot survey was conducted on 50 subjects to judge the aptness of the questionnaire and it was found that an average of 10 min was needed to answer all the questions . the purpose of the study was informed and explained to the participants and those who voluntarily agreed to participate in the study and gave a written consent were asked to fill the questionnaire according to the response format provided in the questionnaire . a self - made closed ended questionnaire written in english language was given to each one of them . in order for them to fully understand the questionnaire , the subjects selected were above 18 years . the questionnaire form was divided into two parts . the first part of the questionnaire collected the demographic details of the individuals participating in the study such as age , sex , gender , occupation etc . , the subsequent part was designed with questions to assess the knowledge , attitude and practices related to oral health such as number of milk teeth , number of permanent teeth , source of dental knowledge , time devoted toward brushing etc . , [ table 1 ] . questionnaire used for collecting information from the study subjects the questionnaires were handed to the patients while they were seated in the waiting area of the out - patient department . at all times , one of the investigators was present with the respondent while the questionnawires were being filled to ensure that the concerned respondent did not discuss the questions or the answers with any other patients sitting in the waiting area and also to make sure that the concerned respondent fully understood the questions as well as the probable answers completely . each positive response was given a score 1 and each negative response was assigned a score 0. results were statistically analyzed using spss package version 15.0 ( spss , chicago , il , usa ) in terms of percentages . however , no attempt was made to correlate the findings with one another in terms of descriptive statistics and using other statistical tests . a cross - sectional study was conducted on the patients visiting the opd of gian sagar dental college and hospital , rajpura . ethical clearance was obtained from the ethical committee of gian sagar dental college and hospital for conducting the study . a pilot survey was conducted on 50 subjects to judge the aptness of the questionnaire and it was found that an average of 10 min was needed to answer all the questions . the purpose of the study was informed and explained to the participants and those who voluntarily agreed to participate in the study and gave a written consent were asked to fill the questionnaire according to the response format provided in the questionnaire . a self - made closed ended questionnaire written in english language was given to each one of them . in order for them to fully understand the questionnaire , the first part of the questionnaire collected the demographic details of the individuals participating in the study such as age , sex , gender , occupation etc . , the subsequent part was designed with questions to assess the knowledge , attitude and practices related to oral health such as number of milk teeth , number of permanent teeth , source of dental knowledge , time devoted toward brushing etc . , the questionnaires were handed to the patients while they were seated in the waiting area of the out - patient department . at all times , one of the investigators was present with the respondent while the questionnawires were being filled to ensure that the concerned respondent did not discuss the questions or the answers with any other patients sitting in the waiting area and also to make sure that the concerned respondent fully understood the questions as well as the probable answers completely . each positive response was given a score 1 and each negative response was assigned a score 0. results were statistically analyzed using spss package version 15.0 ( spss , chicago , il , usa ) in terms of percentages . however , no attempt was made to correlate the findings with one another in terms of descriptive statistics and using other statistical tests . this present study was carried out on 642 subjects . among them , 64.8% were males and 35.2% were females . the number of subjects in 18 - 24 age group was maximum being 266 ( 41.5% ) . in view of their education background , 229 ( 35.8% ) of approximately , 449 ( 70% ) of the study subjects belonged to rural areas with farming as their primary source of earning meals . distribution of study population according to age education level of the subjects under study the results pointed out that educational level was one of the important factors that governed the knowledge , attitude and behavior of the people [ figure 3 ] . almost 554 ( 86% ) of the subjects did n't know the number of deciduous teeth present and 584 ( 90% ) of subjects were of the opinion that deciduous teeth are insignificant or were unaware of their importance . 263 ( 40% ) study subjects did n't find it important to visit the dentist . 263 ( 41% ) subjects cited parents as their primary source of knowledge regarding oral health . knowledge regarding deciduous teeth , visiting dentist and source of oral health knowledge furthermore , 306 ( 48% ) subjects had never visited dentist before and 186 ( 61% ) of those who did , cited extraction and pain as the reason for the first visit . in spite of all the educational awareness programs being carried out , 304 ( 47% ) of the subjects still prefer other cleaning aids over toothbrush like datun ( a wooden stick of the neem tree common in rural areas ) as a cleaning aid [ figure 4 ] . among the ones using toothbrush , 233 ( 69% ) subjects brushed only once a day and 367 ( 58% ) subjects do not use a mirror while brushing . majority of the study subjects ( 407 , [ 64% ] ) brush their teeth only for 1 min and only 17 ( 3% ) subjects devoted 2 - 5 min toward brushing [ figure 5 ] . various cleansing aids used by the study subjects time devoted toward tooth brushing among the study subjects figure 6 depicts the view of the respondents toward oral health and seeking dental treatment . 207 ( 32% ) subjects were of the view that dental health has no effect on general health , which tells us about their level of unawareness regarding dental health . to add on 186 ( 29% ) subjects believed that oral problems can not cause general body problems . 219 ( 34% ) subjects believe that tooth loss is a natural squeal of the aging process . misconceptions about dental treatment go a long way in averting patients to consult the dentist in case of need . approximately , 340 ( 53% ) subjects were of the view that dental treatments hurt and causes pain . oral health is an integral part of general health and a valuable asset for any individual . people have underestimated consequences of bad oral health , which have led to bigger problems which later on become difficult to treat . the present study showed that educational level of the study subjects is directly proportional to the knowledge possessed by him / her and the behavior he / she practices toward his health . about 62% of the study subjects believed that oral health problems have nothing to do with the systemic problems . we as dental health professionals understand that that a core group of risk factors are common to many chronic diseases and injuries . the four most prominent non - communicable diseases - cardiovascular diseases , diabetes , cancer and chronic obstructive pulmonary diseases - share common risk factors with oral diseases . people should be made aware of all these facts in order to lead a healthy and longer life . similar studies in different nations have also been carried out in the past to assess the knowledge , attitude and behavior among different groups , professionals , students and populations . unfortunately , oral health standards in india still pose a major problem due lack of awareness . about 48% of the subjects in the present study never visited a dentist and about 61% of the remaining only visited in case of a problem or extraction , which is in agreement to results obtained by various studies . about 69% people brushed only once a day , which is more than the results of the study conducted elsewhere . on the other hand , according to some other study reports about 74% subjects brush their teeth about twice a day showing a vast difference in dental professionals and common people . parental guidance plays a very crucial role in modifying the behavior of children . in our study , only 41% of the subjects cited parents as a primary source of knowledge regarding oral health where 60% cited other sources showing that most parents do not indulge in guiding their children . these findings were found to be in congruence with findings from previous studies supporting evidence that parents are neglecting oral habits of the subjects under study . fear of pain is one of the important factors that prevent patients from visiting the dentist . in spite of numerous advances in the field of dentistry , phobia of pain during treatment still persists among a large number of populations acting as an obstacle in the path of dental treatment . in our study , almost 53% of the subjects think that pain is inevitable while undergoing a dental procedure . this finding points out toward the fact that fallacies related to dental treatment are still prevalent among the people obstructing them to take the apt decision regarding dental treatment . there is a dearth of knowledge and careless attitude among subjects in regard to dental health in the present study . therefore , there is an urgent need to educate and motivate people about oral health and related problems . the results of this cross - sectional study are an indicator to a major problem , which is often neglected by the population as well as the governing health care bodies . the awareness about oral hygiene and dental health needs to be spread by dental professionals . this approach has to be extended beyond the clinics through various outreach programs in the areas , which are less accessible to oral health facilities . media can also play a role in educating people and motivating them to visit a dentist after regular intervals . last but not the least we as dentists , as a part of the system have a responsibility toward our society to educate and motivate this uneducated / educationally backward group so that we can move a step forward to create a healthy environment .	objective : this study was carried out to assess the knowledge , attitude and behavior among patients visiting the out - patient department ( opd ) of gian sagar dental college and hospital , rajpura.materials and methods : a cross - sectional study was conducted on 642 subjects who visited the opd of gian sagar dental college and hospital . a self - constructed questionnaire was given to each of the participant . responses from the subjects were calculated in terms of numbers and percentages.result:three hundred six ( 48% ) of the subjects had never visited a dentist before . 304 ( 47% ) of the subjects still prefer other cleaning aids over toothbrush . 207 ( 32% ) subjects were of the view that dental health has no effect on general health , whereas 219 ( 34% ) subjects were of the opinion that tooth loss is a natural sequel of the aging process.conclusion:there is a dearth of knowledge and careless attitude among people in regard to dental health . people need to be motivated and their concepts regarding the importance of dental health should be made clear through various campaigns and personal counseling .
You are an expert at summarizing long articles. Proceed to summarize the following text: four independent studies from the netherlands ( nl ) and germany ( d ) were used . details of three of four samples have previously been described ( hoorn [ nl , 137 with igt ] ; utrecht [ nl , 60 with ngt/12 with igt ] ; tbingen [ d , 83 with ngt/35 with igt ] ) ( 17 ) . we have extended our study sample with a cohort selected from the netherlands twin register ( ntr ; 113 with ngt/7 with igt ) ( 22 ) . this cohort consists of a mixed sample of twins and nontwin sibs recruited from 50 families ( family size 19 ) . in total , the ntr twin sample includes 66 monozygotic twins ( 31 pairs ) , 25 dizygotic twins ( 11 pairs ) , and 29 nontwin sibs ( 14 twin , nontwin sib pairs ; 1 single nontwin sib ) . clinical characteristics of the hyperglycemic clamp cohorts data are means sd or medians ( interquartile range ) . * original population from which the cohort originated ( 2126 ) . all participants underwent a hyperglycemic clamp at 10 mmol / l glucose for at least 2 h ( 21,2326 ) . after a priming infusion of glucose to acutely raise blood glucose levels , blood glucose levels were measured with a glucose analyzer and kept constant at 10 insulin levels were measured with immunoassays as previously described ( 21,2326 ) . to correct for this and possible other differences between centers first - phase insulin secretion was determined as the sum of the insulin levels during the first 10 min of the clamp . second - phase insulin secretion was determined as the mean of the insulin levels during the last 40 min of the second hour of the clamp ( 80120 min ) . the insulin sensitivity index ( isi ) was calculated by relating the glucose infusion rate ( m ) to the plasma insulin concentration ( i ) during the last 40 min of the second hour of the clamp ( m / i ) . ( 27 ) compared the isi determined with a hyperglycemic clamp with insulin sensitivity as determined using the euglycemic - hyperinsulinemic clamp in the same subjects and found a good agreement between the two methods . the disposition index ( di ) was calculated by multiplication of first - phase insulin secretion and isi in order to quantify insulin secretion in relation to the ambient insulin sensitivity ( 28,29 ) . subjects from tbingen and the ntr twin sample both underwent an extended clamp using additional glp-1 and arginine stimulation as described previously ( 21 ) . glp-1stimulated insulin release was measured as the mean incremental area under the curve ( 160180 min ) following glp-1 stimulation ( 4.5 pmol / kg bolus for 1 min at t = 120 followed by a continuous infusion of 1.5 pmol kg min . in the dutch ntr twin cohort , slightly lower glp-1 concentrations were used ( 1.5 pmol / kg and 0.5 pmol kg min , respectively ) . arginine - stimulated acute insulin release was measured by injecting a bolus of 5 g arginine hydrochloride at t = 180 as described previously ( 21 ) . the acute insulin response to arginine was calculated as the mean incremental area under the curve from 182 to 185 min . based on the available literature regarding gsis and the novel type 2 diabetes genes , we selected gene variants in tcf7l2 ( rs7903146 ) , kcnj11 ( rs5219 ) , cdkal1 ( rs7754840 ) , igf2bp2 ( rs4402960 ) , hhex / ide ( rs1111875 ) , slc30a8 ( rs13266634 ) , cdkn2a / b ( rs10811661 ) , and mtnr1b ( rs10830963 ) for genotyping . results of the association analysis of the effect of the individual genes on gsis during hyperglycemic clamps in the dutch hoorn and utrecht study and the german tbingen study have been published previously ( 1417 ) . and p values for all four samples combined , including the dutch ntr twins , are given in supplementary table 1 ( available in the online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db09-0736/dc1 ) . all single nucleotide polymorphisms ( snps ) were measured using either the sequenom platform ( sequenom , san diego , ca ) or taqman snp genotyping assays ( applied biosystems , foster city , ca ) in all subjects . the genotyping success rate was > 97% for all snps , and samples measured in duplicate ( 5% ) revealed no errors . we combined the information of the snps using an allele count model ( 6 ) . we summed the number of risk alleles carried by each individual , assuming an equal and additive effect of each allele . the effect of the sum score of risk alleles on the responses was examined by calculating the values for the risk allele score with linear generalized estimating equations , which takes into account the family relatedness when computing the standard errors ( i.e. , in the twin sample ) . for ease of interpretation , the exponent values ( 10 ) for analyses of first- and second - phase gsis , glp-1 and arginine - stimulated insulin secretion adjustment for age , sex , bmi , study center , glucose tolerance status , and isi were used . for the analysis of isi and di , all outcome variables were log - transformed prior to analysis . logistic regression with adjustment for age , sex , and bmi was used to test associations with dichotomous end points like the absence of a first - phase insulin peak and type 2 diabetes . a priori power calculations showed that the design used in this study would allow the detection of a difference in insulin secretion between 10% ( glucose ) to 25% ( glp-1 , arginine ) with 80% power ( < 0.05 ) , depending on the stimulus used and allele frequency . after correction for multiple hypothesis testing , results were regarded significant at p < 0.008 ( six tests ) . for all statistical analyses , spss version 16.0 software ( spss , chicago , il ) was used . four independent studies from the netherlands ( nl ) and germany ( d ) were used . details of three of four samples have previously been described ( hoorn [ nl , 137 with igt ] ; utrecht [ nl , 60 with ngt/12 with igt ] ; tbingen [ d , 83 with ngt/35 with igt ] ) ( 17 ) . we have extended our study sample with a cohort selected from the netherlands twin register ( ntr ; 113 with ngt/7 with igt ) ( 22 ) . this cohort consists of a mixed sample of twins and nontwin sibs recruited from 50 families ( family size 19 ) . in total , the ntr twin sample includes 66 monozygotic twins ( 31 pairs ) , 25 dizygotic twins ( 11 pairs ) , and 29 nontwin sibs ( 14 twin , nontwin sib pairs ; 1 single nontwin sib ) . clinical characteristics of the hyperglycemic clamp cohorts data are means sd or medians ( interquartile range ) . * original population from which the cohort originated ( 2126 ) . all participants underwent a hyperglycemic clamp at 10 mmol / l glucose for at least 2 h ( 21,2326 ) . after a priming infusion of glucose to acutely raise blood glucose levels , blood glucose levels were measured with a glucose analyzer and kept constant at 10 insulin levels were measured with immunoassays as previously described ( 21,2326 ) . to correct for this and possible other differences between centers first - phase insulin secretion was determined as the sum of the insulin levels during the first 10 min of the clamp . second - phase insulin secretion was determined as the mean of the insulin levels during the last 40 min of the second hour of the clamp ( 80120 min ) . the insulin sensitivity index ( isi ) was calculated by relating the glucose infusion rate ( m ) to the plasma insulin concentration ( i ) during the last 40 min of the second hour of the clamp ( m / i ) . ( 27 ) compared the isi determined with a hyperglycemic clamp with insulin sensitivity as determined using the euglycemic - hyperinsulinemic clamp in the same subjects and found a good agreement between the two methods . the disposition index ( di ) was calculated by multiplication of first - phase insulin secretion and isi in order to quantify insulin secretion in relation to the ambient insulin sensitivity ( 28,29 ) . subjects from tbingen and the ntr twin sample both underwent an extended clamp using additional glp-1 and arginine stimulation as described previously ( 21 ) . glp-1stimulated insulin release was measured as the mean incremental area under the curve ( 160180 min ) following glp-1 stimulation ( 4.5 pmol / kg bolus for 1 min at t = 120 followed by a continuous infusion of 1.5 pmol kg min . in the dutch ntr twin cohort , slightly lower glp-1 concentrations were used ( 1.5 pmol / kg and 0.5 pmol kg min , respectively ) . arginine - stimulated acute insulin release was measured by injecting a bolus of 5 g arginine hydrochloride at t = 180 as described previously ( 21 ) . the acute insulin response to arginine was calculated as the mean incremental area under the curve from 182 to 185 min . based on the available literature regarding gsis and the novel type 2 diabetes genes , we selected gene variants in tcf7l2 ( rs7903146 ) , kcnj11 ( rs5219 ) , cdkal1 ( rs7754840 ) , igf2bp2 ( rs4402960 ) , hhex / ide ( rs1111875 ) , slc30a8 ( rs13266634 ) , cdkn2a / b ( rs10811661 ) , and mtnr1b ( rs10830963 ) for genotyping . results of the association analysis of the effect of the individual genes on gsis during hyperglycemic clamps in the dutch hoorn and utrecht study and the german tbingen study have been published previously ( 1417 ) . and p values for all four samples combined , including the dutch ntr twins , are given in supplementary table 1 ( available in the online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db09-0736/dc1 ) . all single nucleotide polymorphisms ( snps ) were measured using either the sequenom platform ( sequenom , san diego , ca ) or taqman snp genotyping assays ( applied biosystems , foster city , ca ) in all subjects . the genotyping success rate was > 97% for all snps , and samples measured in duplicate ( 5% ) revealed no errors . we combined the information of the snps using an allele count model ( 6 ) . we summed the number of risk alleles carried by each individual , assuming an equal and additive effect of each allele . the effect of the sum score of risk alleles on the responses was examined by calculating the values for the risk allele score with linear generalized estimating equations , which takes into account the family relatedness when computing the standard errors ( i.e. , in the twin sample ) . for ease of interpretation , the exponent values ( 10 ) for analyses of first- and second - phase gsis , glp-1 and arginine - stimulated insulin secretion adjustment for age , sex , bmi , study center , glucose tolerance status , and isi were used . for the analysis of isi and di , all outcome variables were log - transformed prior to analysis . logistic regression with adjustment for age , sex , and bmi was used to test associations with dichotomous end points like the absence of a first - phase insulin peak and type 2 diabetes . a priori power calculations showed that the design used in this study would allow the detection of a difference in insulin secretion between 10% ( glucose ) to 25% ( glp-1 , arginine ) with 80% power ( < 0.05 ) , depending on the stimulus used and allele frequency . after correction for multiple hypothesis testing , results were regarded significant at p < 0.008 ( six tests ) . for all statistical analyses , spss version 16.0 software ( spss , chicago , the risk allele counts for the eight -cell genes were normally distributed in our participants ( supplementary fig . 1 ) . there was a significant inverse correlation between the number of risk alleles and first - phase gsis ( = 0.95 [ 95% ci 0.930.97 ] ; p = 7.1 10 ) ( fig . 1 ) , indicating that first - phase gsis decreases with a factor of 0.95 with each additional risk allele . the observed effect size on first - phase gsis was equal in both subjects with ngt and igt ( ngt = 0.95 , p = 4.6 10 , and igt = 0.95 , p = 0.015 , respectively ) . furthermore , the effect was present in each of the separate study samples ( range 0.930.96 , all p 0.08 ) . there was no significant effect of the number of risk alleles on second - phase gsis or isi ( both p 0.13 ) . however , there was also an inverse correlation with the di as measured by the clamp ( = 0.96 [ 95% ci 0.940.99 ] ; p = 1.6 10 ) . the risk allele score explains 4% of the variance in first - phase gsis and 5% of the variance in the di . first - phase gsis in relation to the risk allele counts for the eight loci . the line represents the regression line after adjustment for age , sex , bmi , study center , glucose tolerance status , and isi . = 0.95 ( 95% ci 0.930.97 ) ; p = 7.1 10 . to examine whether our results can be attributed to the effect of one or more single loci , we also added the single loci to the model with the risk allele score ; however , none of the single loci remained significant in this analysis ( all p > 0.3 ) . previously , we showed that three single loci are significantly associated with first - phase gsis ( cdkal1 , igf2bp2 , and mtnr1b ) ( supplementary table 1 ) ( 1417,30 ) . therefore , we also tested a model that includes the three significant single loci and a combined risk allele score for the remaining five loci ( tcf7l2 , kcnj11 , hhex , slc30a8 , and cdkn2a / b ) . in this analysis , the five - gene risk allele score still added significant information to the model ( p < 0.05 ) . for ease of interpretation , we next stratified the participants into three approximately equally sized strata ; carriers of a low ( less than seven risk alleles , n = 141 , 32% ) , medium ( 78 risk alleles , n = 183 , 40% ) , and high number of risk alleles ( more than eight risk alleles , n = 123 , 28% ) . the characteristics of the three groups are given in table 2 and the results per study sample in supplementary table 2 . analysis of the difference in first - phase gsis between these different strata showed a 9 and 23% lower first gsis in the medium and high strata compared with the reference group ( low ) ( ptrend = 5.9 10 ) ( fig . analysis of the differences in di between these groups showed a 9 and 17% reduction in di ( ptrend = 2.9 10 ) ( table 2 ) . again , no significant difference between the strata was found for second - phase gsis or isi ( both p > 0.16 ) . we did not observe an association of the number of risk alleles and glp-1stimulated insulin release during the clamp ( table 2 ) . furthermore , the maximal insulin secretion capacity as measured by arginine stimulation was not affected by the number of risk alleles present ( p = 0.65 ) ( table 2 ) . clinical characteristics of three stratified groups for number of risk alleles data are means sd or estimated means using model 1 ( 95% ci ) . low = carriers of less than seven risk alleles , medium = carriers of seven or eight risk alleles , high = carriers of more than eight risk alleles . p values were computed for different additive models using linear generalized estimating equations , which takes into account the family relatedness when computing the standard errors . model 1 : adjusted for study center , glucose tolerance status , age , sex , bmi , and isi . model 2 : adjusted for study center , glucose tolerance status , age , sex , and bmi . * available for 224 subjects from the tbingen and ntr sample . recently , we have shown that a four - gene risk allele score alters the age - related decline in -cell function in obese subjects as measured by ogtt ( 11 ) . although we have a limited number of obese subjects in the present study ( bmi 30 kg / m , n = 66 ) , we noted a similar increased decline in -cell function in obese subjects with a higher number of risk alleles ( first - phase gsis : low = 1.01 [ 95% ci 0.991.03 ] , p = 0.46 ; medium = 0.98 [ 0.960.99 ] , p = 1.1 10 ; high = 0.97 [ 0.960.99 ] , p = 5.5 10 ) . previously , we have shown that the absence of a first - phase insulin peak is a strong predictor of future development of type 2 diabetes in subjects with igt ( 26 ) . in the present study , subjects with igt without a first - phase peak had on average 1.28 ( 95% ci 0.711.85 ) more risk alleles than those with a peak ( p = 1.0 10 ) . in three strata , the frequency of an absent first - phase peak increased from 12% in the low group to 40% in the high stratum ( ptrend = 6.9 10 , adjusted for age , sex , and bmi ) ( table 3 ) . those with a medium or high number of risk alleles also had an increased risk of conversion to type 2 diabetes during follow - up ; however , due to the small numbers , this was not significant ( table 3 ) . impaired glucose - tolerant group details and follow - up stratification according to the number of risk alleles in subjects with igt only . absence of the first - phase peak was defined according to the method of nijpels et al ( 26 ) . p = unadjusted ; pmodel 1 is p value after logistic regression analysis adjusted for age , sex , and bmi . in this study , we have shown that a risk allele score for eight -cell loci is associated with lower glucose - stimulated first - phase insulin secretion but not with other measures of -cell function . previously , three other groups investigated the relationship between a risk allele score of -cell loci and gsis . pascoe et al . ( 10 ) used a risk allele score of seven loci ( tcf7l2 , kcnj11 , hhex / ide , cdkal1 , igf2bp2 , slc30a8 , and cdkn2a / b ) , whereas haupt and colleagues ( 1012 ) used four loci for his main analyses ( tcf7l2 , cdkal1 , hhex / ide , and slc30a8 ) . finally , stankov et al . ( 13 ) recently reported the results of a risk allele score identical to the one used in this study . all three groups mainly used data from ogtts in nondiabetic volunteers and were able to show that their risk allele scores are inversely correlated with -cell function . the novelty of our study is the fact that we used hyperglycemic clamps with three different stimuli and the extended risk allele score including eight proven -cell loci ( tcf7l2 , kcnj11 , hhex / ide , cdkal1 , igf2bp2 , slc30a8 , cdkn2a / b , and mtnr1b , a gene for which it has recently been shown that it is associated with type 2 diabetes and reduced gsis ) ( 3033 ) . we were able to show that only the first - phase gsis is associated with our combined risk allele score . in contrast , the other measures of -cell function and insulin sensitivity were not associated . furthermore , we noted a significant association with a lower di ( which is the product of first - phase gsis isi ) , suggesting that the investigated subjects are unable to compensate adequately for a diminished insulin sensitivity ( 29 ) . previously , it has been shown that a low di is associated with glucose intolerance and highly predictive for future diabetes ( 34 ) . remarkably , the alterations in first - phase gsis and di are already present in subjects with ngt , suggesting that these defects are either present from birth on or develop well before the onset of hyperglycemia . interestingly , it appears from our previous ( 11 ) and current data that environmental and/or genetic factors acting on obesity interact with the genetic effects on -cell function by altering the rate of the age - related decline in -cell function . our data highlight the importance of using different methods to investigate various aspects of insulin secretion . whereas previous studies have shown that these genes together can affect overall insulin secretion during ogtts , this report refines this important observation by showing that mainly the first phase of gsis is affected . this suggests that their combined effect primarily involves processes regulating the rapid recruitment and exocytosis of insulin granules following glucose stimulation . slc30a8 encodes a -cell specific zn transporter important for insulin storage , stability , and granule exocytosis , which may fit well with the observed defect ( 35 ) . for the other genes , it is less clear how they may affect the first phase of gsis . however , for one of the genes present in our risk allele score , tcf7l2 , its role in insulin granule recruitment and exocytosis was recently supported by cell - based studies using overexpression or knock down of the gene ( 36 ) . as we and others have shown previously , the genetic variation in tcf7l2 mainly affects glp-1induced insulin secretion ( 16,37 ) . in our current analysis , no resistance to glp-1induced insulin secretion with increasing number of risk alleles could be detected . first , this incretin resistance mediated by variation in tcf7l2 is likely to be masked in the present analysis by the other seven risk loci that have no known effect on incretin - induced insulin secretion . this also suggests that the association of the risk allele score with first - phase gsis is not dominated by the effects of a single locus but rather reflects the addition of independent risk mechanisms from all loci together . this is further corroborated by the fact that when we tested for dominance of single genes , by adding them to the model , there were no associations with the single loci . second , the power of the present analysis may be too low considering the relatively small subgroup in which we assessed the glp-1induced insulin secretion ( n = 224 ) . several of the loci present in our risk allele score are putatively involved in transcriptional and/or cell cycle control , and it has been suggested that they may cause a reduced -cell mass leading to the observed -cell defects ( 19,38,39 ) . however , our data show that our risk allele score of eight proven -cell genes is not associated with arginine - induced insulin secretion during hyperglycemia , a marker of ( near ) maximal insulin secretion capacity , which has been proposed as a proxy for -cell mass ( 21 ) . the finding that a higher risk allele score has no effect on second - phase gsis , incretin - induced insulin secretion , or maximal insulin secretion capacity in subjects with ngt and igt does not exclude a relevant role of these mechanisms in the -cell defects leading to type 2 diabetes . however , we may conclude that the reduced first - phase gsis is the first and prominent -cell defect leading to type 2 diabetes . this is in accordance with our recent finding that the absence of a first - phase insulin peak during hyperglycemic clamps was the best predictor of future development of type 2 diabetes in subjects with igt ( hazard ratio 5.74 [ 95% ci 2.6012.67 ] ) ( 26 ) . the strong correlation we observe between our risk allele score and the absence of a first - phase peak in our subjects with igt suggests that the eight genes we tested might be a better predictor of future type 2 diabetes compared with the generally used risk allele score of all known type 2 diabetes genes . however , due to the very small number of converters in our study , this hypothesis should be tested in larger , more suitable , prospective study samples . one of the strong aspects of our studies is the fact that we use four independent study samples from the netherlands and germany , which largely reduced the chance of false - positive findings . however , although this is the largest study sample available using hyperglycemic clamps to test associations between diabetes loci and -cell function , we can not exclude that we have missed some of the more subtle alterations . larger samples including type 2 diabetic subjects and perhaps other sophisticated tests of -cell function would be needed to fully explore all aspects of -cell function regarding these diabetes loci . in conclusion , we show that a combined score of risk alleles for eight -cell loci is associated with reduced first- but not second - phase gsis or maximal insulin secretion capacity . furthermore , in subjects with igt , there was a strong correlation with the absence of a first - phase insulin peak , which is a strong predictor of future development of type 2 diabetes . our data provide evidence that the -cell loci identified thus far act mainly via detrimental effects on processes involved in the early , rapid recruitment and exocytosis of insulin granules after glucose stimulation rather than altering maximal insulin secretion capacity .	objectiveat least 20 type 2 diabetes loci have now been identified , and several of these are associated with altered -cell function . in this study , we have investigated the combined effects of eight known -cell loci on insulin secretion stimulated by three different secretagogues during hyperglycemic clamps.research design and methodsa total of 447 subjects originating from four independent studies in the netherlands and germany ( 256 with normal glucose tolerance [ ngt]/191 with impaired glucose tolerance [ igt ] ) underwent a hyperglycemic clamp . a subset had an extended clamp with additional glucagon - like peptide ( glp)-1 and arginine ( n = 224 ) . we next genotyped single nucleotide polymorphisms in tcf7l2 , kcnj11 , cdkal1 , igf2bp2 , hhex / ide , cdkn2a / b , slc30a8 , and mtnr1b and calculated a risk allele score by risk allele counting.resultsthe risk allele score was associated with lower first - phase glucose - stimulated insulin secretion ( gsis ) ( p = 7.1 106 ) . the effect size was equal in subjects with ngt and igt . we also noted an inverse correlation with the disposition index ( p = 1.6 103 ) . when we stratified the study population according to the number of risk alleles into three groups , those with a medium- or high - risk allele score had 9 and 23% lower first - phase gsis . second - phase gsis , insulin sensitivity index and glp-1 , or arginine - stimulated insulin release were not significantly different.conclusionsa combined risk allele score for eight known -cell genes is associated with the rapid first - phase gsis and the disposition index . the slower second - phase gsis , glp-1 , and arginine - stimulated insulin secretion are not associated , suggesting that especially processes involved in rapid granule recruitment and exocytosis are affected in the majority of risk loci .
You are an expert at summarizing long articles. Proceed to summarize the following text: cataract surgery and lens implantation is usually a successful treatment if the patient 's retina is fully functional . however , 35 to 55% of patients had some visual functional impairment after cataract surgery ( snellen acuity of 0.67 or less ) . in 2011 , the american academy of ophthalmology suggested that the decision to perform cataract surgery should be made based on the measurement of visual acuity ( va ) as well as other functional measurements . preoperative testing such as intraocular pressure , slit lamp examination , color vision examination , b ultrasound examination , and visual field can not evaluate retinal function comprehensively and routine physical examination before cataract surgery does not increase the safety of the surgery . cataract surgery improved the va in the majority of the patients ; however , it would be expected that the va would not be improved in patients who have poor retinal and macular function prior to surgery . preoperative measurement of retinal function is needed to provide information beyond that which could be obtained by routine ophthalmological examination . visual electrophysiology techniques such as pattern visual evoked potential ( pvep ) and flash electroretinogram ( erg ) are used in appraising the necessity of cataract surgery and postoperative visual function [ 4 , 5 ] . pvep is used to measure the functional integrity of the visual pathways from retina via the optic nerves to the visual cortex . therefore pvep response is sensitive to lenticular opacity , but it misdiagnosed macular degeneration when patients suffer from cataract . va is associated with light focused on the fovea which encompasses approximately 5% of the central retinal area . however , with cataract , central vision is impaired and full field erg is not sensitive to the small change in the response of the fovea . there are few studies that correlate pvep , mferg , and erg with preoperative and postoperative va . also , there are no publications that relate mferg and the degree of va of cataract patients . our goal of this study was to examine the response of visual electrophysiology techniques and to compare the correlations with different degree of cataract by va . in addition , the 95% cis of the amplitudes of center point mferg for a range of preoperative va values were obtained that could be used to evaluate the outcome of surgery . and diagnostic values of erg and mferg in patients with cataract are valuable for evaluation of surgical outcome . a total of 150 subjects ( 277 cataractous eyes ) aged 4086 years with average age of 65.73 10.43 years were used for this study . of the cataractous eyes the va of all subjects was in the range 3.0 d to + 3.0 d and the subjects did not have other ophthalmic or general diseases other than cataract . as controls , we tested 20 eyes from participants that were recruited from the xi jing hospital of fourth military medicine university that did not have any pathology or ocular medical history and had a standard logarithmic va better than 1.0 . all subjects received an eye examination including refraction , slit lamp , and indirect ophthalmoscope before and 2 days after cataract surgery . cataract surgeries were performed using a clear corneal incision , phacoemulsification , and posterior chamber intraocular lens implantation . the experimental procedures were approved by the medical ethics committee of the fourth military medicine university , xi'an , china . the institute 's ethics committee approved the study before the patients ' records were analyzed . the data from the evaluation of 104 normal eyes from our ergs database was studied in order to build normal erg values by age . all cataract subjects ( 277 eyes ) were chosen by the 80% amplitude of b - wave in scotopic 3.0 erg response according to the normal data ( table 1 ) in different age groups . a standard logarithmic va chart was used to test the best corrected va ( gb11533 - 2011 , six - six vision corp . , the e characters were viewed at a distance of 5 meters and va was based on the smallest line that could be read . if patients could not see any characters at 5 m , va was measured at 4 m , 3 m , 2 m , and 1 m and was calculated by the formula : va = 0.1 distance/5 . if patients could not see words at less than 1 m , the va was measured if the patients could count fingers ( cf ) ; see hand movements ( hm ) or perceive light ( lp ) 30 centimeters away . subjects were divided into eight groups according to their va : hm , cf , 0.01 to 0.1 , 0.1 to 0.2 , 0.2 to 0.3 , 0.3 to 0.5 , 0.5 to 0.8 , and more than 0.8 ( table 2 ) . pvep recordings were obtained using a commercial system ( gotec-2011 , guote biotechnical , chongqing , china ) . pattern reversals were provided by black and white checks with reversal rates of 2.4 hz . the field size was 15 deg , and the pattern element size was 30 min ( 1 cpd ) . the electrode impedance was below 5 k. in all measurements , the stimuli were presented monocularly . an ag - agcl electrode was placed in occipital lobe that was used as the active electrode . 1.0% tropicamide ( alcon , fort worth , usa ) was placed into each eye . the erg recording was not started until the pupils dilated to at least 7 mm in diameter . copper - cup electrodes were used for both the reference ( located 1 cm from the outer canthus of the eye ) and ground ( located at the ear lobe ) recording . stimulations were produced using a full field stimulation globe with an led light source positioned 15 cm away from the eye . a commercial system ( gotec-2011 , guote biotechnical , chongqing , china ) was used to measure dark - adapted 0.01 erg , 3.0 erg and 3.0 oscillatory potentials and light - adapted 3.0 erg and 3.0 flicker . we used a band pass of 1 hz to 300 hz except oscillatory potentials ( ops ) ( 75300 hz ) . stimulation luminance was set at 3.0 dsm except the dark - adapted 0.01 erg ( 0.01 dsm ) . each stimulus condition was repeated two or three times , and waveforms were recorded for 500 ms . the electrode impedance was below 5 k. the jet electrode was contacted cornea used as the active electrode . the ag - agcl reference and ground electrodes were attached to the outer canthus and earlobe , respectively . pupils were dilated to at least 7 mm with 1.0% tropicamide ( alcon , fort worth , usa ) placed in each eye . a gotec-2011 was used to run the mferg software ( gotec-2011 , guote biotechnical , chongqing , china ) and the stimulus was presented on a samsung liquid crystal diode ( s22a300b ) . a scaled 61-hexagon stimulus pattern was selected and it provided approximately equal signal amplitude at each location . the viewing distance from the subject to the monitor was fixed at 25 cm . the optic angle was 27.7. the degree of the center point mferg ( first ring ) was 2.17. stimuli were set at 105 cdm ( white ) and 1 cdm ( black ) with an average luminance of 53 cdm and the contrast was approximately 98% . the surrounding background light was dimmed . a band pass from 5 to 100 hz and a gain of 100,000 the stimulus frame rate was 60 hz and the response signal was sampled at eight samples per frame with a sampling interval of 80 ms . the recording time for each stimulation cycle was approximately 42 s with intervals of about 5 s between segments . the ag - agcl reference and ground electrodes were attached to the outer canthus and earlobe , respectively . the amplitude and peak time of each waveform were measured by using a gotec-2011 ( guote biotechnical , china ) . a one - way anova followed by a least significant difference test was used for multiple - group comparisons . 150 patients ( 277 eyes ) were chosen with different degrees of cataract , whose amplitude of b - wave in dark - adapted 3.0 erg was 80% of the normal age matched control in our lab to ensure good retinal function ( table 1 ) . the b - wave amplitude level chosen was more than 350 v , 330 v , 300 v , 280 v , and 260 v for the age ranges 4050 years , 5060 years , 6070 years , 7080 years , and more than 80 years , respectively . in all chosen cataract patients , the amplitude of the b - wave of the dark - adapted 3.0 erg was not significantly different for each va group . the three groups with cataracts had significantly lower b - wave amplitudes from 0.01 to 0.3 ( p0.010.1 = 0.016 ; p0.10.2 = 0.013 ; p0.20.3 = 0.026 , figure 1 ) compared with the control group . there was a significant delay ( p < 0.05 ) of peak time of pvep from patients with cataracts compared with the control group , but the amplitude of pvep was significantly lower in only 0.010.3 va groups compared with the control group ( p0.010.1 = 0.000 ; p0.10.2 = 0.001 ; p0.20.3 = 0.014 , figure 2 ) . when the va was more than 0.3 , differences were not significantly different compared with the control groups ( p0.30.5 = 0.125 ; p0.50.8 = 0.351 ; p0.8 = 0.467 , figure 2 ) . the comparison of the responses in cataract groups showed the amplitude of pvep was lower in 0.0010.1 va group compared with other va groups ( p0.10.2 = 0.000 , p0.20.3 = 0.000 , p0.30.5 = 0.000 , p0.50.8 = 0.000 , and p0.8 = 0.000 , figure 2 ) . with the va the peak times of pvep were delayed in the 0.010.1 and 0.10.2 va groups compared with other va groups ( p0.010.1 versus 0.20.3 = 0.001 , p0.010.1 versus 0.30.5 = 0.000 , p0.010.1 versus 0.50.8 = 0.000 , and p0.010.1 versus 0.8 = 0.000 ; p0.10.2 versus 0.20.3 = 0.024 , p0.10.2 versus 0.30.5 = 0.002 , p0.10.2 versus 0.50.8 = 0.000 , and p0.10.2 versus 0.8 = 0.001 , figure 2 ) . and , with the va better than 0.2 , there were no significant differences in these cataract groups . the differences of amplitude density of mferg were not significantly different between cataract patients grouped by va and the control group , except for cf and 0.20.3 groups ( pcf = 0.005 ; p0.20.3 = 0.030 , figure 3 ) . the amplitude of the central point mferg was significantly lower in the hm to 0.8 va groups compared with the control group ( phm = 0.000 ; pcf = 0.000 ; p0.010.1 = 0.000 ; p0.10.2 = 0.000 ; p0.20.3 = 0.000 ; p0.30.5 = 0.000 ; p0.50.8 = 0.004 , figure 3 ) . when the va was greater than 0.8 , the amplitude of the central point mferg in the cataract groups was similar to that of the control group ( p0.8 = 0.674 , figure 3 ) . comparing the responses of mferg in different degree cataract groups , the amplitude density of mferg in all groups , the amplitudes of central point mferg keep low levels in the va lower than 0.1 groups ( phm versus 0.10.2 = 0.000 , phm versus 0.20.3 = 0.000 , phm versus 0.30.5 = 0.000 , phm versus 0.50.8 = 0.000 , and phm versus 0.8 = 0.000 ; pcf versus 0.10.2 = 0.033 , pcf versus 0.20.3 = 0.035 , pcf versus 0.30.5 = 0.005 , pcf versus 0.50.8 = 0.001 , and pcf versus 0.8 = 0.000 ; p0.010.1 versus 0.10.2 = 0.004 , p0.010.1 versus 0.20.3 = 0.000 , p0.010.1 versus 0.30.5 = 0.000 , p0.010.1 versus 0.50.8 = 0.000 , and p0.010.1 versus 0.8 = 0.000 , figure 3 ) . but there were no differences in the three groups ' range hm to 0.1 . in the va . the amplitudes of central point mferg were increased gradually and significantly in each group ( p0.10.2 versus 0.50.8 = 0.015 , p0.10.2 versus 0.8 = 0.000 ; p0.20.3 versus 0.50.8 = 0.015 , p0.20.3 versus 0.8 = 0.000 ; p0.30.5 versus 0.8 = 0.000 ; p0.50.8 versus 0.8 = 0.009 ; figure 3 ) . the amplitude , central point mferg , pvep , and erg responses correlated with preoperative va but the amplitude density of mferg did not ( figure 4 ) . the relationship of the amplitude of central point mferg with preoperative va was 0.568 , p < 0.0001 , and the correlation of amplitude density of mferg was 0.06 , p = 0.326 . the relationships between the amplitude and peak time of pvep with preoperative va were 0.445 and 0.336 , respectively ( pamplitude of pvep : va < 0.0001 , ppeak time of pvep : va < 0.0001 ) . the correlations of amplitude and peak time of the b - wave erg with preoperative va were 0.189 and 0.132 ( pamplitude of b - wave : va = 0.002 , ppeak time of b - wave : va = 0.031 ) . to ensure the retinal function of the patients with cataract was good , the amplitude of the central point mferg was the most relevant parameter when compared with the preoperative va and pvep and erg responses . the correlations of amplitude and peak time of pvep with postoperative va were 0.024 and 0.063 , respectively ( pamplitude of pvep : post va = 0.759 , ppeak time of pvep : post va = 0.476 ) . the correlation of the amplitude of the central point mferg was 0.155 , p = 0.044 , and the correlation of the amplitude density of mferg was 0.101 , p = 0.141 . the correlations of amplitude and peak time of the b - wave erg with postoperative va were 0.302 and 0.235 ( pamplitude of b - wave : post va = 0.001 , ppeaktime of b - wave : post va = 0.002 ) . the amplitude and peak time of erg and amplitude of central point mferg there were 60 eyes whose postoperative va was more than 0.5 and less than 0.8 and there were 104 eyes whose postoperative va was more than 0.8 . only 7 eyes were less than va of 0.5 after cataract surgery ( table 2 ) . over 95% ( 164/171 eyes ) of the patients had a postoperative va of more than 0.5 . the 95% ci of amplitude of the central point mferg was calculated in cataract patients grouped by preoperative va levels ( table 3 ) . female patient number 1 , aged 67 years , had a pre- and postoperative va of 0.25 , with a 95% ci of 0.3 > va 0.2 of 12.46 to 14.18 nv / deg . a 73-year - old female patient number 2 had a pre- and postoperative va of 0.3 and a 95% ci of 0.5 > va 0.3 of 13.30 to 16.22 nv / deg . the amplitude of the central point mferg was 9.6 nv / deg and 11.6 nv / deg for patients 1 and 2 , respectively , which were less than the lower level value of the 95% ci ( figure 6 ) . a 77-year - old male patient number 3 had a preoperative va of 0.25 and a postoperative va of 0.4 . the 95% ci of 0.3 > va 0.2 was 12.46 to 14.18 nv / deg ; amplitude of central point mferg was 10.4 nv / deg . patient 4 , a female aged 67 years , had a va before surgery of 0.2 and a va after surgery of 0.4 . the 95% ci of 0.3 > va 0.2 was 12.46 to 14.18 nv / deg ; amplitude of central point mferg was 10.3 nv / deg . patient 5 , a male aged 78 years , had a va before surgery of 0.2 and va after surgery of 0.4 . 0.2 was 12.46 to 14.18 nv / deg ; amplitude of central point mferg was 11.2 nv / deg . patient 6 , male aged 77 years , had va before surgery of 0.15 and va after surgery of 0.4 . the 95% ci of 0.2 > va 0.1 was 11.86 to 14.19 nv / deg ; amplitude of central point mferg was 10.9 nv / deg . patient 7 , female aged 65 years , had va before surgery of 0.2 and va after surgery of 0.4 . the 95% ci of 0.3 > va 0.2 was 12.46 to 14.18 nv / deg ; amplitude of central point mferg was 15.2 nv / deg . the amplitudes of central point mferg in the 6/7 patients were less than low line of 95% ci in different va groups . the fundus examination of the first six patients showed the reflection of fovea can not be seen . and the fundus of last patient showed macular epiretinal membrane ( table 4 , figure 6 ) . the present study revealed that a well - defined amplitude of the central point mferg was much more closely related to preoperative vas than pvep and erg in agreement with a previous study . they demonstrated that cataract seemed to reduce the central amplitude of the first positive peak ( p1 ) and the second negative peak ( n2 ) the most . some other reports [ 11 , 12 ] found that the amplitudes of n1 and p1 response from the central macula of patients with moderate cataract were notably reduced compared to that of patients with very mild cataract . we also found that there were no significant correlations between the amplitude densities of mferg responses with the pre- or postoperative va . compared with the amplitudes of pvep , pvep was used to evaluate the postoperative visual function at an early period and it was suggested that it could be used to predict the outcome of cataract surgery before the removal of the opaque lens [ 5 , 13 , 14 ] . recently , fuest et al . used blue - yellow pvep to test the erg of patients before and after cataract surgery . they demonstrated that the removal of the cataractous lens led to a significant reduction in the latency of the by - vep peaks . vernon odom et al . stated that patients with cataract and an acuity of 20/50 ( 0.4 ) or better have normal pveps in agreement with our data . we found that there was no significant difference between control and cataract groups in the pvep amplitudes over the preoperative va range 0.3 to 1.0 va . and for the va better than 0.2 , the differences were not notable in cataract groups . although the control group 's mean age was 58.95 years while the cataract group 's mean age was 65.73 , there were not statistic differences in the response of retina function between the two groups ( table 1 ) . in contrast to the correlation between mferg and preoperative va , the response amplitude of center point ( 2.17 ) mferg was significantly lower in the cataract group compared with the control group when the va was less than 0.8 . and the amplitudes of central point mferg were increased gradually and significantly in almost each cataract group . the patients suffer from different degree simple cataract ; they could get different level of amplitudes of central point mferg . in view of the amplitude of the center mferg therefore , we calculated the 95% ci for the amplitude of center point mferg for all of the cataract patient groups that were grouped by preoperative va levels to evaluate the macular function . the postoperative va of seven eyes was less than 0.5 . under the 95% ci of center mferg amplitudes , the six patients suffered from macular edema ( me ) after surgery . only one subject was beyond the 95% ci range of 0.3 > av 0.2 . . showed that the incidence of clinical and angiographic cystoids macular edema ( cme ) after uncomplicated phacoemulsification was 9.1% . . showed that the incidence of cme was 4% of cataract patients without uveitis one month after surgery in agreement with our findings . in this study , the incidence of macular edema was 3.5% in these patients after cataract operation with a low postoperative va . and chung et al . reported central mferg response was suitable to evaluate cme due to branch retina vein occlusion . perhaps the amplitude of the center mferg is an index sensitive to the patients who are prone to cme . almost 96% ( 164/171 ) of the patients that received cataract surgery resulted in an excellent postoperative va . we chose cataract patients without other ophthalmological and general diseases and chose patients whose amplitudes of erg were more than 80% of normal database to ensure good retinal function . we found that the amplitude of the b - wave was closely correlated with postoperative va for the scotopic 3.0 erg response . however , some reports found that the erg responses of subjects with cataract were lower compared with normal control subjects . others have shown that there was no significant difference in amplitude of the b - wave between patients with cataract and control subjects [ 20 , 21 ] . knowing the function of the whole retina preoperatively is essential for postoperative va . over 95% of our patients had ideal outcome vas greater than 0.5 , higher than the range of 48%95% ( 78% average ) measured in other studies . some report that 90% of patients undergoing cataract extraction have postoperative acuities of 6/12 ( 20/40 ) or better . the reason our percentage was higher is because we strictly chose to operate on patients depending on their preoperative ergs . thus , preoperative erg is essential for determining whether the cataract surgery is necessary and will successfully improve va of patients . in conclusion , the amplitude of the central point mferg was much more closely related and specific to different preoperative va levels . the amplitude 95% ci of central mferg could help to predict the outcome of cataract surgery at each level of preoperative va . visual electrophysiological tests indeed would be both time - consuming and costly before cataractous surgery . but the research has proved that erg responses ensure a great function of whole retina and the mferg assess the macular function . the diagnostic values of visual electrophysiological tests are needed and valuable before the cataract surgery in order to reduce unnecessary surgery and pain of patients . we also suggest that before cataract surgery each visual electrophysiology test room must determine their individual full field erg and 95% ci of amplitude central mferg to predict surgical outcome .	purpose . to study the effect of different electrophysiological methods to evaluate retinal function prior to cataract surgery . methods . cataract patients who had no significant other eye disease were chosen . va , pattern visual evoked potential ( pvep ) , electroretinogram ( erg ) , and multifocal electroretinogram ( mferg ) responses were measured from 150 cataract patients and 20 control subjects . results . when the preoperative va was more than 0.3 in cataract patients , the amplitude of pvep was not significantly different between cataract and control subjects . the amplitude of central point mferg was significantly lower in cataract patients compared with control group from hm to 0.8 of preoperative va . the 95% confidence intervals ( cis ) of the amplitudes of center point mferg were calculated for a range of preoperative va values . most of the patients within 95% ci of the center point mferg had a postoperative va more than 0.5 . conclusions . the amplitude of central point mferg in cataract patients was the most relevant parameter to the preoperative va compared with pvep and erg . the 95% ci of the amplitude of central point mferg for each level of va could help to evaluate preoperative macular function which is used to predict the outcome of cataract surgery .
You are an expert at summarizing long articles. Proceed to summarize the following text: release of large quantities of metals into the environment ( especially in natural water ) is responsible for a number of environmental problems . metals are major pollutants in marine , ground , industrial , and even treated waste waters . industrial wastes are the major source of various kinds of toxic metals which have nonbiodegradability and persistence properties resulted in a number of public health problems . metals of interest , cobalt ( co ) and lead ( pb ) , were chosen based on their industrial applications and potential pollution impact on the environment . it is an accumulative toxic metal , which is responsible for a number of health problems . pb reaches humans from natural as well as anthropogenic sources , for example , drinking water , soils , industrial emissions , car exhaust , and contaminated food and beverages . therefore , highly sensitive and selective methods have needed to be developed to determine the trace level of pb in water samples . the maximum contaminant levels of pb in drinking water allowed by environmental protection agency ( epa ) is 15.0 g l , while the world health organization ( who ) for drinking water quality containing the guideline value of 10 g l [ 6 , 7 ] . co is known to be an essential micronutrient for metabolic processes in both plants and animals . it is mainly found in rocks , soil , water , plants , and animals . the determination of trace level of co in natural waters is very important because co is important for living species and it is part of vitamin b12 . exposures to a high level of co lead to serious public health problems and are responsible for several diseases in human such as in lung , heart , and skin . flame atomic absorption spectrometry ( faas ) is a widely used technique for quantification of metal species . the determination of metals in water samples is usually associated with a step of preconcentration of the analyte before detection . the determination of trace levels of pb and co in water samples is particularly difficult because of the usually low concentration ; on the bases of these facts a great effort is needed to develop highly sensitive and selective methods to simultaneously determine trace level of these metals in water samples [ 12 , 13 ] . a variety of procedures for preconcentration of metals , such as solid phase extraction ( spe ) , liquid - liquid extraction ( lle ) , and coprecipitation and cloud point extraction ( cpe ) have been developed . among them , cpe is one of the most reliable and sophisticated separation methods for the enrichment of trace metals from different types of samples . while other methods such as lle are usually time consuming and labor intensive and require relatively large volumes of solvents , which are not only responsible for public health problems but also a major cause of environmental pollution [ 1722 ] . it was reported in literature that pb and co had been preconcentrated by cpe method after the formation of sparingly water - soluble complexes with different chelating agents such as ammonium pyrrolidine dithiocarbamate ( apdc ) [ 23 , 24 ] 1-(2-thiazolylazo)-2-naphthol ( tan ) , 1-(2-pyridylazo)-2-naphthol ( pan ) [ 26 , 27 ] , and diethyldithiocarbamate ( ddtc ) [ 2830 ] . in the present work , we introduce a simple , sensitive , selective , and low - cost procedure for simultaneous preconcentration of co and pb after the formation of complex with oxine , using triton x-114 as surfactant and later analysis by flame atomic absorption spectrometry . several experimental variables affecting the sensitivity and stability of separation / preconcentration method were investigated in detail . the proposed method was applied for the determination of trace amount of both metals in fresh surface and waste water samples . ultrapure water , obtained from elga lab water system ( bucks , uk ) , was used throughout the work . the nonionic surfactant triton x-114 was obtained from sigma ( st . louis , mo , usa ) and was used without further purification . stock standard solution of pb and co at a concentration of 1000 g l was obtained from the fluka kamica ( bush , switzerland ) . working standard solutions were obtained by appropriate dilution of the stock standard solutions before analysis . concentrated nitric acid and hydrochloric acid were analytical reagent grade from merck ( darmstadt , germany ) and were checked for possible trace pb and co contamination by preparing blanks for each procedure . the 8-hydroxyquinoline ( oxine ) was obtained from merck , prepared by dissolving appropriate amount of reagent in 10 ml ethanol and diluting to 100 ml with 0.01 m acetic acid , and were kept in a refrigerator 4c for one week . the 0.1 m acetate and phosphate buffer the ph of the samples was adjusted to the desired ph by the addition of 0.1 mol l hcl / naoh solution in the buffers . for the accuracy of methodology , a certified reference material of water srm-1643e , national institute of standards and technology the glass and plastic wares were soaked in 10% nitric acid overnight and rinsed many times with deionized water prior to use to avoid contamination . a centrifuge of wirowka laboratoryjna type we-1 , nr-6933 ( speed range 06000 rpm , timer 060 min , 220/50 hz , mechanika phecyzyjna , poland ) was used for centrifugation . global positioning system ( ifinder gps , lowrance , mexico ) was used for sampling locations . a perkin elmer model 700 ( norwalk , ct , usa ) atomic absorption spectrometer , equipped with hollow cathode lamps and an air - acetylene burner . the instrumental parameters were as follows : wavelength 240.7 and 283.3 nm and slit widths : 0.2 and 0.7 nm for co and pb . the fresh surface water samples ( canals ) and waste water were collected on alternate month in 2011 from twenty ( 20 ) different sampling sites of jamshoro , sindh ( southern part of pakistan ) with the help of the global positioning system ( gps ) . n and 67 1268 02 e. the sampling network was designed to cover a wide range of the whole district . all water samples were filtered through a 0.45 micropore size membrane filter to remove suspended particulate matter and were stored at 4c . for co and pb determination , aliquot of 25 ml of the standard or sample solution containing both analytes ( 20100 g / l ) , oxine 5 10 mol l and triton x-114 0.5% ( v / v ) , were added . to reach the cloud point temperature , the system was allowed to stand for about 30 min into an ultrasonic bath at 50c for 10 min . separation of the two phases was achieved by centrifuging for 10 min at 3500 rpm . the contents of tubes were cooled down in an ice bath for 10 min . the surfactant - rich phase was treated with 200 l of 0.1 mol l hno3 in ethanol ( 1 : 1 , v / v ) in order to reduce its viscosity and facilitate sample handling . blank solution was submitted to the same procedure and measured in parallel to the standards and real samples . the preconcentration of pb and co was based on the formation of a neutral , hydrophobic complex with oxine , which is subsequently trapped in the micellar phase of a nonionic surfactant ( triton x-114 ) . utilizing the thermally induced phase extraction separation process known as cpe , the analyte is highly preconcentrated and free of interferences in a very small micellar phase . several parameters play a significant role in the performance of the surfactant system that is used and its ability to aggregate , thus entrapping the analyte species . the ph , complexing reagent and surfactant concentration , temperature , and time were studied for optimum analytical signals . the effect of ph on the cpe of co and pb was investigated because this parameter plays an important role in metal - chelate formation . the effect of ph upon the extraction of co and pb ions from the six replicate standard solutions 20.0 g l was studied within the ph range of 310 , while each operational desired ph value was obtained by the addition of 0.1 mol l of hno3/naoh in the presence of acetate / borate buffer . the maximum extraction efficiency of understudy metals was obtained at ph range of 6.57.5 as shown in figure 1 , for subsequent work ph 7.0 was chosen as the optimum for subsequent work . separation of metal ions by a cloud point method involves the prior formation of a complex with sufficient hydrophobicity to be extracted in a small volume of surfactant - rich phase . the nonionic surfactant triton x-114 was chosen as surfactant due to its low cloud point temperature and high density of the surfactant - rich phase , which facilitates phase separation by centrifugation . the effect of triton x-114 concentrations on the extraction efficiencies of co and pb were examined at the range of 0.1 to 1.0% ( v / v ) . figure 2 shows that quantitative extraction was observed when surfactant concentration was > 0.5% ( v / v ) . at lower concentrations , the extraction efficiency of complexes was low probably because of the inadequacy of the assemblies to entrap the hydrophobic complex quantitatively . a triton x-114 concentration of 0.5% ( v / v ) was selected for subsequent studies . the oxine is a relatively very stable and selective hydrophobic complexing reagent which reacts with both selected cations . replicate 10 ml of standard , srm , and real sample solution in 0.5% ( w / v ) triton x-114 at a buffer of ph 7.0 and complexed with oxine solutions in the range of 1.010.0 10mol l. the results revealed in figure 3 that extraction efficiency of both metals increases up to 5 10mol l. this value was , therefore , selected as the optimal chelating agent concentration . the preconcentration factor ( pcf ) is defined as the concentration ratio of the analyte in the final diluted surfactant - rich extract ready for its determination and in the initial solution . among the other factors , this depends on the phase relationship , on the distribution constant of the analyte between the phases , and on sample volume . the sample volume is one of the most important parameters in the development of the preconcentration method , since it determines the sensitivity and enhancement of the technique . the phase ratio is an important factor , which has an effect on the extraction recovery of cations . a low phases ratio improves the recovery of analytes , but decreases the preconcentration factor . however , to determine the optimum amount of the phase ratio , different volumes of a water sample 101000 ml and a constant volume of surfactant solution 0.5% were chosen . the obtained results show that with increasing the sample volume > 100 ml , the extracted understudy analytes were decreased as compared to those obtained with 2550 ml . a successful cloud point extraction should maximize the extraction efficiency by minimizing the phase volume ratio , thus improving its concentration factor . in the present work , the initial sample volume was 25 ml and the final volume of surfactant rich phase after diluted with acidic ethanol was 0.5 ml , hence the pcf achieved in this work was 50 for both understudy analytes . the interference is those relating to the preconcentration step , which may react with oxine and decrease the extraction . to perform this study , 25 ml solution containing 20 g / l of both metals at different interference to analyte ratio were subjected to the developed procedure . the tolerance limit of coexisting ions is defined as the largest amount making variation of less than 5% in the recovery of analytes . commonly encountered matrix components such as alkali and alkaline earth elements generally do not form stable complexes under the experimental conditions . a high concentration of oxine reagent was used , for the complete chelation of the selected ions even in the presence of interferent ions . the calibration graph using the preconcentration step for co and pb were linear with a concentration range of 5.020 ug l of standards and subjecting to cpe methods at optimum levels of all understudy variables . the extracted analytes in diluted micellar media were introduced into the flame by conventional aspiration . table 2 gives the calibration parameters for the proposed cpe method including the linear ranges , relative standard deviation rsd , and limit of detection lod . the experimental enhancement factors calculated as the ratio of the slopes of calibration graphs with and without preconcentration . the enhancement factors of co and pb subjected to cpe method were found to be 70 and 50 , respectively . the limits of detection lod were calculated as the ratio between three times the standard deviation of ten blank readings and the slope of the calibration curve after preconcentration were calculated as 0.26 and 0.44 g the obtained lod was sufficiently low for detecting trace levels of co and pb in different types of fresh and waste water samples . the accuracy of the proposed method was evaluated by analyzing a standard reference material of water srm-1643e with certified values of co and pb content . it was found that there is no significant difference between results obtained by the proposed method and the certified results of both metals . reliability of the proposed method was also checked by spiking both metals at to three concentration levels ( 2.010.0 g the perecentage of recoveries ( r ) of spike standards were calculated as follows : ( 1)r ( % ) = ( cmco)m100 , where cm is a value of metal in a spiked sample , co the value of metal in a sample , and m is the amount of metal spiked . these results demonstrate the applicability of developed procedure for co and pb determination in different water samples . the cpe procedure was applied to determine co and pb in fresh surface and waste water samples . the co and pb concentrations in fresh surface water were found in the range of 2.125.12 g l and 1.498.56 g the levels of both analyte were high , found in the range of 13.616.8 and 15.119.4 g in this study , triton x-114 was chosen for the formation of the surfactant - rich phase due to its excellent physicochemical characteristics , low cloud point temperature , high density of the surfactant - rich phase , which facilitates phase separation easily by centrifugation , and commercial availability and relatively low price and low toxicity . this method is a promising alternative for the determination of co and pb linked with faas . from the results obtained , it can be considered that oxine is an efficient ligand for cloud point extraction of co and pb . the simple accessibility , the formation of stable complexes , and consistency with the cloud point extraction method are the major advantages of the use of oxine in cloud point extraction of co and pb . cpe has been shown to be a practicable and versatile method , being adequate for environmental studies . cloud point extraction is an easy , safe , rapid , inexpensive , and environmentally friendly methodology for preconcentration and separation of trace metals in aqueous solutions . the surfactant - rich phase can be directly introduced into flame atomic absorption spectrometer faas after dilution with acidic ethanol . the proposed cpe method incorporating oxine as chelating agent permits effective separation and preconcentration of co and pb and final determination by faas provides a novel route for trace determination of these metals in water samples of different ecosystem . a low - cost surfactant was used , thus toxic organic solvent extraction generating waste disposal problems was avoided . the comparison of the results found in the presented study and some works in the literature was given in [ 3144 ] . the proposed cloud point extraction method is superior for having lower detection limits when compared to other methods as shown in table 5 .	cloud point extraction ( cpe ) has been used for the preconcentration and simultaneous determination of cobalt ( co ) and lead ( pb ) in fresh and wastewater samples . the extraction of analytes from aqueous samples was performed in the presence of 8-hydroxyquinoline ( oxine ) as a chelating agent and triton x-114 as a nonionic surfactant . experiments were conducted to assess the effect of different chemical variables such as ph , amounts of reagents ( oxine and triton x-114 ) , temperature , incubation time , and sample volume . after phase separation , based on the cloud point , the surfactant - rich phase was diluted with acidic ethanol prior to its analysis by the flame atomic absorption spectrometry ( faas ) . the enhancement factors 70 and 50 with detection limits of 0.26 g l1 and 0.44 g l1 were obtained for co and pb , respectively . in order to validate the developed method , a certified reference material ( srm 1643e ) was analyzed and the determined values obtained were in a good agreement with the certified values . the proposed method was applied successfully to the determination of co and pb in a fresh surface and waste water sample .
You are an expert at summarizing long articles. Proceed to summarize the following text: one is that a certain degree of virulence is beneficial to the organism : a human rendered prone by a malaria fever is less likely to move and kill the mosquitoes which feed on him and spread the infection ; the diarrhoea associated with cholera may result in more widespread transmission of the disease , and so on . occasional host mortality is regrettable from all points of view because host mortality generally also kills the parasite , but is explicable as it occurs at one end of a spectrum of disease states . a second explanation for virulence is that a high parasitaemia causes host pathology but concomitantly results in more assured transmission of the parasite . according to this hypothesis the observed level of virulence is a " trade - off " between minimising host mortality and maximising transmission . [ this argument is appropriate to p. falciparum despite the observation that some people with high parasitaemia show no symptoms while some exhibit severe disease with far fewer parasites , most probably as a consequence of differing levels of immunity ; the key argument is that all other things being equal , higher parasitaemia tends to produce more severe disease , an assertion that seems reasonable for p. falciparum ] . these two explanations both assume a degree of evolutionary fine - tuning to achieve an optimal level of virulence . there are two other explanations for virulence that rest not on evolutionary trade - offs but purely on bad luck . if an infection consists of millions or billions of individual parasites , then periodically a rogue " selfish " mutation may occur that grows rapidly , comes to dominate the infection and can cause a pathology which is detrimental for both host and parasite . alternately , virulence can occur when a parasite finds itself in an exotic host species to which it is not adapted ; the most familiar examples are human zoonosis such as lassa fever or ebola . here like the first two hypotheses , it rests on an evolutionary , rather than bad - luck , argument . moreover , it explains several puzzling features of the biology of plasmodium falciparum , the organism responsible for the most severe form of human malaria . many severe human infections are characterised by a large number of individual parasites that acutely infect a host for a relatively short time before being eradicated by host immunity . central to our thesis is a consideration of how deleterious mutations ( for example , those disrupting protein structure and general cellular machinery ) are eliminated during the life cycles of these organisms . in conventional evolutionary thinking , deleterious mutations are eliminated by direct competition with individuals carrying the normal non - mutated wildtype gene . thus , for example , a mutation decreasing flight efficiency in a mosquito would ultimately be eliminated through being out - competed by mosquitoes with competent flight physiology . this type of mutation elimination is termed " purifying selection " and prevents mutations establishing themselves in the gene pool of the organisms . the problem is that populations of parasites such as malaria are highly sub - divided into numerous separate human hosts and face the overwhelming selective pressure of host immunity . direct competition between separate clones of malaria in different hosts will be small and purifying selection correspondingly weak . [ ' clones ' is used here to denote the large number of parasites in a human descended from a single inoculated sporozoite . people in highly endemic areas may contain up to seven distinct clones , derived from separate infective bites , a feature quantified as their ' clonal multiplicity ' . critically , ' clones ' does not imply that they are genetically stable over time , more realistically they are transitory and broken down during meiosis in the obligate sexual phase of the p. falciparum life cycle ] . our central argument is that mutations in this type of life history may be nullified by compensatory mutation rather than being eliminated by purifying selection . this occurs when a second " compensatory " mutation occurs within the gene which restores the metabolic activity of the gene product and hence nullifies the effect of the original mutation . firstly , the patterns of molecular evolution observed in p. falciparum and , in particular , the rapid rate of non - synonymous ( i.e. protein altering ) mutations are consistent with their being compensatory . secondly , compensatory mutations are noted in laboratory populations of organisms kept in isolation ( see later ) . the efficacy of compensatory mutation depends on two factors , the size of the parasite population within the human host ( which determines whether the rare compensatory mutation will actually occur within an individual host ) and the number of replication cycles in the life cycle ( which determines the extent to which the compensatory mutation spreads within the host prior to its transmission ) . the stochastic element in the process means that it is best investigated by computer simulation . the simulations are used to calculate the probability that ( i ) a fully - functional " wildtype " malaria infection will suffer a deleterious mutation and be transmitted by a mosquito as a mutated " dysfunctional " form , and ( ii ) that a compensatory mutation will occur in a " dysfunctional " infection and spread within this infection to the extent that it will be transmitted by a mosquito as the compensated , metabolically functional , wildtype form . the relative magnitudes of the two processes determine the equilibrium frequency of wildtype and dysfunctional malaria parasites within the human population . the principle is best illustrated with the simplest possible case where the parasites consist of only two types : the fully functional " wildtype " and a mutated " dysfunctional " type . the latter suffers a growth disadvantage compared to the wildtype , so are gradually eliminated if both types are simultaneously present in the same human host . mutations occur in wildtype parasites converting them to the dysfunctional type , and compensatory mutations occur in the dysfunctional types restoring the gene function and thereby converting them back to the wildtype form . these are referred to as " dysfunctional " and " beneficial " mutations respectively and are quantified as the rate per plasmodium per erythrocyte cycle . note that dysfunctional mutations can occur in a large number of genes , all of which periodically mutate to the dysfunctional form . conversely , beneficial mutations can occur only in those few codons where a compensatory mutation can compensate for the original deleterious mutation . thus , dysfunctional mutation rates will be several orders of magnitude higher than the beneficial rate . in the example shown on figure 1 , these rate are 10and 10per erythrocytic cycle respectively , which means that , on average , one in 100,000 wildtype plasmodia mutates to a deleterious form in each erythrocyte cycle ( and similarly that 1 in 10,000,000 mutants have their function restored each erythrocyte cycle ) . the key phrase in the preceding sentence is " on average " . in particular , if the number of parasites within a host is small then zero mutations may occur . the variation in the dynamics between individual infections can be large , so the results are best presented as the equilibrium frequency of the wildtype forms in the population . the exact shape of figure 1 depends on the values of mutation rates and the selective disadvantage of the deleterious mutation ( 10% per erythrocytic cycle in this example ) , but the general results are robust . equilibrium frequency of the fully functional wildtype form of a parasite as a consequence of the number of parasites within the human host ( its clonal population size ) and number of parasite erythrocyte cycles ( each of which lasts two days ) which elapse prior to transmission . computational details are as described in the main text i.e. dysfunctional mutation rates = 10 , beneficial mutation rates = 10 , and the selective disadvantage of the mutation is 10% per erythrocytic cycle the infection starts out as either entirely wildtype or entirely dysfunctional type , depending on the type of sporozoite that initiated the infection . the mean number of mutations expected per cycle is calculated and the actual number randomly drawn from a poisson distribution around this mean ; for example , if the clonal population size is 10and the mutation rate is 10 , then the program will pick zero mutations per cycle in about 90% of simulations , one in about 10% of simulations and two or more in a small proportion of simulations . once the number of new mutations has been simulated , these are added to the number that already exist and the next erythrocytic cycle is simulated . the number of mutations in the next cycle is also drawn from a poisson distribution but taking into account selective differences . for example , if 20 wildtype parasites already exist , one is added by mutation , and wildtypes have a 10% growth advantage then the number next generation is drawn from a poisson distribution with mean ( 1 + 20 ) 1.1 = 23.1 , and so on for the required number of erythrocytic cycles . the simulations are run 10,000 times for each value of clonal population size , so that each combination of population size and number of erythrocytic cycles produces two parameters : , the probability that an infection , originally wildtype , is subsequently transmitted as the dysfunctional type , and , the probability that an infection originally dysfunctional is subsequently transmitted as wildtype . this simple case assumes there are only two types of parasites , wildtype and dysfunctional . the calculations can be easily extended to a case where dysfunctional types may contain 1,2,3,4 .... deleterious mutations . a typical result is shown in figure 1 where the equilibrium frequency of the wildtype form is shown as a function of the parasite population size within the human host ( clonal population size ) and the number of erythrocyte cycles before transmission . increasing the clonal population size increases the rate at which deleterious mutations are nullified by compensatory mutations , thereby increasing the equilibrium frequency of fully functional wildtype infections . as the clonal population size increases , a law of diminishing returns applies and the evolutionary optimal size occurs when the ( short - term ) risk of host mortality balances the ( long - term ) advantages of mutation elimination . burch and chao showed that increasing the clonal population size of bacteriophages increased the speed at which beneficial mutations accumulate . compensatory mutations may be a direct reversal of the original mutation but , more typically , they restore gene function through another compensatory mutation at another site within the same gene . presumably this second mutation restores , partially or completely , the tertiary structure of the molecule and hence its biological activity . several studies [ 3,5 - 9 ] have demonstrated this process in e. coli and bacteriophages . p. falciparum appears to be the only example where the process of an advantageous mutation occurring and spreading to dominate the infection can be directly and easily observed . if an infection is drug sensitive and the human host is treated with a drug , then the symptoms go into remission as the majority of the parasites are eliminated . however , a small number of parasites may contain a spontaneous mutation conferring drug resistance . these survive and flourish even in the presence of drugs , so that the infection reappears shortly afterwards ( " recrudesces " ) as a drug - resistant strain . the effect is extremely dependent on the size of infection . as an example , if a human is inoculated with a drug - sensitive clone and there are 10parasites in the host and the mutation rate to the drug resistant form is 10 , then there will be a sub - population of 10resistant parasites . following drug treatment , the sensitive forms will be eliminated and the sub - population of 10resistant forms will expand to dominate the infection . needless to say , if the mutation rate to resistance is 10 , then infection sizes of less than ten thousand would rarely contain the appropriate mutation . if mutation rates to resistance are 10for each drug in a two - drug mixture , then even an infection of 10individual malaria parasites is highly unlikely ( a probability of 0.0001 ) to simultaneous contain a spontaneous drug - resistant mutation in each gene . p. falciparum , in common with several other parasites , appears to try and evade host immunity by continually changing its immune characteristics . it does so , at least in part , by expressing a sequence of var genes . an interesting consequence of the above argument is that var switching in p. falciparum may select for increased infection load ( because increased parasite numbers are required to increase effective population size ) and hence to increased virulence . the population size illustrated in figure 1 is best interpreted as an effective population size . this is a key concept in population genetic theory and is defined as being equivalent to an idealised population whose size does not fluctuate . effective population size decreases rapidly if the population goes through a series of " bottlenecks " of small population sizes . as p. falciparum switches through its antigenic repertoire , it appears likely that only a small portion of the population will actually survive . as human immunity to the current var product expressed in the infection builds up and starts to eliminate the parasites , a small proportion will have switched to another var gene in the repertoire to escape immunity and expand to dominate the infection [ 15 - 17 ] . this lowers the effective population size considerably below the crudely observed population size of 10to 10parasites in a typical human malarial infection . for example , if the population size is 10but every 10 erythrocyte cycles goes through a bottleneck of 1000 individuals which switch var expression , the effective size decreases to 10,000 . intuitively , it is possible to see how this impedes the spread of a compensatory mutation through an infection : even if a compensatory mutation has occurred and is spreading through an infection , the chances are that it has occurred in a cell lineage that will ultimately be destroyed by human immunity acting against its var gene expression . it is argued that virulence occurs as a consequence of the large parasite density ( quantified as the clonal population size within a human ) required to effectively eliminate mutations or nullify them through compensatory mutations , the evolutionary optimal level of virulence being determined by the conflicting necessity of removing mutations balanced against the need to minimise host mortality . this constitutes a novel hypothesis for the evolution of virulence and is a simple consequence of an inevitable fact of life : that deleterious mutations occur and must be effectively eliminated . it is difficult to see how this can be done effectively solely by the actions of the purifying selection envisaged in conventional population genetic theory , and it appears that compensatory mutations play a major role . p. falciparum life history traits may , therefore , have evolved to facilitate the effective incorporation of compensatory mutations , the most notable consequence being that they reach very high numbers within individual hosts . virulence may therefore be simply an unfortunate side effect of large infection sizes , parasites evolving to be as benign as possible while still maintaining an infection density ( clonal population size within the human ) sufficient to allow the effective removal of deleterious mutations . the trade off between these conflicting interests determines the optimal level of virulence ( see figure 1 ) . the alternative hypotheses for explaining the evolution of virulence can not be resolved , all being entirely plausible post - hoc explanations . however , the mutation / selection hypothesis explains three interesting facets of the p. falciparum lifecycle . firstly , that the correlation between parasite load and infectivity in the field is weak , suggesting that increased infectivity is a relatively weak selective force for increased parasite load . secondly , that despite a large asexual parasite load , the number of infective stages is surprisingly small and usually consists of around 5% of the total parasite number . for example , that they are kept at low levels by host immunity , or are produced at low frequencies to minimise their stimulation of host immunity , or that low levels avoid damaging the mosquito vector . these explanations are immaterial to our argument which addresses the issue of trying to understand why 95% of the parasites which , moreover , are the ones responsible for clinical disease and host death , are necessary to produce the remaining 5% of infective stages . the explanation proposed here is that this 95% constitutes a large selective environment ensuring that the subsequent infective stages harbour a minimal number of deleterious mutations . thirdly , the conventional hypothesis that increasing parasite load increases transmissibility does not explain why the turnover of parasites is so high ( especially because , as noted above , gametocytes are present at a low level and are relatively long - lived ) , whereas our analysis of mutation elimination demonstrates that increasing turnover of parasites increases the rate at which compensatory mutations spread ( figure 1 ) . these arguments have been developed with specific reference to the human malaria parasite p. falciparum . conventionally this has been interpreted as a strategy to increase infectivity , but it can just as validly be regarded as a strategy to increase the efficacy of eliminating harmful mutations . the argument here is not that increasing parasite load does not increase transmissibility ( it seems plausible that it does to some extent ) , but that the primary function of a large , rapidly dividing parasite population is to eliminate mutations rather than increase transmission and that it is rewarding to re - examine several facets of p. falciparum biology , and presumably the biology of similar organisms , in the light of this hypothesis . all authors contributed to the conceptual development of this approach and the interpretation of published data . ih wrote , ran and collated the simulations which were subsequently reviewed by s. p - m and a.s . this work was partly financed by the dfid - funded malaria knowledge programme of the liverpool school of tropical medicine . however , the department for international development can accept no responsibility for any information or views expressed .	backgroundparasites incur periodic mutations which must ultimately be eliminated to maintain their genetic integrity.methodsit is hypothesised that these mutations are eliminated not by the conventional mechanisms of competition between parasites in different hosts but primarily by competition between parasites within the same infection.resultsthis process is enhanced by the production of a large number of parasites within individual infections , and this may significantly contribute to parasitic virulence.conclusionsseveral features of the most virulent human malaria parasite plasmodium falciparum can usefully be re - interpreted in this light and lend support to this interpretation . more generally , it constitutes a novel explanation for the evolution of virulence in a wider range of microparasites .
You are an expert at summarizing long articles. Proceed to summarize the following text: ghrelin was initially discovered as a ligand for the growth hormone secretagogue receptor ( ghs - r1a ) , and the story of its discovery has been well described in some reviews [ 24 ] . the peptide named ghrelin is a term derived from the proto - indo - european word ghre meaning grow and the name can also indicate the abbreviation for gh , followed by relin a suffix meaning releasing substance . ghrelin is a peptide hormone secreted mainly by the stomach , although its expression has been detected in many other organs exerting both endocrine and paracrine effects [ 57 ] . in addition to mediating gh release through the growth hormone secretagogue receptor ( ghs - r ) , ghrelin is involved in a series of biological functions including regulation of food intake , sleep , body weight , gastrointestinal motility , cardiovascular functions , cell proliferation , production of proinflammatory cytokines , and reproduction in many species . the objective of this paper is to review the available information on the role of ghrelin in reproductive processes including female and male reproduction . it has two major endogenous forms : a des - acylated form ( des - acyl ghrelin ) and a form acylated at serine 3 ( ghrelin ) . this posttranslational acylation is essential for the hormone biological activity [ 1 , 4 , 15 ] . the ghrelin structure , particularly that of the acyl - modification regions , is highly conserved throughout vertebrate species . the majority of ghrelin is synthesized by an endocrine cell population , the x / a - like cells , in the stomach mucosa . the des - octanoylated ghrelin and n - octanoylated ghrelin are both found in rat stomach . the small intestine also synthesizes ghrelin to a lesser extent with the amount of ghrelin produced diminishing with increasing distance from the pylorus [ 16 , 18 ] . the expression of ghrelin has also been reported in pancreas , lymphocytes , placenta , kidney , lung , heart , pituitary , brain , ovary , and testis [ 57 ] . circulating ghrelin levels increase with fasting and return to basal levels after refeeding in rodents and humans [ 1925 ] . the plasma ghrelin concentration in cows decreases significantly one hour after feeding , and then recovers to prefeeding levels . nutrient contents and also hormones are important factors for the regulation of ghrelin expression and release . in contrast , the ghrelin mrna level in the rat stomach increases after the administration of insulin and leptin . in cultured whole porcine follicles , gh stimulates both ghrelin synthesis and secretion , whereas igf - i shows less influence . in rodents , the ghrelin receptor is a g - protein - coupled receptor ( gpcr ) firstly identified in pigs and humans in 1996 . it belongs to the rhodopsin - like seven - transmembrane domain ( 7tm ) receptor family that includes the orphan gpr39 as well as receptors for the peptides motilin , neurotensin , and neuromedin . it has a high degree of homology ranging from 93% to 99% identified by using molecular analysis of human , pig , dog , rat , and mouse species [ 3135 ] . cloned before the discovery of the peptide , the ghrelin receptor was initially described as the receptor for a number of synthetic gh secretagogues and is therefore also called the growth hormone secretagogue receptor ( ghs - r1a ) [ 31 , 36 ] . however , some evidence indicates that several ghrelin effects are mediated not by ghs - r1a but by other types of receptors not yet identified . an inactive alternative splice variant of the ghs - r subtype , termed ghs - r1b , has also been found . unlike ghs - r1a , ghs - r1b is not activated by the synthetic ghss or ghrelin and it is unclear whether it is a functional receptor . the ghs - r1a receptor mrna is mainly expressed in the pituitary and in several structures of the brain of mammalian and nonmammalian species [ 3942 ] . however , it is also present in the thyroid , pancreas , spleen , myocardium , adrenal gland , ovary , and testis . the des - acyl ghrelin does not bind to ghsr-1a . upon ghrelin binding to its receptor , different negative feedbacks of ghsr-1a after acute treatment of porcine pituitary cell cultures with ghrelin , luque et al . found that ghrelin downregulated ghs - r expression . ghrelin binding to ghs - r1a also results in a rapid attenuation of the receptor responsiveness . this desensitization is the result of the uncoupling of the receptor from heterotrimeric g proteins and of the internalization of the cell surface receptors to intracellular compartments [ 45 , 46 ] . ghrelin is able to activate various signaling pathways . in ghs - r1a - expressing mammalian cells [ 1 , 31 ] or in rat and human pituitary cells [ 47 , 48 ] , biphasic ca increases , due to a transient ca release from the intracellular store and a ca influx through voltage - dependent l - type calcium channel , which are observed as the signal transduction . ghrelin has also been shown to increase ampk ( adenosine monophosphate - activated kinase ) activity in the hypothalamus and reduce it in the liver [ 50 , 51 ] . it has also been reported that ghrelin could activate the mapk 44- and 42-kda extracellular signal - regulated protein kinases ( erk1/2 ) and the akt [ 4350 ] in different cell lines [ 5255 ] . ghrelin is also able to regulate the expression of several transcription factors including the nuclear factor b , ( nfb ) , ppar , srebp-1 , and cebp [ 56 , 57 ] . about ten years ago , several experiments suggested that ghrelin could act as a modulator of the male and female reproductive functions . indeed , many in vivo and in vitro studies showed that ghrelin was able to exert its action at different levels of the hypothalamic - pituitary - gonadal axis . the hypothalamus has been identified as the main source of ghrelin in the central nervous system . furthermore , as previously described , the ghs - r1a receptor mrna has been found in many areas of the brain . in rats , systemic administration of ghrelin the involvement of npy in the mediation of the effects of ghrelin on pulsatile gnrh secretion is indicated by the complete abolition of the effects of ghrelin by the npy - y5 receptor antagonist . gnrh secretion by hypothalamic fragments from ovariectomized females is also significantly inhibited by ghrelin . in mammalian and nonmammalian species , ghrelin affects gonadotropin release acting at the level of the hypothalamus as well as directly on the pituitary gland . in pituitary , ghrelin suppresses lh pulse frequency in rats , sheep , monkeys [ 6163 ] , and humans . , ghrelin is able to downregulate kiss1 expression in the hypothalamic medial preoptic area and this could be a contributing factor in ghrelin - related suppression of pulsatile lh secretion . in contrast , in women during the menstrual cycle , administration of ghrelin does not affect basal and gnrh - induced lh and fsh secretion . opposite effects of ghrelin on lh secretion mammals and several fish species have been described . indeed , ghrelin has been shown to stimulate lh release in goldfishes [ 6769 ] and recently in carps . recent studies indicate that synthetic goldfish ghrelin stimulates lh release . however , the specific mechanism and the role of this activation are still unknown . there is evidence in rats and humans that ghrelin can suppress not only lh but also fsh secretion in males and females . a significant decrease of fsh was observed after seven days of continuous ghrelin infusion in male rats and in the metestrus of female rats after one injection . however , in rats , ghrelin did not affect fsh secretion in the proestrous and estrous periods of the estrous cycle in females , and in gonadectomized male and female rats after single injection and after chronic intermittent administration . in women during the menstrual cycle , administration of ghrelin did not affect basal and gnrh - induced lh and fsh secretion . the reported effects of ghrelin on lh and fsh secretion suggest that this peptide plays a key role in the reproductive functions . beside central actions on the reproductive functions , some evidence indicates that ghrelin could exert direct effects on the female and male gonads . emerging evidence strongly indicates that the ghrelin and ghrelin receptor ( ghs - r1a and ghs - r1b ) are present in the mammalian and nonmammalian ovary . for example , ghrelin is found in human , rat , pig , sheep , and chicken ovary [ 7276 ] . in sheep ovary , ghrelin is expressed throughout the estrous cycle and pregnancy and the relative mrna levels depend on the stage of the cycle , with the highest expression during the development of the corpora lutea ( cl ) and minimal expression in the regressing cl . more precisely , in rodent ovary , expression of ghrelin has been demonstrated in steroidogenically active luteal and interstitial hilus cells . expression of the functional ghrelin receptor has been reported in oocytes as well as follicular , luteal , and surface epithelium and interstitial hilus cells in rat ovary [ 72 , 75 , 78 ] . these observations indicate that ovarian follicular and luteal cells are potential targets for systemic or locally produced ghrelin , because they express the functional type 1a of ghs - r . they also highlight the plausibility for a role of ghrelin in the direct control of ovarian cell functions . in vivo administration of ghrelin in rats affects folliculogenesis as attested by alterations of some morphometrical and intracellular indexes in ovarian state . indeed , it decreases the mean diameter of follicles , the number of corpora lutea , luteal cells , and oocyte and the diameter of the theca layer and the zona pellucida as well as the whole ovarian volume in the treated animals . in cultured human granulosa luteal cells , ghrelin exerts an inhibitory effect on steroidogenesis ( progesterone and estradiol production ) in the absence or in the presence of hcg by acting through its functional ghs - r1a [ 80 , 81 ] . moreover , the granulosa cells from ghrelin - treated rabbits secrete not only less progesterone and estradiol but also less igf-1 and prostaglandin f than granulosa cells from untreated animals . in contrast to previous reports , in cocultured granulosa and theca cells from porcine follicles , ghrelin induced estradiol secretion by modifying aromatase activity [ 29 , 37 ] . also , ghrelin(118 ) administration in chicken causes not only an increase in progesterone and oestradiol but also secretion of arginine vasotocin and igf-1 [ 76 , 83 ] . in chicken ovarian cells , in vitro ghrelin treatments induce markers of proliferation [ map kinase ; pcna ( proliferating cell nuclear antigen ) , a marker of the s / phase of the cell cycle , and cyclin b1 , a marker of the g2/phase ] and decrease the expression of markers of apoptosis ( caspase-3 , bax , and bcl-2 ) [ 76 , 84 ] . moreover , granulosa cells from ghrelin - treated rabbits have higher expression of pcna and lower expression of tdt ( terminal deoxynucleotidyl transferase ) , than those from control animals . it has also been reported that ghrelin inhibits early embryo development in mice . in porcine oocytes in contrast , it may have some inhibitory effects on the organization of microtubules and microfilaments of porcine oocytes . on the contrary , some data suggest that ghrelin could enhance blastocyst viable from porcine oocytes fertilized in vitro and parthenogenetic embryos while exerting a negative effect on the structural integrity of the blastocysts . thus , the effects of ghrelin on the development of the embryo are not clear . in addition , in rats , high levels of ghrelin receptor ( ghs - r ) mrna are detected in various peripheral fetal tissues beginning on embryonic day 14 and lasting until birth . the testis is a complex endocrine organ where different cell types interplay to produce germ cells , under the control of several extragonadal and intragonodal hormones and growth factors . some evidence suggests that ghrelin participates in such a regulatory network [ 59 , 8991 ] ( figure 1 ) . expression of ghrelin has been demonstrated in rodents and sheep by immunostaining mainly in leydig cells . ghrelin is also present in the human testis and particularly in leydig and sertoli cells but not in germ cells . in human testis , the expression of ghrelin by leydig cells is apparently linked to the degree of cell differentiation . furthermore , it is inversely correlated with the serum testosterone levels in patients with normozoospermia , obstructive azoospermia , or varicocele suggesting that ghrelin has an indirect effect on spermatogenesis . in contrast to human and rodent data , in adult sheep testis , strong ghrelin immunostaining is evident not only in leydig and sertoli cells but also in germ cells , with an indication of increased ghrelin immunoreactivity in germ cells during the mitotic phases and the meiotic prophases of the spermatogenic cycle . thus , there are some differences between species in the localization of ghrelin protein in the testis . expression of the functional ghrelin receptor , ghs - r1a , has been shown in sertoli and leydig cells as well as seminiferous tubules in rats . some changes in the balance between 1a and 1b isoforms of ghs - r gene have been described in rat testis . indeed , changes in the alternative splicing of the gene are observed throughout postnatal development . specifically , during pubertal development , a shift in the pattern of splicing of ghs - r gene takes place in rat testis , favouring the expression of the biological active type 1a form of the receptor and indicating that the balance between receptor subtypes may represent a novel mechanism for the regulation of ghrelin sensitivity in gonads . in humans , ghs - r1a has been located in germ cells , mainly in pachytene spermatocytes , as well as in leydig and sertoli cells . in adult sheep , ghsr-1a protein was detected in leydig cells as well as in sertoli and germ cells within the tubules , and the pattern of ghsr-1a mrna expression across the testis indicated that the mrna was present in the interstitial area and around the periphery of the tubules . these latter data suggest that ghrelin could regulate spermatogenesis by an autocrine or / and a paracrine manner . in this sense , intratesticular injection of ghrelin ( 15 g for 2 days ) in adult rats inhibited mrna expression of the gene encoding stem cell factor ( scf ) , a key signal for germ cells production and a putative regulator of leydig cell development . such an inhibitory action of ghrelin on scf has also been detected in vitro using cultures of staged seminiferous tubules . the testicular scf is a sertoli cell product that has been involved in leydig cell development and survival and is acting as a survival factor for the different cell types in the seminiferous epithelium such as spermatogonia in adult rats . thus , the actions of ghrelin on tubular scf mrna could have an impact on the regulation of spermatogenesis and also on leydig cell proliferation . in vitro , ghrelin significantly also inhibits in a dose - dependent manner both hcg- and camp - stimulated testosterone release by leydig cells . this inhibitory effect of ghrelin on testosterone secretion has been associated with decreases in the hcg - stimulated expression levels of the mrnas for several key factors in the steroidogenic pathway ( star , p450scc , 3 - hsd , and testis - specific 17-hsd type iii ) . in vivo , the effects of ghrelin on plasma levels of testosterone in rats depend on the nutritional state . indeed , in fed rats , ghrelin administration induces a slight decrease in testis mass without detectable changes in final plasma levels of testosterone , whereas in food - restricted animals , where endogenous ghrelin levels are known to be increased , a chronic administration of ghrelin induces overt decrease in plasma testosterone . thus , high levels of ghrelin could contribute to male reproductive axis alterations in situations of energy deficit . it has also been demonstrated by in vivo intratesticular injection of ghrelin that ghrelin is able to inhibit the proliferative rate of immature leydig cells both during puberty development and after selective ablation of pre - existing mature leydig cells by administration of eds ( ethylene dimethane sulfonate ) . the expression of ghrelin but not that of ghs - r1a in leydig tumor cells is apparently linked to the degree of cell differentiation . ghrelin is able to modulate key testicular functions such as seminiferous tubule gene expression , testosterone secretion , and leydig cell proliferation . in conclusion , ghrelin is a peptide hormone mainly secreted from the stomach into the circulation , but it can be synthesized by other tissues such as reproductive tissues suggesting local actions ( autocrine and/or paracrine ) . its functional receptor , ghs - r1a , is also expressed at different levels of the hypothalamic - pituitary - gonadal axis . as described in this paper , ghrelin may participate in the regulation of different aspects of the female and male reproductive functions from germ cell production to embryo development . ghrelin through its various biological functions including energy metabolism by promoting fat deposition and food intake could be a key signal between energy status and control of fertility ( nutrient - gene expression ) . however , further studies are required to gain insights into the understanding of the fine mechanisms of ghrelin action .	ghrelin and one of its functional receptors , ghs - r1a ( growth hormone secretagogue receptor 1a ) , were firstly studied about 15 years . ghrelin is a multifunctional peptide hormone that affects several biological functions including food intake , glucose release , cell proliferation ghrelin and ghs - r1a are expressed in key cells of both male and female reproductive organs in several species including fishes , birds , and mammals suggesting a well - conserved signal through the evolution and a role in the control of fertility . ghrelin could be a component of the complex series of nutrient sensors such as adipokines , and nuclear receptors , which regulate reproduction in function of the energy stores . the objective of this paper was to report the available information about the ghrelin system and its role at the level of the hypothalamic - pituitary - gonadal axis in both sexes .
You are an expert at summarizing long articles. Proceed to summarize the following text: similarly , in germany , approximately 10.9% of the population is involved in accidents annually , and trauma is the second commonest cause of hospitalization . trauma registries have been established globally in an effort to improve the management and outcome of trauma patients . in 1991 , the scottish trauma and audit group ( stag ) was established to assess and improve the management of trauma patients in scotland . this national trauma audit was conducted for a decade , from 1992 to 2002 in 28 hospitals across scotland , collecting data for 52,676 trauma patients . at the same time , the deutsche gesellschaft fuer unfallchirurgie ( dgu ) , being the german society for trauma surgery , established the german trauma registry ( gtr ) in 1993 with an aim to develop guidelines for the management of multiply injured patients . inclusion of patients was originally voluntary , it has since become compulsory for trauma units to record this data for audit purposes . the scottish system relies primarily upon a paramedic service to provide pre - hospital care . the german management of pre - hospital trauma differs ; a greater priority is given to include physician input prior to an arrival to the emergency department , with administration of advanced trauma life support ( atls ) . this study compares the management of polytrauma between scotland and germany using data from stag and the gtr registries , respectively . we present the differences of injury severity , anatomical pattern of injury , and the pre - hospital management between the scottish and german populations , relating these to patient outcome . inclusion criteria for this audit were : patients 12 years of age or more , an admission to hospital for at least 72 hours , or died as a result of injury . patients aged over 65 years of age with an isolated fracture of the neck of femur or pubic rami were excluded . length of stay and patient mortality at 3 months from presentation were the main outcome parameters . one of the key findings of this audit was that the survival rate for seriously injured patients increased from 65.3% to 78.9% over the duration of the audit from 1992 to 2002 . as a result , this audit was discontinued in 2002 as it was concluded from the improved survival rates that management of trauma patients in scotland was significantly better than the rest of the uk . criteria for patient inclusion within the registry was admission through the emergency department ( ed ) after an acute traumatic injury , requiring intensive care unit ( icu ) admission for the same time period or dying in the ed . the registry is open to every hospital and trauma department in germany , in addition , some neighboring countries , such as the netherlands , austria and switzerland , with more than 100 trauma units participate on a voluntary basis . maintenance of data is completed by doctors whilst the patient is still in hospital and following that specially trained personnel ensure that a minimum set of mandatory data is available to allow for participation in the registry . a retrospective analysis of all trauma patients with an injury severity score ( iss ) of 16 or more that were entered into both registries ( stag and gtr ) , from 1 january 2000 to 31 december 2002 was performed . patients aged over 65 years of age with an isolated fracture of the neck of femur or pubic rami were excluded from the gtr . the iss and the revised trauma score ( rts ) were used to assess the anatomical injury severity score ( ais ) and physiological indices of the injury , respectively . the iss and rts were used to calculate the trauma and injury severity score ( triss ) , which was then used to calculate the standardized mortality ratio ( observed / predicted ) for both populations . data criteria obtained from the stag and gtr datasets data collected from both groups was analyzed using statistical package for the social sciences version 17.0 to derive frequencies , means and percentages for the various parameters and confirmation of normal distribution . the data was normally distribution , and a student 's t - test was used for continuous and chi - squared test was used for discontinuous data . there were 227 patients identified from the stag registry and 6878 patients from the gtr registry , were used in our study . the mean age for both groups was > 40 years with a predominantly male population , the majority of which had sustained blunt trauma . the number of injuries sustained per patient in both groups was similar with each patient incurring a mean of 2.3 -_2.4 injuries . the only significant difference was of iss between the groups , with scottish patients having an average score of 24.9 and german patients having an average score of 29.8 , however , there was no significant difference in the rts ( p = 0.6 ) . epidemiological and injury characteristics for both groups table 3 shows the comparison of pre - hospital management interventions . there was a significant difference between both populations , with a considerably higher rate of pre - hospital interventions in the german group . pre - hospital interventions for both groups table 4 shows the regional incidence of injuries and the mean ais score for each region . german patients sustained significantly more facial , chest , abdominal and extremity injuries than the scottish population . there was , however , no significant difference for the incidence of head and external injuries . the severity of these regional injuries only reached a significant difference for chest and abdominal injuries . incidence of regional injuries and mean ais score per region for both groups both , the mean time from injury to arrival to the ed ( 73 vs. 247 minutes , p = 0.001 ) and the time spent in the ed ( 83 vs. 168 minutes , p = 0.001 ) , were significantly longer for the scottish patients [ figures 1 and 2 ] . mean time from injury to arrival to the ed for both groups ( 73 vs. 247 minutes , p = 0.001 ) mean time spent in the ed for both groups ( 83 vs. 168 minutes , p = 0.001 ) table 5 illustrates the outcome parameters . the standardized mortality ratio was significantly greater for the scottish population [ table 5 ] . there was , however , a large difference in the cohorts analyzed with 227 patients in the scottish group and 6878 patients in the german group . this difference is probably related to the actual population size of the individual countries , with over 5 million in scotland and over 80 million in germany . the population density also differs , as scotland 's average population density is 66 persons per square kilometer , and in germany , there are 230 persons per square kilometer . therefore we critically accepted the different cohort sizes . a recent prospective study in the west of scotland compared the outcomes of patients suffering moderate to severe trauma in urban versus rural environments . they demonstrated no significant differences for length of inpatient stay or mortality for either group , despite a significantly longer time from scene to the ed for rural patients . these results are supported by our study , as the longer transfer times we observed , are probably related to distance from the ed and may not result in a worse outcome ; the standardized mortality ratio was greater for the scottish population , although several authors have concerns in the use of triss methodology to compare differing trauma centers . most registries do not include patients who are dead at the scene or die on route to the ed . these patients are lost to the analysis and are not included in the stag or gtr datasets . therefore , we can not conclude if patients , who die before reaching the ed , may have survived if they had reached definitive care earlier . this may have led to a selection bias in our study groups , with critically ill patients dying before arrival to hospital in scotland , therefore , being excluded , whereas the same critical patient in germany may arrive at hospital earlier and become part of the register . the shorter pre - hospital times in the german group are probably due to greater use of air transportation of polytrauma patients by helicopter emergency medical services ( hems ) in germany . the main advantages of hems are : 1 ) shortened overall time to patient arrival at hospital , 2 ) potentially better pre - clinical therapy due to the presence of a highly qualified medical team , 3 ) efficient , fast , and if needed , long - distance transport to level 1 trauma centers . scotland only has 4 air ambulance aircrafts , whereas germany has far more units available in all regions , allowing for more flexible usage and shorter pre - hospital times . the use of air transport has been shown to have a positive effect on the mortality of polytrauma patients . a prospective study , comparing patients transferred by ground ambulance or hems to hospital of polytrauma patients revealed that primary transfer by hems to a level 1 trauma center reduced mortality , compared with transfer to a regional hospital by ground ambulance . they attributed this to superior pre - hospital therapy by the hems team in combination with specialist care at the level 1 trauma center . legislative differences exist between the countries that may contribute to the difference in pre - hospital times . in germany , there exists legislation called the rettungsdienstgesetze ( emergency medical services act ) that governs rescue protocols and the hilfsfrist ( period to help ) ; the time it takes from receiving the emergency call to the arrival of adequate emergency assistance to the scene . this varies regionally throughout germany , but on average , the deadline for emergency assistance to reach the scene is 10 to 15 minutes . this act demands that emergency medical services providers to fulfill the deadline in 95% of emergencies . thus , unlike in scotland where such legislation does not exist , there is an additional responsibility upon the german rescue services and consequently shorter pre - hospital times . scottish polytrauma patients received less pre - hospital interventions , compared to the german patients who received more aggressive intravenous fluid replacement , a higher rate of intubations , and prescribed more anesthetic drugs . the first responders to the scene in scotland are mainly ambulance paramedics or technicians who perform basic life support ( bls ) techniques . they do receive training in endotracheal intubation , intravenous cannulation and fluid administration , and in the use of anesthetic drugs , but the rate at which these are used is relatively low . this may be due to a desire for prompt transfer to a facility for definitive treatment or inexperience of the practitioner . despite this variation in pre - hospital interventions , there was no significant difference demonstrated of physiological parameters upon arrival to the ed , reflected by similar rts for both populations . it is possible for advanced life support ( als ) providers to tailor their on - scene management to stabilize the severely injured patient and not delay transfer to definitive management , as this may be detrimental to patient outcome . patient with an iss of 16 or more , have a significantly increased risk of mortality , and it is this group of patients that benefit most from rapid evacuation to definitive care . previous studies[2022 ] have discussed if there is a tendency for als personnel to waste precious time performing als procedures . trunkey et al and lewis et al have suggested that some als skills are necessary whilst others are a waste of precious time in the field . despite a significantly higher iss in the german group , the unadjusted mortality rates were similar for both populations . one explanation for the higher iss observed in the german population could be the greater use of computer tomography scans used for their patients ( 73.6% vs. 78.5% , p = 0.03 ) . this may have resulted in more covert chest and abdominal injuries being identified , for which we demonstrated a significantly higher prevalence in the german population . this would have also influenced the triss and hence the observed difference in the standardized mortality rates , despite similar unadjusted mortality rates . on the other hand , regional injury severity also differed significantly for chest and abdominal injuries . here , one would expect , that the higher rate of ct scans had no influence , since e.g. severe pulmonary contusions would also be visible on plain chest x - ray . furthermore , comparison of iss alone between differing populations does not take into account other case - mix variables , such as pre - existing medical conditions that influence mortality , although these have a lesser affect on severely injured trauma patients ( iss > 16 ) . it would seem the observed diversity in pre - hospital times and pre - hospital interventions between the groups do not make a difference to overall survival . management of the trauma patient is a multifaceted process , where management and transport to the ed is just one step . this may reflect the need for longer resuscitation , which in germany has already been commenced pre - hospitalization and hence less time is spent in the ed . this theory , however , is not supported by the initial physiological parameters , with similar rts for both groups . it is neither an aim nor in the scope of this study to draw conclusions or derive indications as to which approach to trauma management is superior . this is due to the multi - factorial reasons , unique to individual countries and regions , some of which have been discussed . this study is a novel comparison of two differing populations and their hospital management of the severely injured patient . both the scotland and german populations have similar demographics . the german population , however , present with more severe injuries which may be reflected in the lower standardised mortality ratio . despite longer pre - hospital transfer times and more interventions in the german group , no significant difference was demonstrated in rts upon arrival , or unadjusted mortality rates .	introduction : the management of trauma patients differs depending upon the healthcare system available.aim:to compare the pre - hospital management and outcome of polytrauma patients between two countries with differing approaches to pre - hospital management.materials and methods : the scottish trauma and audit group ( stag ) and the german trauma registry ( gtr ) databases were used to compare the management and outcome of trauma patients in scotland and germany . severely injured patients ( injury severity score ( iss ) > 16 ) were analyzed for a 3 year period ( 2000 to 2002 ) . patient demographics , pre - hospital interventions , iss , revised trauma score ( rts ) , time from scene of injury to arrival to the emergency department ( ed ) , 120 day mortality and standardized mortality ratios using triss methodology were compared.results:there were 227 patients identified from the stag registry and 6878 patients from the gtr registry . there was a significant difference in iss ( 24.9 vs. 29.8 , p = 0.001 , respectively ) . no significant difference was observed for the rts ( p = 0.2 ) . there was a significantly higher rate of pre - hospital interventions in the german group ( p < 0.001 ) . the mean time from an injury to arrival to the ed ( 73 vs. 247 minutes , p = 0.001 ) was longer for the scottish patients . there was no difference for an unadjusted mortality rate between the groups , but the standardized mortality ratio was significantly greater for the scottish population ( 3.8 vs. 2.2 , p = 0.036).conclusion : despite variation in pre - hospital transfer times and interventions , no significant difference was demonstrated in rts upon arrival , or for the unadjusted mortality rates .
You are an expert at summarizing long articles. Proceed to summarize the following text: tlr signaling depends on four different adaptor proteins ( myd88 , mal / tirap , tram / ticam-2 , and trif / ticam-1 ) , which bind to specific tlrs and mediate two main signaling pathways , leading to activation of nf-b and ifn regulatory factor ( irf ) transcription factors ( 11 ) . the lps receptor tlr4 uses mal and tram as bridging adaptors for myd88 and trif , respectively . the double - stranded rna receptor tlr3 only needs trif , whereas all other tlrs signal via myd88 . therefore , in a similar approach , we first tested whether overexpression of specific tlr adaptor proteins in human embryonic kidney 293 t ( hek293 t ) cells triggers processing and secretion of ectopically expressed pro il-1. production of mature il-1 was measured in an il-1 bioassay ( fig . 1 a , bottom ) . interestingly , whereas all four tlr adaptors induced the activation of an nf-b dependent reporter gene ( unpublished data ) , mature il-1 production could only be detected upon overexpression of the tlr3 and tlr4 adaptor protein trif . trif signaling to nf-b is known to involve the binding of the trif n - terminal domain with traf6 , as well as the binding of the trif c - terminal receptor interacting protein ( rip ) homology interaction motif ( rhim ) with rip1 ( 12 , 13 ) . deletion of the c - terminal toll / il-1 receptor domain ( tir ) and rhim containing part of trif completely abolished its ability to induce pro a trif mutant lacking the tir domain , but still containing the more c - terminal rhim domain , was equally potent as full - length trif . these data illustrate an important role of the c - terminal rhim containing domain of trif in signaling to pro il-1 processing . poly(i : c ) and lps induce pro il-1 processing via a trif - dependent signaling pathway . ( a ) hek293 t cells were cotransfected with pro il-1 and 50 or 100 ng of either e - trif , e - tram , e - myd88 , or ha - mal . 24 h later , pro il-1 processing and expression of transfected proteins was analyzed by western blotting of total cell lysates ( bottom ) . secretion of biologically active il-1 into the corresponding cell supernatants was analyzed via il-1 bioassay ( top ) . ( b ) hek293 t cells were cotransfected with pro il-1 and different flag - tagged trif deletion mutants . il-1 processing and secretion of biologically active il-1 was analyzed as in a. expression of trif mutants was verified by western blotting and detection with anti - flag . fl , full length ; nt , n - terminal fragment ; ct , c - terminal fragment ; peemsw , traf6-binding motif ; tir , toll / il-1 receptor domain . ( c ) blp - primed peritoneal macrophages from wt and trif ko mice were incubated for 18 h with poly(i : c ) , lps , blp , or control medium , as described in the materials and methods . il-1 was analyzed in total cell lysates ( tl ) by western blotting ( bottom ) . data are representative of three independent experiments . the specific ability of trif overexpression to trigger pro we therefore tested the ability of polyinosinic : polycytidylic acid ( poly[i : c ] ) and lps , respectively , to initiate pro il-1 processing in either wt or trif - deficient peritoneal macrophages . il-1 expression caused by the ability of trif to also activate nf-b , cells were stimulated with poly(i : c ) and lps in the presence of the translation inhibitor cycloheximide ( chx ) , and pro il-1 expression was first induced by pretreating the cells with the synthetic bacterial lipoprotein ( blp ) and tlr2 ligand pam3cys - sk4 , which was previously shown to up - regulate pro il-1 without inducing its processing ( 6 ) . under these conditions , poly(i : c ) and lps significantly induced pro il-1 processing and secretion of mature il-1 by peritoneal macrophages , which was completely prevented in trif - deficient macrophages ( fig . it should be mentioned that chx not only prevented the up - regulation of pro il-1 by lps and poly(i : c ) , but also increased the constitutive and inducible processing of pro this probably reflects the inhibitory effect of chx on the expression of a negative regulator of pro il-1 processing . besides binding to membrane - bound tlr3 , poly(i : c ) is also recognized by cytosolic mda5 , which triggers nf-b and irf activation ( 14 ) . in addition , nalp3 ( also known as cryopyrin ) is a cytosolic nlr that has been shown to play a critical role in the activation of caspase-1 in response to double - stranded rna treatment of bone marrow derived macrophages ( 8) . to further demonstrate that the poly(i : c)-induced pro il-1 processing that we observe is initiated by tlr3 , we tested pro il-1 processing in hek293-tlr3 cells and blp - primed peritoneal macrophages from wt and tlr3-deficient mice , respectively . il-1 processing after poly(i : c ) treatment of blp - primed macrophages was unaffected by mda5 and nalp3 small interfering rna ( sirna ; fig . knockdown was verified via quantitative pcr ( qpcr ) of nalp3 and mda5 mrna ( fig il-1 processing in response to lps plus atp , which is known to require nalp3 ( 9 , 10 ) , was used as a positive control for the effect of nalp3 sirna ( fig decreased irf-7 mrna induction upon intracellular delivery of poly(i : c ) , which is known to initiate mda5 signaling to type i ifn production , leading to irf-7 expression ( 14 ) , was used as a positive control for the effect of mda5 sirna ( fig . collectively , these data demonstrate that the stimulatory effect of extracellular poly(i : c ) on pro il-1 processing is mediated by tlr3 and its adaptor trif . ( a ) hek293-tlr3 cells transfected with 0.3 or 0.6 g pcaggs - pro il-1 were incubated in the absence or presence of 25 g / ml poly(i : c ) for 6 h. pro il-1 processing was analyzed by sds - page and western blotting of total cell lysates ( bottom ) . secretion of biologically active il-1 into the corresponding cell supernatants was analyzed via il-1 bioassay ( top ) . ( b ) blp - primed peritoneal macrophages from wt and tlr3 ko mice were incubated for 18 h with poly(i : c ) or control medium , as described in the materials and methods . il-1 processing was analyzed by western blotting of total cell lysates ( tl ) and il-1 immunoprecipitates ( ip ) from the cell supernatant ( bottom ) . ( c ) peritoneal macrophages were transfected with either control nontargeting ( n - i ) , nalp3 sirna ( nalp3-i ) , or mda5 sirna ( mda5-i ) , as indicated . il-1 processing as described in b. ( middle right and bottom right ) knockdown was verified by qpcr of nalp3 and mda5 , and is presented as a percentage of the mrna levels in cells that were not treated with sirna . as a positive control for the effect of nalp3 sirna , pro il-1 processing was measured in cells that were stimulated for 12 h with 100 ng / ml lps , pulsed for 20 min with 5 mm atp , and subsequently incubated in fresh medium for 3 h ( middle left ) . as a positive control for the effect of mda5 sirna , irf-7 mrna expression was measured via qpcr 6 h after transfecting 5 g / ml poly(i : c ) ( bottom left ) . il-1 processing in response to multiple stimuli ( 2 , 410 ) . to study the role of caspase-1 in the tlr - initiated pro il-1 processing observed in this study , we compared the potential of poly(i : c ) and lps to stimulate pro il-1 processing in blp - primed peritoneal macrophages from wt and caspase-1deficient mice . as a positive control , il-1 processing were only slightly reduced in caspase-1deficient macrophages compared with wt macrophages ( fig . these data indicate that tlr3 and tlr4 can trigger pro il-1 processing independent of caspase-1 . this was further confirmed by the fact that treatment of peritoneal macrophages or pro il-1 transfected hek293-tlr3 cells with the caspase-1 inhibitor ac - wehd - cho fails to completely inhibit poly(i : c)-induced pro 3 , b and c ) . remarkably , the pan - caspase inhibitor z - vad - fmk significantly inhibited pro il-1 processing , whereas the caspase-3 and -7 inhibitor z - devd - cmk had no effect . in addition , overexpression of crma , which is a potent inhibitor of caspase-1 , -4 , -5 , and -8 ( 15 ) , diminished poly(i : c)-induced pro il-1 processing in hek293-tlr3 cells ( fig ( a ) blp - primed peritoneal macrophages from wt and caspase-1 ko mice were incubated for 18 h with poly(i : c ) , lps , blp , or control medium , as described in the materials and methods . il-1 processing was analyzed by western blotting of total cell lysates ( tl ) and il-1 immunoprecipitates ( ip ) from the cell supernatant ( left ) . as a positive control for caspase-1mediated pro il-1 processing , cells were stimulated for 12 h with 100 ng / ml lps , pulsed for 20 min with 5 mm atp , and subsequently incubated in fresh medium for 3 h ( right ) . ( b ) peritoneal macrophages were stimulated for 18 h with poly(i : c ) , as described in a. 1 h before incubation , cells received 50 m z - vad - fmk , ac - wehd - cho , z - devd - cmk , or 0.05% dmso ( solvent control ) . pro il-1 processing was analyzed by western blotting of total cell lysates ( tl ) and il-1 immunoprecipitates ( ip ) from the cell supernatant ( bottom ) . ( c ) hek293-tlr3 cells transfected with 0.6 g pcaggs - pro il-1 were incubated for 6 h with 25 1 h before incubation , cells received 50 m z - vad - fmk , ac - wehd - cho , z - devd - cmk , or 0.05% dmso ( solvent control ) . in the last two lanes , il-1 processing was analyzed by sds - page and western blotting of total cell lysates . it should be noted that several proteases other than caspase-1 were previously shown to proteolytically activate pro il-1 processing can be inhibited by z - vad - fmk and crma pointed to a role for caspase-8 . this was further suggested by the fact that overexpression in hek293 t cells of wt caspase-8 , but not its catalytically inactive mutant , induced pro il-1 processing and secretion of biological active il-1 ( fig . consistent with the aforementioned inhibitory effect of z - vad - fmk and crma , also more specific inhibition of caspase-8 with z - ietd - fmk or the viral caspase-8 inhibitor vflip prevented tlr3-induced pro similarly , sirna - mediated knockdown of caspase-8 completely prevented poly(i : c)-induced processing in hek293-tlr3 cells ( fig . 4 c ) , as well as poly(i : c)- and lps - induced pro il-1 processing in raw264.7 murine macrophages ( fig . 4 , these experiments demonstrate a crucial role for caspase-8 in the production of mature il-1 in response to tlr3 and tlr4 stimulation . to analyze whether caspase-8 can directly cleave pro il-1 into its mature form , we compared the ability of recombinant caspase-1 and -8 to process pro il-1 in vitro . interestingly , mutation of asp117 also prevented the in vitro generation of mature il-1 by caspase-8 , whereas mutation of two other potential cleavage sites that are conserved in mouse and human pro ( a ) hek293 t cells were cotransfected with pro il-1 and either wt caspase-8 or caspase-8 c362a . il-1 was analyzed by sds - page and western blotting of total cell lysates ( bottom ) . secretion of biologically active il-1 into the corresponding cell supernatants was analyzed via il-1 bioassay ( top ) . 1 h before incubation , cells received 50 m z - vad - fmk , 50 m z - ietd - fmk , or 0.05% dmso ( solvent control ) . where indicated , cells were cotransfected with pcaggs - crma - e ( 100 ng ) or pcr3.1-flag - vflip ( 50100200 ng ) . il-1 processing and secretion of biologically active il-1 was analyzed as described in a. ( c ) hek293-tlr3 cells were transfected with either control nontargeting ( n - i ) or caspase-8 sirna ( c8-i ) . 72 h later , cells were treated for 6 h with 25 g / ml poly(i : c ) and analyzed for pro il-1 processing and secretion of biologically active il-1 , ( d ) raw264.7 macrophages were transduced with either control nontargeting shrna ( ctrl - sh ) or caspase-8 shrna ( casp-8-sh ) . 72 h later , cells were primed with blp and subsequently incubated with poly(i : c ) , lps , blp , or control medium as described in the materials and methods . il-1 processing was analyzed by western blotting of total cell lysates ( tl ) and il-1 immunoprecipitates ( ip ) from the corresponding cell supernatant . data are representative of two ( c and d ) or three ( a and b ) independent experiments . il-1 was incubated for 1.5 h at 37c with increasing concentrations of recombinant caspase-8 ( 10 , 30 , 100 , and 300 ng ) or caspase-1 ( 30 ng ) . il-1 wt or the indicated mutants were incubated for 1.5 h at 37c with recombinant caspase-1 , -3 , or -8 ( 200 ng ) and analyzed as in a. in conclusion , the data described in this study demonstrate that tlr3 and tlr4 stimulation induces a trif - dependent signaling pathway that leads to the caspase-1independent maturation of pro caspase-8 has been best characterized as a cysteine protease that cleaves specific substrates to transmit apoptotic signals downstream of death receptors . additionally , roles for caspase-8 in mediating t , b and nk cell proliferation , macrophage differentiation , nf-b activation , maintaining lymphocytes homeostasis , and suppressing immunodeficiency have become evident ( 3 , 18 ) . full caspase-8 knockout mice are embryonic lethal , but tissue - specific inactivation has also revealed the key role of caspase-8 in innate and adaptive immunity ( 3 , 18 ) . il-1 processing in macrophages further supports its immunoregulatory function . because conditional deletion of caspase-8 in myeloid cells results in defective macrophage differentiation ( 18 ) , we were unable to study pro il-1 processing in caspase-8 knockout macrophages . in contrast to our data that show a role for trif and caspase-8 in tlr3- and tlr4-induced pro il-1 processing , it has previously been reported by others that lps and poly(i : c ) can initiate caspase-1mediated pro il-1 processing independent of tlrs or tlr - associated adaptor molecules ( 5 , 19 ) , but involving the nalp3 inflammasome ( 5 , 810 ) . it should be noted , however , that in the aforementioned reports , lps- or poly(i : c)-induced caspase-1 activation required an additional pulse with atp , which triggers a p2x7- and pannexin-1mediated potassium efflux and cytosolic delivery of bacterial products to intracellular nalp3 ( 5 ) . in fact , the essential role of nalp3 and caspase-1 in lps - plus - atp induced pro , it is worth mentioning that one of the original studies describing the caspase-1 knockout mice already reported that trace levels of mature il-1 can be found in the supernatant of caspase-1deficient macrophages stimulated for 30 min with lps plus atp , and further cultured for 3 h in the absence of atp ( 20 ) . collectively , these data illustrate that differences in experimental conditions ( e.g. , costimulation with atp or intracellular delivery of microbial products ) might determine the signaling pathway that is used to induce pro il-1 processing . il-1 processing has also been reported in turpentine- and zymosan - treated mice and macrophages ( 21 ) , as well as in fas - stimulated neutrophils ( 22 ) . consistent with the latter data , we were also able to show caspase-8 activation and pro il-1 processing in response to fas overexpression in hek293 t cells ( unpublished data ) . was previously reported to be sensitive to the pan - caspase inhibitor z-vad.fmk , we speculate that caspase-8 is also involved in fas - induced pro il-1 processing . similarly , in contrast to tlr3 and tlr4 , tlr2 stimulation did not induce caspase-8 processing , which is representative for caspase-8 activation ( unpublished data ) . it is worth mentioning that caspase-8 has already been implicated in tlr3- and tlr4-induced signaling as part of a trif rip1-fas - associated death domain - containing protein in this context , we noticed that poly(i : c ) and lps also induced macrophage cell death upon longer incubation , especially when the synthesis of antiapoptotic proteins was inhibited by chx ( unpublished data ) . il-1 processing in response to tlr3 or tlr4 stimulation is beyond the scope of this study , it can be expected that a similar trif this is also supported by the specific coimmunoprecipitation of caspase-8 and its activated processing product with wt trif , but not with a rip1 binding - deficient rhim mutant of trif , from hek293 t cells ( unpublished data ) . collectively , these data implicate an important function for caspase-8 at the crossroads of proinflammatory and proapoptotic signaling . classically , apoptosis is defined as a type of cell death that does not induce inflammation ( 25 ) . this is most probably true in most cases of apoptosis , in which dying cells do not express pro il-1 or activated caspase-8 . however , in pathological conditions associated with pro il-1 up - regulation and caspase-8 activation , inflammatory responses could be enhanced by the caspase-8 mediated processing and release of il-1 from apoptotic macrophages . in view of the possible use of caspase-8 inhibitors as therapeutic agents , it will be important to identify those disease conditions in which caspase-8 is involved in the cleavage of pro il-1. hek293 t , hek293-tlr ( provided by a. chariot , university of liege , liege , belgium ) , and raw264.7 cells were grown in dmem supplemented with 10% fcs , 2 mm l - glutamine , 0.4 mm sodium pyruvate , and antibiotics . peritoneal macrophages were grown in rpmi 1640 supplemented with 1% fcs , 2 mm l - glutamine , 0.4 mm sodium pyruvate , antibiotics , and 50 m -mercaptoethanol . trif - deficient mice were obtained from b. beutler ( scripps research institute , la jolla , ca ) ; caspase-1deficient mice were obtained from r. flavell ( yale university school of medicine , new haven , ct ) . tlr3-deficient mice were purchased from the jackson laboratory , and wt c57bl/6 mice were purchased from janvier . maintenance and care of mice complied with the guidelines of the university of ghent ethics committee for the use of laboratory animals , which also approved the use of mice as a source of peritoneal macrophages . other reagents used were poly(i : c ) ( ge healthcare ) , pam3cys - sk4 ( blp ; emc microcollections gmbh ) , ultrapure lps ( invivogen ) , chx ( sigma aldrich ) , z - vad - fmk ( bachem ) , ac - wehd - cho ( peptide insitute , inc . ) , z - devd - cmk ( bachem ) , and z - ietd - fmk ( merck ) . recombinant murine caspase-1 , -3 , and -8 were provided by p. vandenabeele ( ghent university , ghent , belgium ) . the antibodies used were as follows : anti - il-1 ( r&d systems ) , mouse il-1 antibody / il-1f2 mab ( clone 30311 ; r&d systems ) , hrp - linked anti - e tag ( ge healthcare ) , hrp - linked anti - flag tag ( sigma - aldrich ) , anti - ha tag ( crp ) , anti - actin ( mp biomedicals ) , anti mouse ig ( ge healthcare ) , hrp - linked anti goat ig ( santa cruz biotechnology , inc . ) , hrp - linked goat anti pcr3.1-flag expression vectors for human trif , trif - tir ( aa 381660 ) , trif - nt ( aa 1385 ) , trif - ct ( aa 381712 ) , trif - rhim ( aa 534712 ) , and e8-vflip ( equine virus e8 protein ) were a gift from j. tschopp ( university of lausanne , lausanne , switzerland ) ( 12 ) . pcdna3.1-ha - mal was a gift from l. o'neill ( trinity colllege , dublin , ireland ) . other used expression vectors are pcaggs - e - crma ( lmbp4888 ) and pcaggs - pro il-1 ( lmbp3853 ) ( 26 ) , pcaggs - e - myd88 ( 27 ) , pcdna - mcasp-8 ( lmbp3841 ) , and pcaggs - emcasp-8-c362a ( lmbp4942 ) . pcaggs - e - htrif ( lmbp5226 ) and pcaggs - e - htram ( lmbp5227 ) were prepared by cloning the human trif and tram cdna , respectively , as a noti il-1 ( lmbp4639 ) ( 28 ) encodes pro il-1 under control of an sp6 promotor . il-1 cdna from pgem11-pro il-1 using overlap pcr , after which it was cloned into a pcr3 expression vector ( invitrogen ) under the control of a t7 promotor . are available from the bccm / lmbp plasmid collection , department of molecular biology , ghent university , belgium ( http://bccm.belspo.be/about/lmbp.php ) . t and hek293-tlr3 cells ( 0.21 10/6-well ) were cotransfected with pcaggs - pro il-1 and other expression plasmids ( 1 g dna total ) by calcium phosphate precipitation and fugene ( roche ) , respectively . the next day , cells were stimulated and lysed at 4c for 15 min in 100200 l lysis buffer ( 200 mm nacl , 1% np-40 , 10 mm tris - hcl , ph 7.5 , 5 mm edta , and 2 mm dtt ) supplemented with protease and phosphatase inhibitors . the cell lysates were subsequently separated by sds - page and analyzed by western blotting and ecl detection ( perkinelmer ) . biologically active il-1 present in the cell supernatant was determined by bioassay , as previously described ( 29 ) . in the case of peritoneal macrophages , cells were pretreated for 8 h with 200 ng / ml blp to up - regulate pro il-1 , and subsequently incubated for different times with 25 g / ml poly(i : c ) , 100 ng / ml lps , 200 ng / ml blp , or control medium in the presence of 1 g / ml chx that was given 30 min before incubation . cell supernatants were incubated overnight with 10% lysis buffer and 2 g mouse il-1 antibody / il-1f2 mab ( clone 30311 ; r&d systems ) , followed by the incubation with protein g sepharose beads ( ge healthcare ) for 3 h. the beads were washed four times with lysis buffer before elution with laemmli buffer and further analysis by sds - page and western blotting . il-1-d108a , and pcr3-pro il-1-d117a were used for in vitro coupled transcription translation of [ s]methionine - labeled pro il1- in an in vitro reticulocyte lysate system ( promega ) according to the manufacturer 's protocol . translation reactions ( 2 l ) were incubated with recombinant murine caspase-1 , -3 , or -8 in a total volume of 25 l cfs buffer ( 10 mm hepes - naoh , ph 7.4 , 220 mm mannitol , 68 mm sucrose , 2 mm nacl , 2.5 mm kh2po4 , 0.5 mm egta , 2 mm mgcl2 , 5 mm sodium pyruvate , 0.1 mm pmsf , and 1 mm dtt ) for 1.5 h at 37c . 10 cells / well ) 72 h before transfection with human caspase-8 sirna ( on - targetplus smartpoolhcasp8 ; dharmacon ) by dharmafect 1 ( dharmacon ) . 6 h after transfection , cells were split , and they were transfected via fugene with pcaggs - pro il-1 the following day . for rnai in peritoneal macrophages , 10 cells were transfected with 2.5 g nontargeting control ( sicontrol non - targeting sirna pool ; dharmacon ) , nalp3 sirna ( sirna genomewide mouse nalp3 ; qiagen ) , or mda5 sirna ( sirna genomewide mouse mda5 ; qiagen ) using the mouse macrophage nucleofector kit ( amaxa ) according to the manufacturer 's instructions . lentivirus was produced by transfecting 2 10 hek293 t cells with 10 g plko.1 control shrna vector ( sigma - aldrich ; shc002 ) or 10 g plko.1 caspase-8 shrna vector ( sigma - aldrich ; shdnac - trcn0000012247 ) , 3 g pmd2-vsv , and 6.5 g pcmvr8.91 ( 30 ) using the calcium - phosphate transfection method . 8 h after transfection , fresh medium was added to the cells , and 48 h later the viral supernatant was supplemented with 8 g / ml polybrene , which was used to transduce 10 raw264.7 cells in 6-wells . total rna was extracted from cells using the aurum total rna mini kit ( bio - rad laboratories ) and reverse transcribed into cdna with superscript ii reverse transcription ( invitrogen ) using oligo(dt)18 primers according to the manufacturer 's instructions . qpcr was performed by using sybr green i master mix ( roche ) in the lightcycler 480 detection system ( roche ) with the following primers : hprt , 5-agtgttggatacaggccagac-3 and 5-cgtgattcaaatccctgaagt-3 ; nalp3 , 5-attacccgcccgagaaagg-3 and 5-tcgcagcaaagatccacacag-3 ; mda5 , 5-agatcaacacctgtggtaacacc-3 and 5-ctctagggcctccacgaaca-3 ; irf-7 , 5-ctggagccatgggtatgca-3 and 5-aagcacaagccgagactgct-3. quantification was performed using the comparative ct method ( ct ) . hek293 t , hek293-tlr ( provided by a. chariot , university of liege , liege , belgium ) , and raw264.7 cells were grown in dmem supplemented with 10% fcs , 2 mm l - glutamine , 0.4 mm sodium pyruvate , and antibiotics . peritoneal macrophages were grown in rpmi 1640 supplemented with 1% fcs , 2 mm l - glutamine , 0.4 mm sodium pyruvate , antibiotics , and 50 m -mercaptoethanol . trif - deficient mice were obtained from b. beutler ( scripps research institute , la jolla , ca ) ; caspase-1deficient mice were obtained from r. flavell ( yale university school of medicine , new haven , ct ) . tlr3-deficient mice were purchased from the jackson laboratory , and wt c57bl/6 mice were purchased from janvier . maintenance and care of mice complied with the guidelines of the university of ghent ethics committee for the use of laboratory animals , which also approved the use of mice as a source of peritoneal macrophages . other reagents used were poly(i : c ) ( ge healthcare ) , pam3cys - sk4 ( blp ; emc microcollections gmbh ) , ultrapure lps ( invivogen ) , chx ( sigma aldrich ) , z - vad - fmk ( bachem ) , ac - wehd - cho ( peptide insitute , inc . ) , z - devd - cmk ( bachem ) , and z - ietd - fmk ( merck ) . recombinant murine caspase-1 , -3 , and -8 were provided by p. vandenabeele ( ghent university , ghent , belgium ) . the antibodies used were as follows : anti - il-1 ( r&d systems ) , mouse il-1 antibody / il-1f2 mab ( clone 30311 ; r&d systems ) , hrp - linked anti - e tag ( ge healthcare ) , hrp - linked anti - flag tag ( sigma - aldrich ) , anti - ha tag ( crp ) , anti - actin ( mp biomedicals ) , anti mouse ig ( ge healthcare ) , hrp - linked anti goat ig ( santa cruz biotechnology , inc . ) , hrp - linked goat anti pcr3.1-flag expression vectors for human trif , trif - tir ( aa 381660 ) , trif - nt ( aa 1385 ) , trif - ct ( aa 381712 ) , trif - rhim ( aa 534712 ) , and e8-vflip ( equine virus e8 protein ) were a gift from j. tschopp ( university of lausanne , lausanne , switzerland ) ( 12 ) . pcdna3.1-ha - mal was a gift from l. o'neill ( trinity colllege , dublin , ireland ) . other used expression vectors are pcaggs - e - crma ( lmbp4888 ) and pcaggs - pro il-1 ( lmbp3853 ) ( 26 ) , pcaggs - e - myd88 ( 27 ) , pcdna - mcasp-8 ( lmbp3841 ) , and pcaggs - emcasp-8-c362a ( lmbp4942 ) . pcaggs - e - htrif ( lmbp5226 ) and pcaggs - e - htram ( lmbp5227 ) were prepared by cloning the human trif and tram cdna , respectively , as a noti il-1 cdna from pgem11-pro il-1 using overlap pcr , after which it was cloned into a pcr3 expression vector ( invitrogen ) under the control of a t7 promotor . are available from the bccm / lmbp plasmid collection , department of molecular biology , ghent university , belgium ( http://bccm.belspo.be/about/lmbp.php ) . hek293 t and hek293-tlr3 cells ( 0.21 10/6-well ) were cotransfected with pcaggs - pro il-1 and other expression plasmids ( 1 g dna total ) by calcium phosphate precipitation and fugene ( roche ) , respectively . the next day , cells were stimulated and lysed at 4c for 15 min in 100200 l lysis buffer ( 200 mm nacl , 1% np-40 , 10 mm tris - hcl , ph 7.5 , 5 mm edta , and 2 mm dtt ) supplemented with protease and phosphatase inhibitors . the cell lysates were subsequently separated by sds - page and analyzed by western blotting and ecl detection ( perkinelmer ) . biologically active il-1 present in the cell supernatant was determined by bioassay , as previously described ( 29 ) . in the case of peritoneal macrophages , cells were pretreated for 8 h with 200 ng / ml blp to up - regulate pro il-1 , and subsequently incubated for different times with 25 g / ml poly(i : c ) , 100 ng / ml lps , 200 ng / ml blp , or control medium in the presence of 1 g / ml chx that was given 30 min before incubation . cell supernatants were incubated overnight with 10% lysis buffer and 2 g mouse il-1 antibody / il-1f2 mab ( clone 30311 ; r&d systems ) , followed by the incubation with protein g sepharose beads ( ge healthcare ) for 3 h. the beads were washed four times with lysis buffer before elution with laemmli buffer and further analysis by sds - page and western blotting . pgem11-pro il-1 , pcr3-pro il-1-d105a , pcr3-pro il-1-d108a , and pcr3-pro il-1-d117a were used for in vitro coupled transcription translation of [ s]methionine - labeled pro il1- in an in vitro reticulocyte lysate system ( promega ) according to the manufacturer 's protocol . translation reactions ( 2 l ) were incubated with recombinant murine caspase-1 , -3 , or -8 in a total volume of 25 l cfs buffer ( 10 mm hepes - naoh , ph 7.4 , 220 mm mannitol , 68 mm sucrose , 2 mm nacl , 2.5 mm kh2po4 , 0.5 mm egta , 2 mm mgcl2 , 5 mm sodium pyruvate , 0.1 mm pmsf , and 1 mm dtt ) for 1.5 h at 37c . hek293-tlr3 cells were plated in 6-wells ( 2 10 cells / well ) 72 h before transfection with human caspase-8 sirna ( on - targetplus smartpoolhcasp8 ; dharmacon ) by dharmafect 1 ( dharmacon ) . 6 h after transfection , cells were split , and they were transfected via fugene with pcaggs - pro il-1 the following day . for rnai in peritoneal macrophages , 10 cells were transfected with 2.5 g nontargeting control ( sicontrol non - targeting sirna pool ; dharmacon ) , nalp3 sirna ( sirna genomewide mouse nalp3 ; qiagen ) , or mda5 sirna ( sirna genomewide mouse mda5 ; qiagen ) using the mouse macrophage nucleofector kit ( amaxa ) according to the manufacturer 's instructions . lentivirus was produced by transfecting 2 10 hek293 t cells with 10 g plko.1 control shrna vector ( sigma - aldrich ; shc002 ) or 10 g plko.1 caspase-8 shrna vector ( sigma - aldrich ; shdnac - trcn0000012247 ) , 3 g pmd2-vsv , and 6.5 g pcmvr8.91 ( 30 ) using the calcium - phosphate transfection method . 8 h after transfection , fresh medium was added to the cells , and 48 h later the viral supernatant was supplemented with 8 g / ml polybrene , which was used to transduce 10 raw264.7 cells in 6-wells . total rna was extracted from cells using the aurum total rna mini kit ( bio - rad laboratories ) and reverse transcribed into cdna with superscript ii reverse transcription ( invitrogen ) using oligo(dt)18 primers according to the manufacturer 's instructions . qpcr was performed by using sybr green i master mix ( roche ) in the lightcycler 480 detection system ( roche ) with the following primers : hprt , 5-agtgttggatacaggccagac-3 and 5-cgtgattcaaatccctgaagt-3 ; nalp3 , 5-attacccgcccgagaaagg-3 and 5-tcgcagcaaagatccacacag-3 ; mda5 , 5-agatcaacacctgtggtaacacc-3 and 5-ctctagggcctccacgaaca-3 ; irf-7 , 5-ctggagccatgggtatgca-3 and 5-aagcacaagccgagactgct-3. quantification was performed using the comparative ct method ( ct ) .	the cytokine interleukin ( il)-1 is a key mediator of the inflammatory response and has been implicated in the pathophysiology of acute and chronic inflammation . il-1 is synthesized in response to many stimuli as an inactive pro il-1 precursor protein that is further processed by caspase-1 into mature il-1 , which is the secreted biologically active form of the cytokine . although stimulation of membrane - bound toll - like receptors ( tlrs ) up - regulates pro il-1 expression , activation of caspase-1 is believed to be mainly initiated by cytosolic nod - like receptors . in this study , we show that polyinosinic : polycytidylic acid ( poly[i : c ] ) and lipopolysaccharide stimulation of macrophages induces pro il-1 processing via a toll / il-1r domain containing adaptor - inducing interferon-dependent signaling pathway that is initiated by tlr3 and tlr4 , respectively . ribonucleic acid interference ( rnai)mediated knockdown of the intracellular receptors nalp3 or mda5 did not affect poly(i : c)-induced pro il-1 processing . surprisingly , poly(i : c)- and lps - induced pro il-1 processing still occurred in caspase-1deficient cells . in contrast , pro il-1 processing was inhibited by caspase-8 peptide inhibitors , crma or vflip expression , and caspase-8 knockdown via rnai , indicating an essential role for caspase-8 . moreover , recombinant caspase-8 was able to cleave pro il-1 in vitro at exactly the same site as caspase-1 . these results implicate a novel role for caspase-8 in the production of biologically active il-1 in response to tlr3 and tlr4 stimulation .
You are an expert at summarizing long articles. Proceed to summarize the following text: according to the 2006 guidelines of the european society of cardiology , therapeutic goals of medical treatment of coronary heart disease can be partitioned into ( 1 ) immediate short - term relieve , ( 2 ) treatment aimed at relieve of symptoms , and ( 3 ) treatment aimed at improving prognosis . interestingly , there is no overlap between drugs that improve prognosis and drugs that relieve symptoms with the exception of -blockers after myocardial infarction . this suggests that ischemia which causes symptoms may not be a major mechanism relevant to prognosis , whereas mechanisms which influence thrombocyte function and anti - inflammatory or cytokine - neurohumoral actions may be beneficial for survival . current strategies of drug - induced relieve of symptoms aim to improve the imbalance between oxygen supply of the heart and oxygen demand which is relevant to myocardial ischemia and angina pectoris . all agents in this category : -blockers , calcium channel antagonists , nitrates , k - channel openers , and sinus node inhibitors reduce myocardial oxygen demand . this occurs either by direct myocardial effects or indirectly by complex effects on hemodynamic determinants . calcium channel antagonists , nitrates , and k - channel openers in addition may improve blood flow and thus oxygen supply to the heart . ranolazine ( fig . 1 ) , a piperazine derivative , is a new anti - ischemic drug for the treatment of angina , whose mode of action is different from the pharmacological principals mentioned above . myocardial ischemia immediately results in reduced atp fluxes and reduced energy supply to various key proteins for the contraction relaxation cycle of the individual cardiac myocyte . these include proteins which control myocyte ion homeostasis . as a consequence , intracellular sodium , and calcium concentration there are several mechanisms by which energy lack increases intracellular sodium ( fig . 2 ) . a large portion of the sodium enters the cell through the cardiac sodium channel following depolarisation during the initial phase ( fast upstroke ) of the action potential . this sodium influx causes further rapid depolarisation leading to the activation of voltage - gated l - type calcium channels causing calcium influx . channels recycle and may be activated by the next membrane depolarisation [ 8 , 22 ] . it has been shown that this typical fast sodium current may be altered during pathological conditions such as hypoxia , exposure to ischemic metabolites and reactive oxygen species . under those conditions , there is a pronounced late opening of the sodium channel up to a few hundreds of milliseconds following depolarisation referred to as late ( or persistent ) sodium current ( late ina , fig . other mechanisms leading to disturbed sodium balance include sodium influx through the sodium - proton pump or lack of sodium elimination through the sodium potassium atpase . 2scheme for the pathophysiology of myocardial ischemia and the role of late ina inhibition with ranolazinefig . 3late ina under normal and increased late ina under pathophysiological conditions scheme for the pathophysiology of myocardial ischemia and the role of late ina inhibition with ranolazine late ina under normal and increased late ina under pathophysiological conditions energy lack and the resulting decrease in the phosphorylation potential reduce free energy available for calcium transport into the sarcoplasmic reticulum and therefore intracellular calcium accumulates in the cytosol . as a consequence , the sodium calcium exchanger can work in two different directions . in its forward mode , it eliminates calcium outside of the cell to accomplish diastolic relaxation ( in addition to calcium reuptake into the sarcoplasmic reticulum ) . in its reverse mode ( usually during the action potential ) , it brings in calcium into the cell in exchange to transsarcolemmal elimination of sodium . the activity and direction of transport depends on the abundance of the protein as well as on the membrane potential , intracellular sodium and intracellular calcium concentration . sodium accumulation following myocardial hypoxia ( i.e. , through late ina ) promotes reverse mode sodium calcium exchange and therefore reduces the overall cellular capacity to eliminate calcium outside of the cytosol . this adds to the elevated diastolic calcium due to reduced sarcoplasmic reticulum calcium pump activity and further aggravates diastolic dysfunction due to contractile protein activation . moreover , increased diastolic tone increases micro - circulatory resistance and further impairs energy balance of the ischemic myocardium . therefore , diastolic dysfunction following myocardial ischemia increases energy consumption and aggravates disturbed energy balance like a vicious cycle . ranolazine has been shown to be a potent inhibitor of late ina and therefore interrupts a major step in the pathophysiology of myocardial ischemia . in myocytes from dog and guinea pig hearts , ranolazine was shown to cause a concentration , voltage , and frequency - dependent inhibition of late ina . most specifically , ranolazine has been shown to reverse the sustained rise in diastolic and systolic calcium caused by a well - known enhancer of late ina , the sea anemone toxin atx - ii [ 10 , 26 ] . taken together , the major mechanism of action of ranolazine is to inhibit late ina thus preventing sodium overload of the cell . as a consequence , ranolazine prevents reverse mode sodium calcium exchange and thus diastolic accumulation of calcium possibly resulting in improved diastolic tone [ 12 , 27 ] and improved coronary blood flow . accordingly , ranolazine has been shown to decrease post - ischemic contracture in rabbit isolated perfused hearts subjected to ischemia and reperfusion . as a late ina inhibitor , ranolazine was also shown to increase action potential duration and thus modestly qt interval by 25 ms [ 5 , 6 ] . this effect , however , is not heart rate - dependent and can not be exaggerated during bradycardia [ 2 , 19 , 32 ] . furthermore , ranolazine does not induce early after depolarisations and does not increase dispersion of repolarisation across the left ventricular wall . according to this profile ranolazine does not increase the risk of torsade de pointes tachycardia as it is observed with many other qt interval prolonging agents . three initial trials have investigated the efficacy of immediate release ranolazine [ 9 , 20 , 23 ] . two larger phase three studies have examined the efficacy of sustained release ranolazine in patients with chronic stable angina . marisa ( monotherapy assessment of ranolazine in stable angina ) randomised 191 patients to placebo or ranolazine in a cross - over design with 1 week treatment period . carisa ( combination assessment of ranolazine in stable angina ) randomised patients to placebo or ranolazine on top of previous anti - anginal therapy . this was true for exercise duration , time to angina and time to 1 mm st segment depression . more specifically , 70% of patients in the placebo group stopped their exercise test because of angina as compared to only 52% in the ranolazine group ( 1.5 g bidaily ) . carisa improved peak and trough exercise duration , time to angina and time to 1 mm st depression . these effects were sustained through a 12-week treatment . also , ranolazine reduced the number of angina attacks from a baseline of 4.5 per week to 2.1 per week for ranolazine ( 1 g bidaily ) compared to 3.3 per week for placebo . most importantly , the anti - anginal effects of ranolazine in marisa and carisa occurred without clinical meaningful changes in heart rate or blood pressure . in the merlin ( metabolic efficiency with ranolazine for less ischemia in non - st elevation acute coronary syndrome ) timi-36 trial , the effect of clinical outcome of ranolazine therapy was studied in patients with acute coronary syndromes . merlin was a multi - national , double - blind , randomised , placebo - controlled , parallel - group clinical trial designed to evaluate the efficacy and safety of ranolazine during acute and long - term treatment in 6560 patients with non - st elevation acs treated with standard therapy . within 48 h of the onset of angina due to acs , eligible hospitalised patients were enrolled in the study and randomised to receive intravenous ranolazine or placebo , followed by long - term treatment with ranolazine tablets or placebo . although ranolazine did not significantly influence the primary combined endpoint of cardiovascular death , myocardial infarction or recurrent ischemia , additional analyses revealed a 13% relative reduction in the risk of recurrent ischemia . furthermore , ranolazine was favourable regarding safety endpoints although the results of merlin do not support the use of ranolazine for acute management of acs these findings support previous finding regarding safety and benefit of ranolazine as an antianginal therapy and suggest a benefit of ranolazine as antianginal therapy in a broad population of patients with established ischemic heart disease . inhibition of enhanced late ina by ranolazine may represent a new treatment option for cardiac diseases associated with disturbed myocardial ion homeostasis . elevated intracellular sodium has been observed in human heart failure and in several animal failure models [ 15 , 21 ] . it has been shown recently that increased intracellular sodium in heart failure may , in part , result from camkii - dependent phosphorylation of sodium channels with subsequent increase in late ina . therefore , ranolazine may be an interesting approach for the treatment of systolic heart failure by improving disturbed sodium homeostasis . moreover , calcium overload subsequent to disturbed sodium homeostasis may also be a major pathophysiological factor in diastolic heart failure . therefore we speculate that in diastolic heart failure due to disturbed sodium / calcium homeostasis , ranolazine may represent a new attractive treatment option . accordingly , studies in heart failure with systolic and diastolic dysfunction are warranted to test the potential therapeutical benefit of ranolazine .	myocardial ischemia is associated with reduced atp fluxes and decreased energy supply resulting in disturbances of intracellular ion homeostasis in cardiac myocytes . in the recent years , increased persistent ( late ) sodium current was suggested to contribute to disturbed ion homeostasis by elevating intracellular sodium concentration with subsequent elevation of intracellular calcium . the new anti - ischemia drug ranolazine , a specific inhibitor of late sodium current , reduces sodium overload and hence ameliorates disturbed ion homeostasis . this is associated with symptomatic improvement of angina in patients . moreover , ranolazine was shown to exhibit anti - arrhythmic effects . in the present article , we review the relevant pathophysiological concepts for the role of late sodium inhibition and summarize the most recent data from basic as well as clinical studies .
You are an expert at summarizing long articles. Proceed to summarize the following text: living systems have evolved to use pentofuranoses of both the ribo ( rna ) and 2-deoxyribo ( dna ) configurations for the backbones of polymers whose function is to faithfully store and transfer biological information necessary for normal cellular function . although the natural selection of these two carbohydrate backbones has resulted in a successful evolutionary pathway , earlier life forms may have been based on alternative , and perhaps simpler , backbone systems before converging on pentofuranoses . one such possibility is a tetrafuranose - based backbone instead of one constructed of pentofuranoses . of the possible tetrafuranose building blocks , the -l - threofuranosyl nucleosides and the corresponding -l - threofuranosyl nucleic acids ( tnas ) provide a geometry most similar to the -d - ribofuranosyl nucleosides and rna ( dna ) . the geometry of a simpler progenitor need not necessarily be similar to that of rna , but evolution might require an intermediate stage of development where both polymers are present at the same time . in that case , the ability to transfer information from the simpler polymer ( e.g. , one based upon -l - threofuranose ) to one at the next level of development ( e.g. , rna ) becomes more critical . in addition to information transfer , primitive life forms would require these earlier polymers to also have functional characteristics including receptorligand binding as well as catalysis . we plan to test the idea that tna can carry out such functional tasks by attempting to isolate functional tna molecules in the laboratory through iterative rounds of in vitro selection and amplification . these techniques have been used to evolve functional rna and dna molecules capable of binding ( aptamers ) and/or catalysis ( ribozymes ) . to extend this approach to structurally diverse nucleic acids such as tna , it is necessary to show that the tnas can be prepared effectively using dna or rna templates and wild - type or mutant ( if necessary ) dna ( or rna ) polymerases . tna is capable of watsoncrick base pairing with complementary dna , rna , and tna oligonucleotides , despite having a backbone unit one atom shorter than that of dna or rna . to examine the functional characteristics of tnas , we need to determine whether ( i ) tna aptamers and catalysts can be selected from random sequence libraries and ( ii ) how well the functional properties of tna compare with rna . results from these experiments will provide insight into the fitness of tna as a potential genetic polymer . the ability to enzymatically synthesize tna is a prerequisite for in vitro selection and directed evolution experiments . several studies have examined the effect of phosphate substitutions on polymerase - mediated nucleic acid replication . the replacement of nonbridging oxygen atoms with sulfur , methyl , or bh3 groups is compatible with limited polymerase - mediated primer - extension synthesis , while acyclic and 4-modified sugar residues generally act as chain terminators . the poor enzymatic recognition of such modified nucleoside triphosphates highlights the difficulties involved in using natural enzyme polymerases to synthesize unnatural polynucleotides . to evaluate the potential of tntps as enzyme substrates for the preparation of tnas , we screened a wide variety of naturally occurring dna polymerases for the ability to recognize tna either in the template or as a nucleoside triphosphate . from those studies , we identified several dna polymerases capable of faithfully synthesizing short sequences of dna on a tna template , as well as dna polymerases able to catalyze the synthesis of limited stretches of tna on a dna template . unfortunately , these dna polymerases are far too inefficient to be used for the iterative in vitro selection and amplification experiments . for example , dna synthesis on a tna template by bst pol i and mmlv reverse transcriptase required at least 60 min to obtain full - length ( n + 9 ) extension . by comparison , tna synthesis on a dna template is even more challenging , requiring a 24-h incubation with deep vent ( exo- ) before the insertion of three contiguous tttp residues occurred . herdewijn has reported a similar finding for the incorporation of tttp by vent ( exo- ) , suggesting that tntps are not easily accepted by many dna polymerases . in an effort to locate effective polymerization catalysts , we have recently identified a mutant archeal family b dna polymerase commonly referred to as therminator dna polymerase as a reasonably efficient dna - dependent tna polymerase . this polymerase was previously shown to exhibit decreased sugar specificity and more efficient incorporation of acyclic chain terminating nucleotides . here we report a detailed kinetic analysis of therminator - catalyzed tna synthesis using a dna template . solid - phase oligonucleotide syntheses of dna primers and templates were performed on an automated abi 394 dna synthesizer ( applied biosystems , foster city , ca ) using standard -cyanoethyl phosphoramidite chemistry . dna synthesis reagents and phosphoramidites were purchased from glen research ( sterling , va ) . oligonucleotides were deprotected in concentrated nh4oh ( 55 c , 1 h ) , lyophilized to dryness , and purified by preparative denaturing polyacrylamide gel electrophoresis . tna triphosphate derivatives ( figure 1 ) were synthesized in 95% purity as described previously by zou et al.figure 1structures of the four tntp residues used in kinetic assays . dna primers were labeled at the 5-terminus by incubating in the presence of [ -p]-atp ( amersham , billireca , ma ) and t4 polynucleotide kinase ( new england biolabs , beverly , ma ) for 1 h at 37 c . labeled primer was annealed to the dna template in thermopol buffer [ 20 mm tris - hcl ( ph 8.8 ) , 10 mm kcl , 10 mm ( nh4)2so4 , and 20 mm mgso4 ] by heating to 95 c for 3 min and cooling to room temperature for 15 min . polymerase reactions were started by adding dna polymerase to a premixed solution containing dna primertemplate complex , tntp substrates ( tttp , tgtp , and tdtp ) , bsa , and dtt in thermopol buffer at 55 c . reaction progress was monitored over time by 20% denaturing gel electrophoresis . at designated time points , aliquots ( 1 l ) were removed and combined with 19 l of stop buffer [ 8 m urea/ 1x - tbe buffer ( 89 mm tris/89 mm boric acid/2 mm edta)/20 mm edta ( ph = 8.0 ) , 0.05% xylene cyanol and bromophenol blue ] . polymerase reactions contained primertemplate complex ( 750 nm ) , tntps ( 20 m each ) , bsa ( 1 g ) , dtt ( 1 mm ) , and 0.25 l of dna polymerase in a final reaction volume of 10 l . for each dna polymerase , a volume of 0.25 l is equivalent to 0.5 units for dna polymerases 9n , therminator , deep vent ( exo- ) , and vent ( exo- ) ; 0.75 units for y409v / a485l mutant 9n dna polymerase ; and 3.0 units for y409v mutant 9n polymerase . all dna polymerases reported in this study are commercially available with the exception of mutant 9n dna polymerase y409v / a485l and y409v , which were generously provided by w. jack and a. gardner at new england biolabs and mutant versions of taq dna polymerase recently identified and described by holliger . taq dna polymerase mutants were not used beyond the initial screen due to poor tntp substrate recognition . unit definition : one unit catalyzes the incorporation of 10 nmol of dntp into an acid precipitable material in 30 min at 75 c . maldi - tof mass spectrometry . the products of each single - nucleotide addition reaction were analyzed by maldi - tof mass spectrometry analysis . for each reaction , 10 m primertemplate were annealed in 1.1x thermopol buffer by heating to 95 c for 3 min followed by incubation at room temperature for 5 min . we added 1 mm mncl2 ( tntp reactions only ) , 20 m appropriate ntp ( except tttp reaction , which contained 250 m tttp ) , and 0.25 units of therminator to a final volume of 10 l . dntp reactions were stopped after 5 min , and tntp reactions were stopped after 10120 min by addition of 20 mm edta . reactions were precipitated in ethanol/2 m nh4ac/0.25 l glycogen solution and purified by c18 ziptip ( millipore ) . samples were eluted with 1 l of matrix solution consisting of 3-hydroxypicolinic acid in 50% acetonitrile / diammonium citrate in water in a ratio of 9:1 . eluates were directly spotted onto a gold - coated maldi - tof plate and analyzed in negative mode on a voyager maldi - tof mass spectrometer ( applied biosystems ) . kinetic measurements were carried out as described for standing - start single - nucleotide insertions . the chimeric dnatna primer used to measure the kinetics of tntp extension from the tna terminus of a dnatna primer was constructed by template - directed synthesis using therminator dna polymerase to extend a dna primer with five tntp residues ( see above ) . polymerization reactions were initiated by adding 10 l of 2 dntp or tntp solution ( 0.0110 m ) to an equal volume of the reaction mixture containing primertemplate complex , 20 mm tris - hcl , 10 mm kcl , 10 mm ( nh4)2so4 , 20 mm mgso4 , 0.1% triton x-100 , 0.25 g/l bsa , 100 m dtt , and either 0.05 units of therminator dna polymerase ( final concentration 9.3 nm ) ( new england biolabs , 2 u/l ) or 0.1 units of deep vent ( exo- ) dna polymerase ( final concentration 1.82 nm ) ( new england biolabs , 2 u/l ) . the amount of dntp or tntp used and reaction time ( 13 min ) were adjusted to limit polymerization to 20% or less . polymerization reactions were incubated at 55 c and quenched with 10 l of stop buffer [ 8 m urea / tbe/20 mm edta ( ph = 8.0 ) , 0.05% xylene cyanol and bromophenol blue ] . extents of reaction were determined by 20% denaturing polyacrylamide gel electrophoresis and quantifying the resulting bands by phosphorimaging ( bio - rad molecular imager fx , hercules , ca ) . kinetic parameters for km and vmax were determined by linear regression analysis of a haneswoolf plot with reported values being the average of three or more independent experiments ( see below ) . kinetic measurements . we determined the kinetic parameters ( vmax and km ) for each enzyme using the steady - state method for assessing dna polymerase single - nucleotide incorporation efficiency . this is a kinetic assay in which the polymerase concentration is far below the primertemplate concentration and the reaction time is short . by varying the concentrations of dntps , kinetic parameters for km and vmax can be obtained from a haneswoolf plot of [ dntp]/v versus [ dntp ] through a linear least - squares fit of the data . the intercept and slope of the resulting plot correspond to the values for km / vmax and 1/vmax of the reaction process , respectively . in this case , km is defined as the [ dntp ] when the reaction velocity is half of the maximum velocity under saturating substrate conditions and vmax is the maximum velocity as determined by a hyperbolic function of relative velocity verses [ dntp ] . thus , this assay provides a straightforward method for determining the enzymatic efficiency ( vmax / km ) for a given enzymesubstrate pair . the ratio of the vmax / km values for different substrates provides a quantitative measurement describing the selectivity of a given polymerase for dntp versus tntp nucleotides . these selectivity values are independent of enzyme activity and thus allow the comparison of different enzymes . the -l - threofuranosyl nucleoside triphosphates ( tntps ) , considered as potential substrates for dna polymerase , suffer from the absence of one carbon atom in the helical repeat unit , relative to the native dntps ( figure 2a ) . the absence of this methylene group from the carbohydrate backbone ( relative to ribofuranosyl ) means that with the triphosphate portion of the tntp bound correctly within the active site , the nucleobase / sugar residue will necessarily be pulled toward the triphosphate by the absence of the 5-carbon and may not correctly interact with the template residue . such effects could alter enzyme substrate affinity and result in higher apparent km values characterizing the polymerization reaction . in the absence of tntptemplate pairing , the catalytic step necessary to incorporate the tntp residue into the primer strand may be correspondingly reduced ( with lowered vmax values ) . alternatively , with the nucleobase / sugar residue correctly bound in the active site , and paired with the template residue , the absence of the 5 carbon may result in a distortion in the position of the triphosphate , also reducing overall binding affinity ( with increasing km values ) and placing the -phosphate residue in a less optimal position for the requisite chemistry to take place ( reducing vmax ) . figure 2structures of ( a ) tntp and dntp building blocks and ( b ) 3 2 linked -l - threofuranosyl nucleotides ( tna ) and 5 3 linked -d - ribofuranosyl nucleotides ( rna ) . structures of ( a ) tntp and dntp building blocks and ( b ) 3 2 linked -l - threofuranosyl nucleotides ( tna ) and 5 3 linked -d - ribofuranosyl nucleotides ( rna ) . on the other hand , the hydroxyl that functions as the nucleophile ( 3oh in rna , 2oh in tna ) by virtue of the regioisomeric shift by one carbon unit should still be located more or less in the catalytically active site . despite the shorter backbone length , it appears that tna and rna can both form polymers in which the nucleobases are spaced regularly at the same distances ( figure 2b ) . crystallographic studies indicate that the tna backbone can reach far enough to link two stacked base pairs and result in an essentially native dnatna duplex . polymerase screens . on the basis of our previous demonstration that deep vent ( exo- ) dna polymerase ( dv ) was capable of extending a dna primer with three residues of -l - threofuranosyl thymidine using tttp as the substrate , we decided to examine a number of other thermophilic dna polymerases for improved tna polymerase activity . a synthetic primertemplate complex was constructed that consisted of a dna primer annealed to a longer dna template such that nine dna residues were available to function as a template for the synthesis of tna ( figure 3 ) . polymerases were challenged to extend the dna primer using a mixture of tttp , tgtp , and tdtp ( see figure 1 ) . the diaminopurine analogue ( tdtp ) of adenine was used in place of threosyl adenosine 3-triphosphate , because this substitution slightly raises the thermodynamic stability of the dnatna heteroduplex . it has additionally been shown to increase the efficiency of nonenzymatic tna - directed ligation reactions . we have also reported significant rate enhancements as a result of replacing a residues in the template with d residues in previous primer - extension reactions using tttp.figure 3tna polymerase assay . tna elongation product of dna template is shown as lowercase bold letters . to compare qualitatively the ability of various dna polymerases to extend a dna primer with sequential tntp residues , we screened a series of mutant versions of taq polymerase ( data not shown ) and several exonuclease - deficient archeal family b dna polymerases , including 9n , 9n variants a485l ( therminator ) , y409v , and the y409v / a485l double mutant , as well as deep vent and vent polymerases ( figure 4 ) . this screen revealed that the therminator dna polymerase is a much more efficient tna polymerase than any other family b polymerase . for instance , in the therminator - catalyzed tna synthesis reaction , full - length product is visible by 90 min , and the reaction appears largely complete by 300 min . the remaining polymerases are only able to insert a limited number of tntp residues within that same time period . to compare the activity of dv and therminator dna polymerases in greater detail , additional reaction time courses were performed ( figure 5a , b , lanes 17 ) . in these reactions , dv rapidly catalyzed primer extension by one nucleotide followed by very slow and incomplete addition of a second and third nucleotide . under the same conditions , the therminator - catalyzed reaction is characterized by the continuous incorporation of consecutive residues , proceeding almost to completion after 300 min . since therminator is able to continue synthesis even after all primer positions expected to contact the enzyme are composed of tna , it seems likely that dv loses essential contacts with the primer as additional tna nucleotides are added . reaction progress over time was analyzed by denaturing polyacrylamide gel electrophoresis for experiments using exonuclease deficient family b dna polymerases : 9n , therminator , 9n single mutant y409v , 9n double mutant y409v and a485l , deep vent , and vent . time points were taken for each polymerase reaction at 0 ( no enzyme ) , 15 , 30 , 90 , 150 , and 300 min , lanes 16 , respectively.figure 5tna primer extension reactions . reaction progress over time was analyzed by denaturing polyacrylamide gel electrophoresis for ( a ) deep vent exo- ( dv ) and ( b ) therminator - catalyzed dna polymerase reactions . primer - extension reactions were performed in the absence ( lanes 17 ) and presence ( lanes 814 ) of 1.25 mm mncl2 . reaction progress over time was analyzed by denaturing polyacrylamide gel electrophoresis for experiments using exonuclease deficient family b dna polymerases : 9n , therminator , 9n single mutant y409v , 9n double mutant y409v and a485l , deep vent , and vent . time points were taken for each polymerase reaction at 0 ( no enzyme ) , 15 , 30 , 90 , 150 , and 300 min , lanes 16 , respectively . reaction progress over time was analyzed by denaturing polyacrylamide gel electrophoresis for ( a ) deep vent exo- ( dv ) and ( b ) therminator - catalyzed dna polymerase reactions . primer - extension reactions were performed in the absence ( lanes 17 ) and presence ( lanes 814 ) of 1.25 mm mncl2 . encouraged by this result , we attempted to optimize the reaction conditions for tna polymerase activity . variations in salt concentration or ph had little effect , but the presence of mn ions dramatically increased the reaction efficiency . mn ions are known to relax the substrate specificity of many dna polymerases , possibly by allowing enhanced binding to the - and -phosphates of the dntps . we have previously used this strategy to improve the rate of dna synthesis on a tna template . as illustrated in lanes 814 of figure 5 , supplementing the reaction mixture with 1.25 mm mncl2 enhances the efficiency of tna synthesis for both dv and therminator polymerases . with mncl2 we observed the presence of trace amounts of fully elongated product , visible after 1 h , for reactions catalyzed by dv . therminator - catalyzed reactions appear essentially complete in just 10 min with mn versus 150300 min in the absence of mn . to verify the addition of tntps to the 3-terminus of the dna primer , therminator - catalyzed single - nucleotide addition reactions were analyzed by maldi - tof mass spectrometry . as shown in table 1 , the observed mass for each of the four tntp and dntp primer extension reactions thus , the extension of a dna primer with tntps does not appear to be the result of unwanted dntp contamination as tna and dna differ by one methylene group or 14 atomic mass units . table 1maldi - tof mass spectrometry analysis of therminator - mediated single - nucleotide extension of dntps and tntps from a dna primer5-d - taatacgactcactatagggaga 3-d - attatgctgagtgatatccctctxyzcttt xyz ( dna)ntpexpected mass ( m / z)observed mass ( m / z ) 1 tgg ddtp 7385.8 7386.7 2 cgg dgtp 7386.8 7386.9 3 dgg dttp 7361.8 7362.6 4 gaa dctp 7346.8 7345.9 5 tgg tdtp 7371.8 7372.7 6 cgg tgtp 7372.8 7372.3 7 dgg tttp 7347.8 7346.8 8 gaa tctp 7332.8 7333.5 9 cgg none 7058.6 7058.9 maldi - tof mass spectrometry analysis of therminator - mediated single - nucleotide extension of dntps and tntps from a dna primer to quantify these initial observations , we decided to perform two types of experiments : ( i ) the extension of an all - dna primer by one tna versus one dna nucleotide and ( ii ) the extension of a dna primer containing five 3-terminal tna residues by one tna or dna nucleotide . we determined the catalytic efficiency of tna and dna synthesis at each of these positions by measuring single - nucleotide insertion kinetics using the steady - state method . values for vmax / km were determined for dv and therminator - catalyzed insertion of all four -l - threofuranosyl nucleoside 3-triphosphates ( figure 1 ) opposite their cognate watsoncrick complement . this approach provides an accurate method for evaluating the catalytic efficiency for the overall reaction process , but does not identify the rate - limiting step of the reaction . for native dna nucleotides , the rate - limiting step typically involves a conformational change prior to chemical bond formation . conversely , for mismatched and many non - natural dna substrates , phosphodiester bond formation tends to become rate - limiting . by comparing the catalytic efficiency of dv ( exo- ) and therminator dna polymerases for tntp relative to that of dntp substrates , we are able to determine the enzymatic selectivity ( e.g. , the ability for each polymerase to distinguish threose substrates from deoxyribose substrates ) for each enzyme substrate pair . for a dna polymerase to be an efficient tna polymerase it must exhibit little to no selectivity between correctly paired dntp and tntp substrates . primer - extension experiments with tntp substrates and an all - dna primer and template specifically examine the effects of changes in the nucleotide substrate , since enzyme binding to the primertemplate complex should be normal , and the reactive groups ( 3-oh of the primer and the -phosphate of the triphosphate ) are unchanged . thus , any observed effects should reflect changes in substrate binding , changes in the orientation of the bound substrate , or altered conformational changes in the enzyme as a result of alterations in the substrate . we measured single nucleotide incorporation kinetics for dv - catalyzed synthesis of tna from a dna primer . the catalytic efficiency ( vmax / km ) for dv - catalyzed extension of a dna primer was 20100 fold lower for tntp incorporation compared to that of dntp incorporation ( table 2 , entries 58 versus 14 ) . the observed kinetic selectivity is greatest between tctp and dctp ( 90-fold ) , with the least discrimination occurring between tttp and ttp ( 20-fold ) . comparison of the individual km and vmax values for tna and dna shows that the loss in catalytic efficiency is dominated by increases in km . the km for tntps is 545-fold higher than that for dntps , while the vmax drops by only 25-fold . while the large increases in km may reflect loss of binding interactions with the tntp substrate , this interpretation is complicated by the possibility of changes in the rate - limiting step of the reaction . the changes in vmax suggest that the tna triphosphate may not be properly positioned in the active site of the enzyme for inline attack by the 3-hydroxyl of the dna primer ; alternatively , the conformational changes known to follow substrate binding may be slower with tntp substrates . table 2steady - state kinetic parameters for deep vent - mediated single - nucleotide extension of dntps versus tntps from a dna primer5-d - taatacgactcactatagggaga 3-d - attatgctgagtgatatccctctyzcgttt yz ( dna)ntpkm ( m)vmax ( % /min)efficiency ( vmax / km ) 1 tc datp 1.4 0.09 46 13 3.3 102 ca dgtp 0.66 0.18 33 9.0 5.0 103 ac dttp 0.65 0.33 15 1.5 2.3 104 gc dctp 0.18 0.12 14 3.5 7.8 105 tc tdtp 7.5 5.0 8.3 2.4 1.1 106 ca tgtp 9.3 2.5 7.5 1.0 8.6 107 ac tttp 6.2 1.5 7.0 1.0 1.1 108 gc tctp 8.2 0.3 7.4 1.0 8.5 10 steady - state kinetic parameters for deep vent - mediated single - nucleotide extension of dntps versus tntps from a dna primer the catalytic efficiency for therminator - catalyzed single - nucleotide addition of tntps and dntps to a dna primer is significantly better than that for dv - catalyzed synthesis ( table 3 ) . comparison of the vmax / km values for the two enzymes reveals a 17200-fold improvement in the incorporation of tntp substrates for therminator versus dv . this large value does not solely reflect better incorporation of tntps by therminator as this enzyme also shows 410-fold increases in catalytic efficiency with dntps when compared to dv . thus , under these conditions therminator polymerase is simply a more active polymerase than dv . table 3steady - state kinetic parameters for therminator - mediated single - nucleotide extension from dna5-d - taatacgactcactatagggaga 3-d - attatgctgagtgatatccctctyzcgttt yz ( dna)ntpkm ( m)vmax ( % /min)efficiency ( vmax / km)mncl21 tc datp 0.12 0.14 21 7.5 1.8 10 2 ca dgtp 0.21 0.97 49 2.4 2.3 10 3 ac dttp 0.21 0.12 40 2.0 1.9 10 4 gc dctp 0.12 0.07 36 8.6 3.0 10 5 tc tdtp 0.73 0.2 48 33 6.6 10 6 ca tgtp 0.46 0.12 25 2.9 5.4 10 7 ac tttp 1.5 0.17 28 1.0 1.9 10 8 gc tctp 0.32 0.02 55 1.4 1.7 10 9 tc tdtp 0.19 0.01 25 21 1.3 10 + 10 ca tgtp 0.39 0.01 33 1.0 8.5 10 + 11 ac tttp 0.19 0.11 30 7.0 1.6 10 + 12 gc tctp 0.13 0.04 29 2.0 2.2 10 + 13 ca ddgtp 0.13 0.03 19 2.0 1.5 10 14 ca acycgtp 0.05 0.03 14 2.0 2.8 10 15 dc dttp 0.05 0.03 14 3.3 2.9 10 16 dc tttp 0.06 0.05 15 5.7 2.3 10 17 dc tttp 0.04 0.03 6.0 0.9 1.6 10 + reaction mixture supplemented with 1.25 mm mncl2 . steady - state kinetic parameters for therminator - mediated single - nucleotide extension from dna reaction mixture supplemented with 1.25 mm mncl2 . inspection of the individual km and vmax values for the therminator - catalyzed reactions suggests the slight drop in catalytic efficiency with tntps is primarily due to a modest increase in km ; there is no significant difference between vmax values with tntp and dntp substrates . examination of therminator - catalyzed tna synthesis relative to dna synthesis ( entries 58 versus 14 ) indicates that tntps are only slightly less efficient ( 210-fold ) than dntp substrates . because a small degree of kinetic selectivity was observed between tttp and ttp ( 10-fold ) , we tested the idea that tttp incorporation could be improved by replacing da with dd in the dna template . while this substitution provided a modest increase in the catalytic efficiency for dna ( 1.5-fold , entry 3 versus 15 ) , its effect on tna synthesis was much more pronounced ( 12-fold , entry 7 versus 16 ) . interestingly , the enhanced efficiency of both ttp and tttp incorporation opposite d in the template is due to a decrease in km , consistent with enhanced binding due to the increased strength of the td base pair . because of the increased rate of tna synthesis observed in the presence of mn , we decided to measure therminator - catalyzed single - nucleotide tntp insertion efficiencies in the presence of 1.25 mm mncl2 . as expected , supplementing the reaction mixture with mn ions improves the enzymatic efficiency of the tntp incorporation to values closely approximating those observed with dntps in the absence of mn ( 0.80.3-fold as efficient , entries 912 versus 14 ) . evaluating the catalytic efficiency of therminator - catalyzed tna synthesis in the presence ( entries 912 ) and absence ( entries 58 ) of mn ions reveals that the presence of manganese lowers the km of tntps , with an especially significant decrease in the km for tttp . this change might be due to mn ions relaxing some conformational constraints within the enzyme active site , thus restoring weakened contacts to the substrate . mn ions have a similar but smaller effect on the km for tttp incorporation opposite dd ( entry 17 versus 16 ) . therminator - catalyzed tna synthesis from a tna primer . to examine the effect of tna residues in the primer on continued tna synthesis , we constructed a chimeric dnatna primer containing five tna residues at the 3-terminus of the dna primer . the length of the tna segment was chosen to ensure that only the tna region of the primer contacted the polymerase . using this new primer , we then measured therminator - catalyzed single - nucleotide incorporation kinetics ( table 4 ) for all four tntp and dntp substrates in the absence ( entries 18 ) and presence ( entries 916 ) of mn ions . the extension of the tna terminus of the dnatna primer remains slightly faster with dntps than with tntps ( approximately 24-fold in nearly every case ) . however , the rate of tna synthesis in the presence of mn ions ( entries 1316 ) is nearly identical to the rate of dna synthesis in the absence of mn ( entries 14 ) . this result suggests that it should be possible to synthesize long stretches of tna in a polymerase - mediated reaction with catalytic rates that rival natural dna synthesis . surprisingly , no drop in the rate of incorporation was observed for any of the four tntp substrates at the downstream positions ( compare table 3 with table 4 ) . on the contrary , a slight increase in the catalytic efficiency ( 26-fold ) was noted for most substrates . by comparison , similar experiments previously performed using dv dna polymerase to catalyze the incorporation of tttp from a dnatna chimeric primer ending in either one or two tt residues resulted in a 2600-fold drop in catalytic efficiency . this comparison suggests that therminator polymerase may form more direct contacts to the tna primer , thus permitting continued tna synthesis . table 4steady - state kinetic parameters for therminator - mediated single - nucleotide extension from the tna terminus of a dnatna primer5-d - taatacgactcactatagggagaatagg 3-d - attatgctgagtgatatccctcttatccyzcgttt yz ( dna)ntpkm ( m)vmax ( % /min)efficiency vmax / kmmncl21 tc datp 0.040 0.045 22 11 5.5 10 2 ca dgtp 0.019 0.01 16 7.7 8.4 10 3 ac dttp 0.054 0.001 31 0.8 5.7 10 4 gc dctp 0.066 0.02 32 14 4.8 10 5 tc tdtp 0.18 0.1 21 9.4 1.2 10 6 ca tgtp 0.09 0.02 29 1.6 3.2 10 7 ac tttp 0.12 0.03 27 2.7 2.3 10 8 gc tctp 0.21 0.04 36 2.6 1.7 10 9 tc datp 0.025 0.009 43 7.8 1.7 10 + 10 ca dgtp 0.031 0.007 31 5.4 1.0 10 + 11 ac dttp 0.007 0.001 35 0.7 5.0 10 + 12 gc dctp 0.019 0.007 39 8.3 2.1 10 + 13 tc tdtp 0.04 0.01 31 5.9 8.7 10 + 14 ca tgtp 0.08 0.03 39 3.1 4.8 10 + 15 ac tttp 0.09 0.03 38 4.7 4.4 10 + 16 gc tctp 0.11 0.08 49 1.1 4.8 10 + reaction mixture supplemented with 1.25 mm mncl2 . steady - state kinetic parameters for therminator - mediated single - nucleotide extension from the tna terminus of a dnatna primer reaction mixture supplemented with 1.25 mm mncl2 . rationalizing the superior catalytic efficiency of therminator - mediated tna polymerization relative to other family b dna polymerases ( including its parental 9n polymerase ) previous work by gardner and jack has indicated that family b archaeal dna polymerases bearing this mutation exhibit increased efficiency of incorporation of chain - terminating dideoxy and acyclic nucleoside triphosphates . to quantitatively compare these analogues with tntps , we measured the insertion kinetics for ddgtp and the acyclic derivative , 2-hydroxyethoxymethyl - gtp , using therminator dna polymerase and an all - dna primer ( see entries 13 and 14 of table 3 ) . comparison of the catalytic efficiency of incorporation of all four nucleotides ( vmax / km ) results in the following substrate order : acgtp dgtp > ddgtp > tgtp . therminator - mediated incorporation of acyclogtp is approximately 2-fold more efficient than ddgtp and 5-fold more efficient than tgtp . in light of this result , it appears that the mutation a485l allows efficient nucleotide incorporation largely independent of sugar recognition . the crystal structures of the apo 9n dna polymerase and family b rb69 dna polymerase replication complex offer some insight into the structural influence of the a485l substitution . the a485 residue faces away from , and does not interact directly with , the incoming nucleoside triphosphate . instead , the increased bulk of the leucine residue appears to favor the rotation of the fingers domain , which is known to follow nucleotide binding and precede phosphodiester bond formation . if this conformational change is normally slow in nucleotides with sugar analogues , the a485l mutation would be expected to facilitate their incorporation by speeding up this rate - limiting transition . we have not undertaken a detailed analysis of the fidelity of tntp incorporation by the therminator polymerase using the dna template . however , under the conditions of the kinetic characterization of tntp single - nucleotide incorporation studies , we never observe the appearance of the n + 2 product ( specific incorporation followed by nonspecific incorporation ) . if tna synthesis by the therminator polymerase occurred with low levels of sequence fidelity , we would expect some nonspecific elongation of the n + 1 primer . although qualitative in nature , this observation suggests that under the concentrations and conditions employed for the described elongations , sequence fidelity is unlikely to be a major concern . a detailed kinetic analysis of the fidelity of tna synthesis is currently in progress . in summary , we have identified therminator dna polymerase as an enzyme capable of significant tna synthesis activity . using this polymerase , we have found that despite considerable differences in the sugarphosphate backbone , the enzymatic efficiency of tna substrates compares closely with natural dna substrates . the fact that present - day polymerases can incorporate simpler versions of the nucleoside triphosphate building blocks under conditions where rates of polymerization rival those of the dntps suggests that simpler progenitors could form the basis for an alternative genetic system . the observed polymerization rates for tntps also suggest that the iterative process of in vitro selection and amplification of tna aptamers and enzymes may now be possible through a dna display approach similar to mrna display , in which random sequence tna oligonucleotides are displayed on their encoding dna message . detailed experimental methods for steady - state kinetic studies , enzyme saturation plots , haneswoolf plots of kinetic data for nucleotide insertions , and maldi - tof mass spectra for therminator - catalyzed single - nucleotide addition of tntps and dntps .	-l - threofuranosyl nucleoside triphosphates ( tntps ) are tetrafuranose nucleoside derivatives and potential progenitors of present - day -d-2-deoxyribofuranosyl nucleoside triphosphates ( dntps ) . therminator dna polymerase , a variant of the 9n dna polymerase , is an efficient dna - directed threosyl nucleic acid ( tna ) polymerase . here we report a detailed kinetic comparison of therminator - catalyzed tna and dna syntheses . we examined the rate of single - nucleotide incorporation for all four tntps and dntps from a dna primertemplate complex and carried out parallel experiments with a chimeric dnatna primerdna template containing five tna residues at the primer 3-terminus . remarkably , no drop in the rate of tna incorporation was observed in comparing the dnatna primer to the all - dna primer , suggesting that few primer - enzyme contacts are lost with a tna primer . moreover , comparison of the catalytic efficiency of tna synthesis relative to dna synthesis at the downstream positions reveals a difference of no greater than 5-fold in favor of the natural dna substrate . this disparity becomes negligible when the tna synthesis reaction mixture is supplemented with 1.25 mm mncl2 . these results indicate that therminator dna polymerase can recognize both a tna primer and tntp substrates and is an effective catalyst of tna polymerization despite changes in the geometry of the reactants .
You are an expert at summarizing long articles. Proceed to summarize the following text: a 14-year - old female patient presented to us with complaints of palpable purpura and ulceration over lower extremities for last 5 days . the patient was receiving anticonvulsive therapy ( phenytoin ) for epilepsy since she was 3 years old . a fortnight ago , her neurologist added levetiracetam 500 mg daily to phenytoin 50 mg thrice daily , owing to worsening of epilepsy symptoms . eight days after initiation of levetiracetam , the patient developed palpable purpura over lower extremities , associated with itching . she did not suffer from any preceding infection or illnesses and demonstrated the absence of systemic manifestations such as arthralgias , hematuria , melena , or abdominal pain . cutaneous examination revealed the presence of palpable purpura and large ulcers covered with necrotic eschars over the lower extremities [ figure 1 ] . palpable purpura and necrotic ulcers over lower extremities routine laboratory investigations were detected to be normal . additional investigations demonstrated a negative antinuclear antibody , cytoplasmic antineutrophil cytoplasmic antibodies , perinuclear antineutrophil cytoplasmic antibodies and normal serum protein electrophoresis , hepatitis screen , urinalysis , antidouble - stranded dna antibody , and thyroid assay . a skin biopsy from the lesion revealed fibrinoid necrosis of walls of small vessels consistent with lcv [ figure 2 ] . immunofluorescence of the biopsy specimen could not be done due to nonavailability in our setup . histopathological examination showing red blood cell extravasation , infiltration of neutrophils and eosinophils and fibrinoid necrosis ( h and e , 40 ) in the dermis on the basis of temporal association and clinicohistopathological findings , a diagnosis of levetiracetam - induced lcv was established and levetiracetam was discontinued . adverse reaction severity was determined as level 4(b ) according to modified hartwig and siegel scale as it was the reason for admission . the patient was treated with systemic corticosteroids ( 30 mg / day of prednisolone ) along with topical corticosteroids ( mometasone furoate 0.1% cream twice daily ) , emollients , and oral levocetirizine 5 mg twice daily . after 1 week of stoppage of levetiracetam and initiation of treatment , lesions had started subsiding . oral steroids were gradually tapered off over next 3 weeks . at 4 weeks ' follow - up , lesions had cleared completely with residual hyperpigmentation and scarring . causality assessment was carried out using naranjo 's scale and world health organizationuppsala monitoring centre criteria , which suggested that levetiracetam was the probable drugs can cause vasculitis of various morphological types . most commonly , these cause a superficial small vessel cutaneous lcv ; however , other patterns including systemic vasculitis also occur . more than 100 drugs are implicated as causes of drug - induced vasculitis although actual frequency of drug - induced vasculitis is low . commonly , implicated drugs include penicillins , sulfonamides , quinolones , analgesics , anticonvulsants , phenothiazines , allopurinol , and colony - stimulating factors . less commonly used drugs with a significant risk of vasculitis include thiouracil , hydralazine , and biologicals such as adalimumab , etanercept and infliximab , ephedrine , amphetamines , vaccines ( especially influenza and hepatitis b vaccines ) , herbal remedies , and food additives . exact pathogenesis of drug - associated cutaneous vasculitis is unclear , but studies suggest that the offending drug may act as a hapten , which stimulates antibody production and immune complex formation . these immune complexes are subsequently deposited in postcapillary venules leading to complement activation and vascular damage . cutaneous manifestations of drug - induced vasculitis include palpable purpura , papules , and bullae . palpable purpura can occur hours to weeks following exposure to offending drug and most commonly develops on gravity - dependent areas , such as lower extremities and buttocks . this was also observed in the present case where lesions started appearing after 8 days of initiation of offending drug and were localized mostly to lower limbs . distinguishing drug - related vasculitis from other etiologies of lcv can be difficult . however , pattern of development and resolution of lesions with continuation or discontinuation of medication can help in diagnosis . withdrawal of offending drug and minimization of stasis by compression , elevation , and use of nonsteroidal anti - inflammatory drugs are employed . antihistamines and systemic corticosteroids may be required when the cutaneous lesions are progressive as in present case . levetiracetam is a pyrrolidone derivative that is thought to exert its antiepileptic effects through adherence to synaptic vesicle protein sv2a and modulation of neurotransmitter release . levetiracetam is an effective adjunctive therapy in patients with refractory focal epilepsy , myoclonic epilepsy , and primary generalized tonic drug interactions between lev and other medications , such as warfarin , digoxin , oral contraceptives , probenecid , and other antiseizure medications , are not reported . levetiracetam causes several adverse neurological effects including headache , somnolence , asthenia , dizziness , irritability , and behavioral changes . in addition , it causes hematological side effects such as mild thrombocytopenia , leukopenia , and anemia . cutaneous side effects with levetiracetam are less frequent compared to other antiepileptic medication , but adverse effects such as bullous pemphigoid , maculopapular drug rash , and drug reaction with eosinophilia and systemic symptoms have been reported . even though lcv is a common adverse effect of antiepileptics , but to the best of our knowledge , this is the first reported case of lcv with levetiracetam . event relationship , morphology , distribution , histopathological findings , and rapid response on withdrawal of the drug , we conclude that patient developed lcv due to levetiracetam . even though risk of cutaneous adverse effects with levetiracetam is less , clinicians should be aware of possibility of adverse effects such as small - vessel vasculitis or drug eruption occurring as a rare adverse effect with this drug .	drug - induced leukocytoclastic vasculitis is a small - vessel vasculitis that most commonly manifests with palpable purpuric lesions on gravity - dependent areas . vasculitis occurs within weeks after initial administration of medication and demonstrates clearance upon withdrawal of medication . levetiracetam , a pyrrolidone derivative , is used as an adjunctive therapy in patients with refractory focal epilepsy , myoclonic epilepsy , and primary generalized tonic clonic seizures . we present a case of a 14-year - old female , who developed cutaneous small - vessel vasculitis within 8 days of initiation of levetiracetam . vasculitis was successfully managed by discontinuation of medication and systemic corticosteroids . this adverse reaction , to the best of our knowledge , has not been previously reported in literature .
You are an expert at summarizing long articles. Proceed to summarize the following text: the developmental process of systemic autoimmune diseases has been an unsolved mystery for decades . despite the identification of autoreactive t lymphocytes or autoantibodies , both of which may participate in the pathogenesis of the diseases , any precise insight into immunodistortion present in each patient is lacking . therefore , overall immunosuppression , instead of a specific correction of immunodistortion , has been a common choice in clinical practice . corticosteroids and immunosuppressive agents have been the mainstay of the therapeutic strategy of systemic rheumatic diseases . however , the presence of refractory diseases / patients to such approaches , and various adverse effects such as increased risk of severe infections , limits their efficacy . recent progress in our general understanding of molecular pathophysiology of diseases possibly downstream of the immunodistortion has led us to develop molecular targeted therapies in which the function of the key molecule(s ) of the diseases is manipulated in order to control disease activity . we have then an excellent safety profile in terms of an eventual lack of lethal dosage enabled most of the biologic response modifiers ( biologics ) that can be applied at the dosage with which they sufficiently inhibit the function of the targeted molecule . for example , tumor necrosis factor ( tnf ) inhibitors dramatically improved the outcome of patients with rheumatic diseases such as rheumatoid arthritis ( ra ) and seronegative spondyloarthropathies [ takeuchi , 2005 ] . those agents include a chimeric anti - tnf monoclonal antibody ( infliximab ) , a humanized anti - tnf monoclonal antibody ( adalimumab ) , and a p75 tnf - receptor / igg - fc fusion protein ( etanercept ) . in addition , a chimeric anti - cd20 monoclonal antibody ( rituximab ) , anti - interleukin-6 receptor monoclonal antibody ( tocilizumab ) , and cytotoxic t - lymphocyte antigen 4 ( ctla-4 ; cd152)/igg - fc fusion protein ( abatacept ) have been also successful in ra . on the other hand , low molecular weight chemical agents developed as molecular targeted therapies do have some drawbacks compared to biologics in terms of selectivity and limitations in dosage . nonetheless , their intracellular activity which large - molecular agents such as biologics do not possess , although slightly less selective , is still indispensable in the treatment of diseases in which various cytoplasmic / nuclear molecules play important roles . in diseases refractory to glucocorticoids and conventional immunosuppressants such as cyclophosphamide both of which are chiefly targeted to leukocytes , cells of mesenchymal origin such as fibroblast and vascular cells play a pivotal role . novel molecular targeted therapies should therefore include growth factors participating in the remodeling of mesenchymal tissues . among various growth factors , platelet - derived growth factor ( pdgf ) is an excellent candidate due to its multipotent roles in many rheumatic diseases [ stman and heldin , 2001 ; paniagua and robinson , 2007 ] . it can be interfered with monoclonal antibodies against pdgf or its receptor ( pdgf - r ) . another approach in inhibiting pdgf signaling is the application of tyrosine kinase inhibitors of pdgf - r . in contrast to non - selective tyrosine kinase inhibitors such as genestein , imatinib mesylate ( sti571 ; gleevec or glivec ) has been widely used for the treatment of chronic myeloid leukemia ( cml ) [ druker et al . 2001b ] and gastrointestinal stromal tumors ( gist ) [ demetri et al . 2002 ] . therefore , in order to speculate on the clinical importance of pdgf - targeted therapy in refractory diseases and patients , this review article summarizes the involvement of pdgf in systemic autoimmune diseases , as well as preclinical or clinical results of imatinib or other pdgf - targeted therapies . pdgf is a family of homo- or hetero - dimeric molecules of disulfide - bonded polypeptide chains with a conserved sequence of approximately 100 amino acid residues containing a characteristic motif of 8 cystein residues [ stman and heldin , 2001 ; heldin and westermark , 1999 ; pietras et al . combinations of subunits aa , ab , bb , cc and dd have been identified to date . pdgf is synthesized by many cell types such as platelets , endothelial cells , fibroblasts , macrophages , and vascular smooth muscle cells . the pdgf - rs occur as ( ~170 kda ) and ( ~180 kda ) homodimers or heterodimers . the receptor sequences have 5 immunoglobulin - like domains in their extracellular parts and tyrosine kinase domains intracellularly into which is inserted an interrupting sequence of about 100 amino acids . pdgf - aa binds to pdgf - r , ab and cc to and , bb binds to all 3 combinations of receptors , and dd binds to and [ pietras et al . 2003 ] . the dimerization and activation of receptor tyrosine kinases lead to cellular activation of targeted cells including fibroblasts , smooth muscle cells and mesangial cells . a large number of sh2 domain - containing protein kinases / phosphatases and adaptor proteins , such as phosphatidylinositol 3-kinase ( pi3k ) , phospholipase c ( plc ) , sh2-containing protein tyrosine phosphatase shp-2 , grb2 , nck and shc , link pdgf - r with downstream signaling molecules and lead to upregulated gene expression and proliferation , or transformation ( fig . 1 ) [ stman and heldin , 2001 ; heldin and westermark , 1999 ] . originally , imatinib focused on attempts to inhibit pdgf - r kinase with an ic50 of 0.120.15 m . however , it was soon noted that imatinib effectively inhibited c - abl ( ic50 0.10.3 m ) , bcr - abl ( ic50 0.25 m ) and c - kit ( ic50 < 1 m ) [ carroll et al . 1997 ; druker et al . imatinib was also reported to be well tolerated and have significant antileukemic activity in patients with cml with whom treatment with interferon had failed , as well as those with blast crisis of cml or bcr - abl - positive acute lymphoblastic leukemia [ druker et al . imatinib was later revealed to induce a sustained objective response in more than half of patients with an advanced unresectable or metastatic gist [ demetri et al . imatinib has now been widely approved for the treatment of cml and unresectable and/or metastatic c - kit ( cd117)-positive gist . systemic sclerosis ( ssc ; scleroderma ) is characterized by vascular damage and excessive fibrotic response on the basis of immunologic abnormalities ( immunodistortion ) . the progression of organ damage is usually insidious in ssc , with the exception of scleroderma renal crisis which can be successfully treated with angiotensin - converting enzyme inhibitors . therefore , overall disappointing response to corticosteroids has been attributed to the paucity of involvement of active inflammation , characterized by massive leukocyte infiltration . for this reason , disease - modifying drugs for ssc have not been available to date [ wollheim , 2007 ] . as for vascular damage , inhibitors targeting endothelin receptors , such as bosentan , represent a breakthrough in the treatment of pulmonary arterial hypertension ( pah ) , a complication with one of the worst prognosis in ssc , systemic lupus erythematosus ( sle ) or mixed connective tissue disease ( mctd ) [ denton et al . bosentan may also reduce the fibrotic process via its inhibitory effect on fibroblasts [ braun - moscovici et al . 2004 ] , although these effects have not yet been proven in clinical trials . at the same time , a recent report describing a stimulatory autoantibody against pdgf - r is of great interest in view of the pathogenesis and management of fibrosis in ssc [ baroni et al . although the determination of autoantibodies recognizing nuclear components have been useful in defining clinical subgroup of ssc , antinuclear antibodies ( anas ) have not been shown to be directly pathogenic . in contrast to this , stimulatory anti - pdgf - r antibodies exclusively found in sera from ssc patients were demonstrated to activate pdgf - r and induce the upregulation of the ha - ras - erk1/2 ( external signal regulated kinases 1 and 2 ) cascade . this stimulated the expression of type i collagen gene expression and -smooth muscle actin ( -sma ) [ baroni et al . 2006 ] which resembles the case of anti - thyroid stimulating hormone antibodies developing hyperthyroidism . early in 2007 , distler et al . reported that imatinib reduced basal and pdgf- or tgf--stimulated synthesis of extracellular matrix ( ecm ) proteins such as collagen and fibronectin ; and that a 50150 mg / kg / day intraperitoneal administration of imatinib effectively inhibited dermal thickness , the number of myofibroblasts and synthesis of ecm proteins in bleomycin - induced dermal fibrosis model all without evidence of toxic adverse effects [ distler et al . a significant increase in activated pdgf - r expression in idiopathic pah lungs compared with healthy donor lungs , and successful reversal of pulmonary vascular remodeling , in both monocrotaline - induced rat model and hypoxia - induced mouse model of pah [ schermuly et al . 2005 ] , led to the compassionate treatment of a patient with idiopathic pah with a daily administration of 200 mg of oral imatinib [ ghofrani et al . the patient s condition improved impressively over 3 months in pulmonary vascular resistance ( from 1056 dyn.sec.cm to 815 dyn.sec.cm ) , six - minute walk distance ( from 260 m to 383 m ) , and new york heart association functional class ( from iv to ii ) these reports provide the possibility that imatinib may be a disease - modifying drug for ssc . on the other hand , recombinant human anti - tgf1 antibody ( cat-192 ) showed no evidence of efficacy in a multicenter , randomized , placebo - controlled phase i / ii trial for early - stage diffuse cutaneous ssc [ denton et al . the blockade of multiple isoforms of tgf may be required for an effective inhibition of fibrosis . in this context , the pan - isoform - specific anti - tgf antibody 1d11 could be potentially effective for fibrotic diseases . nonetheless , imatinib has the advantage of inhibiting both pdgf and tgf signaling via pdgf - r and c - abl , respectively . interstitial lung disease ( ild ) in ssc will be discussed in the following section . the lung is one of the vital organs involved most frequently in systemic rheumatic diseases , and the presence of ild is a significant prognostic factor of polymyositis / dermatomyositis ( pm / dm ) , rheumatoid arthritis ( ra ) , systemic vasculitis syndromes and ssc . the clinical courses of patients with ild associated with those diseases can be categorized into 4 groups : 1 ) a / sip with rapid deterioration within a month ( acute ) or within 23 months ( subacute ) ; 2 ) chronic progression of pulmonary fibrosis causing non - productive coughing , breath - shortening upon exertion , and occasionally leading to respiratory failure after more than 6 months ; 3 ) acute or subacute exacerbation of chronic ild that is recurrent in some cases ; and 4 ) asymptomatic ild detected in a milder form by radiographic examination or pulmonary function tests in the absence of clinically apparent signs and symptoms throughout the observation period [ kameda and takeuchi , 2006 ] . the american thoracic society / european respiratory society ( ats / ers ) international multidisciplinary consensus classification is usually used for the classification of idiopathic interstitial pneumonias ( iip ) [ american thoracic society ; european respiratory society 2002 ] . diffuse alveolar damage ( dad ) and organizing pneumonia ( op ) usually develop acutely or subacutely , while non - specific organizing pneumonia ( nsip ) shows a subacute course , and usual interstitial pneumonia ( uip ) represents a chronic form of ild called pulmonary fibrosis . however , whether ild associated with systemic rheumatic diseases resembles iip remains debatable : the histological findings may consist of the overlapping features of two or more patterns , nsip and op , or nsip and uip . moreover , patients having idiopathic uip ( clinically idiopathic pulmonary fibrosis ) show poorer prognosis compared to patients with systemic rheumatic diseases , such as ssc demonstrating uip in lung histology [ bouros et al . nevertheless , patients with ild associated with systemic rheumatic diseases also tend to show a favorable response to corticosteroids when the lung histology reveals op or cellular nsip , while they demonstrate a relatively poor response when the lung histology shows dad or uip ; fibrotic nsip stands for an intermediate response . the addition of a single immunosuppressive agent or the combination of 2 or more improved the mortality and morbidity of rapidly or slowly progressive ild associated with pm / dm or ssc [ white et al . 2005 ] . despite the intensified immunosuppressive strategies , a significant number of ild patients resulted in fatal outcomes . because the pathological examination of ild with poor prognosis , dad and uip , shares an excessive fibrosis , another therapeutic strategy such as anti - fibrotic agents is necessary . pirfenidone , n - acetylcysteine and interferon- have been shown to be potentially effective for the prevention of lung fibrosis [ american thoracic society 2000 ] . at the end of the last century , it was reported that the inhibition of the autophosporylation of pdgf - r by ag1296 effectively prevented v2o5-stimulated proliferation of alveolar epithelial / mesenchymal cells as well as hydroxyproline accumulation [ rice et al . a specific inhibition of epidermal growth factor ( egf ) receptor activation by ag1478 also showed a preventive efficacy , although slightly less compared to ag1296 . another approach using an expression plasmid of the extracellular domain of pdgf - r for bleomycin - treated c57bl/6 mice also ameliorated the increases in the wet weight , hydroxyproline content and the histologic changes in the lung [ yoshida et al . proved that imatinib dramatically reduced hydroxyproline content and prevented histopathologic changes in bleomycin - treated lungs of 129tsvems mice [ daniel et al . they also suggested that the efficacy of imatinib is mediated , in part , by the inhibition of serine / threonine tgf- receptor kinase signaling through c - abl tyrosine kinase . aono et al . also showed that imatinib ( 50 mg / kg ) significantly attenuated bleomycin - induced pulmonary fibrosis in terms of histology and collagen deposition in c57bl/6 mice . interestingly , the early treatment with imatinib ( from day 0 to 14 ) , but not the late treatment ( from day 15 to 28 ) significantly inhibited bleomycin - induced lung fibrosis in that model [ aono et al . however , another bleomycin - induced lung fibrosis model using rats showed that imatinib ( 50 mg / kg ) treatment commenced at day 10 was still effective , while prednisolone was effective exclusively in the preventive model started at day 1 [ chaudhary et al . 20 gy)-induced lung fibrosis model using c57bl/6 mice , treatment with either of 3 pdgf - r inhibitors ( su9518 , su11657 and imatinib ) markedly attenuated the development of pulmonary fibrosis in excellent correlation with clinical , histological , ct results , and life span . in addition , no decline in their efficacy was observed when they were started after thoracic irradiation compared to a prevention schedule [ abdollahi et al . these results may provide a possibility that imatinib could be chosen for the treatment of corticosteroid(/immunosuppresants)-refractory ild . in contrast to the above , a recent report failed to demonstrate the efficacy of imatinib ( 10 mg / kg , intraperitoneal or oral administration ) in the protection against bleomycin - induced pulmonary fibrosis in c57bl/6 mice [ vittal et al . systemic lupus erythematosus ( sle ) is a prototype of systemic autoimmune diseases and its renal involvement has been posing major challenges for physicians . renal accumulation of immune complexes followed by complement activation , and antibody - effector - cell interactions through the fc receptor have been implicated in the pathogenesis of lupus nephritis . high - dose corticosteroids combined with immunosuppressive agents such as cyclophosphamide or mycophenolate mofetil are the mainstay in current strategy for the induction of response in lupus nephritis . some patients however do not respond favorably to the above regimens or show repeated relapses , and ultimately progress to end - stage renal disease . renal expression of pdgf , which is synthesized by mesangial cells , endothelial cells , macrophages , and smooth muscle cells in the kidney , and of pdgf - r was significantly increased in the glomeruli of patients with mesangial proliferative glomerulonephritis ( iga nephropathy , henoch - schnlein purpura nephritis , and lupus nephritis ) compared with normal glomeruli [ matsuda et al . thus , pdgf / pdgf - r axis is considered a novel therapeutic target of lupus nephritis and other forms of glomerulonephritis . indeed , administration of neutralizing anti - pdgf igg [ johnson et al . 1992 ] or oligonucleotide aptamer [ floege et al . 1999 ] , which specifically binds to the pdgf - b chain and inhibits its activity to anti - thy-1 glomerulonephritis rats resulted in a significant reduction in mesangial cell proliferation and largely prevented the increased deposition of ecm . imatinib ( 0.0132.0 m ) inhibited pdgf - stimulated , but not fgf - stimulated , mesangial cell proliferation in a dose - dependent fashion in vitro [ gilbert et al . moreover , the efficacy of imatinib in vivo has been proven in 3 different models of ( lupus ) nephritis . first , pdgf - r tyrosine kinase blockade by imatinib ( 50 mg / kg / day ) was associated with a significant reduction in mesangial cell proliferation , the number of -sma - positive mesangial cells , and glomerular type iv collagen deposition in male wistar rats with anti - thy-1.1 glomerulonephritis [ gilbert et al . second , 50 mg / kg imatinib inhibited proliferation of glomerular cells and crescent formation , and also prolonged the life span of mrl / lpr female mice [ sadanaga et al . intriguingly , attenuation of lymphadenopathy and salivary gland inflammation , as well as reduction in serum anti - double - stranded dna antibodies , was also observed in the imatinib - treated mice . third , ( nzb / w)f1 mice treated with imatinib ( 50 mg / kg b.i.d./day ) showed ameliorated survival , delayed onset of proteinuria , and preserved renal function [ zoja et al . histologic examination provided evidence of reduced glomerular hypercellularity , deposits , tubulointerstitial damage , and accumulation of -sma - positive myofibroblasts . the synovial membrane in patients with ra is characterized by hyperplasia , angiogenesis , and an infiltrate of inflammatory cells including cd4 + t lymphocytes [ choy and panayi , 2001 ] . synovial fibroblast - like ( sfl ) cells from ra patients show transformed characteristics [ firestein and zvaifler , 2002 ; mller - ladner et al . 2000 ; yamanishi and firestein , 2001 ] : altered morphology , anchorage - independent growth [ lafyatis et al . 1989 ] , loss of contact inhibition , oncogene activation [ mller - ladner et al . 1995 ] , monoclonal or oligoclonal expansion [ imamura et al . 1998 ] , cartilage invasion in severe combined immunodeficient mice [ mller - ladner et al . 1996 ] , etc . pdgf - rs are abundantly expressed on the surface of ra - sflcells , and stimulation with pdgf enhances both the anchorage - dependent and -independent growth of ra - sflcells and thus implicate pdgf in the activation and transformation of ra - sflcells [ lafyatis et al . 1989 ; rubin et al . 1998 ; remmers et al . 1991 ; sano et al . indeed , pdgf immunostaining of ra synovia is more extensive and intense than that of osteoarthritis ( oa ) or normal synovia . also , pdgf - r expression is elevated in ra synovia compared with oa and normal synovia [ remmers et al . moreover , pdgf , together with tnf , were identified as the major growth factors of ra - sflcells [ thornton et al . furthermore , thrombin activity in synovial fluid is significantly higher in the patients with ra than with oa , and the mitogenic activity of thrombin toward ra - sflcells is associated with an increase in the expression of mrna of pdgf - rs [ ohba et al . we demonstrated that 1 m of imatinib effectively inhibited the pdgf - stimulated tyrosine - phosphorylation of pdgf - r in ra - sflcells , as well as pdgf - enhanced anchorage - dependent and -independent ra - sflcell proliferation in vitro [ kameda et al . inhibition of pdgf - r signaling by 1 m of imatinib did not induce apoptosis in cultured ra - sflcells [ sandler et al . imatinib ( 33100 mg / kg ) effectively prevented and treated collagen - induced arthritis model of dba/1 mice in terms of synovitis , pannus formation and joint erosion , although preventive administration was more efficacious than therapeutic administration [ paniagua et al . notably , imatinib inhibited mast cell c - kit activation , proinflammatory cytokine production , immunoglobulin production from b cells , and t cell response . however , collagen - induced arthritis in lewis rats were resistant to imatinib treatment : only high - dose ( 150 mg / kg , not 50 mg / kg ) imatinib showed a significant inhibition of osteoclast formation and joint destruction , and failed to reduce paw swelling [ ando et al . 2006 ] . although the downstream signaling pathway from pdgf - r in ra - sflcells has not been clarified , many adaptor proteins are likely to be involved . for example , gab1 and gab2 were expressed in ra - sflcells , and both adaptor proteins were rapidly tyrosine - phosphorylated after the stimulation of ra - sflcells with 10 ng / ml of pdgf [ kameda et al . the fact that the expression of gab1 lacking the pleckstrin homology domain is associated with the enhanced anchorage - independent growth of syrian hamster embryo fibroblasts under growth factor stimulation suggests that similar alteration in signaling proteins might be involved in the acquisition of the transformed phenotype of ra - sflcells [ kameda et al . this is supported by the fact that pdgf stimulation enhanced anchorage - independent growth of ra - sflcells [ kameda et al . recent reports on ra patients successfully treated with imatinib were more encouraging than above in vitro and in vivo results . miyachi et al . reported a case with ra and chronic myeloid leukemia , both of which were successfully treated using imatinib [ miyachi et al . moreover , eklund et al . described three patients with severe ra who were treated for 12 weeks with escalating daily doses ( from 100 to 400 mg ) of imatinib [ eklund and joensuu , 2003 ] . all three patients had failed to respond to prior anti - rheumatic medications , including methotrexate and infliximab . all reported less pain and disease activity , and their health assessment questionnaire scores improved subsequent to the imatinib treatment . therefore , the addition of , or the switching to , imatinib may be beneficial to patients with ra who failed in conventional therapies . besides those described above , pdgf is a fascinating molecular target in various other systemic rheumatic diseases such as spondyloarthropathy and systemic vasculitis . the strategies of pdgf signaling inhibition include antibodies against pdgf or pdgf - r , soluble recombinant fusion proteins of pdgf - r and igg , oligonucleotide aptamer interfering pdgf - r signaling , and inhibitors of pdgf - r tyrosine kinase or downstream signaling molecules . among many candidates , imatinib possesses some advantages in : 1 ) clinical use with well acceptable tolerability ; 2 ) additional inhibition of abl and c - kit , which leads to the suppression of tgf- and mast cell activity , respectively . thus , imatinib is likely to play a multipotent role in the treatment of various systemic rheumatic diseases ( table 1 ) . and indeed , several clinical trials examining the efficacy of imatinib for skin sclerosis , ild and pah are ongoing . to date , the principal of the treatment for systemic rheumatic diseases has been chiefly targeting leukocytes . thus , future therapeutic strategies should focus on other cell types , including fibroblasts , epithelial cells and endothelial cells ( fig . 2 ) . combined therapy of anti - inflammatory and anti - fibrotic agents may shed light on the treatment of refractory diseases described in this review and further improve the long - term survival of patients with systemic rheumatic diseases .	some systemic rheumatic diseases and disorders , especially fibrotic and vascular disorders , are often refractory to corticosteroid therapy . recently , ever accumulating evidence suggests that platelet - derived growth factor ( pdgf ) is involved in those refractory diseases . imatinib mesylate inhibits the activation of pdgf receptor as well as c - abl , bcr - abl and c - kit tyrosine kinases . it has therefore been widely used for the treatment of chronic myeloid leukemia and gastrointestinal stromal tumors . imatinib effectively suppresses the activation and proliferation of fibroblasts , mesangial cells and smooth muscle cells both in vitro and in vivo . additionally , it has recently been reported that some patients with rheumatoid arthritis or idiopathic pulmonary arterial hypertension demonstrated a good clinical response to imatinib therapy . imatinib may therefore overcome the limitations of current therapeutic strategy with corticosteroids and immunosuppressive agents for refractory diseases , such as systemic sclerosis and interstitial lung diseases , without clinical intolerability .
You are an expert at summarizing long articles. Proceed to summarize the following text: atherosclerosis is still the leading cause of death in industrialized countries , and novel therapies to lower low - density lipoprotein cholesterol ( ldl - c ) are urgently needed . additionally , any approach promoting the transport of excess cholesterol from plaque macrophages back to the liver via plasma high - density lipoprotein ( hdl ) for biliary and final fecal excretion is expected to prevent atherosclerosis , a mechanistic concept called reverse cholesterol transport ( rct ) ( cuchel and rader , 2006 ; degoma and rader , 2011 ; rader and daugherty , 2008 ) . it is well known that dietary supplementation with omega-6 polyunsaturated fatty acids ( omega-6 pufas ) including arachidonic acid ( aa ) reduces the risk of cardiovascular disease ( cad ) ( harris et al . , 2009 ; katan , 2009 ) , which is in part attributable to the observation that increased aa plasma levels are associated with beneficial changes in ldl - c and hdl - c . in humans , aa is metabolized into many potent bioactive compounds , such as ( 1 ) prostaglandins ( pgs ) and thromboxanes ( txs ) , ( 2 ) leukotrienes ( lts ) , and ( 3 ) lipoxins ( lxs ) . whereas pgs and txs are formed by cyclooxygenases i and ii ( cox i / ii ) , lts are generated through the action of arachidonate 5-lipoxygenase ( alox5 ) , and lxs an acronym of lipoxygenase interaction product by the sequential cell - cell interaction of different lipoxygenases ( mcmahon and godson , 2004 ; serhan , 2007 ) : lta4 , the intermediate of lt synthesis , is produced in neutrophils via alox5 and can be taken up by platelets and converted into lxs via alox12 . 15s - hydroxyeicosatetraenoic acid ( 15s - hete ) is synthesized in epithelial cells and monocytes via alox15 , which can be further converted into lxs in leukocytes by alox5 . generation of lxs occurs also when 15-hete accumulates in cell membranes of neutrophils , where it is converted into lxs ( mcmahon and godson , 2004 ; serhan , 2007 ) . this generates 15r - hete , which is finally converted into 15-epi - lipoxins via alox5 ( mcmahon and godson , 2004 ; serhan , 2007 ) . to date , the relative pathophysiological roles of lipoxygenases , lts , and lxs have been extensively studied in inflammation where ltb4 exerts proinflammatory actions by promoting the recruitment of leukocytes to the site of insult . this is followed by an increase in anti - inflammatory eicosanoids lxa4 and its regioisomer lxb4 , which mediate resolution of inflammation ( serhan , 2007 ) . one important example of sustained chronic inflammation and failure of its resolution is found in atherosclerosis . it was proposed that any intervention leading to an increase in proresolving lxs may represent a novel therapeutic approach to interrupt the vicious circle of inflammation taking place in the arterial wall ( spite and serhan , 2010 ) . aspirin is a widely used drug for primary and secondary prevention of myocardial infarction , stroke , and unstable angina . by transforming the enzymatic properties of cox ii into that of a lipoxygenase , aspirin was shown to increase the generation of lxs not only in different animal models of chronic inflammation , but also in humans , thereby inhibiting the accumulation of leukocytes at sites of inflammation ( spite and serhan , 2010 ) . intriguingly , evidence from genome - wide association studies ( gwass ) revealed a robust association between single nucleotide polymorphisms ( snps ) of alox5 and of 5-lipoxygenase activating protein ( flap ) with the risk of myocardial infarction , obesity , and stroke ( helgadottir et al . confirmation from independent studies is , however , warranted to fully support the genetic association between alox5 and cad . so far , neither the relative role of different aa - metabolizing enzymes , including lipoxygenases , nor the potential impact of their main metabolites , i.e. , ltb4 and lxs , on cholesterol metabolism has been systematically investigated . here , we elucidate the relative roles of lts and lxs on cholesterol homeostasis by combining data from gwas analysis in humans , mediator lipidomics , and loss - of - function studies in mice . we identify lx mimetics as promising therapeutics to lower plasma ldl - c and to treat atherosclerosis . we first mined published genome - wide association data for signals in and around genes encoding enzymes involved in the metabolism of aa . using the recently published data of 46 gwass on the relevance of novel genetic loci for blood lipids in > 100,000 individuals of european ancestry ( teslovich et al . , 2010 ) , we evaluated whether common variants in the human cyclooxygenases i and ii ( ptgs1 and ptgs2 ) , alox5 , alox12 , and the alox15 gene loci were associated with alterations in plasma cholesterol levels . we found no association of plasma cholesterol levels to variants within or around the ptgs1 , ptgs2 , alox12 , and alox15 genes ( data available upon request ) , whereas robust association signals were observed to variants within the chromosome 10 locus ( 10q11.21 ) containing both the alox5 and march8 genes ( see figure s1 available online ) , which was confirmed in the 2013 glgc data set comprising > 188,000 individuals ( willer et al . , 2013 ) figure 1a shows the signals over the alox5 gene associated with hdl - c , with the ten most significant snps within the gene listed in table s1 . no significant associations with ldl - c were observed at this locus , and signals for total cholesterol seem driven by the hdl - c associations . of note , individuals carrying the common t allele ( allele frequency of 0.65 ) of lead snp rs12765320 within the alox5 gene showed a dose - dependent decrease in plasma hdl - c levels ( es = 0.429 mg dl per copy of t allele ; figure 1b ) . the reported association of rs12765320 with hdl - c in the gwas study was independently replicated in the smaller ludwigshafen risk and cardiovascular health ( luric ) ( winkelmann et al . , 2001 ) cohort comprising 2,095 individuals ( hdl - c 37.23 10.69 mg dl versus 36.32 9.42 mg dl , male homozygous carriers of the cc and the tt alleles , respectively ; p < 0.05 ) . to further support the association between alox5 and hdl - c , a second snp ( rs7068039 ) belonging to the haplotype block ( table s1 ) was genotyped in 2,141 individuals from the plic ( progressione della lesione intimale carotidea ) study ( norata et al . , 2010 ) . homozygous carriers of the common tt allele presented significantly lower levels of hdl - c compared to homozygous cc carriers ( 55.11 14.87 mg dl versus 58.78 13.88 mg dl , respectively ; p < 0.05 ) ( figure 1c ) , thus replicating this association in a second independent cohort . next , we characterized whether the differences in hdl - c levels also translate into alterations of hdl function . therefore , cholesterol efflux capacity of apob- depleted serum from age- and sex - matched tt and cc rs7068039 carriers was measured . homozygous tt allele carriers showed significantly reduced cholesterol efflux capacity compared to cc carriers ( figure 1d ) . in summary , gwas screening in humans helped to identify associations between variants within alox5 not only with hdl - c mass but importantly also with hdl function . from the gwas data it can not be inferred whether the newly identified variants may regulate expression of arachidonate lipoxygenases and whether differential activation of arachidonate lipoxygenases therefore , we performed functional validation studies in mice using a systematic approach : ( 1 ) simultaneous activation of alox5 and alox12/15 , ( 2 ) selective knockout of alox5 , and ( 3 ) knockout of alox12/15 . in contrast to humans , who express at least four isoforms of alox15 , mice do not have separate 12- and 15-arachidonate lipoxygenases , but rather a combined 12/15-lipoxygenase with variable positional specificity for both the 12-position and the 15-position of aa ( khn and odonnell , 2006 ) . in our first in vivo experiments , we simultaneously induced the processing of aa by alox5 and alox12/15 through pharmacological inhibition of cox i / ii , which shifts the biosynthetic pathways of the aa metabolome toward the formation of lxs and lts in murine systems ( figure 2a ) ( brink et al . , 2003 ; serhan , 2007 ; spite and serhan , 2010 ) . inhibition of cox i / ii in mice was achieved by systemic treatment with aspirin ( tancevski et al . , 2006 ) , and in vivo macrophage - to - feces rct studies were performed as described ( tancevski et al . , 2010 ; zhang et al . , 2003 ) : after intraperitoneal injection of [ h]-cholesterol - labeled j774 macrophages , the tracer was measured in plasma and feces ( figure 2b ) . aspirin - treated mice had significantly decreased plasma [ h]-cholesterol levels 24 hr postinjection ( figure 2c ) , which was associated with significantly increased [ h]-sterol levels in feces ( figure 2d ) . these findings suggested that the increase in fecal tracer content has been caused either by enhanced uptake of [ h]-hdl - c into liver and/or by increased biliary transport of sterols . hepatic protein expression of the hdl receptor ( scavenger receptor bi , sr - bi ) and of the ldl receptor ( ldlr ) were unaffected in aspirin - treated mice ( figure s3a ) , making the hypothesis of enhanced cholesterol clearance from plasma rather unlikely . accordingly , plasma total cholesterol levels as well as hdl - c levels were unchanged in aspirin - treated mice ( figures s3b and s3c ) , which was further confirmed by lipoprotein separation analysis via fast protein liquid chromatography ( fplc ) ( figure 2e ) . in the liver , a major part of cholesterol is converted into bile acids ( lefebvre et al . , 2009 ) , which are secreted into bile for eventual removal via feces ( lefebvre et al . , 2009 ; stieger , 2009 ; zollner and trauner , 2009 ) . to better define the type of sterols found to be increased in feces of aspirin - treated mice , a subsequent rct study was performed , and fecal sterols were extracted into neutral and acidic sterols . we found a marked increase in [ h]-acidic sterols , i.e. , bile acids , underlying the observed increase in total counts ( relative content of fecal [ h]-acidic sterols , 78% versus 94% , control versus aspirin - treated mice , p < 0.001 ) . accordingly , in an independent in vivo experiment , cox i / ii inhibition by aspirin was shown to increase the content of fecal bile acid mass per se , as measured by an enzymatic assay ( figure 2f ) . plasma levels of 7-hydroxy-4-cholesten-3-one ( c4 ) , a stable plasma marker of bile acid synthesis ( glman et al . , 2003 ) , were not different between aspirin - treated and control mice ( figure s4 ) . in line with unaffected c4 plasma levels , there was no change in hepatic cyp7a1 mrna expression , the rate - limiting enzyme for conversion of cholesterol into bile acids ( figure 2 g ) . moreover , quantitative real - time pcr with reverse transcription ( qrt - pcr ) analysis revealed no changes in mrna levels of hepatic neutral sterol transporters abcg5 and abcg8 ( figure 2 g ) . immunoblot analysis showed increased abcb11 protein levels in livers of aspirin - treated mice ( figure 2h ) , which constitutes a major determinant of bile flow . on the apical membrane of hepatocytes resides not only abcb11 but also the multidrug resistance - associated protein 2 ( mrp2 or abcc2 ) , capable of promoting bile acid excretion ( zollner and trauner , 2009 ) . abcb11 mediates excretion of monovalent bile acids , whereas divalent bile acids are exported by abcc2 , which is a conjugate export pump and which has also been discussed as an alternative canalicular bile acid export system in mice ( zollner and trauner , 2009 ) . in contrast to abcb11 , abcc2 protein levels were found strongly decreased in livers of aspirin - treated mice ( figure 2i ) . under physiological conditions , abcb11 constitutes the rate - limiting step in bile acid transport from the liver into the bile and subsequently intestine ( figge et al . , 2004 ; stieger , 2009 ; stieger and beuers , 2011 ; zollner and trauner , 2009 ) , and its transgenic overexpression in mice increases bile flow by 30% and fecal bile acid content by more than 40% ( wang et al . , 2010 ) . to firmly establish that cox i / ii inhibition by aspirin increases bile acid excretion , [ c]-glycocholic acid was injected into the tail vein of mice , and after 30 min the tracer was quantified in gall bladders of control and aspirin - treated animals ( wang et al . , 2001 ) . in confirmation of our data , cox i / ii inhibition by aspirin increased the amount of tracer in bile 2-fold ( figure 2j ) . finally , treatment of abcb11 mice with aspirin had no effect on macrophage - to - feces rct ( figures 2k and 2l ) , proving the hypothesis of an abcb11-dependent mechanism . thus , we conclude that cox i / ii inhibition by aspirin promotes fecal excretion of bile acids and thereby the rate of macrophage - to - feces rct in mice by increasing hepatic abcb11 expression . aspirin is one of the most widely used drugs for primary and secondary prevention of cad , prescribed to patients at high cardiovascular risk ( i.e. , diagnosed with cad , diabetics , etc . ) . so far , the atheroprotective effect of aspirin was related to its antithrombotic and anti - inflammatory / proresolving properties ( spite and serhan , 2010 ) . however , the identification of aspirin as a rct - promoting drug also raised the question of whether aspirin could confer regression of established atherosclerosis . for this purpose , we performed a study in male ldlr mice fed a western - type diet for 14 weeks , then switched to normal chow and divided into two groups , one receiving placebo and the other receiving aspirin in the drinking water for another 6 weeks . aspirin treatment led to an 50% reduction in atherosclerotic lesion size , showing that aspirin can lead to the regression of atherosclerosis ( figure 2 m ) . to verify adequate cox i / ii inhibition by aspirin and to analyze changes in intrahepatic levels of lts and lxs , we next performed qrt - pcr analysis of the genes involved in the biogenesis of these lipids followed by mediator lipidomic analysis ( arita , 2012 ; morita et al . , 2013 ) . as shown in figure 3a , and in line with a previous report ( xu et al . , 1999 ) , livers of aspirin - treated c57bl/6 mice had reduced cox2 expression , whereas the expression of arachidonate lipoxygenases was unaffected by aspirin treatment . aspirin is expected to inhibit cox i activity , thereby blocking the formation of prothrombotic txa2 . this was confirmed by lipidomic profiling , as levels of the metabolite of txa2 , namely txb2 , were dramatically reduced in livers of aspirin - treated mice ( figure 3b ) . finally , lipidomic profiling revealed that inhibition of the cox i / ii pathway led to enhanced generation of both lts ( ltb4 ) and lxs ( lxa4 ) in livers of aspirin - treated animals ( figure 3b ) . we thus reasoned that the observed increase in hepatic abcb11 protein expression in mice treated with aspirin may have been conferred by either lts or lxs , or both . using primary murine hepatocytes derived from c57bl/6 mice , we confirmed our in vivo studies by demonstrating that both aspirin and its active metabolite salicylic acid induce abcb11 protein expression . moreover , aspirin and salicylic acid induced sr - bi protein expression , whereas they downregulated the expression of the ldlr in vitro ( figure 4a ) . presently , little one main difference between hepatocytes and other cell types is that hepatocytes do not express alox5 . in this regard , clara s lab showed that kupffer cells , which are of myeloid origin and express high levels of alox5 , are the major source of ltb4 and lxs in rat liver exposed to aspirin ( planagum et al . , 2002 ) . accordingly , when comparing mediator lipidomic profiles of mouse liver and of isolated murine hepatocytes , we found that ( 1 ) in both settings , aspirin dramatically reduced txb2 levels as result of efficient cox i inhibition , ( 2 ) in liver extracts , aspirin treatment increased both lts and lxs , and ( 3 ) in isolated mouse hepatocytes , aspirin treatment increased only lx formation ( figure 4b ) . when analyzing the relative effects of different lx isomers on abcb11 expression , we found that lxa4 , 15-epi - lxa4 , and lxb4 increased abcb11 at 10 nm , with lxb4 showing the strongest induction ( figure 4c ) . dose - titration studies as well as coincubation experiments with ltb4 and lxb4 in primary hepatocytes derived from c57bl/6 mice revealed that both lipid mediators increase abcb11 expression . intriguingly , lxb4 decreased abcb11 protein expression at high dosages . on the other hand , sr - bi and ldlr protein expression was induced mainly by ltb4 ( figures 4d and 4e ) . to further decipher the molecular mechanisms underlying the induction of abcb11 by aspirin the main positive regulator of abcb11 expression is the transcription factor farnesoid x receptor ( fxr ) ( stieger , 2009 ; zollner and trauner , 2009 ) . however , fxr reporter studies ruled out any direct activation of this nuclear receptor by both ltb4 and lxb4 ( figure 4f ) . in line with this finding , lts and lxs neither induced the transcription of abcb11 mrna ( figure 4 g ) , nor did they influence abcb11 mrna degradation ( figure 4h ) . in addition , blocking protein translation by cycloheximide did not abolish abcb11 protein expression induced by eicosanoids , suggesting that neosynthesis of protein was not required and that a direct regulation was taking place at a posttranslational level ( figure 4i ) . abcb11 protein expression is known to be stabilized by the mitogen - activated protein kinase ( mapk ) p38 ( kubitz et al . , 2004 ) , and aspirin , in turn , is known to activate p38 in different cell types , including hepatocytes ( oshima et al . , 2008 ; trujillo - murillo et al . , 2008 ) . as shown in figure 4j , blockage of p38 by the selective inhibitor sb 203580 abolished the induction of abcb11 protein expression by ltb4 and lxb4 . to summarize , lts and lxs increase the expression of abcb11 by a posttranscriptional and posttranslational mechanism , involving the activity of mapk p38 . next , we wondered whether knocking out alox5 would affect hepatic abcb11 expression , cholesterol homeostasis , and rct in mice ( figure 5a ) . as shown in figure 5b , no marked difference in plasma ldl - c and hdl - c between alox5 and alox5 mice was observed , whereas vldl - c levels increased in the knockouts . in macrophage - to - feces rct experiments , alox5 mice showed reduced plasma tracer levels over 48 hr ( figure 5c ) but no significant change in fecal excretion of [ h]-sterols , when compared to alox5 mice ( figure 5d ) . immunoblot analysis revealed an 2-fold induction of hepatic abcb11 and a moderate increase in sr - bi , but no effect on ldlr protein expression ( figure 5e ) . finally , lipidomic profiling of livers from alox5 and alox5 mice showed no changes in lx levels , whereas ltb4 levels were drastically reduced ( figure 5f ) . lack of alox12/15 in alox12/15 mice neither affected plasma cholesterol levels nor influenced macrophage - to - feces rct , when compared to alox12/15 mice ( figures 6a6d ) . accordingly , no change in expression of hepatic abcb11 , ldlr , and sr - bi was observed in alox12/15 mice ( figure 6e ) . mediator lipidomic analysis showed unchanged levels of lxs in livers of alox12/15 mice compared to alox12/15 mice , whereas ltb4 levels were increased in the knockouts ( figure 6f ) . finally , in an approach to translate our combined findings from gwas analysis in humans , mediator lipidomics and functional studies in mice into the identification of novel compounds which beneficially influence plasma cholesterol levels and thus putatively the course of cad , we reasoned to study the impact of systemic treatment with lxb4 on cholesterol metabolism in mice ( figure 7a ) . because lxb4 is unstable and rapidly inactivated within the circulation , we performed daily i.v . injections into mice with synthetic stable analogs of lxb4 including 5-(r / s)-methyl - lxb4 and 8,9-acetylenic - lxb4 , the latter being a log order of magnitude less potent than lxb4 ( maddox et al . , 1998 ) . after 4 days of treatment , 8,9-acetylenic - lxb4 caused a nonsignificant 15% decrease in plasma total cholesterol , whereas 5-(r / s)-methyl - lxb4 significantly reduced plasma cholesterol levels by 30% ( figure 7b ) . fplc analysis showed a decrease in ldl - c in 5-(r / s)-methyl - lxb4-treated mice , whereas hdl - c remained unchanged ( figure s5 ) . accordingly , treatment with 5-(r / s)-methyl - lxb4 was associated with an 3-fold increase in the protein expression of hepatic ldlr and a moderate increase in hepatic protein levels of sr - bi ( figure 7c ) . lipoxygenases are lipid peroxidizing enzymes belonging to the nonheme iron dioxygenases family and are conserved across species including bacteria , algae , plants , fish , amphibia , reptilia , and mammals . in animals , the conventional nomenclature classifies lipoxygenases according to their positional specificity of aa oxygenation ( ivanov et al . , 2010 ) . human arachidonate 5-lipoxygenase thus catalyzes oxidation of aa at the 5-position , leading to the formation of hydroxyeicosatetraenoic acids , which can be further metabolized into lts and lxs through cell - cell interaction well - appreciated players in atherosclerosis and myocardial infarction ( drechsler et al . , 2010 ; dutta et al . , 2012)represent a main source of alox5-derived lipid mediators under pathophysiological conditions such as sustained inflammation in atherosclerosis ( spite and serhan , 2010 ) . thus alox5 is believed to potentially accelerate atherosclerosis by promoting the inflammatory process within the arterial wall through increased synthesis of lts by leukocytes ( peters - golden and henderson , 2007 ) . here , we extend this knowledge by showing that alox5 snps associate with hdl - c mass and function in human plasma . during the last decade , the old paradigm focusing solely on hdl - c levels as predictor of atherosclerosis changed to a more comprehensive , functional view of hdl particles . in this regard , it was shown that one key function of hdl particles , namely cholesterol efflux capacity from macrophages , has a strong inverse association with atherosclerosis that is independent of hdl - c levels ( khera et al . , 2011 ) . simultaneously , macrophage - to - feces rct became a recognized key function of hdl important for regression of atherosclerosis ( cuchel and rader , 2006 ) . rader and others identified a multitude of novel approaches to promote rct , including transgenic overexpression of sr - bi or apo - ai , apo - ai - directed therapeutics , and lxr and ppar activation ( rosenson et al . , 2012 ) . moreover , biliary sterol secretion was recognized to be required for functional macrophage - to - feces rct ( nijstad et al . , 2011 ) . here , we show that aspirin , one of the most widely used drugs for prevention of atherosclerosis , promotes macrophage - to - feces rct by increasing fecal excretion of bile acids . moreover , we found that aspirin induces regression of established atherosclerosis in mice , which may besides its well - known anti - inflammatory and platelet - inhibitory effects be at least in part due to promotion of rct . analysis of bile acid kinetics , together with macrophage - to - feces rct measurement in abcb11 mice , showed that promotion of bile flow is the driving force of rct in mice treated with aspirin . failure of aspirin to increase rct in abcb11 mice is conceivably due to the lack of abcb11 , which , however , can not be definitively ruled out , because there may be other hypothetic compensatory mechanisms . intriguingly , by the help of lipid mediator profiling we found that both alox5-dependent classes of lipids , namely lts and lxs , induce protein expression of abcb11 in a posttranslational fashion , presumably by stabilizing mapk p38-dependent trafficking of abcb11 from the golgi to the cytosol and plasma membrane ( kubitz et al . , 2004 ) . depletion of kupffer cells by injection of mice with clodronate liposomes abrogated the effect of aspirin on hepatic abcb11 expression , indicating that these cells serve as a major source for lt and lx formation in vivo ( figure s6 ) . however , our lipidomic analyses in primary murine hepatocytes and in livers of alox5 mice indicate that in the absence of alox5 other enzymes may compensate the lack of this lipoxygenase . interestingly , this alternative pathway remains aspirin responsive , since treatment of alox5 mice with aspirin led to a further decrease in lt levels ( figure s7 ) , thus indicating the existence of a regulated compensatory mechanism of lt and lx synthesis in liver of mice . in an effort to better understand the relative contributions of the main lipoxygenases involved in lt and lx synthesis to rct in mice studies in mice lacking alox5 or alox12/15 identified alox5 as the lipoxygenase with rct - modifying properties . by combining our mechanistic in vitro experiments with mediator lipidomic profiling , our data suggest that in vivo the balance between lxs and lts modulates the expression of hepatic abcb11 , i.e. , when lx levels exceed lt levels . surprisingly , alox5 mice did not show increased excretion of macrophage - derived sterols , despite reduced plasma [ h]-cholesterol levels . this may be due to lower biliary excretion of neutral sterols via abcg5 and abcg8 and/or increased intestinal absorption of neutral sterols in alox5 mice , a prediction which will require further studies to be clarified . finally , we tested lx mimetics in vivo for the following reasons : first , lx mimetics are stable in circulation and may thus modulate hepatic expression of sterol receptors / transporters in a favorable way ; second , lxs have a proresolving function in atherosclerosis . taken together we found that stable lxb4 analogs strongly induced hepatic expression of ldlr and accordingly reduced plasma cholesterol levels . to better understand how lipoxin mimetics regulate ldlr expression in liver of mice , further studies aimed at investigating the regulation of known ldlr - modifying machineries including hmg - coar- , pcsk9- , and idol - dependent pathways , together with the analysis of cholesterol - modulating mirnas in livers of lx - treated mice , are needed . intriguingly , we found that abcb11 protein levels were reduced in livers of mice treated with lx mimetics . from our lipidomic analyses we learned that in vivo abcb11 can be induced when ( 1 ) both lts and lxs are increased , and when ( 2 ) lxs remain unchanged and lts are reduced , whereas abcb11 expression is unaltered when lxs remain unchanged and lts increase . these data indicate that in the liver lx generation is tightly regulated and that lxs are probably a more important regulator of abcb11 than lts . in fact , our in vitro experiments showed that lxs induce abcb11 only at low concentrations , whereas they decrease its expression when given at higher dosages . we thus conclude that lxs may regulate abcb11 with higher specificity than lts and speculate that exogenously administered lxs could have critically altered lipid mediator homeostasis in the liver , thereby decreasing abcb11 expression . our results support the notion that modulation of the aa metabolome may be used to treat and prevent cad , and may explain how omega-6 pufas influence cholesterol homeostasis . in humans , most pufas in the diet consist of the omega-6 type including linoleic acid which is converted into the metabolically important aa after consumption ( harris et al . , 2009 ; katan , 2009 ) . higher omega-6 pufa levels were shown to improve insulin resistance , to reduce the incidence of diabetes mellitus , and to associate with lower blood pressure . moreover , omega-6 pufas were shown to lower plasma ldl - c and plasma total cholesterol - to - hdl - c ratio ( summarized in harris et al . , 2009 ) . these effects are believed to confer omega-6 pufas and especially aa with atheroprotective properties ( harris et al . , 2009 ; katan , 2009 ) . combined data from randomized trials , case - control and cohort studies , and animal experiments indicate that the consumption of at least 5%10% of energy from omega-6 pufas reduces the cardiovascular risk ( harris et al . , 2009 ) , which recently prompted the american heart association to release a recommendation for dietary supplementation with omega-6 pufas ( harris et al . , 2009 ) . using a systematic , interdisciplinary approach , we were able to elucidate the relative role of key players of the aa metabolism in whole - body cholesterol homeostasis in humans and in mice . to summarize , we show that pharmacological and genetic modulation of the aa metabolome affects one major function of hdl , namely rct . moreover , we show that the aa metabolome is a conserved regulator of hdl - c in humans and in mice , and identify lx mimetics ( maddox et al . , however , it is appropriate to issue certain caveats when trying to extrapolate mouse data to humans , since mouse models have limitations for the following reasons : mice have a different lipoprotein profile when compared to humans , with hdl being the major lipoprotein fraction in plasma ; they do not express cholesteryl ester transfer protein in plasma ; and they do not develop atherosclerosis when fed a high - cholesterol diet . although we can not directly extrapolate our data on abcb11 , sr - bi , and ldlr to human cholesterol metabolism , we definitively show that the aa metabolome plays a physiological role in whole - body cholesterol homeostasis and hdl function in mammals , paving the way for the development of novel lipid - lowering drugs based on the structure of aa metabolites and offering a novel therapeutic strategy to counteract cad in humans . genome - wide association data with hdl - c , ldl - c , and total cholesterol was generated by the global lipids genetics consortium ( glgc ) as previously described ( teslovich et al . , 2010 ) : http://www.sph.umich.edu / csg / abecasis / public / lipids2010/. the glgc 2013 data set was recently published ( willer et al . , 2013 ) : http://www.sph.umich.edu / csg / abecasis / public / lipids2013/. plots used in figures 1 , s1 , and s2 were generated using locuszoom ( pruim et al . , 2010 ) . all animals were handled in strict accordance with good animal practice as defined by the austrian authorities , and all animal work was approved by the austrian animal care and use committee ( bundesministerium fr wissenschaft und forschung mice were fed a standard chow diet ( ssniff ) . to induce cox i / ii inhibition , mice were treated with drinking water containing aspirin for 7 days , as described previously by our laboratory ( tancevski et al . , 2006 ) . on a body - scale - adjusted scale , the amount of aspirin would be equal to 360 mg per day if the animals weighed 60 kg ( 6 mg kg per day ) ( tancevski et al . , 2006 ) . lc - ms / ms - based lipidomic analyses were performed using a high - performance liquid chromatography ( hplc ) system ( waters uplc ) with a linear ion trap quadrupole mass spectrometer ( qtrap5500 ; ab sciex ) equipped with an acquity uplc beh c18 column ( waters ) as described ( arita , 2012 ; morita et al . , 2013 ) . ms / ms analyses were conducted in negative ion mode , and fatty acid metabolites were identified and quantified by multiple reaction monitoring ( mrm ) . different tissue isolation procedures and/or different age or body weight of mice could cause differences in the basal levels of aa metabolites . thus , lipid mediator levels shown in figures 3b , 5f , 6f , and s7 can not be directly compared . we determined significance by unpaired two - tailed student s t test , or by one - way anova when more than two groups were compared .	summarycholesterol metabolism is closely interrelated with cardiovascular disease in humans . dietary supplementation with omega-6 polyunsaturated fatty acids including arachidonic acid ( aa ) was shown to favorably affect plasma ldl - c and hdl - c . however , the underlying mechanisms are poorly understood . by combining data from a gwas screening in > 100,000 individuals of european ancestry , mediator lipidomics , and functional validation studies in mice , we identify the aa metabolome as an important regulator of cholesterol homeostasis . pharmacological modulation of aa metabolism by aspirin induced hepatic generation of leukotrienes ( lts ) and lipoxins ( lxs ) , thereby increasing hepatic expression of the bile salt export pump abcb11 . induction of abcb11 translated in enhanced reverse cholesterol transport , one key function of hdl . further characterization of the bioactive aa - derivatives identified lx mimetics to lower plasma ldl - c . our results define the aa metabolome as conserved regulator of cholesterol metabolism , and identify aa derivatives as promising therapeutics to treat cardiovascular disease in humans .
You are an expert at summarizing long articles. Proceed to summarize the following text: chronic obstructive pulmonary disease ( copd ) is a term that encompasses both chronic bronchitis and emphysema . since both of these diseases often coexist , many health care professionals prefer the term copd.1 although some patients may have components of both copd and another obstructive airway disease , asthma , this review concerns only copd . because of the significant worldwide burden of disease and economic implications , evidence - based guidelines , the global initiative for chronic obstructive lung disease ( gold ) , were launched more than a decade ago with frequent updates.2 while more than 12 million americans are known to have copd , up to 24 million have evidence of impaired lung function and may have the disease but have not been diagnosed.1 the primary risk factor for copd is smoking . additional risk factors include exposure to second - hand smoke , occupational dusts and chemicals , air pollution , heredity , a history of childhood respiratory infections , and socioeconomic status.1 copd has a major negative impact on quality of life including imposing limitations on the ability to work , normal physical exertion , household chores , social and family activities , and sleeping patterns.1 in addition to these problems with daily life , there is obviously much suffering associated with emergency department visits and hospitalizations caused by copd exacerbations . the objective of this article is to summarize the economic and clinical burdens of copd in the usa for the general clinician . discussion of the burden of this disease refers to the impact of copd measured by financial cost , morbidity , and mortality . additionally , the natural history of copd will be briefly reviewed as well as the cost of this disease and its treatment . evidence - based diagnosis and management will be discussed including future directions for copd therapy . copd is usually a progressive disease . chronic cough and sputum are most common in some patients , but dyspnea associated with effort is the predominate feature in others . although certain patients have a slowly progressive reduction in pulmonary function , others experience a rapid decline . a small degree of reversible airway obstruction may be detected in some copd patients , but in most the airway obstruction is close to irreversible.3 while there is no cure for copd , progression of the disease may be slowed by smoking cessation and avoiding exposure to other noxious agents.2,4 furthermore , optimal management is proven to reduce exacerbations and enhance quality of life . the natural history and time course of the onset of copd exacerbations exacerbations of copd are defined as an acute event characterized by worsening respiratory symptoms , beyond normal day - to - day variations , which require a change in medication.2 in ambulatory patients with stable copd , predictors for two or more exacerbations annually include older age , chronic mucus hypersecretion , and decreased forced expiratory volume in the first second of expiration ( fev1).5 aaron et al6 found that copd exacerbations exhibit two distinct patterns : gradual and sudden onset . exacerbations with sudden onset are associated with increased respiratory symptoms but reduced exacerbation recovery times . hospitalization for copd exacerbations increases the risk of subsequent mortality regardless of baseline pulmonary function.7 patients with comorbidities such as diabetes and coronary artery disease are more likely to be hospitalized for exacerbations of copd.6 copd is rarely seen in isolation but rather is often managed with comorbidities including heart failure , lung cancer , diabetes , hypertension , and dyslipidemia.8 systemic inflammation likely plays a key role in the development of these concomitant disease states , and elevated biomarkers such as c - reactive protein are associated with an increased risk of comorbidities.9 end - stage copd is characterized by progressively worsening dyspnea during activities of daily living , and finally even at rest.3 additional symptoms , including cough , difficulty in expectoration , loss of energy , weakness , weight loss , and insomnia , are frequently seen . hospital admissions become more common , and patients spend the remaining months of their lives at home , or with hospice care , slowly losing their independence.3 among end - stage copd patients , factors such as current smoking , comorbidities , low body mass index , and hypoxemia are predictors of survival.3,10 given the prevalence of copd in the usa , it is imperative to understand the economic impact a disease of this significance can have . as can be imagined , this debilitating and chronic disease carries a significant and substantial economic burden on individuals and society . unfortunately , this burden is only going to worsen . according to murray and lopez , the 30-year projections for copd are staggering . presently , copd is already the third most common cause of death in the usa , and is expected to match this mark worldwide by the year 2020.11 morbidity data follows this same trend . multiple factors are responsible for this continued growth including continued tobacco use and dependence combined with the overall increase in life expectancy ( allowing individuals to have a greater likelihood of exposure to copd risk factors).2,12 as with all chronic diseases , the associated economic burden is felt in the form of both direct and indirect costs . in 2010 , the cost of copd in the usa was projected to be approximately $ 49.9 billion , which includes $ 20 billion in indirect costs and $ 30 billion in direct health care expenditures.1 with a currently estimated prevalence of over $ 4000 per patient per year could be projected . these costs can be expected to continue to rise as more patients with evidence of lung function impairment are diagnosed through recent advances in copd screening initiatives . these figures stem from the disabling effects of copd , which are most commonly exhibited as days off from work.12 physical exertion and sleeping patterns are effectively reduced in 70% and 50% of copd patients , respectively . in addition , half of all copd patients ( 51% ) state that their disease hinders their ability to work.1 thornton snider et al13 conducted an economic evaluation of the association between the diagnosis of copd in americans more than 50 years old with employment status and the collection of disability benefits . these researchers found that when patients have copd , there is a 9 percentage point reduction in the likelihood of being employed , along with a 4 percentage point increase in the probability of collecting social security disability insurance . these figures rival similar data for patients who have experienced a stroke and exceed all other estimates for major chronic health conditions in the usa including cancer , diabetes , heart disease , and hypertension.13 while the comparative indirect economic burden of copd is noticeably substantial , indirect costs represent only the minority of total dollars spent on the care of copd patients in the usa . direct health care costs , accounting for nearly two - thirds of total copd dollars , are those related to the detection , treatment , prevention , and rehabilitation of a disease , which include : physician office visits , hospitalizations , home care , and medications.12 as would be expected , there is a direct relationship between the severity of copd and the overall cost of care at the patient level.2,12 data indicate that with each progressive stage of copd , as defined in a previous gold guideline , patients with stage i copd experienced the lowest direct cost of $ 1681 per patient per year , stage ii patients $ 5037 per patient per year , and those in stage iii had the highest cost of $ 10,812 per patient per year.14 hospitalization was identified as the most important cost variable across all three stages of copd . the hospital stay accounts for roughly 45%50% of the total direct cost generated by copd patients.14,15 table 1 describes the median ( due to non - normally distributed data ) annual costs of copd treatment . there is undoubtedly a strong association between copd exacerbations and hospitalization . in a small study evaluating 127 patients , 77% of copd patients experienced an exacerbation during one year.16 the mean cost for a copd exacerbation with hospital admission was estimated to be $ 7100.17,18 in 2006 , an estimated 672,000 hospital discharges for copd were reported.1 thus the direct economic impact from exacerbations of copd is alarming and remains on the rise . although the length of stay for a copd - related hospitalization has decreased over the past 10 years , the number of admissions to the hospital has remained the same since 1999.19 with the findings of the medicare payment advisory commission and the implementation of the patient protection and affordable care act 2010 , seven conditions or procedures , including copd , have gained significant attention given their high rates of hospital admission and readmission.20 an evaluation of fee - for - service medicare beneficiaries who were admitted to the hospital for copd in 20032004 found that 22.6% of these patients were readmitted within 30 days of their index hospitalization.21 more recently , the us department of health and human services agency for healthcare research and quality published a statistical brief evaluating over 190,000 index hospitalizations across 15 states.18 of these hospitalizations , 7.1% had a 30-day readmission for a principal diagnosis of copd ; however , all - cause 30-day readmissions affected 20.5% of these patients . an increase in cost with each readmission , ranging from $ 8400 to $ 11,100 based on principal diagnosis and all - cause copd readmissions , respectively , was also demonstrated . african americans and patients in low income areas were readmitted at rates higher than the average.18 although copd is not currently included in the active affordable care act core measures , the policy expands in 2015 to include copd.20 unfortunately , with increasing age and disease severity , exacerbations only become more frequent and severe.20 these reports emphasize the need to further optimize copd diagnosis and management . reducing exacerbations will not only improve quality of life and slow the progression of disease , but also has the potential to significantly reduce direct health care expenditures . currently , patients are diagnosed with copd following a multifactorial assessment that includes clinical presentation , symptomatology , and risk factors in combination with the gold - standard of spirometry . hallmark symptoms of copd include sputum production , cough , and progressive dyspnea . all patients with suspected copd a pertinent and thorough medical history and physical examination are both essential elements for clinical assessment in a patient with suspected copd . in addition , differential diagnosis should be assessed to ensure that an appropriate diagnosis is made.2,23 misdiagnosis and under - diagnosis continues to be a focal problem in the management of copd.24 while clinicians agree that spirometry is essential for copd diagnosis , assessments are often omitted in the primary care setting due to various limiting factors.25 barriers to appropriate spirometry evaluation include lack of time for assessment , lack of available resources , and inadequate training of personnel for accurate measurement . sufficient training for primary care clinicians26 and enhanced population screening initiatives for high - risk patients24,27 may increase frequency , accuracy , and confidence in spirometry screening practices . in particular , differentiation between asthma and copd can be difficult for clinicians due to substantial overlap in disease presentation and symptoms . a recent study indicates that a spirometry diagnosis of copd could be made in approximately 17% of patients previously diagnosed with asthma alone.28 furthermore , patients with copd can exhibit some respiratory function reversibility , mimicking patients with an asthma diagnosis . indeed the possibility of both disorders coexisting is likely more common than expected and can influence management strategies.27 clinicians should place importance on a thorough medical history and utilize guidance from international guideline resources to ensure proper classification of these patients.2 due to the aforementioned challenges of diagnosis , various analyses report diagnosis primarily in later stages of the disease . patients who fall into these later stages of copd before diagnosis classically exhibit less response to treatment modalities . in addition , while pulmonary function decline is slower in earlier stages of copd , it becomes more rapid in more advanced disease.30 in short , advances resulting in earlier diagnosis can significantly influence the clinical course of copd management and the natural history of disease progression . as well as enhancing the frequency and efficiency of spirometry screening , these tools attempt to simplify identification of copd in the general population by providing a straightforward means for individuals to discuss their respiratory symptoms with a clinician . the self - scored copd population screener questionnaire ( copd - ps ) is one such tool that attempts to encompass a broad group of individuals for screening regardless of smoking history , previous diagnosis , or other clinical information.31 a score from questionnaires such as the copd - ps is used by clinicians to determine whether or not supplementary assessment of potential copd diagnosis is necessary . because the positive predictive value of the copd - ps is not sufficient for accurate diagnosis alone ( approximately 57% ) , it is important to note that this tool is meant specifically for identification purposes rather than to be used as an exclusive diagnostic test.31 although further validation and fine tuning of population screening questionnaires such as the copd - ps are necessary , these tools will likely play a more substantial role in the early identification of copd in the future . a key future component of effective copd disease management includes an appropriate assessment of disease severity through symptom evaluation to guide therapy . although spirometry is essential for diagnosis , its role seems to be less well defined in regard to ongoing disease state management . while some sources still promote spirometry use in bronchodilator reversibility testing , this test is no longer recommended due to lack of efficacy as a tool to predict treatment response.2 various assessment tools have been established to better assess copd disease progress and severity . the modified british medical research council ( mmrc ) questionnaire32 and the copd assessment test ( cat ) provide a standardized means of copd - related health status assessment ( figure 1 ) . these tools present a format for assessing the impact of copd on quality of life indicators to help guide clinicians to properly select appropriate , guideline - recommended treatment strategies.2 while the mmrc only evaluates the impact of shortness of breath , the cat includes assessments of copd impact on activities of daily living . a recent randomized controlled study indicates that the cat is a disease - specific instrument that significantly improves the assessment of copd severity of illness.33 these assessment tests are now recommended as a standard means of assessment during patient follow - up visits2 and are used in combination with spirometry and assessment of exacerbation risk to guide therapy . pulmonary imaging has become an area of interest that may play a more significant role in copd assessment and care in the future . quantitative pulmonary imaging can provide greater insight into lung structure and function in comparison with spirometry which can only assess disease severity.31 computed tomography ( ct ) can provide detailed images of lung structure while magnetic resonance imaging ( mri ) can help assess lung function including lung parenchyma function and airway thickening . significant weaknesses of these imaging studies include the need for both ct and mri studies for appropriate lung assessment , availability , and cost.34 although ct is fast and provides high - resolution images , regular ct scans can promote harmful cumulative radiation.35 while these imaging modalities can help clinicians assess patients further , they carry with them both disadvantages and risks while their true role in copd care remains to be established . it must be the first step in modifying the clinical course of copd and reducing the rate of decline in lung function.3638 for this reason , a focus on smoking cessation interventions is likely the principal and most influential factor in copd management . although the most important strategy , smoking cessation may prove especially challenging in these patients , and should be approached utilizing both behavioral and pharmacological therapy when appropriate.39 various first line pharmacotherapy options for tobacco dependence , are available , including varenicline , bupropion sr , and nicotine replacement therapies;2 treatment selection should be patient - specific , focusing on particular patient characteristics , preference , and contraindications.40,41 a comprehensive and multilevel approach to smoking cessation including both patient counseling and support along with pharmacotherapy is optimal,41 and this approach has been shown to provide the best benefit for long term quit rates.36 although controversial due to low quality evidence , long - term oxygen therapy has been shown to decrease mortality in patients with severe resting hypoxemia.2,23 likewise , it is currently a common non - pharmacologic therapy recommendation in this patient population in the hope of also improving functional performance and health - related quality of life.2,23 however , the same benefit has not been found in patients with mild to moderate hypoxemia . despite the need for additional studies to illustrate the benefits of long - term oxygen therapy , ethical constraints of withholding oxygen therapy will likely be a limiting factor in future prospective studies.42 the anti - inflammatory and immunomodulatory effects of macrolide antibiotics as described in the literature,43 along with increased rates of early clinical response with their use , have increased their use in patients with acute infectious copd exacerbations.44 these desirable effects have led to the investigation of macrolides for a potential role in the prevention of acute copd exacerbations . modest improvements in time to acute exacerbations , frequency of exacerbations , quality of life,45 and also number of moderate to severe exacerbations46 have all been reported with the use of macrolide prophylaxis in patients with copd . as described previously , any reduction in acute exacerbations has the potential to translate into significant economic savings . however , it is important to note that none of these studies have indicated a mortality benefit , and significant adverse effects and collateral damage from year - long use of macrolide therapy should be seriously considered . recently , the us food and drug administration issued a drug safety communication on the widespread use of azithromycin , and the risk of potentially fatal heart arrhythmias.47 ototoxicity and the potential for drug drug interactions should also be considered with long - term macrolide therapy . perhaps of even greater concern , the spread of antibiotic resistant isolates poses a threat to both macrolides and various other antimicrobials that exhibit similar mechanisms of action , and are thus affected by similar resistance gene mutations.45 for these reasons , antibiotic prophylaxis is not endorsed by current guidelines.2 the primary goal of chronic copd management is stabilization of chronic disease and prevention of exacerbations . exacerbations not only incur significant morbidity and mortality , but also negatively impact the natural history of the disease causing a progression in disease severity.29 while current available pharmacologic therapy for copd does not prevent progression of the disease , it does offer symptom relief and prevention of exacerbations . some direction is given on the appropriate order of agent initiation , but much is left to clinical judgment.2,23 bronchodilators are the mainstay of copd management.2,23 initial treatment for patients with few symptoms and low exacerbation risk consists of a short - acting bronchodilator , either short - acting beta2-agonist ( saba ) or short - acting muscarinic antagonist ( sama ) used as needed for breathlessness . other options include a combination of saba and sama or a long - acting bronchodilator ; however , data for the combination of short - acting agents are limited49,50 and evidence for long - acting agents is focused on patients with more severe disease.51,52 progression of symptoms , and possible decline in fev1 , warrant the use of long - acting bronchodilators over short - acting agents . selecting either a long - acting beta2-agonist ( laba ) or long - acting muscarinic antagonist ( lama ) should be based on patient response , some evidence suggests benefit of selecting tiotropium as the initial agent over a laba,5356 but data are limited . a recent review found equivocal evidence when comparing tiotropium to labas for copd outcomes including quality of life , exacerbations , and mortality.57 consideration must also be given to dosing schedule and inhalation device when selecting therapy . indacaterol is currently the only laba available that is dosed once daily , compared with formoterol and salmeterol which are dosed twice daily . patients with severe symptoms that persist despite treatment with a single long - acting bronchodilator can be considered for combination bronchodilator therapy . studies evaluating the combination of tiotropium and labas have shown improvement in lung function and dyspnea compared with either agent alone.5860 at present , no means are available to deliver these agents together in one device . a number of fixed - dose combinations containing ultra - labas and lamas given once daily are in development for the treatment of copd . indacaterol / glycopyrronium , vilanterol / umeclidinium , and olodaterol / tiotropium bromide are all in clinical trials under investigation for once daily dosing . these agents would offer an option to patients who need combination therapy to control their symptoms , without increasing the burden of additional devices and the need for more than once daily dosing . unfortunately , diminishing the number of delivery devices does not necessarily correlate to diminishing price , and therefore may not be the ideal option for all patients . theophylline may be considered as an option if inhaled bronchodilator therapy is unavailable or unaffordable , but it is less effective and less well tolerated than inhaled bronchodilators.61 for patients with frequent exacerbations with or without consistent symptoms , inhaled corticosteroids should be considered . this treatment is in addition to a laba or lama and may even consist of evidence supports the use of the combination laba / ics over laba alone in patients with severe airflow limitation or frequent exacerbations.6266 however , data comparing laba / ics to tiotropium are limited67 although both have been shown to reduce exacerbations individually.51,6265,68,69 medications shown to reduce exacerbations in copd are described in table 3 . current laba / ics combinations , including salmeterol / fluticasone , formoterol / mometasone , and formoterol / budesonide , require twice daily administration . in addition to other twice daily dosed formulations , combinations of ultra - labas and ics such as indacaterol / mometasone and vilanterol / fluticasone , dosed once - daily are currently being investigated . frequent exacerbations of copd and unrelenting symptoms despite lama or laba / ics therapy may require consideration for progression to either triple therapy with lama and laba / ics or addition of a phosphodiesterase-4 inhibitor . improvement in lung function has been consistently reported with triple therapy compared with lama or laba / ics alone;7072 however , data on reduction in exacerbations have varied.70,72 roflumilast , a phosphodiesterase-4 inhibitor , may be added if the patient has symptoms of chronic bronchitis and frequent exacerbations despite bronchodilator therapy . despite less clear data in patients on ics , roflumilast has been shown to be effective in reducing exacerbations in patients treated with long - acting bronchodilators.73,74 in addition to a variety of novel ultra - labas , lamas and combination bronchodilator and ics therapies , other bronchodilators with a variety of mechanisms are also being considered for expanding therapeutic options for the treatment of copd . prostaglandin e receptor 4 ( ep4 ) , bitter taste receptors ( tas2rs ) of the tongue , and inhaled dual phosphodiesterase-3/phosphodiesterase-4 inhibitors are being evaluated as drug targets for copd.75 in addition , agents targeting cd8 + t cells , and inhibitors of nf - kb , chemokine - receptors 2 and 3 , t - helper-17 cells and map kinase p38 are also being investigated for their role in managing chronic copd.76 finally , the role of vitamin d supplementation on the disease course is also being evaluated in randomized trials . with over 50 new medications in the pipeline for the treatment of copd , optimal management will continue to evolve and grow more complex with balancing benefits of therapy with the limitations and needs of each patient . in addition to pharmacologic therapies , a few non - pharmacologic therapies may also be considered for the treatment of copd . pulmonary rehabilitation is recommended to reduce dyspnea , improve health - related quality of life , and reduce hospital days and other measures of health - care utilization.77 current guidelines recommend a program of at least 6 weeks duration that includes exercise training , smoking cessation , nutrition counseling , and education.2 pulmonary rehabilitation has been recognized as cost - effective in the treatment of copd , irrespective of its undetermined effect on mortality.77 patients who experience shortness of breath when walking at their own pace on level ground should be offered pulmonary rehabilitation.2 various surgical interventions are available for consideration in the management of medically refractory , advanced stage copd . lung volume reduction surgery involves an excision of emphysematous lung tissue to decrease lung volume and reduce hyperinflation.75 bullectomy can be considered for excision when air - filled pockets ( bullae ) are present in the lung affecting surrounding lung tissue . lung transplantation is an additional alternative surgical option which can completely replace malfunctioning lung , but typically a waiting period is required , it is a more invasive surgical procedure , and transplantation carries serious risks such as organ rejection and the need for lifelong immunosuppressive therapy.2 careful patient assessment and selection should include a comprehensive risk benefit assessment before consideration of surgical palliation.79 copd is a complex , multifactorial , and progressive disease associated with significant morbidity and mortality in the usa . the rising economic burden of copd correlates with increases in disease severity , and hospital admissions and readmissions account for a significant bulk of cost across all stages of copd . early , appropriate behavioral and pharmacotherapy options to reduce copd exacerbations are essential for slowing disease progression , increasing patient quality of life , and subsequently reducing the overall cost burden of this disease state . despite the known clinical and economic devastation this disease causes , a great deal remains unknown about optimal therapy . specifically , more conclusive evidence is needed concerning ideal therapy selection and appropriate sequencing of therapy . additionally , the role of screening tools in facilitating early diagnosis of copd and the impact of early treatment on cost and patient outcomes need further delineation . fortunately , a renewed interest in identifying new drug targets and novel pharmacotherapy for the management of copd is being observed . it is imperative that the role these new agents play in the management of this disease is clearly elucidated . the anticipated high cost of these new therapies will ultimately have to be balanced with their overall benefit in disease state management and the specific medical and financial needs of the individual patient .	chronic obstructive pulmonary disease ( copd ) is the third most common cause of death in the usa . in 2010 , the cost of copd in the usa was projected to be approximately us$50 billion , which includes $ 20 billion in indirect costs and $ 30 billion in direct health care expenditures . these costs can be expected to continue to rise with this progressive disease . costs increase with increasing severity of disease , and hospital stays account for the majority of these costs . patients are diagnosed with copd following a multifactorial assessment that includes spirometry , clinical presentation , symptomatology , and risk factors . smoking cessation interventions are the most influential factor in copd management . the primary goal of chronic copd management is stabilization of chronic disease and prevention of acute exacerbations . bronchodilators are the mainstay of copd therapy . patients with few symptoms and low exacerbation risk should be treated with a short - acting bronchodilator as needed for breathlessness . progression of symptoms , as well as possible decline in forced expiratory volume in the first second of expiration ( fev1 ) , warrant the use of long - acting bronchodilators . for patients with frequent exacerbations with or without consistent symptoms , inhaled corticosteroids should be considered in addition to a long - acting beta2-agonist ( laba ) or long - acting muscarinic antagonist ( lama ) and may even consist of triple therapy with all three agents with more severe disease . phosphodiesterase-4 inhibitors may be an option in patients with frequent exacerbations and symptoms of chronic bronchitis . in addition to a variety of novel ultra - labas , lamas and combination bronchodilator and inhaled corticosteroid ( ics ) therapies , other bronchodilators with a variety of mechanisms are also being considered , to expand therapeutic options for the treatment of copd . with more than 50 new medications in the pipeline for the treatment of copd , optimal management will continue to evolve and grow more complex as benefits of therapy are balanced with the limitations and needs of each patient .
You are an expert at summarizing long articles. Proceed to summarize the following text: metallosis occurs when periprosthetic soft tissues , synovium , and/or bone is infiltrated by metallic debris secondary to metal - on - metal wear . this debris can cause a chronic inflammatory reaction leading to joint instability , pain , and swelling , and may cause osteolysis , implant looseningand ultimately implant failure . an 81 year old female , with a history of primary left total knee arthroplasty , presented with a 6 month history of left knee pain , swelling , and limited range of motion following a fall . radiographs and joint aspiration were performed , with results that showed no evidence of periprosthetic trauma or infection but were suspicious for chronic metallosis . the patient underwent revision total knee replacement of the left knee which revealed extensive necrotic black metal debris throughout the joint space . this case is a rare example of chronic metallosis presenting 26 years following total knee replacement . treatment with revision total knee replacement is the consensus management choice to avoid further destruction of the bone and joint capsule that can occur with metal - induced inflammation . metallosis occurs when periprosthetic soft tissues , synovium , and/or bone is infiltrated by metallic debris secondary to metal- on - metal wear . this debris can cause a chronic inflammatory reaction leading to joint instability , pain , and swelling , and may cause osteolysis , implant loosening and ultimately implant failure . metallosis is well documented in the total hip arthroplasty literature , mainly from the use of metal heads and liners . however , this condition is much less common following primary total knee arthroplasty ( tka ) . the tka literature is limited to mainly case reports and series with patients generally presenting with chronic symptoms between 5 to 10 years out from the primary procedure [ 1 - 8 ] . evaluation to rule out aseptic loosening , implant failure , trauma , and most importantly infection is performed with radiographs , bloodwork , and joint aspiration . radiography is the most effective non - invasive method to diagnosis metallosis , with three radiographic signs bubble , cloud and metal - line signs - cited in the literature [ 1 - 8 ] . furthermore , serological tests and arthrocentesis need to be performed to rule out an infectious etiology . in general , persistent chronic elevations of erythrocyte sedimentation rate ( esr ) and c - reactive protein ( crp ) following tka are suspicious for an infected implant . regarding synovial fluid leukocyte count and differential , results that might point us to consider infection include : > 1100 wbc / ml with a neutrophil ( pmn ) percentage > 64% ( 8 8% and 94% specificity , respectively ) [ 10 - 11 ] . if both the synovial fluid leukocyte count and differential are below these numbers , infection is highly unlikely with a negative predictive value of nearly 99% . as such , in the presence of radiographic signs of metallosis and absence of infectious markers , a diagnosis of metallosis can be made with relative accuracy [ 4 , 5 , 7 , 8 ] . when described in total knee replacement , most cases of metallosis are secondary to a metal - backed patellar implant grinding on the femoral component . here we describe a case report of severe metallosis occurring in an 81 year old patient , and detail the diagnostic , treatment , and postoperative protocols used for her management . an 81-year - old female presented with 6 months of left knee pain , instability and swelling after a ground - level fall . the patient had a history of primary left total knee arthroplasty to treat rheumatoid arthritis performed in 1988 . the patient reported severe pain with weight - bearing and knee flexion , and had been taking anti - inflammatory medication as needed , and has been using a cane for ambulation . the patient had a slight joint effusion and passive range of motion from 5 degrees to 100 degrees . the knee was unstable on varus and valgus testing , in extension , mid flexion , and 90 degrees of flexion . there was slight joint line tenderness medially and laterally as well as palpable crepitus and grinding when ranging the knee . knee radiographs revealed amorphous densities in the posterior capsule and the suprapatellar recess consistent with the cloud sign ( fig 1a ) and curved radiodensities around the distal femur and joint capsule both medially and laterally , consistent with the bubble sign there was severe osteolysis with loosening of both the femoral implant and tibial base plate . a knee arthrocentesis was done in clinic , with significant amounts of black - tinged fluid aspirated ( fig 2 ) . infection was ruled out with joint fluid analysis resulting in a wbc count of 406 and pmn % of 6 . given the severe pain , evidence of implant aseptic loosening and high clinical suspicion for metallosis , the recommendation was made for the patient to undergo left revision total knee arthroplasty . a ) lateral radiograph of the left knee showing severe osteolysis beneath the tibial component ( white arrowhead ) and amorphous curved densities , known as cloud sign ( white arrows ) . b ) postero - anterior radiograph of the left knee showing semicircular radio densities representing metal deposition outlining the synovium and joint capsule , known as bubble sign ( black arrows ) arthrocentesis of the joint pre - operatively yielded a black - tinged fluid suspicious for metallosis . during the operation , there was extensive necrotic black material overlying the entire knee joint after arthrotomy ( fig 3a ) . a complete synovectomy was performed at the medial and lateral gutters and suprapatellar and infrapatellar regions to remove metallic debris ( fig 3b ) . the tibial polyethylene liner was found to be severely worn but it was not fractured or worn through at any area . the femoral component had evidence of aseptic loosening as well as severe distal femoral osteolysis . after component removal , there was evidence of severe osteolysis of both posterior condyles and extensive metal debris overlying the femoral canal ( fig 4a ) . similarly , there was evidence of severe osteolysis underneath the tibial baseplate with bone resorption into the proximal tibial metaphysis after the tibial component was removed ( fig 4b ) . b ) resected synovium with extensive black metallic debris material noted throughout a ) extensive black metallic debris material noted over the distal femur and femoral canal upon removal of the femoral component , b ) extensive black metal debris material noted over the tibia following removal of the tibial component . close inspection of the implants revealed metallic wear secondary to grinding on both the femoral component ( fig 5a ) and metal backed patella ( fig 5b ) , as well as along the lateral surface of the tibial plate ( fig 5c ) . after irrigation and debridement , most of the metal debris was removed . the revision implants included long press - fit diaphysis fitting stems in both the femur and tibia and a varus - valgus constrained component with tibial and femoral wedges used to reconstitute the bone loss and restore the anatomical joint line . an oxidized zirconium femoral component was used to prevent repeat metallic wear ( smith & nephew , memphis , tn ) . the patellar component was removed in its entirety and not replaced due to insufficient bone stock to support a new patella button ( figs 6a and 6b ) . b ) metallic wear of the patella button , c ) erosion of the edge of the lateral tibial base plate . a ) antero - posterior postoperative radiograph showing revision tka b ) lateral post operative radiograph showing revision tka intraoperative joint fluid analysis was again negative for infection , with wbc count 243 and pmn % of 10 . histologic examination of the periprosthetic tissues demonstrated extensive fibrosis ( fig 7a ) with multiple histiocytes ( fig 7b ) and multi - nucleated giant cells ( fig 8) consistent with the diagnosis of metallosis . synovial microscopic histology showing : a ) black pigment interspersed within extensive fibrosis ( white arrows ) . b ) black pigment ( left ) neighboring multiple histiocytes ( white arrows ) synovial microscopic histology showing a multinucleated giant cell ( red arrow ) the patient was allowed to be weight - bearing as tolerated with an unlocked bledsoe brace . she was able to ambulate and perform range of motion exercises with physical therapy and was discharged on postoperative day 3 . at 6 weeks follow - up , her incision was healed , she was ambulating well without an assistance device , and her range of motion was 0 - 110 degrees . in this case report we describe a patient with symptomatic metal - induced synovitis , commonly referred to as metallosis , which presented as a late complication of total knee arthroplasty . after appropriate diagnostic studies ruled out other etiologies of her implant failure , a revision total knee arthroplasty was performed and the patient was able to regain a functional ambulatory status . most cases of metallosis after total knee replacement are due to wear of a metal - backed polyethylene patellar prosthesis , and this was the likely source of our patient s tka aseptic failure based on the significant patellar destruction . metal - backed patellar implants are no longer commonly used , but close evaluation should be kept on patients with these components and metallosis should be at the top of the differential if they present with complaints such as effusion , grinding and pain . in addition , the patient in our case also had wear of the titanium tibial and femoral components with both components showing signs of erosion . a review of the current literature revealed that titanium components appear to have an increased association with metal wear leading to metallosis as compared to chromium - cobalt comprised implants . newer implants such as the one used in this case ( smith and nephew s oxinium ) are composed of oxidized zirconium with the goal of reducing metal wear and should result in fewer incidences of metallosis in the future . these components should preferentially be used during revision cases to limit any additional spread of metal debris . metallosis can be suspected pre - operatively with radiographic signs such as the cloud sign , bubble sign and the metal - line signs , with our patient displaying the former two on lateral and pa radiograph images . sign is the most commonly cited radiographic indication of possible metallosis and is described as amorphous , fluffy densities in periprosthetic soft tissues , most commonly found posterior to the knee implant [ 1 , 2 , 5 ] additionally , bubbly appearing radiodensities representing metal deposition outlining the synovium are known as the bubble sign . finally , the metal - line sign is a thin linear radiodense line that outlines part of the joint capsule ( most commonly in the suprapatellar pouch ) and is fairly specific for metal - induced synovitis . evidence of these signs on imaging should prompt a close evaluation for metallosis . serology and arthrocentesis also need to be performed to rule out infectious etiology . in general , a peripheral wbc count is not useful diagnostic measure since it is generally normal in tka infections while persistent elevation of esr , with abnormal levels defined as > 30 mm / hr three months to one year after tka , is often indicative of infection ( specificity of 87% ) . similarly , elevated crp levels defined as > 10 pg / ml at least 14 - 21 days after tka also point to an infectious etiology ( specificity 83% ) . regarding synovial fluid leukocyte count and differential , the numbers to consider a possible infection , include > 1100 wbc / ml with a pmn percentage > 64% ( 88% and 94% specificity , respectively ) [ 10 - 11 ] . as such , in the presence of radiographic signs of metallosis and absence of infectious markers , a diagnosis of metallosis can be made with relative accuracy [ 4 , 5 , 7 , 8 ] . if clinically and radiographically suspected , treatment with irrigation and debridement along with synovectomy and revision total knee replacement is the consensus management choice to avoid further destruction of the bone and joint capsule that can occur with metal induced inflammation [ 1 - 2 ] . a thorough debridement should be performed , to both remove the source of inflammation and to decrease the particle count that could lead to third body wear . all components should be removed and replaced , preferably with implants with coatings that have high resistance to metallic debris . a more constrained system should be used to limit postoperative instability in cases of severe bone loss and ligament compromise . with a significant amount of bone loss likely from chronic osteolysis , augments or bone grafting may be needed to reconstitute the joint line . orthopaedic surgeons should be aware of the pertinent clinical and radiographic signs and be prepared to perform an extensive revision surgery to restore joint function . as seen with this case of severe chronic metallosis , appropriate although rare after total knee arthroplasty , orthopaedic surgeons should be aware of the pertinent clinical and radiographic signs of metallosis and be prepared to perform an extensive revision surgery to restore joint function .	introduction : metallosis occurs when periprosthetic soft tissues , synovium , and/or bone is infiltrated by metallic debris secondary to metal - on - metal wear . this debris can cause a chronic inflammatory reaction leading to joint instability , pain , and swelling , and may cause osteolysis , implant looseningand ultimately implant failure.case report : an 81 year old female , with a history of primary left total knee arthroplasty , presented with a 6 month history of left knee pain , swelling , and limited range of motion following a fall . radiographs and joint aspiration were performed , with results that showed no evidence of periprosthetic trauma or infection but were suspicious for chronic metallosis . the patient underwent revision total knee replacement of the left knee which revealed extensive necrotic black metal debris throughout the joint space . histopathology confirmed the diagnosis of a foreign body reaction consistent with metallosis.conclusion:this case is a rare example of chronic metallosis presenting 26 years following total knee replacement . treatment with revision total knee replacement is the consensus management choice to avoid further destruction of the bone and joint capsule that can occur with metal - induced inflammation .
You are an expert at summarizing long articles. Proceed to summarize the following text: the impact of timely recanalization is critical in the treatment of acute ischemic stroke ( ais ) , especially for large vessel occlusion ( lvo).7)12 ) when considering thrombolysis methods , mechanical thrombolysis has been actively preferred because of the low efficacy of pharmacological thrombolysis.2)4)10)13 ) various mechanical devices have been used , including wires , microcatheters , balloons , stents , and capture or aspiration devices . high recanalization rates and early recanalization were achieved with mechanical thrombolysis , but this method also has limitations . for example , mechanical disruption of the thrombus could lead to migration of the fragmented emboli into distal arteries that are more difficult to open . squeezing or pushing out the thrombus to the vessel walls with balloons or stents can work11)14 ) but is often associated with complications.3)6)11 ) theoretically and practically , removal of the occluding thrombi from the cerebral arteries is the best method for treatment of acute stroke . however , high recanalization rates have not been reported for the merci device.13 ) the penumbra system , another device for removal of thrombi , does have high recanalization rates.1 ) however , it requires steps for fragmentation of thrombi . in this article it is very simple ; placement of a large bore microcatheter at the proximal part of the thrombi , application of negative pressure using a syringe . the thrombi are sucked out as fragments or captured at the catheter tip by the negative pressure and withdrawn as a single piece . from january 2013 to december 2013 , 16 consecutive acute stroke patients with intracranial large arterial occlusions in the middle cerebral artery ( mca ; n= 7 ) , internal cerebral artery ( ica ; n = 5 ) , basilar artery ( ba ; n = 1 ) , and a tandem lesion ( ica and mca ; n = 1 ) were treated by the suction thrombectomy technique . our intra - arterial mechanical thrombolysis ( iamt ) criteria were similar to those of other iamt trials.1)6)13 ) patients who met the following criteria were included : ( 1 ) clinical symptoms of ais ; ( 2 ) intracranial large arterial occlusion ( lao ) visible on brain magnetic resonance ( bmr ) angiograms or brain computed tomography ( bct ) angiograms ; ( 3 ) examination within 8 hours of onset ; and ( 4 ) within a time window of 3 h , the patients exhibited no response on bmr angiograms to intravenous tissue plasminogen activator ( tpa ) treatment . patients who had intracranial hemorrhages ( ich ) , broad infarctions ( middle cerebral artery territory 1/3 ) , or severe brain edema were excluded . the etiology of the ais was classified according to the trials of org 10172 in acute stroke treatment ( toast ) classification system . at an initial examination and at a periprocedural examination , the presence of neurological deficits was evaluated by a stroke neurologist according to the national institutes of health stroke scale ( nihss ) . follow up bct or bmr images were evaluated within 24 h of the thrombolytic therapy . a symptomatic hemorrhage was defined as neurological deterioration greater than or equal to 4 points on the follow - up nihss score compared to that of the initial examination and a hemorrhage visible on follow up imaging . functional disability was assessed using a modified rankin scale ( mrs ) and clinical outcome was tested by mrs at 90 days . good long - term outcome was defined as an mrs score 2 at 90 days . recanalization was assessed and scored using the thrombolysis in cerebral infarction ( tici ) scale . we regarded tici grades 2 and 3 as recanalization and complete recanalization was defined as tici grades 2b or 3 . the endovascular procedure was performed using a femoral artery approach under local anesthesia with the occasional addition of the sedative medications midazolam and propofol for uncooperative patients . after determining occlusion site and extent , a large bored suction catheter ( penumbra system 4.1 fr , penumbra inc , alameda , ca , usa ) was advanced to the proximal portion of the thrombi under the guidance of a microwire or a coaxial microcatheter system ( excelsior-10 , boston scientific , ca , usa ) . if the suction catheter could not be advanced smoothly over the acute angle of the carotid siphon at the cavernous segment of the ica , the suction catheter tip was retrieved , steam - shaped and reinserted . after placing the suction catheter proximal to the thrombi , in most cases , a microcatheter ( excelsior-10 ) was advanced through the thrombi distally over the microwire and selective angiography was performed in order to measure length of whole clot and visualize distal vessels . if the microcatheter was not able to pass smoothly through the thrombi because of its consistency , we did not try to advance it by force . with experience , we have realized that passing through the thrombi and confirming the distal part of the thrombi is not an essential part of the suction thrombectomy . as a next step , we slowly advanced the suction catheter in order to wedge it to the proximal part of the thrombi . for that , we needed to insert the catheter tip into the proximal several millimeters of the clot . in most cases , placing the catheter tip into the clot was easy when the thrombi were located in a straight vessel part like in the m1 or in the supraclinoid ica . however , when the thrombi began at a curved vessel like the intradural ica bifurcation or the carotid siphon , we tried not to cause the suction catheter tip to be wedged to the vessel wall . in these cases , the first one involves placement of the suction catheter tip 1 - 2 mm proximal to the thrombi ( not into the thrombi ) and then aspirating it with the ipsilateral common carotid artery occluded manually or by using a balloon guiding catheter . the second method involves insertion of the catheter tip up to the straight part of the clot after passing the curved part . . 1 ; aspiration gun , taesung , seoul , korea ) to hold a 50 ml syringe . by pulling the gun handle we were also able to control the suction pressure by use of a teeth - like locking system . the negative pressure was moderate with the aspiration gun handle pulled to approximately 3/4 of the maximum . we then slowly advanced the catheter tip to the thrombi while maintaining the suction pressure . if the catheter tip was wedged to the thrombi , the aspirated blood suddenly stopped . at that time , we pulled the aspiration gun handle to the maximum . in many cases , thrombi were easily caught by the suction catheter tip , and in those cases , we slowly withdrew the catheter and the thrombi together . in many cases , , we were able to check whether or not the catheter tip held tight to the thrombi by simply checking for the presence of constant aspirated blood in the syringe . the negative pressure was then released and the suction catheter was readvanced to catch the thrombi again . the endovascular procedure was performed using a femoral artery approach under local anesthesia with the occasional addition of the sedative medications midazolam and propofol for uncooperative patients . after determining occlusion site and extent , a large bored suction catheter ( penumbra system 4.1 fr , penumbra inc , alameda , ca , usa ) was advanced to the proximal portion of the thrombi under the guidance of a microwire or a coaxial microcatheter system ( excelsior-10 , boston scientific , ca , usa ) . if the suction catheter could not be advanced smoothly over the acute angle of the carotid siphon at the cavernous segment of the ica , the suction catheter tip was retrieved , steam - shaped and reinserted . after placing the suction catheter proximal to the thrombi , in most cases , a microcatheter ( excelsior-10 ) was advanced through the thrombi distally over the microwire and selective angiography was performed in order to measure length of whole clot and visualize distal vessels . if the microcatheter was not able to pass smoothly through the thrombi because of its consistency , we did not try to advance it by force . with experience , we have realized that passing through the thrombi and confirming the distal part of the thrombi is not an essential part of the suction thrombectomy . as a next step , we slowly advanced the suction catheter in order to wedge it to the proximal part of the thrombi . for that , we needed to insert the catheter tip into the proximal several millimeters of the clot . in most cases , placing the catheter tip into the clot was easy when the thrombi were located in a straight vessel part like in the m1 or in the supraclinoid ica . however , when the thrombi began at a curved vessel like the intradural ica bifurcation or the carotid siphon , we tried not to cause the suction catheter tip to be wedged to the vessel wall . in these cases , the first one involves placement of the suction catheter tip 1 - 2 mm proximal to the thrombi ( not into the thrombi ) and then aspirating it with the ipsilateral common carotid artery occluded manually or by using a balloon guiding catheter . the second method involves insertion of the catheter tip up to the straight part of the clot after passing the curved part . we designed a gun - like aspiration device ( fig . 1 ; aspiration gun , taesung , seoul , korea ) to hold a 50 ml syringe . by pulling the gun handle , we were able to apply negative suction pressure through the suction catheter . we were also able to control the suction pressure by use of a teeth - like locking system . the negative pressure was moderate with the aspiration gun handle pulled to approximately 3/4 of the maximum . we then slowly advanced the catheter tip to the thrombi while maintaining the suction pressure . if the catheter tip was wedged to the thrombi , the aspirated blood suddenly stopped . at that time , we pulled the aspiration gun handle to the maximum . in many cases , thrombi were easily caught by the suction catheter tip , and in those cases , we slowly withdrew the catheter and the thrombi together . in many cases , , we were able to check whether or not the catheter tip held tight to the thrombi by simply checking for the presence of constant aspirated blood in the syringe . the negative pressure was then released and the suction catheter was readvanced to catch the thrombi again . the clinical and neuroradiological characteristics and outcomes of the 14 cases are summarized in table 1 . the mean interval from the onset of symptoms to femoral arterial puncture was 5.9 hours ( range : 3.6 - 12.8 hours ) . the initial median nihss was 17.5 ( range : 9 - 35 ) and the immediate post - procedural nihss was 16 ( range : 2 - 35 ) . seven of the 14 patients ( 50% ) underwent intravenous tpa before intra - arterial thrombolysis ( iat ) according to our protocol . the occluded vessels were divided as follows : m1 in 7 patients ( 50% ) , ica in 5 ( 3 extradural and 2 intradural ica ) ( 35.6% ) , 1 ica ( extracranial lesion ) and m1 ( 7.1% ) , and 1 ba ( 7.1% ) . based on the toast classification , large - artery atherosclerosis was present in 6 patients ( 42.9% ) , cardioembolism in 7 patients ( 50% ) , and the etiology was undetermined in 1 ( 7.1% ) . adjuvant intraarterial thrombolytic agents including urokinase ( uk ) and/or tirofiban were administered in 7 patients . the median procedural time ( the time from arterial puncture to procedural end ) was 85 minutes ( range : 17 - 242 minutes ) . in 8 cases , suction thrombectomy was performed alone . seven of these cases were recanalized with complete recanalization in 6 of the 7 patients . the median procedural time of these 7 cases was 30 min ( range : 17 - 112 min ) . in these cases , we were not able to advance the suction catheter to the occlusion site due to vessel tortuousness . these 2 cases were finally recanalized by local infusion of urokinase and balloon angioplasty , respectively . good long - term outcomes ( mrs 0 - 2 ) at 90 days were achieved in 6 of the 14 patients ( 42.9% ) . of these , 6 cases were treated by suction thrombectomy alone . a 93-year - old female presented with a sudden onset right - side hemiparesis and a drowsy consciousness within a 3.15 hour window . diffusion magnetic resornance ( mr ) showed acute infarction in the left basal ganglia and the corona radiata ( fig . 2b ) and mr angiogram demonstrated complete occlusion of the proximal m1 segment of the left mca ( fig . a suction catheter was advanced to the thrombus under the guidance of a wire and a coaxial microcatheter . the suction catheter tip was wedged to the proximal part of the thrombus ( fig . then , forced aspiration was applied by pulling the handle of the aspiration gun in order to capture the thrombus . a 93-year - old female presented with a sudden onset right - side hemiparesis and a drowsy consciousness within a 3.15 hour window . diffusion magnetic resornance ( mr ) showed acute infarction in the left basal ganglia and the corona radiata ( fig . 2b ) and mr angiogram demonstrated complete occlusion of the proximal m1 segment of the left mca ( fig . a suction catheter was advanced to the thrombus under the guidance of a wire and a coaxial microcatheter . the suction catheter tip was wedged to the proximal part of the thrombus ( fig . then , forced aspiration was applied by pulling the handle of the aspiration gun in order to capture the thrombus . the procedural details are very simple and involve placement of a large bore tube ( a 4-fr suction catheter ) proximally to the thrombi or wedging it into the thrombi and then applying negative pressure by pulling on a 50 ml syringe . we were able to control the negative pressure by using a simple device to hold the syringe , the so - called aspiration gun . thrombi may be broken and fragmented by the negative pressure that could be easily aspirated . in many other cases , the clot was well caught by the catheter and retrieved easily as one piece under the condition that we maintained continuous negative pressure by the aspiration gun . in most cases , we did not use balloon - mounted guiding catheters to control the proximal blood flow . in over half of our cases , no thrombolytic drug infusion was necessary . pathologic findings of the thrombi in our cases demonstrate the sticky characteristics of thrombi . grossly , the retrieved clots had an elastic consistency , and they were not easily fragmented by manual manipulation . histologically , multiple layers of components of acellular fibrin appeared to play a role in keeping the clot as one unit . fibrin holds blood cells , which are mainly red blood cells and other fibrin components together . thus , they were not easily torn or broken , so that retrieving the thrombi as one piece by catching the proximal part was possible . we have used the reperfusion catheter of the penumbra system as a suction catheter.1)5 ) we think this catheter is suitable for this purpose because it has a large lumen that is enforced by metal braiding that protects the catheter lumen from collapsing under the strong negative pressure . other helpful characteristics of this catheter are the minimal difference between the proximal and distal inner - luminal diameters , which is important in terms of providing sufficient negative pressure . a malleable distal tip , which is necessary when a clot is located in a curved vessel , is also helpful . compared to other devices and techniques such as the merci ( concentric medical , ca , usa ) and the original penumbra system1)13 ) , we believe that the current technique is simpler . the only special devices necessary for this technique are a large - bore catheter and 50 ml syringes . ais , caused by lvo , is particularly morbid and neurological outcome is dependent on timely recanalization.13 ) thus , we believe that a short procedural time is important . in our study , the median procedural time was just 30 min ( range : 17 - 112 min ) in the successful cases . now , this technique has become the first line of treatment for iat in our practice because of the relatively high recanalization rate and the short procedural duration . aspiration thrombolysis has proved to be effective in terms of reducing distal emboli in the cardiac intervention field.8)9 ) considering our results with very low distal emboli , the current technique seems to have a low risk of embolism during the procedure . with respect to the suction technique , it seems that there is a possibility that vessel perforation or dissection may occur by sucking on the vessel medial wall . however , in our experience , there were no complications related to this technique . placing the catheter tip at the straight part of the vessel appears to be important . the current trial has some limitations , including the retrospective collection of data , a small number of cases , a single - center experience , and a short follow - up period . thus , a prospective , large , long - term follow - up and multi - center study is required in order to prove the efficacy and safety of the current technique . the suction thrombectomy technique outlined in this paper is a simple , time - saving , beneficial , and safe method for treatment of ais with lvo . thus , the current technique is worthy of consideration as a rapid and effective treatment option among various thrombolytic methods for recanalization of lvo in ais .	objectiveduring mechanical thrombolysis , to reduce procedure - related complications and time , the authors have performed a simple suction thrombectomy technique . in this article , the authors describe the technical details and clinical outcomes of this technique.materials and methodsfrom january 2013 to december 2013 , 14 consecutive acute ischemic stroke ( ais ) patients with large cerebral arterial occlusions in the middle cerebral artery ( mca ; n = 7 ) , internal cerebral artery ( ica ; n = 5 ) , basilar artery ( ba ; n = 1 ) , and a tandem lesion ( ica and mca ; n = 1 ) were treated using this technique . the proximal part of the occluding clot was aspirated or captured and retrieved as one piece using a large bored microcatheter by applying negative suction pressure using a 50 ml syringe.resultsoverall recanalization rate was 85.7% ( 12 patients ) . in the 8 patients in whom this technique was used alone , the recanalization rate was 87.5% ( 7 patients ) . the median procedural duration was 30 minutes ( range 17 - 112 ) in these 7 patients . distal embolism did not occur . two patients developed post - procedural intracerebral hemorrhages and one was symptomatic . his modified rankin scale ( mrs ) score at 90 days was 4.conclusionthis technique is a feasible , fast , and safe method for treatment of ais .
You are an expert at summarizing long articles. Proceed to summarize the following text: sepsis is systemic inflammatory response syndrome ( sirs ) resulting from a wide spectrum of infectious agents . this condition can further lead to severe sepsis and septic shock , and now it is the focus and challenge of critical care medicine ( 1,2 ) . recent data have shown that 18 million of new sepsis cases occur each year worldwide , with a high fatality rate of 30% ( 3 , 4 ) . they also have the highest fatality rate , especially those with severe sepsis ( 6 , 7 ) . recent data suggests that sepsis and its induced septic shock and multiple organ dysfunctions ( mods ) are among the leading causes of admission to intensive care units ( icus ) and it leads to an extremely high fatality rate in pediatric intensive care unit ( picu ) ( 8,9 ) . the key to decrease the fatality rate of pediatric sepsis , especially severe sepsis , is early diagnosis , accurate assessment and timely treatment . however , the diagnosis of sepsis and evaluation of its severity only based on clinical signs and symptoms such as temperature , heart rate and respiratory rate is quite difficult , due to its untypical and diverse clinical signs as well as the complex and dynamic pathophysiologic process ( 10 ) . failure to recognize the severity of illness in the early course of disease may lead to inappropriate disposition or treatment . therefore , it is of utmost importance to develop a clinical tool that is more accurate and objective than clinicians experience to stratify severity of sepsis ( 11 ) . in 2001 , the north american and european sepsis definitions conference proposed the piro ( predisposition , infection , response , organ dysfunction / failure ) concept with the suggestion that sepsis could be stratified on the basis of easily measured biological indicators in a way similar to cancer , with the tnm ( tumor node metastasis ) staging system ( 12 ) . in recent years , severity stratification scoring systems such as acute physiology and chronic health evaluation ii ( apacheii ) , sequential organ failure assessment ( sofa ) , pediatric risk of mortality ( prism ) score have been applied to various septic populations ( 13,14 ) . these scoring systems indeed played a part in assessing sepsis in children with relatively comprehensive parameters . however , they were computationally complex and devised either for adult patients or for general critical disease , and mainly focus on the prediction of survival or death ( 15,16 ) , thus not suit for pediatric sepsis . moreover , because of important differences between adults and children with respect to comorbidities , organ failure , and baseline mortality rate , efficacy from adults may not be generalized to children(5 ) . to our knowledge , scoring model established specifically for pediatric septic patients with high clinical application value has not yet been reported . the aim of this study was to develop a scoring model based on selected objective variables with high specificity and sensitivity , to aid severity assessment in children with sepsis . patients presenting with sepsis were retrospectively recruited from the picu in children s hospital of hunan province between mar 2011 and mar 2013 . this hospital is the only comprehensive children s hospital in this province , with 80 picu beds and over 200 two - way referral hospitals . more than 80% of the serious children patients in hunan province were admitted in this hospital . so , the patients in this hospital are highly representative of all serious children patients in hunan province . electronic management was implemented for all medical records in this hospital with complete and reliable information , which guaranteed the quality of data . all selected patients met the pediatric - specific diagnostic criteria for sepsis established by the international pediatric sepsis consensus conference ( 17 ) . in this study patients who had been admitted for less than 24 h , and patients with important information such as age , gender and prognosis missing were excluded . to develop the scoring model , 75% of the patients were randomly assigned to the training group and the remaining 25% to the validation group , according to their admission number . we used the training group to establish the model , and the validation group to evaluate the model . the hospital electronic medical records for all patients were reviewed by specially trained doctors and eligible patients were selected according to the unified diagnostic criteria and exclusion criteria . the following information was collected : demographics , clinical and physiologic data , diagnosis data and prognosis data . in order to standardize data collection , clinical and physiologic data were taken as the worst value recorded during the first 24 h after admission . the independent variables considered for inclusion into the sepsis scoring model included demographic variables ( age , gender ) and vital signs ( temperature , heart rate , systolic blood pressure etc . ) ; infection related indicators ( leukocyte platelet proealcitonin , c - reactive protein etc . ) ; organ dysfunction related indicators ( bilirubin , creatinine , total bilirubin , d - dimer , brain natriuretic peptide etc . ) . this study was approved by xiangya medical school research ethics committee , changsha , china . we did nt get written or verbal informed consent from participate or the next of kin , caretakers , or guardians on behalf of the minors / children since we have not access the patients . no any potential harm to the participants was apparent . to ensure anonymity , every participant regression estimation technique was used to impute the missing values ( the proportion of data missing for individual variables was less than 5% ) . results are presented as numbers with percentages in parentheses for categorical variables and mean ( sd ) or median ( quartiles ) for continuous variables . univariate analysis was used to select a subset of predictors associated with sepsis severity at p<0.1 level to be considered for inclusion in the multivariable scoring model . continuous variables were categorized to binary or categorical indicators required for a clinically useful scoring system in sepsis . multivariate analysis was performed by stepwise discriminant analysis to identify variables independently associated with the severity of sepsis ( =0.05 , =0.1 ) . we established the accurate discriminate model based on the discriminant coefficients resulting from the stepwise discriminant analysis . the simplified scoring model was developed based on standardized canonical discriminant coefficients obtained from discriminant analysis , with the general rule of multiplying the coefficients by 10 and round off to the nearest integer . to assess the accuracy of the models , we calculated the sensitivity ( sn ) and specificity ( sp ) , and then constructed receiver operating characteristic ( roc ) curves by plotting the sn against ( 1-sp ) at different cutoff value . the discriminant performance of the scoring systems was assessed by the area under the roc curve ( aroc ) , with values close to 1.0 indicating high diagnostic accuracy . patients presenting with sepsis were retrospectively recruited from the picu in children s hospital of hunan province between mar 2011 and mar 2013 . this hospital is the only comprehensive children s hospital in this province , with 80 picu beds and over 200 two - way referral hospitals . more than 80% of the serious children patients in hunan province were admitted in this hospital . so , the patients in this hospital are highly representative of all serious children patients in hunan province . electronic management was implemented for all medical records in this hospital with complete and reliable information , which guaranteed the quality of data . all selected patients met the pediatric - specific diagnostic criteria for sepsis established by the international pediatric sepsis consensus conference ( 17 ) . in this study patients who had been admitted for less than 24 h , and patients with important information such as age , gender and prognosis missing were excluded . to develop the scoring model , 75% of the patients were randomly assigned to the training group and the remaining 25% to the validation group , according to their admission number . we used the training group to establish the model , and the validation group to evaluate the model . the hospital electronic medical records for all patients were reviewed by specially trained doctors and eligible patients were selected according to the unified diagnostic criteria and exclusion criteria . the following information was collected : demographics , clinical and physiologic data , diagnosis data and prognosis data . in order to standardize data collection , clinical and physiologic data were taken as the worst value recorded during the first 24 h after admission . the independent variables considered for inclusion into the sepsis scoring model included demographic variables ( age , gender ) and vital signs ( temperature , heart rate , systolic blood pressure etc . ) ; infection related indicators ( leukocyte platelet proealcitonin , c - reactive protein etc . ) ; organ dysfunction related indicators ( bilirubin , creatinine , total bilirubin , d - dimer , brain natriuretic peptide etc . ) . this study was approved by xiangya medical school research ethics committee , changsha , china . we did nt get written or verbal informed consent from participate or the next of kin , caretakers , or guardians on behalf of the minors / children since we have not access the patients . no any potential harm to the participants was apparent . to ensure anonymity , every participant regression estimation technique was used to impute the missing values ( the proportion of data missing for individual variables was less than 5% ) . results are presented as numbers with percentages in parentheses for categorical variables and mean ( sd ) or median ( quartiles ) for continuous variables . univariate analysis was used to select a subset of predictors associated with sepsis severity at p<0.1 level to be considered for inclusion in the multivariable scoring model . continuous variables were categorized to binary or categorical indicators required for a clinically useful scoring system in sepsis . multivariate analysis was performed by stepwise discriminant analysis to identify variables independently associated with the severity of sepsis ( =0.05 , =0.1 ) . we established the accurate discriminate model based on the discriminant coefficients resulting from the stepwise discriminant analysis . the simplified scoring model was developed based on standardized canonical discriminant coefficients obtained from discriminant analysis , with the general rule of multiplying the coefficients by 10 and round off to the nearest integer . to assess the accuracy of the models , we calculated the sensitivity ( sn ) and specificity ( sp ) , and then constructed receiver operating characteristic ( roc ) curves by plotting the sn against ( 1-sp ) at different cutoff value . the discriminant performance of the scoring systems was assessed by the area under the roc curve ( aroc ) , with values close to 1.0 indicating high diagnostic accuracy . during the 2-year study period , 687 patients admitted to picu met the criteria of sepsis or severe sepsis , of whom 43 ( 6.3% ) were excluded for less than 24 h of hospital stay . 634 children were included in the final analysis , with a response rate of 92.3% . 424 ( 66.9% ) patients improved or recovered , 49 ( 7.7% ) gave up treatment and were discharged , and 161(25.4% ) patients died . the average age was 16.9 24.4 months ( range 1 month to 14 yr ) and 65.3% were male . the two groups had no statistical difference in gender , age , length of hospital stay , mechanical ventilation , blood culture ; cause of sepsis and the proportion of patients with severe sepsis ( table 1 ) . a total of 585 patients were included in the prognostic analysis due to 49 cases ( 7.7% ) were abandoned or left hospital voluntarily with no available prognostic information . we compared the initial characteristic between the included 585 patients and the excluded 49 patients . table 2 reveals that there were no statistic difference in sepsis severity and mean score between the two group ( p>0.05 ) , which indicated that our results resulted from the remained sample may be reliable . clinical characteristics of patients in the training and validation groups results are presented as numbers with percentages in parenthesis characteristic of the included 585 patients and excluded 49 patients group a : 585 patients included in the prognostic analysis ; group b : 49 patients excluded in the prognostic analysis due to lack of prognostic information table 3 compares the characteristics and clinical variables of mild sepsis versus severe sepsis in the training group . several clinical variables were strongly associated with severe sepsis in the univariate analysis , including d - dimer , heart rate , respiratory rate , platelets , potassium , capillary refill time , prothrombin time , pao2/fio2 ratio , base excess , blood lactate , total bilirubin , serum total protein , alanine aminotransferase , urea nitrogen , creatinine , uric acid , myoglobin , proealcitonin , brain natriuretic peptide , and troponin . univariate analysis of suspected factors of severe sepsis in training group ( 476 patients ) binary and categorical data are presented as n and percentages of totals , using the pearson s chi - square test/ normally distributed data are presented as mean ( sd ) , using student s t - test/ other nonsymmetrical distributed continuous data are presented as medians and 25th to 75th percentile ranges , using mann - whitney test / hr : heart rate ; alt : alanine aminotransferase ; pt : prothrombin time ; pfg : fasting plasma glucose ( fpg ) ; bun : urea nitrogen ; cr : creatinine ; pct : proealcitonin ; bnp : brain natriuretic peptide ; crp : c - reactive protein the nineteen statistically significant factors identified by the univariate analysis were taken to fisher stepwise discriminant analysis to construct a discriminant function ( table 4 ) . as a result , seven variables were retained in the final discriminant model , including prothrombin time , d - dimer , pao2/fio2 ratio , total bilirubin , serum total protein , uric acid and myoglobin . these results can be presented in the form of the following equation to establish the accurate discriminant model for severe sepsis : z=7.312 + 0.702x11 ( total bilirubin)+0.634x15(uric acid)+0.680x6 ( ddimer)+0.934x12 ( serumtotal protein)+0.795x5 ( prothrombin time)+0.616x16 ( myoglobin)+0.551x7 ( pao2/fio2 ratio ) the average discriminant function value for severe sepsis group was za=0.45 , and for mild sepsis group was zb=0.92 , distinguishing value zc= ( za + zb)/2= ( 0.45 + 0.92 ) / 2 = 0.24 . thus , zi 0.24 was discriminated as severe sepsis , and zi < 0.24 was discriminated as mild sepsis . for convenience in clinical use , we generated a simplified score using weightings defined by the standardized discriminant coefficients of the model ( multiplied by a constant and rounded to the nearest integer ) ( table 5 ) . simplified scoring model developed based on the accurate discriminate model coefficient : standardized canonical discriminant coefficients the score is 0 if the variable is normal ; for abnormal variables , the score equals to the coefficients multiplied by 10 and rounded to the nearest integer . the performance of the discriminant model in discriminating mild sepsis and severe sepsis was estimated both in the training sample and validation sample using roc curves . the arocs ( fig.1a ) of accurate discriminate model were 0.816 ( 95% ci 0.771 to 0.861 ) in the training group and 0.836 ( 95%ci 0.765 to 0.907 ) in the validation group . for simplified scoring model , the aroc remained relatively high with aroc 0.800 ( 95%ci : 0.7530.846 ) in the training set and 0.825 ( 95%ci : 0.7500.899 ) in the validation set ( fig.1b ) . receiver operator characteristic ( roc ) curves for the accurate discriminate model and simplified scoring model in the training ( a ) and validation ( b ) groups . these scores ranged from 0 to 23 , with a mean ( sd ) value of 11.6 ( 6.2 ) . table 6 shows the prevalence of severe sepsis and fatality rate with each level of scores . as the score rises , the proportion of severe sepsis and the fatality rate increases significantly , and the percentage of improved or recovered decreases significantly ( trend chi - square tests p<0.05 ) . prevalence of severe sepsis and prognosis in total patients according to summed score a total of 585 patients were included in the prognostic analysis due to 49 cases ( 7.7% ) were abandoned or left hospital voluntarily with no available prognostic information . during the 2-year study period , 687 patients admitted to picu met the criteria of sepsis or severe sepsis , of whom 43 ( 6.3% ) were excluded for less than 24 h of hospital stay . 634 children were included in the final analysis , with a response rate of 92.3% . 424 ( 66.9% ) patients improved or recovered , 49 ( 7.7% ) gave up treatment and were discharged , and 161(25.4% ) patients died . the average age was 16.9 24.4 months ( range 1 month to 14 yr ) and 65.3% were male . the two groups had no statistical difference in gender , age , length of hospital stay , mechanical ventilation , blood culture ; cause of sepsis and the proportion of patients with severe sepsis ( table 1 ) . a total of 585 patients were included in the prognostic analysis due to 49 cases ( 7.7% ) were abandoned or left hospital voluntarily with no available prognostic information . we compared the initial characteristic between the included 585 patients and the excluded 49 patients . table 2 reveals that there were no statistic difference in sepsis severity and mean score between the two group ( p>0.05 ) , which indicated that our results resulted from the remained sample may be reliable . clinical characteristics of patients in the training and validation groups results are presented as numbers with percentages in parenthesis characteristic of the included 585 patients and excluded 49 patients group a : 585 patients included in the prognostic analysis ; group b : 49 patients excluded in the prognostic analysis due to lack of prognostic information table 3 compares the characteristics and clinical variables of mild sepsis versus severe sepsis in the training group . several clinical variables were strongly associated with severe sepsis in the univariate analysis , including d - dimer , heart rate , respiratory rate , platelets , potassium , capillary refill time , prothrombin time , pao2/fio2 ratio , base excess , blood lactate , total bilirubin , serum total protein , alanine aminotransferase , urea nitrogen , creatinine , uric acid , myoglobin , proealcitonin , brain natriuretic peptide , and troponin . univariate analysis of suspected factors of severe sepsis in training group ( 476 patients ) binary and categorical data are presented as n and percentages of totals , using the pearson s chi - square test/ normally distributed data are presented as mean ( sd ) , using student s t - test/ other nonsymmetrical distributed continuous data are presented as medians and 25th to 75th percentile ranges , using mann - whitney test / hr : heart rate ; alt : alanine aminotransferase ; pt : prothrombin time ; pfg : fasting plasma glucose ( fpg ) ; bun : urea nitrogen ; cr : creatinine ; pct : proealcitonin ; bnp : brain natriuretic peptide ; crp : c - reactive protein the nineteen statistically significant factors identified by the univariate analysis were taken to fisher stepwise discriminant analysis to construct a discriminant function ( table 4 ) . as a result , seven variables were retained in the final discriminant model , including prothrombin time , d - dimer , pao2/fio2 ratio , total bilirubin , serum total protein , uric acid and myoglobin . these results can be presented in the form of the following equation to establish the accurate discriminant model for severe sepsis : z=7.312 + 0.702x11 ( total bilirubin)+0.634x15(uric acid)+0.680x6 ( ddimer)+0.934x12 ( serumtotal protein)+0.795x5 ( prothrombin time)+0.616x16 ( myoglobin)+0.551x7 ( pao2/fio2 ratio ) the average discriminant function value for severe sepsis group was za=0.45 , and for mild sepsis group was zb=0.92 , distinguishing value zc= ( za + zb)/2= ( 0.45 + 0.92 ) / 2 = 0.24 . thus , zi 0.24 was discriminated as severe sepsis , and zi < 0.24 was discriminated as mild sepsis . for convenience in clinical use , we generated a simplified score using weightings defined by the standardized discriminant coefficients of the model ( multiplied by a constant and rounded to the nearest integer ) ( table 5 ) . simplified scoring model developed based on the accurate discriminate model coefficient : standardized canonical discriminant coefficients the score is 0 if the variable is normal ; for abnormal variables , the score equals to the coefficients multiplied by 10 and rounded to the nearest integer . the performance of the discriminant model in discriminating mild sepsis and severe sepsis was estimated both in the training sample and validation sample using roc curves . the arocs ( fig.1a ) of accurate discriminate model were 0.816 ( 95% ci 0.771 to 0.861 ) in the training group and 0.836 ( 95%ci 0.765 to 0.907 ) in the validation group . for simplified scoring model , the aroc remained relatively high with aroc 0.800 ( 95%ci : 0.7530.846 ) in the training set and 0.825 ( 95%ci : 0.7500.899 ) in the validation set ( fig.1b ) . receiver operator characteristic ( roc ) curves for the accurate discriminate model and simplified scoring model in the training ( a ) and validation ( b ) groups . we calculate the severity scores for each of the study subjects . these scores ranged from 0 to 23 , with a mean ( sd ) value of 11.6 ( 6.2 ) . table 6 shows the prevalence of severe sepsis and fatality rate with each level of scores . as the score rises , the proportion of severe sepsis and the fatality rate increases significantly , and the percentage of improved or recovered decreases significantly ( trend chi - square tests p<0.05 ) . prevalence of severe sepsis and prognosis in total patients according to summed score a total of 585 patients were included in the prognostic analysis due to 49 cases ( 7.7% ) were abandoned or left hospital voluntarily with no available prognostic information . sepsis is a severe condition triggered by systemic inflammation in response to infection ( 18 ) , which remains one of the common critical illnesses encountered in the picu . it is very complicated for clinicians to diagnose and assess pediatric sepsis due to its untypical symptoms , rapidly development and dynamic pathophysiological process ( 19,20 ) . thus , practical clinical scoring models with few indicators are urgently required in pediatric critical medical care to assess patients condition ( 21 ) . this study specially designed to stratify severity of sepsis for pediatric patients , using a score based on seven variables drawn from patient clinical findings and laboratory examinations . advances in statistical methods have supplied the tools necessary to model complex relationships among many variables relevant to outcomes . in this study other alternatives would have been the use of synthetic evaluation model , for example hierarchy method and delphi method ( 22 ) . however , those methods always select indicators subjectively or need other auxiliary methods to select indicators objectively . besides , specialists were required to participate in and reach a high agreement coefficient to obtain reliable results . therefore , the availability and comprehensiveness of discriminant analysis and the simplicity of presenting the results as simple scores have conducted us to this election . discriminant analysis is a classification statistical method using the known categories of sample to establish the discriminant model . the stepwise discriminant analysis is the ideal statistical method for our analysis by using fewer indicators to achieve stable discriminant effect ( 23 ) . receiver - operating curve ( roc ) analysis has been used to determine the performance of a model in many studies ( 24 ) . based on 634 patients , we selected 27 variables , which are readily available in most of the institutions and closely related with various systems of the body . nineteen of them entered into discriminant analysis by univariate analysis , and 7 were retained in the final model . most of the severity indicators found in our study are in concordance with previous study ( 2527 ) . other indicators , such as c - reactive protein , tumor necrosis factor and procalcitonin , have been reported as potential biochemical markers of infection ( 2830 ) , however have not been shown to be associated with severity of pediatric sepsis in our study . one explanation may be that only children diagnosed with sepsis were included in this study , so the biochemical markers of infection can not be used to distinguish the severity of infected children . these variables and their coefficients are different from the widely used but complicated scoring systems such as apacheii , sofa , and prism score ( 15,16 ) . this difference may be related to our specific research objects , which fully shows the rationality and uniqueness of our model in assessing severity of sepsis in children . previous studies have attempted to derive clinical scores as a tool to identify seriously ill sepsis patients ; however , most of them looked at factors which may be predictive of fatality ( 4,31 ) . shapiro et al . ( 32 ) firstly derived and validated the mortality in emergency department sepsis ( meds ) score to address the need for an early risk stratification tool for sepsis in adult patients . the score was based on nine variables drawn from patient profile , clinical findings , and initial laboratory examination . the performance of the meds score has been validated in various populations to predict the 28-d fatality rate , with aroc 0.76 to 0.82 ( 33,34 ) . then corinne alberti et al . developed a risk of infection to severe sepsis and shock score ( rissc ) to estimate the risk of worsening sepsis in critically ill patients with infection ( 35 ) . the score included 12 variables such as temperature , heart rate , platelets , which are subsequently simplified into four subclasses of risk . unfortunately , scores in the above studies were devised based on adult groups whose average age were over 60 yr old , which were not suitable for assessment of disease severity in pediatric population . yet there are some scoring systems for mortality prediction in pediatric sepsis have been developed in recent past . ( 36 ) constructed and validated a prediction - scoring model for late - onset neonatal sepsis from clinical , laboratory , and management variables in a retrospective cohort . the validity of this score was good with arocs from 0.80 to 0.85 , but its practical application only suits for neonates . wong et al . ( 37 ) derived a pediatric sepsis biomarker risk model using 12 gene probes associated with outcome in children with septic shock with an aroc 0.811 . however , it only suits for sepsis shock children and has technical limitation for widely clinical application . in the present study , we evaluated the accurate discriminate model with training sample and validation sample , which showed a good discriminatory performance in assessing the severity of sepsis ( aroc 0.815 to 0.836 ) . it was similar to the clinical value of prediction - scoring model for late - onset neonatal sepsis and pediatric sepsis biomarker risk model ( 36 ) , better than the prism reported by de araujo costa et al ( 38 ) and apache score in assessing critical illness of children reported by ana lilia et al . it can be applied easily by clinicians with simple calculation procedures installed on their personal computers . for those inconvenient to use a computer , , we provide a more convenient simplified scoring model with similar clinical discriminant effect ( auroc:0.8000.825).the simplified scoring model was superior to the mews , scs and rems in predicting septic fatality reported by ghanem - zoub ( 39 ) , and also better than the sofa and cis score reported by shigeto oda ( 13 ) . in addition , we provided the risk estimation of severe sepsis and fatality according to the summed score , which is not only of diagnosis value but also of clinical predictive value . although we used scientific statistical methods to develop and verify the model , some limitations should be noted . firstly , the performance of the model can be optimized with more predictable factors included . in our analysis , not all variables that might be considered for inclusion into a severity score of sepsis were obtained . for example , we had no information on nervous system ( data regarding gsw were only available in 67 patients . ) , cytokines levels or patients genetic predisposition in our population . however , examination of such indicators is costly and currently limited to few centers throughout the world . different etiologies may confer different severity and prognoses but the underlying etiology is often unknown until relatively late in the course of hospitalization . factors that account for the accuracy of the model also contribute to its complexity , and sophisticated parameters are not uniformly obtained in resource - limited settings . accordingly , we intended to create a clinical tool based on commonly available clinical variables . all of these additional diagnostic tests merit further evaluation and incorporating such variables into a sepsis risk score might be feasible in a not - too - distant future . secondly , our study was conducted at single center in chinese population and may not be representative of all the picus worldwide . thirdly , 49 patients exclusion from the prognostic analysis might have introduced a bias in this study . an accurate discriminate model and simplified scoring model proposed in this study are new , applicable tools for severity assessment in pediatric sepsis patients . using generally available indicators , clinicians can easily stratify the disease severity and predict the risk of severe sepsis in septic children , which are very important in guiding treatment and improving outcomes . we propose that this severity - scoring model should be further evaluated for severity stratification and mortality prediction in larger prospective study as well as in other ethnic groups . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication , and/ or falsification , double publication and/ or submission , redundancy , etc . ) have been completely observed by the authors .	background : multiple severity scoring systems have been devised and evaluated in adult sepsis , but a simplified scoring model for pediatric sepsis has not yet been developed . this study aimed to develop and validate a new scoring model to stratify the severity of pediatric sepsis , thus assisting the treatment of sepsis in children.methods:data from 634 consecutive patients who presented with sepsis at children s hospital of hunan province in china in 20112013 were analyzed , with 476 patients placed in training group and 158 patients in validation group . stepwise discriminant analysis was used to develop the accurate discriminate model . a simplified scoring model was generated using weightings defined by the discriminate coefficients . the discriminant ability of the model was tested by receiver operating characteristic curves ( roc).results : the discriminant analysis showed that prothrombin time , d - dimer , total bilirubin , serum total protein , uric acid , pao2/fio2 ratio , myoglobin were associated with severity of sepsis . these seven variables were assigned with values of 4 , 3 , 3 , 4 , 3 , 3 , 3 respectively based on the standardized discriminant coefficients . patients with higher scores had higher risk of severe sepsis . the areas under roc ( aroc ) were 0.836 for accurate discriminate model , and 0.825 for simplified scoring model in validation group.conclusions:the proposed disease severity scoring model for pediatric sepsis showed adequate discriminatory capacity and sufficient accuracy , which has important clinical significance in evaluating the severity of pediatric sepsis and predicting its progress .
You are an expert at summarizing long articles. Proceed to summarize the following text: preterm delivery is defined by a birth occurring before 37 weeks of gestation or before 259 days from the last menstrual period . prematurity is multifactorial and its incidence has increased during the last decade in most occidental countries , probably due to increased risk factors responsible for elective prematurity [ 13 ] . it could be associated either with a premature activation of the physiological contracting process or with a pathological factor responsible for uterine contractions , leading to preterm delivery [ 13 ] . among identified pathways for preterm labour , there are uterine overdistension due to multiple pregnancies or polyhydramnios , placental ischaemia , cervical disease , immunologic and allergic phenomena , decidual or retroplacental haemorrhage , fetal endocrine activation intrauterine infections , and inflammatory processes . elective prematurity due to maternal or foetal conditions is becoming a significant cause [ 14 ] . tocolytic drugs have been available for several decades but their actions are directed toward the effects and not the causes of preterm labour [ 1 , 3 , 5 ] . therapeutic strategies available in the literature for stopping preterm labour are discussed in this paper . their efficacy depend on an early and accurate diagnosis of the condition , the fetal fibronectin , and cervical length ultrasonography . drugs safety and side effect profile is a major concern not only for the pregnant women but also for the foetus [ 46 ] . in some clinical conditions such as abruptio and chorioamnionitis , inhibition of uterine contractions and birth delay may be more harmful in terms of outcome and should be avoided [ 2 , 3 ] . another concern is the administration route and the optimal range of gestational age for these treatments . tocolysis aims not only to inhibit uterine contractions but also to allow a safe transfer of the pregnant patient to a tertiary care centre . it gives the opportunity to administrate corticosteroids for preventing neonatal risks associated with prematurity [ 57 ] . it involves the presence of hormonal receptors , ions channels , intercell gap junctions , and regulatory proteins such as oxytocin , endothelin , tachykinin , and angiotensin [ 8 , 9 ] . the increase of intracellular calcium concentration is essential for the uterine smooth muscle contraction . as shown on figure 1 , uterine relaxation may be obtained by interfering with an intracellular messenger responsible for contractile proteins effects : adrenergic receptor agonists , nitric oxide ( no ) donors , magnesium sulphate and calcium channel blockers are tocolytic drugs aiming to this [ 1 , 2 , 6 , 9 ] . atosiban , an oxytocin receptor antagonist and prostaglandin - synthetase inhibitors have this effect by interfering with endogenous myometrial stimulators [ 1 , 2 , 6 , 9 ] . selective 2 agonists such as ritodrine and salbutamol have been used in clinical practice for preterm labour since the 1980s . these drugs impair intracellular cyclic amp concentration and facilitate myometrial relaxation [ 9 , 10 ] . randomized controlled studies and meta - analysis reported that these agents were more efficient than placebo for delaying preterm birth for two days . unfortunately , no benefit for long - term ( tocolytic effect restricted to 7 days ) and perinatal mortality and morbidity rate was found [ 5 , 10 , 11 ] . moreover , even with selective 2 adrenergic receptor agonists , there are significant maternal side effects reported such as tachycardia , dyspnoea , hypokalemia , hyperglycemia , and chest pain [ 5 , 6 , 912 ] . in conclusion , despite their efficiency , 2 agonists ' safety profile is a real concern responsible for therapy discontinuation and choosing alternative tocolytic drugs . no is a powerful vasodilator synthesized during an amino acid oxidation process catalysed by no synthase . it is present in myometrial cells and increases cgmp content by interaction with guanylyl cyclase . there is a specific link between no production and uterine relaxation [ 8 , 9 ] . it was associated to a better tocolytic effect than placebo on delaying delivery for two days . its effect was similar to ritodrine [ 25 ] . as there is no large randomized studies available , the relaxant effect of magnesium sulphate in vitro and in vivo on human uterine contractility has been widely reported . as magnesium is a calcium antagonist , it decreases calcium intracellular concentration and inhibits contraction process [ 2 , 4 , 9 ] . however , in 2002 , a meta - analysis based on 881 patients did not evidence any benefit of magnesium sulphate administration over placebo use in preterm labour . as the drug is crossing the placenta , there were concerns about fetal safety . an increased risk of perinatal death and neonatal adverse effects including neurological and metabolic disorders were reported in some trials using magnesium sulphate treatment at high dosage [ 6 , 13 ] . it can also affect maternal neuromuscular system . over a serum concentration of 9 mg / dl , there is a high toxicity risk resulting in respiratory depression and disappearance of reflexes . there is no evidence any more to recommend this drug as a first - line tocolytic agent [ 2 , 6 , 13 , 14 ] . however , when administered prophylactically at low dose , it was reported to have a neonatal neuroprotective effect in a randomized multicentre trial but this effect should be confirmed in the next future on large randomised controlled studies . prostaglandin - synthase or cyclooxygenase ( cox ) isoforms cox-1 and -2 are essential enzymes for converting arachidonic acid to prostaglandins . prostaglandins are well - known uterine contraction inducer by enhancing myometrial gap junction and increasing intracellular calcium concentration [ 2 , 4 , 5 , 9 ] . indomethacin , a nonspecific cox inhibitor , has been reported in studies and in a recent meta - analysis to be an efficient tocolytic drug compared to placebo , significantly delaying preterm delivery . its use should be restricted in duration and limited to pregnancies below 32 weeks because of fetal ductus arteriosus closure risk and decreased urine production responsible for oligohydramnios [ 3 , 5 , 6 , 17 ] . these treatments also have maternal side effects including gastric ulcer or asthma recurrence [ 3 , 5 , 6 ] . cox-2 inhibitors such as nimesulide or rofecoxib have been studied in animal but not yet in humans and are not actually recommended for preventing preterm labour in clinical practice . in conclusion , indomethacin is an efficient tocolytic drug with no serious adverse drug reaction and is indicated for short - term effect during the second trimester of pregnancy . it blocks in a reversive manner the intracytoplasmic calcium release associated with contractions and downregulates prostaglandin synthesis [ 2 , 9 ] . a first multicentric randomised trial comparing atosiban and ritodrine demonstrated a similar tocolytic effect but fewer adverse effects with atosiban [ 4 , 6 ] . a meta - analysis published in 2005 reported no benefit in terms of preterm delivery rate and neonatal outcome in 1695 patients treated either by atosiban or placebo . however , in europe , many studies were carried out and did not confirm it . atosiban is widely used in clinical practice because of its low side effects profile [ 5 , 6 ] . a german meta - analysis based on 6 randomised trials , among them 3 double blind studies , confirmed a similar tocolytic action for atosiban and adrenergic receptor agonists . a significantly low incidence of adverse effects is reported . moreover , a lower cost saving in terms of hospital length and extra tests for excluding morbidity causes is found for the atosiban treated patients when compared to continuous fenoterol administration controls . in conclusion , atosiban seems to be an adequate therapeutic choice for effective tocolysis with a low maternal and fetal adverse effects profile . nifedipine is the most commonly used drug for preterm labour inhibition at a daily dose of 3060 mg daily . randomised controlled trials report a similar tocolytic effect for nifedipine compared with adrenergic receptor agonists . a cochrane database review meta - analysis published in 2003 , reported a decreased number of deliveries within 7 days following treatment and also , a reduced incidence of neonatal respiratory distress syndrome . a recent systematic review based on 26 trials and 2179 patients confirms a higher efficiency and a lower side effects incidence in the nifedipine group compared to adrenergic receptor agonists - treated patients . these data confirm that nifedipine is a efficient tocolytic agent , with an easy oral route of administration , few side effects , and a low neonatal complications rate . however , it should be used with caution in patients with compromised cardiovascular condition as they may be at risk of pulmonary oedema and cardiac failure . progesterone is a steroid hormone secreted by the corpus luteum and by the placenta after 8 weeks of gestation . it has a physiological effect on uterine quiescence mediated by a direct effect on intracellular calcium concentration and prostaglandin synthesis [ 1 , 2 , 5 , 9 ] . several randomised trials reported a significantly reduced incidence of preterm birth in patients at risk treated either with weekly intramuscular 17--hydroxy progesterone caproate or daily vaginal micronized progesterone [ 24 , 25 ] from 24 to 34 weeks . but these treatments showed no benefit in terms of perinatal mortality and morbidity [ 2 , 5 , 2325 ] . the vaginal route of progesterone administration is associated with less side effects such as sleepiness and headaches [ 4 , 5 ] . although these treatments seem effective in patients with previous history of preterm birth or with a short cervix , it is essential to collect more data in large randomised controlled trials for confirming its potential benefit in the prevention of preterm delivery . infection is one of causal factors of preterm labour with an incidence of 2040% , especially before 30 weeks [ 1 , 2 ] . antibiotics use for preventing preterm labour has been largely studied [ 5 , 2830 ] . in the presence of preterm labour with intact membranes , the prophylactic administration of antibiotics is not recommended as there is little evidence of benefits . but if there is a preterm rupture of the membranes ( prom ) , a meta - analysis based on 22 studies including more than 6000 patients , shows a significant decrease of preterm delivery and chorioamnionitis rate in the treated group . in bacterial vaginosis associated with pregnancy , antibiotics were found to eradicate infection but they showed no effect on the incidence of preterm delivery . in conclusion , prom is the only clinically proved indication for using antibiotics in order to prevent preterm birth . there are many possible interventions aiming to treat this multifactorial syndrome called preterm delivery . as described here , only some drugs have been proved to be effective on the contraction process , but there are no clear evidence of associated improved neonatal outcome . some drugs are used as first - line single therapy such as adrenergic receptor agonists and atosiban in europe [ 11 , 12 ] . in severe cases , combined therapy a dutch prospective study based on 1920 women , reported that the overall incidence of severe adverse effect is doubled when a multiple - drug regimen is chosen . the literature review evidences that there are still insufficient data regarding some therapies such as the effectiveness of progesterone in the absence of previous medical history and the role of antibiotics , bed rest , and maintenance therapy [ 5 , 31 ] . specific conditions are subject to discussion : in multiple pregnancies , expanded blood volume and anaemia may predispose to pulmonary oedema when tocolytic agents such as adrenergic receptor agonists , magnesium sulphate , and calcium channel blockers are prescribed . in these pregnancies , atosiban , with its low side effects incidence , seems to be the safest choice . the role of tocolysis in prom allows pregnancy prolongation for corticosteroids administration but has not been reported to significantly improve neonatal outcome . there is no clinical evidence on published trials and systematic review to justify tocolytic therapy maintenance except for atosiban . a critical review about tocolysis points to the potential risk of delaying preterm delivery specially in case of infectious or inflammatory process and does not evidence an improved neonatal outcome as tocolysis prevalence of preterm birth has increased during the last decades and it is a real public health concern . management with tocolytic drugs aims to stop uterine contractions and to prevent neonatal risks associated with prematurity by in utero transfer of the pregnant patient in a tertiary specialized centre and by corticosteroids administration [ 1 , 2 , 7 ] . our review of several studies and meta - analyses reported on table 1 confirm the efficacy of adrenergic receptor agonists , prostaglandin - synthetase inhibitors , and atosiban for delaying delivery for 2448 hours [ 2 , 5 , 6 , 10 , 11 , 17 ] . in terms of maternal and fetal safety , the overall prevalence of severe side effects associated with tocolysis is around 1% and is more frequent in multiple therapies , multiple gestation , and preterm rupture of the membranes . atosiban is our first choice drug for safety , followed by prostaglandin - synthase inhibitors and nifedipine [ 2 , 5 , 6 , 12 , 27 ] . for the future , tocolytic drugs development should aim to reach a better efficacy in terms of pregnancy prolongation and a lower adverse effects profile . a better understanding of the regulation of myometrial contractility and the detection of specific maternal or fetal parameters should be used for new tocolytic strategies . last generation of oxytocin receptor antagonists such as barusiban could be more efficient and have less affinity for the vasopressin receptors . specific cox-2 inhibitors or coxibs , prostaglandin receptors antagonists could be promising tocolytic alternatives [ 2 , 4 , 9 , 18 ] .	the aim of this paper is to review available data about drugs for preventing preterm labour . tocolytic therapy includes adrenergic receptor agonists , no donors , magnesium sulphate , prostaglandin - synthase inhibitors , oxytocin receptor antagonists , calcium - channel blockers , progesterone , 17--hydroxyprogesterone caproate , and antibiotics . their specific effects on myometrial contractility , their safety , their efficiency , and side effects profile for the mother and the fetus are presented . the main question of why and for what reasons tocolysis should be administrated is discussed .
You are an expert at summarizing long articles. Proceed to summarize the following text: fermented sausages such as salami and pepperoni are commonly considered safe for consumption , and the acidification by lactic acid starter bacteria is one of the main preserving factors . nevertheless , outbreaks of serious sausage - borne gastrointestinal infections with pathogens such as verocytotoxic ( shigatoxic ) escherichia coli ( vtec / stec ) , salmonella , and listeria monocytogenes do occur regularly ( 1 ) . for example , in a 2006 outbreak in norway , 17 people with sausage - borne vtec infections ( 10 of them children < 9 years old ) were treated for renal failure or hemolytic uremic syndrome , with one fatal outcome ( 2 ) . although fermented beef products have been identified as potential health hazards ( 3 ) , it is largely unclear when and why fermented sausages pose a risk to consumers . we tested the hypothesis that statutorily tolerable levels of veterinary antibiotics in meat pose a food safety threat associated with sausages by inhibiting microbial starter cultures and fermentation , thus allowing pathogens to multiply during processing ( 4 ) . sausage processors typically initiate fermentation with lyophilized starter cultures that produce large amounts of lactic acid , and the rapidly decreasing ph levels prevent growth of pathogenic bacteria . such starter bacteria are primarily selected for production purposes . therefore , most strains of lactic acid bacteria are highly sensitive to antibiotics , and commercial suppliers even take care not to provide strains that carry antibiotic resistance genes ( 5 ) . still , antibiotics are used extensively and widely in livestock farming for treatment , control , and prevention of animal diseases as well as for production purposes , e.g. , to enhance growth or improve feed efficiency . as a consequence food safety regulation in many countries sets maximum tolerable levels of microbial residues . in the european union ( eu ) , these are called maximum residue limits ( mrl ) ( 6 ) , whereas in the united states , the food and drug administration ( fda ) has defined tolerance levels ( tl ) , and violations , where the measured antibiotic concentrations in meat exceed the mrl / tl , are registered . national residual monitoring programs showed violations in 0.2 to 1.0% of sampled beef and pork meat in the eu and united states in 2009 ( 7 , 8) , with 0.4% of bovine animals and 0.05% of pigs being required to be controlled in the eu ( 8) . meat samples violating the tolerance levels are withdrawn from the food chain , but not all violations are caught in the monitoring programs . furthermore , many countries lack monitoring or reporting of sales and data on use of antibiotics ( 9 ) , and the frequency of inspection of imported meat is low ; e.g. , in the united states in 2009 , 3,872 imported meat samples were analyzed for chemical contamination ( 7 ) . shortcomings in the current screening methods are likely to cause underestimation of noncomplying products , and there is a need for development and implementation of more adequate residual screening methods ( 10 ) . here , we evaluated six commercially available starter cultures that are widely used for sausage production ( bactoferm fsc-111 , f1 , and t - spx [ c. hansen , hoersholm , denmark ] and bitec advance rd-1 , ls-25 , and ls-25 - 2 [ gewrzmller , korntal - mnchingen , germany ] ) . the starter cultures are all a mixture of two or three species , including both lactic acid - producing bacteria , which are important for ph control , and coagulase - negative cocci , which are important for flavor formation . the starter cultures used in this study contain either ( i ) pediococcus pentosaceus in combination with staphylococcus xylosus ; ( ii ) lactobacillus sakei in combination with staphylococcus carnosus ; or ( iii ) lactobacillus curvatus , s. carnosus , and kocuria varians . in broth experiments , we found that under laboratory conditions ( de man , rogosa , and sharpe broth [ mrs ] , ph 6.1 ) , all six starter cultures were sensitive to three commonly used veterinary antibiotics ( oxytetracycline , erythromycin , and penicillin ) ( fig . 1 ) at or near the levels designated as tolerable ( tl or mrl ) . as expected , acidification correlated well with starter culture growth after 20 h incubation at 25c . importantly , in the presence of antibiotics at or close to the tolerable concentrations , only minor acidification occurred , with a final ph of 6 , whereas in the absence of antimicrobials , the final ph was 4.3 . six commercial starter cultures were inoculated in mrs broth ( oxoid ) at an absorbance at 600 nm of 0.05 in the presence or absence of oxytetracycline ( a ) , erythromycin ( b ) , or penicillin ( c ) . after incubation at 25c for 20 h , absorbance ( bars ) and ph ( dots ) were measured . arrows mark the tolerance levels ( tl , set by the fda ) for residual tetracyclines ( 2 g ml ) or the maximal residual limits ( mrl , set by the eu ) for penicillin ( 0.05 g ml ) and erythromycin ( 0.2 g ml ) . to evaluate the impact of residual antibiotics on fermentation , we created standardized 50-g model sausages stuffed in 60-ml plastic syringes ( 11 ) using a recipe that resembles those of traditional european sausages ( minced beef or pork meat , 3% nacl , 100 ppm sodium nitrite , 0.7% dextrose , and starter culture , according to the manufacturer s recommendations ; 25 g kg meat batter ) . fermentation was monitored in terms of ph decrease after 48 h of incubation at 25c . model sausages ( controls ) fermented by any of the starter cultures had an average end ph of 4.75 0.07 after fermentation , whereas spontaneous fermentation in meat without addition of starter cultures resulted in a final ph of 5.45 0.12 ( n 12 for each condition ) . in contrast , we found that with the addition of erythromycin at the mrl concentration , fermentation was significantly reduced in five of the six starter cultures , resulting in an average end ph of 5.16 0.34 . also , the presence of oxytetracycline at the tl concentration reduced fermentation in three of the six starter cultures , resulting in an average end ph of 4.84 0.14 . it was reported in 1998 that commercial starter cultures are susceptible to low levels of antibiotics like erythromycin , penicillin , tylosin tartrate , and ceftiofur hydrochloride ( excenel ) , leading to inhibited starter culture performance in meat ( 12 ) , and this problem seems to be overlooked , as the continuous development of starter cultures has failed to addressed the issue . the influence of residual antibiotics on pathogen survival and viability was evaluated using reporter strains of escherichia coli o157:h7 and salmonella enterica serovar typhimurium uk1 that express high levels of bioluminescence ( 13 ) . model sausages were inoculated with e. coli or s. typhimurium to a level of 2 10 to 4 10 cfu g , as determined by selective plating , by harvesting 10 ml of lb cultures at an absorbance at 600 nm of 1.0 by centrifugation ( 5,000 g for 5 min ) and resuspending pellets in sterile , saline ( 0.9% ) water before inoculation . bioluminescence signal intensities were used to measure pathogen viability in relative light units ( rlu , in photons s cm ) in a xenogen ivis100 imaging system ( xenogen , alameda , ca ) before and after fermentation . importantly , high - level pathogen bioluminescence was observed only in sausages with residual erythromycin present at twice the mrl ( 0.4 g g ) and not in control sausages without antibiotics ( fig . furthermore , in sausages without antibiotics , fermentation reduced the number of pathogens by 1 log unit ( accompanied by a 3- to 4-log - unit decrease in bioluminescence ) , whereas in the presence of erythromycin at twice the mrl ( 0.4 g g ) , no reduction neither in pathogen counts nor bioluminescence levels was observed ( fig . this suggests that , at a level close to the mrl , erythromycin can render the starter culture ineffective during sausage processing and enable pathogen survival . ( a ) bioluminescent imaging after 48 h of fermentation at 25c on triplicate 1-g sausage samples inoculated with the e. coli o157:h7 reporter strain without ( lower row ) and with ( upper row ) the addition of erythromycin ( 0.4 g g ) . ( b ) selective e. coli o157:h7 and ( c ) s. typhimurium counts ( bars ) and relative light units ( rlu ; dots ) in model sausages after fermentation ( 48 h , 25c ) . each bar or dot shows the value for one representative of three biological replicates , measured in three technical replications . erm , erythromycin ( 0.4 g g ) ; otet , oxytetracycline ( 2.0 g g ) . starting counts before fermentation were 2.9 10 to 3.3 10 cfu g for e. coli and 1.7 10 to 2.5 10 cfu g for s. typhimurium . the resistance of starter cultures to veterinary drugs was investigated previously ( 12 , 14 ) , but in contrast to earlier studies , our study shows that starter cultures can be affected by antibiotics at levels that are probable and even tolerable in meat , which highlights the importance for food safety . we conclude that sausages prepared from meat with residual concentrations of antibiotics at or close to levels deemed tolerable by u.s . and eu regulators can lead to full or partial fermentation failures and thus to food products capable of causing serious food - borne infections . there is a general lack of knowledge about the decay of antibiotics in meat or the state of the residuals , and we can only mimic the state of the antibiotics in meat . one of the common methods for qualitative screening of antibiotic residuals in muscle tissue relies on microbiological activity against sensitive bacterial strains ( 15 ) , but this and other applied detection methods are reported to be insensitive or inadequately accurate ( 10 , 15 ) . we suggest that fermentation disruption could occur in single batches in a production and that random sampling could leave some fermentation failures undetected . some smaller sausage producers , including local butcher shops , altogether lack adequate ph control ( 16 , 17 ) . our results indicate that fermentation during sausage production should be monitored closely to reduce food safety risks . at present , no data on the use of antibiotics in livestock farming worldwide are collected systematically ( 9 ) . our work reveals an overlooked risk associated with the presence of veterinary drugs in meat . the results add to a large body of research pointing to adverse effects of antibiotics in food , and this may prompt legislators to reconsider the criteria behind the establishment of tolerance levels .	abstractfermented sausages , although presumed safe for consumption , sometimes cause serious bacterial infections in humans that may be deadly . not much is known about why and when this is the case . we tested the hypothesis that residual veterinary antibiotics in meat can disrupt the fermentation process , giving pathogenic bacteria a chance to survive and multiply . we found that six commercially available starter cultures were susceptible to commonly used antibiotics , namely , oxytetracycline , penicillin , and erythromycin . in meat , statutorily tolerable levels of oxytetracycline and erythromycin inhibited fermentation performance of three and five of the six starter cultures , respectively . in model sausages , the disruption of meat fermentation enhanced survival of the pathogens escherichia coli o157:h7 and salmonella enterica serovar typhimurium compared to successful fermentations . our work reveals an overlooked risk associated with the presence of veterinary drugs in meat .
You are an expert at summarizing long articles. Proceed to summarize the following text: ewing 's sarcoma ( es ) is a small , round , blue cell malignancy that most commonly arises in the skeleton of adolescents and young adults ( 1 ) . a rare subset of es , known as extraskeletal ewing 's sarcoma ( ees ) arises in soft tissue rather than in relationship to bone . the principal sites of ees are the chest wall , lower extremities , and paravertebral region . the head and neck have seldom been involved as the primary site of ees ( 2 - 5 ) . here we report a case of extraskeletal es of the hard palate in a young man aged 34 yr . to our knowledge a 34-yr - old male patient was admitted our hospital with a painless swelling of the left hard palate ( fig . it was incidentally detected 4 months previously with a maximum diameter of 3 cm , and did not exhibit ulceration . a paranasal sinus ct - scan revealed a contrast - enhancing mass lesion in left side hard palate with focal bony destruction ( fig . the tissue specimen was fragmented containing several pieces of solid mass and the cut surface was pale tan without showing hemorrhage or necrosis . histological examination of hematoxylin - eosin stained sections showed a homogeneous population of closely packed small neoplastic cells with abundant fibrovascular stroma ( fig . most of the individual cells had scanty cytoplasm , indistinct borders and round or oval nuclei with fine powdery chromatin ( fig . some of the tumor cells had a moderate amount of intracytoplasmic glycogen as demonstrated by pas stain totally abolished after diastase pretreatment . the tumor cells were positive for cd99/mic2 and vimentin and negative for ; the leukocyte common antigen , pancytokeratin , cytokeratin 7 , neuron - specific enolase , chromogranin , synaptophysin , smooth muscle actin and s-100 protein . the cd99/mic2 stain exhibited strong membranous staining ( fig . ultrastructurally , the tumor cells showed a few intracytoplasmic organelles without evidence of neurosecretory granules or neurofilaments . the rt - pcr showed the presence of the ews - fli-1 fusion transcript , which is of the t(11;22 ) translocation characteristic of es and primitive neuroectodermal tumor ( fig . the patient was treated with multiagent chemotherapy with ifosfamide , cisplatin and etoposide combined with 6,800 cgy of radiotherapy . es is one of the most controversial tumors . ever since its first description by james ewing ( 6 ) as a " diffuse endothelioma " , remarkable evolution in the concepts regarding its histogenesis and relation with other small round cell tumors , including primitive neuroectodermal tumor ( pnet ) . recent immunoperoxidase and cytogenic studies indicate that pnet and es are the same entity showing varying degrees of neuroectodermal differentiation and they are categorized into a group known as the ewing family of tumors ( 7 , 8) . some studies require histologic evidence of rosette formation , others require immunohistochemical evidence of neural differentiation , with or without rosettes for a diagnosis of pnet . schmidt et al . ( 9 ) suggested that a tumor was designated a pnet if it had homer - wright rosettes on light microscopy or co - expressed two or more neural markers by immunohistochemistry . using these criteria , they found that patients with pnet had a more aggressive clinical course than those with ees . in our case , tumor cells showed no rosette formation and were negative on immunohistochemical stains for neuron - specific enolase , s-100 protein , chromogranin , and synaptophysin . the cd99/mic2 identified by the 013 antibody , which is a useful immunohistochemical marker for es ( 10 ) . cd99/mic2 is a cell surface glycoprotein found in virtually all es and pnet , having been shown in up to 98% of es and pnet . but it is also detected other small round cell tumors in the differential diagnosis such as t - lymphoblastic lymphoma , poorly differentiated synovial sarcoma , small cell osteosarcoma , rhabdomyosarcoma , desmoplastic small round cell tumor , small cell carcinoma , and merkel cell carcinoma and it should be used as part of a panel of immunostains , given it 's lack of complete specificity ( 11 ) . the current case could exclude the possibility of other small round cell tumors , such as lymphoma , rhabdomyosarcoma , poorly differentiated synovial sarcoma , by negative immunoreactivities for leukocyte common antigen , desmin , and cytokeratin ( 9 ) . although the exact etiology remains unknown , more than 95% of es / pnet show the characteristic translocation t(11;22)(q24;q12 ) or the variant t(21;22)(q22;q12 ) ( 7 ) . these translocations fuse the 5'portion of the ews gene on chromosome 22q12 to either fli1 on 11q24 or erg on 21q22 . the resultant fusion genes ( ews / fli1 or ews / erg ) express chimeric proteins , which are capable of cell transformation and act as aberrant transcription factors . identification of the fusion transcripts ews / fli1 or ews / erg by rt - pcr or fluorescent in situ hybridization serves as a sensitive and specific diagnostic test for es / pnet . various therapeutic modalities have been developed ( 12 ) . early and confident diagnosis coupled with modern chemoand radiotherapy this approach has been successful in our patient : surgical excision followed by chemotherapy and radiotherapy resulted in no clinical evidence of recurrence by the nine - month follow - up examination .	extraskeletal ewing 's sarcoma ( ees ) is a rare soft tissue tumor morphologically indistinguishable from the more common ewing 's sarcoma of bone . we report a case of ees arising in the hard palate of 34-yr - old male patient . microscopically , the monotonous small round cells without neuronal differentiation showed membranous positive immunoreactivity for mic2/cd99 and vimentin . ultrastructurally , the tumor cells showed a few intracytoplasmic organelles without evidence of neurosecretory granules or neurofilaments . the ews - fli1 chimeric gene was identified using the nested reverse transcriptase - polymerase chain reaction .
You are an expert at summarizing long articles. Proceed to summarize the following text: foot and mouth disease ( fmd ) is one of the highly contagious diseases of domestic animals , caused by foot - and - mouth disease virus ( fmdv ) , a member of the family picornaviridae , which has a colossal global impact , due to the huge number of animals affected . the fmd endemic countries collectively contain three - quarters of the world 's population ( robinson et al . , 2011 ) , indicating the global economic significance of the disease . at the national level in india , annual total economic loss due to fmd ranges from rs 12,000 crore to rs 14,000 crore ( singh et al . , 2013 ) . in spite of all the control measures taken , fmd continues to be an economically important disease in india due to poor surveillance and inadequate control programs . understanding of the mechanism of foot - and - mouth disease virus ( fmdv ) infection and replication of this virus is important to the control of this worldwide menace ( alexandersen et al . , 2003 , longjam et al . , 2011 ) . a vital question that has yet to be addressed concerns the role of viral receptors in the pathogenesis of fmd . integrins are the biologically important set of proteins used by the cells to bind and respond to the extracellular matrix which belong to a large family of integral membrane receptors that is required for cell adhesion . functionally active integrins consist of two noncovalently bound transmembrane glycoprotein subunits viz , alpha ( ) and beta ( ) ( springer , 2002 ) . evidence suggested that virus binding and infection of the integrin 6 ( itgb6 ) transfected cells are mediated through an rgd - dependent interaction ( baxt and becker , 1990 , jackson et al . , 2000 , mason et al . , 1994 ) . considering the role of host itgb6 receptor gene , the aim of the present study was to screen genetic variation within a snp ( rs136500299 ) at exon 14 region among different indigenous cattle . the polymorphism t / c is located at position 2145 of the reference itgb6 mrna and produces a missense change phe / ser in the position 667 of the polypeptide . previously , this polymorphism has been reported at least ten times : ss250661448 , ss263658018 , ss415630763 , ss420604742 , ss422472086 , ss679762826 , ss752601716 , ss828200981 , ss907724252 , and ss942564461 . in this study , we describe an accurate method on the basis of competitive polymerase chain reaction ( pcr ) so called tetraplex arms pcr , for identification of the snp among different animals . for analyzing the scenario of targeted snp among different zebu cattle , a total of 148 animals of different indigenous breeds of cattle { sahiwal ( 51 ) , kankrej ( 48 ) , ongole ( 38 ) and gir ( 11 ) } from different agricultural zones were used in the study . blood samples were collected from all the animals by jugular vein puncture using sodium heparin ( 10 iu / ml ) as an anticoagulant . immediately after collection , blood samples were stored in a portable refrigerator at 4 c , transported to the laboratory , and stored at 80 c until dna extraction . chloroform extraction method ( sambrook and russell , 2001 ) and the purity of genomic dna was assessed spectrophotometrically . the tetra - primer pcr procedure ( ye et al . , 2001 ) was used for genotyping the snp ( rs136500299 ) at exon 14 region of itgb6 receptor gene . the method employs four primers to amplify a fragment from dna containing the snp and amplicons representing each of the two allelic forms . primers can be designed to amplify fragments of differing sizes for each allele band in order for them to be easily resolved using agarose gel electrophoresis . details of the primer used for the present study and the amplicon size for different genotypes were shown in table 1 . pcr was performed in a total volume of 25 l containing approximately 50 ng dna , 2.5 l of 10x buffer , 2.0 mm mgcl2 , 0.2 mm dntps , 5 pmol of each outer primers , 10 pmol of each inner primers and 1 u of taq polymerase ( sigma aldrich , usa ) . the polymerase chain reaction ( pcr ) protocol was 94 c for 5 min , followed by 35 cycles of 94 c for 30 s , annealing at 55 c for 30 s and 72 c for 30 s , and a final extension at 72 c for 10 min . the pcr products were separated on 1.0% agarose gel ( sigma aldrich , usa ) including 0.5 g / ml of ethidium bromide and photographed under gel documentation system ( alpha imager ep ) . validation of the three different genotypes was analyzed by cloning and sequencing the 433 bp pcr products for each genotype . gene ( allele ) and genotype frequencies of itgb6 receptor gene were calculated by direct counting method . the four populations were tested for hardy weinberg equilibrium using proc allele ( sas inst . cary , nc ) . the chi - square ( ) test was used to find the difference in genotype frequencies in different breeds . the present study was aimed to develop a single tube tetraplex pcr based genotyping assay for snp ( rs13650029 ) at exonic region of bovine itgb6 receptor gene . snp genotyping techniques depend on amplification of the target dna using pcr technique , but differ in the means of discerning between the different alleles , which involves significant post - amplification manipulations . for instance , the restriction fragment length polymorphism typing method based on digestion of amplified pcr products with suitable restriction endonuclease . another extensively used snp typing technique allele specific oligonucleotide ( aso ) melting involves lengthy blotting and hybridization techniques . tetra - primer arms pcr method described in the present context circumvents the limitations of the earlier mentioned techniques . the technique used in the present study involves a single step pcr protocol with two sets of primers to detect the different banding pattern , without the downstream processing like re digestion or hybridization . the primers were designed in such a way to amplify fragments of differing sizes for each allele , in order to resolve differentially in agarose gel electrophoresis . the method described in the present study is a simple , swift and cost - effective method for snp genotyping in large number of individuals ( ye et al . , 2001 ) . correspondence between arms pcr and sequencing confirmed three genotype pattern of the targeted snp at exon 14 region of bovine itgb6 gene among different zebu cattle breeds ( fig . 1 ) . genotyping revealed that , the genotype tt is widely distributed among the targeted zebu cattle breeds . the study revealed that the frequency of t allele was higher in indigenous populations compared to the c allele . this trend was mostly seen in all the breeds except sahiwal where the heterozygotic frequency was comparatively higher , even though the difference is not statistically significant ( table 2 ) . the test for hw equilibrium among different populations showed that all the breeds were under equilibrium with respect to the itgb6 receptor gene indicating the absence of aggressive selection i.e. selection primarily based on this gene ( p > 0.05 ) . the frequency of animals having cc genotype was lowest in all the four breeds . in order to study the variation in the genotype frequencies among different indigenous breeds of cattle , the result showed in table 3 indicates that the genotype frequencies were not statistically different ( = 7.900 , p = 0.2455 ) among the breeds indicating that all the populations are having similar genetic constitution with regard to the itgb6 receptor gene . the snp ( rs136500299 ) t / c located at position 2145 of the reference itgb6 mrna produces a missense change phe / ser . serine is a polar amino acid with its smaller size , whereas phenylalanine is an aromatic amino acid with complex structure . thus it may be presumed that changes of amino acid may alter the conformational changes of the itgb6 receptor coding polypeptide , which however , needs to be confirmed through further studies . the results of the present study suggest that t allele is widely distributed among the indigenous breeds of cattle which can be associated with the resistance to fmd virus , as the susceptibility to fmd virus is lower than the tauras breeds . however , studies with larger sample sets and wide range of cattle breeds are still needed to confirm the exact genetic distribution pattern of the snp .	the present study was aimed to screen genetic variation within a snp ( rs136500299 ) located at exon 14 region of bovine itgb6 gene among different zebu cattle breeds . the genotyping method describe in the present study is a tetraplex arms pcr , which offers extremely fast , economical , and simple detection tool . the distribution of the itgb6 genotypes among the different breeds studied suggested that the populations were under hardy weinberg equilibrium . our findings revealed that tt genotypes are widely distributed among different zebu cattle breeds , which can be associated with the resistance to fmd virus , as the bos indicus are more resistant to fmd virus in comparison to bos taurus .
You are an expert at summarizing long articles. Proceed to summarize the following text: cerebral palsy includes a group of nonprogressive movement disorders due to brain lesions or abnormalities in early development . its prevalence of 2 per 1000 newborns overall rises to 77 per 1000 preterms born at below 28 0/7 weeks of gestation [ 2 , 3 ] . a major cause is cystic periventricular leukomalacia ( cpvl ) comprising necrosis and subsequent cyst formation of the periventricular white matter : 60100% of children with cpvl develop cerebral palsy [ 46 ] . although the etiology and pathogenesis of cpvl remain unelucidated , several perinatal risk factors appear involved . chorioamnionitis is thought to provoke a fetal inflammatory response syndrome associated with increased fetal cytokines that may lead to neonatal brain injury . several studies indicate that the cytokines can themselves damage white matter without bacteremia being required [ 815 ] . an important predictor of chorioamnionitis is preterm prelabor rupture of membranes ( pprom ) . chorioamnionitis is quite common and often subclinical : fever and inflammatory marker elevation are rare in the early stages , making diagnosis difficult . against this background the risks of prematurity from immediate delivery have to be balanced against those of ascending intrauterine infection and its probable consequences . moreover subclinical chorioamnionitis is believed to cause pprom . at a gestational age below 34 0/7 weeks , half the gynecologists in australia and new zealand preferred to induce labor , while the other half chose conservative management . a cochrane review from 2010 found no evidence about which strategy is favorable . despite a lack of randomized studies new british and german guidelines advise active management before 34 weeks and active management between 34 and 36 weeks . zurich university hospital has hitherto favored conservative management , delaying delivery until clinically mandatory , on the grounds that the higher mortality and morbidity of newborns at lower gestational age are proven whereas the effect of increasing cpvl risk by prolonging pregnancy remains unknown . the more limited objectives of the present study were to identify the risk factors for pvl in the conservative pprom management setting and determine whether prolonging gestation outweighs the risk of cpvl due to chorioamnionitis . the study population comprised all babies with cpvl born in zurich university hospital 's obstetric department between 1993 and 2008 . cranial ultrasound was obtained in infants with gestational age below 32 0/7 weeks or birth weight below 1500 g at days 1 , 3 , and 7 of life and repeated weekly until hospital discharge . all 6440 infants born between 2005 and 2007 and not affected by pvl served as controls . during the study period women with premature contractions received tocolytic drugs ( hexoprenaline only until 2001 , nifedipine or hexoprenaline from 2002 to 2008 ) for 48 hours to allow lung maturation with 24 mg of betamethasone . urinary tract infection or bacterial vaginosis was treated with antibiotics ( co - amoxiclav or clindamycin ) . steroids were repeated every 10 days until 2002 . since then , all women with threatened preterm delivery have received a single course of steroids . after pprom co - amoxiclav was used until 2001 when it was changed to erythromycin , chorioamnionitis was monitored using blood tests ( including leukocytes and c - reactive protein ( crp ) 12 hourly for the first 48 hours ) , maternal temperature , and fetal heart rate . clinical chorioamnionitis ( 3 of following markers : leukocytes > 20,000/l , crp > 40 mg / dl , maternal temperature > 38c , maternal tachycardia > 100 bpm , and fetal tachycardia > 160 bpm ) was treated with antibiotics ( co - amoxiclav ) and prompt delivery . if the diagnosis was uncertain , delivery was deferred until chorioamnionitis became clinically obvious or delivery could be delayed no longer for other reasons . diagnosis was based on placental histology , positive amniotic fluid cultures sampled at cesarean section , or clinical parameters . babies born below 25 0/7 weeks were excluded in both groups because in most instances neonatal care was restricted to comfort care . the risk factors recorded in both groups were chorioamnionitis , pprom - delivery interval , gestational age at delivery , birth weight , gender , race , and parity . all statistical analyses were performed with stata 10 statistics / data analysis software ( stata corporation , college station , tx ) using pearson 's test for comparisons of frequencies and wilcoxon 's rank - sum test for group comparisons . subsequent to univariate analysis , multivariate logistic regression was performed to test the impact of factors such as chorioamnionitis , gestational age , birth weight , gender , and pprom - delivery interval on the incidence of cpvl . the results were used to calculate the risks of developing cpvl at different fetal weights and pprom - delivery intervals . given that the analysis was of anonymized data , the study was exempt from local institutional review board approval . follow - up data of study preterms below 32 0/7 weeks were extracted from the prospective national database of the swiss neonatal network & follow - up group . according to the recommendations of our research ethics committee between 1993 and 2008 , 32,276 infants were born at zurich university hospital , including 6027 ( 18.7% ) preterms ( below 37 0/7 weeks ) ; over the same period 32 cases of cpvl were recorded , representing an overall prevalence of 0.99 ( tables 1 and 2 ) . cpvl prevalence among preterm infants was 5.3. all 32 infants with pvl were delivered preterm and all but one before 34 0/7 weeks . cpvl risk decreased exponentially with increasing birth weight ( figure 1 ) and increasing gestational age . males were 3 times more affected than females ( male : female ratio 24 : 8) . all birth weights in newborns with cpvl were less than 2500 g ( table 1 ) . the individual pprom - delivery intervals of all pvl cases are shown in figure 2 . of the 32 infants , five ( 16% ) died within the first 6 weeks after birth . of the 27 surviving infants , three ( 11% ) were lost to follow - up ( parental refusal ) , while 24 ( 89% ) were neurodevelopmentally assessed at a median ( range ) age of 3.8 years ( 2.010.2 years ) : one ( 4% ) was normal , nine ( 38% ) were moderately disabled , defined as cerebral palsy grade <3 according to the gross motor function classification system ( gmfcs ) , or cognitive impairment with developmental quotient 5569 , or moderate visual or hearing impairment , and 14/24 ( 54% ) were severely disabled , defined as disabling cerebral palsy ( grade 35 gmfcs ) , or severe cognitive disability with developmental quotient < 55 , or major visual or hearing impairment . a further two infants , for whom placental histology was missing , had 3 markers of clinical chorioamnionitis : leukocytes > 20,000/l , crp > 40 mg / dl , maternal temperature > 38c , maternal tachycardia > 100 bpm , and fetal tachycardia > 160 bpm . thus , 18/32 cases ( 56% ) were classified as having been complicated by chorioamnionitis . two cases were assigned to the nonchorioamnionitis group despite the absence of placental histology and a number of clinical parameters . review of the placental histology and clinical parameters reduced these to 71 cases of histological chorioamnionitis and two cases of clinical chorioamnionitis in the absence of placental histology . preliminary logistic regression revealed significant associations between cpvl and chorioamnionitis , male sex , and birth weight . chorioamnionitis had the highest impact on cpvl risk ( or 35.9 , 95% ci 12.6102.7 ) . however , because a prenatal diagnosis of chorioamnionitis is often not possible , logistic regression was performed , replacing chorioamnionitis by the pprom - delivery interval . this revealed significant impacts on cpvl by sex ( p = 0.008 ) , pprom - delivery interval > 48 hours ( p < 0.001 ) , and fetal weight ( p < 0.001 ; table 3 ) . further multiple logistic regression analyses revealed significant associations between chorioamnionitis and pprom - delivery interval > 24 hours ( p = 0.002 ) and gestational age ( p < 0.001 ) . no significant influence of ethnicity ( p = 0.49 ) , fetal weight ( p = 0.37 ) , or parity ( p = 0.79 ) was observed . according to logistic regression analyses tabulation of estimated cpvl incidence at varying pprom - delivery intervals and birth weights for boys and girls ( table 4 ) , assuming fetal weight gain of 200 g / week , revealed a slight rise in the first 48 hours , followed by a significantly lower risk after the first and second week of prolongation of pregnancy . increasing fetal weight during pprom latency had a far stronger protective effect despite a prolonged pprom - delivery interval being a risk factor for cpvl . this accounts for the high prevalence of preterm deliveries compared to the national average ( 19% versus 9% ) . the prevalence of cpvl in our study group ( 0.99 ) appears lower than the few reports in the literature . hamrick et al . reported an incidence of 1.8% at uc san francisco in 1992 , falling to 0.2% in 2002 ; the incidence of cpvl in children weighing < 1500 g decreased from 2.9% to 0.5% over the same period . the difference may be partly due to zurich 's conservative management of newborns below 25 0/7 weeks of gestation ( restriction to comfort care in the majority of cases ) . we may also have missed some cases of late cpvl diagnosis in children born after 32 0/7 weeks ( there were no instances of late diagnosis of brain lesions in preterms included in long - term follow - up ) . given our small sample size , we could only extrapolate cpvl incidence for birth weights < 1000 g ( figure 1 ) . the vermont oxford network reported approximately 3% cpvl at birth weights 7511500 g ; risk was highest ( 6% ) at birth weights < 751 g . our data confirm the reported exponential decrease in cpvl incidence with increasing birth weight [ 28 , 30 ] . they also confirm a similar exponential decrease with advancing gestational age independently of birth weight . again , our data at below 26 0/7 weeks are not comparable to other centers due to our conservative management of newborns around 25 0/7 weeks . our data support the dependency of cpvl risk on the pprom - delivery interval [ 8 , 31 ] , but not on either low parity or prom [ 8 , 10 , 31 ] . the finding of a 4 : 1 male / female ratio confirms previous reports [ 8 , 15 , 31 ] but remains unelucidated . we also confirmed the several reports of a significant association between cpvl and chorioamnionitis [ 8 , 9 , 11 , 14 , 15 ] . the fact that only one cpvl baby had a positive blood culture within 3 days of birth supports the hypothesis that fetal inflammatory response syndrome is perfectly capable of causing brain damage even in the absence of bacteremia [ 3234 ] . apart from being a risk factor for cpvl , chorioamnionitis is well - recognized as correlating with neonatal morbidity and mortality [ 3234 ] . unfortunately , these risk factors can not resolve our strategic dilemma of immediate versus delayed delivery for lowering short - term mortality and long - term sequelae . chorioamnionitis is a major complication of pprom but probably even more often the cause of pprom . the increase in cpvl risk during the first 48 hours after pprom and the substantial decrease thereafter at varying birth weights and pprom - delivery intervals ( table 4 ) can be interpreted in several ways . for example , the initial increase may relate to the use of antenatal steroids to induce lung maturation . steroids could facilitate the spread of bacterial infection ; they could also modulate the fetal inflammatory cytokines thought to cause brain damage . corroborative evidence is that the incidence of cpvl in our group decreased from 1.3 on repeated steroid courses to 0.7 on single - course steroids ( although we must admit to having concomitantly switched to erythromycin and introduced nifedipine tocolysis ) . this study could not add any information about the impact of the different changed interventions to the lower cpvl incidence 20022008 . another explanation is that the inverted u - shaped risk for cpvl with respect to the pprom - delivery interval results from superposing two distinct groups of women : one with pprom due to chorioamnionitis and the other with pprom from a noninfectious cause . thus , women still pregnant after one week of pprom are more likely to have a noninfectious cause of fluid leakage . as a consequence , delaying delivery in these cases would lower cpvl risk by allowing birth weight to increase . at the same time , by increasing gestational age and birth weight , this strategy would substantially decrease all other complications of prematurity such as cerebral hemorrhage or lung pathology . an increased risk for neurodevelopmental impairment in the first 48 to 72 hours after pprom was also observed in a large french cohort with 1884 infants born at 2432 weeks of gestational age . given this strong association between cpvl and chorioamnionitis , it is absolutely essential to diagnose intrauterine infection as early as possible . this points once again to the urgent need for a tool that reliably diagnoses chorioamnionitis . in the absence of such a tool because cpvl affects only a small proportion of newborns , with other problems of prematurity playing a much larger role , it seems not unreasonable to pursue a conservative strategy until prospective randomized trials provide a definitive answer or , at the least , until we have a reliable test for the early diagnosis of chorioamnionitis . perinatal morbidity is strongly correlated with prematurity and latency does not appear to worsen outcome in pprom . the fact that chorioamnionitis and the pprom - delivery interval seem to have a high impact on the risk of developing cpvl in our study could have important consequences for the future management of pprom . the strengths of this study are that all infants and mothers were monitored in the same department and that all preterms below 32 0/7 weeks received long - term follow - up , where possible ( the actual follow - up rate was 89% ) . only in midstudy were there any relevant changes in the management of pprom ( antibiotics , tocolytic , and steroid courses ) . we had particularly few birth weights below 1000 g , partly because the swiss society of neonatology recommends restricting neonatal management to comfort care at gestational ages below 24 0/7 weeks . between 24 0/7 and 25 6/7 weeks of gestation the decision to undertake intensive care is individual and influenced by prenatal factors such as birth weight , gender , antenatal steroid use , intrauterine growth restriction , chorioamnionitis , fetal malformation , multiple gestation , and clinical condition immediately after delivery ( asphyxia , heart rate , activity , and response to initial resuscitation ) . intervention continues in the neonatal intensive care unit with the primary goal of survival with an acceptable quality of life . other factors accounting for small sample size in any study of this kind include the fact that the true number of newborns with cpvl can be difficult to evaluate due to early postnatal death , especially when gestational age is very low . cpvl can often only be diagnosed weeks after birth because it takes time for the periventricular cysts to become visible on ultrasound . failure of underreporting when making a late diagnosis of cpvl is another source . even if a prolonged pprom - delivery interval may briefly increase the risk of cpvl , we believe that conservative management makes sense in the absence of clinical chorioamnionitis . higher infant weight at delivery compensates for the impact of pprom latency on neonatal outcome provided that the pregnancy can be prolonged by more than 48 hours .	objective . to identify the risk factors for cystic periventricular leukomalacia ( cpvl ) and their implications for deciding between immediate delivery and conservative management of preterm prelabor rupture of the membranes ( pprom ) . methods . the following risk factors were compared between cpvl infants and 6440 controls : chorioamnionitis , sex , gestational age ( ga ) , birth weight , pprom , and pprom - delivery interval . factor impact on cpvl risk and clinical decision - making was determined by multivariate logistic regression . results . overall cpvl prevalence ( n = 32 ) was 0.99/1000 births . all cpvl infants but one were born < 34 weeks of gestation and were < 2500 g ; 56% had histological chorioamnionitis versus 1.1% of controls ( or 35.9 ; 95%-ci 12.6102.7 ) . because chorioamnionitis is a postnatal diagnosis , logistic regression was performed with prenatally available factors : pprom - delivery interval > 48 hours ( or 9.0 ; 95%-ci 4.120.0 ) , male gender ( or 3.2 ; 95%-ci 1.47.3 ) . ga was not a risk factor if birth weight was included . risk decreased with increasing fetal weight despite a prolonged pprom - delivery interval . conclusion . pprom - delivery interval is the single most important prenatally available risk factor for the development of cpvl . immediate delivery favors babies with chorioamnionitis but disfavors those with non infectious pprom . in the absence of clinical chorioamnionitis fetal weight gain may offset the inflammatory risk of cpvl caused by a prolonged pprom - delivery interval .
You are an expert at summarizing long articles. Proceed to summarize the following text: clinical diagnosis of fibromyalgia syndrome ( fms ) is based on many accompanying subjective symptoms such as fatigue , sleep disorders , stiffness , irritable bowel syndrome , depression , and anxiety , in addition to chronic widespread musculoskeletal pain1 . according to the american college of rheumatology ( acr ) 1990 classification criteria , fms is defined as > 3 months of continuous tenderness determined by a finger pressure of around 4 kg at at least 11 out of 18 predefined sites and widespread musculoskeletal pain2 . recently , new acr diagnostic criteria including fatigue , non - restorative sleep , abdominal discomfort and cognitive symptoms have been proposed3 , 4 . although it is reported that a multifactorial condition with various biological and psychosocial factors may play a role in the initiation and maintenance of pain , the etiopathogenesis of pain is not yet fully understood5 , 6 . it is reported that the available treatment modalities provide relief of symptoms in less than 50% of patients6 . aerobic exercise programs have been shown to improve the physical capacity of patients with fms1 . additionally , it has been suggested that aerobic exercise has modest effects on some symptoms of fms and physical function6 , 7 . researchers have investigated the effectiveness of various exercises programs including bicycle ergometer , side step in the pool , jogging , walking outdoors and walking on a treadmill6 , 8 . some studies have reported that aerobic exercise has positive effects on pain , disability and mood8 , 9 . in a meta - analysis , it was mentioned that the effectiveness of aerobic and strengthening exercises on general well - being in fms is contradictory . in the assessment of functional condition , the positive effects of exercise have been reported in some studies using the fibromyalgia impact questionnaire ( fiq ) , but the absence of a statistically significant difference has also been reported10 . although there might be many reasons behind these differing results , one possibility is the personality characteristics of the patients . it has been showed that the profiles of individuals with fms include difficulties regarding physical , functional and psychological status . additionally , it has been emphasized that odyophobia lies at the bottom of psychological and behavior responses in the subgroups comprised of individuals with fms and a self - management approach should be included in the treatment for chronic pain11 . according to the biopsychosocial model of health , it has been reported that when education programs developing self - managements for individuals are supported by exercise programs , there are positive effects on physical function and fms symptoms12 . a previous study also reported that some personality parameters assessed by the minnesota multiphasic personality inventory ( mmpi ) differ with pain management13 . besides fms is a disease characterized by widespread pain and tender points , therefore it is important to consider the psychological aspect of fms14 . it has been reported that it is necessary to focus on dysfunction in both physical and emotional aspects of treatment together9 . evaluation of personality characteristics and the role of personality characteristics in treatment planning are important in fms . in this study , we aimed to evaluate the personality characteristics of patients with fms and to assess the pain , quality of sleep , physical function , and depression parameters after a 6-week home - based aerobic exercise program . eighteen female patients admitted to the physical medicine and rehabilitation department of bakirkoy dr . sadi konuk training and research hospital and diagnosed with fms according to 1990 acr classification criteria were included in this study . the exclusion criteria were as follows : psychotic disorder ; suicidal ideation ; presence of neurological disease ; use of neurological and psychiatric tricyclic antidepressant , antipsychotics , selective serotonin - norepinephrine reuptake inhibitors , or medicines similar to anticonvulsants ; presence of a systemic disease that would interfere with doing exercise ; pregnancy or abnormality in routine tests . sadi konuk training and research hospital and written informed consent was received from each subject prior to their participation . demographic characteristics , fms symptoms and the number of tender points of the patients were identified . pain and quality of sleep were assessed using visual analog scale ( vas ) . physical function was assessed with the fiq , depression was assessed with the beck depression inventory ( bdi ) , and personality characteristics were assessed with the mmpi . the structured clinical interview for dsm - iv axis i disorders ( scid - i ) was used to determine whether the patients had dsm - iv axis i disorders or not . a home - based exercise program was performed three times a week for 6 weeks . each exercise session lasted 60 minutes and consisted of a warming - up period of 10 minutes , moderate intensity aerobic exercises period of 40 minutes and a cooling down period of 10 minutes . the training program included exercises for strength , endurance , and elasticity , and stretching of both the upper and lower extremities . the intensity of exercise was performed at a heart rate ( hr ) of between 60% and 80% of the maximal heart rate , which was calculated by karvonen formula ( target hr= ( ( 220-age)-resting hr ) 0.60 + resting hr5 ) . the training program was checked by a physical therapy and rehabilitation specialist every 2 weeks . in this study , we assessed whether there were significant differences in the pain , quality of sleep , physical function and depression parameters of the patients with fms before and after the exercise program . additionally , features of the psychiatric diagnosis and personality profiles of the patients were evaluated . ncss ( number cruncher statistical system ) 2007 statistical software ( utah , usa ) program was used for the statistical analysis performed in this study . the paired t - test was used for comparisons of descriptive statistics ( mean , standard deviation ) as well as for comparisons of data before and after treatment . mcnemar s test was used for the comparison of qualitative data , and pearson s correlation test was used for the comparison of the correlations among the variables . four of 18 patients included in our study dropped out of the study because they did not want to maintain the exercise program . therefore , the data of only 14 patients with fms used in the analysis . the mean age of the patients with fms was 435.33 years ( minimum : 25 , maximum : 43 ) , and their mean body mass index ( bmi ) was 24.213.3 ( minimum : 17.99 , maximum : 30.11 ) the other demographic characteristics are shown in table 1table 1.demographic characteristics of the patients with fibromyalgia syndromevariablemean sdminimummaximumage ( year)35.43 5.332543bmi ( kg / m)24.21 3.317.9930.11number of children1.5 1.1603variable n%educationprimary school214.3secondary school321.4high school535.7university428.6marrial statussingle214.3married1178.6divorced17.1occupationhousewives857.14employees321.43public official17.14private sector214.9smokingyes321.4no1178.6bmi : body mass index , sd : standard deviation . bmi : body mass index , sd : standard deviation after exercise , the symptoms accompanying fms ( fatigue , morning stiffness , disturbance of sleep , morning fatigue , paresthesia , headache , irritable bowel syndrome and soft tissue edema ) were determined to be significantly lower than before exercise ( p<0.05 ) ( table 2table 2.comparison of accompanying fibromyalgia syndrome before and after exercisebefore exerciseafter exercisevariablen%n%fatigue1392.9642.9morning stiffness1392.9535.7sleep disorder1285.7428.6morning tiredness1392.9857.1paresthesia1178.6321.4headache1392.977raynaud s phenomenon00.000irritable bowel syndrome750.017.1sicca symptoms321.417.1female urethral syndrome535.717.1soft tissue edema1178.617.1dysmenorrhea857.1221.4p<0.05 ) . the number of tender points , vas values for pain , and quality of sleep after exercise were found to be significantly lower than their respective values before exercise ( p<0.05 ) ( table 3table 3.comparison of clinical parameters before and after exercisevariablebefore exerciseafter exercisemean sdmean sdnumber of tender points by palpation14.79 1.378.36 3,05vas pain7.71 2.164.29 2.43vas sleep6.14 2.983.64 2.68fiq physical function5.21 1.544.34 2.47fiq job loss0 00 0fiq working5.4 3.443.8 0.84fiq pain7.79 2.044.64 2.31fiq fatigue8.21 1.536.71 2.81fsesf resting9 1.246.71 2.81fiq stiffness7.29 2.555.14 3.37fiq anxiety7.93 2.165.5 2.9fiq depression7.29 1.984.57 2.9total fiq70.58 14.6450.57 20.53bdi17.57 7.8210.64 7.52p<0.05 , vas : visual analog scale , fiq : fibromyalgia impact questionnaire , bdi : beck depression inventory , sd : standard deviation ) . * p<0.05 , vas : visual analog scale , fiq : fibromyalgia impact questionnaire , bdi : beck depression inventory , sd : standard deviation in the patients with fms , mean values of physical function , feeling good , pain , fatigue , resting , stiffness , anxiety , depression parameters and total fiq scores after the exercise program , except the working parameter , ( p>0.05 ) were determined to be significantly improved compared to before the exercise program ( p<0.05 ) ( table 3 ) . mean bdi after exercise was found to be significantly lower than mean bdi before exercise ( p<0.05 ) ( table 3 ) . when scid - i was investigated , major depression , dysthymia or depressive disorder not otherwise specified were determined in 5 patients ( 35.7% ) . social phobia , generalized anxiety disorder , or obsessive compulsive disorder were determined in 6 patients ( 42.9% ) , and specific phobia in 3 patients ( 21.4% ) . anxiety disorder not otherwise specified was determined in 9 patients ( 64.3% ) , and somatoform disorders in 8 patients ( 57.1% ) . diagnosis of panic disorder , post trauma stress disorder , adjustment disorder or other dsm iv disorders were not seen in any patient . major depression , dysthymia or depressive disorder not otherwise specified according to scid - i lifetime values were determined in 13 patients ( 92.9% ) . obsessive compulsive disorder was determined in 6 patients ( 42.9% ) and anxiety disorder not otherwise specified in 9 patients ( 64.3% ) . adjustment disorder was determined in 4 patients ( 28.6% ) , social phobia or generalized anxiety disorder in 12 patients ( 85.7% ) and specific phobia in 7 patients ( 50% ) . somatoform disorders were determined in 8 patients ( 57.1% ) but post - traumatic stress disorder , panic disorder or other dsm iv disorders were not found in any patient . according to the mmpi personality inventory , only the hysteria subscale score ( 71.218.84 ) was determined to be above the significance level ( table 4table 4.assessment of the personality characteristics of the patients with fibromyalgia syndrome by the minnesota multiphasic personality inventorymmpimean sdminimummaximumlie55.43 11.374181frequency50.64 7.473865correction52 10.363772hypochondriasis63.86 6.625071depression58.57 10.974278hysteria71.21 8.845286psychotic deviation53.86 9.73573male - female48.21 10.283466paranoia51 9.663162psychasthenia56.93 9.474273schizophrenia52.86 7.613863hypomania48.43 7.63764social introversion58.64 8.714574mmpi : the minnesota multiphasic personality inventory , sd : standard deviation ) . non - pharmacological approaches to treatment of fms have gradually gained in importance in recent years . a physical exercise program is an important treatment option either alone or combined with the other treatment components in the treatment of fms due to its relatively ease of applicability , low risk and low cost10 , 15,16,17 . it has been reported that a home exercise program is effective at easing the level of pain and improving functional status18 . in addition researchers have suggested that active individual exercise programs improve muscle function19 . in the literature , the positive effects of aerobic exercise on pain , physical function and quality of life have been reported9 , 10 , 15 . a meta - analysis reported a significant improvement in the number of tender points by palpation after aerobic exercise alone or in combination with strengthening exercises , and its authors emphasized that improvement in the number of tender points through exercise supports the reduction of widespread pain and tenderness in female patients with fms20 . jones et al.21 reported positive effects of submaximal aerobic exercise on pain , fatigue and the quality of life . huser et al.16 reported positive effects of aerobic and mixed exercise on physical function . in contrast , king et al.22 concluded that aerobic exercise was ineffective in the treatment of physical function as assessed by fiq in the patients with fms . on the other hand , in the systematic review performed by busch et al.23 the positive effects of aerobic exercise on fms symptoms again emphasized the positive effects of aerobic exercise on pain , the number of tender points , physical function and fms symptoms , albeit with the caveat that more comprehensive studies of exercise prescription and compliance of patients with the exercise program were necessary24 . according to the results of our study , a significant improvement was seen in the symptoms accompanying fms , the number of tender points by palpation , vas score of pain and quality of sleep in the patients with fms after the home - based aerobic exercise program . according to the assessment of physical function by the fiq the symptoms of the patients with fms , and the type and levels of physical exercise affect the response to fms treatment9 . most authors have recommended gradually increasing the intensity of exercise and the start low and go slow approach and moderate intensity exercise programs are especially recommended . a reduction in post - exercise pain and fatigue complaints with these approaches suggest that this type of approach is most suitable9 , 25 . the authors of a previous study tried to develop a formula to calculate target heart rate for aerobic exercise program using a mathematical model . according to this model , the recommended exercise intensity for patients with fms is within the range of 5260% of heart rate reserve or 7585% of hr at the anaerobic threshold26 . in our present study , in addition to fms symptoms , and characteristics of physical exercise , the importance of psychological characteristics has also been mentioned in relation to fms treatment9 . the correlation between chronic pain and emotional , physical and social function was shown in two studies10 , 27 . in a meta - analysis , it was reported that aerobic exercise interventions had positive effects on depression16 . mannerkorpi et al.12 used the hospital depression scale to assess the psychological status before and after exercise and reported that there was a mild improvement in the scale . in our study , post - exercise mean bdi was significantly lower than the pre - exercise mean bdi . some studies have reported poor patient compliance with exercise regimes and high dropout rates28 , 29 . in our study , 4 patients dropped out because they did not want to continue the exercise program . although it was reported that the personality characteristics of patients with fms were heterogeneous in a review , studies performed on this subject have been very few . assessment tools and the characteristics of the patients included in studies might have contributed to these differences30 . in our study , we evaluated the personality characteristics of the patients with fms using the mmpi . according to the mmpi personality inventory the hysteria scale of the mmpi is a subset of individuals with higher scores who mainly use denial , who are childishly egoistic , and have anxiety - related somatic complaints . it is known that personality plays a major role in the etiology of psychosomatic disorders31 . taking account of this , multidisciplinary approaches should be planned to increase the participation of patients in an exercise program by evaluation of personality characteristics and psychological status of the patients before the exercise program . some studies have reported the effectiveness of home - based programs including exercise program . for example , in a controlled study , it was reported that targeted individual training increases the effectiveness of exercise in the treatment of fms34 . another study mentioned that frequent visits during a training program had significant effects on the psychosocial status of patients with fms35 . in our study , the 6-week home - based aerobic exercise programs of the patients with fms were checked by a physical therapy and rehabilitation specialist every two weeks . in a meta - analysis performed by huser et al.36 , results were assessed over a period of 115 months . moreover , the assessment was performed according to whether the total exercise period was shorter or longer than 30 hours . huser et al . emphasized that short - term and long - term aerobic exercise program had positive effects on physical function and depression but that multicomponent treatment programs are necessary to increase compliance with an exercise program during long - term home care . with the development of individually focused psychological strategies for patients with fms , it is generally accepted that maintaining compliance with an aerobic exercise program increases the success of the treatment . fms is a highly complicated syndrome and its etiopathogenesis is not yet well understood . however , many studies indicate that it is a neurobiological disease and emphasize its association with central sensitization , endocrine factors , sleep disorders , psychosocial , physical stress and physical trauma37 . it has also been reported that physical function , anxiety , pain , stiffness , general fatigue and morning tiredness of fms patients are significantly improved by psychosocial training33 . psychosocial training programs for personality profiles and the psychological status of the patients with fms can be included in aerobic exercise programs . in this study , we investigated the personality characteristics of the patients with fms while assessing the effectiveness of aerobic exercise . we wanted to confirm that aerobic exercise is effective in the treatment of fms , and that emotional status and personality characteristics should be considered during the planning process of the treatment for fms . we think that many more studies with a larger number of patients are required on this subject .	[ purpose ] the aim of this study was to assess the effectiveness of a 6-week aerobic exercise program on pain , physical function , and psychological status , and to evaluate the personality characteristics of fibromyalgia syndrome ( fms ) patients . [ subjects and methods ] fourteen women with fms were enrolled . they were trained for a 6-week home - based aerobic exercise program . the fibromyalgia impact questionnaire , the beck depression inventory , the visual analog scale of pain and sleep quality were measured at baseline and at the end of week 6 . the personality profiles were evaluated using the minnesota multiphasic personality inventory ( mmpi ) . [ results ] after the exercise program , significant improvements were determined in pain , sleep quality , physical function , depression and fms symptoms compared to baseline . in addition , the hysteria item ( 71.218.84 ) of the mmpi was significantly higher in fms . [ conclusion ] our findings indicate that home - based aerobic exercise may be a useful treatment in the management of fms . personality characteristics should be considered during the planning process of the treatment of fms . personality is a filter between life events and psychological responses . it is defined to be the integration of effective and behavioral patterns . long - term studies involving larger clinical samples are needed to define the role of personality characteristics in fms .
You are an expert at summarizing long articles. Proceed to summarize the following text: the greater omentum plays a unique role in intraperitoneal pathology and the corresponding computed tomographic ( ct ) imaging of that pathology . as a predominantly fat - containing structure within the abdomen , its inherent contrast on ct makes inflammatory , infectious , and neoplastic processes more apparent . in time , these processes result in a diffuse thickening of the omentum , such that it changes from a barely discernible fatty band to a mass that can displace underlying bowel from the abdominal wall , i.e. , the so - called omental cake . ovarian carcinoma is the most common prototype malignancy to produce omental cakes ; however , numerous other malignancies may have a similar or forme fruste appearance . we present various usual and unusual aetiologies and imaging characteristics of omental cakes , as well as the anatomy and embryology of the greater omentum . the role of percutaneous image - guided biopsy is discussed when the cause of omental cakes is uncertain . the greater omentum is a derivative of the dorsal mesogastrium , brought anteriorly by the counterclockwise rotation of the gut at 6 weeks of gestation . from the greater curvature of the stomach , two layers of peritoneum join and form an apron - like structure that hangs inferiorly anterior to the small bowel , then doubles back upon itself to fuse with the superior layer of the transverse mesocolon ( fig . 1 ) . laterally it extends to the pylorus or first portion of the duodenum on the right , and on the left is continuous with the gastrosplenic ligament . these four layers of variably apposed peritoneum may act either as an actual or potential anatomic space . 1schematic sagittal diagram demonstrating the anatomy of the greater omentum ( modified and reprinted with permission from ) schematic sagittal diagram demonstrating the anatomy of the greater omentum ( modified and reprinted with permission from ) the size of the greater omentum and its correlative ct appearance are largely dependent on the amount of fat it contains . the greater omentum also contains gastroepiploic vessels , lymphatics , and milky spots , or accumulations of immune cells that are comprised predominantly of macrophages . these milky spots are involved in the clearance of pathogens from the peritoneum and serve as part of the abdominal policeman role of the greater omentum . these areas are located throughout the peritoneum and are seen in the highest concentration in the greater omentum , explaining the high frequency of omental involvement in intraperitoneal disease processes ( fig . 2 ) . adenocarcinoma of the vulva in a 55-year - old woman . a gross omental cake specimen with an 8-cm irregular firm nodular lesion at the superior border . b transverse sections of the omentum show that the lesion is solid , tan - white with scattered foci of hemorrhage ( arrow ) ( a , b ) . adenocarcinoma of the vulva in a 55-year - old woman . a gross omental cake specimen with an 8-cm irregular firm nodular lesion at the superior border . b transverse sections of the omentum show that the lesion is solid , tan - white with scattered foci of hemorrhage ( arrow ) on ct , the normal greater omentum appears as a band of fatty tissue with variable width . the ct appearance of omental pathology is dependent on the extent and duration of disease involvement . early omental disease manifests as a smudged or permeated appearance of the omental fat ( fig . 3a ) . enhancing soft tissue nodules form within the omentum as the disease progresses . an omental cake arises when these nodules coalesce to form a diffusely thickened mass and replace the normal fat ( fig . 3b ) . depending on the cause of the omental cake and the extent of intraperitoneal disease a initial ct image shows early infiltration and nodularity of the omentum ( arrows ) and retroperitoneal adenopathy ( arrowheads ) . b interval progression of disease with ascites and the mass - like omental cake ( arrowheads ) in the remaining omentum after a partial omentectomy on a ct scan 3 months later ( a , b ) . ovarian cancer in a 47-year - old woman demonstrating progresssion of omental cake . a initial ct image shows early infiltration and nodularity of the omentum ( arrows ) and retroperitoneal adenopathy ( arrowheads ) . b interval progression of disease with ascites and the mass - like omental cake ( arrowheads ) in the remaining omentum after a partial omentectomy on a ct scan 3 months later while 100150 cc of non - ionic iodinated intravenous contrast material ( 1.5 - 2 cc / s ) is desirable to increase the intrinsic contrast of the images , it may not be necessary to diagnose the extent of an omental cake , unless knowledge of the extent is important to surgical planning . frequently , however , intravenous contrast material is administered , mostly to evaluate coexisting liver or other solid organ disease . oral contrast material is valuable to avoid confusing unopacified bowel loops with omental pathology and to define the extent of the omental findings . the presence of associated intraabdominal and intrahepatic findings , such as hepatic metastases and lymphadenopathy , may be the only clues as to the origin of omental disease if the diagnosis is unknown ; the appearance of the omental cake itself is non - specific with respect to the diagnosis . as there are many conditions that can produce an omental cake , the need for a specific diagnosis relies on percutaneous biopsy of the cake if the aetiology is unknown . ultrasound ( us ) and magnetic resonance imaging ( mri ) also have been used to evaluate the greater omentum [ 8 , 9 ] . mri demonstrates omental cakes and other peritoneal implants , but unless a gastrointestinal contrast agent is administered , there is inferior contrast resolution relative to ct . nevertheless , mri may be utilized in patients with contraindications to ct ( contrast sensitivity , pregnancy ) or as an adjunct in patients with inconclusive ct findings . furthermore , the use of diffusion - weighted mri is emerging as a potential technique for omental and peritoneal metastases . peritoneal fluid ( 74% ) and peritoneal thickening with enhancement ( 62% ) , omental involvement is a frequently encountered finding with peritoneal carcinomatosis on ct . while ovarian carcinoma is the most common cause of omental cakes , colonic , pancreatic , and gastric cancers are other common malignancies that may result in omental metastases . however , virtually any tumour capable of intraperitoneal spread , such as endometrial or bladder cancer , may cause an omental cake ( figs . 4 , 5 , 6 , 7 ) . fig . ct image demonstrates a thick omental cake in the left anterior abdomen ( arrows ) . ct image shows multiple , ill - defined , soft tissue nodules and masses ( arrows ) permeating the omental fat . ct image demonstrates diffuse linear infiltration , nodularity , and thickening of the omentum ( arrows ) ovarian cancer in a 51-year - old woman . ct image shows extensive omental thickening ( arrows ) and ascites colon cancer in a 65-year - old man . ct image demonstrates a thick omental cake in the left anterior abdomen ( arrows ) . peripheral ascites is also present , predominantly on the right side pancreatic adenocarcinoma in a 58-year - old man . ct image shows multiple , ill - defined , soft tissue nodules and masses ( arrows ) permeating the omental fat . ascites is also present in the right paracolic gutter gastric cancer in a 53-year - old woman . ct image demonstrates diffuse linear infiltration , nodularity , and thickening of the omentum ( arrows ) metastases gain access to the greater omentum by any of four principal routes : ( 1 ) direct extension of tumour along peritoneal ligaments , ( 2 ) intraperitoneal seeding , or via ( 3 ) haematogeneous or ( 4 ) lymphatic spread of disease . hepatobiliary malignancies , such as gallbladder carcinoma and cholangiocarcinoma , are unusual causes of omental cakes that often are the result of direct extension of tumour along the hepatoduodenal ligament and lesser omentum ( figs . 8 , 9 , 10 ) . metastatic renal cell carcinoma to the omentum may break through the renal capsule , the anterior renal fascia , and the closely apposed posterior parietal peritoneum to spread along the peritoneal surface . unusual gynaecologic ( fallopian tube and endometrium ) , genitourinary ( prostate and urothelium ) , small bowel , and appendiceal primary cancers also may result in intraperitoneal seeding ( figs . melanoma , lung , and breast cancers can cause omental cakes , typically by haematogenous spread . metastases from breast cancer to the stomach may extend directly into the greater omentum ( figs . non - hodgkin s lymphoma , and , very rarely , hodgkin s disease , can develop omental cakes , often with associated diffuse peritoneal and retroperitoneal disease , and ascites from lymphatic spread ( fig . ct image shows extensive soft tissue nodules present within the omentum ( arrows ) and the retroperitoneum . a right nephrectomy with surgical clips is seen in the right renal fossa , and ascites is also seen on the rightfig . ct image illustrates an omental cake anterior to the liver with infiltration and nodularity of the omental fat ( arrows ) . ct image demonstrates omental involvement ( arrows ) as infiltration of the fat , nodularity , and coalescence of the nodules form an omental cakefig . ct image shows multiple nodular metastases present within the omentum ( arrows ) and along the peritoneal surface , the result of intraperitoneal seeding . ct image demonstrates omental infiltration ( arrows ) seen in the absence of ascites or other signs of peritoneal carcinomatosis . ct image shows extensive diffuse omental involvement ( arrows ) , including the surfaces of the adjacent bowelfig . ct image illustrates peritoneal carcinomatosis with ascites , peritoneal thickening , nodularity ( curved arrow ) , and omental cake ( arrowheads ) . note also the shrunken liver ( arrows ) with pseudocirrhosis appearance seen after treatment for liver metastases from breast cancerfig . ct image demonstrates hematogenous metastases seeding the omentum as seen in this omental cake ( arrows ) adjacent to the spleen and left upper quadrant . ct image shows omental cakes ( arrowheads ) manifested as ill - defined areas of soft tissue anteriorly and peripherally in the abdomen . multiple renal cysts and calcified gallstones are present , as is ascites renal cell carcinoma in a 62-year - old man . ct image shows extensive soft tissue nodules present within the omentum ( arrows ) and the retroperitoneum . a right nephrectomy with surgical clips is seen in the right renal fossa , and ascites is also seen on the right gallbladder carcinoma in a 70-year - old woman . ct image illustrates an omental cake anterior to the liver with infiltration and nodularity of the omental fat ( arrows ) . the tumour also infiltrates the fat of the lesser sac ( arrowheads ) cholangiocarcinoma in a 56-year - old man . ct image demonstrates omental involvement ( arrows ) as infiltration of the fat , nodularity , and coalescence of the nodules form an omental cake endometrial adenocarcinoma in a 50-year - old woman . ct image shows multiple nodular metastases present within the omentum ( arrows ) and along the peritoneal surface , the result of intraperitoneal seeding . ct image demonstrates omental infiltration ( arrows ) seen in the absence of ascites or other signs of peritoneal carcinomatosis . note is made of an inferior vena cava filter urothelial carcinoma of the bladder in a 59-year - old man . ct image shows extensive diffuse omental involvement ( arrows ) , including the surfaces of the adjacent bowel breast cancer in a 45-year - old woman . ct image illustrates peritoneal carcinomatosis with ascites , peritoneal thickening , nodularity ( curved arrow ) , and omental cake ( arrowheads ) . note also the shrunken liver ( arrows ) with pseudocirrhosis appearance seen after treatment for liver metastases from breast cancer non - small cell lung cancer in a 65-year - old man . ct image demonstrates hematogenous metastases seeding the omentum as seen in this omental cake ( arrows ) adjacent to the spleen and left upper quadrant . there are small bilateral pleural effusions non - hodgkin s lymphoma in a 70-year - old man . ct image shows omental cakes ( arrowheads ) manifested as ill - defined areas of soft tissue anteriorly and peripherally in the abdomen . multiple renal cysts and calcified gallstones are present , as is ascites with regards to imaging findings , obvious careful search for the primary malignancy is important to determine the aetiology if the cause of the omental cake is unknown . metastatic omental involvement occasionally may be heralded by abdominal pain secondary to bowel obstruction or intussusception in cases of gastrointestinal malignancies that metastasise to the small bowel . typically of mesenchymal origin , they include : abdominal mesothelioma , haemangiopericytoma , leiomyoma , leiomyosarcoma , gastrointestinal stromal tumour ( gist ) , lipoma , liposarcoma , neurofibroma , fibrosarcoma , and small round cell tumours ( figs . 18 , 19 , 20 , 21 ) [ 16 , 17 ] . while these primary lesions are rare , these should be considered in the absence of a known or suspected primary organ - based malignancy . with respect to differentiating imaging findings for benign versus malignant neoplastic cakes , benign lesions usually are well circumscribed , while malignant cakes commonly have indistinct margins and invade surrounding structures . ct image shows a thin omental cake ( arrows ) in the anterior abdomen with a small amount of ascites in the left paracolic gutter and perihepatic spacesfig . ct image shows large , cystic - appearing masses ( arrows ) , some involving the omentum , and a large volume of ascites . the patient had been treated with imatinib mesylate ( gleevec ; novartis , new york , ny ) that led to the cystic changes . ct image demonstrates multiple , clustered , nodular metastases present within the omentum seen in the right abdomen ( arrows ) primary mesothelioma in a 52-year - old man . ct image shows a thin omental cake ( arrows ) in the anterior abdomen with a small amount of ascites in the left paracolic gutter and perihepatic spaces testicular mesothelioma in a 53-year - old man . ct image shows an omental cake ( arrows ) in the anterior abdomen gastrointestinal stromal tumour ( gist ) in a 45-year - old man . ct image shows large , cystic - appearing masses ( arrows ) , some involving the omentum , and a large volume of ascites . the patient had been treated with imatinib mesylate ( gleevec ; novartis , new york , ny ) that led to the cystic changes . there is a subcutaneous implant in the right anterior abdominal wall liposarcoma in a 56-year - old man . ct image demonstrates multiple , clustered , nodular metastases present within the omentum seen in the right abdomen ( arrows ) infectious diseases are rare causes of omental cakes . typically , these diseases are the result of haematogenous , lymphatic , or direct spread of infectious organisms into the peritoneum . tuberculous peritonitis commonly exhibits omental manifestations , albeit this condition is rare in developed countries . nevertheless , there are several findings that can help distinguish tuberculous peritonitis from peritoneal carcinomatosis . these include : mesenteric macronodules , irregularity of the infiltrated omentum , an omental line , i.e. a fibrous wall covering the infiltrated omentum , and/or splenomegaly or splenic calcification . fibrotic - fixed form of tuberculous peritonitis produces an omental mass that may mimic metastatic disease ( fig . furthermore , the presence of associated enlarged and necrotic mesenteric lymph nodes may be a coexisting finding to narrow the differential diagnosis towards tuberculosis . ct image demonstrates ascites and large , low - attenuation omental macronodules covered with a thin omental line ( arrows ) tuberculosis in a 51-year - old man . ct image demonstrates ascites and large , low - attenuation omental macronodules covered with a thin omental line ( arrows ) actinomycosis produces an infiltrative solid or cystic omental mass that invades normal anatomic barriers , usually with dense inhomogeneous contrast enhancement . if there is an omental mass along with clinical signs of leukocytosis and fever without an attributable source , biopsy / aspiration can determine the aetiology ( fig . attention to the appendix and colon should also be made , as these are the most common intraabdominal organs involved with actinomycosis . 2341-year - old woman with aids , an ovarian mass , and omental cake : ct fluoroscopic - guided percutaneous biopsy of the omental thickening using a 22-g needle revealed actinomyces israelii , but no evidence of malignancy 41-year - old woman with aids , an ovarian mass , and omental cake : ct fluoroscopic - guided percutaneous biopsy of the omental thickening using a 22-g needle revealed actinomyces israelii , but no evidence of malignancy coccidioidomycosis rarely involves the peritoneum and omentum , but also can exhibit an omental cake that mimics peritoneal malignancy ( fig . 24 ) . in another report , ct showed peripherally enhancing deposits in the peritoneal cavity in a patient with systemic coccidioidomycosis . in patients with omental masses and systemic infection geographically in the san joaquin valley in california or in arizona a differentiating feature of coccidioidomycosis is that the gastrointestinal manifestations of coccidioidomycosis are usually preceded by pulmonic , neurological , and musculoskeletal involvement . ct image shows an omental nodule in the right anterior abdomen ( arrow ) and mesenteric lymph nodes ( arrowheads ) . ct image shows an omental nodule in the right anterior abdomen ( arrow ) and mesenteric lymph nodes ( arrowheads ) . arash heidari ) non - tuberculous mycobacterial infection , histoplasmosis , and omental paragonimiasis all have been reported to cause omental cakes [ 23 , 24 ] . a unique feature of omental paragonimiasis is the multiple , irregularly shaped , conglomerate calcifications that sometimes occur . various rare benign processes can infiltrate the omentum to such a degree that an omental cake may develop . extramedullary haematopoiesis , secondary to a number of conditions such as myelofibrosis , is another rare cause of omental caking ( fig . along with hepatosplenomegaly and multiple masses in various organs in the abdomen , mesenteric and omental masses should raise the suspicion of extramedullary haematopoiesis . ct image shows extensive omental infiltration ( arrows ) with areas of nodularity and ascites . benign omental cakes are indistinguishable from those caused by malignancy myelofibrosis in a 66-year - old man with a history of splenectomy . ct image shows extensive omental infiltration ( arrows ) with areas of nodularity and ascites . benign omental cakes are indistinguishable from those caused by malignancy sclerosing omentitis and amyloidosis both may involve the greater omentum and contain scattered calcifications that mimic the appearance of metastatic ovarian cancer or treated peritoneal mesothelioma . associated calcifications in the subcutaneous tissues , kidneys , and urethra may be additional clues of the presence of amyloidosis . due to the non - specific ct appearances of omental cakes , biopsy is important to diagnose the etiology if unknown . the superficial location of omental cakes is ideally suited for both image - guided fine - needle ( 20 g or smaller ) and large needle core biopsy ( 19 g or larger ) under either ct or us guidance ( fig . 26 ) . ct fluoroscopic - guided biopsy of the omental cake using a 22-g needle ( arrow ) revealed adenocarcinoma , with the primary being in the colon unknown primary cancer and omental cake in a 65-year - old man . ct fluoroscopic - guided biopsy of the omental cake using a 22-g needle ( arrow ) revealed adenocarcinoma , with the primary being in the colon one study reported a sensitivity of 89.5% , specificity of 100% , and accuracy of 92% in the detection of malignancy in 25 percutaneous ct - guided large - needle core biopsies of omental lesions . furthermore , they were able to obtain a specific diagnosis of the malignancy in 78.9% ( 15/19 ) of cases . in another study of 111 percutaneous image - guided peritoneal and omental biopsies , the overall diagnostic rate was 89% , with a sensitivity of 93% and specificity of 86% . moreover , the authors concluded that a second malignancy was revealed in approximately 10% of patients with a known primary cancer ( 8/79 ) , such as non - hodgkin s lymphoma . it should be noted , however , that although omental involvement can be both conspicuous and relatively straightforward to biopsy , early cases may be subtle and challenging both to visualize and to biopsy . if there is any question of where the cake - bowel interface is , bowel opacification with oral contrast should be administered to avoid inadvertent needle puncture of the gastrointestinal tract . one study showed that of 258 patients with nodules in the greater omentum , definitive diagnoses were achieved in 94.57% of cases by us - guided biopsy . while ovarian carcinoma is the prototype omental cake , many malignancies from a wide spectrum of primary sites and organ systems can produce this appearance . although malignancy is by far the most common aetiology of omental cakes , numerous benign causes exist as well . the non - specific ct appearances of omental cakes make the need for a pathological diagnosis paramount for proper treatment if the primary diagnosis is unknown . the typical omental cake , located superficially within the abdomen , is ideally suited to percutaneous ct or us - guided biopsy for primary diagnosis and staging .	backgroundomental cakes typically are associated with ovarian carcinoma , as this is the most common malignant aetiology . nonetheless , numerous other neoplasms , as well as infectious and benign processes , can produce omental cakes.methodsa broader knowledge of the various causes of omental cakes is valuable diagnostically and to direct appropriate clinical management.resultswe present a spectrum of both common and unusual aetiologies that demonstrate the variable computed tomographic appearances of omental cakes.conclusionthe anatomy and embryology are discussed , as well as the importance of biopsy when the aetiology of omental cakes is uncertain .
You are an expert at summarizing long articles. Proceed to summarize the following text: many attractive smiles are marred by some discoloration or stain , either on an individual tooth or on all teeth . isolated yellow , brown , or white hypoplastic areas on an otherwise normal enamel surface are common . such defects usually occur due to dental fluorosis amongst patients residing in areas with high fluoride content in drinking water . dental fluorosis has been categorized under various grades as follows : grade 0 : normal , translucent , smooth , and glossy teeth ; grade i : white opacities , faint yellow line ; grade ii : changes as in grade i and brown stains ; grade iii : brown line , pitting , and chipped off edges ; grade iv : brown , black and/or loss of teeth . various methods have been suggested to remove or mask discoloration such as vital or nonvital bleaching , microabrasion , macroabrasion , and direct or indirect veneering procedure . isolated brown or white defects of less than few tenths of a millimeter depth can be successfully treated with microabrasion . however , a combination of various techniques such as microabrasion / macroabrasion along with bleaching or full or partial veneering are available to effectively mask deeper defects . originally , the use of 18% hydrochloric acid was recommended to remove superficial fluorosis stains . later on , the procedure was modified to incorporate the use of pumice and hydrochloric acid paste and was termed microabrasion . croll further modified the technique , reducing the concentration of acid and increasing the abrasiveness of the paste using silicon carbide particles instead of pumice . currently , microabrasion is performed by applying abrasive slurry of silicon carbide and hydrochloric acid using a manual or handpiecedriven rubbing action . the depth of the discoloration can not be known until attempts are made to remove it . abrasive disks are used for gross contouring , finishing and polishing of ceramic and resin materials . super snap ( shofu inc . , japan ) is one such system that is used at low speed ( 1000015000 rpm ) . this system provides high gloss finish when used sequentially from coarse to ultra fine grit . these abrasive discs along with hydrochloric acid may be utilized during microabrasion to reduce the chair side time and to improve efficacy . the mechanism of color improvement appears to be the removal of discolored surface enamel and the creation of a highly reflective enamel surface that may mask any remaining discoloration . the combined benefits of enamel microabrasion followed by home tooth whitening using carbamide eroxide have been reported in case studies.[911 ] in vitro studies favor the application of neutral sodium fluoride after microabrasion treatment to create enamel that is significantly more resistant to demineralization than untreated enamel . this report presents a modified microabrasion technique followed by in office bleaching that resulted in a significant reduction of the discoloration . a 21-year - old female patient reported to the department of conservative dentistry and endodontics with the complaint of discoloration in upper front teeth [ figure 1 ] . history of the patient revealed the presence of yellowish brown and white patches on teeth since childhood . clinical examination showed the presence of dark yellow patches in maxillary central incisors and white patches on the facial surface of all teeth . careful exploration of teeth revealed intact and smooth enamel surfaces . several treatment options suggested to the patient were microabrasion , microabrasion along with bleaching , and direct or indirect veneers . after discussion , it was agreed to use enamel microabrasion followed by bleaching to improve the appearance of her teeth . the maxillary canines and incisors to be treated were first cleaned with pumice and water slurry . petroleum jelly was applied around the cervical portion of the teeth to prevent leakage of the hydrochloric acid or damage to the gingiva . freshly prepared solution of 11% hydrochloric acid was applied using cotton pellet on the discolored area followed by application of coarse composite contouring discs ( super snap , shofu inc . , japan ) at low speed for 10 seconds per tooth [ figure 2 ] . same procedure was repeated 3 times at the same visit , which resulted in lightening of the dark areas to a great extent [ figure 3 ] . white spots were still evident on the labial surfaces of teeth . thereafter , the remaining acid was rinsed from the teeth by use of gentle air water pressure and a high - volume aspirator . all teeth were finished using fine and extra fine grit abrasive discs ( super snap ) . after finishing , the bleaching agent ( xx - white , dentn co. , france ) was applied over the labial surfaces of isolated teeth , followed by light activation using a bleaching light ( flexi light whitening system , dentn co. , france ) for 4 minutes [ figure 4 ] . the bleaching agent was removed by means of moist cotton followed by rinsing with air water spray . all the treated teeth were polished using fine polisher ( compo site , shofu inc , japan ) to obtain high luster . high gloss finish obtained after fine polishing , camouflaged white spots as well as remaining dark areas on the enamel surface [ figure 5 ] . the patient was informed regarding the likelihood of developing dentinal hypersensitivity , which would subside in a few days . the patient was prescribed the calcium sodium phosphosilicate - containing desensitizing tooth paste ( vantej , dr . reddy 's laboratories ltd . , india ) for 3 weeks and then discharged . at 1 month follow - up , the results were stable and the patient did not complain of any symptoms related to dentinal hypersensitivity [ figure 6 ] . preoperative view showing yellowish discoloration on labial aspect of both central incisors and chalky labial surface of all teeth application of acid via cotton pellet followed by use of coarse grit abrasive discs for 10 seconds at low speed under rubber dam isolation note the color change immediately after completion of microabrasion in office power bleaching procedure carried immediately after microabrasion completion of finishing and polishing procedure . note the high luster obtained producing camouflage effect and masking the white chalky patches one month follow - up visit showing constancy of esthetics achieved after treatment microabrasion is a noninvasive , conservative , and economical approach to partially or completely remove superficial enamel discoloration . lower cost of this technique makes it a viable treatment alternative in rural / semi urban dental practice . microabrasion technique has been modified several times to enhance the esthetic results as well as simplify the treatment procedure . discolored teeth without loss of surface integrity of enamel are ideally suited for microabrasion treatment . however , if discoloration is accompanied with pitting of the surface as in grade iii or grade iv fluorosis , clinicians can utilize a combination of microabrasion / bleaching followed by direct or indirect veneering procedures . it is prudent to carry out microabrasion and in office bleaching under strict isolation using rubber dam as the acid and 35% hydrogen peroxide used in the procedures may damage the adjacent soft tissues . application of petroleum jelly over the gingival tissue prior to placement of rubber dam provides added protection from the acid . also , the use of protective eye wear during the procedure by the patient as well as operator is mandatory . long term effectiveness of microabrasion is clinically proven in several studies and case reports with no or minimal intra - operative and post - operative discomfort such as dentinal hypersensitivity.[1315 ] not only does microabrasion mask and remove stained tooth structure , thus improving tooth color , but the surface layer created during treatment is a highly polished , densely compacted , mineralized structure . the technique is believed to modify the optical properties of enamel . abrasion of enamel prisms combined with acid erosion results in the development of a densely compacted prism - free layer on the enamel surface . in addition , subsurface stains may be camouflaged by the optical properties of the newly microabraded surface . the original microabrasion technique utilized the slurry of 11% hydrochloric acid and silicon carbide using a manual or handpiece - driven rubbing action . in the present case , technique was modified in an attempt to reduce chair side time and enhance effectiveness as well as convenience . instead of slurry of abrasive and acid , the acid was applied directly on the tooth surface and the abrasive effect was achieved by the use of coarse composite contouring discs ( super snap ) . thus , the abrasive action was limited only to the area of contact of the disc , thereby , avoiding unnecessary loss of enamel surface . the combined regimen ( microabrasion and bleaching ) is most effective in patients who have prominent white areas on teeth that are yellowish or that have darkened with age . in office bleaching was preferred in this case over home bleaching regimen because it is quick and the dentist is in total control of the treatment . several bleaching agents are available in the market such as hydrogen peroxide and carbamide peroxide in various concentrations . in general , the efficacy of hydrogen peroxide containing products are approximately the same when compared with carbamide peroxide containing products with equivalent or similar hydrogen peroxide content and delivered using similar format and formulations . peroxide and light treatment significantly lighten the color of teeth to a greater extent than does peroxide or light alone , with a low and transient incidence of tooth sensitivity . use of casein phosphopeptide - amorphous calcium phosphate containing tooth paste after microabrasion have been found to significantly reduce the enamel surface roughness thus , minimizing the risk of developing smooth surface caries . bioactive glasses like calcium sodium phosphosilicate when in contact with saliva , rapidly release sodium , calcium , and phosphorous ions into the saliva , which are then available for the remineralization of the tooth surface and result in the formation of hydroxyl carbonate apatite . to conclude , the case presented supports a feasible and conservative technique to manage enamel discoloration .	esthetics is a primary concern amongst young patients and represents a challenge to the dentist . discolored teeth are frequently seen in the general population . several techniques have been devised to minimize or completely eliminate tooth discoloration . this case report highlights the successful management of enamel discoloration via modified microabrasion technique followed by in office bleaching .
You are an expert at summarizing long articles. Proceed to summarize the following text: inflammatory response and cytokine elaboration are integral components of the host immune response to tissue injury and play an active role after myocardial infarction . the degree of the inflammatory response is an important determinant of the host 's outcome because it can lead to healing and restoration of function , to acute cardiac rupture , or chronic dilatation . myocardial remodeling can be defined as molecular , cellular , and interstitial changes within the myocardium that result in changes in left ventricular size and function [ 2 , 3 ] : one of the predominant features of myocardial remodeling is left ventricular dilatation , whose progression affects the survival of the patients with an increased mortality due to heart failure . upregulation of pro - inflammatory cytokines , such as tnf , interleukin 1beta ( il1 ) , and il6 , usually unexpressed in the normal heart , has been clearly shown both in animal and human models during myocardial infarction [ 68 ] ; the acute intramyocardial gene expression of tnf , il1 , and il6 involves both the infarct area and the noninfarcted myocardium , but it begins to decrease towards baseline after 1 week . if the infarct size is large or if there are ongoing myocardial stress factors , the cytokine gene expression may remain elevated or may recrudescence as a second wave of cytokine activation ; the levels of late cytokine activation in the noninfarctual region correlate the best with the eventual left ventricular end - diastolic diameter measured at 20 weeks after infarction [ 1 , 11 ] . more recently , it has been shown that il10 , a pleiotropic cytokine with potent anti - inflammatory effects in many cells lines , may have in some in vitro ischemia - reperfusion models a protective role through the suppression of the acute inflammatory process : in particular il10 is able to abrogate tnf-induced vascular smooth muscular cell ( vsmc ) growth . on the basis of these premises , we studied the role of peripheral cytokine production in myocardial remodeling and functioning in patients affected by acute myocardial infarction undergoing pci . in particular , we evaluated pbmcs tnf and il10 production as well as lymphomonocyte apoptosis at different timepoints after the acute ischemic event and we correlated immune activation to postischemic left ventricular remodeling assessed with echocardiographic study . we enrolled 40 patients ( mean age 64 years , range 4878 ) affected by acute st - elevation myocardial infarction ( stemi ) undergoing pci within 12 hours from the onset of symptoms . patients were successively divided in two groups of left ventricular remodeling ( r , n = 20 ) and no left ventricular remodeling patients ( nr , n = 20 ) according the presence or absence of left ventricular dilation evaluated at 6 months after infarction with echocardiographic criteria ( tables 1 and 2 ) . patients with a history of previous myocardial infarction , previously known coronary artery disease , heart failure , arrhythmias , valvulopathies , chronic or acute inflammatory or infectious disease , neoplasm , liver , and renal disease were excluded from the study . the same conditions , particularly acute or chronic infections , induced the exclusion of patient from the study in the follow - up at the various timepoints . patients did not assume drugs that could interfere with immune cell functions in any phase of the study ; only acetaminophen was occasionally assumed by some patients ( 3 remodeling patients and 4 not remodeling subjects ) and just for no longer than a few days and not in coincidence with blood sampling . fifteen normal subjects matched for age and sex were also studied as regards to cell cultures . the procedure was approved by the ethical committee of our hospital and the study was done according the ethical standards for experiments in human subjects established by the declaration of helsinki . the study was done using vivid seven echocardiograph ( general electrics ) equipped with 2.5 mhz transducers . bidimensional images , echo - doppler ultrasound , and color - doppler ultrasound spectra were analyzed using a computerized system ( echo - dat ; medicine inc.software ) . the ejection fraction ( ef ) , left ventricular end - systolic ( lvesv ) and end - diastolic volume ( lvedv ) , were recorded as indices of ventricular function . ef was calculated by the modified simpson 's method in apical four- and two - chamber views [ 14 , 15 ] . postischemic left ventricular remodeling was defined as a 20% increase of left ventricular end - diastolic and end - systolic volumes at the end of follow - up ( 6 months ) compared with baseline measures ( day 1 ) . pbmcs were obtained from the patients ' and controls ' heparinized whole blood at the following timepoints : day 1 , day 3 , day 7 , 1 month , and 6 months after reperfusion . pbmcs were isolated by density gradient centrifugation over histopaque 1077 ( sigma - aldrich , milano , italy ) and cultured in rpmi 1640 medium supplemented with fetal calf serum ( 10% ) , l - glutamine ( 2 mm ) , and penicillin - streptomycin ( 100 u / ml , 100 g / ml , gibco , paisley , uk ) . 1 10 pbmcs were put in culture in complete medium and stimulated with lps ( e.coli , 1 g / ml , sigma ) for 24 hours . cell culture media harvested were tested for tnf and il10 production by elisa using elisa microtiter plates ( corning easy wash , celbio , milano , italy ) coated overnight with 2 g / ml anti - tnf- or anti - il10 capture mab ( pharmingen ) in 0.1 m na2hpo4 ph 9 buffer and blocked with pbs / tween . a biotin - labeled anti - tnf or anti - il10 detecting antibody ( pharmingen ) at 1 g / ml in pbs/10% fetal calf serum was used . the plates were developed using avidin - hrp ( vector , burlingame , ca , usa ) and 2,2 azino - bis substrate ( sigma ) . after 20 hours of culture , lymphocyte apoptosis was assessed through the binding of annexin v / uptake of propidium iodide by flow cytometry ( pas , partec , germany ) using the apoptosis detection kit annexin v - fitc ( dako , glostrup , denmark ) . forward light scatter characteristics of living cells were used to delete debris from the analyses . logarithmic fluorescence intensity of annexin v - fitc was plotted versus the fluorescence intensity of propidium iodide ( pi ) in a dot plot . data from 10.000 lymphocytes gated on forward scatter versus side scatter properties were analysed for each plot and the percentage of annexin positive- and pi negative - cells ( early apoptotic cells ) was determined . quadrants were estimated by comparison of unstained and annexin v - fitc / pi stained samples . the mann whitney u - test was used to compare data obtained in patients undergoing ventricular remodeling to those obtained in patients not undergoing ventricular remodeling and in controls . the wilcoxon test was used to compare data obtained in the same group of patients at different timepoints . spearman 's correlation coefficient was employed to determine putative linear relations between changes in the measurable echographic and biological parameters . table 1 shows baseline and clinical characteristics of patients divided in the two groups of patients who showed left ventricular remodeling , compared with patients who not undergo left ventricular remodeling . as shown in the table , the two subgroups of patients were very similar and no differences were present as regards risk factors , characteristics of infarction , and drug assumption . table 2 shows the echocardiographic characteristics of the same groups of patients which were used to distinguish remodeling and not remodeling subjects on the basis of left ventricular dilation , defined as an increase in end diastolic volume > 20% , as assessed by authors . patients with postischemic left ventricular remodeling showed on day 1 after pci an increased production of tnf after lps stimulation in comparison with patients who did not undergo postischemic left ventricular remodeling ( p < .05 ) . .05 ) , whereas there was no difference between controls and patients who did not undergo left ventricular remodeling ( figure 1 ) . the increased tnf production after lps stimulation was still detectable in remodeling subjects in comparison with not remodeling ones on day 3 ( p < .01 ) and day 7 ( p < .01 ) after pci , as well as 1 month ( p < .01 ) and 6 months ( p < .05 ) after this procedure ( figure 2 ) . in patients undergoing left ventricular remodeling we could not find any significant difference concerning lps - stimulated tnf production amongst the different timepoints ; similar results were obtained in those patients who did not develop left ventricular remodeling ( figure 3 ) . when we analyzed lps - induced il10 production , on day 1 after reperfusion we did not find any difference between left ventricular remodeling subjects and not remodeling subjects . however in both groups il10 production was significantly reduced in comparison with controls ( p < .001 , figure 4 ) . on day 3 and day 7 il10 production was not different between remodeling and not remodeling subjects , but 1 and 6 months after reperfusion , il10 production was statistically lower in subjects developing left ventricular remodeling than in not remodeling ones ( p < .05 , p < .001 , figure 5 ) . in patients undergoing left ventricular remodeling we found that lps - stimulated il10 production increased on day 3 and on day 7 in comparison with day 1 ( p < .05 ) but returned to levels similar to day 1 , 1 and 6 months after reperfusion ( figure 6 ) . on the contrary , in not remodeling patients , il10 production was significantly increased in comparison with day 1 after reperfusion at every timepoint ( p < .001 ) and it was still statistically higher 6 months after reperfusion when it reached values comparable to normal controls ( figure 6 ) . when we analyzed spontaneous lymphocyte apoptosis in vitro after 24 hours of cultures , we found that the percentage of annexinv+pi- lymphocytes was not significantly different between remodeling patients and not remodeling ones ( 28.5 10 versus 30 8% ) , overlapping the values obtained in normal subjects ( 25 11% ) ( not shown ) . our findings of a different pro - inflammatory / anti - inflammatory imbalance in the studied groups according to remodeling trend were confirmed by the linear regression analysis between tnf , il10 , and lvedv in the whole cohort ( figure 7 ) . indeed , a direct linear relation was found between tnf levels and lvedv volume ( r = 0.28 , p = .039 ) and between percent changes of both parameters ( r = 0.31 , p = .018 ) at six months ( figure 7 ) . il10 levels were inversely related to lvedv at day 1 ( r = 0.41 , p = .011 ) that was confirmed at 6 months ( r = 0.37 , p = .019 ) also when analyzed as percent changes ( r = 0.38 , p = .021 ) ( figure 7 ) . postischemic left ventricular remodeling is a complex process that takes place after myocardial infarction both in the region affected by acute ischemia and in adjacent areas : it is characterized by reduction of myocytes in the infarct area , chamber dilatation , fibrosis and scar formation , collagen dissolution and excessive interstitial matrix accumulation , increased wall stress , and myocyte hypertrophy . it results in ventricular geometric alterations and sustained deterioration in cardiac function [ 4 , 5 ] . the development of ventricular remodeling involves a number of different mechanisms , including neurohormonal stimulation , enzymes , ion channels , oxidative stress , mechanical stress , growth factors , and inflammatory cytokine production . recent clinical and experimental studies have suggested that , among inflammatory cytokines , increased release of tnf can contribute to the progression of left ventricular remodeling and dysfunction . in adult rats , surgically implanted with an osmotic minipump infusing tnf for 5 days in order to reach plasma levels comparable to those reported in clinical heart failure , a decrease in left ventricular fractional shortening occurred and left ventricular end diastolic diameter increased by over 25% when compared with time - matched controls . in a transgenic mouse model , myocardial tnf overexpression caused increased systolic and diastolic left ventricular volumes and a reduced collagen crosslinking in myocardium . since activation of tnf receptors increases production of matrix metalloproteinases , one mechanism by which tnf can influence left ventricular remodeling appears to be induction of myocardial matrix metalloproteinases and subsequent degradation of extracellular matrix components . we found that in patients undergoing postischemic left ventricular remodeling in vitro tnf production immediately after the ischemic event was statistically increased in comparison with patients who did not develop left ventricular remodeling . more interestingly , 6 months after myocardial infarction , in the same group of patients , tnf production was persistently higher than that in the patients not undergoing left ventricular remodeling . this finding agrees with other authors studies which assessed the role of tnf both in myocardial infarction and in left ventricular remodeling ; particularly , it has been found that the levels of late cytokine activation in the noninfarctual region correlate the best with the eventual left ventricular end - diastolic diameter measured at 20 weeks after infarction [ 7 , 8 ] . our data suggest that peripheral cytokine production reflects what happens in myocardium in which the persistence of cytokine activation in response to mechanical , oxidative and neurohormonal stress initiates a vicious cycle . in patients undergoing ventricular remodeling secondary to ischemic cardiac disease , otero et al . could not find increased serum levels of tnf in comparison with those affected by dilated cardiomyopathy , whereas they found increased levels of stnf - ri and stnf - rii ; the different results obtained in this study in comparison with ours could be due to the fact that we evaluated tnf in vitro production which does not necessary correspond to increased serum levels of this cytokine . we also studied il10 in vitro production because il10 is an anti - inflammatory cytokine which modulates matrix metalloproteinase expression and suppresses pro - inflammatory cytokine synthesis , such as tnf [ 12 , 22 ] . numerous recent experimental studies have shown that either systemic or local il10 gene transfer attenuates atherogenesis and affects processes associated with lesion progression [ 23 , 24 ] . moreover , in a large cohort of patients affected by acute coronary syndromes , elevated il10 serum levels have been associated with a more favourable prognosis . however , at least in animal models , il10 does not seem to play a critical role in infarct healing and left ventricular remodeling , because il10 gene disruption does not alter fibrous tissue deposition and dilatative remodeling of the infarcted heart in a mouse model . similarly , the pretreatment of cardiac fibroblasts with il10 does not inhibit chemokine synthesis in response to tnf . in our study , il10 production was significantly decreased in comparison with normal subjects in both patients undergoing left ventricular remodeling and those not undergoing left ventricular remodeling , immediately after myocardial infarction . however , in those patients who did not develop left ventricular remodeling il10 increased progressively reaching normal levels 6 months after the acute event , whereas in those developing left ventricular remodeling it increased on day 3 and 7 after reperfusion but returned to baseline levels 1 and 6 months after reperfusion . therefore il10 seems to play a protective role because lower levels several months after reperfusion are associated with left ventricular remodeling . such findings could be of relevance because they add data to the body of evidence dealing with a more complex system in vivo , in which the balance between pro-/anti - inflammatory mediators is operating in cardiac remodeling with respect to the single action of several pro-/anti - inflammatory mediators as shown especially in animal models . finally we evaluated lymphocyte apoptosis because we found a persistent and increased production of tnf in ventricular remodeling patients . tnf is able to induce apoptosis in several cell types , including lymphocytes , by binding to tnfr-1 that contains a death domain [ 27 , 28 ] . moreover , in some human models , such as in aging , both tnf production and tnf-induced apoptosis are increased [ 29 , 30 ] . however , spontaneous lymphocyte apoptosis was not different among ventricular remodeling patients , not ventricular remodeling ones and controls . it remains to be established whether the increased systemic tnf production contributes to the increased cardiomyocyte apoptosis that has been found in postinfarction cardiac remodeling , especially at the site of recent infarction but also in unaffected areas to a lesser extent [ 31 , 32 ] . in summary , our data analysing the cytokine network in the complex processes of postischemic left ventricular remodeling have confirmed important disturbances in the cell production of pro- and anti - inflammatory mediators ; in particular the increase of pro - inflammatory cytokine tnf is associated with the decrease of il10 which could exert a protective / regulatory role . it is not clear why the same ischemic stress induces in patients with similar characteristics more tnf and less il10 production than in others . however we can observe that a marked imbalance between pro - inflammatory and protective mechanism is generated in patients undergoing left ventricular remodeling and we can suggest that the lack of this important homeostatic mechanism could influence the activation and the extent of inflammatory reaction which leads to the progression of ventricular remodeling and consequent myocardial failure .	objectives . cytokines play an important role in left ventricular remodeling consequent to myocardial ischemia . the aim of this study was to correlate cytokine production and lymphocyte apoptosis to post - ischemic left ventricular remodeling in patients affected by acute myocardial infarction ( ami ) undergoing primary cutaneous angioplasty ( pci ) . methods . in 40 patients , affected by ami and undergoing pci , we evaluated peripheral blood mononuclear cells ( pbmcs ) , tumor necrosis factor - alpha ( tnf- ) and interleukin 10 ( il10 ) production and apoptosis on day 1 , day 3 , day 7 , 1 month and 6 months after pci . patients were divided into two subgroups of remodeling or not remodeling by echocardiographic criteria . results . in the subgroup of remodeling patients , at each timepoint tnf- production was increased significantly in comparison with the subgroup of not remodeling patients . il10 production was statistically lower in remodeling subjects than in not remodeling ones 1 and 6 months after reperfusion . there were no differences between the two groups as regards lymphomonocyte apoptosis . conclusions . we found an increased production of pro - inflammatory cytokine tnf- and a corresponding decrease of anti - inflammatory / regulatory cytokine il10 in remodeling patients and we concluded that this cytokine imbalance resulted in pro - inflammatory effects which might contribute to the progression of left ventricular remodeling .
You are an expert at summarizing long articles. Proceed to summarize the following text: angiotensin - converting enzyme ( ace ) inhibitors have been used extensively in the management of hypertension and heart failure . recent trials , primarily the heart outcomes prevention evaluation ( hope ) study , also demonstrate a clear role for these agents in reducing the risk for adverse cardiovascular outcomes in patients without heart failure and with preserved left ventricular ( lv ) ejection fraction . experimental research and recent clinical studies also show favorable effects of ace inhibitor therapy on the arterial vascular wall . the study to evaluate carotid ultrasound changes in patients treated with ramipril and vitamin e ( secure ) , a substudy of the hope trial , thus demonstrated reduced progression of carotid atherosclerosis in patients treated with ramipril . what are ' optimal ' doses of ace inhibitors to be used in different clinical settings ? a number of surveys suggest that clinicians often prefer the use of low doses of ace inhibitors , and the perception that low doses are as effective as high ones is quite prevalent . in addition , clinicians frequently titrate ace inhibitor dose according to blood pressure and rely on ' adequate ' blood pressure control as a marker of the effectiveness of this therapy , not only in patients treated for hypertension , but also in those treated for heart failure and for reduction of cardiovascular risk . in this commentary , several lines of evidence have been extracted from clinical trials in chronic heart failure , coronary artery disease ( cad ) and atherosclerosis to show that the size of the ace inhibitor dose matters , higher doses are more effective than lower doses and the duration of therapy is important . several clinical trials in heart failure have specifically addressed the question of optimal ace inhibitor dose ( table 1 ) . with the exception of the assessment of treatment with lisinopril and survival ( atlas ) trial , these studies have been underpowered , both with regard to the number of patients studied and the duration of treatment and follow - up . furthermore , some of these studies , such as the network of general practitioners and hospital physicians involved in the study of low versus high doses of enalapril in patients with heart failure ( network ) trial ( which found no conclusive benefit for higher versus lower dose enalapril ) enrolled mainly patients with mild , new york heart association ( nyha ) class i heart failure . the atlas trial , a much larger study with adequate long - term follow - up lasting 46 months , enrolled a significant proportion ( 84% ) of patients with more advanced , class iii or iv nyha heart failure symptoms . this study identified a significant 12% lower risk for death or all - cause hospitalization and a 24% reduction in hospitalizations for heart failure in patients treated with high - dose compared to those treated with low - dose lisinopril . the extended analysis of the atlas study , including patients at high risk for cardiovascular death ( such as diabetics and those with lv ejection fraction of less than 25% ) , showed similar benefit in the combined endpoint of mortality and all - cause hospital admissions . these findings support the use of higher doses of ace inhibitors in patients with chronic heart failure . ' very high ' ace inhibitor doses ( i.e. higher than those usually employed in clinical practice ) are unlikely to provide additional benefit . trials exploring ace inhibitor dosing regimens in heart failure ace - i = angiotensin - converting enzyme inhibitor ; atlas = assessment of treatment with lisinopril and survival ; chips = captopril in heat insufficient patients study ; heds = high enalapril dose study ; network = network of general practitioners and hospital physicians involved in the study of low versus high doses of enalapril in patients with heart failure trial . a number of prospective observational studies have reported that heart failure patients discharged from hospital and maintained on ' high ' ace inhibitor doses had improved clinical outcomes compared to those receiving low dose therapy . the benefits included lower rates of death and re - hospitalization , thus incurring lower costs . the ability to achieve adequate doses of ace inhibitors for the treatment of chronic heart failure in general practice is also well documented . studies such as the prospective evaluation by messner pellenc found that a daily dose of 20 mg of enalapril could be reached in a high proportion of heart - failure patients with good tolerability and improved outcomes . clinical practice guidelines , published by both the agency for health care policy and research and the american college of cardiology / american heart association , reflect the findings of these studies . these recommend that when managing chronic heart failure , every effort should be made to increase the dose of ace inhibitors to the target doses shown in clinical trials to decrease mortality and morbidity , for example at least 150 mg daily of captopril or at least 20 mg daily of enalapril or lisinopril . a number of large randomized controlled clinical trials have demonstrated the beneficial effects of ace inhibitors in coronary artery disease in patients with prior , recent or remote myocardial infarction . such trials have enrolled patients either with heart failure or with documented lv systolic dysfunction and , more recently in the hope trial , patients with preserved lv ejection fraction without heart failure symptoms . in addition to improved mortality rates and a reduction in heart - failure - related outcomes , the major randomized clinical trials of ace inhibitors in cad have also demonstrated a reduction in acute ischemic events . these large clinical trials have not compared different ace inhibitor dosing regimens , but invariably used ' high ' target ace inhibitor doses . among these studies , those with longer duration of treatment and follow - up showed more pronounced benefits ( fig . 1 ) . the effect of ace inhibitor therapy on myocardial infarction in chronic coronary artery disease . ace inhibitor dose and duration of therapy in the major large clinical trials of ace inhibitors in coronary artery disease are shown . reduction in myocardial infarction risk was obtained with prolonged administration of high doses of ace inhibitors . aire = acute infarction ramipril efficay study ; hope = heart outcomes prevention evaluation study ; save = survival and ventricular enlargement trial ; solvd - p = studies of left ventricular enlargement - prevention arm ; solvd - t = studies of left ventricular enlargement - treatment arm ; trace = trandolapril cardiac evaluation study . notably , the quinapril ischemic event trial ( quiet ) , used an intermediate dose of quinapril ( 20 mg daily ) and failed to demonstrate a clear benefit for ace inhibitor therapy in patients with preserved lv systolic function . by contra - distinction , the trial on reversing endothelial dysfunction(trend ) substudy of quiet , which used a higher ace inhibitor daily dose of 40 mg of quinapril , did show significant improvement in coronary endothelial function in actively treated patients . the failure to demonstrate a statistically significant advantage for quinapril in the quiet trial may be related to multiple factors , such as the low event rates , the inadequate sample size , the duration of the study and the suboptimal compliance . it remains possible , however , that the chosen ace inhibitor dose may have also contributed to the overall disappointing results of this study . in the absence of clinical trials that compare high - dose versus low - dose ace inhibitor regimens in chronic cad , the most prudent approach is to aim for the relatively high target doses used in the large randomized clinical trials . a large body of experimental evidence suggests that prolonged ace inhibitor therapy may have beneficial effects on atherogenesis , both by inhibiting the formation of tissue and circulating angiotensin ii and by bradykinin potentiation . these ace inhibitor actions result in decreased proliferation and migration of smooth muscle cells , decreased accumulation and activation of inflammatory cells , decreased oxidative stress , and increased endothelial nitric oxide formation , leading to improved endothelial function . increased ace activity has been demonstrated in human coronary artery lesions , and long - term ace inhibitor therapy has been shown to reduce the area of atherosclerotic lesions in normotensive animal models of atherosclerosis . interestingly , in all the experimental animal model studies of atherosclerosis that demonstrated beneficial effects of ace inhibitors , high drug doses were used ( e.g. captopril 3 - 25 mg / kg / day , cilazapril 10 mg / kg / day , quinapril 10 mg / kg / day ) . a number of clinical studies have evaluated the effect of ace inhibitor therapy on the progression of atherosclerosis . the best demonstration of a clear effect of ace inhibitor therapy on retarding the anatomic progression of atherosclerosis is provided by the secure substudy of hope . this study enrolled 732 high - risk patients aged 55 years or more with vascular disease or diabetes and at least one other risk factor , but without a history of heart failure or a low lv ejection fraction . patients were randomized to treatment with 2.5 mg ramipril / day , 10 mg ramipril / day , or a placebo , and the progression of atherosclerosis was monitored by b - mode carotid ultrasound . although the study was not powered to compare the two doses of ramipril , there was a trend suggesting a dose - dependent effect with the highest benefit for the group on 10 mg ramipril / day ( fig . a dose of 10 mg ramipril / day was also used in the large parent hope trial , where it was shown to have clear benefits on a range of clinical endpoints . furthermore , it is notable that blood pressure lowering with the two doses of ramipril used in the secure trial did not parallel the effects on atherosclerosis . this finding confirms that blood pressure is not an adequate surrogate marker for determining the most effective ace inhibitor dose , when treating either patients without hypertension or hypertensives with baseline , well - controlled blood pressure . the secure trial supports the notion that the effect on the vascular wall is dependent on dose , and that higher ace inhibitor dose regimens are associated with higher benefit . recent additional data from the echocardiographic substudy of the hope trial also show similar dose - dependent beneficial effects of ramipril on lv mass and function ( table 2 ) . there was a dose - dependent benefit with reduction in atherosclerosis progression attained with ramipril whcih was more effective at the higher dose of 10 mg / day than in the lower dose of 2.5 mg / day . mean maximum imt = average of maximum intimal - medial thickness across 12 predefined carotid arterial segments . effect of ramipril on echocardiographic measurements of left ventricular mass and function in a substudy of hope p < 0.05 . hope = heart outcomes prevention evaluation study ; lvmi = left ventricular mass index ; lvef = left ventricular ejection fraction ; lvedv = left ventricular end - diastolic volume ; lvesv = left ventricular end - systolic volume . the choice of ace inhibitor dose to be used in clinical practice remains a very important and difficult one . although the evidence that is currently available does not clearly identify the optimal ace inhibitor dose level to be used in different clinical settings , it suggests the following : 1 . higher doses of ace inhibitors are better than lower doses in chronic heart failure and in coronary artery disease . 2 . duration of therapy is important . in patients with atherosclerotic vascular disease ( with or without lv systolic function and with or without clinical manifestations of heart failure ) 3 . the safest and most logical clinical approach needs to be based on principles of evidence - based medicine . the currently available evidence supports the use of those specific ace inhibitors shown to reduce mortality and morbidity in clinical trials . the target doses used in these clinical trials were 10 mg ramipril / day , 20 - 40 mg enalapril / day , 150 mg captopril / day , 10 - 35 mg lisino - pril / day or 4 mg trandolapril / day . the use of other ace inhibitors that have not been tested in large - scale clinical trials with mortality and/or morbidity endpoints , and the use of lower target ace inhibitor doses can not be endorsed . 4 . there are no adequate surrogate markers to aid clinicians in the choice of the most effective ace inhibitor dose . the use of blood pressure and even the use of clinical symptoms appear to be inadequate in determining optimal ace inhibitor dose level . high ace inhibitor doses , when titrated appropriately , are generally well tolerated and can be achieved and maintained in the majority of patients with atheroscle - rotic vascular disease and/or chronic heart failure . in those who can not tolerate target doses , the highest tolerated dose should be used . an aggressive approach to therapy with comprehensive risk factor modification and use of multiple drugs as well as non - pharmaceutical approaches can improve significantly both quality of life and survival in most patients . maximizing doses of drugs that are shown to be effective is an important component of this aggressive treatment strategy and should be applied rigorously . ace = angiotensin - converting enzyme ; atlas = assessment of treatment with lisinopril and survival trial ; cad = coronary artery disease ; hope = heart outcomes prevention evaluation study ; lv = left ventricular ; nyha = ney york heart association ; network trial = network of general practitioners and hospital physicians involved in the study of low versus high doses of enalapril in patients with heart failure trial ; secure = study to evaluate carotid ultrasound changes in patients treated with ramipril and vitamin e ; quiet = quinapril ischemic event trial .	the choice of the appropriate dosage of ace inhibitor in clinical practice is an important one . the available evidence suggests that in chronic heart failure as well as in chronic coronary artery disease , high doses of angiotensin - converting enzyme ( ace ) inhibitor are more effective than low ones . the current recommended clinical approach is to target ace inhibitor dosing regimens to be similar to those used in the clinical trials , which demonstrated mortality and morbidity benefits . when titrated appropriately , ace inhibitors are generally well tolerated and target doses can be achieved and maintained in the majority of patients with atherosclerotic vascular disease , with or without heart failure .
You are an expert at summarizing long articles. Proceed to summarize the following text: previously known as pathological gambling , gambling disorder has recently been included in the substance - related and addictive disorders section of the dsm-5 ( american psychiatric association , 2013 ) . the prevalence of lifetime pathological gambling has been estimated at around 0.41.0% ( american psychiatric association , 2013 ) , depending on the country , the sample assessed , and particularly the assessment tool used . indeed , one limitation when working on general population - based samples ( like those used for prevalence surveys ) is that long structured diagnostic interviews [ like the structured clinical interview for pathological gambling ( sci - pg ) ( grant , steinberg , kim , rounsaville , & potenza , 2004 ) or the diagnostic interview for gambling severity ( digs ) ( winters , specker , & stinchfield , 2002 ) ] are not feasible on a large scale , because they need significant and costly human resources . thus , several self - report tools have been developed to enable rapid identification of gambling problems , which can be classified into three categories according to the problem gambling research and treatment centre ( pgrtc , 2011 ) . examples of long ( > 13 items ) questionnaires are the south oaks gambling screen ( sogs ) ( lesieur & blume , 1987 ) , the national opinion research center dsm screen for gambling problems ( nods ) ( gerstein et al . , 1999 ; hodgins , 2004 ) , and the victorian gambling screen ( vgs ) ( tolchard & battersby , 2010 ) . an example of medium - sized ( 412 items ) questionnaires is the canadian problem gambling inventory ( cpgi ) ( ferris & wynne , 2001 ) . finally , examples of brief ( 13 items ) screening tools are the one - item screen for problem gambling ( one - item spg ) ( thomas , piterman , & jackson , 2008 ) , the lie / bet questionnaire ( johnson et al . , 1997 ) , the brief biosocial gambling screen ( bbgs ) ( gebauer , labrie , & shaffer , 2010 ) , and the nods - clip ( control , lying , and preoccupation version of the nods toce - gerstein , gerstein , & volberg , 2009 ) . because of their short duration , brief screening tools provide a good alternative for systematic screening of large samples of people who may have an elevated risk of gambling - related problems . they must be supplemented by further assessment in case of a positive screening ( pgrtc , 2011 ) and should only be used as a first triage of people to be interviewed . according to stinchfield , mccready , and turner ( 2012 ) , the majority of the brief problem gambling screens have not been rigorously tested beyond their development . it is currently unknown what screen to be chosen for what kind of population , and whether a cross - use in clinical and community - based samples is possible without decreasing the psychometric properties . it is also still unknown if such tools are usable interchangeably in interview - based ( like telephone - based surveys ) or self - assessment - based ( like internet - based surveys ) epidemiological surveys , outside the context of their initial development . for example , the lie / bet questionnaire ( johnson et al . , 1997 ) is often used in general population for a very quick screening of problem gambling , even though stinchfield et al . ( 2012 ) rightly noted that this test is not as accurate in screening for problem gambling among the general population ( because the authors did not take the low prevalence of problem gambling into account in the validation studies ) . moreover , they emphasized that the lie / bet questionnaire displays several limitations , especially the use of a lifetime timeframe ( which is likely to increase false positive rate ) and the lack of empirical evidence of classification accuracy from investigators other than the developers . moreover , no recommendation is done about a use as a self - assessment questionnaire or an interview . but it also displays some limitations , for example , the lifetime timeframe , the lack of independence of the gold standard used for the validation study ( the full nods ) , and the lower screening performance in a clinical sample ( stinchfield et al . , 2012 ) . there is again a lack of independence of the gold standard used for the validation study ( the full audadis from which the bbgs is derived ) ( stinchfield et al . , 2012 ) . due to its recent development , the bbgs also requires further research to cross - validate its classification accuracy estimates ( stinchfield et al . , 2012 ) , because of the limited date available ( pgrtc , 2011 ) . finally , the one - item spg is one of the least used brief screening tools . critics about the one - item spg are mainly about its important brevity ( just one item ) , which yields high error rates , particularly false negative rates ( stinchfield et al . , 2012 ) . the aim of our work is to perform a systematic search of the best combinations of items from several gambling scales , to develop two brief screening tools ( three items or less ) being suitable for interview - based epidemiological surveys on the one hand and self - rating - based epidemiological surveys on the other hand . indeed , self - assessment and interviews are not strictly equivalent and the tools used must be adapted for each need . the objective is to harmonize screening of gambling problems in epidemiological surveys . another objective is to compare the combinations tested to equivalents of the four major brief screening scales previously validated and widely used ( one - item spg , lie / bet , bbgs , and nods - clip ) within a single sample , with good representation of problem gamblers . indeed , to our knowledge , those tools have so far neither been compared to each other in the same dataset , nor tested in samples combining problem gamblers and non - problem gamblers ( npg ) . this analysis was performed using baseline data from the jeu cohort study , collected between 2009 and 2011 ( challet - bouju et al . , 2014 ) . the jeu cohort consists of 628 gamblers , divided into three groups , depending on whether they are problem or non - problem gamblers and on whether they had sought treatment or not . the main objective of this study is to identify the determinants of key state changes in the gambling practice . initially based on the pathological gambling section of the dsm - iv , the diagnosis of a gambling disorder was reassessed for this analysis according to the current dsm-5 section for gambling disorders ( i.e. , removal of criterion 8 on illegal acts and use of a threshold of 4 ) . with this re - categorization , the sample was composed of 301 npg , 124 problem gamblers without treatment ( pgwt ) , and 186 problem gamblers seeking treatment ( pgst ) ( 17 more gamblers were initially in the pgst group , but were reclassified as npg with the dsm-5 classification ; we decided to exclude them a posteriori from the npg group because they had sought treatment ) . npg and pgwt were recruited in various gambling places and via the press , in order to cover the broadest possible range of gambling activities . pgsts were recruited in seven care centers , among patients who started treatment less than 6 months before . only participants who reported gambling on at least one occasion during the previous year and who were between 18 and 65 years old were included in the study . for more information about the jeu cohort study , refer to the study protocol ( challet - bouju et al . , 2014 ) . interview based on the 10 diagnostic criteria for pathological gambling in the dsm - iv ( american psychiatric association , 2000 ) , an interview designed to explore their gambling history and habits ( lifetime subjective history of problem gambling , monthly expenses in gambling , and abstinence of 1 month or more ) , and two self - report questionnaires : the sogs ( lejoyeux , 1999 ; lesieur & blume , 1987 ) and the gambling attitudes and beliefs scale ( gabs ) ( bouju et al . the sogs is a well - known measure of problem gambling severity , and the gabs measures cognitive biases , irrational beliefs , and positively valued attitudes to gambling ( breen & zuckerman , 1999 ) . the formulations of the interview - based items are given in table 1 [ for the formulations of items from the sogs and the gabs , see the validation papers of these scales ( breen & zuckerman , 1999 ; lesieur & blume , 1987 ) ] . the dsm-5 status was used as a gold standard to perform the screening properties analysis . formulations of the interview - based items for the secondary objective , we focused particularly on combinations which could correspond to equivalents of the four major brief screening scales ( one - item spg , lie / bet , bbgs , and nods - clip ) . indeed , even if these combinations are not strictly formulated in the same way as the original scales , we presume that they represent good equivalents that could be used for the comparison . the formulations of the originals and equivalents of the four brief screening tools are given in table 2 . formulations of the original and equivalents four major brief screening tools tested for the interview - based tool , we tested the screening properties of combinations of the 10 items from the pathological gambling section of the dsm - iv and the three questions from the gambling history and habits ( lifetime history of problem gambling , monthly expenses in gambling , and abstinence of 1 month or more ) . for the self - report - based tool , we tested the screening properties of combinations of 25 items from the sogs ( items 216 k , excluding question 12 and including non - scoring items ) and the 35 items from the gabs . question 2 of the sogs was rephrased in order to obtain the value of the maximum amount of money wagered in a day ( instead of amounts grouped in classes ) . in order to obtain a binary response to this question answer , calculated to maximize the youden index [ ( yi ) which is a statistic that measures the performance of a diagnostic test , independently of the disorder s prevalence ] ( youden , 1950 ) . the same strategy was used for the interview question about the monthly expenses in gambling , with a threshold of 125 . gabs responses ( with four response modalities from strongly agree to strongly disagree ) were redefined as yes answers when strongly agree or all possible combinations of one to three items ( n = 377 for interview combinations and n = 34,279 for self - report combinations ) were tested . a combination was considered as having a positive screening when there was at least one yes answer . screening properties ( sensitivity : se , specificity : sp , incorrect classification rate : icr , youden index : yi , and positive and negative predictive values : ppv and npv ) were estimated in the jeu sample excluding pgsts . we excluded pgsts because the final brief screening tools are not intended to be used clinically for problem gamblers in treatment , so that their inclusion would not have been relevant . in addition to providing the screening properties in our sample without the pgsts , we then re - computed ppv , npv , and icr to take into account the french prevalence of problem gambling in the population of past - year gamblers , that is , 2.76% ( costes et al . , 2011 ) . the prevalence of problem gambling in past - year gamblers ( pr ) was calculated as follows : prevalence of active gamblers in the general population ( 12.2% ) prevalence of problem gambling in active gamblers ( 10.8%)/prevalence of past - year gamblers in the general population ( 47.8% ) ( costes et al . , 2011 ) . the adjusted ppv was calculated as follows : se pr/[se pr + ( 1 sp)(1 pr ) ] , the adjusted npv as follows : sp(1 pr)/[sp(1 pr ) + ( 1 se)pr ] , and the adjusted icr as follows : ( 1 sp)(1 pr ) + ( 1 se)pr , where pr = 0.0276 . the objective , in adjusting the proportion of problem gamblers according to national prevalence , was to obtain a more realistic sample ( because the sample used in the jeu cohort study was constituted based on an approximate equality of size between problem and non - problem gamblers , it overestimates the prevalence of problem gambling ) . as stated above , the aim of brief screening tools is to enable rapid identification of potential problem gamblers , in order to reduce the number of people to be interviewed . consequently , we chose to retain only the combinations of items with the highest sensitivity for consideration ( we set the threshold at 0.95 ) . of these , the final choice of the best combination for each modality ( interview or self - report ) and within each number of items was the one with the highest yi , which is a statistic that combines both se and sp , and thus gives a good compromise between true positive and true negative rates . within the best retained combinations of each modality , we chose to favor the briefer ones if they had equivalent properties , in order to have the shortest duration . as argued by volberg , munck , and petry ( 2011 ) , although sensitivity is the key performance characteristic of a screening tool , diagnostic efficiency is also very important to determine the tool s accuracy . thus , the equivalence of properties was determined as a difference in se , sp , or icr of less than 5% . participants were informed about the research and gave their written informed consent prior to their inclusion in the study . this study was approved by the french research ethics committee ( cpp ) on january 8 , 2009 . this analysis was performed using baseline data from the jeu cohort study , collected between 2009 and 2011 ( challet - bouju et al . , 2014 ) . the jeu cohort consists of 628 gamblers , divided into three groups , depending on whether they are problem or non - problem gamblers and on whether they had sought treatment or not . the main objective of this study is to identify the determinants of key state changes in the gambling practice . initially based on the pathological gambling section of the dsm - iv , the diagnosis of a gambling disorder was reassessed for this analysis according to the current dsm-5 section for gambling disorders ( i.e. , removal of criterion 8 on illegal acts and use of a threshold of 4 ) . with this re - categorization , the sample was composed of 301 npg , 124 problem gamblers without treatment ( pgwt ) , and 186 problem gamblers seeking treatment ( pgst ) ( 17 more gamblers were initially in the pgst group , but were reclassified as npg with the dsm-5 classification ; we decided to exclude them a posteriori from the npg group because they had sought treatment ) . npg and pgwt were recruited in various gambling places and via the press , in order to cover the broadest possible range of gambling activities . pgsts were recruited in seven care centers , among patients who started treatment less than 6 months before . only participants who reported gambling on at least one occasion during the previous year and who were between 18 and 65 years old were included in the study . for more information about the jeu cohort study , refer to the study protocol ( challet - bouju et al . , 2014 ) . among other assessments , participants were interviewed throughout a past year interview based on the 10 diagnostic criteria for pathological gambling in the dsm - iv ( american psychiatric association , 2000 ) , an interview designed to explore their gambling history and habits ( lifetime subjective history of problem gambling , monthly expenses in gambling , and abstinence of 1 month or more ) , and two self - report questionnaires : the sogs ( lejoyeux , 1999 ; lesieur & blume , 1987 ) and the gambling attitudes and beliefs scale ( gabs ) ( bouju et al . , 2014 ; breen & zuckerman , 1999 ) . the sogs is a well - known measure of problem gambling severity , and the gabs measures cognitive biases , irrational beliefs , and positively valued attitudes to gambling ( breen & zuckerman , 1999 ) . the formulations of the interview - based items are given in table 1 [ for the formulations of items from the sogs and the gabs , see the validation papers of these scales ( breen & zuckerman , 1999 ; lesieur & blume , 1987 ) ] . the dsm-5 status was used as a gold standard to perform the screening properties analysis . formulations of the interview - based items for the secondary objective , we focused particularly on combinations which could correspond to equivalents of the four major brief screening scales ( one - item spg , lie / bet , bbgs , and nods - clip ) . indeed , even if these combinations are not strictly formulated in the same way as the original scales , we presume that they represent good equivalents that could be used for the comparison . the formulations of the originals and equivalents of the four brief screening tools are given in table 2 . for the interview - based tool , we tested the screening properties of combinations of the 10 items from the pathological gambling section of the dsm - iv and the three questions from the gambling history and habits ( lifetime history of problem gambling , monthly expenses in gambling , and abstinence of 1 month or more ) . for the self - report - based tool , we tested the screening properties of combinations of 25 items from the sogs ( items 216 k , excluding question 12 and including non - scoring items ) and the 35 items from the gabs . question 2 of the sogs was rephrased in order to obtain the value of the maximum amount of money wagered in a day ( instead of amounts grouped in classes ) . in order to obtain a binary response to this question answer , calculated to maximize the youden index [ ( yi ) which is a statistic that measures the performance of a diagnostic test , independently of the disorder s prevalence ] ( youden , 1950 ) . the same strategy was used for the interview question about the monthly expenses in gambling , with a threshold of 125 . gabs responses ( with four response modalities from strongly agree to strongly disagree ) were redefined as yes answers when strongly agree or all possible combinations of one to three items ( n = 377 for interview combinations and a combination was considered as having a positive screening when there was at least one yes answer . screening properties ( sensitivity : se , specificity : sp , incorrect classification rate : icr , youden index : yi , and positive and negative predictive values : ppv and npv ) were estimated in the jeu sample excluding pgsts . we excluded pgsts because the final brief screening tools are not intended to be used clinically for problem gamblers in treatment , so that their inclusion would not have been relevant . in addition to providing the screening properties in our sample without the pgsts , we then re - computed ppv , npv , and icr to take into account the french prevalence of problem gambling in the population of past - year gamblers , that is , 2.76% ( costes et al . , 2011 ) . the prevalence of problem gambling in past - year gamblers ( pr ) was calculated as follows : prevalence of active gamblers in the general population ( 12.2% ) prevalence of problem gambling in active gamblers ( 10.8%)/prevalence of past - year gamblers in the general population ( 47.8% ) ( costes et al . , 2011 ) . pr/[se pr + ( 1 sp)(1 pr ) ] , the adjusted npv as follows : sp(1 pr)/[sp(1 pr ) + ( 1 se)pr ] , and the adjusted icr as follows : ( 1 sp)(1 pr ) + ( 1 se)pr , where pr = 0.0276 . the objective , in adjusting the proportion of problem gamblers according to national prevalence , was to obtain a more realistic sample ( because the sample used in the jeu cohort study was constituted based on an approximate equality of size between problem and non - problem gamblers , it overestimates the prevalence of problem gambling ) . as stated above , the aim of brief screening tools is to enable rapid identification of potential problem gamblers , in order to reduce the number of people to be interviewed . consequently , we chose to retain only the combinations of items with the highest sensitivity for consideration ( we set the threshold at 0.95 ) . of these , the final choice of the best combination for each modality ( interview or self - report ) and within each number of items was the one with the highest yi , which is a statistic that combines both se and sp , and thus gives a good compromise between true positive and true negative rates . within the best retained combinations of each modality , we chose to favor the briefer ones if they had equivalent properties , in order to have the shortest duration . as argued by volberg , munck , and petry ( 2011 ) , although sensitivity is the key performance characteristic of a screening tool , diagnostic efficiency is also very important to determine the tool s accuracy . thus , the equivalence of properties was determined as a difference in se , sp , or icr of less than 5% . participants were informed about the research and gave their written informed consent prior to their inclusion in the study . this study was approved by the french research ethics committee ( cpp ) on january 8 , 2009 . there were 194 interview combinations with sensitivity greater or equal to 0.95 , 15 of them being composed of two items , and 179 of three items ( none with just one item ) . among them , the top 10 combinations ( regarding their yi ) are presented in table 3 ( top 5 for 2-item combinations and top 5 for 3-item combinations ) , with their relative screening properties . we can notice that the combinations which were considered as equivalents to three of the four major brief screening tools ( lie / bet , bbgs , and nods - clip ) were not in the top 10 . the equivalent of the nods - clip was the only one to be in the 194 combinations with sensitivity greater or equal to 0.95 ( in the 49th position of 3-item combinations ) . screening properties of the top 10 best combinations of interview - based items , and comparison with three equivalents of brief screening tools ( lie / bet , bbgs , and nods - clip ) notes . only combinations with the highest sensitivity ( se 0.95 ) were first selected , and the obtained list of combinations was then graded according to the highest youden index ( yi ) . the retained combination is emphasized in italic font . for all combinations , the screening of a gambling problem was based on at least one yes answer . yi : youden index = sensitivity + specificity 1 ; performance of a diagnostic test , independently of the disorder s prevalence . se : sensitivity ; probability of screening a participant with a diagnosis of gambling disorder according to the gold standard ( full pathological gambling section of the dsm-5 ) as a problem gambler , using the screening tool tested . sp : specificity ; probability of screening a participant who does not have a diagnosis of gambling disorder according to the gold standard ( full pathological gambling section of the dsm-5 ) , as a npg with the screening tool tested . ppv : positive predictive value ; probability of a participant who is screened as a problem gambler using the tested screening tool , having a diagnosis of gambling disorder according to the gold standard ( full pathological gambling section of the dsm-5 ) . npv : negative predictive value ; probability of a participant who is screened as a npg using the tested screening tool , not having a diagnosis of gambling disorder according to the gold standard ( full pathological gambling section of the dsm-5 ) . icr : incorrect classification rate : proportion of misclassified gamblers ( problem gamblers according to the gold standard who are classified as npg using the tested screening tool and npg according to the gold standard who are classified as problem gamblers using the tested screening tool ) . yi , se , and sp are estimated values of the youden index , sensitivity and specificity obtained from the jeu sample excluding pgsts . ppv , npv , and icr were approximated using estimated values of se and sp in the jeu sample excluding pgsts , and then re - computed to take into account the french prevalence rate of pathological gambling in the population of past - year gamblers ( appv : adjusted ppv ; anpv : adjusted npv ; and aicr : adjusted icr ) , that is 2.76% of at risk or excessive gambling ( costes et al . , 2011 ) . lifetime history of pg = subjective evaluation by the gambler whether he had or not a lifetime history of problem gambling . three equivalents of interview - based brief screening tools ( lie / bet , bbgs , and nods - clip ) . the best combinations were composed of items 2 ( increasing bets ) and 3 ( loss of control ) from the dsm for 2-item combinations , and items 1 ( preoccupation ) , 4 ( withdrawal ) , and 9 ( jeopardizing of other activities ) from the dsm for 3-item combinations . since both combinations exhibited equivalent properties ( difference for se of 3% and sp and icr of 2% ) , we chose to retain the briefer combination ( i.e. , dsm2dsm3 combination ) as the best one for interview - based brief screening tool . there were 7,465 self - assessment combinations with sensitivity greater or equal to 0.95 , 100 of them being composed of two items and 7,365 of three items ( none with just one item ) . among them , the top 10 combinations ( regarding their yi ) are presented in table 4 ( top 5 for 2-item combinations and top 5 for 3-item combinations ) , with their relative screening properties . we can notice that the combination which was considered as equivalent to one of the major brief screening tools ( one - item ) was not in the top 10 , and even not in the high - sensitivity combinations . screening properties of the best combinations of self - report items , and comparison with one equivalent of brief screening tool ( one - item spg ) notes . only combinations with the highest sensitivity ( se 0.95 ) were first selected , and the obtained list of combinations was then graded according to the highest youden index ( yi ) . the retained combination is emphasized in italic font . for all combinations , the screening of a gambling problem was based on at least one yes answer . yi : youden index = sensitivity + specificity 1 ; performance of a diagnostic test , independently of the disorder s prevalence . se : sensitivity ; probability of screening a participant with a diagnosis of gambling disorder according to the gold standard ( full pathological gambling section of the dsm-5 ) as a problem gambler , using the screening tool tested . sp : specificity ; probability of screening a participant who does not have a diagnosis of gambling disorder according to the gold standard ( full pathological gambling section of the dsm-5 ) , as a npg with the screening tool tested . ppv : positive predictive value ; probability of a participant who is screened as a problem gambler using the tested screening tool , having a diagnosis of gambling disorder according to the gold standard ( full pathological gambling section of the dsm-5 ) . npv : negative predictive value ; probability of a participant who is screened as a npg using the tested screening tool , not having a diagnosis of gambling disorder according to the gold standard ( full pathological gambling section of the dsm-5 ) . icr : incorrect classification rate : proportion of misclassified gamblers ( problem gamblers according to the gold standard who are classified as npg using the tested screening tool and npg according to the gold standard who are classified as problem gamblers using the tested screening tool ) . yi , se , and sp are estimated values of the youden index , sensitivity and specificity obtained from the jeu sample excluding pgsts . ppv , npv , and icr were approximated using estimated values of se and sp in the jeu sample excluding pgsts and then re - computed to take into account the french prevalence rate of pathological gambling in the population of past - year gamblers ( appv : adjusted ppv ; anpv : adjusted npv ; and aicr : adjusted icr ) , that is 2.76% of at risk or excessive gambling ( costes et al . , 2011 ) . the equivalent of the self - report brief screening tool ( one - item spg ) . the best combinations were composed of item 6 from the sogs ( past 12 months history of pg ) and item 5 from the gabs ( losing track of time ) for 2-item combinations , and items 4 ( chasing ) , 9 ( guiltiness ) , and 10 ( perceived inability to stop ) from the sogs for 3-item combinations . since the two combinations exhibited very different properties ( difference for se of 1% , sp of 13% , and icr of 9% ) , we chose to retain the longer combination ( that is sogs4sogs9sogs10 ) as the best one for self - assessment brief screening tool . we named it the rapid screener for problem gambling self - assessment ( rspg - sa ) . table 5 shows the concordance between dsm-5 diagnosis and rspg - i and rspg - sa classifications . the results show that the rspg - i and the rspg - sa captured the vast majority ( 95.2% and 95.0% , respectively ) of participants with a gambling disorder according to the dsm-5 . it means that less than 5% of disordered gamblers were not covered by the rspg . both rspg versions captured a significant proportion of gamblers without a gambling disorder ( 21.9% for rspg - i and 36.3% for rspg - sa ) , which reflects the low specificity of the two questionnaires , particularly rspg - sa . as specificity performance was not the priority for the selection of best combinations , this is not surprising . the objective was to miss as few disordered gamblers as possible . concerning the severity assessed by the dsm-5 among the participants with a gambling disorder , all the severe disordered gamblers were captured by both questionnaires and almost all the moderate disordered gamblers were captured by rspg - i ( 97.7% ) and rspg - sa ( 97.6% ) . for mild disordered gamblers , the capture rate was lower for both questionnaires , but still acceptable ( 91.2% and 91.1% ) . classification accuracy of the rapid screener for problem gambling ( rspg ) compared to gambling disorder dsm-5 diagnosis and severity , in the jeu cohort excluding pgsts ( n = 425 ) note . gd = diagnosis of a gambling disorder according to dsm-5 ; gd/gd+ = without a gambling disorder / with a gambling disorder ; rspgi+ = positive screening of a gambling problem according to the rapid screener for problem gambling interview ; rspgsa+ = positive screening of a gambling problem according to the rapid screener for problem gambling self - assessment ; md = missing data . there were 194 interview combinations with sensitivity greater or equal to 0.95 , 15 of them being composed of two items , and 179 of three items ( none with just one item ) . among them , the top 10 combinations ( regarding their yi ) are presented in table 3 ( top 5 for 2-item combinations and top 5 for 3-item combinations ) , with their relative screening properties . we can notice that the combinations which were considered as equivalents to three of the four major brief screening tools ( lie / bet , bbgs , and nods - clip ) were not in the top 10 . the equivalent of the nods - clip was the only one to be in the 194 combinations with sensitivity greater or equal to 0.95 ( in the 49th position of 3-item combinations ) . screening properties of the top 10 best combinations of interview - based items , and comparison with three equivalents of brief screening tools ( lie / bet , bbgs , and nods - clip ) notes . only combinations with the highest sensitivity ( se 0.95 ) were first selected , and the obtained list of combinations was then graded according to the highest youden index ( yi ) . the retained combination is emphasized in italic font . for all combinations , the screening of a gambling problem was based on at least one yes answer . yi : youden index = sensitivity + specificity 1 ; performance of a diagnostic test , independently of the disorder s prevalence . se : sensitivity ; probability of screening a participant with a diagnosis of gambling disorder according to the gold standard ( full pathological gambling section of the dsm-5 ) as a problem gambler , using the screening tool tested . sp : specificity ; probability of screening a participant who does not have a diagnosis of gambling disorder according to the gold standard ( full pathological gambling section of the dsm-5 ) , as a npg with the screening tool tested . ppv : positive predictive value ; probability of a participant who is screened as a problem gambler using the tested screening tool , having a diagnosis of gambling disorder according to the gold standard ( full pathological gambling section of the dsm-5 ) . npv : negative predictive value ; probability of a participant who is screened as a npg using the tested screening tool , not having a diagnosis of gambling disorder according to the gold standard ( full pathological gambling section of the dsm-5 ) . icr : incorrect classification rate : proportion of misclassified gamblers ( problem gamblers according to the gold standard who are classified as npg using the tested screening tool and npg according to the gold standard who are classified as problem gamblers using the tested screening tool ) . yi , se , and sp are estimated values of the youden index , sensitivity and specificity obtained from the jeu sample excluding pgsts . ppv , npv , and icr were approximated using estimated values of se and sp in the jeu sample excluding pgsts , and then re - computed to take into account the french prevalence rate of pathological gambling in the population of past - year gamblers ( appv : adjusted ppv ; anpv : adjusted npv ; and aicr : adjusted icr ) , that is 2.76% of at risk or excessive gambling ( costes et al . , 2011 ) . lifetime history of pg = subjective evaluation by the gambler whether he had or not a lifetime history of problem gambling . three equivalents of interview - based brief screening tools ( lie / bet , bbgs , and nods - clip ) . the best combinations were composed of items 2 ( increasing bets ) and 3 ( loss of control ) from the dsm for 2-item combinations , and items 1 ( preoccupation ) , 4 ( withdrawal ) , and 9 ( jeopardizing of other activities ) from the dsm for 3-item combinations . since both combinations exhibited equivalent properties ( difference for se of 3% and sp and icr of 2% ) , we chose to retain the briefer combination ( i.e. , dsm2dsm3 combination ) as the best one for interview - based brief screening tool . there were 7,465 self - assessment combinations with sensitivity greater or equal to 0.95 , 100 of them being composed of two items and 7,365 of three items ( none with just one item ) . among them , the top 10 combinations ( regarding their yi ) are presented in table 4 ( top 5 for 2-item combinations and top 5 for 3-item combinations ) , with their relative screening properties . we can notice that the combination which was considered as equivalent to one of the major brief screening tools ( one - item ) was not in the top 10 , and even not in the high - sensitivity combinations . screening properties of the best combinations of self - report items , and comparison with one equivalent of brief screening tool ( one - item spg ) notes . only combinations with the highest sensitivity ( se 0.95 ) were first selected , and the obtained list of combinations was then graded according to the highest youden index ( yi ) . the retained combination is emphasized in italic font . for all combinations , the screening of a gambling problem was based on at least one yes answer . yi : youden index = sensitivity + specificity 1 ; performance of a diagnostic test , independently of the disorder s prevalence . se : sensitivity ; probability of screening a participant with a diagnosis of gambling disorder according to the gold standard ( full pathological gambling section of the dsm-5 ) as a problem gambler , using the screening tool tested . sp : specificity ; probability of screening a participant who does not have a diagnosis of gambling disorder according to the gold standard ( full pathological gambling section of the dsm-5 ) , as a npg with the screening tool tested . ppv : positive predictive value ; probability of a participant who is screened as a problem gambler using the tested screening tool , having a diagnosis of gambling disorder according to the gold standard ( full pathological gambling section of the dsm-5 ) . npv : negative predictive value ; probability of a participant who is screened as a npg using the tested screening tool , not having a diagnosis of gambling disorder according to the gold standard ( full pathological gambling section of the dsm-5 ) . icr : incorrect classification rate : proportion of misclassified gamblers ( problem gamblers according to the gold standard who are classified as npg using the tested screening tool and npg according to the gold standard who are classified as problem gamblers using the tested screening tool ) . yi , se , and sp are estimated values of the youden index , sensitivity and specificity obtained from the jeu sample excluding pgsts . ppv , npv , and icr were approximated using estimated values of se and sp in the jeu sample excluding pgsts and then re - computed to take into account the french prevalence rate of pathological gambling in the population of past - year gamblers ( appv : adjusted ppv ; anpv : adjusted npv ; and aicr : adjusted icr ) , that is 2.76% of at risk or excessive gambling ( costes et al . , 2011 ) . the equivalent of the self - report brief screening tool ( one - item spg ) . the best combinations were composed of item 6 from the sogs ( past 12 months history of pg ) and item 5 from the gabs ( losing track of time ) for 2-item combinations , and items 4 ( chasing ) , 9 ( guiltiness ) , and 10 ( perceived inability to stop ) from the sogs for 3-item combinations . since the two combinations exhibited very different properties ( difference for se of 1% , sp of 13% , and icr of 9% ) , we chose to retain the longer combination ( that is sogs4sogs9sogs10 ) as the best one for self - assessment brief screening tool . we named it the rapid screener for problem gambling self - assessment ( rspg - sa ) . table 5 shows the concordance between dsm-5 diagnosis and rspg - i and rspg - sa classifications . the results show that the rspg - i and the rspg - sa captured the vast majority ( 95.2% and 95.0% , respectively ) of participants with a gambling disorder according to the dsm-5 . it means that less than 5% of disordered gamblers were not covered by the rspg . both rspg versions captured a significant proportion of gamblers without a gambling disorder ( 21.9% for rspg - i and 36.3% for rspg - sa ) , which reflects the low specificity of the two questionnaires , particularly rspg - sa . as specificity performance was not the priority for the selection of best combinations , this is not surprising . concerning the severity assessed by the dsm-5 among the participants with a gambling disorder , all the severe disordered gamblers were captured by both questionnaires and almost all the moderate disordered gamblers were captured by rspg - i ( 97.7% ) and rspg - sa ( 97.6% ) . for mild disordered gamblers , the capture rate was lower for both questionnaires , but still acceptable ( 91.2% and 91.1% ) . classification accuracy of the rapid screener for problem gambling ( rspg ) compared to gambling disorder dsm-5 diagnosis and severity , in the jeu cohort excluding pgsts ( n = 425 ) note . gd = diagnosis of a gambling disorder according to dsm-5 ; gd/gd+ = without a gambling disorder / with a gambling disorder ; rspgi+ = positive screening of a gambling problem according to the rapid screener for problem gambling interview ; rspgsa+ = positive screening of a gambling problem according to the rapid screener for problem gambling self - assessment ; md = missing data . the objective of this work was to develop two brief screening tools ( three items or less ) being suitable for reducing the duration of problem gambling screening in interview - based and self - rating - based epidemiological surveys . the analyses have enabled us to propose two very brief screening tools ( two or three items ) for problem gambling : the rspg - i and the rspg - sa . the final rspg - i and rspg - sa are given in english language in table 6 and in french language in table 7 ( note that the french version was the only one to be tested in this work , and that the english version corresponds to a translation which has not been validated ) . final rapid screener for problem gambling ( rspg ) english version final rapid screener for problem gambling ( rspg ) french version the rspg - i is composed of two criteria from the gambling disorder section of the dsm : the increasing bets criterion and the loss of control criterion . this version exhibited good screening properties and was especially efficient for screening gamblers with a diagnosis of gambling disorder ( sensitivity of 0.95 ) . even if we selected the best combinations first based on the best sensitivity , the other properties remained at good levels . in particular , the rspg - i showed good diagnosis efficiency ( 83.1% ) , in the same range as the nods - clip ( 86.4% in the development study ) ( volberg et al . , 2011 ) . the rspg - i combines two crucial elements of addiction : tolerance and loss of control . for a long time , the definition of addiction emphasized tolerance and withdrawal as key components of drug dependence , which was only considered as a physical dependence ( american psychiatric association , 1980 ) . since version iv of the dsm ( american psychiatric association , 2000 ) , symptoms of tolerance and withdrawal are no longer mandatory for a diagnosis of addiction , and behavioral symptoms ( e.g. , repeated but unsuccessful attempts to cut down or control the drug consumption or gambling practice , consuming drug or gambling more than intended , etc . ) are now as important as the symptoms of physical dependence . the rspg - i has thus the advantage of combining symptoms of both physical ( tolerance ) and behavioral ( loss of control ) dependence . moreover , loss of control was one of the key elements of the definition of addictions proposed by aviel goodman ( 1990 ) . this definition was especially well suited for behavioral addiction , and pathological gambling was mentioned as one of the disorders that corresponded very well to addiction criteria . thus , the rspg - i is fairly consistent with the reconciliation of gambling disorder and substance use disorders made in the dsm-5 ( american psychiatric association , 2013 ) . another element of consistency with the dsm-5 is the absence in the rspg - i of the illegal acts criterion , which is no longer considered for the diagnosis . although this criterion was taken into account alongside other criteria to test all possible combinations , it has not been retained in the final version of the rapid screener . toce - gerstein and colleagues ( toce - gerstein , gerstein , & volberg , 2003 ) identified the items 2 and 3 of the dsm - iv as being more present in pathological gamblers ( with 57 positive criteria in dsm - iv ) . these items could thus indicate a certain level of severity of the gambling practice beyond the mere excessive use , which seems relevant with their use for a rapid screening of problem gambling . the rspg - sa is composed of three items from the sogs ( lesieur & blume , 1987 ) : the chasing item , the guiltiness item , and the perceived inability to stop item . despite of its self - report design , it displayed good screening properties . the rspg - sa provided relevant screening of gamblers with a diagnosis of gambling disorder ( sensitivity of 0.95 ) and showed correct diagnosis efficiency ( 72.9% ) . the chasing behavior had been demonstrated to be one of the dsm criteria , which discriminates best between community gamblers and gamblers in treatment ( stinchfield , govoni , & frisch , 2005 ) . moreover , the chasing item from the sogs was found to be present for almost only probable pathological gamblers ( sogs score 5 ) in a telephone - based community survey ( cox , kwong , michaud , & enns , 2000 ) . even if it was not the most frequently endorsed item , it seemed to be able to discriminate well between non - problem and problem gamblers , which seems relevant with its inclusion in the rspg - sa . in the same study , guiltiness and inability to stop belonged to the most endorsed items in probable pathological gamblers . compared to the chasing item ( which rather refers to an externalized component of addiction ) , guiltiness and perceived inability to stop gambling could refer to more internalized components of gambling addiction . the presence of the item guiltiness in the self - report rapid screener is especially very interesting , because this notion is often forgotten from other problem gambling scales , despite of its clinical relevance . as argued by flanagan ( 2013 ) , the life of the addict is a source of both guilt and shame . guiltiness does reflect the reactive attitude to failure to control gambling , as an intra - personal feeling of being unsuccessful both to control the behavior and to achieve the expected life made impossible because of the addiction . as this is not a necessary element to diagnose gambling disorder , but rather a psychological state of mind , it is rarely investigated in problem gambling screening scales . but the inclusion of this aspect of gambling addiction in the rspg is not surprising for the self - report version ( who can be better suited than the gambler himself to assess his own state of mind ? ) . it is also an indication of more severe problems , because guiltiness often appears when damages are already here and noticeable by others . finally , perceived inability to stop gambling is rarely explored in gambling - related scales . yet for example , in a study exploring gambling - related cognitions , the perceived inability to stop gambling accounted for the highest variance in sogs score and displayed a high discriminant function for identifying probable problem gamblers ( raylu & oei , 2004 ) . this dimension is indeed another indirect way to explore the loss of control over gambling , which could lead to low self - efficacy and the conviction that it is impossible to change the behavior . for a self - report measure , the recognition of a certain powerlessness to control the behavior may identify precociously problem gamblers long before important damage ( which are often a focus of gambling problems related scales ) settle down . the rspg - sa has thus the advantage of combining both externalized and internalized components of addiction , and behavioral ( chasing ) , emotional ( guiltiness ) , and cognitive ( perceived inability to stop ) aspects . a secondary objective of this study was to compare the rspg to equivalents of the four major brief screening scales previously validated and widely used ( one - item spg , lie / bet , bbgs , and nods - clip ) , especially in a sample with a good representation of both problem and non - problem gamblers . the equivalents were each better than the two versions of the rspg in at least one screening property , depending on the preliminary choice made by the authors at the time of development of these scales . however , our strategy to select the best combinations based on both sensitivity and yi had allowed us to obtain two measures that are good in almost all screening properties , with no deficient property . moreover , comparing to equivalents , the rspg - i does not include item 7 from the dsm ( lying ) , while this item is included in the three main equivalents ( nods - clip , bbgs , and lie / bet ) . this item is probably more prone to denial , which is a major bias problem in screening measures in addictology . moreover , when the gambler has no close relative to whom he can lie , what is the relevance of this item ? both the two versions of the rspg have the advantage of combining complementary aspects of addiction and thus of being relatively complete despite of their short duration . first , the final rspg questionnaires were not validated alone , in a representative sample of gamblers . second , the list of items tested was obviously not exhaustive , and cpgi ( ferris & wynne , 2001 ) items could especially not be included , whereas it is currently the mostly used questionnaire for screening gambling problems ( the sogs was most commonly used during startup of this study in 2009 ) . third , this work was done in french only , so that it could be useful to confirm the interest of the rspg in other languages ( the proposed english - version had not been tested itself ) . fourth , the diagnosis of a gambling problem was made based on the 10 criteria from the dsm - iv , because the dsm-5 was not published at the time of recruitment and baseline assessment ( 20092011 ) . dsm-5 changes include : reclassification , renaming , and changes in diagnostic criteria and lowering of threshold for a diagnosis ( reilly & smith , 2013 ) . all these changes could have led to underestimate the prevalence of addiction compared to the dsm - iv . however , a recent study of the impact of dsm-5-related changes on prevalence rates and classification accuracy concluded that the new criteria yielded equivalent or slightly better classification accuracy in all comparisons and across all samples ( petry , blanco , stinchfield , & volberg , 2013 ) . fifth , the comparison with existing tools is not completely reliable because equivalents are not formulated strictly in the same way as the original tools so gamblers could have responded differently . moreover , some items were passed in interview ( dsm ) , while these tools are all used in self - report ( nods - clip , bbgs , lie / bet , and one - item , spg ) . it is noteworthy that one of the strengths of our procedure was to differentiate the two modes of completion , while the existing screening tools are often used interchangeably in self - report ( pen - and - paper or internet - based surveys ) and interview ( mostly telephone - based surveys ) studies . another great strength of this work was that all combinations of items from available gambling scales were tested in a systematic manner , with no a priori . finally , to our knowledge , this is the first mini - screener for problem gambling based on dsm-5 categorization . finally , and as expected , ppv were very low when being adjusted to national prevalence . however , the adjusted vpn remains very good even with low national prevalence , as this is desired for a screening tool . to conclude , we recommend to use the rspg - sa / i for screening problem gambling in epidemiological surveys , with the version adapted for each purpose ( rspg - i for telephone - based or face - to - face survey , and rspg - sa for pen - and - paper or internet - based surveys ) . this first triage of potential problem gamblers using the rspg - sa / i must be supplemented by further assessment ( problem gambling research and treatment centre ( pgrtc ) , 2011 ; toce - gerstein et al . , 2009 ) , as it may overestimate the proportion of problem gamblers ( specificity = 0.78 or 0.64 ) . however , a first triage has the great advantage of saving time and energy in large - scale screening for problem gambling . mgb and gcb designed the study , conducted literature search , wrote the protocol , and are responsible for the project management . all other authors ( including those mentioned in the jeu group ) contributed to include the participants in the study , to the development of the protocol , and to obtain funding sources . gcb wrote the first draft of the manuscript , and all authors gave feedback and approved the final manuscript . mgb and gcb declare that the university hospital of nantes has received funding from the gambling industry ( fdj and pmu ) in the form of a sponsorship , which supports the gambling section of the balanced unit ( the reference centre for excessive gambling ) . lr declares that the university of paris ouest nanterre la dfense has received funding directly from gambling industry ( fdj and pmu ) as part of other research contracts this funding has never had any influence on this work . bp , jbh , mv , dm , mf , icb , and al declare that they have no conflicts of interest .	background and aimsthe aim of this study was to test the screening properties of several combinations of items from gambling scales , in order to harmonize screening of gambling problems in epidemiological surveys . the objective was to propose two brief screening tools ( three items or less ) for a use in interviews and self - administered questionnaires.methodswe tested the screening properties of combinations of items from several gambling scales , in a sample of 425 gamblers ( 301 non - problem gamblers and 124 disordered gamblers ) . items tested included interview - based items ( pathological gambling section of the dsm - iv , lifetime history of problem gambling , monthly expenses in gambling , and abstinence of 1 month or more ) and self - report items ( south oaks gambling screen , gambling attitudes , and beliefs survey ) . the gold standard used was the diagnosis of a gambling disorder according to the dsm-5.resultstwo versions of the rapid screener for problem gambling ( rspg ) were developed : the rspg - interview ( rspg - i ) , being composed of two interview items ( increasing bets and loss of control ) , and the rspg - self - assessment ( rspg - sa ) , being composed of three self - report items ( chasing , guiltiness , and perceived inability to stop).discussion and conclusionswe recommend using the rspg - sa / i for screening problem gambling in epidemiological surveys , with the version adapted for each purpose ( rspg - i for interview - based surveys and rspg - sa for self - administered surveys ) . this first triage of potential problem gamblers must be supplemented by further assessment , as it may overestimate the proportion of problem gamblers . however , a first triage has the great advantage of saving time and energy in large - scale screening for problem gambling .
You are an expert at summarizing long articles. Proceed to summarize the following text: in recent years , there has been a paradigm shift in the treatment of rheumatoid arthritis ( ra ) . biological agents have approved and marketed for the treatment of ra in europe and the united states include anti - tumor necrosis factor- ( tnf- ) antibodies such as infliximab ( remicade ) adalimumab ( humira ) , soluble tnf- receptor etanercept ( enbrel ) , and interleukin ( il)-1 receptor antagonist anakinra ( kineret ) . among these , etanercept has drawn particular attention as a highly effective and safe biological product in the treatment of ra ; it was approved in january 2005 in japan . etanercept is a recombinant chimeric protein consisting of two molecules of p75 and the fc portion of human igg1 and is produced by introducing the fusion gene into chinese hamster ovary cells ( molecular weight , approximately 150kda ; total amino acid residues , 934 ) . as compared with the natural - occurring soluble tnf- receptor , etanercept showed 50-fold greater binding to tnf- , 100- to 1000-fold greater biological activity , and 5- to 8-fold longer plasma half - life ; therefore , treatment of ra with etanercept has been conducted.1 in a phase iii study in the united states involving 234 patients with active ra who were resistant to disease - modifying antirheumatic drugs ( dmards ) including methotrexate ( mtx ) , treatment with etanercept 25 mg showed significantly greater efficacy than etanercept 10 mg or placebo.1 analysis of adverse events revealed that the incidence of injection - site reactions was significantly higher in the 25-mg dose group than other dose groups and that the active treatment groups had a higher incidence of infections , i.e. , upper respiratory tract infections , than the placebo group . in a double - blind study of concomitant mtx , 89 patients with active ra who had been treated with mtx for at least 6 months received either etanercept 25 mg or placebo twice a week subcutaneously in addition to mtx , resulting in improvement in a 20% american college of rheumatology ( acr 20 ) response in 71% of patients receiving etanercept and an acr 50 improvement in 39% of patients receiving etanercept . moreover , there were no significant differences in incidence of adverse events such as infections between the two groups.2 on the basis of these results , etanercept was approved as a treatment for ra by the federal drug administration ( fda ) in the united states in november 1998 . more than 6 years after its approval in the united states , the drug was approved in january 2005 and has been marketed since the end of march 2005 in japan . its efficacy has been demonstrated to be far superior to that of mtx , which is known to have the potent effect of slowing the progression of joint destruction.3 the remarkable effectiveness of etanercept has been shown particularly in the recently reported tempo ( trial of etanercept and methotrexate with radiographic patient outcomes).4 in this trial , 686 patients with ra who were resistant to one or more dmards other than mtx received one of the following three treatments for 2 years : mtx alone , etanercept alone , or etanercept plus mtx . the primary efficacy endpoint was the numeric index of the acr response ( acr - n ) area under the curve ( acr - auc ) over the first 24 weeks . the primary endpoint did not differ significantly between the mtx monotherapy group and etanercept monotherapy group ; however , the etanercept plus mtx group had significantly higher acr - auc values than the two monotherapy groups . the proportion of patients achieving acr 50 , a clinically meaningful efficacy , at 2 years was 71% in the etanercept plus mtx group as compared with 42% in the mtx monotherapy group and 54% in the etanercept group , indicating greater efficacy of the combination of etanercept and mtx . moreover , the change in total sharp score at 1 year of treatment was 0.54 in the etanercept plus mtx group as compared with + 2.8 in the mtx monotherapy group and + 0.52 in the etanercept group , suggesting the possibility that the combination may inhibit the progression of joint destruction and even heal the condition . frequently observed adverse events include injectionsite reactions , which are characterized by erythema with pruritus , swelling , or pain at the injection sites . the most careful attention should be given to monitoring for infections . among the more than 1100 patients receiving long - term treatment for at least 6 months , 50 experienced serious infections such as pyelonephritis , bronchitis , septic arthritis , and abscess formation , which were caused by various types of organisms including bacteria , fungi , and pneumocystis jiroveci . etanercept may mask clinical symptoms characteristic of infections , such as fever and chills , and inhibit the production of acute inflammatory proteins , thereby causing the problem of difficulty in detecting infections at an early stage . in addition , occurrence of tuberculosis has recently been of particular concern , although etanercept appears to be rarely associated with tuberculosis as compared with infliximab.5,6 however , caution should be exercised when etanercept is used in japan , where tuberculosis frequently occurs,7 because bcg vaccinations in japan preclude the use of the tuberculin skin test for screening at the start of drug treatment , and there are not a few patients with drugresistant mycobacterium tuberculosis.8,9 although the occurrence of malignancies was the most serious among possible complications , the incidence in the more than 1100 patients was not significantly different from the expected incidence in the general population . also , patients with active ra have been shown to have a slightly higher incidence of malignant lymphoma . in march 2003 , the fda reported that the standardized incidence ratio ( sir ) for malignant lymphoma ranged from 2.3 to 3.5 in patients receiving etanercept with no statistically significant difference.10 because etanercept is known to exacerbate congestive heart failure , caution should be made when etanercept is administered to patients with heart failure . initially , clinical trials were conducted with infliximab or etanercept as a therapeutic agent for congestive heart failure because tnf- was believed to be involved in the pathophysiology of congestive heart failure . however , individual clinical trials showed treatment failures and even worsening cases of congestive heart failure , leading to termination of these trials.11 in addition , rare cases of pancytopenia have been reported . although demyelinating diseases in the central nervous system have also been reported , a causal relationship to the treatment remains uncertain . in some patients with multiple sclerosis , an increase in disease activity has been found after the treatment.12 a recent report showed that etanercept treatment in early ra patients was well tolerated for up to 5 years.13 in japan , 147 patients who were refractory to conventional dmards were enrolled in phase ii clinical study . patients were randomly divided into three groups , i.e. , placebo group , 10 mg twice - weekly group , and 25 mg twice - weekly group , and treated for 12 weeks . consequently , both the 10 mg group and 25 mg group yielded an almost identical acr20 response , significantly better than the placebo group ( 64.0% , 65.3% vs. 6.3% , respectively ) . there was no significant difference observed in severe adverse effects between the etanercept and placebo groups . for the safe use of etanercept in japan , which produces such high efficacy and potential adverse events , the internal medicine rheumatology study group of the ministry of health , labor and welfare , japan ( led by n.m . , t.t . , and k.e . ) has developed the guidelines for treatment with etanercept , which provide indications , contraindications , and tuberculosis risk assessment , which was based on the guidelines for the use of infliximab for ra patients in japan9 ( fig . the guidelines were approved by the board of directors of japan college of rheumatology . tnf , tumor necrosis factor ; inh , isoniazid ; pms , postmarketing surverytable 1treatment guidelines for the use of etanercepta.inclusion criteriapatients with active rheumatoid arthritis still presenting the following despite the use of one or more mhlw recommendation - level - admards ( methotrexate , bucillamine , or sulfasalazine ) at a normal dose for more than 3 months:(1)tender joints 6(2)swollen joints 6(3)esr 28mm / h or crp 2.0 mg / dlalso , the patients must meet the following as having low risk for opportunistic infections:(1)wbc 4000/mm(2)peripheral blood lymphocytes 1000/mm(3)serum -d - glucan : negativeb.usagethe dose of etanercept is 1025 mg administered twice weekly as a subcutaneous injection . a patient can self - inject etanercept only after the ability to self - inject is carefully assessed and appropriate training is provided by a health professional.c.contraindication1.ongoing infection2.past history of serious infections in the last 6 months3.abnormal shadows on chest radiographs suggestive of old pulmonary tuberculosis ( tb ) or tuberculosis pleuritis4.history of extra pulmonary tb or pneumocystis carinii pneumonia5.congestive heart failure6.malignancy or demyelinating diseased.caution1.from the point of view of screening for infection ( especially tb and opportunistic infections ) as well as prevention of side effects , etanercept is recommended for clinical use at medical institutes where:(1)chest x - rays can be obtained on the same day , and the x - ray can be interpreted by a pulmonologist , tb specialist , or radiologist(2)opportunistic infections can be treated2.comprehensive tb screening should be conducted including an in - depth patient history , chest radiographs ( chest ct whenever possible ) and a ppd skin test . in patients with suspected tb , based on medical history , abnormal shadows on chest radiographs suggestive of old pulmonary tb , or with a ppd skin test positive ( as evidenced by redness of at least 20 mm in diameter or the presence of induration ) , the treatment with etanercept may be considered in addition to anti - tuberculosis drugs only if the potential benefits outweigh the potential risks.mhlw , ministry of health , labor and welfare ; dmard , disease - modifying antirheumatic drug ; esr , erythrocyte sedimentation rate ; crp , c - reactive protein ; wbc , white blood cells ; tb , tuberculosis ; ct , computed tomography ; ppd , purified protein derivative cited in the diagnostic manual and evidence - based treatment guidelines tuberculosis risk evaluation chart of the use of anti - tnf therapy . tnf , tumor necrosis factor ; inh , isoniazid ; pms , postmarketing survery treatment guidelines for the use of etanercept mhlw , ministry of health , labor and welfare ; dmard , disease - modifying antirheumatic drug ; esr , erythrocyte sedimentation rate ; crp , c - reactive protein ; wbc , white blood cells ; tb , tuberculosis ; ct , computed tomography ; ppd , purified protein derivative cited in the diagnostic manual and evidence - based treatment guidelines etanercept is indicated in patients with active ra at or above a certain level . specifically , etanercept may be used in patients who have inadequately been controlled despite treatment of at least 3 months with the usual doses of one of the dmards ( methotrexate , bucillamine , or sulfasalazine ) , which are rated as recommendation a level in the diagnostic manual and evidence - based treatment guidelines15 developed by the study group of the ministry of health , labor and welfare . leflunomide , another dmard rated as recommendation a , is not included in the present guidelines because of the adverse event of serious interstitial pneumonia observed in japan.16 inadequate response to previous treatment is defined by the presence of at least six tender joints and swollen joints and either c - reactive protein levels of at least 2.0 mg / dl or erythrocyte sedimentation rate ( esr ) of at least 28mm / h . to avoid potential opportunistic infections , patients should have a peripheral leukocyte count of 4000/mm or more , peripheral lymphocyte count of 1000/mm or more , and a negative test for blood -d - glucan . these criteria are based on the findings that cellular immunity plays an important role in opportunistic infections caused by mycobacterium tuberculosis or fungi such as pneumocystis jiroveci , and that these infections are likely to occur in patients with decreased peripheral lymphocyte counts.17 a test for blood -d - glucan has been included because -d - glucan , a component of fungi , may be diagnostic of fungal infections , especially infections with pneumocystis jiroveci . the recommended dosage and administration of etanercept in japan is 1025 mg given once daily and twice weekly as a subcutaneous injection . in this aspect , onceweekly administration of 50 mg etanercept in patients with active ra patients has been approved in the united states , and this dosing regimen was shown to be equivalent to 25 mg etanercept twice weekly in terms of safety , efficacy , and pharmacokinetics.18 patients will switch to self - injection after they are assessed as capable of conducting self - injections and receive adequate instructions . etanercept may be used as monotherapy as the drug was administered so in clinical trials in japan . in europe and the united states , however , etanercept in combination with mtx has been demonstrated to provide greater efficacy in tempo.4 thus , the combination of etanercept with mtx should be considered in patients with highly active disease in japan . etanercept is contraindicated in patients with active infections or a history of serious infections within the previous 6 months . in addition , careful assessment of the risk of tuberculosis should be made . specifically , the following three examinations should be performed before treatment initiation : interview with respect to family and past history of tuberculosis , chest radiography , and purified protein derivative ( ppd ) skin test ( fig . chest radiographs should preferably be interpreted by a specialist in pulmonology , tuberculosis , or radiology . when abnormalities are suspected on chest radiography , computed tomography of the chest should be performed . etanercept is contraindicated in patients with abnormalities in chest radiographs such as linear opacities , calcification 5 mm , and pleural thickening suggesting old pulmonary tuberculosis , and individuals infected with pulmonary or extrapulmonary tuberculosis . however , treatment with etanercept may be considered with antituberculous agents only if the potential benefits outweigh the potential risks . in patients with a positive ppd skin test ( as evidenced by erythema of at least 20 mm in diameter or the presence of induration ) or opacities suggesting old pulmonary tuberculosis on chest radiographs , treatment with isoniazid 0.3 g / day should be initiated at least 1 month prior to administration of etanercept and continued for the subsequent 9 months . however , no definite guidelines are available that address how to deal with isoniazid - induced hepatic impairment and isoniazid - resistant mycobacterium tuberculosis , as well as how long isoniazid treatment should be given . etanercept is also contraindicated in patients with previous pneumocystis jiroveci pneumonia , congestive heart failure , malignancies , or demyelinating disease . to sum up , in this article we focused on the guidelines for the use of etanercept that have been introduced in japan since spring 2005 . in japan , because only about 100 patients received etanercept in clinical trials , it remains uncertain whether etanercept yields clinical benefit and adverse events with a similar frequency as observed in europe and the united states . nonetheless , we will conduct an all - cases postmarketing surveillance using the above - mentioned treatment guidelines , review the results , and revise the guidelines as needed .	application of biological agents targeting inflammatory cytokines such as tumor necrosis factor- ( tnf- ) dramatically caused a paradigm shift in the treatment of rheumatoid arthritis ( ra ) . infliximab , a chimeric anti - tnf- monoclonal antibody , has initially been introduced to japan in 2003 and shown to be dramatically effective in alleviating arthritis refractory to conventional treatment . however , serious adverse events such as bacterial pneumonia , tuberculosis , and pneumocystis jiroveci pneumonia were reported to be in relatively high incidence ; i.e. , 2% , 0.3% , and 0.4% , respectively , in a strict postmarketing surveillance of an initial 4000 cases in japan . etancercept , a recombinant chimeric protein consisting of p75 tnf- receptor and human igg , was subsequently introduced to japan in march of 2005 . we therefore drew up treatment guidelines for the use of etanercept to avoid potential serous adverse events , since only approximately 150 cases have been included in the clinical study of etanercept in japan . the guidelines were initially designed by the principal investigators ( n.m , t.t . , k.e . ) of rheumatoid arthritis study groups of the ministry of health , labor and welfare ( mhlw ) , japan , and finally approved by the board of directors of the japan college of rheumatology . the mhlw assigned a duty to the pharmaceutical companies to perform a complete postmarketing surveillance of an initial 3000 cases to explore any adverse events , and this was performed according to the treatment guidelines shown in this article .
You are an expert at summarizing long articles. Proceed to summarize the following text: a lack of signs , symptoms , and radiographic findings specific to foraminal stenosis may lead to failed treatment 4 5 , and may be the cause of pain in up to 60% of patients who remain symptomatic postoperatively 4 . initial treatment for symptomatic foraminal stenosis is centered on aggressive conservative methods , including mobilization , activity modification , anti - inflammatory medications , steroid injections , and selective nerve root block . patients refractory to conservative management are candidates for surgical decompression . while anterior or posterior open surgical approaches are associated with good outcome , a significant number of patients have postsurgical symptoms , including pain , weakness , and changes in sensorium . an anterior surgical approach places the patient at risk of damage to important neurovascular structures , and both anterior and posterior approaches are associated with an increased risk of infection and neurological damage . these methods are associated with a lower risk of infection and major neurovascular or organ damage , increased rate of recovery , and shorter duration of hospital stay . in this paper we present the results of an open , nonrandomized trial of endoscopic laminoforaminoplasty for the treatment of foraminal spinal stenosis . this was a prospective study of 64 patients who underwent endoscopic laminoforaminoplasty for refractory foraminal stenosis . inclusion criteria were foraminal stenosis documented by magnetic resonance imaging ( mri ) or computerized tomography ( ct ) and symptoms noted on physical exam . patients with stenosis due to either intervertebral disc or boney compression were included , and were treated with an identical operative procedure to decompress the foraminal canal . prior to surgery , radicular pain was confirmed with either nerve conduction studies and/or nerve blocks . all surgeries were performed under intravenous ( iv ) sedation with the patient able to communicate in order to reduce neurological injury . all the surgeries were performed on an outpatient basis , and all patients signed informed consent documents prior to surgery . the surgery commenced as follows : intravenous ( iv ) antibiotics were administered perioperatively ; cefazolin was used unless there was an allergy , in which case ciprofloxacin was substituted . the procedure is performed under monitored anesthesia care sedation , in which the patient is sedated with benzodiazepines and opioids but is conscious to aid in the protection of the nerves during the procedure . a scalpel is used to make a stab wound through which a guide - wire is inserted down to the facet region of the vertebral body associated with stenosis . over this guide - wire , a commercially available dilating system is used to dilate the tissues to approximately 14 mm . first , a 14 mm tube is inserted and the inner pieces are removed ; this is considered the working tube . a 12 mm drill bit is used to create a window into the foraminal canal . this is done utilizing fluoroscopy to determine the depth of penetration of the drill unit . once the bone and newly drilled hole is visualized , a standard mechanical burr system is utilized to grind away the lamina of the vertebral body and to widen the opening that was created with the 12 mm bit . kerrisons and pituitaries are utilized during the entire process to smooth the edges of the bone that had been burred and for general debulking of soft issues and loose bone fragments . once the region of the lamina and foraminal canal is properly opened , the procedure is completed and the dilation tube is removed . outcome measures were percent change from baseline in oswestry disability index ( oswestry ) and visual analog scale ( vas ) scores . the age range was 32 to 90 years of age with the median age of 62 . total time for the surgery was between 30 minutes and 1.5 hours with the mean of 50 minutes actual surgical time . most patients were discharged within 1 hour of reaching the pacu ( range 42 to 121 minutes ) and all patients were discharged the same day . the only complication was dural leak , which occurred in two patients and was corrected intraoperatively with duragen . . over half ( 59% ) of patients showed 75 - 100% improvement in oswestry score , and 59% showed 75 to 100% improvement in vas score . foraminal stenosis is an important cause of spinal nerve root compression that is amenable to both conservative and surgical treatments . open surgical decompression may be carried out via a midline approach , which may be performed as interlaminar exposure , laminotomy , laminectomy , medial facetectomy , medial foraminotomy , or muscle - splitting wiltse or lateral approach with foraminotomy 6 7 8 9 . cases requiring complete foraminal decompression may be treated with a combined interlaminar and lateral approach 6 . in a report of 65 surgical cases of lumbar foraminal stenosis , laminectomy and foraminotomy was the most common treatment ( 52 patients ) , followed by laminotomy and foraminotomy ( 23 patients ) 10 . results were excellent or good in 29 ( 45% ) and 25 ( 39% ) patients , respectively , at 32.5-month follow - up . these results are consistent with other small studies , with good results reported in the majority of cases 11 12 13 14 . open surgical correction is the current standard of care , but is not without risks . blood loss , infection , prolonged hospital stay , and postoperative pain may occur regardless of surgical approach . posterior cervical decompression requires subperiosteal stripping of the paraspinal muscles , which can result in postoperative pain , muscular spasms , and loss of function 15 . anterior approaches are also frequently used , but carry significant risk of esophageal or neurovascular injury and damage to tissues along the plane of section , including major organs 16 . alternative surgical techniques , such as endoscopic approaches , allow for shorter operating time , reduction in tissue exposure and manipulation , and decreased risk of damage to surrounding structures . 15 reported decreases in fluid loss , length of hospital stay , and postoperative pain medication with minimally invasive techniques compared to open surgery . cervical microendoscopic foraminotomy / discectomy ( cmef / d ) provides clinical results equivalent to those seen with traditional surgical approaches while reducing blood loss , hospital stay , and postoperative pain 15 17 . similar techniques for posterior decompression are reported to have similar outcomes 18 16 19 20 , with symptomatic improvements equal to those found with traditional surgical techniques . our findings of improved pain and disability scores in the majority of patients agree with other published trials evaluating endoscopic approaches for foraminal stenosis , which report positive results in 44 - 97% 21 15 17 . all patients in our study were discharged the same day and there were no major complications . our findings are limited by the lack of a control group , preventing an adequate comparison of endoscopic laminoforaminoplasty to conventional open decompression . however , our results support the safety of endoscopic interventions and highlight the need for large scale comparative trials to further determine the relative efficacy of open versus endoscopic interventions . based on data from the current study and previously published reports , the novel technique of endoscopic surgical treatment for foraminal stenosis is validated as a potentially effective alternative to open decompression . no adverse events occurred in our patient population , and pain and disability were improved to the same degree reported in the literature for open surgical approaches . additional controlled trials are warranted to quantify the efficacy and safety of endoscopic laminoforaminoplasty relative to conventional techniques .	background : foraminal stenosis is an important cause of radicular and generalized back pain . in patients who do not respond to conservative interventions , endoscopic spinal surgery provides similar results to open surgical approaches with lower rates of complication , postoperative pain , and shorter duration of hospital stay.methods : we performed a prospective , open , uncontrolled trial of 64 patients to evaluate endoscopic laminoforaminoplasty for the treatment of refractory foraminal stenosis.results : fifty - nine percent of patients had at least 75% improvement in oswestry disability index ( oswestry ) and visual analog scale ( vas ) scores . all patients were discharged the day of surgery . dural leaks occurred in two patients , which were repaired intraoperatively . no other adverse events occurred.conclusions : endoscopic laminoforaminoplasty appears to be a safe alternative to open decompression in patients with spinal foraminal stenosis ; additional controlled trials are warranted .
You are an expert at summarizing long articles. Proceed to summarize the following text: an ostomy barrier attaches to the skin around the mucocutaneous junction , where the skin meets the stoma . a barrier that is not secure against the peristomal skin will leak effluent , which can cause skin damage ; thus , a secure seal is crucial.3 a secure seal of the ostomy barrier against the skin can be difficult to obtain , especially as the stoma and surrounding skin evolve as edema resolves during the immediate postoperative period ; when the stoma is located in a challenging anatomical position ; when the peristomal skin is uneven because of scars or skin folds ; or when the peristomal skin is fragile owing to age or cutaneous conditions . in these cases , component products ( currently classified as ostomy accessories ) such as skin barrier rings or seals , stoma paste , or barrier strips can be used to fill in and eliminate gaps , thereby creating a secure seal between the ostomy barrier and the peristomal skin.4 other components , such as adhesive removers / releasers , also may be used to support integrity of the barrier seal . appropriate use of these components allows conventional ostomy barriers to better conform to challenging abdominal planes , thereby preventing leakage , protecting peristomal skin , and preventing the occurrence / recurrence of peristomal skin complications ( pscs ) . reports of the incidence and prevalence of pscs vary greatly.3,5 study findings are difficult to compare due to differences in study population , study design , ostomy site , ostomy type , time since surgery , operational definitions of psc , psc assessment , and response rate.5 nevertheless , there is widespread agreement that ( 1 ) pscs are common and have a significant detrimental impact on health - related quality of life6,7 ; ( 2 ) unattended , a mild psc can progress into a more severe condition3 ; ( 3 ) peristomal leakage ( effluent on the skin ) is a key causative factor for pscs8,9 ; ( 4 ) besides discomfort and pain , damaged peristomal skin can reduce adhesion of the ostomy barrier , which , in turn , increases the risk of leakage and the necessity for frequent pouching system changes10,11 ; ( 5 ) the development of a psc often necessitates greater than usual use of ostomy supplies9 ; and ( 6 ) addressing pscs at an early stage is essential in order to avoid long - term , debilitating , and expensive complications.12 the results of a recent investigation estimating the costs associated with different forms of psc suggest that prompt management of leakage is cost - effective and exerts a positive impact on daily health - related quality of life for individuals living with an ostomy.12 in addition , clinical experience emphasizes the role of ostomy components in preventing the occurrence of common stoma - related problems.6,13 the aim of this study was to evaluate the economic and humanistic implications of using ostomy components to prevent subsequent pscs in individuals who experience an initial , leakage - related psc event . we developed a 1 year cost - utility model to simulate a cohort of 1000 individuals living with an ostomy . the model compares the 1-year outcomes ( psc events avoided ; quality - adjusted life days gained ) and costs ( barriers / pouches ; ostomy components ; clinical utilization ) associated with 2 scenarios : ( 1 ) a skin barrier alone scenario assumes that ostomy components are not available to manage pscs , and ( 2 ) a skin barrier and components scenario assumes that ostomy components are used selectively , with clinical oversight , to individualize barrier fit / adhesion . proper barrier fit and adhesion are hypothesized to prevent pscs among individuals who have a first psc event . baseline inputs for the model are drawn from published sources where available ( eg , articles identified in a medline search using key words such as ostomy / economics and surgical stomas / adverse effects ; manufacturer - suggested retail price lists ) , as indicated . where published estimates were nonspecific or unavailable , we asked a panel of 26 enterostomal therapy ( et)/woc nurses in 2 north american advisory board meetings to offer clinically reasonable values based on informal ( nonrandomized ) chart review and/or their clinical experience . the nurses in our panel had an average of 11 years of clinical ostomy experience ; 2 ( a.m. , a.t . ) are authors . all inputs were subsequently varied over a range of values to assess the robustness of modeled results . , the model assumes hypothetically that all individuals have established a stable pattern for use of either a 1-piece or a 2-piece barrier / pouch system ( table 1 ) and have not experienced leakage - related pscs . manufacturer 's suggested retail price , british columbia , 2014 canadian dollars . this stable pattern of ostomy supply use may be interrupted in any cycle by pscs , which are assumed to occur at an annual rate of 65% ( 5.4% per month ) . in the model , a psc may be mild ( 25% ) , moderate ( 55% ) , or severe ( 20% ) ( table 2 ) . these incidence and severity estimates are congruent with published literature5 and affirmed by our panel of practicing et / woc nurses . to simplify the analysis , we assume conservatively that psc events occur at the start of a 30-day cycle and are resolved within the same cycle . manufacturer 's suggested retail price , british columbia ; 2014 canadian dollars . versus an uncomplicated ostomy average of twice - weekly barrier changes . barrier alone ; barrier & components ) , our baseline analysis assumes that individuals experiencing pscs will attempt to self - manage these events by increasing their usual frequency of barrier changes in an effort to minimize exposure to the irritating effluent . in some cases , more frequent pouching system changes are successful and , individuals will seek the advice of an et / woc nurse ( table 2 ) . for example , in the absence of ostomy components ( barrier alone scenario ) , we assume that individuals experiencing a mild psc will , in an effort to get leaking under control , increase their barrier change frequency from twice - weekly to every - other - day ( 3.5 barrier changes per week ) , which represents 175% of ( 75% increase over ) their usual use . we further assume that this self - directed intervention is enough to enable skin healing for most ( 75% ) individuals with mild pscs . these individuals will then return to their baseline ( twice - weekly ) frequency of barrier changes after 14 days . the remaining individuals ( 25% ) with mild pscs are assumed to consult an et / woc nurse at the end of the first 14 days . in the barrier alone scenario , adding an ostomy component ( eg , skin barrier ring or seal , stoma paste ) to individualize the fit of an ostomy barrier is not an option . instead , our model assumes that the et / woc nurse will suggest continuing to change the ostomy barrier every - other - day for 1 more week ( total of 21 days to healing ) and will recommend that all individuals use a stoma powder and skin protectant film with each barrier change to treat the irritated peristomal skin . individuals with a moderate psc in the barrier alone scenario are assumed to respond initially by changing their barriers daily ( 350% of their usual use ) for an average of 7 days ( table 2 ) . self - directed care notwithstanding , we assume that all individuals with a moderate psc will eventually consult an et / woc nurse , who will suggest moving to an every - other - day barrier change schedule for 23 days ; recommend use of a stoma powder and skin protectant film with each barrier change to treat irritated skin ; and direct use of a hydrocolloid sheet , topical corticosteroid , and/or topical antifungal to help skin healing . most individuals ( 70% ) with a moderate psc will have a second visit with an et / woc nurse . the model assumes conservatively that a moderate psc will heal within a 30-day window ( 7 days of self - care + 23 days of et / woc nurse - directed care ) , after which the individual will return to a baseline schedule of barrier changes . similarly , individuals with severe psc are assumed to attempt self - management of leakage and skin irritation by increasing the frequency of barrier changes to once daily , although we envision that the severity of their wounds will motivate them to seek clinical attention sooner ( after 3 days ) than individuals with less severe pscs ( table 2 ) . for these individuals , we assume that the et / woc nurse will suggest a schedule of once - daily barrier changes for 27 days ; recommend use of a stoma powder and skin protectant film with each barrier change to treat irritated skin ; and direct use of a hydrocolloid sheet , topical corticosteroid , and/or topical antifungal to aid skin healing . most individuals ( 80% ) with a severe psc will have a second visit with an et / woc nurse ; some ( 50% ) will require a third visit . as before , the model assumes conservatively that severe pscs will heal within a 30-day window ( 3 days of self - care + 27 days of et / woc nurse - directed care ) , after which the affected individual will return to a baseline schedule of barrier changes . in the barrier and components scenario , we assume that individuals experiencing pscs will , as before , respond by changing their ostomy barriers more frequently than usual ( table 2 ) . however , in contrast to the barrier alone scenario and in keeping with our premise that ostomy components are used with clinical oversight , our analysis assumes that all individuals who experience psc will consult an et / woc nurse . the nurse will recommend a clinically appropriate component to stop leakage by improving the individual fit / adhesion of the ostomy barrier ( table 3 ) . we assume that the et / woc nurse will still direct individuals to increase their barrier change frequency to allow the pscs to heal but , because the component improves barrier fit / adhesion , individuals will be able to resume their baseline barrier change schedule after an average of 7 ( mild / moderate pscs ) or 14 ( severe pscs ) days of specialist nurse - directed care . furthermore , the analysis assumes that individuals in the barrier and components scenario make short - term use of a skin barrier powder and skin barrier protectant film with each barrier change to treat broken peristomal skin . however , because of the ostomy component in this scenario , we assume the et / woc nurse will work with the patient to break the leakage cycle , resulting in relatively less use of hydrocolloid sheets , topical corticosteroids , topical antifungals , and follow - up visits compared to their counterparts in the barrier alone scenario . in addition , we assume that individuals within the barrier and component scenario will use components for the duration of the model and change the component each time they change their ostomy barriers . manufacturer 's suggested retail price , british columbia ; 2014 canadian dollars . our et / woc nurse panel estimated that the use of an ostomy component following a first psc reduces an individual 's risk of having a subsequent psc by 80% . individuals who experience a second ( or third ) psc event are assumed to generate all psc - related costs , including the use of a second ( or third ) ostomy component for the duration of the model but receive no additional preventive benefit from the use of the second ( or third ) component . those experiencing a fourth psc event are assigned a 1-time , macro - cost of $ 1200 , which is intended simply to acknowledge that individuals with chronically occurring pscs will likely require referral for more complex management . this fixed cost does not vary by modeled scenario ( barrier alone ; barrier & components ) or by the elapsed time between the start of therapy and the occurrence of the fourth psc event . an important outcome of any clinical intervention is the change it makes for better or worse in a person 's perceived state of well - being . traditionally , preferences for certain health states are measured using an interval scale , where a score of 1.0 indicates an optimal level of health and well - being ( perfect health ) and 0.0 indicates the worst health status possible . each health state in between if someone experiences an improvement in his or her well - being , we say that his or her utility has increased . if well - being declines , we say that his or her utility has decreased . quality adjustments allow for differences in morbidity effects between alternate interventions being assessed . in the present context , the baseline ( reference ) utility is 1 day with uncomplicated ostomy ( 1 quality - adjusted life day , or qald ) . disutilities , that are associated with a first , second , or third psc.14 these disutilities are subtracted from the baseline because they decrease the individuals ' health - related quality of life by a small amount ; this effect persists daily until the psc heals . for example , individuals with healthy peristomal skin ( no psc ) are assumed to have a qald of 0.754 ( ie , about 75% of the quality of life they would have in 1 day of perfect health ) . having a mild psc reduces that quality of life by 0.0057 units , every day , for the duration of the psc . thus , the daily quality of life for an individual with a mild psc is ( 0.754 0.0057 =) 0.647 ( table 4 ) . the exception is that individuals experiencing a fourth psc , the maximum number allowed in the model , are assumed to accrue 0.647 qald ( 0.754 0.165 ) , every day , not just for the duration of the psc , but for the duration of the modeled year . abbreviations : psc , peristomal skin complication ; qald , quality - adjusted life day . reprinted with permission from nichols.14 running the model considers all of the baseline assumptions together to simulate the 1-year experience of individuals in each scenario . during this period , the model keeps track of individuals ' use of ostomy supplies , psc events , and direct clinical care costs , as well as the number of qald generated . at the end , the model compares the total number of psc events in each clinical management scenario ( barrier alone ; barrier & components ) , relative utilization of ostomy supplies and direct clinical care costs , and the number of qald arising as a result of the different strategies . technical validity was assessed by a thorough quality check of programming and by setting inputs to extreme values . for example , if the annual rate of pscs is set to 0% , then the model should report 0 psc events ; if 100% of psc events are assumed to be severe , then the model should calculate no utilization for mild and moderate pscs ; and so on . in addition , 1-way sensitivity analyses were conducted on user - modifiable inputs to test the robustness of modeled observations . baseline inputs for the model are drawn from published sources where available ( eg , articles identified in a medline search using key words such as ostomy / economics and surgical stomas / adverse effects ; manufacturer - suggested retail price lists ) , as indicated . where published estimates were nonspecific or unavailable , we asked a panel of 26 enterostomal therapy ( et)/woc nurses in 2 north american advisory board meetings to offer clinically reasonable values based on informal ( nonrandomized ) chart review and/or their clinical experience . the nurses in our panel had an average of 11 years of clinical ostomy experience ; 2 ( a.m. , a.t . ) are authors . all inputs were subsequently varied over a range of values to assess the robustness of modeled results . , the model assumes hypothetically that all individuals have established a stable pattern for use of either a 1-piece or a 2-piece barrier / pouch system ( table 1 ) and have not experienced leakage - related pscs . manufacturer 's suggested retail price , british columbia , 2014 canadian dollars . this stable pattern of ostomy supply use may be interrupted in any cycle by pscs , which are assumed to occur at an annual rate of 65% ( 5.4% per month ) . in the model , a psc may be mild ( 25% ) , moderate ( 55% ) , or severe ( 20% ) ( table 2 ) . these incidence and severity estimates are congruent with published literature5 and affirmed by our panel of practicing et / woc nurses . to simplify the analysis , we assume conservatively that psc events occur at the start of a 30-day cycle and are resolved within the same cycle . abbreviation : psc , peristomal skin complication . manufacturer 's suggested retail price , british columbia ; 2014 canadian dollars . versus an uncomplicated ostomy average of twice - weekly barrier changes . ( barrier alone ; barrier & components ) , our baseline analysis assumes that individuals experiencing pscs will attempt to self - manage these events by increasing their usual frequency of barrier changes in an effort to minimize exposure to the irritating effluent . in some cases , more frequent pouching system changes are successful and in other cases , individuals will seek the advice of an et / woc nurse ( table 2 ) . for example , in the absence of ostomy components ( barrier alone scenario ) , we assume that individuals experiencing a mild psc will , in an effort to get leaking under control , increase their barrier change frequency from twice - weekly to every - other - day ( 3.5 barrier changes per week ) , which represents 175% of ( 75% increase over ) their usual use . we further assume that this self - directed intervention is enough to enable skin healing for most ( 75% ) individuals with mild pscs . these individuals will then return to their baseline ( twice - weekly ) frequency of barrier changes after 14 days . the remaining individuals ( 25% ) with mild pscs are assumed to consult an et / woc nurse at the end of the first 14 days . in the barrier alone scenario , adding an ostomy component ( eg , skin barrier ring or seal , stoma paste ) to individualize the fit of an ostomy barrier is not an option . instead , our model assumes that the et / woc nurse will suggest continuing to change the ostomy barrier every - other - day for 1 more week ( total of 21 days to healing ) and will recommend that all individuals use a stoma powder and skin protectant film with each barrier change to treat the irritated peristomal skin . individuals with a moderate psc in the barrier alone scenario are assumed to respond initially by changing their barriers daily ( 350% of their usual use ) for an average of 7 days ( table 2 ) . self - directed care notwithstanding , we assume that all individuals with a moderate psc will eventually consult an et / woc nurse , who will suggest moving to an every - other - day barrier change schedule for 23 days ; recommend use of a stoma powder and skin protectant film with each barrier change to treat irritated skin ; and direct use of a hydrocolloid sheet , topical corticosteroid , and/or topical antifungal to help skin healing . most individuals ( 70% ) with a moderate psc will have a second visit with an et / woc nurse . the model assumes conservatively that a moderate psc will heal within a 30-day window ( 7 days of self - care + 23 days of et / woc nurse - directed care ) , after which the individual will return to a baseline schedule of barrier changes . similarly , individuals with severe psc are assumed to attempt self - management of leakage and skin irritation by increasing the frequency of barrier changes to once daily , although we envision that the severity of their wounds will motivate them to seek clinical attention sooner ( after 3 days ) than individuals with less severe pscs ( table 2 ) . for these individuals , we assume that the et / woc nurse will suggest a schedule of once - daily barrier changes for 27 days ; recommend use of a stoma powder and skin protectant film with each barrier change to treat irritated skin ; and direct use of a hydrocolloid sheet , topical corticosteroid , and/or topical antifungal to aid skin healing . most individuals ( 80% ) with a severe psc will have a second visit with an et / woc nurse ; some ( 50% ) will require a third visit . as before , the model assumes conservatively that severe pscs will heal within a 30-day window ( 3 days of self - care + 27 days of et / woc nurse - directed care ) , after which the affected individual will return to a baseline schedule of barrier changes . in the barrier and components scenario , we assume that individuals experiencing pscs will , as before , respond by changing their ostomy barriers more frequently than usual ( table 2 ) . however , in contrast to the barrier alone scenario and in keeping with our premise that ostomy components are used with clinical oversight , our analysis assumes that all individuals who experience psc will consult an et / woc nurse . the nurse will recommend a clinically appropriate component to stop leakage by improving the individual fit / adhesion of the ostomy barrier ( table 3 ) . we assume that the et / woc nurse will still direct individuals to increase their barrier change frequency to allow the pscs to heal but , because the component improves barrier fit / adhesion , individuals will be able to resume their baseline barrier change schedule after an average of 7 ( mild / moderate pscs ) or 14 ( severe pscs ) days of specialist nurse - directed care . furthermore , the analysis assumes that individuals in the barrier and components scenario make short - term use of a skin barrier powder and skin barrier protectant film with each barrier change to treat broken peristomal skin . however , because of the ostomy component in this scenario , we assume the et / woc nurse will work with the patient to break the leakage cycle , resulting in relatively less use of hydrocolloid sheets , topical corticosteroids , topical antifungals , and follow - up visits compared to their counterparts in the barrier alone scenario . in addition , we assume that individuals within the barrier and component scenario will use components for the duration of the model and change the component each time they change their ostomy barriers . manufacturer 's suggested retail price , british columbia ; 2014 canadian dollars . our et / woc nurse panel estimated that the use of an ostomy component following a first psc reduces an individual 's risk of having a subsequent psc by 80% . individuals who experience a second ( or third ) psc event are assumed to generate all psc - related costs , including the use of a second ( or third ) ostomy component for the duration of the model but receive no additional preventive benefit from the use of the second ( or third ) component . those experiencing a fourth psc event are assigned a 1-time , macro - cost of $ 1200 , which is intended simply to acknowledge that individuals with chronically occurring pscs will likely require referral for more complex management . this fixed cost does not vary by modeled scenario ( barrier alone ; barrier & components ) or by the elapsed time between the start of therapy and the occurrence of the fourth psc event . an important outcome of any clinical intervention is the change it makes for better or worse in a person 's perceived state of well - being . traditionally , preferences for certain health states are measured using an interval scale , where a score of 1.0 indicates an optimal level of health and well - being ( perfect health ) and 0.0 indicates the worst health status possible . each health state in between is assigned a preference weight , or utility , ranging from 0.0 to 1.0 . if someone experiences an improvement in his or her well - being , we say that his or her utility has increased . if well - being declines , we say that his or her utility has decreased . quality adjustments allow for differences in morbidity effects between alternate interventions being assessed . in the present context , the baseline ( reference ) utility is 1 day with uncomplicated ostomy ( 1 quality - adjusted life day , or qald ) . disutilities , that are associated with a first , second , or third psc.14 these disutilities are subtracted from the baseline because they decrease the individuals ' health - related quality of life by a small amount ; this effect persists daily until the psc heals . for example , individuals with healthy peristomal skin ( no psc ) are assumed to have a qald of 0.754 ( ie , about 75% of the quality of life they would have in 1 day of perfect health ) . having a mild psc reduces that quality of life by 0.0057 units , every day , for the duration of the psc . thus , the daily quality of life for an individual with a mild psc is ( 0.754 0.0057 =) 0.647 ( table 4 ) . the exception is that individuals experiencing a fourth psc , the maximum number allowed in the model , are assumed to accrue 0.647 qald ( 0.754 0.165 ) , every day , not just for the duration of the psc , but for the duration of the modeled year . abbreviations : psc , peristomal skin complication ; qald , quality - adjusted life day . reprinted with permission from nichols.14 running the model considers all of the baseline assumptions together to simulate the 1-year experience of individuals in each scenario . during this period , the model keeps track of individuals ' use of ostomy supplies , psc events , and direct clinical care costs , as well as the number of qald generated . at the end , the model compares the total number of psc events in each clinical management scenario ( barrier alone ; barrier & components ) , relative utilization of ostomy supplies and direct clinical care costs , and the number of qald arising as a result of the different strategies . technical validity was assessed by a thorough quality check of programming and by setting inputs to extreme values . for example , if the annual rate of pscs is set to 0% , then the model should report 0 psc events ; if 100% of psc events are assumed to be severe , then the model should calculate no utilization for mild and moderate pscs ; and so on . in addition , 1-way sensitivity analyses were conducted on user - modifiable inputs to test the robustness of modeled observations . when compared to the barrier alone scenario , the barrier and components scenario resulted in 130 fewer psc events ( 520 vs 650 ) over the course of 12 months ( table 5 ) . specifically , fewer individuals had repeat pscs in the barrier and components scenario compared to those in the barrier alone arm ( 3% vs 14% ) . individuals in the barrier and components scenario accrued 1043 more qald over the course of the modeled year compared with their counterparts in the barrier alone scenario ( 270,538 vs 269,495 ) . thus , each psc event avoided via the use of ostomy components yielded , on average , 8 additional qald during the modeled year ( 1043 qald gained 130 psc events avoided ) . the incremental resource use for ostomy components in the barrier and components scenario ( $ 224 ) was offset by lower average resource use for supplies ( barriers ; pouches ) ( $ 2061 vs $ 2109 ) and lower clinical utilization ( $ 54 vs $ 91 ) than the barrier alone scenario . overall , we found that per capita annual resource use was about 6.3% ( $ 139 ) higher in the barrier and components scenario ( table 5 ) . one - way sensitivity analyses on user - modifiable input variables support the robustness of model findings . our analysis is most sensitive to assumptions about ( 1 ) the increased use of ostomy supplies among individuals who experience pscs ( ie , the additional frequency with which barriers are changed coupled with time to healing ) and ( 2 ) the cost of ostomy components . all other things being equal , individuals with pscs for whom ostomy components are unavailable will consume relatively more ostomy supplies ( barriers ; pouches ) and have worse outcomes ( more repeat psc events ; fewer qald ) over the course of a year . individuals with psc for whom ostomy components are used to resolve issues of barrier fit and adhesion will have component acquisition costs ( offset in whole or in part by the use of relatively fewer barriers / pouches ) as well as better outcomes ( fewer repeat psc events ; more qald ) over the course of a year . one - way sensitivity analyses on user - modifiable input variables support the robustness of model findings . our analysis is most sensitive to assumptions about ( 1 ) the increased use of ostomy supplies among individuals who experience pscs ( ie , the additional frequency with which barriers are changed coupled with time to healing ) and ( 2 ) the cost of ostomy components . all other things being equal , individuals with pscs for whom ostomy components are unavailable will consume relatively more ostomy supplies ( barriers ; pouches ) and have worse outcomes ( more repeat psc events ; fewer qald ) over the course of a year . individuals with psc for whom ostomy components are used to resolve issues of barrier fit and adhesion will have component acquisition costs ( offset in whole or in part by the use of relatively fewer barriers / pouches ) as well as better outcomes ( fewer repeat psc events ; more qald ) over the course of a year . our analysis of 1000 hypothetical individuals with an ostomy estimated that the use of components following a first psc would result in 130 fewer psc events over the course of 1 year versus psc management without components . in this analysis , the costs of ostomy components were offset by lower resource use for other ostomy supplies ( barriers ; pouches ) and lower clinical utilization to manage pscs . overall , annual average resource use was about 6.3% ( $ 139 per individual ) higher when ostomy components were used with clinical oversight , compared to a strategy of managing pscs without ostomy components . each psc event avoided via the use of ostomy components yielded , on average , 8 additional qald over the modeled year . our analysis was most sensitive to assumptions about the increased use of ostomy supplies ( barriers ; pouches ) among individuals who experience pscs ( ie , the additional frequency with which barriers are changed coupled with the time to healing ) and the cost of ostomy components . in general , our model demonstrates that when ostomy components are used successfully to address issues of barrier fit / adhesion , individuals will ( 1 ) generate component acquisition costs that are offset in whole or in part by the consumption of relatively fewer ostomy supplies and ( 2 ) have better outcomes ( fewer repeat psc events ; more qald ) over the course of a year compared to a strategy of psc management without components . first , there is little published evidence from which to draw baseline model inputs . in its absence , we relied heavily on the experience of a panel of et / woc nurses in active practice . related to this is the observation that ostomy practice patterns ( eg , usual barrier change schedules ; standards of care for psc ) vary nationally , regionally , and even locally , making it impossible to create a single , broadly applicable set of baseline assumptions . nevertheless , the decision model we constructed applies a consistent theoretical framework to clarify immediate and downstream cost and outcome tradeoffs between alternative therapeutic approaches . by design , the baseline assumptions of a model are easily changed in light of new information and/or to meet the needs and local clinical practices of decision makers . second , our model takes a conservative position regarding the severity mix of pscs ; specifically , that psc severity will remain the same whether or not ostomy components are used . however , to the extent that ostomy components prevent leakage , as they are designed to do , it is conceivable that any subsequent pscs may be milder than would be anticipated if pscs were managed without components . third , depending on the circumstances , an et / woc nurse evaluating a leakage - related psc might not suggest adding an ostomy component but , instead , might appropriately recommend use of a differently sized barrier , or a switch from a flat - barrier to a convex - barrier in order to improve the barrier 's seal with the abdominal skin . our analysis does not consider these therapeutic options , which also have the potential to reduce the recurrence of pscs for some individuals , albeit with a higher unit cost per barrier . finally , the model assumes conservatively that all pscs are resolved within a 30-day window . however , at least one cross - sectional study found that , in 76% of patients with pscs , the issues took more than 3 months to resolve.3 indeed , without components to prevent recurring leakage , stepping up the frequency of barrier changes is one of the few ways individuals have to manage and prevent pscs . for some , the increased use of ostomy supplies ( barriers ; pouches ) triggered by a first psc may become their new normal rather than an acute intervention . when this is the case , the additional use of ostomy supplies will quickly exceed the cost of using an ostomy component to improve barrier fit / adhesion from the outset , again adding strength to our conclusions . ostomy components used with clinical oversight may prevent psc by improving barrier fit / adhesion . in our analysis , ( 1 ) acquisition costs for ostomy components were offset in whole or in part the use of fewer ostomy supplies to manage pscs and ( 2 ) use of ostomy components to prevent pscs produced better outcomes ( fewer repeat psc events ; more qald ) over 1 year compared to not using components .	purpose : the aim of this study was to evaluate the economic and humanistic implications of using ostomy components to prevent subsequent peristomal skin complications ( pscs ) in individuals who experience an initial , leakage - related psc event.design:cost-utility analysis.methods:we developed a simple decision model to consider , from a payer 's perspective , pscs managed with and without the use of ostomy components over 1 year . the model evaluated the extent to which outcomes associated with the use of ostomy components ( psc events avoided ; quality - adjusted life days gained ) offset the costs associated with their use.results:our base case analysis of 1000 hypothetical individuals over 1 year assumes that using ostomy components following a first psc reduces recurrent events versus psc management without components . in this analysis , component acquisition costs were largely offset by lower resource use for ostomy supplies ( barriers ; pouches ) and lower clinical utilization to manage pscs . the overall annual average resource use for individuals using components was about 6.3% ( $ 139 ) higher versus individuals not using components . each psc event avoided yielded , on average , 8 additional quality - adjusted life days over 1 year.conclusions:in our analysis , ( 1 ) acquisition costs for ostomy components were offset in whole or in part by the use of fewer ostomy supplies to manage pscs and ( 2 ) use of ostomy components to prevent pscs produced better outcomes ( fewer repeat psc events ; more health - related quality - adjusted life days ) over 1 year compared to not using components .
You are an expert at summarizing long articles. Proceed to summarize the following text: guz ten lokalizuje si gwnie w jelitach ( z predyspozycj do okolicy krtniczo - ktniczej ) , w wzach chonnych krezki i przestrzeni pozaotrzewnowej . objawy kliniczne choroby s niespecyficzne : ble brzucha , wymioty , krwawienie z przewodu pokarmowego , objawy ostrego brzucha sugerujce zapalenie wyrostka robaczkowego lub wgobienie jelitowe . w badaniu ultrasonograficznym jamy brzusznej choniak burkitta moe mie rn manifestacj , co wie si z punktem wyjcia zmiany . badania ultrasonograficzne jamy brzusznej oraz przewodu pokarmowego wykonano aparatem siemens , stosujc gowic convex 3,55 mhz w badaniu ultrasonograficznym w analizowanej grupie 15 pacjentw u 3 ( 20% ) patologiczna masa zlokalizowana bya w cianie odka , u 10 ( 67% ) w okolicy krtniczo - ktniczej , u 2 ( 13% ) proces by rozsiany w jamie brzusznej . u 12 pacjentw z rozpoznanym nieziarniczym choniakiem burkitta w lokalizacji pozaodkowej stwierdzono rn morfologi zmian w obrazie ultrasonograficznym . dokadna ocena w badaniu ultrasonograficznym wszystkich narzdw jamy brzusznej gowicami convex i liniow zwiksza szanse prawidowego rozpoznania . burkitt 's lymphoma accounts for 2550% of non - hodgkin lymphomas that occur in childhood . it occurs endemically in african children in whom it is localized mainly in the mandibular and maxillary bones . the abdominal form of burkitt 's lymphoma is more frequently found in non - african children . the extranodal localization of lymphoma is usually the small intestine , with a tendency to occur in the ileocecal region . the gastric wall is a very rare site of origin in children . within the abdominal cavity , patients seek medical advice due to non - specific symptoms of abdominal pain , gastrointestinal bleeding and anemia or with symptoms of acute abdomen suggestive of appendicitis , bowel obstruction or intestinal intussusception . the ultrasound ( us ) presentation of gastrointestinal non - hodgkin lymphoma is ambiguous and should be differentiated from other pathologies , such as inflammatory lesions in the intestine , appendicitis or intestinal intramural hematoma . burkitt 's lymphoma that originates from lymph follicles of the terminal ileum submucosa spreads along the wall , which on us examination is manifested by fragmentary thickening with low echogenicity and a blurred layered structure . wall infiltration may be asymmetrical and the bowel lumen may be normal or narrowed . single or multifocal and oval areas of low echogenicity surrounded by hyperechoic mesentery are characteristic of abdominal lymph node involvement by lymphoma . in physiological conditions , there is no lymphatic tissue in the gastric mucosa . a chronic inflammatory process , e.g. infection with helicobacter pylori , may facilitate the development of the lymphatic tissue , which , in turn , may transform into a neoplasm . in the adult population , non - hodgkin lymphomas of the stomach are usually of the malt type ( mucosa - associated lymphoid tissue ) . in children however , burkitt 's lymphoma may be highly malignant . depending on the extent of the lesion , us examination helps to assess the thickening of individual layers of the gastric wall , which is usually of low echogenicity , with or without a preserved layered structure . the initial diagnosis of the character of the infiltration in the gastrointestinal tract may be determined on the basis of ultrasound presentation . from 2000 to 2012 , 15 pediatric patients ( one girl and 14 boys ) were diagnosed and treated for abdominal burkitt 's non - hodgkin lymphoma in the department of pediatric radiology and in the department of pediatric hematology and oncology , medical university of lublin , poland . the patients were aged between 2 and 17 ( mean age was 9 years and 6 months ) . the clinical symptoms of abdominal pain , weight loss , vomiting and general malaise prevailed . additionally , 2 patients presented with yellowed skin and 2 had gastrointestinal bleeding and anemia . in one case , the only symptom of the neoplasm was an enlarged lymph node localized on the medial surface of the right thigh . ultrasound examinations were conducted with the use of a siemens scanner with a convex transducer of 3.55 mhz and a high - frequency linear array transducer of l4 7.5 mhz . the following modes were used : b - mode , color and power doppler as well as tissue harmonic imaging ( thi ) . the gastrointestinal tract was assessed using an ultrasound set - up for organs located superficially ( set - up small parts ) . during the diagnostic process , all patients underwent laboratory tests , biochemical examinations ( ldh level ) , bone marrow examination as well as abdominal and pelvic computed tomography . ultrasound examinations conducted in the group of 15 patients revealed pathological masses localized in the gastric wall in 3 patients ( 20% ) , in the ileocecal region in 10 patients ( 67% ) and a disseminated process in 2 patients ( 13% ) . in the group of 3 patients in which the lesion originated from the gastric wall , the body of the stomach and prepyloric region were involved . in 2 patients , a pathological mass with heterogeneous echogenicity protruded into the gastric lumen and narrowed it considerably ; in one patient we observed polycyclic margins of a lesion of low echogenicity that extended beyond the gastric wall . in 2 patients , the size of the lesions ranged from 63 56 to 94 101 mm . gastroscopy , which was conducted in these patients , confirmed the presence of an infiltration in the gastric wall . in a histopathological examination of the collected samples , burkitt 's lymphoma was diagnosed in 2 patients and malt lymphoma in one patient . the urease test for us examination , epigastric region . a low echogenicity mass originating from the gastric wall . intestinal dilation us examination , right lumbar region . a low echogenicity tissue area with calcifications a lymph node affected by lymphoma in 12 patients with a diagnosed burkitt 's non - hodgkin lymphoma in an extragastric localization , differences in the morphology of the lesions were observed in us images and the patients were thus divided into three groups : group i in 2 patients ( 17% ) , a pattern was observed in us images in the subhepatic region , which is characteristic of ileocecal intussusception ; in the center , the intussusception had low echogenicity and the lymph nodes were round.group ii in 8 patients ( 66% ) , us examination revealed well - circumscribed areas of low echogenicity that were connected to the adjacent intestinal loops . in one patient , the lesion was extensive and reached the hepatic hilum , which caused bile duct dilation . in all patients , the intestinal wall was 923 mm thick , presented low echogenicity and lacked any layered structure . one patient manifested a dilated intestinal lumen and in all remaining cases , the lumen was narrow but did not cause obstruction . in 4 patients , power doppler demonstrated the rich vascularity of the altered intestinal wall.group iii in 2 patients ( 17% ) , us examination revealed numerous lymph nodes in the epigastric and umbilical regions , ranging in size from 821 mm , with low echogenicity and without a vascular hilum . group i in 2 patients ( 17% ) , a target pattern was observed in us images in the subhepatic region , which is characteristic of ileocecal intussusception ; in the center , the intussusception had low echogenicity and the lymph nodes were round . group ii in 8 patients ( 66% ) , us examination revealed well - circumscribed areas of low echogenicity that were connected to the adjacent intestinal loops . in one patient , the lesion was extensive and reached the hepatic hilum , which caused bile duct dilation . in all patients , the intestinal wall was 923 mm thick , presented low echogenicity and lacked any layered structure . one patient manifested a dilated intestinal lumen and in all remaining cases , the lumen was narrow but did not cause obstruction . in 4 patients , group iii in 2 patients ( 17% ) , us examination revealed numerous lymph nodes in the epigastric and umbilical regions , ranging in size from 821 mm , with low echogenicity and without a vascular hilum . additionally , in 2 patients , fluid was present between the intestinal loops and in the vesicorectal space . the final diagnosis was established on the basis of a histopathological examination of the sample collected intraoperatively in 8 patients and during gastroscopy in 3 patients . in a further 3 cases , a diagnosis was made based on the clinical picture and changes in the bone marrow . five patients with lesions in the ileocecal region qualified for surgical treatment due to acute stomach . in 2 cases , the process was disseminated at the time of admission to hospital . the disease is currently in remission and these patients are undergoing periodic follow - up examinations . malignant non - hodgkin lymphomas constitute a diverse group of neoplasms of the lymphatic system . in children , the abdominal form is dominant , i.e. burkitt 's lymphoma , with the tendency to occur in the ileocecal region in 2550% of cases . neoplasms of this type are highly malignant ; they may double their mass within 24 hours . due to their non - specific clinical and radiological signs , the diagnosis of gastrointestinal lymphomas in children is difficult . this is because the common and most frequent abdominal symptoms , such as abdominal pain , loss of appetite , flatulence , diarrhea , constipation , hepato- and splenomegaly , are usually associated with infectious diseases ( e.g. appendicitis ) rather than oncological causes . the process of conducting abdominal us examinations in frequently agitated children may also be challenging and may result in overlooking lesions in the intestinal loops . such an assessment , however , is essential since the gastrointestinal tract , and the ileocecal region in particular , is the most common localization of extranodal non - hodgkin lymphomas . during the examination , one should assess the thickness of the intestinal wall , the presence or absence of the layered wall structure and the degree of intestinal dilation . such a manifestation of lymphoma was observed in 5 patients in our study . depending on the degree of wall thickening and exophytic proliferation , lesions may narrow the lumen of the gastrointestinal tract ( to various degrees ) or cause its compression , leading to obstruction . in the case of circular wall thickening , however , the presence or even the dilation of the intestinal lumen is apparent . in certain patients , the first sign of lymphoma may be ileocecal intussusception with tumor acting as its front . in our patients , intestinal intussusception frequently occurs in young children and is called spontaneous intussusception and is associated with peristalsis , elongation of the intestinal mesentery or lymph node enlargement . in older children , intussusception may be caused by the presence of pathological lesions , such as lymphoma , or intestinal polyps . in one girl of the analyzed group who was diagnosed with lymphoma , numerous polyps of the large bowel were also observed and confirmed endoscopically . persisting non - specific abdominal pain in children requires differential diagnosis between inflammatory and neoplastic diseases . in each child with abdominal symptoms , abdominal us examination is the first test , and provides physicians with information that is valuable in the diagnostic and therapeutic process . the application of high - frequency transducers enables the assessment of the gastrointestinal wall , the degree and extent of its thickening , and whether or not the lymph nodes are enlarged . a thorough us assessment of all abdominal organs conducted using convex and linear probes increases the chances of establishing an adequate diagnosis . the authors do not report any financial or personal links with other persons or organizations , which might affect negatively the content of this publication and/or claim authorship rights to this publication .	introductionburkitt 's lymphoma accounts for approximately 25% of lymphomas diagnosed in children of developmental age . the tumor is localized mainly in the intestine ( usually in the ileocecal region ) , mesenteric lymph nodes and extraperitoneal space . the clinical symptoms are non - specific and include : abdominal pain , vomiting , gastrointestinal bleeding , and acute abdomen suggesting appendicitis or intestinal intussusception . on ultrasound examination , burkitt 's lymphoma may manifest itself in various ways , depending on the origin of the lesion.aimthe aim of this paper was to review the ultrasound manifestation of abdominal burkitt 's lymphoma in children.material and methodsthe analysis included 15 pediatric patients with burkitt 's non - hodgkin lymphoma in the abdominal cavity . the mean age of the patients was 9.5 . abdominal and gastrointestinal ultrasound examinations were conducted using a siemens scanner with a convex transducer of 3.55 mhz and linear array transducer of l4 7.5 mhz.resultsultrasound examinations conducted in the group of 15 patients revealed pathological masses localized in the gastric wall in 3 patients ( 20% ) , in the ileocecal region in 10 patients ( 67% ) and a disseminated process in 2 patients ( 13% ) . in 12 patients with a diagnosed burkitt 's non - hodgkin lymphoma in an extragastric localization , differences in the morphology of the lesions were observed.conclusionsthe clinical and ultrasound picture of abdominal burkitt 's lymphoma in children is variable . a careful ultrasound assessment of all abdominal organs conducted with the use of convex and linear probes increases the chances of establishing an adequate diagnosis .
You are an expert at summarizing long articles. Proceed to summarize the following text: identified all published observational or interventional studies that reported clinical outcomes according to baseline aspects in acute ischemic stroke patients treated with endovascular management . we conducted a systematic literature review of pubmed , embase , and cochrane databases from january 2000 to january 2016 . the following key words and entry terms analogous with these were used for searching in relevant combinations by using the boolean operators or and and : cerebrovascular accident , stroke , ischemia , embolectomy , endovascular , studies were selected in the primary list as follows : any study that 1 ) involved ais patients eligible for endovascular therapy ; 2 ) reported over 20 cases undergoing endovascular therapy ; 3 ) reported baseline aspects of brain imaging modality in ais patients ; and 4 ) accurately described functional outcomes using a modified rankin scale ( mrs ) at 90 days . we excluded studies 1 ) having duplicated data ; 2 ) reporting mainly patients with posterior circulation stroke ; 3 ) in which aspects was graded based on perfusion imaging only , and 4 ) lacking appropriate data . a prisma flow diagram was used to illustrate the decision - making process regarding the studies . , s.p . , h.s . ) independently extracted data from selected studies that fulfilled the inclusion and exclusion criteria using a standardized form , and all disagreements were resolved by consensus . the following data were collected : report characteristics ( first author 's name , journal , year of publication ) ; study design ( retrospective / prospective analysis , intervention trial or observation , name of cohort , single / two arms , single / multicenter ) , indication for endovascular therapy , treatment option ( the administration of intravenous thrombolytic agent ( ivt ) before endovascular therapy , type of intra - arterial approach ) , study sample ( sample size , age , sex , baseline national institutes of health stroke scale [ nihss ] , baseline aspects , the occlusive segment , time from symptom onset to recanalization , rate of recanalization ) ; and data regarding and definitions of outcomes ( favorable functional outcome , mortality , and sich ) . if a study presented outcomes according to dichotomized aspects , we used these data without modification , and if not , aspects was dichotomized into high ( > 7 ) and low ( 7 ) using data extracted for primary analysis , as performed previously . the quality of the included studies was also independently assessed by the two reviewers ( c.r . , h.s . ) using the quality assessment tool for observational cohort and cross - sectional studies , provided by the national institutes of health ( nih ) and/or cochrane collaboration 's tool for assessing risk of bias . the primary outcome of interest was the proportion of patients with favorable mrs scores of 0 to 2 at 90 days post intervention . we calculated , and subsequently pooled in independent meta - analyses , the odds ratios ( ors ) with corresponding 95% confidence intervals ( ci ) for each outcome of interest . for all meta - analyses , outcomes were pooled using the dersimonian and laird random - effects model , with weights calculated by the mantel - haenszel method . heterogeneity between studies was assessed using cochrane 's q test and i statistic , with i values exceeding 50% representing significant heterogeneity . publication bias was evaluated visually by funnel plots or quantified by the begg - mazumdar 's rank correlation test . subgroup analyses and meta - regression were used to determine whether study - related factors could account for heterogeneity . subgroup analysis was performed according to the study design and included intra - arterial chemical thrombolysis as the primary endovascular treatment option versus mechanical thrombectomy as the primary option . we were able to analyze the impacts of the rate of internal carotid artery ( ica ) occlusion , the rate of recanalization , and time from symptom to recanalization for meta - regressions . in order to evaluate the stability of the pooled results , we further conducted sensitivity analyses by removing studies with higher risks of introducing bias . a further analysis was conducted with aspects dichotomized at very low ( 0 - 4 ) versus intermediate and high ( 5 - 10 ) , and dichotomized at indeterminate ( 5 or 6 - 7 ) versus high ( 8 - 10 ) . meta - analyses were undertaken in accordance with guidelines for meta - analysis of observational studies in epidemiology ( moose ) . identified all published observational or interventional studies that reported clinical outcomes according to baseline aspects in acute ischemic stroke patients treated with endovascular management . we conducted a systematic literature review of pubmed , embase , and cochrane databases from january 2000 to january 2016 . the following key words and entry terms analogous with these were used for searching in relevant combinations by using the boolean operators or and and : cerebrovascular accident , stroke , ischemia , embolectomy , endovascular , studies were selected in the primary list as follows : any study that 1 ) involved ais patients eligible for endovascular therapy ; 2 ) reported over 20 cases undergoing endovascular therapy ; 3 ) reported baseline aspects of brain imaging modality in ais patients ; and 4 ) accurately described functional outcomes using a modified rankin scale ( mrs ) at 90 days . we excluded studies 1 ) having duplicated data ; 2 ) reporting mainly patients with posterior circulation stroke ; 3 ) in which aspects was graded based on perfusion imaging only , and 4 ) lacking appropriate data . a prisma flow diagram was used to illustrate the decision - making process regarding the studies . three reviewers ( c.r . , s.p . , h.s . ) independently extracted data from selected studies that fulfilled the inclusion and exclusion criteria using a standardized form , and all disagreements were resolved by consensus . the following data were collected : report characteristics ( first author 's name , journal , year of publication ) ; study design ( retrospective / prospective analysis , intervention trial or observation , name of cohort , single / two arms , single / multicenter ) , indication for endovascular therapy , treatment option ( the administration of intravenous thrombolytic agent ( ivt ) before endovascular therapy , type of intra - arterial approach ) , study sample ( sample size , age , sex , baseline national institutes of health stroke scale [ nihss ] , baseline aspects , the occlusive segment , time from symptom onset to recanalization , rate of recanalization ) ; and data regarding and definitions of outcomes ( favorable functional outcome , mortality , and sich ) . if a study presented outcomes according to dichotomized aspects , we used these data without modification , and if not , aspects was dichotomized into high ( > 7 ) and low ( 7 ) using data extracted for primary analysis , as performed previously . the quality of the included studies was also independently assessed by the two reviewers ( c.r . , h.s . ) using the quality assessment tool for observational cohort and cross - sectional studies , provided by the national institutes of health ( nih ) and/or cochrane collaboration 's tool for assessing risk of bias . the primary outcome of interest was the proportion of patients with favorable mrs scores of 0 to 2 at 90 days post intervention . we calculated , and subsequently pooled in independent meta - analyses , the odds ratios ( ors ) with corresponding 95% confidence intervals ( ci ) for each outcome of interest . for all meta - analyses , outcomes were pooled using the dersimonian and laird random - effects model , with weights calculated by the mantel - haenszel method . heterogeneity between studies was assessed using cochrane 's q test and i statistic , with i values exceeding 50% representing significant heterogeneity . publication bias was evaluated visually by funnel plots or quantified by the begg - mazumdar 's rank correlation test . subgroup analyses and meta - regression were used to determine whether study - related factors could account for heterogeneity . subgroup analysis was performed according to the study design and included intra - arterial chemical thrombolysis as the primary endovascular treatment option versus mechanical thrombectomy as the primary option . we were able to analyze the impacts of the rate of internal carotid artery ( ica ) occlusion , the rate of recanalization , and time from symptom to recanalization for meta - regressions . in order to evaluate the stability of the pooled results , we further conducted sensitivity analyses by removing studies with higher risks of introducing bias . a further analysis was conducted with aspects dichotomized at very low ( 0 - 4 ) versus intermediate and high ( 5 - 10 ) , and dichotomized at indeterminate ( 5 or 6 - 7 ) versus high ( 8 - 10 ) . 13 studies were pertinent to include in this review . a flow diagram summarizing the literature search the main methodological and baseline characteristics of included studies are presented in tables 1 and 2 . three studies were primary reports of rcts ( escape , revascat , swift - prime ) that compared the treatment effects of endovascular therapy to those of the current standard therapy for patients with ais ( 3 - 5 ) , and three studies were ancillary analyses of endovascular arms of rcts ( proact - ii , defuse - ii , ims - iii ) . one study used pooled data from two single - arm trials ( penumbra phase ii pivotal trial ; clinicaltrials.gov ; nct00334061 , and penumbra imaging collaborative study ; clinicaltrials.gov ; nct00785161 ) to assess the safety and efficacy of endovascular devices . no studies were considered to be seriously flawed as per the quality assessment tool for observational cohort and cross - sectional studies ( table 3 ) . of 1,798 participants ( nine studies ) , 74% had ivt before endovascular treatment , and in two studies , patients did not receive intravenous thrombolytic agents before endovascular treatment according to their study protocols . in four studies , intraarterial chemical thrombolysis was the primary choice of endovascular therapy or was given to over a half of the endovascular cohorts . penumbra suction systems and/or stent retrievers were used as the primary choice for endovascular thrombectomy in nine studies . eleven studies used non - enhanced ct to score aspects and three studies used mri . an aspects dichotomy threshold of seven was used in 12 studies and a threshold of six was used in two studies . meta - analysis of pooled data from the 13 included studies revealed favorable functional outcomes ( mrs sore 0 - 2 at 90 days ) in favor of high baseline aspects ( or=2.227 ; 95% ci : 1.735 to 2.859 ; p<0.0001 ) ( fig . there was no significant heterogeneity among the included studies ( q - statistics , p=0.12 ; i = 32.96% ) . significant publication bias was not observed ( kendal 's tau , 0.000 ; two - tailed p=1.00 ) ( fig . subgroup analyses of the seven prospective trials ( or=2.154 ; 95% ci 1.685 to 2.754 ; p<0.0001 ; q - statistics , p=0.74 ; i=0.00% ) and six retrospective case series ( or=2.422 ; 95% ci , 1.764 to 3.326 ; p<0.0001 ; q - statistics , p<0.05 ; i=64.37% ) also demonstrated favorable outcomes in favor of high aspects ( fig . subgroup analyses of four studies that included intra - arterial thrombolysis as the dominant endovascular treatment option also showed that initial high aspects was associated with stronger odds for good outcomes ( or=2.638 ; 95% ci , 11.971 to 3.531 ; p<0.0001 ; q - statistics , p=0.06 ; i=59.67% ) . pooled analyses of eight studies that used new generation devices ( suction thrombectomy and stent retriever ) for thrombectomy yielded the same results ( or=2.074 ; 95% ci , 1.580 to 2.721 ; p<0.0001 ; q - statistics , p=0.41 ; i=2.06% ) . there were no significant differences between the subgroups ( q - statistics , p=0.236 ) ( fig . 2c ) . meta - regression analysis demonstrated that the log odds ratios between high and low aspects arms decreased with increases in the ica occlusion rate ( regression coefficient=0.048 ; 95% ci , 0.078 to 0.017 ; p = 0.002 ) ( fig . 2d ) in 11 studies , but did not identify any correlations with functional outcome on the basis of time to recanalization or the rate of pre - interventional ivt . exclusion sensitivity analysis demonstrated that pooled estimates did not change with the exclusion of any one study for either effect size measure . pooled estimates of good outcomes were not significantly different , with the exclusion of three studies that used mri to score aspects , four studies that did not have upper age limits for inclusion , and two studies that excluded subjects with ica occlusions . mortality was extracted from 1,085 patients of seven studies , and sich was from 1,235 patients of eight studies . mortality and sich were significantly lower ( or=2.178 ; 95% ci , 1.530 to 3.100 ; p<0.0001 ; q - statistics , p=0.32 ; i=14.17% ; and or=2.133 ; 95% ci , 1.510 to 3.015 ; p<0.0001 ; q - statistics , p=0.35 ; i=10.59% ) ( fig . dichotomization of aspects as very low ( 4 ) versus intermediate to high ( > 4 ) was available for a total of 1,062 patients . meta - analysis demonstrated good outcomes in favor of intermediate to high aspects ( or=4.077 ; 95% ci , 1.884 to 8.825 ; p<0.0001 ; q - statistics , p=0.05 ; i=60.75% ) . dichotomization into intermediate ( 5 or 6 - 7 ) and high aspects ( 8 - 10 ) was available in nine studies . meta - analysis demonstrated good outcomes in favor of high aspects ( or=1.880 ; 95% ci , 1.3025 to 2.713 ; p<0.0001 ; q - statistics , p<0.05 ; i=53.62% ) ( fig . 13 studies were pertinent to include in this review . a flow diagram summarizing the literature search the main methodological and baseline characteristics of included studies are presented in tables 1 and 2 . three studies were primary reports of rcts ( escape , revascat , swift - prime ) that compared the treatment effects of endovascular therapy to those of the current standard therapy for patients with ais ( 3 - 5 ) , and three studies were ancillary analyses of endovascular arms of rcts ( proact - ii , defuse - ii , ims - iii ) . one study used pooled data from two single - arm trials ( penumbra phase ii pivotal trial ; clinicaltrials.gov ; nct00334061 , and penumbra imaging collaborative study ; clinicaltrials.gov ; nct00785161 ) to assess the safety and efficacy of endovascular devices . no studies were considered to be seriously flawed as per the quality assessment tool for observational cohort and cross - sectional studies ( table 3 ) . of 1,798 participants ( nine studies ) , 74% had ivt before endovascular treatment , and in two studies , patients did not receive intravenous thrombolytic agents before endovascular treatment according to their study protocols . in four studies , intraarterial chemical thrombolysis was the primary choice of endovascular therapy or was given to over a half of the endovascular cohorts . penumbra suction systems and/or stent retrievers were used as the primary choice for endovascular thrombectomy in nine studies . eleven studies used non - enhanced ct to score aspects and three studies used mri . an aspects dichotomy threshold of seven was used in 12 studies and a threshold of six was used in two studies . meta - analysis of pooled data from the 13 included studies revealed favorable functional outcomes ( mrs sore 0 - 2 at 90 days ) in favor of high baseline aspects ( or=2.227 ; 95% ci : 1.735 to 2.859 ; p<0.0001 ) ( fig . 2a ) . there was no significant heterogeneity among the included studies ( q - statistics , p=0.12 ; i = 32.96% ) . significant publication bias was not observed ( kendal 's tau , 0.000 ; two - tailed p=1.00 ) ( fig . subgroup analyses of the seven prospective trials ( or=2.154 ; 95% ci 1.685 to 2.754 ; p<0.0001 ; q - statistics , p=0.74 ; i=0.00% ) and six retrospective case series ( or=2.422 ; 95% ci , 1.764 to 3.326 ; p<0.0001 ; q - statistics , p<0.05 ; i=64.37% ) also demonstrated favorable outcomes in favor of high aspects ( fig . subgroup analyses of four studies that included intra - arterial thrombolysis as the dominant endovascular treatment option also showed that initial high aspects was associated with stronger odds for good outcomes ( or=2.638 ; 95% ci , 11.971 to 3.531 ; p<0.0001 ; q - statistics , p=0.06 ; i=59.67% ) . pooled analyses of eight studies that used new generation devices ( suction thrombectomy and stent retriever ) for thrombectomy yielded the same results ( or=2.074 ; 95% ci , 1.580 to 2.721 ; p<0.0001 ; q - statistics , p=0.41 ; i=2.06% ) . there were no significant differences between the subgroups ( q - statistics , p=0.236 ) ( fig . 2c ) . meta - regression analysis demonstrated that the log odds ratios between high and low aspects arms decreased with increases in the ica occlusion rate ( regression coefficient=0.048 ; 95% ci , 0.078 to 0.017 ; p = 0.002 ) ( fig . 2d ) in 11 studies , but did not identify any correlations with functional outcome on the basis of time to recanalization or the rate of pre - interventional ivt . exclusion sensitivity analysis demonstrated that pooled estimates did not change with the exclusion of any one study for either effect size measure . pooled estimates of good outcomes were not significantly different , with the exclusion of three studies that used mri to score aspects , four studies that did not have upper age limits for inclusion , and two studies that excluded subjects with ica occlusions . mortality was extracted from 1,085 patients of seven studies , and sich was from 1,235 patients of eight studies . mortality and sich were significantly lower ( or=2.178 ; 95% ci , 1.530 to 3.100 ; p<0.0001 ; q - statistics , p=0.32 ; i=14.17% ; and or=2.133 ; 95% ci , 1.510 to 3.015 ; p<0.0001 ; q - statistics , p=0.35 ; i=10.59% ) ( fig . dichotomization of aspects as very low ( 4 ) versus intermediate to high ( > 4 ) was available for a total of 1,062 patients . meta - analysis demonstrated good outcomes in favor of intermediate to high aspects ( or=4.077 ; 95% ci , 1.884 to 8.825 ; p<0.0001 ; q - statistics , p=0.05 ; i=60.75% ) . dichotomization into intermediate ( 5 or 6 - 7 ) and high aspects ( 8 - 10 ) was available in nine studies . meta - analysis demonstrated good outcomes in favor of high aspects ( or=1.880 ; 95% ci , 1.3025 to 2.713 ; p<0.0001 ; q - statistics , p<0.05 ; i=53.62% ) ( fig . meta - analysis of pooled data from the 13 included studies revealed favorable functional outcomes ( mrs sore 0 - 2 at 90 days ) in favor of high baseline aspects ( or=2.227 ; 95% ci : 1.735 to 2.859 ; p<0.0001 ) ( fig . 2a ) . there was no significant heterogeneity among the included studies ( q - statistics , p=0.12 ; i = 32.96% ) . significant publication bias was not observed ( kendal 's tau , 0.000 ; two - tailed p=1.00 ) ( fig . subgroup analyses of the seven prospective trials ( or=2.154 ; 95% ci 1.685 to 2.754 ; p<0.0001 ; q - statistics , p=0.74 ; i=0.00% ) and six retrospective case series ( or=2.422 ; 95% ci , 1.764 to 3.326 ; p<0.0001 ; q - statistics , p<0.05 ; i=64.37% ) also demonstrated favorable outcomes in favor of high aspects ( fig . subgroup analyses of four studies that included intra - arterial thrombolysis as the dominant endovascular treatment option also showed that initial high aspects was associated with stronger odds for good outcomes ( or=2.638 ; 95% ci , 11.971 to 3.531 ; p<0.0001 ; q - statistics , p=0.06 ; i=59.67% ) . pooled analyses of eight studies that used new generation devices ( suction thrombectomy and stent retriever ) for thrombectomy yielded the same results ( or=2.074 ; 95% ci , 1.580 to 2.721 ; p<0.0001 ; q - statistics , p=0.41 ; i=2.06% ) . there were no significant differences between the subgroups ( q - statistics , p=0.236 ) ( fig . 2c ) . meta - regression analysis demonstrated that the log odds ratios between high and low aspects arms decreased with increases in the ica occlusion rate ( regression coefficient=0.048 ; 95% ci , 0.078 to 0.017 ; p = 0.002 ) ( fig . 2d ) in 11 studies , but did not identify any correlations with functional outcome on the basis of time to recanalization or the rate of pre - interventional ivt . exclusion sensitivity analysis demonstrated that pooled estimates did not change with the exclusion of any one study for either effect size measure . pooled estimates of good outcomes were not significantly different , with the exclusion of three studies that used mri to score aspects , four studies that did not have upper age limits for inclusion , and two studies that excluded subjects with ica occlusions . mortality was extracted from 1,085 patients of seven studies , and sich was from 1,235 patients of eight studies . mortality and sich were significantly lower ( or=2.178 ; 95% ci , 1.530 to 3.100 ; p<0.0001 ; q - statistics , p=0.32 ; i=14.17% ; and or=2.133 ; 95% ci , 1.510 to 3.015 ; p<0.0001 ; q - statistics , p=0.35 ; i=10.59% ) ( fig . dichotomization of aspects as very low ( 4 ) versus intermediate to high ( > 4 ) was available for a total of 1,062 patients . meta - analysis demonstrated good outcomes in favor of intermediate to high aspects ( or=4.077 ; 95% ci , 1.884 to 8.825 ; p<0.0001 ; q - statistics , p=0.05 ; i=60.75% ) . dichotomization into intermediate ( 5 or 6 - 7 ) and high aspects ( 8 - 10 ) was available in nine studies . meta - analysis demonstrated good outcomes in favor of high aspects ( or=1.880 ; 95% ci , 1.3025 to 2.713 ; p<0.0001 ; q - statistics , p<0.05 ; i=53.62% ) ( fig . the meta - analyses showed that a high aspects favored a good clinical outcome after endovascular therapy in comparison with a low aspects . this supports that baseline aspects is a reliable predictor of prognosis in patients with ais undergoing endovascular therapy , as noted in several individual studies . additional subgroup and sensitivity analyses revealed that the primary endpoint of pooled data was not affected by potential biases , such as study design , imaging modality , or endovascular therapy method . because the baseline infarction volume is an essential factor affecting clinical results in ais along with the time - window , many researchers have used aspects to assess the efficiency of the treatment modality . in ivt of ais , the prognostic value of aspects was established in clinical trials with large cohorts , showing a linear correlation between aspects and prognosis . however , aspects was not proven to modify the effectiveness of ivt in terms of improved functional outcomes in two randomized trials compared to placebo , which does not support the exclusion of patients from ivt based on aspects . unlike ivt , the present study indicates that aspects can identify candidates who are suited for endovascular therapy in ais and can help determine the best treatment option without delaying therapy . in this meta - analysis , the pooled data showed heterogeneity across enrolled studies , which was explained by treatment option , intraarterial thromobolysis versus intraarterial thrombectomy . such differences in endovascular method have also been suggested to be a confounding factor in previous meta - analyses comparing the effectiveness of endovascular therapy vs. medical treatment of ischemic stroke ( 29 , 30 ) . because the present analysis used a dichotomous classification of aspects and many of enrolled studies did not provide cut - off values of aspects for candidates of endovascular therapy but instead used the one - third rule , we were unable to specify the lowest aspects value associated with therapeutical benef its after endovascular therapy . therefore , further studies should be conducted to identify cut - off values of aspects for selecting patients likely to benefit from endovascular therapy . although aspects was originally designed for use with non - enhanced brain ct , recent studies assessed its practicability with advanced brain imaging methods , such as perfusion ct and mri , due to limitations associated with interrater reliability , predictability , and sensitivity for early ischemic lesions when assessed using ct - aspects compared with mri - aspects . however , ct has the advantage of being an easy approach and saving the time to treatment , and has stronger evidence through many clinical trials . therefore , ct - aspects will not be replaced by alternative scoring systems in clinical practice within the next few years . the lower reliability of ct aspects should be overcome by training clinicians who assess patients initially after admission to the hospital . in this study , meta - regression showed that the rate of ica occlusion was negatively correlated with odds ratios in favor of high aspects . this f inding suggests that lower recanalization rate , procedural difficulty , and weaker collateral supply in ica occlusion are factors that decrease the likelihood of good outcomes , despite initial small volumes of infarction . first , because baseline aspects was not randomized by researchers in most studies , this manuscript was described based on guidelines for meta - analyses of observational studies . second , our results could be constrained by the unclear risk of bias owing to incomplete data in a few studies . our meta - analysis of pooled data , including prospective trials and observational studies , provides high - level evidence of outcome prognostication of dichotomized aspects in endovascular therapy for ischemic stroke . scoring the baseline aspects would enhance the selection of candidates for endovascular therapy by predicting prognosis in the management of ischemic stroke .	purposethe alberta stroke program early ct score ( aspects ) was devised to quantify the extent of early ischemic changes in the middle cerebral artery territory on brain ct . we performed a systematic review and meta - analysis of studies that presented clinical outcomes and baseline aspects in ischemic stroke patients managed with endovascular methods to validate the use of aspects for risk prognostication.materials and methodswe searched the medline , embase , and cochran databases for observational or interventional studies that reported clinical outcomes and baseline aspects in ischemic stroke patients treated with endovascular methods . data were pooled to perform a meta - analysis for comparisons of clinical outcomes between high and low aspects patients.resultsa meta - analysis of 13 studies ( six observational and seven interventional ) revealed favorable outcomes ( mrs sore 0 - 2 at 90 days ) for high baseline aspects ( odds ratio=2.22 ; 95% ci : 1.74 - 2.86).conclusionhigh aspects is a predictor of favorable outcome after endovascular therapy for ischemic stroke .
You are an expert at summarizing long articles. Proceed to summarize the following text: endometriosis is an estrogen - dependent chronic disease with the incidence of 3040 % in women with pain complaints of the lesser pelvis [ 1 , 2 ] . the disease is estimated to affect 1015 % of asymptomatic women of the reproductive age . endometriosis is connected with the presence of ectopic endometrial cells within the organs of the lesser pelvis and with biochemical , molecular , and hormonal changes which negatively affect the homeostasis in a female body . endometriotic women are known to have elevated levels of macrophages , dendritic cells , and peritoneal fluid nk cells as well as abnormal levels of inflammatory mediators , i.e. , interleukin-1 ( il-1 ) , il-6 , il-8 , substance p , and tumor necrosis factor ( tnf ) . disturbances in the functioning of the immune system lead to chronic inflammatory processes and are associated with the appearance of the following symptoms of inflammation : dysmenorrhea , dysuria , and dyspareunia . the presence of the abovementioned manifestations is connected with the pathogenesis of endometriosis as well as the consequences of an inflammation , namely intraperitoneal adhesions . the foci of ectopic endometrial cells may develop within the ovaries , fallopian tubes , corpus uteri , douglas pouch , vesicouterine pouch , as well as outside the pelvis , for example on the surface of colon , parietal peritoneum , and abdominal tissue . the most common , nonspecific endometriosis - related complaints include dysmenorrhea , dyspareunia , dysuria , dyschezia , and noncyclic ( not related to menstrual cycle ) chronic pelvic pain . the pain may be correlated with the advancement of the endometrial lesions , but only in grades iii and iv cases , whereas grades i and ii have not been confirmed to be related [ 8 , 9 ] . endometriosis is clinically graded into four stages of advancement according to the revised american society of reproductive medicine classification . the chapron classification ( 2003 ) is an example of another system , which introduced the deep infiltrating endometriosis ( die ) term as the main cause of pain complaints , depending on the location within the organs of the lesser pelvis . the consequences of the disease are a serious and complex social issue , although it is often underestimated or ignored . endometriosis is a multifactorial disease and extends beyond a mere medical condition , resulting in impaired fecundity , disturbed family relations , and leaves of absence from work due to chronic pain complaints . enucleation or destruction of cysts , removal or destruction of the focal lesions , lysis of adhesions , and/or the nerve - sparing procedure of selective laparoscopic uterine nerve ablations ( lunas ) of the uterosacral ligaments belong the most common laparoscopic methods applied in the treatment of the disease . these techniques aim to maximize the therapeutic effect and minimize the side effects , i.e. , damage to the healthy tissue . co2 laser ablation seems to be the most beneficial of them all , as it allows for a precise vaporization of endometriotic lesions with good homeostasis and minimal damage to surrounding tissue . the latter is especially important in the event of a removal of the endometrial cysts within the ovary , as it allows preservation of the ovarian reservoir [ 13 , 14 ] . the efficacy of laser ablation of endometrial implants to reduce pain is estimated at almost 65 % . however , there is no consensus on the positive therapeutic effect of other classical laparoscopic techniques such as electroablation . latest research shows that laparoscopy with surgical management of the focal lesions has a beneficial therapeutic effect and lowers the possibility of recurrence of endometrial cysts and complaints . the aim of the study was to evaluate the therapeutic effect of two laparoscopic techniques , electroablation of endometriosis vs. co2 laser ablation , to reduce a variety of pain complaints in the affected individuals . the aim of the study was to evaluate the therapeutic effect of two laparoscopic techniques , electroablation of endometriosis vs. co2 laser ablation , to reduce a variety of pain complaints in the affected individuals . a laser is a device that emits electromagnetic radiation in various ranges of wavelengths : visible light , ultraviolet , or infrared radiation , by using stimulated emission . laser radiation is coherent , usually polarized , and the beams have very small divergence . narrow emission linewidth , which corresponds to a high power in a selected , narrow spectrum range , may be easily generated . the co2 laser is a gas laser based on a gas mixture of carbon dioxide , nitrogen , hydrogen , and helium . the main spectral lines are within the wavelength of 9.4 and 10.6 m , and the emitted power reaches 100 kw at continuous and 10 pulsed operation . the acupulse co2 laser of 3040 w ( lumenis , israel ) , connected to a laparoscope ( storz , germany ) , and aida software ( storz , germany ) to archive data were used in the study . a total of 48 patients with ovarian endometriosis and die , grades i ( n = 0 ) , ii ( n = 4 ) , iii ( n = 37 ) , and iv ( n = 7 ) according to rarsm , prepared for laparoscopic removal of endometriotic lesions at the clinic of gynecology and oncology , krakw , between 2011 and 2012 , were recruited for the study . exclusion criteria were the following : pregnancy , history of surgery within the abdominal cavity , history of pelvic inflammatory disease , and prolonged use of oral contraceptives . before the surgery , all patients filled a questionnaire on pain complaints during the 3 months preceding the study . numerical rating scale ( nrs ) was used in the questionnaire , with 0 for no pain and 10 for unbearable pain , to evaluate the intensity of five types of pain during menstruation , urination , defecation , sexual intercourse , as well as noncyclic pelvic pain syndrome ( pps ) . patients deemed eligible for the study underwent a gynecological examination and an ultrasound test with the use of transvaginal probe , 2d/3d/4d 59 mhz , voluson e6 ( general electrics , usa ) . the subjects were randomized into the laser ablation ( n = 15 ) and electroablation ( n = 33 ) groups . at the 3- and 6-month checkup , the patients completed the pain questionnaire again . additionally , changes in painkiller use were also investigated . at the first visit , when patients deemed eligible for the study were selected and all control checkups , the subjects were examined with the use of a transvaginal ultrasound to evaluate the presence of endometrioid lesions . the tests were performed by the same experienced and certified ( isuog , ptg , iota ) doctor , agnieszka nocu . student s t test for matched pairs ( for near - normally distributed variables ) and nonparametric wilcoxon test ( for no - normally distributed variables ) were used to evaluate changes in pain intensity . mcnemar s test was used to analyze the percentage of patients using antispasmodic drugs ( e.g. , no - spa drotaverine hydrochloride ) and nonsteroidal anti - inflammatory drugs ( nsaids ) ( the most commonly used ) . student s t test for independent groups and mann - whitney u test for nonnormally distributed variables were used for the comparison between changes in pain intensity inpatients with disease recurrence vs. no recurrence . student s t test for matched pairs ( for near - normally distributed variables ) and nonparametric wilcoxon test ( for no - normally distributed variables ) were used to evaluate changes in pain intensity . mcnemar s test was used to analyze the percentage of patients using antispasmodic drugs ( e.g. , no - spa drotaverine hydrochloride ) and nonsteroidal anti - inflammatory drugs ( nsaids ) ( the most commonly used ) . student s t test for independent groups and mann - whitney u test for nonnormally distributed variables were used for the comparison between changes in pain intensity inpatients with disease recurrence vs. no recurrence . a total of 48 patients were deemed eligible for the study , with 33 women who underwent electroablation ( group characteristics , table 1 ) and 15 subjects who received co2 laser ablation ( group characteristics , table 2 ) . out of the 48 patients who underwent surgery , three ( 6.25 % ) women withdrew from the study without stating the cause . at the 3-month checkup , the electroablation and laser ablation groups comprised 25 ( 75 % ) and 15 ( 100 % ) subjects , respectively . eventually , the 6-month checkup included 34 ( 71 % ) patients , 20 ( 60 % ) after electroablation and 14 ( 93 % ) after co2 laser ablation . one ( 2.9 % ) woman conceived and five ( 14.7 % ) resigned from the 6-month checkup.table 1patient characteristics : electroablation groupno . of patients ( n = 33)meanmedianmin . valueage30.17312239bmi20.9717.7520.8924.65dysmenorrhea6.277.00010dyschezia0.930.007dysuria1.870.0010pps3.62.8208dyspareunia3.874.007 patient characteristics : electroablation group patient characteristics : co2 laser ablation group the statistical analyses generated diversified results . in the co2 laser group , the 3-month checkup revealed statistically significant pain relief only during sexual intercourse ( p = 0.035 ) . pain threshold increased in one ( 6.67 % ) , decreased in nine ( 60 % ) , and remained on the same level in five ( 33.3 % ) patients . in the electroablation group , the 3-month checkup revealed statistically significant pain relief during menstruation ( p = 0.01 ) , urination ( p = 0.037 ) , and sexual intercourse ( p = 0.008 ) . dysuria decreased from seven to four points in 7 ( 28 % ) , remained on the same level in 16 ( 64 % ) , and increased in 2 ( 8 % ) patients , whereas 12 ( 50 % ) subjects reported complete resolution of pain symptoms . the 6-month checkup revealed further changes . in the co2 laser group , dysmenorrhea significantly subsided ( p = 0.025 ) , but dyschezia intensified ( p = 0.018 ) . fifteen ( 100 % ) patients presented no dyschezia complaints before the surgery , but after 6 months , seven ( 50 % ) patients reported pain of mild intensity . interestingly , after the initial improvement observed at the 3-month checkup , the 6-month checkup revealed significantly intensified dyspareunia ( p = 0.016 ) . in the electroablation group , pain related to menstruation continued to decrease ( p = 0.004 ) ( fig . 1 ) . seventeen ( 50 % ) patients reported dysmenorrhea at the level of greater than or equal to seven points before the surgery , but four and three points at the 3- and 6-month checkup , respectively . however , dyspareunia intensified significantly ( p = 0.032 ) in that group . seventeen ( 50 % ) patients reported dyspareunia at the level of greater than or equal to two points before the surgery , but greater than or equal to ten points at the 6-month checkup.fig . 1changes in pain complaints before / during menstruation ( electroablation vs. co2 laser ablation ) , expressed in points , before the operation , 3 and 6 months after the surgery changes in pain complaints before / during menstruation ( electroablation vs. co2 laser ablation ) , expressed in points , before the operation , 3 and 6 months after the surgery no statistically significant changes in terms of pps ( p > the frequency of the use of painkillers and antispasmodic drugs was also analyzed in both groups . nsaids ( ketonal , paracetamol ) and antispasmodic drugs ( no - spa ) were most often used . statistical analysis was carried out for both of these groups of drugs , and statistically significant decrease in the use of nsaids was noted in both study groups ( p = 0.008 for electroablation and p = 0.031 for laser ablation ) , but not sooner than 6 months postoperatively . the frequency of postoperative use of antispasmodic drugs was comparable to preoperative values ( p > 0.05 ) . owing to the diversified results from both study groups , a relation between the investigated types of pain and disease recurrence on transvaginal ultrasound ( n = 7 ) was investigated . recurrence was noted only in the laser ablation group . a statistically significant correlation ( p = 0.02 ) was found between intensified dyschezia and disease recurrence at the 6-month checkup ( table 3 ) in that group of patients.table 3analysis of correlations between pain intensity during sexual intercourse and disease recurrence on ultrasoundtype of painusg_recidiv_6 mno . valuemax . value p valuedefec_pain_6-m laser071.000.001.732040.020173.865.002.41006 analysis of correlations between pain intensity during sexual intercourse and disease recurrence on ultrasound no correlations between changes in pain intensity and disease recurrence on ultrasound within the lesser pelvis ( p > 0.05 ) with regard to the remaining types of pain were found . regardless of various theories , for example histologic comorbidity of endometriotic foci and the ends of nerve fibers , changes in tnf gene expression , smooth muscle hyperreflexia and hyperalgesia of interstitium of endometriotic lesions , and excessive innervation of endometrioid ovarian cysts , there is no consensus regarding the pathogenesis of pain complaints and their diversification . abdominal ( nociceptive ) pain , caused among others by chronic inflammation and endometrial infiltration into the healthy tissue , is the main component of endometriosis - related pain , while nonnociceptive pain ( hyperalgesia , psychogenic factors ) is of less significance . thus , the search for optimal patient management , mostly based on prospective studies , continues . apart from surgical removal of the endometriotic lesions , pharmacotherapy ( hormonal contraceptives , gonadotropin agonists ) remains to be the most commonly used alternative method of pain management , whereas vagus nerve stimulation , diet therapy , or alternative medicine are less popular . it seems that both co2 laser ablation and electroablation result in relief of pain complaints before and during menstruation . although it is not a disease - specific symptom , dysmenorrhea is a common complaint among the affected women . . mentioned it in their study , while hsu et al . suggested a lack of correlation between pain complaints and location of endometriosis . significant decrease in mean pain intensity and , more importantly , a tendency to further drop after 6 months since the surgery allow to draw optimistic conclusions about the therapeutic effect of both procedures ( fig . 1 ) . our results are consistent with the findings of a randomized prospective study by sutton et al . and jacobson review , with regard to laser ablation . similar results have been reported by radosa et al . , who investigated the effectiveness of electroablation , in their retrospective study over the course of 2 years , and also by roman in prospective study of the effects of electrosurgical excision . also , it is noteworthy that the use of nsaids , associated mostly with dysmenorrhea - related pain , was also statistically significantly decreased ( p < 0.08 after 6 months ) . regardless , changes in the intensity of the remaining types of pain do not allow for unambiguous assessment of the positive effects of laparoscopic treatment . both co2 laser ablation and 2 ) and , especially in the former group , significantly increased dyschezia . intensified pain complaints in these cases might have been the result of the surgical technique of removing endometriotic lesions from the areas of the douglas pouch and uterosacral ligaments , as both of these locations are associated with these two types of pain [ 30 , 31 ] . previous surgical techniques of removing die from the area of uterosacral ligaments deemed to be positive therapeutic results in terms of subsiding dyspareunia and dysmenorrhea , but they also increased the number of grave urologic complications due to nerve damage around the bladder and consequently resulted in the necessity of self - catheterization in some patients [ 32 , 33 ] . the precision of co2 laser , believed to be the essential factor for preservation of the ovarian reserve in the treatment of ovarian endometriosis , may have a less beneficial therapeutic effect in die therapy of the douglas pouch and promotes earlier recurrence of endometriosis and , consequently , pain complaints , especially dyspareunia [ 34 , 35 ] . obtained good results of die treatment with the use of co2 laser , but the study included patients with die of the rectosigmoid area and management consisting of segmental colon resection with the additional use of co2 laser.fig . 2changes in pain complaints during sexual intercourse ( electroablation vs. laser ablation ) , expressed in points , before the operation , 3 and 6 months after the surgery changes in pain complaints during sexual intercourse ( electroablation vs. laser ablation ) , expressed in points , before the operation , 3 and 6 months after the surgery evaluation of partial therapeutic effect ought to take into account hyperalgesia of the nerve endings of tissues theoretically neighboring die lesions , which in case of electroablation and laser ablation , probably are less damaged than by the radical surgical approach . as a result , disease recurrence takes place faster than after the classical approach , i.e. , excision of the endometriotic lesions with a margin of healthy tissue . such an explanation is consistent with the results of the abovementioned study by meuleman et al . paradoxically , the precision of co2 laser , believed to be its advantage in the treatment of ovarian endometriosis , might not correspond to the long - term therapeutic effect in pain management of extra ovarian endometriosis , i.e. , die . pain relief in patients after laparoscopic co2 laser ablation and electroablation is short - term and incomplete . precision of the co2 laser and relatively limited tissue damage during electroablation seem to be irrelevant when it comes to their practical application in treating pain related to extra ovarian endometriosis . owing to a short postoperative observation period , our results should be regarded as a preliminary evaluation of treatment efficacy for pain complaints . further prospective analysis is necessary , and additionally , long - term hormonal therapy as adjuvant to laparoscopic treatment ought to be considered .	endometriosis is a chronic disease affecting mainly women of the reproductive age . its most common manifestations include impaired fecundity , pelvic pain , and dyschezia . laparoscopic removal of endometriotic foci remains to be the gold standard for the treatment of endometriosis . more effective techniques of endoscopic approach among others , laser application are continually being developed . the aim of the study was to evaluate the efficacy of laparoscopic treatment with the use of co2 laser ablation vs. electroablation with regard to pain complaints in the affected patients . the study included 48 women ( aged 2242 ) with varying degrees of endometriosis of the lesser pelvis . the numeric rating scale ( nrs ) was used to evaluate pain intensity before the surgery in all patients , followed by either laser ablation or electroablation of the endometriotic foci . the results of the laparoscopic treatment were monitored after 3 and 6 months postoperatively . p value of 0.05 was considered to be statistically significant . patients from both groups reported less intensive pain before / during menstruation ( dysmenorrhea ) 6 months postoperatively , with more distinct tendency in the electroablation group ( p = 0.004 ) as compared to the laser ablation group ( p = 0.025 ) . despite the initial improvement reported at the 3-month checkup ( p = 0.008 ) , 6 months postoperatively , a statistically significant increase in pain intensity was noted in both groups ( p = 0.016 and p = 0.032 for co2 laser ablation and electroablation , respectively ) . both surgical methods seem to be effective only in the treatment of endometriosis - related dysmenorrhea , whereas the intensity of other pain complaints ( dyspareunia , dysuria , dyschezia , pelvic pain syndrome ( pps ) ) has remained on the same level .
You are an expert at summarizing long articles. Proceed to summarize the following text: donor tissue was obtained from a 58-year - old donor male deceased after sudden cardiac arrest , who underwent rk many years before his demise . after consulting the surgeon , the corneas were preserved in organ culture medium and were provided to our institution for the use into be used for endothelial keratoplasty . briefly , the donor cornea was mounted on an artificial anterior chamber of the altk system ( moria , antony , france ) . the central corneal thickness of the donor was measured using ultrasound pachymetry ( sp-3000 ; tomey gmbh ) to be 733 m in the first cornea and 743 m in the second cornea . after the first cut , the central corneal thickness was measured again ( 325 m in the first case and 317 m in the second one ) . at this stage , the rk incisions could still be seen in both corneas . after turning by 180 , the dovetail of the artificial anterior chamber , a second cut was performed in both corneas using a 130 m microkeratome head . at this point , faint radial marks could still be seen in the periphery of both corneal lamellae , as could be better visible after trypan blue stain . videos 1 and 2 illustrate the tissue preparation in the described cases . as a large optical zone of at least 6.5 mm was found to be free from any scarring in both cases , the tissue was further prepared and transplanted as per standard technique . the first recipient was a 40 year old with a failed penetrating keratoplasty ( pk ) graft . at the last follow - up visit ( 2.5 years postoperatively ) , visual acuity was 20/25 with a spectacle correction of + 2.5 sphere 4.5 cylinder at 50. endothelial cell density was 1715 cells / mm ( i.e. , a loss rate of 34% ) . anterior segment optical coherence tomography ( as - oct ) demonstrated a graft of regular shape with a central thickness of 88 m , and a thickness of 90 m , 91 m , 93 m and 90 m , 1500 m temporally , nasally inferiorly and superiorly from the center . the second recipient was a 62-year - old female with fuchs ' dystrophy and cataract . she underwent ut - dsaek combined with phacoemulsification and pciol insertion . at the last follow - up examination ( also 2.5 years postoperatively ) , visual acuity was 20/25 with a spectacle correction of + 2 sphere 1.75 cylinder at 30. endothelial cell density was 1170 cells / mm ( i.e. , a loss rate of 57% ) . the cornea and graft - recipient interface appeared clear . as - oct showed a regularly shaped graft with a central thickness of 87 m , and a thickness of 82 m temporally , 110 m nasally , 119 m inferiorly , and 112 m , 1500 m superiorly from the center . phillips et al . have reported the use of two post - rk grafts for dsaek as a part of a case series of dsaek utilizing corneas with various anterior stromal pathologies . their results compared well with a control group of matched regular donors . in a reply to this work , khalifa et al . prepared two post - rk grafts using a 350 m head obtaining residual stromal bed of 120 and 132 m . in this report , radial endothelial scars were found underlying radial stromal incisions and scanning electron microscopy demonstrated epithelial cell presence in the stromal interface of the rk incisions in both grafts . in our cases , incision lines could still be seen after the second cut , but they could not be identified postoperatively , and we doubt whether they had any effect on the patient 's quality of vision . while we had no means of excluding the presence of epithelial cells in the implanted graft , it has been reported before that epithelial cells may be implanted into up to a third of venting incisions commonly performed for the evacuation of interface fluid in dsaek . theoretically , as corneal radial incisions are at risk for traumatic dehiscence even years after surgery , post - rk donor tissue may split apart under the high pressure induced by microkeratome - assisted dissection and/or get entangled inside the microkeratome head . in addition , the blade might be driven into a false route by one of the radial incisions , thus creating a different and deeper plane of dissection . descemet 's membrane endothelial keratoplasty ( dmek ) and pre - descemet 's endothelial keratoplasty ( pdek ) are techniques in which the stroma is not used for transplantation . as the post - rk grafts have sustained the pressure of the microkeratome - assisted dissection , we believe that they would also sustain the mechanical stress caused by peeling descemet 's membrane in dmek , and the pneumatic dissection done in pdek . in the latter technique , the radial incisions can theoretically enable air to escape superficially during the dissection , making the procedure more challenging . post - rk grafts prepared using these techniques will probably be no different from usual grafts in terms of the optical quality of the interface and the risk of epithelial ingrowth . after preparation for ut - dsaek , tissue with preexisting post - rk incisions has a scar - free optical zone large enough to be used for transplantation . the use of double - pass ut - dsaek technique enables the removal of all but the very deep stroma adjacent descemet 's membrane , thus minimizing the possibility of leaving in place clinically significant residual rk scars at the edge of the optical zone . recently , introduced microkeratome systems for the dissection of single - cut ultrathin grafts , as well as techniques such as dmek , and pre - descemet 's membrane endothelial keratoplasty ( pdek ) may prove equally efficient for the dissection of tissue with anterior stromal scars .	this is a report of two cases in which tissue that had undergone radial keratotomy ( rk ) was utilized for double - pass ultrathin descemet stripping automated endothelial keratoplasty ( ut - dsaek ) . postoperative slit - lamp examination , visual acuity , anterior segment optical coherence tomography , and specular microscopy were available 30 months after surgery . both corneas from a donor , who had undergone rk several years before his demise , and were otherwise suitable for endothelial keratoplasty were prepared for ut - dsaek using double - pass dissection using first a 300 mm microkeratome head and then a 130m microkeratome head ( altk system , moria , antony , france ) . after the second cut , the tissue was punched to 9.0 mm and transplanted in two eyes with endothelial decompensation according to standard technique . as early as 3 months after surgery , both patients had 20/25 best - corrected visual acuity , which remained stable for the following 27 months . postoperative endothelial cell loss was 34% and 57% at 2.5 years . in conclusion , post - rk donor tissue can be used for ut - dsaek .
You are an expert at summarizing long articles. Proceed to summarize the following text: we examined the inpatient hospital discharge data set from the california office of statewide health planning and development for 19972002 ( 1 ) , which contains inpatient discharge diagnoses from all nonfederal hospitals in california . we abstracted all records with any international classification of diseases , 9th edition ( icd-9 ) , code for coccidioidomycosis ( 114114.5 and 114.9 , with 114.2 representing coccidioidal meningitis ) and defined each record as a discrete hospitalization . from each record , we extracted year of admission , county of residence , age , race , ethnicity , sex , presence of hiv infection ( icd-9 codes 042 or v08 ) , pregnancy status ( icd9 codes v22-v23.9 or 630676.9 ) , vital status at discharge , and record locator number ( rln ) ( available for 19972000 only ) . we obtained population estimates from california department of finance by county of residence , age , racial - ethnic group , and sex ( 2,3 ) . numbers of aids cases and estimates of the population with hiv were obtained from the california department of health services ( 4 ) . we calculated the frequency of hospitalization by county , age group , racial - ethnic group , sex , pregnancy status , and immune status . incidence of initial hospitalization for severe coccidioidomycosis was estimated by using each earliest hospitalization with a given rln during the years 19972000 for which rln was available , and rates of repeat hospitalization were calculated on the basis of subsequent hospitalizations with the same rln . mortality rate was calculated as crude incidence rate for death among those hospitalized for coccidioidomycosis with unique rlns . bivariate relative risks ( rrs ) were calculated for the effect of pregnancy status and immune status on the frequency of hospitalization . multivariate poisson regression was used to estimate rr of year , county , age , racial - ethnic category , and sex on the frequency of hospitalization for coccidioidomcyosis . among those hospitalized , multivariate logistic regression was used to evaluate odds ratios ( ors ) for race , ethnicity , and sex on rehospitalization and meningitis . records for which data were missing for age , sex , race / ethnicity , or county were not included in multivariate analysis . records that lacked data for county were not included in crude incidence calculations by county . for crude incidence calculations by age , race / ethnicity , and sex , cases for which category was unknown were redistributed among known categories in the same proportion as they occurred among those with known category . this study was approved by the committee on human research , university of california , san francisco . from 1997 through 2002 , of 7,457 inpatient hospitalizations associated with coccidioidomycosis in nonfederal institutions in california , 3,707 ( 50% ) had a principal diagnosis of coccidioidomycosis , 1,605 ( 22% ) had a first additional diagnosis of coccidioidomycosis , and 896 ( 12% ) had a second additional diagnosis of coccidioidomycosis . frequency of hospitalization for coccidioidomycosis was 3.7 per 100,000 residents per year ( table 1 ) . kern , los angeles , and san diego counties had highest total number of hospitalizations and together accounted for 47% of all hospitalizations . there were 417 deaths , resulting in a mortality rate of 2.1 per 1 million california residents annually . * per 100,000 residents per year . for years for which an rln was available ( 19972000 ) , 63% of hospitalizations were initial and 37% were repeat . the incidence of initial hospitalization for severe coccidioidomycosis was 2.4 per 100,000 residents , and 8.9% of persons initially hospitalized with coccidioidomycosis died in the initial or a subsequent hospitalization . pregnant women were more likely than nonpregnant women to be hospitalized with a code for coccidioidomycosis ( rr 2.5 , 95% confidence interval [ ci ] 2.033.08 ) . compared with all californians , rr for hospitalization for persons with aids was 34.5 ( ci 31.038.4 ) and for persons with hiv was 13.9 ( ci 12.515.5 ) . when only records with rlns were examined , 24% of persons admitted with coccidioidomycosis who had hiv coinfection died during hospitalization , compared with 8.2% of persons admitted with coccidioidomycosis who did not have hiv coinfection ( p<0.005 by analysis ) . in multivariate poisson regression that used california department of finance population estimates , older age , black race / ethnicity , and male sex were associated with increased risk for hospitalization . native american and hispanic race / ethnicity was protective for this outcome ( see reference groups in table 2 ) . asian - pacific islander race / ethnicity was protective on a statewide level but was a risk factor in the 4 counties with the highest incidence . crude incidence per 100,000 residents in kern , tulare , kings , and san luis opispo counties . rr by multivariate poisson model controlling for year , county , age , race , and sex . for the years 19971999 , racial - ethnic categories were white , hispanic , black , native american , and asian - pacific islander . for the years 20002002 , racial - ethnic categories were white , hispanic , black , native american , asian , pacific islander , and multirace . the population of multirace represented 1% of populations relevant to the study and was not included in the analysis . california department of finance population estimates from 20002002 for asians and pacific islanders were combined into a single category , asian - pacific islander , to match coding of the office of statewide health planning and development database . all hispanics in the department of finance data were assumed to be of white race . to estimate a denominator for the pregnant population , we estimated the total person - years of pregnancy for each county in california in the following manner . the total number of live births was multiplied by 0.75 ( to approximate 9 mo of pregnancy ) and added to the total number of fetal deaths , multiplied by 0.56 ( to estimate a gestation of 30 weeks ) . this sum was finally added to the total number of abortions , multiplied by 0.19 ( to estimate a gestation of 10 weeks ) . estimates of live births and fetal deaths were obtained from the center for health statistics birth rate tables ( 5 ) . annual number of abortions was estimated from federal abortion surveillance data from 1997 ( 6 ) . logistic regression showed that black persons hospitalized with a diagnosis of coccidioidomycosis had increased risk for rehospitalization ( or 2.08 , ci 1.592.73 ) compared with white persons , controlling for year , county , age , and sex . controlling for the same confounders , asian - pacific islanders hospitalized with coccidioidomycosis had increased risk for meningitis ( or 1.63 , ci 1.022.63 ) ; hispanic race / ethnicity was protective against meningitis ( or 0.63 , ci 0.480.84 ) . persons with aids have both a very high frequency of hospitalization for coccidioidomycosis and a very high proportion of deaths from the disease . persons with aids in the 4 counties with the highest frequency of coccidioidomycosis ( kern , tulare , kings , and san luis obispo ) have a frequency of hospitalization for coccidioidomycosis that approaches 1% per year . this study confirms several well - known risk factors for coccidioidomycosis , including black race , middle age and older age , and pregnancy ( 7 ) . we did not find evidence supporting previous reports of hispanic and asian racial / ethnic background as a risk factor for coccidioidomycosis hospitalization statewide ( 8,9 ) . first , we included all hospitalizations that contained any discharge diagnosis of coccidioidomycosis ; 73% of our included hospitalizations coded coccidioidomycosis as principal or first additional diagnosis . among those hospitalizations for which coccidioidomycosis was not principal or first additional diagnosis , it is unclear whether other principal diagnoses ( such as aids ) would have caused hospitalization in the absence of coccidioidomycosis . second , we have no information about persons hospitalized in federal hospitals , which could lead to an underestimation of effects of disease or bias of results regarding disease distribution . however , because only 19 of 570 hospitals licensed in california in 1999 were federal , the bias of omitting federal hospitals is likely to be small ( 10 ) . third , we had information on duplicate hospitalizations for 19972000 only , and some persons either may have had a repeat hospitalization subsequently or may have been hospitalized for coccidioidomycosis before this period . the increased risk we found for asian - pacific islanders in the 4 counties with highest incidence is not consistent with risk statewide , and this might be partly explained by differential risk by subcategory of race / ethnicity . however , differential exposure patterns based on employment or recreation might also contribute to the discrepancy . the risk for severe disease and death attributable to coccidioidomycosis in california is of a magnitude similar to the risk from varicella in the state before the varicella vaccine ( 11,12 ) . furthermore , a substantially higher risk exists for many subgroups , including residents of high - incidence counties , middle - aged and older persons , pregnant women , black residents , and those with hiv infection . recent progress in vaccine development has raised the possibility of a way to better control this disease ( 13 ) . the development of new therapeutic and preventive modalities could do much for the population at risk and should be considered a priority for healthcare research . our data offer a good overall estimate of the incidence of severe disease for the state , but to assess the success of a new vaccine , further studies will need to determine initial hospitalization and primary cause of hospitalization with greater specificity .	we used hospital discharge data to estimate incidence and distribution of coccidioidomycosis - associated hospitalizations in california . for 19972002 , the average annual rate of hospitalization was 3.67 per 100,000 population . county of residence , older age , black race , male sex , hiv infection , and pregnancy were strongly associated with increased risk for hospitalization .
You are an expert at summarizing long articles. Proceed to summarize the following text: cardiovascular disease ( cvd ) is known to be the leading cause of mortality worldwide resulting in 17.1 million deaths , with 13 million deaths attributed to coronary heart disease and stroke alone ; of these , more than 80% of deaths has occurred in low- to middle - income countries . it is projected that by the year 2030 , cvd - related mortality will rise up to 25 million , mainly from heart disease and stroke . similarly , global statistics on diabetes are also alarming , as the disease is rapidly increasing worldwide and future projections of its burden are reported to rise particularly in pakistan and other developing countries [ 2 , 3 ] . it is evident that diabetes is an independent risk factor for cvd , and people with diabetes are three to four times more likely to develop cvd [ 4 , 5 ] . the development of cvd in diabetic patients is a cause of concern , as it is a major reason for hospitalization , premature morbidity , disability , and mortality [ 6 , 7 ] which lead to an increased cost of care . it is reported that over 70% of the cost attributed to diabetes care is associated with its cardiovascular complications . lifestyle behaviors such as lack of exercise , psychosocial factors , and exposure to smoking further increase the risk of developing cvd [ 812 ] and are also highly prevalent in less developed countries [ 13 , 14 ] . on the other hand , prevention and modification of these unhealthy behaviors can lead to reduction in cvd and resultant mortality [ 13 , 15 ] . literature reveals that at least 80% of cvd ( coronary heart disease and cerebrovascular diseases ) could potentially be avoided by adopting healthy lifestyle [ 1 , 15 ] . the clustering of such unhealthy lifestyle practices has very important implications for both public health practitioners as well as for clinicians . it is well known that the risk of developing cvd multiplies many folds when related lifestyle risk factors coexist as compared to their individual risk . numerous studies have identified the clustering pattern of cvd - related factors among various groups of population [ 16 , 17 ] . a study from japan reported the clustering of cardiovascular risk factors , but the study mainly focused on biological risk factors such as glucose intolerance , dyslipidemia , and hyperuricemia . recently , khuwaja and kadir reported the clustering of lifestyle risk factors in pakistan , but the study participants did not include a high - risk population for cvd such as patients having diabetes . we therefore conducted this study among diabetic patients to assess the prevalence and clustering pattern of cvd - related lifestyle risk factors and their associations with cvd . this multicentre cross - sectional study was conducted in four outpatient clinics in karachi , the largest city and economic hub of pakistan with a population of over 16 million , which represent all ethnicities and socioeconomically diverse populations in the country . an attempt to capture a wide spectrum of clinical and socioeconomic factors was made by enrolling study participants from four different clinics including family medicine , internal medicine , specific diabetes care , and endocrinology clinics representing both public and private sectors . all patients having type 2 diabetes visiting their respective clinics for follow - up visits were consecutively recruited till the final sample size was achieved . we considered patients having type 2 diabetes who were labeled as type 2 diabetic patients by their treating physician and recorded in their medical files . however , patients suffering from type 1 diabetes or women with gestational diabetes were excluded . in this study , we were not expecting any adverse event to study participants ; even so , prior to enroll in the study , consent was obtained from all the study participants . participants were assured about the confidentiality and anonymity of their information , and all efforts were made to ensure privacy . after reviewing the study protocol and questionnaire , permission was granted from all the concerned clinics to conduct this study in their clinics . face - to - face interviews were conducted to get the required information , and each interview took about 20 minutes . pretested structured questionnaire was used to obtain information about sociodemographic ( gender , age , and education level ) and lifestyle risk factors ( level of physical activity , psychosocial history , smoking status , and exposure to passive smoking ) . the questionnaire used to assess the presence of anxiety and depression was hospital anxiety and depression scale ( hads ) . this tool is validated in national language of pakistan ( urdu ) and was used extensively to study anxiety and depression among various outpatient as well as inpatient settings . one of its main features is that the items , which could relegate to problems such as insomnia , unemployment , eating disorders , headache , and fatigue , have been excluded , in order to avoid false positive cases among persons with somatic diseases . the hads - d ( depression ) covers mostly anhedonia and loss of interest , which form the core of depression symptoms , whereas hads - a ( anxiety ) covers mainly the fields of tension and worry . the hads questionnaire consists of 14 items ( sentences - questions ) with answers in four grades on a likert scale . a score up to 8 indicates that the individual is free of symptoms , and a score beyond 8 defined that the symptomatology of anxiety or depression is present . the variables which included blood pressure , glycemic levels , lipid profile , height , and weight were noted / verified from patients ' medical records . body mass index ( bmi ) was calculated as weight in kilograms divided by height in meter squares . study participants were classified as obese if their bmi > 25 kg / m . hypercholesterolaemia was defined according to atp iii criteria ( 200 mg / dl ) . individuals were classified as hypertensive if they were previously diagnosed and currently on antihypertensive medication . however , participants in whom elevated levels of blood pressure were discovered for first time at the day of interview ( indexed visit ) were not included in hypertensive category , as it is recommended to have at least two elevated blood pressure readings at two different times . cardiovascular disease ( coronary artery disease and/or stroke ) was considered to exist if there was a history of coronary heart disease ( angina , myocardial infarction ) verified through medical records of a prior episode and confirmed by work - up including electrocardiography , echocardiography , and exercise treadmill test , while having stroke was solely labeled on the basis of patient 's history along with file note verification of treating physician . cvd - related lifestyle factors such as physical inactivity were defined as not doing moderate to vigorous activity for 30 minutes or more , at least 4 days in a week , and participants falling in this group were categorized as physically inactive . passive smoker for this study was defined as any person who has been exposed to second - hand smoke for at least 30 minutes in a day , for at least 5 days of the week either at home and or at work place , for last six months , and more . to analyze the defined objectives of this study , the initial required sample size was 895 study participants . however , we approached 1000 consecutively eligible type 2 diabetic patients from the four clinics to participate in the study . in total , 87 patients refused to participate in the study , while the required information was incomplete and missing for 26 patients . all the data was collected , cleaned , and validated by medical graduates specifically trained for this task . the data was analyzed using the statistical package for social sciences ( spss ) version 19 . mean and standard deviations ( sd ) for continuous variables and percentages for categorical variables and lifestyle factors were calculated separately . clustering of lifestyle factors was studied as none , one , and two or three . in model i , multivariable analysis using multiple logistic regressions was carried out to evaluate the association of combined effect of lifestyle factors with cvd among patients with type 2 diabetes , while in model ii , the association of clustering pattern of lifestyle factors with cvd was assessed . age , sex , educational status , and body mass index are well known confounders for lifestyle factors and cvd [ 7 , 13 ] ; we therefore adjusted these variables in both models to evaluate the independent association of cvd with lifestyle risk factors and their clustering pattern . cross - tabulation and chi - square test of significance was applied to identify the association of lifestyle factors and clustering pattern by gender , age , and educational status . all smokers in this study were men ; hence , we did not include it in the final model . baseline characteristics of the study participants are presented in table 1 . in all , 43.6% of the study participants were up to the age of 50 years , and there was a preponderance of females ( 57.4% ) . about half of the patients reported family history ( siblings , parents , and grandparents ) of diabetes . in all , 41% of the diabetic patients were also concurrently diagnosed to have hypertension ; however , overall mean systolic and diastolic blood pressure levels of study participants were substantially high . there were also higher mean values of lipid profile ( total cholesterol , low - density lipoproteins , and triglycerides ) and body mass index . of the study participants were taking oral hypoglycemic agents , while one - third of the patients were also taking low - dose aspirin on regular basis . in table 2 , proportion distribution and clustering pattern of lifestyle factors and their associations with cvd are described . amongst all , 30.3% ( 95% ci = 27.233.2 ) of the diabetic patients had cvd . over 65% of participants were physically inactive , 71.4% had anxiety and/or depression , and 40.1% were exposed to passive smoking . in the univariate analysis , all the three studied lifestyle factors and their clustering pattern were found to be significantly associated with cvd ( physical inactivity : crude or = 1.7 , 95% ci = 1.22.3 ; psychosocial factors : crude or = 2.2 , 95% ci = 1.63.2 ; passive smoking exposure : crude or = 1.7 , 95% ci = 1.32.3 ; clustering of any two or three lifestyle factors : crude or = 6.1 , 95% ci = 2.713.7 ) . however , the confounders ( age , sex , educational status , and body mass index ) reported in the literature were not fulfilling the criteria of being a confounding factor in this study except age which was confounded by the exposures of physical inactivity and clustering of lifestyle factors . in model i of the final multivariable analysis ( table 2 ) , the odds of having cvd were higher among those who were physically inactive ( adjusted or = 1.6 ; 95% ci = 1.22.3 ) and had anxiety and/or depression ( adjusted or = 1.9 ; 95% ci = 1.42.8 ) , and among those exposed to passive smoking ( adjusted or = 1.7 ; 95% ci = 1.22.3 ) while adjusted for age , sex , educational status , and body mass index . in another model , the odds of having cvd increased with the clustering of lifestyle factors : for having any one factor ( adjusted or = 2.7 ; 95% ci = 1.26.2 ) and for clustering of two or three factors ( adjusted or = 6.1 ; 95% ci = 2.713.7 ) after adjusting for the similar factors described in the first model . the association of sociodemographic characteristics with cvd - related lifestyle factors and their clustering pattern are presented in table 3 . in comparison to males , similarly those with no / less education were more inactive compared to their counterparts having education of more than five years ( 77.7% versus 53.6% ; p < 0.001 ) . significant majority of study participants having anxiety and/or depression were females ( 74.5% ) , elderly ( 77.0% ) , and having no / less education ( 75.6% ) compared to their counterparts . clustering of two or three cvd - related lifestyle factors was significantly higher among females compared to males ( 69.9% versus 55.3% ; p < 0.001 ) and elderly compared to younger patients ( 68.1% versus 58.0% ; p = 0.004 ) . clustering of these factors was also higher among study participants having no / less education compared to those with more education ( 71.8% versus 56.2% ; p < 0.001 ) . it is well known that modifiable lifestyle factors such as physical inactivity , psychosocial stress , and smoking result in an increased risk of cvd , while control of the same substantially decreases the development of cvd [ 1 , 15 ] . the results of our study are consistent with those of previous studies and highlight the importance of adequate control of these lifestyle factors , particularly among high - risk people like diabetics , to prevent the development and progression of cvd and its consequences . in a recently conducted study on healthy canadian adults , only 10% of the study population was found to be physically inactive , as opposed to 60% healthy adults in pakistan . the presence of such high levels of physical inactivity is particularly harmful among people with diabetes , as the presence of diabetes itself confers increased cardiovascular risk , and the coexistence of physical inactivity further amplifies this risk . the high prevalence of physical inactivity in an earlier study from pakistan and in our study may be attributed to the lack of awareness regarding the role and benefits of exercise in preventing cvd as highlighted from the earlier studies in pakistan . furthermore , watching television and playing computer games have considerably risen in this part of the world , along with unavailability of safe playgrounds and walking tracks rendering majority of the population physically inactive . furthermore , the burden of psychosocial factors which predispose to anxiety and depression is also reported to be more prevalent in developing countries . by using hads scale , our study showed that more than 70% of the study participants were suffering from anxiety and/or depression . however , results of a study conducted in the united kingdom using the same scale revealed substantially lesser proportion of these disorders among diabetic patients . this sharp difference in prevalence of mood disorders may be attributed to the high levels of poverty , poor socioeconomic conditions , and scarce health care facilities and resources in developing countries . it is evident that smoking is a strong risk factor for developing cvd in general and among diabetics in particular . it is also reported that passive smoking also increases the risk of chronic diseases including cvd [ 8 , 10 ] . a community - based survey recently reported that about half of the study participants in pakistan were exposed to passive smoking . using the same definition of passive smoking in our study , over one - third of the diabetic population this high proportion of exposure reflects the lack of awareness about the hazards of passive smoking among the general population . in pakistan , in spite of laws and constitutions to restrict smoking at public places , people freely smoke in public transport , shopping malls , restaurants , and even many of the work places and offices . it is documented that , in pakistan , up to 34% adults smoke cigarettes . however , in our study , 13% of the study participants were reported as being current smokers and all of them were males . this lower prevalence can be attributed to the fact that in this study , interviews were conducted in the presence of patients ' family members / attendants , raising the possibility that majority of the participants did not admit that they smoked , as it is viewed as a socially unacceptable habit in this part of the world . another possible explanation for the lower prevalence of smoking may be due to the fact that patients might have given up smoking after developing diabetes and its complication . furthermore , previous work reported was done only in men , and it is well reported that when compared to women , smoking among men is more prevalent in both developed as well as in developing countries [ 13 , 26 ] . recently , data collected from a multisite five asian countries survey revealed that a substantial proportion of study population had clustering of lifestyle risk factors , and similar findings were also reported in a community - based study from urban pakistan . in our study , a very small proportion of the participants were found to have none of cvd - related lifestyle factors , while one - fourth had one of these risks , and majority had clustering of two or three factors . this pattern of unhealthy lifestyle clustering reflects the possibility of poor awareness and harmful attitude and practices regarding healthy behaviors . results of this study also endorse the existing literature that physical inactivity , adverse psychosocial factors , and exposure to smoking are strongly associated with cvd [ 1 , 15 ] , and clustering of these factors enhances the risk further [ 13 , 28 ] . with the increase in prevalence of cvd - related modifiable lifestyle factors among high - risk population like diabetics in developing countries , identification of specific target groups within such population is important in order to introduce comprehensive and integrated preventive strategies aimed to reduce cvd . though literature from the western world has identified females to have a lower risk of developing cvd , evidence from south asia reveals that both men and women bear an equal risk of developing these diseases . furthermore , a study from pakistan reports women to have a greater risk of developing cvd than men . the results of our study reveal that all the cvd - related lifestyle factors and their clustering are significantly higher among women . hence , the female population in our study was found to be at higher risk of developing cvd owing to increased prevalence of unhealthy lifestyle behaviors . the presence of increased cvd - related risk factors in women can be attributed to the fact that up to 50% males have been reported to smoke at home , thus exposing the females to passive smoking as well . furthermore , the social status of women in our patriarchal culture leads to increased prevalence of psychosocial risk factors among them . moreover , cultural restrictions limit females to going outside their homes without an accompanying male family member resulting in decreased likelihood for joining sport physical and exercise centers and gymnasiums . it is well known that increasing age is associated with increased cardiovascular risk due to acceleration of atherosclerosis and other cardiovascular risk factors . this study showed that up to 80% of the older population was found to have anxiety and/or depression . this increased psychosocial suffering may be attributed to the presence of more chronic illnesses and cvd as well as challenging life situations such as being more isolated and dependent . clustering of two or more lifestyle risk factors was also found to be present in up to 70% of the elderly patients , providing further explanation for increased cardiovascular risk in this age group . these results are in accordance with results of various studies conducted elsewhere [ 16 , 27 ] . it has been reported that higher level of education has a protective role with regard to healthy lifestyle and behaviors [ 33 , 34 ] as it leads to greater awareness and improved conscience regarding health . the results of our study also suggest low prevalence of cvd - related factors such as physical inactivity and anxiety and/or depression among people having more years of education . similarly , clustering of these risk factors was in lesser proportion among the educated participants , reinforcing the fact that people with less education have an increased risk of unhealthy lifestyle practices . the overall metabolic control ( blood pressure levels , glycemic control , lipid levels , and body mass index ) of our study participants was poor . it is well reported that the management and control of diabetes is a real challenge for health care providers as well as people having diabetes [ 7 , 22 ] . many possible reasons and explanations exist for poor control of disease , like lack of knowledge about the disease among diabetic patients , poor quality of care provided by treating physicians , and excessive cost for the management of diabetes [ 6 , 36 ] which many patients can not afford in resource - constrained countries . since this study employs a cross - sectional study design , temporal relation between cvd and its lifestyle factors could not be identified . coronary artery disease is often silent with regards to symptoms in diabetic subjects , and therefore noninvasive studies ( such as myocardial scintigraphy and dobutamine stress echocardiography ) should have been performed for a thorough evaluation of the cardiac status . however , due to cost and resource limits , we have not evaluated the cardiac status using these tests . similarly , hba1c , another comparatively costly test , is recommended to evaluate the overall glycemic control , but it was only reported in 285 patients . therefore , we can not comment about the overall glycemic control of study participants during the period of time . all the smokers in this study were male ; hence , this important factor was not included in the final analysis . we did not inquire about the dietary habits of study participants which is an imperative lifestyle factor for cvd . all the study centers were from one metropolitan city ; therefore , it may not be possible to generalize the findings to the rural population that might have different behaviors . furthermore , being a cross - sectional study , we can not assess the impact of successful medical treatment on the occurrence of cvd . age , sex , educational status , and body mass index are well known confounders for lifestyle factors with cvd [ 7 , 13 , 37 ] ; however , in this study except for the age , other established confounders were not found to be associated with cvd , lifestyle risk factors , and their clustering pattern . this multicenter study highlights very high prevalence and clustering of cvd - related lifestyle factors , particularly physical inactivity , anxiety , depression , and exposure to passive smoking . the presence of such a high burden of these factors among diabetic patients is a cause of concern and requires urgent interventions in order to prevent and control cvd . these interventions should be based on a comprehensive and integrated approach covering all of these lifestyle factors rather than any single factor to anticipate their cumulative effects . we recommend that health care providers should provide awareness and education regarding cvd risk factors and their prevention to patients and their families / caregivers . furthermore , safe walking tracks , playgrounds , and relaxation avenues should also be made available to allow more people to engage in physical activities and relaxation programs . further research is suggested to explore this very important avenue in more detail and to design and test interventions accordingly .	background . we evaluated the prevalence and clustering pattern of cardiovascular disease ( cvd ) related lifestyle factors and their association with cvd among patients with type 2 diabetes . we also examined the association of these factors with various socio - demographic characteristics . methods . a total of 1000 patients with type 2 diabetes were interviewed in a cross - sectional , multi - center study in out - patient clinics in karachi , pakistan . results . in this study 30.3% study participants had cvd . majority of the patients were physically inactive and had adverse psychosocial factors . forty percent of the study participants were exposed to passive smoking while 12.7% were current smokers . only 8.8% of study subjects had none of the studied lifestyle factor , 27.5% had one , while 63.7% had two or three factors . cvds were independently associated with physical inactivity , adverse psychosocial factors , passive smoking and clustering of two or three lifestyle factors . physical inactivity was more prevalent among females and patients with no / less education . proportion of adverse psychosocial factors were higher among females , elders and patients with no / less education . clustering of these lifestyle factors was significantly higher among females , elderly and no / less educated patients . conclusion . these results suggest the need of comprehensive and integrated interventions to reduce the prevalence of lifestyle factors .
You are an expert at summarizing long articles. Proceed to summarize the following text: parasites : blood infected with b. bovis ( shannxian ) , a kind gift from the lanzhou veterinary research institute , was inoculated into a splenectomized cattle immunosuppressed by dexamethasone injection . when parasitemia reached 5% , the animal was bled and the infected blood was cryopreserved in liquid nitrogen . the animal experiments in this research were approved by gansu provincial science and technology department in china and in accordance with the animal house of lanzhou institute of husbandry and veterinary pharmaceutical science instructions . rna extraction and cdna synthesis : total rna was extracted from purified merozoites using the trizol reagent ( invitrogen , carlsbad , ca , u.s.a . ) and treated with rnase - free dnasei ( takara , otsu , japan ) to remove possible contaminating dna . measurement of rna concentration was conducted at od 260 nm on a spectrophotometer ( thermo , hudson , nh , u.s.a . ) . the cdna was prepared from approximately 5 g of the total rna using the m - mlv first - strand synthesis system for qrt - pcr ( invitrogen ) according to the manufacturer s instructions . cloning and bioinformatic analysis of bbdxs gene : primers specific for b. bovis dxs were designed based the b. bovis t2bo dxs(genbank accession no . the open reading frame ( orf ) of dxs was amplified by pcr using primers with bamhi and hindiii restriction sites ( underlined ) , bbdxs - f ( ggtcggatccatggtgctgatgttaccccttgt ) and bbdxs - r ( gtgcaagctttcatgacgccaggaactgcc ) . the pcr conditions were as follows : initial denaturation at 94c for 5 min , followed by 30 amplification cycles ( 94c for 45 sec , 68c for 45 sec and 72c for 2 min ) and a final extension step at 72c for 10 min . the pcr products were purified with the dna purification kit ( takara ) and subcloned into pgem - t easy vector ( promega , madison , wi , u.s.a . ) . ( shanghai , china ) . functional domains , enzyme active sites and secondary structures of the deduced proteins were analyzed using the blast search tools . the characteristics of the deduced proteins were compared with those of other dxs homologs by multiple amino acid alignment analysis , and the dxs amino acid sequences of the other species were obtained from the genbank database . alignment of all the homologous peptides was carried out using clustal omega ( http://www.ebi.ac.uk/tools/msa/clustalo/ ) software . expression and purification of rbbdxs protein : the positive clones plasmids were digested with restriction enzymes bamh i and hind iii and then inserted into a similarly digested pet-30a expression plasmid with his - tag ( clontech , otsu , japan ) . the plasmid was transformed into e. coli bl21 ( de3 ) , and the transformed colony was cultured in a lysogeny broth ( lb ) medium containing 50 g / ml kanamycin sodium at 37c . when the optical density at 600 nm reached 0.8 , expression of the recombinant fusion protein was induced by addition of 1 mm isopropyl b - d - thiogalactopylanoside ( takara ) , followed by incubation for another 12 hr at 20c . the bacteria were harvested by centrifugation and lysed by sonication in buffer containing 50 mm tris - hcl ( ph 8.0 ) , 1 mm edta , 100 mm nacl , 2 mm dl - dithiothreitol , 1 mg / ml lysozyme and 0.5% triton x-100 . the recombinant fusion protein , his - rbbdxs , was purified using ni - nta affinity chromatography according to the manufacturer s instructions ( ge healthcare , fairfield , ct . u.s.a . ) . the purified protein was analyzed on a 10% resolving gel using sodium dodecyl sulfate polyacrylamide gel electrophoresis ( sds - page ) . the concentration of the purified rbbdxs protein was determined using the bca protein assay ( sangon ) with bovine serum albumin as the standard . production of rabbit anti - rbbdxs anti - serum and identification of native bbdxs enzyme : three- to six - month - old rabbits , from which pre - immune sera were collected before immunizations , were immunized subcutaneously by injection with 2 mg purified rbbdxs protein emulsified with an equal volume of freund s complete adjuvant ( sigma , st . thereafter , three boosters consisting of 1 mg of the same antigen emulsified with freund s incomplete adjuvant ( sigma ) were administered to the rabbit via the same route at days 14 , 21 and 28 . sera were collected 7 days after the last booster and checked for specific antibodies by western blotting . the animal experiments in this research were approved by gansu provincial science and technology department in china and in accordance with the animal house of lanzhou institute of husbandry and veterinary pharmaceutical science instructions . b. bovis lysate was prepared as described previously and separated by 10% sds - page . the native enzyme was identified by western blotting using rabbit anti - rbbdxs serum , the lysate of health bovine erythrocytes and leukocytes as a control . rbbdxs enzyme activity : the rbbdxs enzyme reaction mixtures contained 120 mm tris - hcl ph 7.5 , 10 mm mgcl2 , 5 mm 2-mercaptoethanol , 2 mm thiamin diphosphate , various concentrations of pyruvate - na and d , l - glyceraldehyde 3-phosphate ( d , l - gap ) or dihydroxyacetone ( dhap ) and rbbdxs in a final volume of 100 l . after incubation at 37c , reactions were stopped by heating at 80c for 5 min , and 5-l aliquots were separated on silica gel with n - propanol / ethylacetate / h2o 5:1:3 ( v / v / v ) . doxp formation was monitored under 365 nm excitation after reaction with a 10% ethylenediamine sulfate solution for 5 min at 100c . for the determination of kinetic parameters , the concentrations of the substrates varied , and kinetic parameter values were calculated with graphpad prism v 5 software ( san diego , ca , u.s.a . ) . the final enzymatic product doxp was identified and measured by lc - ms / ms . for lc - ms / ms analysis , we used a hypersil ods 3 m 4.6 100 mm column , coupled with an agilent 6410a triple - quadrupole mass spectrometer ( agilent technologies , santa clara , ca , u.s.a . ) with an electrospray ionization ( esi ) source interface operated in the negative - ion scan mode . the ions monitored were doxp m / z=214.11 , [ m - h ] 213 . the capillary potential of the ms was + 4,000 v , the gas temperature was 350c , the gas flow rate was 10 l min , the nebulizer pressure was 30 psi , and the dwell time was 200 ms . all assays for the calculation of km values were carried out at 37c and in triplicate . cloning and bioinformatic analysis of b. bovis dxs enzyme : among these enzymes involved in mep pathway , we focused on dxs , which catalyzed the first step of the mep pathway , making this enzyme a putative drug target . this orf sequence ( genbank i d : kf694747 ) was 2,061 bp and encoded a protein of 686 amino acids with a calculated molecular mass of 75 kda and an isoelectric point of 6.93 ( genbank i d : kf694747 ) . therefore , we performed blastp analysis of translated bbdxs polypeptide and found that it shares significant homology with the b. bovis t2bo dxs enzyme ( genbank i d : xm_001611343 ) , having 98% amino acid sequence identity ( e value=0 ) . the predicted secondary structure of bbdxs consisted of thiamine pyrophosphate ( tpp)binding module , a pyrimidine ( pyr ) binding domain and a transketolase c - terminal domain ( fig . 1afig . it consisted of tpp - binding module , pyr binding domain and a transketolase c - terminal domain . ( b ) dxs amino acid sequences were aligned with using the clustal omega program . arabidopsis thaliana ( genbank : np_566686.2 ) , escherichia coli ( genbank : wp_001583256.1 ) and theileria annulata ( genbank : xp_954253.1 ) . ) , each of which bears homology to the equivalent domains in transketolase and the e1 subunit of pyruvate dehydrogenase . these predicted results indicated that the bbdxs belongs to the tpp - dependent superfamily , as the dxs enzyme is highly conserved in plants and bacteria ( fig . residues in the active catalysis domain are highly conserved among the dxs enzymes , and weak sequence homology has also been identified with transketolase and the pyruvate dehydrogenase e1 subunit . expression and detection of the native of bbdxs enzyme : to complete the dxs enzyme biochemical characterization , the corresponding gene was overexpressed in e. coli and purified by ni - nta affinity chromatography . purified rbbdxs revealed a 78-kda band on 10% sds - page , including an additional 3 kda of the his - tag sequence ( fig . lane 1 , purified recombinant bbdxs fused with his - tag after analysis by sds - page ; ( b ) lane m , molecular size marker . lane 2 and lane 4 , western blot analysis of the purified rbbdxs ; lane 3 and lane 5 , western blot analysis of the lysates of b.bovis ; lane 6 and lane 7 , western blot analysis of the erythrocytes and leukocyte of health bovine , respectively . the first antibody of lane 2 and lane 3 was preimmune sera of rabbit;the first antibody of lane 4 to lane 7 was rabbit anti - rbbdxs anti - serum . ) . furthermore , rabbit anti - rbbdxs enzyme serum reacted with b. bovis lysate to yield a specific band of approximately 75 kda and with the purified rbbdxs to yield a 78-kda band , but not the health bovine erythrocytes and leukocytes . however , serum of non - immunized rabbit did not react with the babesia lysate ( fig . it consisted of tpp - binding module , pyr binding domain and a transketolase c - terminal domain . ( b ) dxs amino acid sequences were aligned with using the clustal omega program . arabidopsis thaliana ( genbank : np_566686.2 ) , escherichia coli ( genbank : wp_001583256.1 ) and theileria annulata ( genbank : xp_954253.1 ) lane 1 , purified recombinant bbdxs fused with his - tag after analysis by sds - page ; ( b ) lane m , molecular size marker . lane 2 and lane 4 , western blot analysis of the purified rbbdxs ; lane 3 and lane 5 , western blot analysis of the lysates of b.bovis ; lane 6 and lane 7 , western blot analysis of the erythrocytes and leukocyte of health bovine , respectively . the first antibody of lane 2 and lane 3 was preimmune sera of rabbit;the first antibody of lane 4 to lane 7 was rabbit anti - rbbdxs anti - serum . rbbdxs enzyme activity : we theorized that the expressed rbbdxs is likely to be an active enzyme because bbdxs cdna encoded an authentic protein . therefore , we examined rbbdxs activity and found that rbbdxs could catalyze the formation of doxp using d , l - gap or dhap as a substrate . this demonstrates that the rbbdxs enzyme may have isomerization activity . when the reaction product was subjected to chromatography with authentic doxp ( sigma ) under the same assay conditions , no formation of doxp after induction of e. coli bl21 ( de3)/pet 30a - dxs with iptg , purified rbbdxs was incubated with na - pyruvate and d , l - glyceraldehyde 3-phosphate or dihydroxyacetone ( dhap ) . in the product mixture separation by tlc , the product doxp was detected under 365 nm uv either pyruvate and dl - gap ( lane3 ) or pyruvate and dhap ( lane4 ) as substrates . after induction of e. coli bl21 ( de3)/pet 30a - dxs with iptg , purified rbbdxs was incubated with na - pyruvate and d , l - glyceraldehyde 3-phosphate or dihydroxyacetone ( dhap ) . in the product mixture separation by tlc , the product doxp was detected under 365 nm uv either pyruvate and dl - gap ( lane3 ) or pyruvate and dhap ( lane4 ) as substrates . the steady - state kinetic parameters for rbbdxs enzyme revealed km values of 380 46 m and 790 52 m for d , l - gap and na - pyruvate , respectively ( fig . 4.effects of substrate concentration on the activities of purified dxs for pyruvate ( a ) and d , l - gap ( b ) . dxs activities were determined in the presence of a fixed concentration of the second substrate by using a coupled assay method . ) . the km values for both pyruvate and d , l - gap were higher than the values obtained for agrobacterium tumefaciens ( 40.3 and 23.2 m for pyruvate and gap , respectively ) and for streptomyces sp . strain ( 65 and 120 m for pyruvate and d - gap , respectively ) . effects of substrate concentration on the activities of purified dxs for pyruvate ( a ) and d , l - gap ( b ) . dxs activities were determined in the presence of a fixed concentration of the second substrate by using a coupled assay method . the mevalonate - independent pathway for isoprenoid biosynthesis , which generates isoprenoid precursors , is a promising chemotherapeutic target , because this pathway is different from the mevalonate pathway in mammals and very important to such pathogens . the reaction , which is catalyzed by dxs enzyme in the mep pathway , is similar to that of transketolases : a c2 unit derived from pyruvate is transferred to an aldose in a thiamine - dependent reaction . although the dxs proteins from other microorganisms and plants have been the subject of characterization and metabolic engineering studies , no characterization has been reported for dxs from b. bovis , which is one of the most important apicomplexan parasites worldwide . therefore , we cloned and expressed the dxs - encoding genes from b. bovis in this study . first , we identified the b. bovis dxs gene that encodes the putative enzyme of the mep pathway , indicating that the pathway is present in this parasite . multiple sequence alignments show that the deduced secondary structure of bbdxs is similar to that of other known enzymes . we found that the bbdxs polypeptide has tpp - binding module , a pyr - binding domain , and a transketolase c - terminal domain as do the already characterized dxs enzymes . we also found that amino acid residues in the catalytic domain of babesia dxs and those of other species are highly conserved . these observations appear to concur with previous reports that the dxs enzyme belongs to the tpp - dependent superfamily and shares homology with the transketolases . in apicomplexa , protein import into the lumen of the apicoplast is faciliated by a bipartite signaling mechanism that requires an n - teriminal signal peptide followed by a transit peptide . however , application of either program to predict apicoplast targeted proteins in related apicomplexans is unreliable due to the low adenine - thymidine content of the genome of plasmodium falciparum used to train pats and plasmoap [ 4 , 20 ] . predicted signal and transit peptides for the b.bovis dxs protein showed that there is no signal peptide and transit peptide using singalp , psort , pats and plasmoap . in this study , we successfully expressed a corresponding rbbdxs in e. coli and produced its anti - serum . antisera against recombinant enzymes have been used to identify and characterize other enzymes of apicomplexan parasites , including babesia species . similarly , our results revealed that rabbit antisera against rbbdxs could identify rbbdxs and native bbdxs in b. bovis , demonstrating that the bbdxs cdna encoded an authentic enzyme that exists in some of the parasite stages . expression of the recombinant dxs enzyme enabled us to study the biochemical properties of the enzyme in vitro , and the determined properties of bbdxs were similar to those reported for dxs of e. coli and r. capsulatus . in conclusion , this study reports for the first time the isolation , cloning and expression of the b. bovis dxs gene , providing a corresponding purified rbbdxs enzyme of approximately 78 kda that is catalytically active . our study also demonstrated the presence of an approximately 75-kda native bbdxs in the parasite lysate by western blotting . we showed that b. bovis has a catalytically active dxs enzyme and characterized the biochemical properties of rbbdxs in vitro . consequently , we propose further research of the active sites of the enzyme and the study of the tertiary structure of the purified enzyme to facilitate the design of anti - babesia agents that can optimally target the active sites of the enzyme .	abstractthe 1-deoxy - d - xylulose-5-phosphate synthase ( dxs ) enzyme has been characterized in other species , but not in the genus babesia , which causes major losses in the livestock industries worldwide . therefore , we isolated , cloned and expressed the wild - type b. bovis dxs cdna in escherichia coli and evaluated its enzymatic activity in vitro . dna sequence analysis revealed an open reading frame of 2061 bp capable of encoding a polypeptide of 686 amino acid residues with a calculated isoelectric point of ph 6.93 and a molecular mass of 75 kda . the expressed soluble recombinant fusion dxs protein was approximately 78 kda , which is similar to the native enzyme identified from the parasite merozoite using anti - rdxs serum . the recombinant fusion dxs enzyme exhibited km values of 380 46 m and 790 52 m for d , l - glyceraldehyde 3-phosphate and pyruvate , respectively . in this work , we present the first cloning , expression and characterization of dxs enzyme from b. bovis .
You are an expert at summarizing long articles. Proceed to summarize the following text: the stimulation of monocytes / macrophages by modified low density lipoprotein ( ldl ) , such as oxidized ldl ( oxldl ) , is an early event in atherosclerosis development . these macrophages accumulate in the subendothelial space and differentiate into foam cells , which contribute to a chronic inflammatory response in the arterial wall and atherosclerotic plaque progression . several pattern recognition receptors are involved in oxldl recognition by macrophages ; cd36 is one of the most studied . m1 or classically activated macrophages are induced by th1 cytokines and exhibit high microbicidal activity and induce inflammation . in contrast , m2 or alternatively activated macrophages are induced by th2 cytokines and contribute to the resolution of inflammation and tissue remodeling . the atherosclerotic plaque provides a complex microenvironment for macrophages , and both populations , m1 and m2 , have been found in human lesions . it has been demonstrated that m1 macrophages are predominant in regions prone to rupture , while m2 macrophages are mostly detected in the adventitia and in stable plaque areas . however , it is not known which role macrophages with such opposing functions play in the progression of atherosclerosis . m2 macrophages express high levels of cd36 and sr - a1 and are thus able to efficiently take up oxldl and are more prone to differentiating into foam cells . macrophages also express receptors for platelet - activating factor ( pafr ) , and our previous work suggested that pafr works in conjunction with cd36 for optimal oxldl uptake and cytokine gene expression . moreover , preferential production of il-10 over il-12 was observed ( submitted article ) . in the present study , we investigated the effect of oxldl on macrophage differentiation , activation , and phenotype and the role played by cd36 and pafr . we found that oxldl increases the expression of alternative activation markers and that both cd36 and pafr are involved . the study was approved by the ethics committee of the institute of biomedical sciences , university of so paulo . plasma was obtained from normolipidemic volunteers and treated with benzamidine ( 2 mm ) , gentamicin ( 0.5% ) , chloramphenicol ( 0.25% ) , phenyl - methyl - sulfonyl - fluoride ( pmsf ) ( 0.5 mm ) , and aprotinin ( 0.1 units / ml ) . ldl ( 1.0191.063 g / ml ) was isolated by sequential ultracentrifugation at 100,000 g at 4c , using a p90at-0132 rotor ( cp70mx ultracentrifuge ; hitachi koki co. , ltd . , ldl was dialyzed at 4c against pbs ( ph 7.4 ) with 1 mm edta , filtered ( 0.22 m ) , and stored at 4c . oxidized ldl ( oxldl ) was obtained by incubation of ldl ( 2 mg / ml ) with 20 m cuso4 for 18 h at 37c . the oxidation of both protocols was terminated by the addition of 0.5 mm edta . the monocytic line thp-1 was cultured in rpmi-1640 medium supplemented with 5% ( v / v ) fetal bovine serum ( fbs ) , 100 u / ml penicillin , 100 g / ml streptomycin , 2 mm l - glutamine , 15 mm hepes , and 11 mm sodium bicarbonate . the differentiation of thp-1 monocytes into macrophages was induced by 150 nm phorbol 12-myristate-13-acetate ( pma ) for 24 h. nonadherent cells were removed by aspiration of the supernatant followed by replacement with fresh medium . male c57bl/6 710 weeks old mice were acquired from the department of immunology animal facility at the university of so paulo and kept in microisolator cages under specific pathogen - free conditions . animal care and research protocols were in accordance with the principles and guidelines adopted by the brazilian college of animal experimentation ( cobea ) and approved by the biomedical sciences institute / usp - ethical committee for animal research ( ceea ) . peritoneal exudate cells were obtained by lavage of the peritoneal cavity 4 days after injection of 1 ml of 3% thioglycolate medium . the fluid lavage was centrifuged ( 100 g , 10 min , 4c ) . the cellular concentration was adjusted to 2 10 cells / ml with rpmi 1640 medium , supplemented with 5% fcs , streptomycin ( 100 g / ml ) , penicillin ( 60 u / ml ) , sodium bicarbonate ( 11 mm ) , l - glutamine ( 2 mm ) , and hepes ( 20 mm ) , referred to hereafter as rpmi / fbs . cells were left to adhere on microplates for 2 h at 37c in a 5% co2 . bone marrow - derived macrophages ( bmdm ) were obtained as previously described by davies and gordon , with minor modifications . in brief , femurs were flushed with dmem medium containing 2 mm l - glutamine , 100 u / ml penicillin g , and 100 mg / ml streptomycin ( all from gibco , long island , ny , usa ) , using a 26 g 1/2 needle . cells were grown in dmem containing 20% l-929 cell - conditioned medium ( lcm ) and 15% heat - inactivated fetal calf serum ( fcs ) , incubated at 37c in 5% co2 . on day 3 , a monolayer of macrophages was scrapped on day 6 ( 96% of the cells were positive for cd11b and f4/80 ) . briefly , culture supernatants were incubated with the griess reagent ( 0.1% naphthylethylenediamine dihydrochloride and 1% sulfanilamide in 2.5% phosphoric acid , v / v ) at room temperature for 10 min . thioglycolate - elicited macrophages were treated with different concentrations of ldl or oxldl for 24 h and then stimulated with lps ( 1 g / ml ) . cells were washed with cold pbs , and lysates were obtained in lysis buffer ( 10% nonidet p-40 , 150 mm nacl , 10 mm tris - hcl , ph 7.6 , and 2 mm 0.1% sds ) supplemented with a protease inhibitor cocktail ( sigma - aldrich , saint louis , mo , usa ) and phosphatase inhibitors ( 10 mm sodium fluoride and 1 mm sodium orthovanadate ) . protein concentrations were determined using the pierce bca protein assay kit ( thermo scientific , rockford , il , usa ) . equal amounts of proteins were separated by 10% sds - page , transferred to a hybond nitrocellulose membrane ( ge healthcare , nj , usa ) , and incubated with rabbit - anti - cox-2 or rabbit - anti - inos ( both from cayman chemical , ann arbor , mi , usa ) , and with mouse anti--actin ( sigma - aldrich , saint louis , mo , usa ) . as secondary antibodies , we used antirabbit igg - hpr ( 1 : 2000 ) and antimouse - hrp ( 1 : 2000 ) ( cell signaling technology , beverly , ma , usa ) . expression was visualized using supersignal west pico chemiluminescent substrate ( thermo scientific , rockford , il , usa ) . the resulting autoradiograms were analyzed with the alphaeasefc software v3.2 beta ( alpha innotech , san leandro , ca , usa ) . the mitochondrial - dependent reduction of methylthiazolyldiphenyl - tetrazolium bromide ( mtt ) into insoluble formazan crystals was used to evaluate cell viability . briefly , 500 mg / ml of mtt in rpmi was added to the cells after treatment . next , a solution of 10% sds in 0.01 m hcl was added to the cells to dissolve the crystals , and the absorbance was measured after 14 h using a dynatech microplate reader at 570 nm . cells were harvested at various time points , and total rna was isolated using the trizol reagent ( invitrogen , carlsbad , ca , usa ) according to the manufacturer 's instructions . cdna was generated from total rna using the revertaid first strand cdna synthesis kit ( thermo scientific fermentas , vilnius , lithuania ) . real - time pcr was performed with the stratagene mxpro3005ptm qpcr systems ( santa clara , ca , usa ) , using sybr green ( sybr green master mix , applied biosystems , warrington , uk ) and specific primers for il-10 , mr , arg-1 , ppar- , inos , il-12p40 , tgf-1 , rantes , and gapdh ( table 1 ) . data are shown as the fold change in expression of the target gene relative to the internal control gene ( gapdh ) . human il-6 , il-8 , il-10 , tgf- , il-1 , and tnf- and murine il-10 and il-12p40 production were determined by elisa ( elisa kits , bd biosciences , san diego , ca , usa ) according to the manufacturer 's specifications . oxidized ldl was obtained according to a previous publication and presented high values for both negative charge and tbars compared to non - modified ldl . human monocytic thp-1 cells were differentiated into macrophages using pma , followed by treatment with oxldl ( 20 g / ml ) ; 24 h later , they were stimulated with lps ( 100 ng / ml ) for an additional 24 h. we found that pretreatment with oxldl decreased the lps - induced production of il-8 and il-6 ( 29% and 34% inhibition , resp . ) , potentiated the production of il-10 ( 2-fold increase ) and tgf- ( 3-fold increase ) , and did not significantly affect tnf- and il-1 production ( figure 1 ) . although pretreatment with oxldl did not significantly affect the lps - induced production of tnf and il-1 , the fact that it decreased il-6 and il-8 and increased il-10 and tgf- production suggests that oxldl stimulates macrophages towards an alternative activation phenotype . it is known that depending on the degree of ldl oxidation , different products are formed , and distinct biological effects have been attributed to the ldl preparations subjected to high and low oxidation [ 1113 ] . here , we used oxldl with high oxidative degree . in this situation , phospholipids , triacylglycerol , and cholesterol esters are transformed into hydroperoxides which react with apob-100 , resulting in modification and fragmentation of amino acid side chains [ 14 , 15 ] . we next examined the effect of oxldl on thioglycolate - elicited murine macrophages that already express a pro - inflammatory phenotype . macrophages were treated with different concentrations of oxldl for 24 h and then stimulated with lps ( 1 g / ml ) for an additional 24 h. figure 2(a ) shows that oxldl inhibits nitric oxide ( no ) production induced by lps in a dose - dependent manner . treatment with oxldl also inhibited the expression of inos and cox-2 induced by lps stimulation ( 52% and 55% for inos and cox-2 , resp . ) the inhibitory effects of oxldl were not related to a decrease in cell viability , evaluated by measuring mitochondrial activity by the mtt assay , which was actually increased in oxldl - treated macrophages ( figure 2(d ) ) . although oxldl particles have been associated with proinflammatory mechanisms related to the development of atherosclerosis , our data indicate that oxldl increases anti - inflammatory and reduces pro - inflammatory markers induced by lps , favoring macrophage differentiation toward the m2 phenotype . compounds present in the oxldl particle , such as sphingosine 1-phosphate ( s1p ) and oxidized 1-palmitoyl-2-arachidonoyl - sn - glycero-3-phosphocholine ( oxpapc ) have been shown to inhibit tlr2 and tlr4 activation , respectively [ 16 , 17 ] . the complexity involved in this mechanism could be explained by interactions between different compounds formed after the oxidative process with different receptors present on macrophages . murine bone marrow - derived cells were differentiated to macrophages ( bmdm ) with l929 supernatant for six days in the presence of oxldl . cells were treated with oxldl ( 20 g / ml ) on the first day of culture and supplemented every two days . we found that macrophages treated with oxldl expressed high levels of mrna for the m2 macrophage markers il-10 , arginase-1 ( arg-1 ) , mannose receptor ( mr ) , and ppar and decreased expression of il-12 mrna with no effect on inos mrna ( figure 3 ) . this indicates that the presence of oxldl during macrophage differentiation shifts the phenotype toward the m2 profile . in a previous study , we found that costimulation of pafr and cd36 is needed for optimal macrophage activation induced by oxldl . here , we investigated if both receptors are involved in the induction of the m2 phenotype . murine bmdm were treated with pafr antagonists ( web2086 or cv3988 ) alone or in combination with blocking antibody to cd36 for 30 min and then treated with oxldl ( 20 g / ml ) for 5 h. figure 4(a ) shows that oxldl induced the expression of tgf- and arg-1 mrna and that this was reversed by treatment with pafr antagonists ( tgf- : 36% and 45% inhibition ; arg1 : 57% and 50% inhibition for web and cv , resp . ) . blockage of cd36 reduced only the mrna expression of tgf- ( 56% ) . simultaneous blockage of cd36 and pafr did not further reduce arg-1 and tgf- mrna expression . the oxldl also induced the expression of rantes and cxcl2 , but this was not affected by treatment with the pafr antagonists or cd36 blocking antibody . next , we examined the requirement of pafr and cd36 for il-10 and il-12 production . to ensure the production of detectable levels of these cytokines , bmdm were pretreated with the cd36 blocking antibody alone , or in combination with the pafr antagonists 30 min before overnight stimulation with oxldl ( 20 g / ml ) followed by activation with lps ( 10 ng / ml ) . figure 4(b ) shows that oxldl increased the lps - induced production of il-10 but did not affect il-12 . furthermore , the il-10 concentration was strongly reduced by the pafr antagonists web and cv and by the cd36 blocking antibody . although several receptors may be involved in oxldl recognition , the upregulation of il-10 induced by oxldl depends mainly on cd36 and pafr since , in the present study , the production of this cytokine was almost completely blocked by treatment with pafr antagonists and antibodies to cd36 . it has been described that oxldl induces arginase expression and activity in macrophages and in endothelial cells [ 19 , 20 ] . we showed here that pafr antagonists decreased arg-1 and tgf-1 mrna expression induced by oxldl , indicating that pafr activation is required for the induction of alternative activation markers in macrophages . atherosclerosis is characterized by a chronic inflammatory reaction in the arterial wall , and both forms of activated macrophages , classical and alternative , have been found in atherosclerotic lesions . m1 macrophages are mostly present in areas prone to rupture , while m2 macrophages are found in the adventitia , and both m1 and m2 are present in the fibrous cap . however , the real function of each macrophage population still needs to be elucidated . in the atherosclerotic plaque , , we found that ldl with a high degree of oxidation increased anti - inflammatory markers in a pafr- and cd36-dependent manner . we do not exclude the idea that additional mechanisms may contribute to oxldl - induced macrophage differentiation into the m1 or m2 phenotype . it can be speculated that the presence of m2 macrophages in the plaque is an attempt of the organism to control the inflammatory response ; in this case , the pafr would be involved in atheroprotection . however , m2 macrophages express more cd36 [ 4 , 6 ] and are more likely to become foam cells , which contribute to the pathophysiology of atherosclerosis . moreover , these cells are more sensitive to death in a high lipid environment , such as the lipid core of the atherosclerotic plaque . in the present study , we demonstrated that oxldl induces macrophage differentiation towards an alternative phenotype and that this requires the engagement of pafr and cd36 . as the real function of m2 macrophages in the development of atherosclerosis remains unclear , in vivo studies using pafr antagonists are needed before suggesting their use as a therapeutic approach for the treatment of atherosclerosis .	oxldl is recognized by macrophage scavenger receptors , including cd36 ; we have recently found that platelet - activating factor receptor ( pafr ) is also involved . since pafr in macrophages is associated with suppressor function , we examined the effect of oxldl on macrophage phenotype . it was found that the presence of oxldl during macrophage differentiation induced high mrna levels to il-10 , mannose receptor , ppar and arginase-1 and low levels of il-12 and inos . when human thp-1 macrophages were pre - treated with oxldl then stimulated with lps , the production of il-10 and tgf- significantly increased , whereas that of il-6 and il-8 decreased . in murine tg - elicited macrophages , this protocol significantly reduced no , inos and cox2 expression . thus , oxldl induced macrophage differentiation and activation towards the alternatively activated m2-phenotype . in murine macrophages , oxldl induced tgf- , arginase-1 and il-10 mrna expression , which were significantly reduced by pre - treatment with pafr antagonists ( web and cv ) or with antibodies to cd36 . the mrna expression of il-12 , rantes and cxcl2 were not affected . we showed that this profile of macrophage activation is dependent on the engagement of both cd36 and pafr . we conclude that oxldl induces alternative macrophage activation by mechanisms involving cd36 and pafr .
You are an expert at summarizing long articles. Proceed to summarize the following text: due to their power efficiency , brightness , and larger color gamut extremes lasers are ideal light sources for projector applications . a fully coherent source provides an image along the optical axis without the concern of losing focus . speckle , the granular intensity pattern resulting from constructive and destructive interference , can be observed from laser - illuminated surfaces . the resultant speckle in the projected image strains the eye , resulting in observer s headaches . speckle contrast associated with the overall intensity pattern is calculated by equation ( 1 ) , where is the standard deviation and iavg is the average irradiance across the image as described by equation ( 2).(1 ) c=iavg ( 2 ) c=(e[i2]-e[i]2)/iavg diffusers can be used to offset the original coherence in the laser light prior to reflection from a screen or surface . the degraded coherent optical field results in a change of the image irradiance levels , thus reducing the speckle contrast . a commonly used speckle reduction technique is temporal averaging of the irradiance pattern using a diffractive diffuser . a stationary diffuser introduces a single independent phase change . by moving the diffuser either though rotation or vibration , k rotation of a pseudo - random pattern diffuser determines the speckle reduction as a function of the number of patterns averaged . c=1k in order to temporal averaging to completely negate speckle for the human eye , sample rate of 20 hz , a diffuser would have to rotate a number approaching infinity all within 0.05 s. a rotating or vibrating diffuser would also be susceptible to mechanical failures , reducing product lifespan . rotational or vibrational methods require additional supporting components , increasing implementation difficulty in pico - projectors which have severely limited spatial allocation . a diffuser that reduces speckle without the need for physical manipulation is ideal for laser pico - projection systems . previous work on non - rotating diffusers have had limited success . a more recent article utilized an mems device for very small motion of the diffuser where speckle reduction of 0.48 was achieved . another method used piezoelectric benders to reduce speckle while limiting actual diffuser motion with a contrast of 0.16 . the piezoelectric method , while non - rotational , requires two mechanically vibrating parts making the design susceptible to failure . various contrast reduction methods [ 3,79 ] have resulted in significant speckle contrast , but all require motion . additionally , the majority of speckle reduction methods require large setups or devices that would need to be miniaturized for pico - projector application . we present a novel non - rotational , non - moving diffractive diffuser that is easily integrated into laser pico - projectors , significantly reducing speckle contrast . a binary diffuser commonly used in speckle reduction techniques has an associated phase shift of either 0 or for each individual phase element of the structure . a hadamard matrix is a square matrix used for performing hadamard transforms ( ht ) that is composed entirely of + 1 and 1 values . a special property of the hadamard matrix is the relationship between the matrix and its transpose as described in equation ( 4 ) . this definition requires all hadamard matrices to be square with orders n = 2 , 4 , 8 , 16 , where h1=1 . multiple versions of the hadamard matrix exist , each with a unique binary pattern.(4 ) hnhnt = hnthn = nin the first type of hadamard matrix is the sylvester matrix and is described in equation ( 5 ) with the condition that h1=1 . an order 16 sylvester matrix is shown in figure 1 where the dark area denotes + 1 and the white space denotes 1.(5 ) h2n = h2n-1h2n-1h2n-1-h2n-1 order 16 sylvester matrix . the other hadamard matrix types are known as the walsh paley and the walsh matrix , and can be constructed through recursion . while each matrix still follows the basic definition , each has an exclusive pattern creating different propagated irradiance patterns when observed . the 1 elements of the matrix can be replaced with 0 and a binary diffuser can be developed from the pattern . the original design requires 150200 rpms for rotating diffusers in order to achieve speckle contrast at or below 0.20 as discussed previously regarding temporal averaging of a diffuser . variations in the hadamard matrix pattern types will reduce speckle contrast without the need for temporal averaging . using two stationary statistically correlated hadamard diffusers with varying phase patterns in tangent can reduce the speckle more than two generic uncorrelated binary diffusers . a similar experiment was conducted in 2012 in which a single optimized binary diffuser was manipulated into two separate diffuser structures . while stationary diffuser speckle was reduced , the method did not lower the contrast more than previously demonstrated using single rotating diffuser contrast values . a single scattering , fourier model is used for initial analysis of the proposed dual hadamard diffuser reduction technique and proceeds with a full analysis of optical system simulation . a 16-order matrix is created as an individual cell and duplicated to fill the total size of the array dependent on the analysis of the entire propagation system . for any speckle reduction technique , hadamard matrices included , a decrease by ( m ) can be achieved where m is the degree of freedom . the degree of freedom represents the number of independent diffraction patterns that are created by a stationary diffuser . a 16-order hadamard matrix pattern can be expected to have a contrast measurement of 0.707 . placing two differing hadamard patterns in series along the optical path , within the fresnel zone of the primary diffuser allows for a speckle value of 0.343 . due to the correlation between the two patterns , one - half of the contrast reduction associated with the fully developed speckle can be assumed . calculation of the expected contrast value requires an extension of equation ( 2 ) , which can be done by assuming n independent pixels for the image irradiance . the standard deviation of the irradiance can now be expanded given by equation ( 6).(6 ) c=n=1nii - iavg2n-1iavg the image irradiance level can be found using fourier propagation with the assumption that the illuminated diffuser speckle pattern will propagate onto a projection lens prior to observation onto a screen . this layout is illustrated in figure 2 where z 1 and z 2 represent the propagation distances between the diffuser , lens , and observation screen and f represents the focal length of the lens . initial analysis will involve a single diffuser to verify the approach to satisfy the previously expected contrast values . the initial propagation prior to incidence on the diffuser as coherent monochromatic gaussian light is defined by equation ( 7).(7 ) ugx , y = agex2+y2w02 ag represents the amplitude of the beam and w0 is the initial waist of the beam . the diffuser can be modeled as a single scattering phase screen with the hadamard matrix structure defined in equation ( 6 ) . this matrix can be replicated to represent the whole of the diffuser as described in equation ( 8).(8 ) tax , y = ej/2h16 ... h16 ......... h16 ... h16 the 2 in the exponential is the phase shift that separates the two levels of the diffusers . the incident illumination can be multiplied by the diffuser within the fourier domain since it is modeled as a phase screen . it is assumed that the gaussian illumination is a negligibly small distance from the incident diffuser which allows direct convolution of the incident beam and the diffuser . the initial optical field immediately after the diffuser is defined in equation ( 9).(9 ) uinc(inc,inc)=ug(xinc , yinc)ta(xinc , yinc ) propagation after the diffuser can be accomplished through the transfer matrix approach , taking into account the distance of propagation is still within the near - field region . equation ( 10 ) shows the result of propagation after the diffuser.(10 ) udxd , yd = ejkzjzuinc,ejk2zx-2+y-2dd due to the very small size of the diffuser elements in x and y , the phase propagated pattern size will increase rapidly along the z axis causing the lens to be well within the focal length and thus , within the fresnel region of the diffuser output . this satisfies the condition for fresnel approximation given by equation ( 11 ) .(11 ) z34x-2+y-2max2 an important element in measuring the speckle is to ensure that the lens does not decrease the size of the speckle spots so much that the individual pixels of the camera used for measurement do not cause averaging , independent of the rest of the system . this matching of lens to speckle screen was used extensively for measuring laser beam size effects and diffuser speed while maintaining the individual speckle spot size , effectively comparing the speckle contrast across the surface . a lens , l , can be described as a phase function applied to the incoming wave . the transmittance function of the projection lens is described by equation ( 12 ) .(12 ) tlxl , yl = pxl , yle - jkfxl2+yl2 for a lens function , it can be shown that the distance d is replaced by the focal length of the lens f. the aperture function p can be simply described as a circle . propagation of the lens can occur using the fraunhofer propagation equation and replacing the distance parameter z with the focal length f of the lens . substituting z for the focal length f and inserting equations ( 10 ) and ( 12 ) results in equation ( 14).(13 ) ufxf , yf = ejkzjzejk2zx2+y2u1,e - j2zx+ydd ( 14 ) ufxf , yf = ejkfjfejk2fxf2+yf2udxd , ydpxf , yfe - j2fxfxd+yfyddxddyd uf represents the amplitude of the wave of the resultant propagation at the focal plane of the lens l. after the focal plane of the lens , propagation to the observation plane can be evaluated using the fresnel propagation equation described previously by equation ( 11 ) . the final amplitude output of the system uobs can be described by equation ( 15 ) where equation ( 14 ) can be viewed as the initial amplitude field and is propagated using the fresnel approximation to the final observation screen.(15 ) uobsxobs , yobs = ejkz2jz2ejkfjfejk2fxf2+yf2udxd , ydpxf , yfe - j2fxfxd+yfyddxddydejk2zx-2+y-2dd the distance from the focal plane of the lens to the final observation plane is greater than that previously described for the diffuser to the lens . this distance z 2 is still well within the near - field distance requirement and satisfies equation ( 12 ) . far - field propagation will need to be considered for projection onto surfaces for image viewing ( actual projector system ) , but is not applicable for the detection measurement . contrast measurements for the output speckle images can now be found from the previously discussed contrast equation involving speckle image intensity as described in equation ( 7 ) . the intensity of the observation measurement from the optical field in the observation plane can be broken into pixel elements as shown in equation ( 16).(16 ) iobsxobs , yobs = uobsxobs , yobs2 thus , the overall contrast created by the hadamard diffuser can be attributed to taking multiple fourier transforms of the initial phase screen ta . a second phase screen can now also be included by evaluating equation ( 8) again with all elements the same except for the phase screen . the analysis for both diffusers will need to maintain the same z value associated with the diffusers prior to the lens to maintain fresnel region propagation . a simulation will be used further to the previous analysis and provide an accurate accounting of the contrast reduction provided by the diffuser . modeling of the z value to match the phase elements of both diffusers will be discussed in section 3 . simulation of the primary diffuser is accomplished first to ensure the proper contrast evaluation prior to a two - diffuser simulation . fourier analysis requires that the discrete values associated with the sampling of the arrays be properly related to the linear size of each array . in this situation , the two primary physical objects that require extended examination are the diffuser , or diffusers , and the lens . a positive lens is used in imaging the aperture of the lens and will determine the final speckle spot size in the observation plane . an important part of measuring the speckle contrast is ensuring that the speckle spots will not be averaged together in a single pixel of the observation screen . this will be fixed by ensuring a large array for the lens that will project the pattern propagated from the diffuser . an 8000 8000 array group will be used for each screen , i.e. gaussian input , diffuser , and lens . this means a sampling size of 3.89 per pixel given a 54.8 cm diameter lens and a 25.4 cm linear , square diffuser . the most advanced photolithography machines are capable of incrementing diffuser size of around 1 . this physical size limitation is well within the current standards for producing an actual diffuser and our simulated sampling size stands . the final output for the single hadamard diffuser propagated through a projection lens is shown below in figure 3 . the output directly after the diffuser and a smaller cropped version of the final output image are shown as well . ( a ) intermediate image screen ; ( b ) final image screen ; ( c ) final image normalized . the contrast provided by the final image is 0.67 0.02 comparable to the theoretical value of 0.707 for a single hadamard diffuser . the distance between the two diffusers was optimized for lowest possible speckle and is currently set at 8 mm . ( a ) image directly after second diffuser ; ( b ) final image output from dual diffuser system ; ( c ) close up image output from dual diffuser system . hadamard diffuser designs were manufactured by the microoptics division of jenoptik optical systems , inc ( huntsville ) . speckle contrast results were measured for the diffusers using a 532.8 nm dpss laser with pseudo - random linear polarization . a single diffuser was measured with a measured speckle contrast minimum of 0.62 ( 0.02 ) using a 25 mm focal length projection lens . the image was captured using a ccd camera with an array size of 480 640 pixels and a pixel size of 7 m giving a total detector size of 3.36 4.48 mm . the image results from the single physical hadamard diffuser matches the output results of a zoomed - in version of the simulation output in figure 3(c ) . two diffusers were aligned along a common optical axis and the image contrast was measured . final contrast results for dual hadamard diffusers were slightly more difficult to compare with simulated values due to mitigating factors such as spatial alignment , separation distance between diffusers , and speckle spot size . each of these factors can arguably effects the speckle output , so all conditions of testing have been fully analyzed for each contrast result . a standard separation distance between the diffuser of approximately 5 mm ( 0.5 mm ) was set up . it is noted that a significant variance in the speckle measurements was observed with an 812% change in the contrast resulting from the lack of optimization with the separation distance between the two diffusers . simulation results confirm that separation distance between the diffusers can have a significant impact on the resulting speckle contrast value which was confirmed with the physical measurements fluctuations . further research is underway to optimize the separation distance to enhance the speckle reduction capacity of the hadamard matrix diffuser set . the minimum value achieved was within 23% of expected simulation results although still greater than the 6% that was theoretically predicted . it is hypothesized that a possible difference in contrast is due to larger than anticipated gaussian beam effects and pixel to speckle spot size matching . while the simulation attempts to overcome pixel size mismatch by utilizing large array sizes , the camera array size , and pixel size this is still of minor importance as differences in theoretical vs. physical measurements are within the variance caused by the distance discrepancies of the two diffusers . however , this change is within error parameters caused by the physical setup of the diffuser so it is of interest only in situations where the laser is completely polarized . a static , dual in - line hadamard diffuser optical system has been demonstrated for speckle reduction in pico - projection applications . hadamard diffusers were fabricated and measured with good agreement between experimental contrast measurements and simulated values . a minimum contrast of 0.40 ( 0.08 ) was achieved without using rotation or vibrational movements . using this type of structured binary matrix maintains partial coherence of the laser source , unlike static pseudo - random grayscale - style diffusers , necessary to preserve the perceived brightness of the laser . this static design ensures no mechanical failure modes and no vibration that could result in optical component alignment issues within a small enclosed system . the in - line hadamard diffuser notion allows for a greater reduction in speckle than a single diffuser while still maintaining partial coherence desired for integrated laser pico - projector sources .	personal electronic devices such as cell phones and tablets continue to decrease in size while the number of features and add - ons keep increasing . one particular feature of great interest is an integrated projector system . laser pico - projectors have been considered , but the technology has not been developed enough to warrant integration . with new advancements in diode technology and mems devices , laser - based projection is currently being advanced for pico - projectors . a primary problem encountered when using a pico - projector is coherent interference known as speckle . laser speckle can lead to eye irritation and headaches after prolonged viewing . diffractive optical elements known as diffusers have been examined as a means to lower speckle contrast . this paper presents a binary diffuser known as a hadamard matrix diffuser . using two static in - line hadamard diffusers eliminates the need for rotation or vibration of the diffuser for temporal averaging . two hadamard diffusers were fabricated and contrast values measured showing good agreement with theory and simulated values .
You are an expert at summarizing long articles. Proceed to summarize the following text: polymeric gene delivery systems are of great interest in gene therapy because of their greater degree of safety compared to that of viral vectors . many types of cationic polymers , such as poly - l - lysine and its derivatives [ 1 , 2 ] , polyethyleneimine , polyamidoamine dendrimer , and vinyl polymers , have been developed as gene carriers to aim at effective and safe in vitro and in vivo gene transfection into cells . they can spontaneously condense dna by electrostatic interaction between positive charged groups of polycation and phosphate groups of dna and form complexes , which are called polyplexes . the polyplex formation protects dna from degradation by dnases in extracellular and intracellular pathways , resulting in the enhancement of gene transfection efficacy . however , the cytotoxicity of cationic polymers is an essential problem in the polyplex - based gene transfer field . therefore , significant efforts have been made towards decreasing the toxicity of polymeric gene carriers . one is to attach polyethylene glycol ( peg ) , which is widely used as a nonionic , highly soluble , low toxicity polymer , to polymeric gene carriers , a process that is called pegylation . pegylation increases the water solubility of polyplexes and reduces the interaction of polyplex and serum and blood components , resulting in effective transfection without toxicity [ 8 , 9 ] . the other is the use of non- or less cationic polymers , which can form complexes via nonelectrostatic interactions , such as hydrogen bonding . double strand schizophyllan , which is one type of polysaccharide ( -1 , 3 glucan ) , forms a triple helical complex with single - strand dna through hydrogen bonding interaction . protective interactive noncondensing ( pinc ) polymers , poly ( n - vinyl pyrrolidone ) ( pvp ) , and poly ( vinyl alcohol ) ( pva ) , form flexible polyplexes with dna via hydrogen bonds [ 11 , 12 ] . in addition , we have developed a novel formulation method of dna complexes with nonionic , water - soluble polymers through hydrogen bonding interaction using high hydrostatic pressure technology . under high hydrostatic pressure conditions , inter- and intramolecular hydrogen bonding interaction we previously reported that nanoscaled pva / dna complexes via hydrogen bonding interaction were obtained by high hydrostatic pressurization at 980 mpa and 40c for 10 min . the pva / dna nanoparticles were taken up by raw264 cells with nontoxicity , and no significant gene expressions were observed . traditionally , the calcium phosphate ( cap)-dna coprecipitation method has been used for in vitro gene transfection because of cap 's biocompatibility , biodegradability , and ease of handling [ 17 , 18 ] . many cap - dna coprecipitation methods that particulate formation , being affected by ph , temperature , and buffer conditions , have been developed to aim at effective gene transfection . in addition , several researchers have proposed the idea of applying cap - dna coprecipitates produced in polyplexes to gene delivery . it is considered that polyplexes including cap were internalized into cells through endocytosis pathways , in which the ph was lower than 5.5 , and then the rupture of endosome and endosomal releases of polyplex were induced by osmotic shock [ 22 , 23 ] . currently , nanoscaled haps , which are one of the forms of cap , have been synthesized with well - controlled size and shape and utilized as gene carriers because of the capability of haps to absorb dna molecules . on the basis of this background , in the current study , we used nanoscaled haps ( about 50 nm ) as an endosomal escape reagent because of their ability to dissolve in endosome vesicles under low ph conditions . we investigated a method of preparing the pva / dna complexes encapsulating haps by using high hydrostatic pressure technology in detail . using the obtained pva / hap / dna nanoparticles , the cellular uptake , cytotoxicity , and in vitro and in vivo transfection efficiency pva with a degree of polymerization of 1700 and a degree of saponification of 99.3% was kindly supplied from kuraray co. ltd . hap with an average diameter of 50 nm was synthesized by an emulsion system [ 25 , 26 ] and then suspended in water . plasmid dna encoding a luciferase gene under an sv40 promoter ( pgl3 : 5.2 kbp ) was purchased from promega co. , ltd . , ( madison , usa ) . an aqueous pva solution of 5 w / v% was prepared by autoclaving it three times for 30 min at 121c and diluting it to various concentrations . the dna solution was mixed with the pva / hap suspension ( final concentrations : pva 0.0011.0 w / v% , ha 0.00010.1 w / v% , dna 0.0025 w / v% ) . the mixture solution of pva , hap , and dna was hydrostatically pressurized at 980 mpa and 40c for 10 min using a high hydrostatic pressure machine ( dr . the shapes of pva / dna ( pva : 1.0 w / v% ) and pva / hap / dna ( pva : 1.0 w / v% , hap : 0.1 w / v% ) complexes obtained by the high hydrostatic pressurization were observed with a scanning electron microscope ( sem , jsm-6301f , jeol co. , tokyo , japan ) . one l of the complex solutions was dropped on a glass slide and dried in air . the sizes of the pva / dna and pva / hap / dna complexes obtained by the high hydrostatic pressurization were measured by dynamic light scattering ( dls ) using a zetasizer nano product ( malvern , worcestershire , uk ) . the stability of dna in pva / dna complex on 10% serum condition was investigated . the pva / dna complexes were incubated with medium containing 10% serum for 20 h. then , they were subjected to in vitro transcription and translation system ( tnt quick coupled transcription / translation system , promega co. , ltd . , madison , usa ) , and the luciferase activity was measured by using an ab-2200 luminometer ( atto , corp . , tokyo , japan ) for 10 s. a mixture solution of pva ( 2 w / v% ) and hap ( 0.2 w / v% ) was prepared and diluted stepwise to 0.01 w / v% of pva and 0.001 w / v% of hap . an aqueous dna solution of 0.005 w / v% was mixed with pva / hap mixtures for each concentration at an equal volume . their mixtures were treated under 980 mpa at 40c for 10 min using a high hydrostatic pressure machine . the cos-7 cells used were purchased from riken bioresource center ( brc , saitama , japan ) . they were cultured in a complete modified eagle medium ( dmem , life technologies japan ltd , tokyo , japan ) , supplemented with non - inactivated 10% fetal bovine serum ( fbs ) , 50 iu / ml of penicillin , and 50 g / ml of streptomycin ( icn biomaterials , ohio , usa ) . the cos-7 cells ( 2.0 10 ) on a 96-well plate were incubated with pva / dna and pva / hap / dna complexes of various concentrations at 37c for 20 h in the presence of fbs ( 10% ) . the cellular viability was assessed using a cell counting kit-8 ( dojindo laboratory , tokyo , japan ) according to the manufacturer 's instructions . the pgl3 plasmid dna was labeled with rhodamine using a label it kit ( panvera , wis , usa ) according to the manufacturer 's instructions ( rh - dna ) . hap / rh - dna ( hap : 0.4 w / v% ) . pva / rh - dna , and pva / hap / rh - dna complexes ( pva : 0.001 w / v% , hap : 0.0001 w / v% ) were added to cos-7 cells ( 1.0 10 ) cultured in 24-well plates in the presence of fbs ( 10% ) , and incubated at 37c for one and 24 h. after washing with pbs twice , the cells were observed under a fluorescent microscope . cos-7 cells ( 8.0 10 ) were cultured overnight in a 48-well plate . hap / dna ( hap : 0.4 w / v% ) , pva / dna , and pva / hap / dna complexes ( pva : 0.001 w / v% , hap : 0.0001 w / v% ) were added to cells and incubated at 37c for 24 h. the medium was removed from each well and washed with pbs twice . 50 l of a 1x luciferase cell culture lysis buffer ( promega co. , ltd . , 10 l of cell extract was mixed with 100 l of a luciferase assay reagent ( promega co. , ltd . , madison , usa ) and the luciferase activity was measured by using an ab-2200 luminometer ( atto , corp . , tokyo , japan ) for 10 s. the protein concentration of the supernatant was determined by using a dc protein assay kit ( bio - rad laboratories , inc . . 1.6 ml of the saline solution of pva / dna and pva / hap / dna complexes ( pva : 0.001 w / v% or 0.01 w / v% , hap : 0.0001 w / v% or 0.001 w / v% , dna : 0.0025 w / v% ) were prepared by high hydrostatic pressurization and injected by a hydrodynamic technique as previously described . briefly , mice were restrained , and the tail vein was accessed with a 25 gauge needle . administration of the solution was performed in 10 seconds or less without extravasation ; each group was represented by three or more animals . after 12 , 24 , and 72 h injection , the liver and lung were dissected from dead animals using the standard surgical procedures . 1 ml of lysis buffer ( 0.1 m tris - hcl , 2 mm edta , and 0.1% triton x-100 , ph 7.8 ) was added to a piece of liver with wet weight of approximately 200 mg . the liver was homogenized for 1520 s with a homogenizer ( pt2100 , kinematica ag , lucerne , switzerland ) at maximal speed , and the tissue homogenate was then centrifuged in a microcentrifuge for 10 min at 13000 g at 4c . the protein concentration of the supernatant was determined by using a dc protein assay kit . for luciferase assay of the liver extract , the supernatant was further diluted 60-fold using an hepes buffer . 10 l of supernatant of diluted liver extract was mixed with 100 l of luciferase assay reagent , and the luciferase activity was measured by using the ab-2200 luminometer for 10 s. all experiments were repeated at least three times ( five times for dls analysis ) , and the values are expressed as means standard deviations . statistical analysis was performed using student 's t - test , with the significant level set at p < .05 . the mixture solution of pva , hap , and dna was hydrostatically pressurized at 980 mpa and 40c for 10 min using a high hydrostatic pressure machine . after removal of pressure , the obtained pva / hap / dna complexes were observed by sem . figure 1 shows typical sem images of pva / dna ( pva : 1.0% ) and pva / hap / dna complexes ( pva : 1.0% , hap : 0.1% ) . many particles less than 1 m were observed for the pva / dna complex . on the other hand , in the case of pva / hap / dna complexes , irregular particle surfaces were observed without any significant hap absorption on the particles , showing that hap particles were encapsulated in the pva / hap / dna complexes . when excess haps were mixed with pva and dna , many aggregates of haps on the pva / hap / dna particles obtained by the pressurization were clearly visible ( data not shown ) . the particle size of pva / dna and pva / hap / dna complexes at various concentrations of pva and hap were measured by dls measurement ( figure 2 , table 1 ) . the diameter of pva / dna particles without hap increased with increased pva concentration , which corresponds to our previous report [ 14 ] . this tendency was exhibited for the particle size of pva / hap / dna complexes , irrespective of hap concentration . at each pva concentration , the diameter of pva / hap / dna particles increased with increased hap concentration , indicating that hap particles were significantly encapsulated in pva / hap / dna complexes at these concentrations of pva and hap . from these results of sem observation and dls measurement , it was clear that nano- , microscaled composites of pva , hap , and dna were obtained by high hydrostatic pressurization , and the size of pva / hap / dna particles depended on pva and hap concentrations . to investigate the stability of dna in the pva / dna particles on serum condition , pva / dna particles were incubated in medium containing 10% serum for 20 h , and then subjected to in vitro transcription and translation ( figure 3 ) . the high luciferase activity of dna was showed on the condition without serum , whereas the luciferase activity was remarkably reduced after incubation with serum . on the other hand , there is no difference in the luciferase activity of dna in pva / dna particles before and after incubation with serum , indicating the high stability of dna in pva / dna particles against serum . to date , many methods for preparation of composite materials of pva and hap , such as in situ crystallization of hap in pva hydrogel , gelation of pva solution mixed with hap crystals , and alternating soaking reaction , which promote hap crystallization on / in gel , have been reported . large - scaled composite hydrogels ( several centimeters ) have been prepared for use in biomedical applications such as cartilage and bone . however , few preparation methods of nanocomposites of pva and hap have been reported . in this study , the nano- , microparticles of pva , hap and dna were obtained by using high hydrostatic pressure technology . it is thought that this is achieved by the pressure - induced quick formation of pva particles that could incorporate secondary and third substrates , such as dna and hap , without phase separation [ 15 , 31 ] . figure 4 shows the result of the cytotoxicity test of pva / dna and pva / hap / dna complexes . the high viability of cos-7 cells incubated with them is shown , irrespective of the concentration of pva and hap . pva and hap are biocompatible materials [ 32 , 33 ] . the pva / dna complex is nontoxic because of the composite formation of pva and dna via hydrogen bonding interaction . consequently , it is considered that the nontoxicity of pva / hap / dna complexes was achieved by these combinations . in order to investigate cellular uptake of the hap / dna complex , pva / dna , and pva / hap / dna nanoparticles , figure 4 shows fluorescent microscopic images of cos-7 cells incubated with complexes of pva , hap , and rhodamine - labeled dna for one and 24 h. after 1 h incubation , fluorescent spots were poorly observed for dna and pva / dna nanoparticles ( figures 5(a ) and 5(c ) ) , whereas a lot of bright red fluorescent spots on many cells were shown in the case of hap / dna and pva / hap / dna complexes ( figures 5(b ) and 5(d ) ) , indicating the effective absorption of them onto cells because of their higher specific gravity . however , strong aggregation of hap / dna complexes was observed due to the fact that the nature of hap particles tends to result in an aggregation in the aqueous medium . for pva / hap / dna nanoparticles , pva bearing hap could attenuate the aggregation property of hap . after 24 h incubation , the aggregation of the hap / dna composite was still observed ( figure 5(f ) ) . also , the subcellular distribution of dna was observed in some cells ( figure 5(h ) ) similar to that of pva / dna nanoparticles ( figure 5(g ) ) . this strongly suggests that hap in pva / hap / dna nanoparticles could be dissolved during the intracellular process , probably due to the endocytosis pathway . the expressing of the delivered dna compositing with pva and hap was assayed by measuring luciferase activity ( figure 6 ) . the level of luciferase activity of pva / dna nanoparticles was similar to that of the hap / dna complex due to the slow internalization of pva / dna nanoparticles into cells , which could probably permit dna degradation . in the case of the pva / hap / dna nanoparticles , which can be taken up by cells quickly , high luciferase activity was shown , indicating that the encapsulation of hap in pva / dna nanoparticles could enhance the transfection efficiency in vitro . however , the transection efficiency of the pva / hap / dna nanoparticles was lower than in the high - efficient calcium phosphate transfection method , which is optimized for in vitro transfection . in vivo transfection was performed by using a hydrodynamic method ( figure 7 ) . this method is known as an effective plasmid dna transfection method without gene carrier to liver . the luciferase activity of the pva / dna complex ( pva : 0.001 w / v% ) was lower than that of dna injection , whereas high luciferase activity was achieved for pva / hap / dna nanoparticles at the pva concentration of 0.001 w / v% ( hap : 0.0001 w / v% ) . at pva concentration of 0.01 w / v% ( hap : 0.001 w / v% ) , the luciferase activity of pva / hap / dna nanoparticles decreased compared to that of 0.001 w / v% . this is thought to be caused by the insignificant uptake of the large particles of pva / hap / dna nanoparticles ( about 780 nm , figure 2 , table 1 ) by hepatocytes . when the luciferase activity in lung was also investigated , the low activity was detected in lung compared to that in liver , irrespective of type of nanoparticles . the time - course of transgene activity was also investigated ( figure 7(b ) ) . for plasmid dna , the highest value for luciferase activity was detected after 12 hours , and the level of gene expression significantly decreased over time . on the other hand , in the case of pva / hap / dna nanoparticles , the highest value for luciferase activity was achieved for 24 hours . this result indicates that the pva / hap / dna nanoparticles could prolong the gene expression . we assumed that pva / hap / dna nanoparticles could be accumulated due to the relative high stability , which are continuously transcribed and translated ( figure 3 ) . we successfully developed pva / dna nanoparticles encapsulating haps by using simple high hydrostatic pressure technology . they could enhance the transfection efficiency without any significant cytotoxicity in vitro and in vivo hydrodynamic injection . consequently , the potential use of hap could be expected as an enhancer of gene transfer activity of pva / dna nanoparticles .	our previous research showed that poly(vinyl alcohol ) ( pva ) nanoparticles incorporating dna with hydrogen bonds obtained by high hydrostatic pressurization are able to deliver dna without any significant cytotoxicity . to enhance transfection efficiency of pva / dna nanoparticles , we describe a novel method to prepare pva / dna nanoparticles encapsulating nanoscaled hydroxyapatites ( haps ) prepared by high hydrostatic pressurization ( 980 mpa ) , which is designed to facilitate endosomal escape induced by dissolving haps in an endosome . scanning electron microscopic observation and dynamic light scattering measurement revealed that haps were significantly encapsulated in pva / hap / dna nanoparticles . the cytotoxicity , cellular uptake , and transgene expression of pva / hap / dna nanoparticles were investigated using cos-7 cells . it was found that , in contrast to pva / dna nanoparticles , their internalization and transgene expression increased without cytotoxicity occurring . furthermore , a similar level of transgene expression between plasmid dna and pva / hap / dna nanoparticles was achieved using in vivo hydrodynamic injection . our results show a novel method of preparing pva / dna nanoparticles encapsulating hap nano - crystals by using high hydrostatic pressure technology and the potential use of haps as an enhancer of the transfection efficiency of pva / dna nanoparticles without significant cytotoxicity .
You are an expert at summarizing long articles. Proceed to summarize the following text: treatment planning systems ( tps ) used in brachytherapy , employ the american association of physicists in medicine ( aapm ) task group no . 43 report ( tg-43 ) formalism [ 1 , 2 ] in which the radial dose function gl(r ) and 2d anisotropy function f(r, ) are introduced in the form of single and double entry tables , respectively , using a specific mesh for each parameter . current tps require dose calculation in a clinical implant using higher spatial resolution of radial distance r and polar angle than the entered parameter data , i.e. , gl(r ) and f(r, ) . therefore , tps must interpolate gl(r ) and f(r, ) values from data tables . a review of the published data for various brachytherapy sources indicated that different authors used a variety of spatial and angular increments and ranges in their reporting . therefore , a standardized methodology for interpolation from the published data may be required to determine the dose rate distributions at spatial locations not explicitly included in the published data . the aapm tg-43u1 report provided guidelines for interpolation from 2d and 1d dosimetry parameters for the case of low energy sources of i and pd . the supplement to 2004 tg-43 report ( i.e. , tg-43u1s1 ) included further clarification and modifications of the interpolation techniques in order to assemble these procedures as more accurate and user - friendly . the tg-43u1 and tg-43u1s1 reports recommended log - linear interpolation for gl(r ) and linear - linear interpolation for f(r, ) . an accuracy of 2% was required for establishing r and resolution , interpolation techniques and fitting procedures . the tg-43u1s1 indicated that these interpolation techniques may be extended to other brachytherapy sources in general . polynomial fits are usually included , although tri - exponential fits and other fitting functions recently have been explored with very good agreement for all sources [ 49 ] . the tg-43 formalism has also been extended for high - energy sources of co , cs , ir and yb . however , given the contradictory behaviour of gl(r ) and f(r, ) between low - energy and high - energy brachytherapy sources due to photon interactions , it is quite interesting to determine whether the tg-43u1 and tg-43u1s1 recommendations on interpolation and extrapolation for low - energy sources are applicable to high - energy sources [ 11 , 12 ] . therefore , the objectives of this study are : 1 ) to check what interpolation method allows accurate acquisition of gl(r ) and f(r, ) from the published data ; 2 ) to determine the minimum number of entries in gl(r ) and f(r, ) that allow reproduction of dose distributions with sufficient accuracy . four high - energy photon - emitting brachytherapy sources were studied in the present work : ( 1 ) co source from bebig ( model co0.a86 ) ; ( 2 ) cs source from bebig ( model csm-3 ) ; ( 3 ) ir source from bebig ( model ir2.a85 - 2 ) ; and ( 4 ) a hypothetical yb source having the same design as ir flexisource from isodose control , but with central core composed of yb . all four sources had active lengths l = 0.35 cm with the exception of cs source that had an equivalent active length ( number of seeds times separation between sources ) of l = 1.8 cm . for these sources , we used the monte carlo ( mc ) raw data , d.(r, ) , in a mesh of 0.5 mm from 0 to 10 cm in = 1 steps obtained in previous publications [ 1315 ] , and performed equivalent simulations for yb theoretical source . the gl(r ) and f(r, ) brachytherapy dosimetry parameters were derived using this dense mesh . detailed description of the mc study of co , cs and ir sources can be found in respective publications . the study for yb source has been performed with the same methodology as for the other . radiation spectra was adopted from the national nuclear data center ( nndc ) . water- and air - kerma per photon history each source was placed at the centre of a spherical water phantom with radius r = 40 cm , except for co where the radius used was 50 cm . kerma estimation in water used spherical voxels that were arranged every 0.05 cm in 1 steps . the quantity of simulated photon histories was sufficient enough to assure good statistical uncertainties ( see each publication for additional details ) . published gl(r ) and f(r, ) tables for high - energy sources used a radial mesh for r that typically includes a combination of 0.25 , 0.5 , 0.75 , 1 , 1.5 , 2 - 8 ( integer steps ) and 10 cm . some authors may add supplementary data points for r < 10 cm [ 21 , 22 ] or at larger distances such as r = 12 cm or r = 15 cm [ 1316 ] . in case of f(r, ) , the typical spatial resolution for is 0-5 ( in 1 steps ) , 5-10 ( in 2 steps ) , 10-30 ( in 5 steps ) , 30-90 ( in 10 steps ) with the same possibility of supplementary angles . in some studies of high - energy sources , lower angular resolutions were used such as 10 near the source longitudinal - axis [ 21 , 22 ] . for the four sources examined , the published gl(r ) and f(r, ) tables used the typical mesh as previously indicated . the tg-43u1 and tg-43u1s1 interpolation recommendations were examined in this context . furthermore , linear - linear interpolation of gl(r ) was examined . results were compared with the values obtained from the mc calculations for the aforementioned sources with the same grid . results for linear - linear interpolation and logarithmic - linear interpolation did not differ significantly for gl(r ) as shown in fig . interpolation differences were 0.5% compared with mc results over the entire radial range 0.25 r 10 cm . for co and cs sources , differences between mc and interpolation results were > 2% for 0.25 . dissimilarities between mc and interpolation results reduced to 0.5% upon addition of gl(r = 0.33 cm ) and gl(r = 0.35 cm ) for co and cs , respectively , to account for gl(r ) maximum in the case of co , and the high gl(r ) gradient in the case of cs ( fig . 2 ) . due to small ( < 0.5% ) rounding errors in the published data , the gl , int.(r)/gl , mc(r ) ratio is not equal to unity at radii corresponding to the tabulated data points . there were no substantial differences between the linear - linear and log - linear interpolations for the four sources examined . radial dose function gl(r ) for the four sources studied ( left scale ) and ratio of interpolated gl(r ) to mc raw data ( right scale ) . full black lines represent mc results in a mesh of 0.5 mm from 0 to 10 cm . closed circles represent the same mc results but for the radial mesh typically used in published tables . the mesh points used for interpolation are shown as closed circles radial dose fuction gl(r ) for the two sources studied in the radial range up to 1 cm ( left ) and with two additional points ( right ) the results for f(r, ) are shown in table 1 , with graphical representation for ir source shown in fig . 3 . for the four sources and four approximations in case of f(r, ) , differences with mc were 0.5% in the radial range up to 10 cm when using 1 and 2 polar angle steps , with the exception of cs where differences were 1.5% for < 15. with 5 polar angle steps , differences for co , cs , ir , and yb sources were 0.5% , 1.5% for < 15 , 0.5% , and 2% for < 5 , respectively . with 10 polar angle steps , dissimilarities for co , cs , ir , and yb sources were 1.5% for < 5 , 2% for < 10 , 1.5% for < 25 , 2% for < 10. differences of linear - linear interpolated f(r, ) values compared to mc results comparison between interpolated ( fint ) and mc ( fmc ) 2d anisotropy function results for the bebig 192ir source for two different angular resolutions : a ) 2 increments and b ) 10 increments . the region inside the source capsule is shown in white near r = 0 and is not clinically relevant if dosimetric information is required ( i.e. , desire to evaluate organ - at - risk dose ) for r > 10 cm , physicists should refer to the original mc publications . however , radiation scatter conditions and the water equivalence of tissues may need to be considered for accurate dose estimation . in contrast with dosimetry parameter interpolation for low - energy brachytherapy sources , extrapolation to r rrmin for high - energy sources is complicated by the lack of electronic equilibrium and the assumption that collisional kerma is equal to absorbed dose over the entire radial range . significant issues that are generally not included in most publications on high - energy brachytherapy source dosimetry are the presence of electronic disequilibrium near the source and the contributions from emitted electrons . consequently , no extrapolation method can predict the behaviour of data without obtaining the physical basis in order to understanding the effect . in contrast to the established standards ( tg-43u1s1 ) for low - energy sources which recommends log - linear interpolation for gl(r ) , linear - linear or log - linear interpolation methods , produced nearly the same results for high - energy sources . for gl(r ) and for sources analysed in this study , the typical mesh used in the literature was adequate for linear - linear or log - linear interpolations of ir and yb sources . for co and cs , the mesh was also adequate for gl(r ) , however an additional gl(r ) point for 0.25 < r < 0.5 cm was included to keep minimize interpolation errors to < 0.5% . for f(r, ) close to longitudinal axis source ( i.e. , < 15 ) , 1-2 polar angle steps were adequate for all 4 sources examined .	purposethe aim of this work was to determine dose distributions for high - energy brachytherapy sources at spatial locations not included in the radial dose function gl(r ) and 2d anisotropy function f(r, ) table entries for radial distance r and polar angle . the objectives of this study are as follows : 1 ) to evaluate interpolation methods in order to accurately derive gl(r ) and f(r, ) from the reported data ; 2 ) to determine the minimum number of entries in gl(r ) and f(r, ) that allow reproduction of dose distributions with sufficient accuracy.material and methodsfour high - energy photon - emitting brachytherapy sources were studied : 60co model co0.a86 , 137cs model csm-3 , 192ir model ir2.a85 - 2 , and 169yb hypothetical model . the mesh used for r was : 0.25 , 0.5 , 0.75 , 1 , 1.5 , 28 ( integer steps ) and 10 cm . four different angular steps were evaluated for f(r, ) : 1 , 2 , 5 and 10. linear - linear and logarithmic - linear interpolation was evaluated for gl(r ) . linear - linear interpolation was used to obtain f(r, ) with resolution of 0.05 cm and 1. results were compared with values obtained from the monte carlo ( mc ) calculations for the four sources with the same grid.resultslinear interpolation of g l(r ) provided differences 0.5% compared to mc for all four sources . bilinear interpolation of f(r, ) using 1 and 2 angular steps resulted in agreement 0.5% with mc for 60co , 192ir , and 169yb , while 137cs agreement was 1.5% for < 15.conclusionsthe radial mesh studied was adequate for interpolating gl(r ) for high - energy brachytherapy sources , and was similar to commonly found examples in the published literature . for f(r, ) close to the source longitudinal - axis , polar angle step sizes of 1-2 were sufficient to provide 2% accuracy for all sources .
You are an expert at summarizing long articles. Proceed to summarize the following text: raman spectroscopy is widely used for the sensitive characterization of molecular structure and interactions . in the structure elucidation of nucleic acids and their nucleotide building blocks , raman spectroscopy , in resonance with electronic transitions in the uv , has been one of the most important tools . the possibility to enhance raman signals of many chemical compounds in surface - enhanced raman scattering ( sers ) has been used to study the structure and interaction of nucleotides and nucleic acids off - resonance . hyper - raman scattering ( hrs ) is the two - photon excited analogue of raman scattering and gives signals shifted relative to the second harmonic of the excitation wavelength . in the local fields of plasmonic materials the very low hyper - raman cross - sections can be overcome , and sensitive probing of the interaction of the molecules with silver or gold nanoparticles , often used as plasmonic substrates , is enabled . sehrs with its different selection rules compared to raman and infrared absorption spectroscopy provides complementary chemical and structural information . hrs , due to the nonlinearity of the process , benefits even more from electromagnetic enhancement than raman scattering , and it is possible to acquire spectra with cross - sections that are similar to two - photon fluorescence . while resonant hyper - raman scattering in solutions of organic molecules is feasible , obtaining nonresonant hyper - raman spectra from solutions of biomolecules without the help of surface enhancement is practically not possible because of the low cross - section of hrs . in addition to a higher electromagnetic contribution in sehrs compared to sers , also the chemical contribution in sehrs enhancement can vary . sehrs spectra of several chemical compounds such as pyridine , bipyridines , pyrazine , and adenine are known . meanwhile , first sehrs spectra of complex biological materials suggest a thorough assessment of the capabilities of sehrs as a tool for microprobing of organic structures and materials . for example , it has been shown recently that the combination of sers with sehrs is more powerful for microenvironmental ph sensing than sers alone . to explore further the potential of sehrs for probing bioorganic samples , in this work , we report nonresonant sehrs spectra of five important nucleobases , adenine , guanine , cytosine , thymine , and uracil . in order to characterize the nucleobases interaction with the plasmonic nanostructure used as sehrs substrate , the spectra are obtained with different types of silver nanostructures and the sehrs spectra excited with 1064 nm are compared with sers data obtained at 532 nm excitation from the identical samples . the data are discussed before the extensive background of previous work on nucleobases carried out by means of raman , sers , and infrared spectroscopy . silver nitrate ( 99.9999% ) , hydroxylamine hydrochloride ( 99% ) , sodium hydroxide ( p.a . ) , magnesium sulfate heptahydrate ( 99% ) , borax / sodium hydroxide buffer solution ( ph 10 ) , adenine ( 99% ) , guanine ( 99% ) , thymine ( 97% ) , uracil ( 99% ) , and cytosine ( 99% ) were purchased from sigma - aldrich . geyer , and sodium chloride ( 99,6% ) was purchased from j. t. baker . all solutions were prepared using milli - q water ( usf elga purelab plus purification system ) . silver nanoparticles were prepared by chemical reduction of silver nitrate by citrate or hydroxylamine , respectively . for citrate reduced silver nanoparticles , 46 mg of silver nitrate was dissolved in 245 ml of water and heated to boiling with extensive stirring . a 5 ml aliquot of a 0.04 m sodium citrate solution was added dropwise , and the reaction mixture was kept boiling for ca . 1 h. for hydroxylamine reduced silver nanoparticles , 17 mg of silver nitrate , dissolved in 10 ml of water , was added rapidly to a 90 ml solution , containing 11 mg of hydroxylamine hydrochloride and 12 mg of sodium hydroxide . for the sers and sehrs experiments , silver nanoaggregates were formed by the addition of sodium chloride or magnesium sulfate to the nanoparticle solutions and were mixed with stock solutions of the nucleobases to give a final sample concentration of 5 10 m. due to its poor water solubility , the guanine stock solution contained 0.001 m hydrochloric acid . the sers and sehrs spectra were measured using an imaging spectrometer by microprobe sampling ( 10 objective ) . briefly , hyper - raman excitation at 1064 nm was provided by a mode - locked laser producing 7 ps pulses at a 76 mhz repetition rate , and its second harmonic was used for raman excitation at 532 nm . the liquid samples were placed in microcontainers , and the raman and hyper - raman scattering were collected in confocal and epi - illumination microscope configuration . typically , sers spectra were accumulated for 1 s with a photon flux density of 1.4 10 photons cm s , and sehrs spectra for 4060 s with 1.7 10 or 5.1 10 photons cm s. spectral resolution was 36 cm , considering the full spectral range . the hyper - raman spectra were background corrected using an automatic algorithm provided by ref ( 32 ) . using high repetition rate mode - locked picosecond excitation at 1064 nm with photon flux densities ranging from 3.4 10 to 5.1 10 photons cm s and silver nanostructures prepared according to two different protocols as plasmonic substrates , it was possible to obtain high quality nonresonant sehrs spectra of the five nucleobases ( chemical structures in figure 1 ) . the overall sehrs signals yielded in the experiments with citrate reduced silver nanoparticles were 510 times higher than those obtained with the hydroxylamine reduced nanoparticles . this is consistent with the sehrs enhancement factors in previous experiments with the same nanostructures , pointing to specific properties of the nanoaggregates that are formed by the different nanoparticles . structure and atom labeling for adenine , guanine , uracil , thymine , and cytosine . both one- and two - photon excited spectra with the two nanoparticle solutions exhibit characteristic vibrational bands of the investigated compounds , and the sers spectra obtained here ( spectra b and d in figures 25 ) are in good agreement with similar studies reported previously , for example in refs ( 1113 , 28 , and 3336 ) . we obtain very similar sers spectra and very similar sehrs spectra respectively with citrate and hydroxylamine reduced silver nanoparticles . . nevertheless , as will be discussed in the following sections , small differences were observed , specifically regarding the intensity ratios for some bands . as will be shown , the molecules display qualitatively very different sers and sehrs spectra ( compare , for example , spectra a and b in each of the figures 26 ) . one very obvious difference between sers and sehrs spectra common to all five nucleobases is the signal of the symmetric ring breathing mode , which is particularly enhanced in sers but weak or medium compared to other bands in the sehrs spectra . this mode is also very strong in the raman but medium in the ir absorption spectra of the solid compounds ( raman and ir absorption spectra of the nucleobases in ref ( 37 ) ) . regarding the ring breathing mode , the sehrs and the ir spectra show more similarity than sers with ir spectra . surface - enhanced hyper - raman ( a , c ) and surface - enhanced raman ( b , d ) spectra of adenine obtained with citrate ( a , b ) and hydroxylamine ( c , d ) reduced silver nanoparticles : excitation , 1064 nm ( a , c ) and 532 nm ( b , d ) ; photon flux density , 5.1 10 photons cm s ( a , c ) and 1.4 10 photons cm s ( b , d ) ; acquisition time , 20 s ( a ) , 60 s ( c ) , and 1 s ( b , d ) ; scale bars , 5 cps ( a ) , 1000 cps ( b ) , 1 cps ( c ) , and 1500 cps ( d ) ; adenine concentration , 5 10 m. surface - enhanced hyper - raman ( a , c ) and surface - enhanced raman ( b , d ) spectra of guanine obtained with citrate ( a , b ) and hydroxylamine ( c , d ) reduced silver nanoparticles : excitation , 1064 nm ( a , c ) and 532 nm ( b , d ) ; photon flux density , 5.1 10 photons cm s ( a , c ) and 1.4 10 photons cm s ( b , d ) ; acquisition time , 20 s ( a ) , 60 s ( c ) , and 1 s ( b , d ) ; scale bars , 5 cps ( a ) , 500 cps ( b ) , 1 cps ( c ) , and 2500 cps ( d ) ; guanine concentration , 5 10 m. surface - enhanced hyper - raman ( a , c ) and surface - enhanced raman ( b , d ) spectra of uracil obtained with citrate ( a , b ) and hydroxylamine ( c , d ) reduced silver nanoparticles : excitation , 1064 nm ( a , c ) and 532 nm ( b , d ) ; photon flux density , 1.7 10 photons cm s ( a , c ) and 1.4 10 photons cm s ( b , d ) ; acquisition time , 40 s ( a ) , 100 s ( c ) , and 1 s ( b , d ) ; scale bars , 5 cps ( a ) , 300 cps ( b ) , 1 cps ( c ) , and 1500 cps ( d ) ; uracil concentration , 5 10 m. spectra with hydroxylamine reduced silver nanoparticles were obtained at ph 10 . surface - enhanced hyper - raman ( a , c ) and surface - enhanced raman ( b , d ) spectra of thymine obtained with citrate ( a , b ) and hydroxylamine ( c , d ) reduced silver nanoparticles : excitation , 1064 nm ( a , c ) and 532 nm ( b , d ) ; photon flux density , 1.7 10 photons cm s ( a , c ) and 1.4 10 photons cm s ( b , d ) ; acquisition time , 40 s ( a ) , 100 s ( c ) , and 1 s ( b , d ) ; scale bars , 5 cps ( a ) , 300 cps ( b ) , 1 cps ( c ) , and 600 cps ( d ) ; thymine concentration , 5 10 m. spectra with hydroxylamine reduced silver nanoparticles were obtained at ph 10 . surface - enhanced hyper - raman ( a ) and surface - enhanced raman ( b ) spectrum of cytosine obtained with citrate reduced silver nanoparticles : excitation , 1064 nm ( a ) and 532 nm ( b ) ; photon flux density , 4.7 10 photons cm s ( a ) and 1.4 10 photons cm s ( b ) ; acquisition time , 40 s ( a ) and 1 s ( b ) ; scale bars , 10 cps ( a ) and 500 cps ( b ) ; cytosine concentration , 5 10 m. the sehrs and sers spectra of adenine are presented in figure 2 , and band assignments are given in table 1 . both one- and two - photon excited spectra are in very good agreement with previously reported sers and sehrs spectra of adenine on silver substrates . in the sehrs spectra ( figure 2a , c ) the signal of the symmetric ring breathing mode ( 734 cm ) , which is dominating the sers spectra ( compare with spectra b and d of figure 2 ) , is similar to those of the other bands . this band is also very strong in the normal raman spectrum , but medium in the ir absorption spectrum of solid adenine ( see , e.g. , ref ( 37 ) ) . furthermore , the sehrs data indicate a strong contribution from several bands associated with nh2 and n9h deformation modes , specifically the nh2 rocking band at 1026 cm , in - plane nh2 scissoring vibrations at 1487 , 1554 , and around 1650 cm , and the three bands at 564 , 1141 , and 1600 cm , which can be associated with n9h bending modes ( see table 1 for details ) . vs , very strong ; s , strong ; m , medium ; w , weak ; vw , very weak ; br , broad . bend , bending ; breath , breathing ; def , deformation ; rock , rocking ; sciss , scissoring ; str , stretching ; wag , wagging ; 5-ring , five - membered ring ; 6-ring , six - membered ring . the respective sehrs ( figure 2a , c ) and sers ( figure 2b , d ) spectra obtained with the two different silver nanostructures are very similar . comparing the sehrs spectra obtained with the different silver nanostructures ( figure 2a , c ) , we can observe small differences in the intensity ratios of the same bands . the differences in the sers ( figure 2b , d ) are very weak ; a small band at 482 cm associated with an out - of - plane n9h and nh2 wagging appears only in the spectrum with citrate reduced silver nanoparticles ( figure 2b ) . the sehrs and sers spectra of guanine with citrate and hydroxylamine reduced silver nanoparticles are shown in figure 3 . as in adenine , the respective sehrs and sers spectra of guanine with the two types of silver nanostructures are very similar ( compare figure 3a with figure 3c for sehrs and figure 3b with figure 3d for sers ) . the sehrs spectra of guanine differ from the sers spectra in the region between 1200 and 1700 cm , e.g. , in a pronounced sehrs signal of the nh2 scissoring at around 1570 cm and in the absence of the in - plane nh bending mode at 1351 cm ( figure 3a , c ) . the most prominenent differences , however , are found in the region below 800 cm : the ring breathing mode at 660 cm is very strong in sers ( figure 3b , d ) but very weak in the sehrs spectra ( figure 3a , c ) . vice versa , the ring deformation modes at 572 and 517 cm are very strong in sehrs and weak in the sers spectra ( see table 2 for detailed band assignments ) . unlike adenine , the sehrs spectra of guanine ( figure 3 ) do not show comparable signals for the ring breathing mode and the ring deformation modes below 700 cm ( compare , e.g. , figure 3a with figure 2a ) . vs , very strong ; s , strong ; m , medium ; w , weak ; vw , very weak ; br , broad . bend , bending ; breath , breathing ; def , deformation ; rock , rocking ; sciss , scissoring ; str , stretching ; wag , wagging ; 5-ring , five - membered ring ; 6-ring , six - membered ring . figure 4 and figure 5 present the spectra of uracil and thymine , respectively . previous sers and dft studies have shown that both pyrimidine bases interact with silver surfaces in their deprotonated forms , even at neutral ph . therefore , also under the conditions of the experiments here , the spectra of uracil in figure 4 and of thymine in figure 5 must be those of the anions of the two nucleic acid bases . as for adenine and guanine discussed above , the sehrs spectra of uracil ( figure 4a , c ) and thymine ( figure 5a , c ) differ greatly from their sers spectra , this is observed for both types of silver nanoparticles . tables 3 and 4 provide the band assignments for all spectra of uracil and thymine , respectively . in the sehrs spectra we find strong signals due to the c = o stretching vibrations around 1600 cm and a relatively low intensity ring breathing band at 802 cm in uracil ( figure 4a , c ) and around 780 cm in thymine ( figure 5a , c ) . vs , very strong ; s , strong ; m , medium ; w , weak ; vw , very weak ; br , broad . bend , bending ; breath , breathing ; def , deformation ; str , stretching ; wag , wagging . vs , very strong ; s , strong ; m , medium ; w , weak ; vw , very weak ; br , broad . bend , bending ; breath , breathing ; def , deformation ; str , stretching ; wag , wagging . the spectra with citrate reduced silver nanoparticles ( figures 4a , b and 5a , b ) were obtained by the addition of nucleobase solutions to the nanoparticle aggregates ; the ph of the resulting mixtures was 7.5 . it should be noted that it was not possible to obtain spectra of thymine and uracil under the same conditions ( ph 7 ) with the hydroxylamine reduced silver nanoparticles . increasing the ph to 10 by the addition of a sodium hydroxide borax buffer allowed us to measure sehrs and sers spectra of uracil ( figure 4c , d ) and thymine ( figure 5c , d ) with these nanoparticles . since the negatively charged forms of the molecules interact with the nanoparticle surface , we assume that the concentration of the anions at the surfaces at ph 7 is too small . these ions are only formed at very high solution ph values ( the pka values for uracil and thymine in water are 9.36 and 9.86 , respectively ) or upon lowering of the pka by the contact with the silver surface . this is supported by citrate reduced silver nanoparticles , but , as our results indicate , not by the hydroxylamine reduced silver nanoparticles . as will be discussed in this and in the following paragraph , for sehrs and sers spectra of both molecules , there are differences between the data obtained at ph 7.5 with citrate reduced nanoparticles and at ph 10 with hydroxylamine reduced nanoparticles ( tables 3 and 4 and figures 4 and 5 ) . the slightly higher relative intensity of the ring breathing mode at 802 cm of uracil and 780 cm of thymine in the sers spectra with the hydroxylamine reduced nanoparticles ( compare panel b with panel d of figure 4 and panel b with panel d of figure 5 ) could result from the different orientation of the molecules . under the basic conditions that were used to obtain the spectra with these nanoparticles ( figure 4d and figure 5d ) , more nucleobase anions are present and a more upright orientation of the molecules would be less sterically demanding . in addition to different orientation at different ph , the ph dependent differences in the spectra of uracil and thymine can also be caused by the presence of different tautomeric forms of the molecules : thymine and uracil can be deprotonated at the n1 or n3 position , which leads to a tautomeric equilibrium between both deprotonated forms . the distribution of the two species depends on the temperature , the dielectric constant of the solvent , ionic strength , and ph of the solution and has been studied for uracil and thymine by means of sers and dft previously . according to the assignments proposed in ref ( 13 ) , the n1c6 stretching at 1532 cm in the sers spectrum of uracil is characteristic of the n1-deprotonated tautomer . in the sers spectrum measured with the citrate this indicates that , in the case of the citrate reduced nanoparticles , the n3-deprotonated tautomer contributes more to the sers spectra , supporting earlier findings . particularly , the sehrs data can provide valuable additional information about the interaction of the molecules with the silver nanostructures at the two different ph values , due to the different selection rules that govern the two - photon excited raman process . similar to the sers spectrum , the sehrs spectrum of uracil at ph 7 ( figure 4a ) does not show a contribution at 1532 cm . at alkaline ph ( figure 4c ) , a strongly enhanced band at 1532 cm appears in the sehrs spectrum , clearly indicating the presence of the n1-deprotonated species . the signal is the strongest in the sehrs spectrum and is more pronounced than in the sers spectrum of this tautomer ( figure 4d ) . also the band at 645 cm ( table 3 ) in the sehrs spectrum at ph 10 ( figure 4c and supporting information figure s1 ) can be related to a changed distribution of the uracil anion tautomers . in the sers spectrum ( figure 4d ) , it is not visible as clearly . figure s1 , showing the same sehrs spectra as figure 4c , but for the citrate stabilized silver nanoparticles , illustrates that the differences observed in the spectra are indeed ph induced and are very similar for both types of silver nanoparticles . analogous to this discussion of the contribution of the different tautomers to the uracil spectra at different ph , in the spectra of thymine at alkaline ph ( figure 5c , d ) a new band due to the ring stretching vibration at 1521 cm appears , which is more intense in the sehrs spectrum ( figure 5c and supporting information figure s2 ) and indicates the presence of n1-deprotonated thymine . similarly , the band around 650 cm becomes more intense than in the spectra at ph 7.5 ( figure 5a , b ) . these differences between the spectra at different ph can be associated with the shift of the tautomeric equilibrium between the n1- and n3-deprotonated thymine . it should be noted here that in the sers spectra of uracil ( figure 4b ) and thymine ( figure 5b ) obtained with the citrate reduced nanoparticles , three additional bands can be observed at 900 , 928 , and 952 cm . these bands appear also in the sers spectrum of citrate anions shown in ref ( 46 ) . since the same band pattern occurs in the sers spectra of uracil and thymine , and only with citrate reduced nanoparticles ( figure 4b and figure 5b ) , we conclude that they indicate coadsorption of citrate on the silver surface . in the sehrs spectra ( figure 4a and figure 5a , respectively ) , only a very weak band at 952 cm can be observed . the weak citrate signals may present an additional advantage of sehrs over sers regarding the selective characterization of other analyte molecules as well . due to the very low stability of the hydroxylamine reduced silver nanoparticles in the presence of cytosine , we were not able to collect sehrs spectra of the molecule using these nanoparticles without a strong background contribution . figure 6 shows the sehrs and sers spectra obtained with the more stable citrate reduced nanoparticles ; table 5 contains the assignments of the bands . the most obvious differences between the sehrs ( figure 6a ) and the sers spectra ( figure 6b ) are the pronounced signals of the c n stretching mode at 1482 cm and a relatively strong nh2 bending mode around 1590 cm . in accord with the sehrs data of the other molecules , the ring breathing mode at 798 cm both spectra display the contributions from citrate as discussed above for the spectra of uracil and thymine , with a very small signal at 952 cm in the sehrs spectrum . vs , very strong ; s , strong ; m , medium ; w , weak ; vw , very weak ; br , broad . bend , bending ; breath , breathing ; def , deformation ; str , stretching . we have discussed here nonresonant hyper - raman spectra of the nucleic acid bases . in sehrs experiments with silver nanostructures , at an excitation wavelength of 1064 nm , it is possible to obtain spectra of guanine , uracil , thymine , and cytosine , in addition to the sehrs spectrum of adenine that has been reported before . in order to acquire more comprehensive vibrational information about the nanoparticle nucleobase interaction and to interpret the sehrs spectra , also one - photon excited sers spectra of the same samples were acquired at a wavelength of 532 nm . the spectra obtained with silver nanostructures that are stabilized by different molecular species at their surfaces are very reproducible qualitatively , in spite of different sehrs and sers enhancement factors of the different nanoaggregates . they suggest that the interaction of the molecules with the silver nanoparticles , e.g. , at different ph values , is independent of the type of nanoparticles that are used . the sehrs spectra of the nucleobases differ greatly from the sers spectra , due to the different selection rules of the one- and two - photon excited raman process . the very strong ring breathing mode in sers , which is often used to estimate the adsorbate orientation with respect to the surface , is relatively weak in the sehrs spectra of all five molecules . as seen for the spectra of uracil and thymine with the silver nanostructures obtained at alkaline ph , the sehrs spectra can provide additional information about the interaction of the molecules with the nanoparticle surfaces . for example , the n1c6 stretching characteristic for n1-deprotonated uracil is more enhanced in sehrs compared to sers and therefore allows more sensitive determination of the tautomer involved in the interaction . as a further advantage of sehrs we have observed a greater sensitivity with respect to the nucleobase molecules and fewer contributions by the bands of citrate ions that are known to stabilize the citrate reduced nanoparticles . this can be seen by the presence of citrate bands in the sers spectra of uracil , thymine , and cytosine , in contrast to almost no contribution of citrate in the corresponding sehrs spectra . in conclusion , it was shown that the combination of one- and two - photon excitation allows a comprehensive vibrational spectroscopic characterization of the nucleobase nanoparticle interactions for a whole set of nucleobases . the possibility to obtain the nonresonant sehrs spectra at relatively low excitation intensities opens new possibilities for future sehrs applications , specifically the investigation of biological samples , which generally profits from near - infrared excitation . the sehrs spectra of the nucleobases will help to interpret sehrs data obtained from more complex systems , such as spectra from cells . the high sensitivity of the two - photon excited raman scattering enhanced by plasmonic metal nanoparticles with respect to the orientation and contact with the silver nanoparticle surfaces is a very promising approach for the characterization of nanobiointeractions .	using picosecond excitation at 1064 nm , surface - enhanced hyper - raman scattering ( sehrs ) spectra of the nucleobases adenine , guanine , cytosine , thymine , and uracil with two different types of silver nanoparticles were obtained . comparing the sehrs spectra with sers data from the identical samples excited at 532 nm and with known infrared spectra , the major bands in the spectra are assigned . due to the different selection rules for the one- and two - photon excited raman scattering , we observe strong variation in relative signal strengths of many molecular vibrations obtained in sehrs and sers spectra . the two - photon excited spectra of the nucleobases are found to be very sensitive with respect to molecule nanoparticle interactions . using both the sehrs and sers data , a comprehensive vibrational characterization of the interaction of nucleobases with silver nanostructures can be achieved .
You are an expert at summarizing long articles. Proceed to summarize the following text: cystic lymphangiomas of abdomen has mostly involved mesentery and retro peritoneum that should be considered as a differential diagnosis of abdominal masses . a 65-year - old lady who has presented with epigastric pain , then during investigations , a cystic tumor which located in the tail of pancreas , has found . whereas definite diagnosis of tumor with routine procedures was impossible , the tumor has completely resected by distal pancreatectomy and splenectomy . according to this presentation diagnosis of cystic lymphangioma of the tail of pancreas should be considered as a differential diagnosis of pancreatic cystic lesions and complete excision has been the treatment of choice . many pancreatic neoplasms and benign conditions could present as cystic leisions on imaging studies such as ultrasonography ( us ) , computed tomography ( ct ) scan or magnetic resonance imaging ( mri ) . pancreatic lymphangiomas were extremely infrequent and accounted for less than 1% of all lymphangiomas ( 1 ) . the clinical manifestations of pancreatic lymphangioma were non - specific and depending on size of the cyst , patients might present with symptoms including abdominal pain , nausea , vomiting , and a palpable abdominal mass ( 2 ) . some of pancreatic cystic lesions included pseudo cyst , simple cyst , mucinous cyst neoplasms , serous cyst adenoma and intraductal papillary mucinous neoplasms , so conventional imaging examinations like abdominal us , ct scan or mri could not distinguish these tumors ; therefore , preoperative diagnosis has been very difficult . for large or symptomatic lymphangiomas , a total resection has carried out to prevent recurrence , infection , torsion and pressure effect ( 3 ) . neoplastic cystic tumors or pseudocysts of pancreas were more common than lymphangioma , so , differential diagnoses between these were very important . pheochromocytoma was a very important differential diagnosis before any invasive procedure or surgery , because it might cause paroxysmal hypertension with dangerous complications such as intracranial hemorrhage and death . in addition of imaging studies such as us , ct scan or mri , endoscopic ultrasonography ( eus ) and fine needle aspiration ( fna ) by this procedure for cytology evaluation or tumor marker assay could help us in more precise diagnosis . a 65-year - old woman has presented with epigastric pain radiating to the back since 5 months before her admission . there was a history of diabetes mellitus , hypertension and hyperlipidemia and patient had no history of past surgery , pancreatitis or trauma which made the diagnosis of pseudo cysts less likely . the patient has not also reported any history of weight loss , nausea , vomiting , jaundice , or alcoholism . on physical examination , vital signs were normal without fever , chills or rigor , abdomen was soft without tenderness , or distension and extremities pulses were symmetric . laboratory investigations have revealed a leukocytosis ( white blood cell : 22600 ) , mild anemia ( hb : 10.2 mg / dl ) , and raised blood sugar ( blood sugar : 272 mg / dl ) . abdominal ultrasound examination has illustrated a heterogeneous mass with diameter of 59 76 between spleen and left kidney in luq . abdomenopelvic computed tomography ( ct ) has shown a septated solid cystic 65 62 70 mass in the tail of pancreas , adjacent to left kidney . the mass has limited to lesser sac space and it has not invaded any contiguous organs , but it has displaced left kidney to downward . no calcification has revealed and the peri tumoral fat tissue has not obliterated . the differential diagnosis of ct scan report was suggestive of a mass with adrenal origin . in order to investigate the origin of the mass , an adrenal gland mri has performed.it has revealed a 60 58 heterogeneous and lobulated mass adjacent to left adrenal gland suggestive of a tumor originated from pancreas tail , left kidney or intestinal loop with the most probability of pancreas tail tumor ( e.g. pancreatic serous cyst adenoma ) . to ensure distinction between cystic lymphangioma and other pancreatic cystic lesions , diagnostic investigations such as guided eus and ct scan fna 24 hours urine vma and metanephrine analysis were also normal ( cr : 624 mg / day , vma : 6.0 mg/24 hours , v : 1200 ml/24 hours , metanephrine : 185.6 g/24 hours , normetanephrine : 624.4 g / h . ) to rule out pheochromocytoma . furthermore , the cea and ca 19 - 9 tumor marker were within the normal range less likely to make diagnosis of malignancy . however , laparotomy has performed by a left subcostal approach . it has revealed an 8 8 cm solid cystic mass in distal pancreas . the mass had no adhesion to any adjacent organs and it has gradually detached from contiguous tissues . the mass has separated from adrenal gland and the gland was left intact and normal . distal pancreas has displaced from beneath stomach . then left gastroepiploic and short gastric arteries have ligated . finally , the mass has resected with 5 cm margin.so distal pancreatectomy associated with splenectomy has done because splenic vessels were adhered to the lesion severely . on gross examination , the tumor had a cystic and lobulated appearance ( figure 1 ) . a , surgical excision has revealed a nodular and cystic surface of the mass which has surrounded by normal pancreatic tissue ; b , resected spleen . however , histologic findings have revealed numerous cystic like spaces lined by a single layer of flat shaped endothelial cells with well - defined cytoplasmic borders , small round nuclei with dense chromatin . the cystic spaces , which have resembled vascular spaces , filled with homogenous pink fluid and lymphoid aggregates were evident between cystic spaces ( figure 2 ) . dilated cystic spaces with flattened endothelial cell lining ( black arrow ) and filled by homogenous pink fluid . dilated lymphatic channels of varying sizes , separated by thin septa within the pancreatic parenchyma have shown . finally , the diagnosis of pancreatic lymphangioma has confirmed by immunohistochemistry ( ihc ) which shown immunoreactivity to factor viii - r antigen , cd31 positivity and cd34 negativity for cells lining the dilated lymphatic channels . lymphangioma has been a small growing tumor which has resulted from congenital lymphatic malformations causing lymphatic flow obstruction and leading to lymphangiectasis ( 1 , 4 ) . patients have often presented with nonspecific clinical features resulting from mass effects that have been including abdominal pain , nausea , vomiting , and an associated palpable mass . among the adults , some of differential diagnoses were simple cyst , pseudo cyst , cyst adenoma and cyst adenocarcinoma ( 2 ) .one of the most important differential diagnoses was pheochromocytoma that should rule out prior to any intervention . abdominal us usually have revealed polycystic tumor and calcifications which were typical for cyst adenomas ( 5 ) . ct scan typically has illustrated well - circumscribed homogenous cystic masses in or adjacent to the pancreas . large lymphangiomas might displace adjacent organs such as the stomach , spleen , kidney and liver which could demonstrate by ct . the accurate diagnosis of cystic lymphangioma of the pancreas has confirmed immunohistochemically . although factor viii ag and cd31 were sensitive and reliable markers for lymphatic endothelium identification , cd34 reactivity was commonly negative in lymphatic endothelial cell in contrast to vascular endothelial cells ; suggesting that these three markers ( factor viii ag , cd31 and cd34 ) could be useful in distinguishing lymphatic endothelium from vascular endothelium ( 1 ) . it should consider that definite diagnosis of lymphangioma was not possible by these markers . also staining for particularly when lymphangioma contains lymphoid aggregates , locating between cystic spaces , and then commonly developed in peripancreatic tissues rather than the pancreas . in cases with complicated clinicopathologic features , ihc investigations could demonstrate the endothelial nature of lining cells and the absence of keratin in lymphangiomas ( 6 ) . although preoperative evaluations with abdominal sonography or abdominal ct scan could not distinguish lymphangioma from other pancreatic cystic lesions , at the very end , it has seemed histopathology and ihc examination remained the most distinctive yet highly definite approach to the end result ( 2 , 7 ) . while eus - fna was a valid procedure for diagnosis of pancreatic cystic lymphangiomas , its role in the treatment of these lesions was controversial . eus - guided drainage could alleviate symptoms temporarily , but recurrence was inevitable ( 8) . though complete surgical excision was the treatment of choice and also curative ( 1 , 9 ) . depending on the tumor location and size , complete excision could be a simple excision of the mass , or require pancreatic resections , such as a whipple procedure , or distal pancreatectomy ( 10 ) or patient might undergo cystectomy procedure with preservation of the main pancreatic duct ( 11 ) . indeed incomplete excision was the only reason likely to lead to a local relapse ( 2 ) .	introductioncystic lymphangiomas of abdomen has mostly involved mesentery and retro peritoneum that should be considered as a differential diagnosis of abdominal masses . pancreatic lymphangiomas were extremely rare that should be differentiated from neoplastic pancreatic cysts . patients have commonly presented with epigastric pain and a relevant palpable epigastric mass.case presentationa 65-year - old lady who has presented with epigastric pain , then during investigations , a cystic tumor which located in the tail of pancreas , has found . whereas definite diagnosis of tumor with routine procedures was impossible , the tumor has completely resected by distal pancreatectomy and splenectomy . pathology and ihc was suggestive of benign lymphangioma.conclusionsaccording to this presentation diagnosis of cystic lymphangioma of the tail of pancreas should be considered as a differential diagnosis of pancreatic cystic lesions and complete excision has been the treatment of choice .
You are an expert at summarizing long articles. Proceed to summarize the following text: emergency medical service ( ems ) systems annually encounter about 275 000 out - of - hospital cardiac arrest ( ohca ) patients in europe 1 . early recognition and ems activation by the dispatch centre is the first link in the chain of survival 24 . when processing emergency telephone calls , the emergency medical dispatcher ( emd ) has to decide whether there is a medical emergency , find out the chief complaint / current state and/or rapidly identify cardiac arrest and prioritize and define an ems response . the ability to recognize ohca is a challenging task , but still the capacity to identify ohca patients has been reported to be as high as 7083% 57 . in cases of ohca , the dispatcher can and should give telephone - guided cardiopulmonary resuscitation ( t - cpr ) instructions to the caller 4 . it has previously been shown that bystander cpr improves the survival rates of ohca patients , especially when started at an early stage 8 . a similar improvement in outcome has been shown when evaluating the effects of t - cpr if the identification of ohca is made correctly 2,3,6,9 , but evidence of this is not clear 10 . to report ohca uniformly , utstein - style definitions and it is suggested that dispatching centre variables should be included when reporting ohca variables to compare results and improve the quality of the whole ems system 12 . there are few previous reports concerning the dispatch process with dispatch response times for ohca 6,13,14 . patients who suffer a witnessed cardiac arrest , receive bystander cpr and who initially have a shockable rhythm have the best chances to survive ohca 1518 . ems reaching the patient within a short window of time is also imperative for survival . the aim of this study was to describe and report the dispatch process in bystander ( not ems)-witnessed ohca with initial shockable rhythm , and to determine whether recognition of cardiac arrest by the emd affects the outcome of these patients . this study was a prospective observational cohort study conducted in southern and eastern finland from 1 march 2010 to 31 august 2010 . it includes data on all patients in the study areas who at dispatch fulfilled the criteria of suspected ohca according to the national uniform emergency medical dispatch guidelines . further analyses were conducted on patients who experienced witnessed ( not ems ) ohca with initial shockable rhythm to minimize other confounding factors of survival . the overall population in the study area was 2 644 200 ( 49.1% of the total finnish population ) . the finnish dispatcher training involves 1.5 years of formal education in emergency - telephone - call processing and dispatching . eight regional dispatch centres are located within the study area , accessed through the common emergency number combined centres for ems , police and fire and rescue services , and they are connected to a common database . time points are registered automatically : the beginning of the emergency telephone calls , the dispatch of the first response unit and the time when the first unit is on scene . medical call processing and medical priority criteria are described in the dispatcher s guidebook and are based on the patient s chief complaint ( e.g. chest pain ) and on the patient s current condition ( e.g. awake or not ) . ems calls are prioritized into four categories from a to d , where a represents the highest medical priority . the dispatcher should quickly identify the site or the address of the emergency . to exclude cardiac arrest , the dispatcher initially verifies the patient s consciousness ( is the patient awake ? what is he / she doing right now ? ) and the presence of breathing ( is he / she breathing normally ? ) . if the answer to both questions is no , the dispatcher continues processing the call as a cardiac arrest call and uses a tiered response strategy to alert the closest and the most appropriate ems units to the scene . the dispatcher starts to give t - cpr instructions , unless cpr is already going on or the caller says he or she knows how to administer cpr . since the year 2000 , the t - cpr instructions have included only chest compressions unless the victim is a child or ohca is probably due to drowning or choking 4,19 . tieto oy ltd ( http://www.intensium.com/web/english ) has provided a uniform , common database to link the dispatch data to the data that were obtained from dedicated paper case reports ( crfs ) submitted by the ems crews that treated the patients . information on the beginning of the emergency call , dispatch and scene times , priority categories and dispatched units were electronically transferred from the dispatch centres to this database . the crfs were faxed to a research nurse who entered the data into this database and linked them to the dispatch data . data of bystander cpr were collected by the ems paramedics who were asked to report whether there was ongoing bystander cpr at arrival on the scene and whether it was based on dispatcher guidance or not . the principal investigator received information about the patient s status at the time of hospital discharge from the national institute for health and welfare ( discharged home or discharged to another facility ) . data regarding ohca survival at 1 year was obtained from the finnish population information system , which is a computerized national registry containing basic data about persons residing permanently in finland . the cerebral performance category ( cpc ) status of survivors was evaluated at 6 months after the ohca by a neurologist ( m.t . ) who called the patients or their close relatives . the association between categorical variables was assessed using cross tabulation and the -test . a p - value a logistic regression model was used to determine factors related to survival at 1 year . the dispatch centres received 885 338 emergency telephone calls during the 6-month study period . of these , 237 295 were medical ( 26.8% of all telephone calls ) , leading to 186 420 ems missions ( 78.6% of all medical telephone calls ) ( fig . the study flow chart . survival after 1 year could not be established in two patients who were discharged alive from hospital to their home countries . cpc , cerebral performance category ; ems , emergency medical service ; ohca , out - of - hospital cardiac arrest ; rosc , return of spontaneous circulation ; t - cpr , telephone - guided cardiopulmonary resuscitation . the ems crews considered resuscitation for 1042 patients ( 0.56% of all ems missions ) , and resuscitation was eventually attempted in 671 patients . of these , 164 patients had suffered bystander - witnessed ohca and had a shockable initial cardiac rhythm . the majority of these patients were presumed to have ohca of cardiac origin ( n=140 , 85.4% ) . the ohca took place mainly in an urban environment ( n=109 , 66.5% ) , whereas 15.9 and 17.7% occurred in semi - urban and rural areas , respectively . the dispatcher correctly recognized 82.3% ( n=135 ) of the 164 patients with witnessed ocha and in shockable rhythm during the emergency telephone call as cardiac arrests . of those not recognized , 29 ( 17.7% ) were primarily dispatched as other high - priority calls , that is , unconscious patient , chest pain or other cardiac symptom ( table 1 ) . reasons for dispatching for those not recognized as ohca by the dispatcher data of the dispatch process of the calls were received from 151 of the 164 missions with witnessed ohca with shockable rhythm . the median time from the beginning of the telephone call to the dispatch of the first ems unit was one minute ( iqr 12 min ) , and for the majority ( 90.7% ) of the calls , dispatch occurred within 2 min . for the survivors at 1 year , the dispatch time was less than 2 min in 30 patients ( 61.2% ) and more than 2 min in 19 patients ( 38.8% , p=0.345 ) . table 2 demonstrates a comparison of the dispatch response , cpr and survival data depending on whether the time from the beginning of the emergency telephone call to ems arrival on scene was within 8 min or not . when the ems response time was within 8 min , 53.9% of the patients were alive at hospital discharge , and when the time exceeded 8 min , the survival rate was 30.2% ( p<0.001 ) . although there were twice as many ( 41.4% ) patients alive in 1 year in the less than 8-min group compared with the more than 8-min group ( 21.0% ) , this number did not reach statistical significance ( p=0.09 ) . comparison of the response time within 8 min from the beginning of the emergency call to ems arrival on the scene and dispatch recognizing ohca , t - cpr instructions and cpr provided and survival table 3 shows the sex , dispatching times and outcomes for the ohca patients with shockable rhythm with or without dispatcher - recognized ohca . cpr was given more frequently among the patients in whom ohca was recognized ( 75.6 vs. 51.7% , p=0.01 ) . age , sex , dispatch , ems response , cpr before ems , rosc and survival with cpc recognized as ohca or not in the dispatch centre the overall survival to hospital discharge was 43.4% ( n=71 ) , and survival at 1 year was 32.9% ( n=54 ) . survival to hospital discharge was 44.4% ( n=60 ) when the dispatcher recognized ohca and 37.9% ( n=11 ) when it was missed ( p=0.521 ) . survival rates at 1 year were 32.6% ( n=44 ) and 27.6% ( n=8 ) , respectively , and there was no difference in the outcome at 1 year whether the ohca was recognized or not ( p=0.469 ) . of the patients surviving to hospital discharge , data of the cpc status at 6 months were available for 51 patients , and for 37 of these , cpc was 1 or 2 . in all , 117 patients ( 71.3% ) received bystander cpr before ems arrival , and the survival rates to hospital discharge and the survival at 1 year were 44.4% ( n=52 ) and 35.7% ( n=41 ) , respectively . of the 47 patients not receiving bystander cpr before ems , survival rates to hospital discharge and at 1 year were 40.4% ( n=19 ) and 27.7% ( n=13 ) , respectively . there was no difference in the survival to hospital discharge ( p=0.639 ) or at 1 year ( p=0.327 ) in relation to whether bystander cpr was given or not given before ems arrival . all of these patients received bystander cpr before ems arrival , and their survival to hospital discharge was 46.6% ( n=27 ) . in the logistic regression analysis , survival rates were higher at 1 year ( p=0.018 , odds ratio 2.82 , 95% confidence interval : 1.196.67 ) if the ems response was within 8 min . other variables tested were the type of municipality , whether t - cpr instructions were given , if the emergency call was processed within 2 minutes or not ( p=0.077 , odds ratio 0.48 , 95% ci : 0.211.082 ) , whether cpr was given before ems and whether ohca was recognized by emd . first , this study demonstrated that dispatchers in finland recognize ohca with high accuracy in the patient group with the best prognosis witnessed ohca with shockable initial rhythm . however , in this study , we found that this was not associated with increased survival to hospital discharge . second , a short response time from the beginning of the emergency telephone call to ems arrival on the scene was related to better survival for these patients . third , it seems that a majority of ohca patients in this subgroup received bystander cpr a proportion that probably can be increased by t - cpr instructions . previous studies have shown a high rate of recognition of ohca in finland by dispatchers , who correctly identified 7983% of ohca patients 6,7 . our study corroborated these results , showing a high identification rate of ohca . in a study by axelsson et al . the reason for such a low recognition rate could have been the national protocol , where the dispatch criteria were symptom - related rather than condition - related ( i.e. cardiac arrest ) . if the dispatcher clearly suspects ohca and wants to code the call as such , he / she has to create this in a free text rather than just launching the mission with a specific code . moreover , the study did not describe the emd training programme or the background of the dispatchers in sweden . could the lower rate of recognizing ohca patients be explained by differences in emd training ? the finnish nationwide emd protocol is based on questions that the dispatcher asks about what has happened and whether the patient is awake and breathing normally ( if the patient is not alert or breathing normally , the dispatch code is suspected cardiac arrest ) 21 . 22 showed a 200% increase in the recognition of cardiac arrest by dispatchers when these three questions were asked . however , in a finnish study 7 , it was shown that the dispatchers adhered to the protocol in only 52.4% of the calls , and still the sensitivity in recognizing ohca was high : more than 80% . the records of the emergency calls were reviewed , and they revealed that if the ohca was witnessed , the protocol was followed significantly more often than if it was unwitnessed . this , however , did not lead to an increased rate of correct identification in witnessed compared with unwitnessed ohca patients . if the protocol was followed , however , the dispatch time of the first response unit was shorter in witnessed ohcas ( median , 71 vs. 91 s , p<0.001 ) , which may have a profound effect on the outcome for these patients . it seems important that the protocol includes the question of the presence of normal breathing . 9 demonstrated that when the ohca was unrecognized , in 51% of the calls the dispatcher did not ask about the normality of breathing , and if asked , all ohcas would have been recognized . 23 . however , it is unrealistic to assume that an emd could yield 100% detection of cardiac arrest in a real - world setting . in this study , the unrecognized ohcas were mostly coded as unconscious ( n=10 ) , but the ems was still alerted at highest priority . there were also three traffic accidents that were a consequence of cardiac arrest , and three patients whose cardiac arrests were due to electric shock . in these situations , the dispatcher coded the emergency correctly , although the patient was having a cardiac arrest . this may be due to the fact that there was a high recognition rate of ohcas overall , or that the number of patients was too small to show differences in this setting . cpr was given more frequently to those whose ohca was recognized by the dispatcher ( 75.6 vs. 51.7% ) , p=0.01 , but this did not have an impact on the survival . it has been shown in several studies that cpr before ems increases survival rates two - fold to three - fold 24 . previous reports have also demonstrated the positive effect on the outcome when the dispatcher recognized the ohca during the emergency call 9,25 . thus , the size of our study group may lack the power to show the effects of bystander cpr or ohca recognition on the outcome . survival to hospital discharge was better for those patients who were reached by ems within 8 min from the time the emergency call was placed ( p<0.001 ) . a short delay from the call to ems arrival on the scene has been shown to improve the outcome in previous studies when treating ohca 15,2628 , and thus our results are similar to those reported previously . a time within 480 s ( 8 min ) from alerting ems to the ems response to the patient in life - threatening situations is a widely accepted indicator of ems performance ( cited 30 september 2013 at : www.eed-project.de ) and was also used in this study . this study showed that 32.3% of ohca patients were given dispatcher t - cpr instructions . in a previous study from finland by kuisma et al . korea , this number was 24.2% , with only 5.2% of the patients actually receiving cpr 29 . in another study , about one - third of ohca bystanders received t - cpr instructions 30 . in our study , the overall number of patients receiving bystander cpr was 71.3% . according to the finnish dispatcher protocol , the dispatcher does not give t - cpr instructions if the caller says that he / she knows how to perform cpr , or if cpr is already being administered . the quality of bystander cpr was not evaluated , and we received the information on whether or not t - cpr was administered from the paramedics , and not from the dispatch centre . this lack of quality of t - cpr data may have caused bias in the data when evaluating the effectiveness of t - cpr to the outcome . time points regarding the dispatch process were registered in minutes and not in seconds , which reduced the accuracy of the dispatching times . these data would have made it possible for researchers to evaluate the dispatching process thoroughly and analyse the unidentified ohca emergency calls and the protocol used by dispatchers during the call . the small size of the study group might lack the power to show statistical differences in outcomes . however , as shown in table 3 , there are fewer survivors ( return of spontaneous circulation , to hospital discharge and at 1 year ) if ohca is not recognized . this suggests that the correct recognition of cardiac arrest may further increase the chances of survival , a result that could be shown more clearly in a larger study group and with a longer follow - up . this study showed a high rate of recognition of ohca by dispatchers in finland , probably due to the national emd protocol and trained dispatchers . this did not , however , have an effect on the outcome in patients with witnessed cardiac arrest and initial shockable rhythm . if the time of the beginning of the emergency call to ems arrival at the patient s side was within 8 min , the patients were more likely to be alive at hospital discharge . this study showed a high rate of recognition of ohca by dispatchers in finland , probably due to the national emd protocol and trained dispatchers . this did not , however , have an effect on the outcome in patients with witnessed cardiac arrest and initial shockable rhythm . if the time of the beginning of the emergency call to ems arrival at the patient s side was within 8 min , the patients were more likely to be alive at hospital discharge .	objectiveto describe the dispatch process for out - of - hospital cardiac arrest ( ohca ) in bystander - witnessed patients with initial shockable rhythm , and to evaluate whether recognition of ohca by the emergency medical dispatcher ( emd ) has an effect on the outcome.methodsthis study was part of the finnresusci study focusing on the epidemiology and outcome of ohca in finland . witnessed [ not by emergency medical service ( ems ) ] ohca patients with initial shockable rhythm in the southern and the eastern parts of finland during a 6-month period from march 1 to august 31 2010 , were electronically collected from eight dispatch centres and from paper case reports filled out by ems crews.resultsof the 164 patients , 82.3% ( n=135 ) were correctly recognized by the emd as cardiac arrests . the majority of all calls ( 90.7% ) were dispatched within 2 min . patients were more likely to survive and be discharged from the hospital if the ems response time was within 8 min ( p<0.001 ) . telephone - guided cardiopulmonary resuscitation ( t - cpr ) was given in 53 cases ( 32.3% ) . overall survival to hospital discharge was 43.4% ( n=71 ) . survival to hospital discharge was 44.4% ( n=60 ) when the emd recognized ohca and 37.9% ( n=11 ) when ohca was not recognized . the difference was not statistically significant ( p=0.521).conclusionthe rate of recognition of cardiac arrest by emd was high , but emd recognition did not affect the outcome . the survival rate was high in both groups . recognized cardiac arrest patients received bystander cpr more frequently than those for whom ohca remained unrecognized .
You are an expert at summarizing long articles. Proceed to summarize the following text: however , the world health organization predicts that it will become the third leading cause of death by 2030 . according to a recent report,1 the priority of screening spirometry in asymptomatic patients has been reduced . however , a diagnostic pulmonary function test in symptomatic patients with wheezing , dyspnea , productive cough , or cough is needed ( especially in primary care clinics).2 until now , expensive , labor - intensive , and inconvenient spirometry has been an obstacle in copd diagnosis . in the united states , only 32% of copd patients undergo spirometry within 2 years before , or 6 months after , the diagnosis has been made.3 previously , we showed that only 27.5% of korean patients with airway obstruction who used copd - related health care facilities underwent spirometry.4 several studies518 have demonstrated that forced expiratory volume in 6 seconds of exhalation ( fev6 ) , and forced expiratory volume in 1 second ( fev1 ) of exhalation ratio with fev6 , can be used as convenient and accurate surrogates for forced vital capacity ( fvc ) and fev1/fvc , respectively . owing to its use of a 6-second expiratory maneuver , fev6 makes spirometry in the office easier , faster , and safer19 than fvc measurement . this theoretical basis enables primary care physicians to use hand - held spirometric devices such as piko-6 ( nspire health , inc . longmont , co , usa ) or copd-6 ( vitalograph ltd , ennis , co. , clare , ireland ) without having to employ expensive spirometry tests for the screening or diagnosis of copd , and by easily providing the values of fev at 1 and 6 seconds of exhalation . however , an identical cut - off value between fev1/fev6 and fev1/fvc can not be used for detecting airway obstruction because fev6 can not be greater than fvc . despite this controversy , some reports have argued that fev1/fev6 can reduce the sensitivity of detecting airway obstruction , especially in elderly patients with mild airway obstruction.20,21 therefore , other studies6 have submitted increased cut - off values ( 73%76% ) of fev1/fev6 for detecting airway obstruction to overcome these limitations . spirometry indices are influenced by age , height , sex , and ethnicity.22 therefore , discovering the cut - off value of fev1/fev6 for detecting airway obstruction in a nationwide , representative population sample in korea is worthwhile . the purpose of the present study was to ascertain the cut - off value of fev1/fev6 in place of fev1/fvc for detecting airway obstruction in a korean population . data for the present study were obtained from 5 years of the fifth and sixth korean national health and nutrition examination survey ( knhanes v vi ) , which was conducted between january 2010 and december 2014 . knhanes v vi employed a stratified , multiple - stage , clustered - probability design to select a representative sample of non - institutionalized civilians among a korean population . these data comprised information on age , ethnicity , sex , height , weight , and pre - bronchodilator spirometry values . a vmax 2130 dry rolling - seal spirometer ( sensormedics , yorba linda , ca , usa ) was employed . spirometry was undertaken by specially trained technicians according to recommendations set by the american thoracic society ( ats)/european respiratory society ( ers ) in 2005.23 data from a total of 14,978 individuals aged > 40 years who underwent complete pulmonary - function tests from knhanes v vi were selected for the present study . we analyzed data on fev1 , fev6 , and fvc from subjects with two or more acceptable spirometric performances . the study protocol was approved by the institutional review board of severance hospital ( approval number : 4 - 2006 - 0101 ) . written informed consent was obtained from patients or their next of kin . airway obstruction was defined as fev1/fvc < 70% as a fixed cut - off point according to guidelines set by the global initiative for chronic obstructive lung disease ( gold).24 severity of airway obstruction was classified as : mild ( 50% fev1 < 80% predicted , gold stage ii ) , severe ( 30% fev1 < 50% predicted , gold stage iii ) , and very severe in addition , normal lung function was defined as fev1/fvc 70% and fvc 80% predicted . ats / ers guidelines recommend use of reference equations derived from a representative sample of healthy individuals to determine the lower limit of normal ( lln ) , taking into account that spirometry indices are influenced by age , height , sex , and ethnicity . however , an officially recognized equation to use as a reference for pulmonary function in korea is lacking . hence , we used equations for fev1/fvc lln set by the esr / global lung initiative ( gli ) in 2012 . these equations were announced by an ers / gli taskforce , and were derived from data collected from healthy nonsmokers 3 to 95 years old from 33 countries ( including korea ) . ers / gli 2012 equations provided multiple - ethnicity values and the lln for spirometry.25 airway obstruction by fev1/fvc lln was defined as being below its lln in the presence of a normal fev1/fvc . baseline characteristics were summarized using numbers and percentages to describe categorical variables , and compared using the chi - squared test . continuous variables were compared using the student s t - test and are presented as the mean standard deviation ( sd ) . fev1/fev6 was determined for the highest collective sensitivity and specificity using a receiver operating characteristic ( roc ) curve for detecting airway obstruction . cohen s kappa coefficient ( ckc ) was used to evaluate agreement between fev1/fev6 and fev1/fvc . positive predictive value ( ppv ) and negative predictive value ( npv ) were calculated for the most suitable fev1/fev6 threshold for the diagnosis of fev1/fvc < 70% . data for the present study were obtained from 5 years of the fifth and sixth korean national health and nutrition examination survey ( knhanes v vi ) , which was conducted between january 2010 and december 2014 . knhanes v vi employed a stratified , multiple - stage , clustered - probability design to select a representative sample of non - institutionalized civilians among a korean population . these data comprised information on age , ethnicity , sex , height , weight , and pre - bronchodilator spirometry values . a vmax 2130 dry rolling - seal spirometer ( sensormedics , yorba linda , ca , usa ) was employed . spirometry was undertaken by specially trained technicians according to recommendations set by the american thoracic society ( ats)/european respiratory society ( ers ) in 2005.23 data from a total of 14,978 individuals aged > 40 years who underwent complete pulmonary - function tests from knhanes v vi were selected for the present study . we analyzed data on fev1 , fev6 , and fvc from subjects with two or more acceptable spirometric performances . the study protocol was approved by the institutional review board of severance hospital ( approval number : 4 - 2006 - 0101 ) . written informed consent was obtained from patients or their next of kin . airway obstruction was defined as fev1/fvc < 70% as a fixed cut - off point according to guidelines set by the global initiative for chronic obstructive lung disease ( gold).24 severity of airway obstruction was classified as : mild ( 50% fev1 < 80% predicted , gold stage ii ) , severe ( 30% fev1 < 50% predicted , gold stage iii ) , and very severe in addition , normal lung function was defined as fev1/fvc 70% and fvc 80% predicted . a restrictive spirometric pattern was defined as fev1/fvc 70% and fvc < 80% predicted . ats / ers guidelines recommend use of reference equations derived from a representative sample of healthy individuals to determine the lower limit of normal ( lln ) , taking into account that spirometry indices are influenced by age , height , sex , and ethnicity . however , an officially recognized equation to use as a reference for pulmonary function in korea is lacking . hence , we used equations for fev1/fvc lln set by the esr / global lung initiative ( gli ) in 2012 . these equations were announced by an ers / gli taskforce , and were derived from data collected from healthy nonsmokers 3 to 95 years old from 33 countries ( including korea ) . ers / gli 2012 equations provided multiple - ethnicity values and the lln for spirometry.25 airway obstruction by fev1/fvc lln was defined as being below its lln in the presence of a normal fev1/fvc . data were analyzed using sas v9.2 ( sas institute inc . , cary , nc , usa ) . baseline characteristics were summarized using numbers and percentages to describe categorical variables , and compared using the chi - squared test . continuous variables were compared using the student s t - test and are presented as the mean standard deviation ( sd ) . fev1/fev6 was determined for the highest collective sensitivity and specificity using a receiver operating characteristic ( roc ) curve for detecting airway obstruction . cohen s kappa coefficient ( ckc ) was used to evaluate agreement between fev1/fev6 and fev1/fvc . positive predictive value ( ppv ) and negative predictive value ( npv ) were calculated for the most suitable fev1/fev6 threshold for the diagnosis of fev1/fvc < 70% . among the 14,978 participants , 6,515 ( 43.5% ) were male and 2,104 ( 14.0% ) had airway obstruction . a total of 1,018 ( 6.8% ) participants were classified as having mild obstruction , 996 ( 6.6% ) with moderate obstruction , 80 ( 0.5% ) with severe obstruction , and ten ( 0.1% ) with very severe obstruction according to spirometry values . airway obstruction was more prevalent in male than in female participants ( table 1 ) . according to the airway obstruction with fev1/fvc < 70% , an roc curve was used to determine the best corresponding cut - off for fev1/fev6 ( figure 1 ) . the area under the roc curve was 0.989 ( 95% confidence interval [ ci ] : 0.9870.990 ) . the fev1/fev6 cut - off corresponding to the greatest sum of sensitivity and specificity was 75% . table 2 shows the sensitivities and specificities of different thresholds of fev1/fev6 for prediction of fev1/fvc < 70% . when choosing an fev1/fev6 cut - off of 70% , specificity reached 100% but the sensitivity dropped to 44.1% . a fixed cut - off of fev1/fev6 < 76% showed high sensitivity ( 98.0% ) and specificity ( 90.8% ) but a low ppv ( 63.6% ) . when using a fixed cut - off fev1/fev6 of 75% , sensitivity of 93.8% , specificity of 94.8% , ppv of 74.7% , npv of 98.9% , accuracy of 94.7% , and ckc of 0.8 , ( 95% ci : 0.7860.814 ) were obtained , suggesting very good agreement between fev1/fev6 and fev1/fvc . when using a fixed cut - off of fev1/fev6 < 75% , the number of false - positive cases was 670 ( 5.2% ) and false - negative cases was 130 ( 6.2% ) ( table 3 ) . in particular , false - negative cases were included in mild ( n=102 ) and moderate ( n=28 ) airway - obstruction groups ( table 4 ) . to detect airway obstruction , we compared fev1/fvc lln with a fixed cut - off of fev1/fvc < 70% or fev1/fev6 < 75% . when choosing a fixed cut - off of fev1/fvc < 70% and fev1/fev6 < 75% , the prevalence of obstruction was 14.1% and 17.7% , respectively . compared with fev1/fvc lln , a fixed cut - off of fev1/fvc < 70% showed 99.0% sensitivity , 92.6% specificity , 93.1% accuracy , 51.1% ppv , and 99.9% npv . a fixed cut - off of fev1/fev6 < 75% showed 99.9% sensitivity , 88.8% specificity , 89.6% accuracy , 41.0% ppv , and 99.9% npv ( table 5 ) . when grouped together according to age and fev1 ( % ) , a fixed cut - off of fev1/fev6 < 75% was used to diagnose more airway obstruction in older individuals and those with mild moderate stages ( table 6 ) . with increasing age and severity of obstruction , the mean difference between fev1/fev6 and fev1/fvc was increasingly larger because fev6 was increasingly smaller than fvc . however , with increasing age , the mean difference between fev1/fvc lln and fev1/fvc or fev1/fev6 showed only a slight difference . with increasing severity of obstruction , the mean difference between fev1/fvc lln and fev1/fev6 was larger than the mean difference between fev1/fvc lln and fev1/fvc at mild moderate stages of airway obstruction , but that was smaller than that at severe and very severe stages ( figures 2 and 3 ) . among the 14,978 participants , 6,515 ( 43.5% ) were male and 2,104 ( 14.0% ) had airway obstruction . a total of 1,018 ( 6.8% ) participants were classified as having mild obstruction , 996 ( 6.6% ) with moderate obstruction , 80 ( 0.5% ) with severe obstruction , and ten ( 0.1% ) with very severe obstruction according to spirometry values . airway obstruction was more prevalent in male than in female participants ( table 1 ) . according to the airway obstruction with fev1/fvc < 70% , an roc curve was used to determine the best corresponding cut - off for fev1/fev6 ( figure 1 ) . the area under the roc curve was 0.989 ( 95% confidence interval [ ci ] : 0.9870.990 ) . the fev1/fev6 cut - off corresponding to the greatest sum of sensitivity and specificity was 75% . table 2 shows the sensitivities and specificities of different thresholds of fev1/fev6 for prediction of fev1/fvc < 70% . when choosing an fev1/fev6 cut - off of 70% , specificity reached 100% but the sensitivity dropped to 44.1% . a fixed cut - off of fev1/fev6 < 76% showed high sensitivity ( 98.0% ) and specificity ( 90.8% ) but a low ppv ( 63.6% ) . when using a fixed cut - off fev1/fev6 of 75% , sensitivity of 93.8% , specificity of 94.8% , ppv of 74.7% , npv of 98.9% , accuracy of 94.7% , and ckc of 0.8 , ( 95% ci : 0.7860.814 ) were obtained , suggesting very good agreement between fev1/fev6 and fev1/fvc . when using a fixed cut - off of fev1/fev6 < 75% , the number of false - positive cases was 670 ( 5.2% ) and false - negative cases was 130 ( 6.2% ) ( table 3 ) . in particular , false - negative cases were included in mild ( n=102 ) and moderate ( n=28 ) airway - obstruction groups ( table 4 ) . to detect airway obstruction , we compared fev1/fvc lln with a fixed cut - off of fev1/fvc < 70% or fev1/fev6 < 75% . however , when choosing a fixed cut - off of fev1/fvc < 70% and fev1/fev6 < 75% , the prevalence of obstruction was 14.1% and 17.7% , respectively . compared with fev1/fvc lln , a fixed cut - off of fev1/fvc < 70% showed 99.0% sensitivity , 92.6% specificity , 93.1% accuracy , 51.1% ppv , and 99.9% npv . a fixed cut - off of fev1/fev6 < 75% showed 99.9% sensitivity , 88.8% specificity , 89.6% accuracy , 41.0% ppv , and 99.9% npv ( table 5 ) . when grouped together according to age and fev1 ( % ) , a fixed cut - off of fev1/fev6 < 75% was used to diagnose more airway obstruction in older individuals and those with mild moderate stages ( table 6 ) . with increasing age and severity of obstruction , the mean difference between fev1/fev6 and fev1/fvc was increasingly larger because fev6 was increasingly smaller than fvc . however , with increasing age , the mean difference between fev1/fvc lln and fev1/fvc or fev1/fev6 showed only a slight difference . with increasing severity of obstruction , the mean difference between fev1/fvc lln and fev1/fev6 was larger than the mean difference between fev1/fvc lln and fev1/fvc at mild moderate stages of airway obstruction , but that was smaller than that at severe and very severe stages ( figures 2 and 3 ) . fev1/fev6 and fev6 are reliable surrogates for fev1/fvc and fvc to identify obstruction and restriction using spirometry . however , in previous studies , the cut - off values of fev1/fev6 for detecting airway obstruction were different among lln or fixed ratios ( 70%76%).6 lln for fev1/fev6 is the most accurate for detecting airway obstruction , but many countries do not have pulmonary function reference equations of lln for fev1/fev6 for local ethnic groups . nevertheless , primary care clinicians have used handheld spirometric devices such as piko-6 or copd-6 without proper reference values for fev1/fev6 . these two devices are inexpensive , and require less quality control of equipment , and no experienced personnel to carry out tests and analyses . the main purpose of the present study was to determine a fixed cut - off value for fev1/fev6 as a surrogate for fev1/fvc for detecting airway obstruction in a korean population . first , a fixed cut - off for fev1/fev6 as a good surrogate for fev1/fvc for detecting airway obstruction in a korean population was 75% with 93.8% sensitivity , 94.8% specificity , 74.7% ppv , 98.9 npv , and good ckc ( 0.8 ) . second , a raised fixed cut - off value of fev1/fev6 < 75% to improve sensitivity showed the tendency to over - diagnosis in the mild moderate airflow limitation group compared with fev1/fvc<70% were observed in the mild moderate airflow limitation group compared with fev1/fvc . therefore , a raised and fixed cut - off value of fev1/fev6 < 75% should be used with caution in older individuals or those with mild moderate airflow limitation because this cut - off value can lead to over - diagnosis rather than under - diagnosis for airway obstruction screening . a fixed ratio of cut - off led to greater over - diagnosis in patients with mild airflow limitation than lln , but it was less - time consuming , easier , and safer for patients . additionally , recording fev6 was more reproducible than fvc , less physically demanding for patients , and the results were more clear at the end of the test.22 in a study in belgium , a fixed cut - off of fev1/fev6 of < 73% showed 94.4% sensitivity , 93.3% specificity , 92.2% ppv , and 95.2% npv.11 jing et al showed , in a meta - analysis , that the efficacy of fev1/fev6 is not affected adversely by the choice of cut - off point,6 but an appropriate clinical guideline for using fev1/fev6 in place of fev1/fvc is needed . according to one study,26 the cut - off value of pre - bronchodilator fev1/fev6 < 70% had 91.4% sensitivity , 100% specificity but a 91.4% ppv and 87.4% npv in 353 koreans aged > 65 years . however , this cut - off value of pre - bronchodilator fev1/fev6 < 70% can not be relied upon because the data were from a small study cohort with only older participants ; thus the results were not applicable to a general population . further , a cutoff value of a fixed ratio of fev1/fvc < 70% can not be applied because fev6 can not be greater than fvc otherwise , airway obstruction may be underestimated . because an appropriate study on the cut - off of fev1/fev6 for airway obstruction in a korean population had not been carried out , a revised clinical guideline27 for copd in korea published in 2014 recommended a cut - off of fev1/fev6 of 73% for detecting airway obstruction based on studies undertaken outside korea.24,27 our study showed that 75% as a fixed value of fev1/fev6 in analyses of roc curves was the cut - off point with the best combination of sensitivity and specificity and a good surrogate for fev1/fvc < 70% . prevalence of airway obstruction was 17.7% when using fev1/fev6 < 75% and 14.1% with fev1/fvc < 70% . rosa et al found that fev1/fev6 < 75% showed 89.0% sensitivity , 95.4% specificity , 85.2% ppv , and 96.7% npv in pre - bronchodilator curves , results that were similar to our research.28 a total of 620 ( 5.2% ) false - positive values and 130 ( 6.2% ) false - negative values were observed ( table 3 ) . in the subgroup analysis , 130 false - negative cases showed a mean difference of fev1/fvc and fev1/fev6 , with a respective lln of 4.4% ( sd = 2.0 ) and 11.4% ( sd = 2.1 ) . they were classified as gold stages i and ii because reduced end - expiratory flow and expiratory time > 6 seconds might have occurred in the initial stage of airflow limitation ( table 4 ) . a total of 620 false - positive cases showed a mean difference of fev1/fvc and fev1/fev6 with a respective lln of 4.8% ( sd = 2.9 ) and 6.8% ( sd = 2.8 ) . this finding might have been due to different fixed cut - off values between fev1/fvc < 70% and fev1/fev6 < 75% . the main strength of our study was that we obtained results from a representative sample of noninstitutionalized civilians among a korean population using a stratified , multiple - stage , clustered - probability design . first , lung function data from prebronchodilator spirometric values might have inadvertently included asthma patients , and hence be skewed . carrying out postbronchodilator spirometry in a large second , the absence of data on smoking history , previously diagnosed diseases ( eg , copd , asthma , tuberculosis , and bronchiectasis ) in our study could have resulted in abnormal values for airway obstruction . so our results for detecting of airway obstruction were not limited to copd , asthma , or other obstructive disease . third , there were no available data on fev1/fev6 lln because a pulmonary reference equation for fev6 for a korean population is lacking . hence , we could not obtain a cut - off value of fev6 in place of fvc for detecting restrictive pulmonary patterns . finally , the fixed cut - off value of fev1/fev6 < 75% should be verified with handheld spirometric devices with good repeatability , as in other studies,18 and not only with office spirometry . a fixed cut - off for fev1/fev6 as a good surrogate for fev1/fvc for detecting airway obstruction was 75% in a korean population . however , a fixed cut - off value of fev1/fev6 < 75% should be used with caution in older individuals and in those with mild moderate airflow obstruction .	backgroundforced expiratory volume in 1 second ( fev1)/forced expiratory volume in 6 seconds ( fev6 ) has been proposed as an alternative to fev1/forced vital capacity ( fvc ) for detecting airway obstruction . a fixed cut - off value for fev1/fev6 in a korean population is lacking . we investigated a fixed cut - off for fev1/fev6 as a surrogate for fev1/fvc for detecting airway obstruction.materials and methodswe used data obtained in the 5 years of the fifth and sixth korean national health and nutrition examination survey . a total of 14,978 participants aged 40 years who underwent spirometry adequately were the study cohort . airway obstruction was a fixed cut - off fev1/fvc < 70% according to the global initiative for chronic obstructive lung disease guidelines . we also used european respiratory society / global lung initiative 2012 equations for the fev1/fvc lower limit of normal.resultsamong the 14,978 participants ( 43.5% male , 56.5% female ; mean age : 56.9 years for men and 57.0 years for women ) , 14.0% had obstructive lung function according to a fixed cut - off fev1/fvc < 70% . optimal fev1/fev6 cut - off for predicting fev1/fvc < 70% was 75% using receiver operating characteristic curve analyses ( area under receiver operating characteristic curve = 0.989 , 95% confidence interval 0.9870.990 ) . this fixed cut - off of fev1/fev6 showed 93.8% sensitivity , 94.8% specificity , 74.7% positive predictive value , 98.9% negative predictive value , and 0.8 cohen s kappa coefficient . when compared with fev1/fvc < lower limit of normal , fev1/fev6 < 75% tended to over - diagnose airflow limitation ( just like a fixed cut - off of fev1/fvc < 70% ) . when grouped according to age and fev1 ( % ) , fev1/fev6 < 75% diagnosed more airway obstruction in older participants and mild moderate stages compared with fev1/fvc < 70%.conclusiona valid fixed cut - off for detecting airway obstruction in a korean population is fev1/fev6 of 75% , but should be used with caution in older individuals and those with mild moderate airway obstruction .
You are an expert at summarizing long articles. Proceed to summarize the following text: benidipine is a triple calcium channel blocker , simultaneously blocking l , t , and n type channels . it is reported that the effect on t channel is stronger than that on l channel , making it a great potential protection for kidney . a number of studies explored the rho signaling pathway , renal interstitial fibrosis , and tubular epithelium cell transdifferentiation ( emt ) [ 24 ] . the blocking of t calcium channel ( tcc ) was reported to inhibit the activity of rho kinase , and this is essential in podocyte effacement in immune complex - mediated glomerular disease and other kidney injuries . furthermore , under cellular stress , rho kinase activation results in cytoskeletal rearrangement , stress fiber formation , and loss of cellular integrity and function . these suggested that blocking t channel may have a protective effect on diabetic kidney and reduce epithelium - mesenchymal transdifferentiation and fibrosis via inhibiting rock1 ( rho kinase 1 ) activity . it was suggested that fasudil , a rho kinase inhibitor , may attenuate emt through reduced activation of rhoa / rock signaling and be a renoprotective agent for the treatment of dn . based on that , in this study , we proposed that by inhibiting rho kinase activity , benidipine reduces epithelium - mesenchymal transdifferentiation and protects kidney in rats with type 1 diabetes ( t1 dm ) . by treating type 1 diabetic rats with benidipine and using rho kinase inhibitor fasudil as positive control , we studied the effects of benidipine on the activity of rho kinase and emt in diabetic nephropathy in vivo . eight - week old male wistar rats weighed at 180200 g ( spf class ) were supplied by the center for animal experiment of wuhan university ( produce permission no . rabbit antibody p - mypt1 ( p853 ) and e - cadherin antibody were purchased from bioworld technology , usa , rock1 antibody was purchased from santa cruz , usa , rabbit antibody -sma from sigma , usa , secondary antibody for internal control protein from santa cruz , usa , enzyme - labeling secondary antibody from sigma usa , streptozocin ( stz ) from sigma usa , hydrochloride fasudil injection from tianjin hongri pharmaceutical inc . ( lot : 070525 ) , benidipine from japanese kyowa hakko kogyo co. , ltd . ( lot : 119afi ) , anti - rabbit / rat universal immunohistochemistry kit from denmark ( dako ) , protein extraction buffer from shanghai xinghan ( dbi ) , real - time pcr master mix from japanese toyobo biotech , real - time fluorescence pcr equipment from biorad usa , and the analysis software for fluorescence quantitation was purchased from icycler ( version 3.1.7050 ) . fifty - four spf male wistar rats were fed with normal chow diet , had free access to water , with room temperature of 20~25c and relative humidity of 40%~70% , and were in the 12 h light - dark cycle . the rats were randomly assigned into normal group ( n = 8) and diabetic model group ( n = 46 ) . after a one - week adaption , the model group was injected intraperitoneally with a single dose of streptozocin ( stz ) 60 mg / kg ( dissolved in 10 mmol / l citrate buffer , ph 4.5 ) , after a 12-hour fasting . seventy - two hours after the injection , blood glucose was tested with the samples from tail vein for 3 consecutive days . the criteria for diabetic models were as follows : nonfasting blood glucose is 11.1 mmol / l ( all was 16.7 mmol / l in this study ) , urine output exceeds the controls over 50% , and urine glucose is strongly positive . during the procedure , 3 rats died and 6 did not meet the criteria . thirty - seven diabetic rats were randomly assigned into three groups : diabetic without treatment ( d , n = 13 ) , diabetic treated with fasudil ( f , n = 12 ) , and diabetic treated with benidipine ( b , n = 12 ) . fasudil was injected intraperitoneally with 10 mg / kg / d ; benidipine was dissolved in 0.3% carboxymethyl cellulose solution and given via gastric tubing with 3 mg / kg / d . after three months , 8 rats in n group , 9 in d group , 9 in f group , and 8 in b group survived and were sacrificed accordingly . one day prior to the sacrifice , 24-hour urine was collected in metabolic chamber . on the same day of sacrifice , tail artery blood pressure was measured with noninvasive blood pressure meter and blood samples were collected . after rinsing with normal saline , some of the kidney tissues were fixed with 10% neutral formalin , embedded with paraffin , made into 3 m slides , and stained with he for pathological analysis . twenty - four - hour urine protein quantification was measured with sulfosalicylic acid method ; serum creatinine ( scr ) was tested with picric acid method ; blood glucose was tested with glucose oxidase method ; and nag activity was measured with colorimetry as described previously . deparaffin the slides routinely , heat repair with microwave , incubate in 3% peroxide at room temperature for 15 minutes , and rinse with pbs ( ph 7.4 ) for three times , 5 minutes for each . add rabbit antibody p - mypt1 ( 1 : 50 ) , -sma ( 1 : 50 ) , and e - cadherin ( 1 : 100 ) antibody , respectively , and incubate at 4c overnight . incubate with horseradish peroxidase - labeled chemmatetmenvision secondary antibody at room temperature for 45 minutes , detect with dab , repeat staining with he , dehydrate , and seal the film with transparent plastic membrane . the total proteins of kidney tissues were extracted with total protein extraction kit . the protein concentration was analyzed with uv spectrophotometry at 260 nm wavelength . thirty g of total protein was loaded for sds - page electrophoresis , then was transferred to nitrocellulose membrane , and then was observed with ponceau s staining . wash with pbs , then add rabbit anti - rat p - mypt1 ( 1 : 1000 ) , rock1 ( 1 : 400 ) , -sma ( 1 : 400 ) , e - cadherin ( 1 : 1000 ) , and -actin ( 1 : 1000 ) , respectively , and incubate overnight . and then incubate with 1 : 2000 hrp - labeled goat anti - rabbit igg . detect with chromogenic agent and expose the film . scan the image and analyze absorbance with computer software . take the kidney cortex tissue 0.1 g from each rat , extract total rna with trizol , and remove genomic dna with dnase i. reverse rna and obtain cdna . the fluorescence pcr quantification of cdna was performed with sybr green , with triplets for each sample per protocol . the total volume of each reaction was 30 l , with the following condition : 95c for 3 min for predenature , then 95c for 20 s , 60c for 20 s , and 72c for 30 s and repeat for 35 cycles , and then 72c for 5 min . take the ct ratio of each sample to internal control as the relative value of the gene expression of this sample . normal distributed quantitative variables were presented as mean sd . comparison among groups was performed with anova , snk , and lsd tests . abnormally distributed variables were log - transformed into normal distributed variables and then analyzed thereafter ; data were presented with median . as shown in table 2 , at 12 weeks , compared with n group , d group had elevated 24-hour urine protein , nag activity , scr ( p < 0.05 ) , and decreased ccr ( p < 0.05 ) . compared with d group , f group had decreased 24-hour urine protein , nag activity , and scr ( p < 0.05 ) . there was no significant difference between f and b groups . there was no significant difference for blood pressure or glucose among groups , as shown in table 3 . compared with n and f groups , d group had significant expanded glomerular mesangial matrix , increased cell number , thickened basement membrane , with multiple inflammatory cells infiltrated in interstitial space , dilated renal tubular , and fibrosis in interstitial space . there were mild proliferation of glomerular mesangial matrix , inflammatory infiltration , tubular dilatation , and fibrosis in f and b groups , as shown in figure 1 . the expression of rock1 showed trace in tubular epithelium cells in n group , was enhanced in d group which mainly distributed in dilated renal tubular , and was reduced in f and b groups . -sma was presented in the smooth muscle cells of renal small artery in n group and visible in epithelium of renal tubular in d group with majority expressed in medullar area but no expression in f or d group . e - cadherin was mainly presented in the epithelium cells of renal tubular in n group , especially in the cell conjunction area , with partial expression for f and b groups which was enhanced at the cell junction area but no expression on tubular epithelium in d group , as shown in figure 2 . as shown in figure 3 , compared with n group , the rats in d group had enhanced protein expressions of p - mypt1 , rock1 , and -sma in renal cortex but reduced e - cadherin . compared with d group , f group and b group had reduced protein expressions for p - mypt1 , rock1 , and -sma and enhanced e - cadherin which was still less than that of the normal group . there was no significant difference between f and b groups , as shown in figure 3 and table 4 . compared with n group , mrna expression of rock1 in renal cortex was increased in d group . compared with d group , there was less mrna expression of rock1 in f and b groups , lower than normal , as shown in figure 4 . in this study , by treating rats with type 1 diabetic nephropathy with benidipine , a triple channel blocker , and fasudil , a rho kinase inhibitor , we successfully investigated the effect of benidipine on epithelium - mesenchymal transdifferentiation and its possible mechanism via inhibiting rho kinase activity . these results were consistent with some previous studies . rock directly affects myosin light chain ( mlc ) or indirectly affects the target subunit of myosin phosphatase ( mypt1 ) and thus increases the phosphorylation of mlc in plasma and controls the attachment , chemoattractant , contraction , and so forth . fasudil is a rock - specific inhibitor and inhibits rock activity by competitively combining atp sites of rock catalytic domain . rocki and rockii were both reported . in kidney tissues , rocki is the major one presented . recent studies revealed that abnormal activation of rock signaling pathway played a very important role in the pathophysiology of all kinds of complications of diabetes [ 13 , 14 ] . our study confirmed that there was rock activation in renal tubular epithelium cells of 12 weeks of diabetic rats , and the effects of rock on diabetic renal interstitial space were through rock1 . further study found that the protein expression of e - cadherin , the marker protein of renal tubular epithelium cells , was downregulated in diabetic rats , while the protein expression of -sma , the marker protein of myofibrillar cells , was upregulated , indicating that there was emt in diabetic nephropathy of rats . benidipine or fasudil can significantly inhibit nag activity , reduce urine protein and scr level , decrease the expression of p - mypt1 , rock1 , and -sma , and increase the expression of e - cadherin without affecting blood glucose or pressure . benidipine has protective effect on diabetic nephropathy of rats , independent of its effect of lowering blood pressure . tcc is a low - voltage activated channel , mainly located in renal efferent arterioles and pacing cells of the heart . through its strong blocking effects on tcc , benidipine dilates renal afferent and efferent arterioles equally and thus effectively reduces the resistance of renal vessels and intrarenal pressure . it is showed that , besides its effects on adjusting capillary pressure of glomerular , tcc has many nonhemodynamic effects [ 1619 ] . it regulates the activity of nf - k and thus inhibits inflammation , promotes the secretion and release of aldosterone , improves the remodeling of the heart and kidney , and anti - oxygenize and anti - proliferate [ 2023 ] . it is found that in the subremoval kidney models , by inhibiting rho kinase activity , selective t channel blocker improves renal interstitial fibrosis and emt . however , there are limitations of our study ; the sample size was rather small , and it is a study in animals instead of human being . in summary , our study is the first study suggesting that benidipine protects kidney in rats with type 1 diabetes , possibly through its effect of inhibiting rho kinase activity and thus reducing epithelium - mesenchymal transdifferentiation ( emt ) . this may guide further animal studies , clinical trials on the importance of benidipine in diabetic emt development especially in type 1 diabetic , and the possible mechanism involved . from the long run , it may direct the clinical use of benidipine in treating patients with diabetic nephropathy especially those in t1 dm .	we investigated the protective effect of benidipine , by testing the changes of the activity of rho kinase and transdifferentiation of renal tubular epithelium cells in vivo . wistar rats were randomly divided into two groups : normal ( n ) and diabetes . stz were used to make the rats type 1 diabetic and were randomly assigned as diabetes without treatment ( d ) , diabetes treated with benidipine ( b ) , and diabetes treated with fasudil ( f ) and treated for 3 months . immunohistochemistry and western blotting were for protein expressions of rock1 , -sma , and e - cadherin and real - time pcr for the mrna quantification of rock1 . compared with n group , d group had significant proliferation of glomerular mesangial matrix , increased cell number , thickened basement membrane , widely infiltrated by inflammatory cells and fibrosis in the renal interstitial , and dilated tubular . those presentations in f and b groups were milder . compared with n group , d group showed elevated mypt1 phosphorylation , increased expression of rock1 , -sma protein , and rock1 mrna and decreased expression of e - cadherin protein . b group showed attenuated mypt1 phosphorylation , decreased rock1 , -sma protein , and rock1 mrna expression and increased expression of e - cadherin protein . in conclusion , benidipine reduces the epithelium - mesenchymal transdifferentiation and renal interstitial fibrosis in diabetic kidney by inhibiting rock1 activity .
You are an expert at summarizing long articles. Proceed to summarize the following text: four different types of dendritic cells exist in lymph nodes , namely , histiocytic , fibroblastic , interdigitating , and follicular cells . their main function is the presentation of antigens and the generation and regulation of the germinal center reaction . follicular dendritic cells participate in the immune system by presenting antigens for b cells and by stimulating b cell proliferation and differentiation . these cells are localized to areas of b cells in the germinal centers of lymphoid follicles . interdigitating dendritic cells participate in the immune system by stimulating t lymphocytes and are found in the t cell areas of peripheral lymphoid tissues ( 1 - 3 ) . dendritic cell neoplasms are rare tumors , though they are being recognized with increasing frequency . they were previously classified as lymphomas , sarcomas , or histiocytic neoplasms . however , the world health organization ( who ) classified dendritic cell neoplasms into five groups : langerhans cell histiocytosis ( lch ) , langerhans cell sarcoma ( lcs ) , interdigitating dendritic cell sarcoma / tumor ( idcs ) , follicular dendritic cell sarcoma / tumor ( fdcs ) , and dendritic cell sarcoma , not specified otherwise ( 4 ) . idcs are infrequent neoplasms , and therefore , a limited number of cases have been reported . although most arise in lymph nodes , rare cases of idcs have been described in extranodal sites , such as the spleen , small intestine , nasopharynx , skin , testis , ovary , urinary bladder , and tonsils ( 5 - 12 ) . here , we report a case of extranodal idcs presenting in the pleura , a hitherto unreported site . on october 1st , 2009 , a 32-yr - old man visited the outpatient clinic with a 1-month history of progressively worsening blood - tinged sputum and chest pain . the patient had worked in a small educational institute for three years , and was currently working as a company employee . however , he denied exposure to asbestos . on physical examination , hepatosplenomegaly and peripheral lymphadenopathy were absent , but a chest examination revealed retraction and tenderness of the left chest wall . laboratory testing revealed hemoglobin 12.3 mg / dl , white cell count 11,100/l , and platelet count 519 10/l . computed tomography ( ct ) of the chest showed irregular pleural thickening and pleural effusion in the left lung ( fig . an incisional biopsy of pleura was performed , and histologic findings suggested a malignant undifferentiated tumor . the tumor cells had oval to spindled nuclei , and indented nuclei were frequently observed . the cytoplasm of the tumor cells was abundant and slightly eosinophilic with an indistinct border ( fig . , immunohistochemistry was performed on the benchmark automated immunostaining system ( ventana medical system , tuscon , az , usa ) . the monoclonal antibodies used were the following : s100 ( 1:800 ; dako , glostrup , demark ) , vimentin ( 1:200 ; dako ) , cd45 ( 1:100 ; leica , newcastle - upon - tyne , uk ) , ck ( 1:600 ; leica ) , myeloperoxidase ( 1:200 ; leica ) , hmb45 ( 1:150 ; leica ) , cd1a ( 1:20 ; leica ) , cd20 ( 1:200 ; leica ) , cd21 ( 1:60 ; leica ) , cd23 ( 1:100 ; leica ) , cd31 ( 1:300 ; leica ) , cd34 ( 1:20 ; leica ) , cd56 ( 1:150 ; leica ) , ck5 ( 1:300 ; leica ) , wt-1 ( 1:40 ; leica ) , calretrenin ( 1:100 ; leica ) , cd68 ( 1:600 ; dinona , iksan , korea ) , cd3 ( 1:300 ; neo , fremont , usa ) , cd35 ( 1:50 ; cell marque , rocklin , ca , usa ) , and ck6 ( 1:50 ; thermo , fremont , ca , usa ) . 3 ) , vimentin , and cd68 , but negative for cytokeratin ( epithelial cell marker ) , myeloperoxidase ( myeloid cell marker ) , hmb45 ( melanoma marker ) , cd1a ( lcs marker ) , cd3 ( t - cell marker ) , cd20 ( b - cell marker ) , cd21 , cd23 , cd35 ( fdcs marker ) , cd31 ( vascular endothelial cell marker ) , cd34 ( myeloid stem cell marker ) , cd56 ( neuroendocrine cell marker ) , ck5 , ck6 , wt-1 , and calretrenin ( mesothelioma marker ) . the patient underwent a positron emission tomography ( pet)-ct scan , which revealed 18-fluoro - deoxyglucose ( fdg ) uptake in the thickened pleura and whole axial skeleton ( standardized uptake value ( suv ) ; 10.5 and 9.8 ) compatible with malignant tissue ( fig . subsequently , the patient was treated with two courses of chop ( cyclophosphamide , doxorubicin , vincristine , prednisone ) and one course of imep ( ifosfamide , methotrexate , etoposide , prednisolone ) . however , the pleura - based masses were aggravated , and he died of progressive disease 3 months after diagnosis . tumors arising from dendritic cells , such as , fdcs and idcs , are very rare . fewer than two hundreds of cases have been reported to date ( 4 ) , and only 37 cases of idcs have been reported in the english literature ( 5 ) . idcs usually is encountered in a lymph node , but extranodal idcs is rare and can occur in a wide variety of sites ( 5 - 12 ) . the recognition of extranodal idcs requires a high index of suspicion because of its rarity . we present a case of extranodal idcs in the pleura that was diagnosed using a combination of morphologic and immunophenotypic characterizations . as far as we know , only one case of idcs with pleural effusion has been reported , in which malignant pleural effusion occurred during disease course in a idcs patient presented with multiple lymphadenopathies ( 13 ) . moreover , the reported case might not be idcs due to its expression of surface cd1a in the tumor cells . to the best of our knowledge , this is the first case report to describe extranodal idcs initially presented with diffuse pleural involvement . the diagnosis was confirmed histologically on slides stained with hematoxylin and eosin and a wide panel of antibodies , which included probes recognizing antigens specifically expressed by follicular and interdigitating dendritic cells ( 2 , 3 ) . neoplastic cells were large , fusiform spindle cells with indistinct cell borders , oval central nuclei , finely dispersed chromatin , and small but prominent nucleoli , and often formed a storiform or whorled , fascicular growth pattern . idcs should be differentiated from fdcs , lcs , s100 positive histiocytic tumors , melanoma , and fibroblastic reticular cell tumors . immunohistochemistry demonstrated neoplastic cells positivity for all histiocytic markers , including cd68 , lysozyme , and macrophage transcription factor pu.1 , and showed that the dendritic cell markers fascin and s100 were strongly expressed . however , they were negative for cd1a ( lcs marker ) , cd21/23/35 ( fdcs marker ) , cd20 ( b cell marker ) , cd3 ( t cell marker ) , and cd34 ( myeloid stem cell marker ) ( 5 - 8 ) . neoplastic cells in our case were strongly positive for s100 and negative for t cell , b cell , epithelial , and follicular dendritic cell markers . treatments administered have varied in accord with clinical context of the affected patients . in patients with localized disease several chemotherapeutic regimens have been tried including chop , abvd ( doxorubicin , bleomycin , vinblastine , dacarbazine ) , dhap ( dexamethasone , cisplatin , high - dose cytarabine ) , epoch ( etoposide , prednisone , vincristine , cyclophosphamide , doxorubicin ) , ice ( ifosfamide , carboplatin , etoposide ) , and cisplatin / epirubicin with limited response ( 1 , 3 , 6 ) . for the greater part , remission durations are usually short , and limited results for bone marrow transplantation are not encouraging ( 3 ) . our patient was treated using the chop and imep regimens , but eventually succumbed to disease progression . furthermore , its unusual location , extreme rarity , and the morphological similarities between idcs and fdcs and with other poorly differentiated tumors can easily delay diagnosis . the possibility of idcs with an unusual extranodal site should be considered when an undifferentiated neoplasm with a mixed population of lymphocytes is encountered . awareness of this tumor , particularly in extranodal sites , and the use of immunohistochemical stains with appropriate markers are crucial for arriving at a correct diagnosis .	interdigitating dendritic cell sarcoma ( idcs ) is an extremely rare neoplasm arising from the antigen - presenting cells of the immune system . this disease usually involves the lymph nodes , and rarely , extranodal sites may be affected . the authors report a case of extranodal idcs presenting in the pleura . a 32-yr - old man presented with progressive chest pain . imaging studies showed diffuse pleural thickening with pleural effusion . morphological and immunohistochemical analysis of an incisional biopsy of the pleura were consistent with a diagnosis of idcs ; tumor cells were positive for s100 and cd45 , but negative for cd1a , cd21 , cd35 , b cell and t cell markers . the patient was administered chemotherapy , but died of progressive disease . although its incidence is extremely rare , this case suggests that extranodal idcs should be considered in the differential diagnosis of undifferentiated neoplasms and that immunohistochemical staining be performed using appropriate markers .
You are an expert at summarizing long articles. Proceed to summarize the following text: important landmarks are documenting whether the intended outcome of the procedure was achieved under the restriction of acceptable side effects , patient comfort and costs . endoscopic retrograde cholangiopancreatography ( ercp ) is a complex and challenging procedure for diagnosis and treatment of biliary and pancreatic disorders . it carries a relatively high risk of complications , and thus , assurance of quality is pivotal.13 however , monitoring and enhancing the quality of endoscopic procedures is impossible without methods to register specific parameters . therefore , the american society for gastrointestinal endoscopy ( asge ) committee on outcomes research has defined a set of quality indicators for ercp.4 these quality indicators roughly fall in three separate domains : pre - procedural quality indicators ( appropriateness of indication ) , procedural quality indicators ( ie , common bile duct ( cbd ) cannulation rates and therapeutic success ) and post - procedural outcomes ( ie , documentation and complications ) . there have been several publications on complications as a marker of quality,59 but procedural success or patient - related outcomes are less often described.10 in addition , self - assessment of procedural performance in ercp might enhance quality by stimulating active reflection on one 's actions . questions on topics such as individual versus group performance , personal performance level compared with that of colleagues and how to learn from mistakes made can be answered through proper self - assessment . furthermore , specific objective outcomes such as cbd cannulation rate can easily be calculated . in order to gain insight into quality of ercps , especially focusing on endoscopists performance a similar method has proven its value for colonoscopy.11 based on this study , as well as on previously validated assessment tools , the rotterdam assessment form for ercp ( raf - e ) was developed ( figure 1).1214 the rotterdam assessment form for endoscopic retrograde cholangiopancreatography ( ercp ) . the aim of this study was to test in daily practice an easy - to - use form for assessment of procedural quality in ercp . a major drawback of an easy - to - use form to be completed after every procedure without taking up too much time is the number of parameters that can be measured . from january 2008 to december 2011 , a prospective , single centre evaluation of ercp performance was carried out in the erasmus mc , university medical center in rotterdam , the netherlands . all ercp procedures performed by these five qualified endoscopists were included in the analysis . both scheduled and emergency procedures were included . participants completed raf - e after each ercp . the form , as shown in figure 1 , contains an objective part and a subjective part . objective parameters include indication , difficulty degree adapted from schutz 's classification ( table 1),15 previous failed attempts at cannulation in a different centre and the presence of a virgin papilla or previous sphincterotomy , as well as cbd cannulation success and success of various therapeutic procedures . in the subjective section , after each completion of a set of 10 assessment forms , an improvement plan can be formulated based on the osborn parnes creative problem solving process as used in other fields.16 the subjective scores are not taken into account in the statistical analysis , nor the outcome of the improvement plan . the value of the subjective assessment lies in creating self - awareness to enable self - reflection on performance rather than in providing evidence for quality measurements . to exclude registration bias , the number and outcome of these were studied by checking reports from the endoscopy database and assessed according to the same raf - e criteria . degrees of difficulty based on schutz 's classification15 a questionnaire with questions on the endoscopists experience with the form , why some forms were not completed and suggestions for improvement was filled out by all participating endoscopists to gain insight into their opinion on the added value of this quality measurement programme . tests were used in order to test for differences between two groups . regarding all results , performance data on cannulation rate are expressed as group medians plus ranges unless stated otherwise . from january 2008 to december 2011 , the five qualified endoscopists performing ercp in our department participated in this study . all 176 non - assessed ercps were checked manually by deriving reports from our electronic endoscopy reporting system that captures all procedures . the cbd cannulation success rate of non - assessed procedures was not significantly different from self - assessed ercps ( 95.3% vs 94.1% ; =0.774 , p=0.379 ) . the average number of ercps per endoscopist per year was 116 ( range 56184 ) . table 2 presents an overview of indications and complexity for ercp in this hospital . table 4 shows the results of performance data of all endoscopists who participated in this study ( total procedural outcomes as well as separate per difficulty degree ) . overview of indications for ercp ercp , endoscopic retrograde cholangiopancreatography ; psc , primary sclerosing cholangitis . distribution of difficulty degrees * partial success regarding cannulation was defined as passage of contrast fluid or successful cannulation with a guidewire , but cannulation with the catheter was not achieved . cbd , common bile duct ; ercp , endoscopic retrograde cholangiopancreatography ; pd , pancreatic duct . the most frequent indications in level 1 ercps were cbd stones ( n=251 ; 27.6% ) , benign strictures ( n=216 ; 23.7% ) or malignant strictures ( n=240 ; 26.4% ) . malignant stricture was in the level 2 group , the most frequent indication for ercp ; this accounted for 41.7% of the total number ( n=96 ) . the major part of level 3 ercps was performed for pancreatic indications , such as endoscopic therapy in chronic pancreatitis ( 47.2% of all level 3 ercps ) . procedural success was calculated for the most common indications : stone extraction and benign or malignant strictures . in 148 patients with stones , both sphincterotomy and stone extraction sphincterotomy was successfully performed in all cases as well and complete stone extraction was successful in 92.3% . procedural success in cases in which ercp was indicated for suspicion of cbd stones was therefore 92.3% ( range 84.294.4% ) . in patients with strictures ( either benign or malignant ; n=482 ) , cbd cannulation success rate was 98.4% and stent placement was successful in 96.8% of the cases , resulting in an overall 95.3% ( range 82.4100% ) procedural success rate . the cbd cannulation success rate in patients with a virgin papilla compared with patients who had undergone a previous sphincterotomy was significantly different ( 87.0 ( range 79.295.5 ) vs 98.4% ( range 90.5100 ) ; =36.66 , p<0.01 ) . analysing cbd cannulation success rate in previous ercp failure versus no failed procedure before ( 86.7 vs 96.2% ) showed a significant difference as well ( =13.88 , p<0.01 ) . the participating endoscopists were asked to give their opinion about the self - assessment programme through a short questionnaire . the common opinion was that this programme was valuable and useful to gain insight into performance . the main reason for this was that they forgot to fill out raf - e due to time pressure or busy programmes . receiving feedback on performance was stated as important in order to achieve and maintain good adherence . the most frequent indications in level 1 ercps were cbd stones ( n=251 ; 27.6% ) , benign strictures ( n=216 ; 23.7% ) or malignant strictures ( n=240 ; 26.4% ) . malignant stricture was in the level 2 group , the most frequent indication for ercp ; this accounted for 41.7% of the total number ( n=96 ) . the major part of level 3 ercps was performed for pancreatic indications , such as endoscopic therapy in chronic pancreatitis ( 47.2% of all level 3 ercps ) . procedural success was calculated for the most common indications : stone extraction and benign or malignant strictures . in 148 patients with stones , both sphincterotomy and stone extraction sphincterotomy was successfully performed in all cases as well and complete stone extraction was successful in 92.3% . procedural success in cases in which ercp was indicated for suspicion of cbd stones was therefore 92.3% ( range 84.294.4% ) . in patients with strictures ( either benign or malignant ; n=482 ) , cbd cannulation success rate was 98.4% and stent placement was successful in 96.8% of the cases , resulting in an overall 95.3% ( range 82.4100% ) procedural success rate . the cbd cannulation success rate in patients with a virgin papilla compared with patients who had undergone a previous sphincterotomy was significantly different ( 87.0 ( range 79.295.5 ) vs 98.4% ( range 90.5100 ) ; =36.66 , p<0.01 ) . analysing cbd cannulation success rate in previous ercp failure versus no failed procedure before ( 86.7 vs 96.2% ) showed a significant difference as well ( =13.88 , p<0.01 ) . the participating endoscopists were asked to give their opinion about the self - assessment programme through a short questionnaire . the common opinion was that this programme was valuable and useful to gain insight into performance . the main reason for this was that they forgot to fill out raf - e due to time pressure or busy programmes . receiving feedback on performance was stated as important in order to achieve and maintain good adherence . in this study , we prospectively evaluated the performance of endoscopists with respect to ercps in a tertiary referral hospital using a self - assessment method . with a simple form , we were able to present a descriptive analysis of indications , difficulty degrees , cannulation success rates and therapeutic success . this quality assessment of 1515 procedures gave insight into performance of individual endoscopists as well as group performance . the self - assessment programme seems a reliable method to monitor quality and performance . with the rising attention for quality assurance and the expectancy that healthcare inspection will take measures within the near future in order to assess and assure endoscopic quality , in addition to complication registration , which is already compulsory for all endoscopy departments in our country , this procedural registration will address a different and valuable aspect of procedural quality . the demand for quality assessment in endoscopic procedures is increasing , but up until now , there is still no gold standard to assess the quality of ercps . dutch guidelines state that an endoscopist is certified for ercp when he has performed 100 procedures ( dutch association of gastroenterologists ) . obviously , there is no scientific basis for this threshold number and the quality of these procedures remains unknown . asge guidelines state that a cbd cannulation success rate of 90% is an overall appropriate target , including experts , and that most endoscopists should be able to achieve a success rate of 85%.4 in general , gastroenterologists in smaller regional hospitals usually perform ercps with a level 1 difficulty degree . technically more challenging procedures with difficulty level 2 or 3 are more often performed in tertiary referral centres . questions regarding quality are being raised , such as the number of successful cbd cannulations and whether there was a difference in success between virgin papillas and patients with previous sphincterotomy . . another matter might be about a case with successful cbd cannulation , but failed stone extraction . on top of these questions , we wanted to encourage critically reflecting on one 's performance . our aim was to develop a self - assessment form that was easy to fill out and addressed the problems raised . a major drawback of too extensive evaluation forms is the inversely correlated drop in adherence to filling them out as we experienced in a pilot study . as reported by the participants , the most common reason not to fill out the form was lack of time during a busy programme . it was thus necessary to find a balance between the number of questions asked in the form and ease of completing it . unfortunately , this implies an inevitable trade - off for a number of parameters that would have been interesting to monitor as well . in order to achieve compliance as high as possible and to develop a practical assessment tool for future , the most important outcome parameters were determined through expert opinion and this process resulted in the development of the raf - e form used in this study . the final version of the form combines registration of procedural intention and outcome ; we have used parts of previously validated assessment tools and metrics as described by peter cotton.17 18 parameters that were scored as partially successful were considered to be failures in the analysis in order to avoid any discussions on definitions of partial success . the results have shown that raf - e is an easy - to - use device that provides insight into performance of individual endoscopists as well as larger groups . unfortunately , the improvement plan was sparsely filled out by the experts , so it is difficult to make a statement on whether performance has improved afterwards . however , it might be worth considering linking raf - e to the electronic endoscopy reporting system . this is a desirable step to take within the near future , which ensures the reliability of this method and provides easy accessible data for analysis . since too much registration seems to be a burden for doctors in general , as well as for endoscopists , we believe that this linking of systems will result in even more reliable data . previous studies on ercp quality focused mainly on complications , an accepted outcome parameter to assess quality.1921 however , next to complication registration , we believe that the procedural quality is of equal importance as stated above . some study groups have published their performance data on , that is , cannulation success with numbers similar to our centre ( 92% to 94%).6 7 22 since performing ercp only for diagnostic purposes , for example , in suspected cbd stones23 24 is considered obsolete and risky , less invasive methods such as magnetic resonance cholangiopancreatography ( mrcp ) or endoscopic ultrasound ( eus ) are recommended for diagnostics . asge states that clearance of cbd stones should be achieved in > 85% of the cases . in our centre stent placement was successful in 97.8% of patients , which is in line with the asge recommendations as well ( > 90% success rate ) . these data show that our raf - e provides insight into performance criteria such as those formulated by asge . this score was not yet available at the start of this study.25 the results of our study are in line with the findings of the ercp quality network,26 which is an electronic system where endoscopists can enter their data anonymously . as a result of this anonymity , no data verification can be performed and data are thus subject to bias . moreover , one can not recollect whether the ercps entered in the database are the only procedures performed by the participating endoscopists ( registration bias ) . on the other hand , since the ercp quality network is anonymous , there is less incentive to leave out failed cases . our study was single centre ; the ercp quality network enables endoscopists from different centres to enter their procedures in the database . this is the first study to show the rationale for using a self - assessment programme in order to assess the quality of ercps and the prospective design is one of the strengths . in the netherlands , no methods are available to gain insight into quality and performance of ercp apart from retrospective database research one might state that the forms are sensitive for falsification since they are not linked to an endoscopy report database . therefore , reports of all ercps performed in the time frame were extracted to quantify and evaluate non - assessed procedures . these non - assessed procedures were checked manually on procedural outcomes such as cbd cannulation success . there were no significant differences in outcome between assessed and non - assessed procedures , which makes it unlikely that procedures were left out on purpose . another limitation of this study is that it was performed in a single tertiary referral centre . the performance numbers can not be extrapolated to general endoscopists in smaller hospitals with a different workload and case mix . moreover , there were quite some variations in numbers and case mix between the endoscopists in this study alone . this might have had some influence on the results , but this is a reflection of the workload and caseload in our endoscopy unit and probably many other endoscopy units across the world . however , a clear relation between numbers of ercps performed and outcome has not been established yet.27 the numbers in this study are too small for a clear point of view on this topic , but when looking closer at our analysis , there was no correlation between volume and performance of the participating endoscopists . finally , the impact of trainees on procedural outcome or success was not established in this study . since this study was performed in a teaching hospital , trainees were involved in most ercps . this study shows that a simple self - assessment form is a successful device to provide insight into quality of ercps on an individual basis as well as group performance . however , we experienced that in order to achieve and maintain a good adherence , reporting data to the participants on an individual basis was eminent , but this required time and dedication as well as one of the endoscopists stimulating the others to fill out the raf - e forms . the next step is to roll out this self - assessment programme nationwide in the netherlands , which will provide insight into quality and performance regarding ercps across the country . next to investigating quality of ercps performed by experienced endoscopists , including trainees , in this self - assessment programme will provide additional information on learning curves on top of quality assessment . what is already known on this subjectalthough quality monitoring of ercps is extremely important , useful assessment tools are lacking . what this study addsself - assessment is a valuable method to gain insight in ercp performance.the raf - e captures the most important procedural quality parameters and is easy to incorporate in daily practice . the raf - e captures the most important procedural quality parameters and is easy to incorporate in daily practice . the demand for quality assessment in endoscopic procedures is increasing , but up until now , there is still no gold standard to assess the quality of ercps . dutch guidelines state that an endoscopist is certified for ercp when he has performed 100 procedures ( dutch association of gastroenterologists ) . obviously , there is no scientific basis for this threshold number and the quality of these procedures remains unknown . asge guidelines state that a cbd cannulation success rate of 90% is an overall appropriate target , including experts , and that most endoscopists should be able to achieve a success rate of 85%.4 in general , gastroenterologists in smaller regional hospitals usually perform ercps with a level 1 difficulty degree . technically more challenging procedures with difficulty level 2 or 3 are more often performed in tertiary referral centres . questions regarding quality are being raised , such as the number of successful cbd cannulations and whether there was a difference in success between virgin papillas and patients with previous sphincterotomy . . another matter might be about a case with successful cbd cannulation , but failed stone extraction . on top of these questions , we wanted to encourage critically reflecting on one 's performance . our aim was to develop a self - assessment form that was easy to fill out and addressed the problems raised . a major drawback of too extensive evaluation forms is the inversely correlated drop in adherence to filling them out as we experienced in a pilot study . as reported by the participants , the most common reason not to fill out the form was lack of time during a busy programme . it was thus necessary to find a balance between the number of questions asked in the form and ease of completing it . unfortunately , this implies an inevitable trade - off for a number of parameters that would have been interesting to monitor as well . in order to achieve compliance as high as possible and to develop a practical assessment tool for future , the most important outcome parameters were determined through expert opinion and this process resulted in the development of the raf - e form used in this study . the final version of the form combines registration of procedural intention and outcome ; we have used parts of previously validated assessment tools and metrics as described by peter cotton.17 18 parameters that were scored as partially successful were considered to be failures in the analysis in order to avoid any discussions on definitions of partial success . the results have shown that raf - e is an easy - to - use device that provides insight into performance of individual endoscopists as well as larger groups . unfortunately , the improvement plan was sparsely filled out by the experts , so it is difficult to make a statement on whether performance has improved afterwards . however , it might be worth considering linking raf - e to the electronic endoscopy reporting system . this is a desirable step to take within the near future , which ensures the reliability of this method and provides easy accessible data for analysis . since too much registration seems to be a burden for doctors in general , as well as for endoscopists , we believe that this linking of systems will result in even more reliable data . previous studies on ercp quality focused mainly on complications , an accepted outcome parameter to assess quality.1921 however , next to complication registration , we believe that the procedural quality is of equal importance as stated above . some study groups have published their performance data on , that is , cannulation success with numbers similar to our centre ( 92% to 94%).6 7 22 since performing ercp only for diagnostic purposes , for example , in suspected cbd stones23 24 is considered obsolete and risky , less invasive methods such as magnetic resonance cholangiopancreatography ( mrcp ) or endoscopic ultrasound ( eus ) are recommended for diagnostics . asge states that clearance of cbd stones should be achieved in > 85% of the cases . in our centre stent placement was successful in 97.8% of patients , which is in line with the asge recommendations as well ( > 90% success rate ) . these data show that our raf - e provides insight into performance criteria such as those formulated by asge . this score was not yet available at the start of this study.25 the results of our study are in line with the findings of the ercp quality network,26 which is an electronic system where endoscopists can enter their data anonymously . as a result of this anonymity moreover , one can not recollect whether the ercps entered in the database are the only procedures performed by the participating endoscopists ( registration bias ) . on the other hand , since the ercp quality network is anonymous , there is less incentive to leave out failed cases . our study was single centre ; the ercp quality network enables endoscopists from different centres to enter their procedures in the database . this is the first study to show the rationale for using a self - assessment programme in order to assess the quality of ercps and the prospective design is one of the strengths . in the netherlands , no methods are available to gain insight into quality and performance of ercp apart from retrospective database research . one might state that the forms are sensitive for falsification since they are not linked to an endoscopy report database . therefore , reports of all ercps performed in the time frame were extracted to quantify and evaluate non - assessed procedures . these non - assessed procedures were checked manually on procedural outcomes such as cbd cannulation success . there were no significant differences in outcome between assessed and non - assessed procedures , which makes it unlikely that procedures were left out on purpose . another limitation of this study is that it was performed in a single tertiary referral centre . the performance numbers can not be extrapolated to general endoscopists in smaller hospitals with a different workload and case mix . moreover , there were quite some variations in numbers and case mix between the endoscopists in this study alone . this might have had some influence on the results , but this is a reflection of the workload and caseload in our endoscopy unit and probably many other endoscopy units across the world . however , a clear relation between numbers of ercps performed and outcome has not been established yet.27 the numbers in this study are too small for a clear point of view on this topic , but when looking closer at our analysis , there was no correlation between volume and performance of the participating endoscopists . finally , the impact of trainees on procedural outcome or success was not established in this study . since this study was performed in a teaching hospital , trainees were involved in most ercps . this study shows that a simple self - assessment form is a successful device to provide insight into quality of ercps on an individual basis as well as group performance . however , we experienced that in order to achieve and maintain a good adherence , reporting data to the participants on an individual basis was eminent , but this required time and dedication as well as one of the endoscopists stimulating the others to fill out the raf - e forms . the next step is to roll out this self - assessment programme nationwide in the netherlands , which will provide insight into quality and performance regarding ercps across the country . next to investigating quality of ercps performed by experienced endoscopists , including trainees , in this self - assessment programme will provide additional information on learning curves on top of quality assessment . what is already known on this subjectalthough quality monitoring of ercps is extremely important , useful assessment tools are lacking . what this study addsself - assessment is a valuable method to gain insight in ercp performance.the raf - e captures the most important procedural quality parameters and is easy to incorporate in daily practice . the raf - e captures the most important procedural quality parameters and is easy to incorporate in daily practice .	backgroundthe american society for gastrointestinal endoscopy committee on outcomes research has recommended monitoring nine endoscopic retrograde cholangiopancreatography ( ercp)-specific quality indicators for quality assurance in ercp . with the development of a self - assessment tool for ercp ( rotterdam assessment form for ercp raf - e ) , key indicators can easily be assessed.objectivethe aim of this study was to test in daily practice an easy - to - use form for assessment of procedural quality in ercp and to determine ercp quality outcomes in a tertiary referral hospital.designthis was a prospective study carried out in a tertiary referral hospital . in january 2008 , a quality self - assessment programme was started . five qualified endoscopists participated in this study . all ercps were appraised using raf - e . primary parameters were common bile duct ( cbd ) cannulation rate and procedural success . the indication was classified and procedural difficulty was graded ; success rates of therapeutic interventions were measured for all different difficulty degrees.resultsa total number of 1691 ercps were performed . 1515 ( 89.6% ) of these were appraised using raf - e . median cbd cannulation success rate was 94.1% . successful sphincterotomy was accomplished in almost all patients ( median 100% ; range 98.2100% ) . stent placement was successful in 97.8% and complete stone extraction , if indicated , was achieved in 86.8%.conclusionsquality indicators for ercp can be measured using the rotterdam self - assessment programme for ercp . outcome data in ercps obtained with this raf - e provide insight into the quality of individual as well as group performance and can be used to assess and set standards for quality control in ercp .
You are an expert at summarizing long articles. Proceed to summarize the following text: the newfoundland and labrador health research ethics board approved of this study ( hic reference 09.37 ) . we recruited patients presenting at regional cancer clinics across the province ( st . john 's , gander , grand falls - windsor and corner brook ) and at daffodil place ( the provincial cancer lodge ) . we also mailed study invitations to patients who were identified through the provincial cancer registry . these invitations asked interested patients to contact a research assistant to arrange for an interview . the study used a retrospective design and recruited patients who had already been diagnosed with cancer and had either started or completed their treatment regimen . to be eligible for the larger study , patients had to be residents of newfoundland and labrador ; 19 years of age or older ; fluent in english ; seeking or receiving treatment for their first cancer diagnosis ; and diagnosed with breast , lung , colorectal or prostate cancer between 1 january 2009 and 30 june 2011 . we excluded male patients with breast cancer and patients with multiple cancer diagnoses . in this article , we examine patients with breast cancer who underwent surgery as their primary form of treatment ( as specified in their cancer clinic medical chart ) , had undergone surgery before other forms of treatment , knew the date of first visit to their surgeon and consented to the chart review . research assistants screened individuals for eligibility , obtained consent and conducted in - person surveys with patients . the research assistants received extensive training and used scripted prompts and visual aids ( e.g. , calendars for reference ) during the interviews . the survey instrument was written in english at a grade 8 level and included questions related to eligibility , dates in the care - seeking process ( e.g. , the onset of symptoms , first presentation to a healthcare provider , etc . ) , clinical and screening history and socio - demographic characteristics . in addition , respondents were asked to rate their satisfaction with specific wait - time intervals ( e.g. , from first visit with a surgeon until surgery , etc . ) using a five - point likert scale , where one was not at all satisfied and five was very satisfied . a chart audit tool was used to review cancer clinic medical charts of surveyed patients . the audit tool gathered data of demographic characteristics ( e.g. , date of birth , community of residence , etc . ) , stage , availability of and completeness of needed clinical information ( e.g. , date of pathology report , diagnostic tests ) and treatment ( types , priority rating , date and site of initial consultation and start of treatments , etc . ) . the items included in the survey and chart reviews were identified and selected based on in - depth literature reviews and consultations with cancer care providers , patients with cancer and representatives from the provincial division of the canadian cancer society . in addition , we also conducted extensive pre - testing with patients and cancer care providers to ensure the face validity and comprehensibility of the questions prior to administering the survey . this pre - testing resulted in changes to the wording and ordering of questions , but not to the actual content of the instrument . we also pre - tested the chart audit forms to ensure that data were available in the charts and could be efficiently gathered . for example , the items were listed on the chart audit tool in the order of their appearance in the chart and described using the same terminology . survey and chart data were entered into a database using spss data entry software and analyzed using ibm spss statistics software ( version 20.0 : ibm , armonk , ny , usa ) . data entry errors were identified using frequencies and cross - tabulations , and original surveys and chart reviews were consulted to correct errors . to assess the representativeness of the sample , we used chi - square tests to compare the age and community of residence of respondents to the data provided by the cancer registry ( used to mail out study invitations ) . the primary outcome considered in the analysis was satisfaction with the waiting time from first visit with a surgeon until surgery . wait - related satisfaction was based on the question using a scale where 1 is very dissatisfied ' and 5 is very satisfied ' , in general , how satisfied are you with the time from your first visit with a surgeon to the time of your surgery ? because data were skewed , the variable was recoded into two categories : dissatisfied ( responses 13 ) and satisfied ( responses the independent variable was length of waiting time from first visit with a surgeon until surgery . the wait - time was calculated by subtracting the date of surgery ( taken from the chart ) from the date given in response to the survey question when did you first see a surgeon ? because the data were skewed , the variable was grouped into two categories : shorter than average wait ( equal to or less than the median wait - time ) and longer than average wait ( greater than the median wait - time ) . other variables considered in the analyses included socio - demographic characteristics ( age , community of residence , marital status , employment status and income ) , family history of cancer and cancer- and treatment - related characteristics ( number of diagnostic tests , stage , type of surgery and location of surgery ) . stage of cancer was coded into either early stage ( 0,1 ) or late stage ( 2,3,4 ) . we also included variables on wait - time from first visit to a health - care provider to diagnosis and satisfaction with this wait - time because preliminary analyses suggested that the wait - time for diagnosis may overlap with the wait - time from first visit to a surgeon and/or surgery ( that is , a cancer diagnosis may only have been confirmed after consulting a surgeon or after having undergone surgery ) . the wait - time from first visit to a healthcare provider to diagnosis was calculated from the questions : when did you first see a healthcare professional about these symptoms / screening results ? and when did someone tell you that you definitely had cancer ? , and were coded as shorter than average wait ( equal to or less than the median wait - time ) and longer than average wait ( greater than the median wait - time ) . wait - time satisfaction was based on the question using a scale where 1 is very dissatisfied ' and 5 is very satisfied ' , in general , how satisfied are you with the time from your first visit to a healthcare provider until you were told you definitely have cancer ? and coded as dissatisfied ( responses 13 ) and satisfied ( responses 45 ) . after describing the characteristics of the sample , we used chi - square tests ( or fisher 's exact tests , if applicable ) to detect differences between patients with shorter and those with longer than average surgery wait - times and between patients who were satisfied and those who were unsatisfied with surgery wait - times . in supplementary analyses , we repeated this after removing outliers from the sample to assess the impact of extreme wait - times . we used multiple logistic regression to identify significant ( p < 0.05 ) predictors of satisfaction with surgery - related wait - time . we selected potential predictor variables for the regression model on the basis of the chi - square tests . we decided the final model on the basis of change in the 2 log likelihood value ( osborne 2015 ) . there were 652 patients who expressed interest in the study ; 383 of these patients were eligible . we asked participants about cancer type during the survey and found 122 women to have breast cancer . we excluded 10 women who did not consent to a chart review , seven women who did not know when they first visited a surgeon and six women who had undergone surgery after some other form of treatment , thereby leaving 99 patients in the study . characteristics of the study sample are shown in table 1 . the sample over - represented women under 65 years as well as urban residents ( table 1 ) . sample representativeness of patients with breast cancer numbers are based on cancer registry data provided for the study ; the sample includes all eligible patients with breast cancer ( including those who did not undergo surgery as primary treatment ) . most of the patients in the study were under the age of 65 years ( mean 55.20 years , median 56.0 years , standard deviation 9.74 years , range : 3379 years ) . the majority of patients with breast cancer in the sample were married or equivalent , were educated with a high school diploma or more , had early - stage breast cancer and were satisfied with their waiting time from first visit to a healthcare provider to diagnosis and from first visit with a surgeon to having undergone surgery ( table 2 ) . characteristics of eligible patients with breast cancer numbers may not add to 99 because of missing answers ; hcp = healthcare provider , nl = newfoundland and labrador . the median wait - time from first visit with a surgeon to having undergone surgery was 24.5 days . there were no differences in the proportion of patients with longer than and those with shorter than average wait - times among any of the variables considered , with the exception of wait - time from first visit to a healthcare provider and that for diagnosis ( table 3 ) . compared to patients with shorter than average wait - times for surgery , a larger proportion of patients who had longer than average waits for surgery also had longer than average waits for a diagnosis . after excluding outliers surgery - related wait - times and wait - related satisfaction among patients with breast cancer numbers may not add to 99 because of missing answers ; hcp = healthcare provider , nl = newfoundland and labrador . a large majority ( 86.3% ) of patients with breast cancer said that they were satisfied with their wait - time from first visit with a surgeon to having undergone surgery . compared with those who were satisfied , a larger proportion of unsatisfied patients had late - stage cancer , had either a total or bilateral mastectomy , had longer wait - times for diagnosis and were unsatisfied with their wait - time for diagnosis . there were no other significant differences between satisfaction with surgery - related wait - times , amongst those with longer than average and those with shorter than average wait - times for surgery . after excluding outliers , compared with those who were satisfied , a larger proportion of unsatisfied patients had late - stage cancer , had either a total or bilateral mastectomy and were unsatisfied with their wait - time for diagnosis . there was no significant difference in satisfaction with surgery - related wait - times and diagnosis - related wait - times . logistic regression showed that women with late - stage breast cancer were 8.33 times less likely ( based on the inverse of 0.12 ) to be satisfied with their surgery - related wait - time than women with early - stage breast cancer ( table 4 ) . given the small sample size , the number of variables that we could include in the regression model was limited . predictors of surgery - related wait times and wait - related satisfaction among patients with breast cancer or = odds ratio ; 95% ci = 95% confidence interval . we linked patient survey and chart data to examine the association between wait - time from first visit to a surgeon until surgery and wait - related satisfaction for patients with breast cancer in newfoundland and labrador . contrary to our hypothesis , shorter wait - times for surgery did not produce greater interval - specific satisfaction . instead , we found that satisfaction with wait - time for surgery was associated with the severity of the diagnosis and treatment and satisfaction with diagnosis - related waits . although there was no difference in the wait - time of women with early- and late - stage breast cancer , women with late - stage cancer were more likely to be unsatisfied with their surgery - related wait - time . likewise , a larger proportion of women who had either total or bilateral mastectomies were unsatisfied with surgery - related wait - times even though there was no difference in wait - times . women with late - stage cancers or those requiring more severe treatments may believe that their wait - time to see a surgeon may have contributed to their disease progression . a significantly larger proportion of ( 75% ) of women with late - stage cancer than early - stage cancer ( 41% ) had long wait - times ( greater than median ) from their first visit with a healthcare provider ( for symptoms ) and their first visit to a surgeon . the median wait - time was 36.50 days ; mode , 18 and 30 days ; mean , 88.35 days ; range 0806 days ; and a 90 percentile of 253.30 days . the influence of the diagnosis - related wait on the perception of the surgery - related wait may be due in part to the overlap between the two intervals ; only 35.4% of the women in the study knew they definitely had cancer before their first visit with a surgeon , and 83.8% learned of their diagnosis before their surgery . however , surgery - related wait - time and diagnosis - related wait - time is weakly correlated ( r = 0.22 , p = 0.021 ) , so the overlap in itself does not fully explain why the wait - time for diagnosis colours the perception of the wait - time for surgery . the wait - time for diagnosis is typically the most anxious period for patients during the cancer care - seeking journey and the experiences during this interval can affect their decision - making , well - being and psychosocial outcomes during treatment and thereafter ( dore et al . , we examined the relationship between screening behaviours , wait - time for diagnosis and wait - related satisfaction and found that satisfaction was poorest among women who engaged in regular screening activities but whose screening activities did not detect their cancer ( mathews et al . these findings suggest that the experiences and expectations related to cancer diagnosis may have a greater impact on patients ' perception of the timeliness of surgery than the actual wait - time itself . the surgery - related wait - times reported by women in this study are longer than the wait - times reported by the newfoundland and labrador wait - times ( newfoundland and labrador department of health and community services 2014 ) . the longer times reported in the study may be due to differences in the start date of the wait . although the study used first visit to a surgeon , newfoundland and labrador , like other provinces , measures the start of the wait - time from the date that both the patient and surgeon agree to have a surgery ( newfoundland and labrador department of health and community services 2014 ) . newfoundland and labrador also only include wait - times for patients with a confirmed cancer diagnosis . as described above , roughly one in eight women only receive a confirmed diagnosis after having undergone surgery . there were few differences in the characteristics of women with longer than average and those with shorter than average surgery - related wait - times . these findings echo findings from other studies in canada that have found that wait - times are equitable relative to socio - demographic traits ( gorey et al . there was no difference in the wait - times of women with late- and early - stage cancer . given that staging is usually done following surgery , it can not be used to prioritize women for surgery . our ability to detect significant differences and conduct multivariate analyses is limited by the relatively small sample size of patients with breast cancer in the study . as a result although the date of surgery was taken from the medical chart , we relied on survey data to establish the date of diagnosis and the date of first visit with a surgeon . in addition , the design may influence reported satisfaction with wait - times , that is , once the stage and prognosis are better known . as a result although a number of studies have noted that patients with cancer can reliably recall key dates in their cancer care , further research is needed to assess recall reliability over the course of their illness ( i.e. , from symptom to treatment ) . the study examines a non - representative sample which may suffer from volunteer bias ; patients with better prognoses may have been more likely to participate than those with poor prognoses , resulting in more positive perceptions of wait - times . although there are a number of validated scales that measure satisfaction with cancer care , none of these scales captures satisfaction with wait - times as patients move across different healthcare sectors , from the onset of their symptoms through testing and various forms of treatment . based on the results of these initial studies , we have identified dimensions of a wait - related satisfaction scale ( ryan et al . finally , the study examines patients with breast cancer from one province and this may not be generalizable to other jurisdictions . further research is needed to confirm these findings in other provinces . our ability to detect significant differences and conduct multivariate analyses is limited by the relatively small sample size of patients with breast cancer in the study . as a result although the date of surgery was taken from the medical chart , we relied on survey data to establish the date of diagnosis and the date of first visit with a surgeon . in addition , the design may influence reported satisfaction with wait - times , that is , once the stage and prognosis are better known . as a result although a number of studies have noted that patients with cancer can reliably recall key dates in their cancer care , further research is needed to assess recall reliability over the course of their illness ( i.e. , from symptom to treatment ) . the study examines a non - representative sample which may suffer from volunteer bias ; patients with better prognoses may have been more likely to participate than those with poor prognoses , resulting in more positive perceptions of wait - times . although there are a number of validated scales that measure satisfaction with cancer care , none of these scales captures satisfaction with wait - times as patients move across different healthcare sectors , from the onset of their symptoms through testing and various forms of treatment . based on the results of these initial studies , we have identified dimensions of a wait - related satisfaction scale ( ryan et al . finally , the study examines patients with breast cancer from one province and this may not be generalizable to other jurisdictions . satisfaction with surgery - related wait - times was not associated with the length of the wait - time from first visit with a surgeon to surgery among patients with breast cancer in newfoundland and labrador . however , satisfaction with surgery - related wait - time was associated with the severity of diagnosis and treatment , and satisfaction with the wait - time for cancer diagnosis . to the best of our knowledge , this study is one of the first in canada to explore the relationship between surgery - related wait - times and wait - related satisfaction . despite its limitations , the study highlights the importance of early and timely diagnosis in patients ' perceptions of wait - times for breast cancer surgery .	do shorter waits for breast cancer surgery lead to greater wait - related patient satisfaction ? using survey and cancer clinic chart data of 99 patients with breast cancer from newfoundland and labrador , we found that median wait - time from first visit to a surgeon to surgery was 22.0 days and 87% were satisfied with their wait - time . wait - related satisfaction was not associated with the length of wait but rather with the stage , severity of treatment , wait - time for a diagnosis and satisfaction with diagnosis - related wait . these findings highlight the importance of an early and timely diagnosis in patients ' perceptions of breast cancer care wait - times .
You are an expert at summarizing long articles. Proceed to summarize the following text: our study was performed on the basis of the guidelines set both by the u.s . national institute of health and the recommendations of the committee on animal research at our institution . ten pigs ( n = 10 , 30 - 35 kg ) were subjected to 90 minutes of occlusion of the left anterior descending coronary artery , and this was followed by 90 minutes of reperfusion . after performing a left lateral thoracotomy along the fifth intercostal space , the left anterior descending coronary artery was isolated distal to the first diagonal branch , and a snare loop made with 4 - 0 silk was placed in a slender plastic tube . occlusion or reperfusion of the left anterior descending coronary artery was produced by simply fastening or releasing the snare loop . the hearts were rapidly excised and placed in a bath of cold ( 4 ) cardioplegic solution . the hearts were stored in formalin solution for at least 18 hour to let the possible early ventricular geometry changes occur before mr imaging , as was previously suggested ( 9 , 14 ) . the dt - mri were acquired from the ten excised hearts by using a philips 3 t achieva scanner ( philips medical system , best , netherlands ) and an eight - channel head coil . the formalin - fixed porcine heart specimens were suspended in a cylinder filled with formalin to avoid tissue - air susceptibility artifacts . after the scout images were acquired on the four - chamber and two - chamber views , the short axis images of the left ventricle were obtained at the midventricular level for dt - mri . the sensitivity encoding ( sense)-based echo - planar imaging technique was applied to shorten the image acquisition time and to alleviate any image distortion caused by susceptibility artifacts from the single - shot echoplanar imaging sequences . the sense factor was chosen to be 2.4 in this study as a trade off between image distortion due to the high echo - planar imaging factor and the sense artifacts caused by a high sense factor , as was previously suggested ( 14 ) . with a b - value of 800 s / mm , the diffusion tensor images were obtained , respectively , for 6 , 15 and 32 diffusion gradient directions at the same midventricular level of each specimen . the imaging parameters were as follows : te = 55 ms , tr = 5000 ms , number of slices = 5 , slice thickness = 1.13 mm , slice gap = 0 mm and the number of excitations = 1 . three - dimensional reconstruction of the myocardial fibers was done by using the commercially available pride software package ( philips medical systems , best , netherlands ) . for each of the short - axis slices , the numbers of tracked fibers , the fractional anisotropy ( fa ) and the length of the tracked fibers in the left ventricle were measured using the pride software by an experienced cardiac radiologist who has 12 years of experience with quantitative analysis . the fiber distribution was investigated with the fa magnitude and directional thresholds set at 0.15 and 40 , respectively ( 14 ) . the image quality of the fiber tractography was assessed by two radiologists for qualitative analysis . they scored each image on a 3-point scale : 1 ( poor ) , 2 ( moderate ) and 3 ( good ) . the definition of each rating score is as follows : ' poor ' was visualization of the myocardium with frequent discontinuity except for in the infarcted myocardium ; ' moderate ' was visualization of the myocardium with partial discontinuity except for in the infarcted myocardium ; ' excellent ' was visualization of myocardial fibers without or with minimal discontinuity except in the infarcted myocardium . the average of the scores for each image was used for qualitative analysis . for statistical analysis among the three paired data sets , all quantitative and qualitative comparisons were analyzed by using friedmann 's test and the wilcoxon - signed rank test for post - hoc consideration . spss version 12.0 ( spss , chicago , il ) was used for the statistical calculation . our study was performed on the basis of the guidelines set both by the u.s . national institute of health and the recommendations of the committee on animal research at our institution . ten pigs ( n = 10 , 30 - 35 kg ) were subjected to 90 minutes of occlusion of the left anterior descending coronary artery , and this was followed by 90 minutes of reperfusion . after performing a left lateral thoracotomy along the fifth intercostal space , the left anterior descending coronary artery was isolated distal to the first diagonal branch , and a snare loop made with 4 - 0 silk was placed in a slender plastic tube . occlusion or reperfusion of the left anterior descending coronary artery was produced by simply fastening or releasing the snare loop . the hearts were rapidly excised and placed in a bath of cold ( 4 ) cardioplegic solution . the hearts were stored in formalin solution for at least 18 hour to let the possible early ventricular geometry changes occur before mr imaging , as was previously suggested ( 9 , 14 ) . the dt - mri were acquired from the ten excised hearts by using a philips 3 t achieva scanner ( philips medical system , best , netherlands ) and an eight - channel head coil . the formalin - fixed porcine heart specimens were suspended in a cylinder filled with formalin to avoid tissue - air susceptibility artifacts . after the scout images were acquired on the four - chamber and two - chamber views , the short axis images of the left ventricle were obtained at the midventricular level for dt - mri . the sensitivity encoding ( sense)-based echo - planar imaging technique was applied to shorten the image acquisition time and to alleviate any image distortion caused by susceptibility artifacts from the single - shot echoplanar imaging sequences . the sense factor was chosen to be 2.4 in this study as a trade off between image distortion due to the high echo - planar imaging factor and the sense artifacts caused by a high sense factor , as was previously suggested ( 14 ) . with a b - value of 800 s / mm , the diffusion tensor images were obtained , respectively , for 6 , 15 and 32 diffusion gradient directions at the same midventricular level of each specimen . the imaging parameters were as follows : te = 55 ms , tr = 5000 ms , number of slices = 5 , slice thickness = 1.13 mm , slice gap = 0 mm and the number of excitations = 1 . three - dimensional reconstruction of the myocardial fibers was done by using the commercially available pride software package ( philips medical systems , best , netherlands ) . for each of the short - axis slices , the numbers of tracked fibers , the fractional anisotropy ( fa ) and the length of the tracked fibers in the left ventricle were measured using the pride software by an experienced cardiac radiologist who has 12 years of experience with quantitative analysis . the fiber distribution was investigated with the fa magnitude and directional thresholds set at 0.15 and 40 , respectively ( 14 ) . the image quality of the fiber tractography was assessed by two radiologists for qualitative analysis . they scored each image on a 3-point scale : 1 ( poor ) , 2 ( moderate ) and 3 ( good ) . the definition of each rating score is as follows : ' poor ' was visualization of the myocardium with frequent discontinuity except for in the infarcted myocardium ; ' moderate ' was visualization of the myocardium with partial discontinuity except for in the infarcted myocardium ; ' excellent ' was visualization of myocardial fibers without or with minimal discontinuity except in the infarcted myocardium . the average of the scores for each image was used for qualitative analysis . for statistical analysis among the three paired data sets , all quantitative and qualitative comparisons were analyzed by using friedmann 's test and the wilcoxon - signed rank test for post - hoc consideration . spss version 12.0 ( spss , chicago , il ) was used for the statistical calculation . the results of the quantitative analysis are summarized in table 1 . by increasing the numbers of diffusion - sensitizing gradient directions from 6 to 15 and to 32 on dt - mri , the mean fa and standard deviation were significantly reduced ( p < 0.01 ) . for the evaluation of fiber tracking , the number of tracked fibers was significantly increased ( p < 0.01 ) and the length of the tracked fibers was also increased ( p < 0.01 ) with the increased number of the diffusion - sensitizing gradient directions ( figs . 1 - 3 ) . in the qualitative analysis , the image quality of the fiber tractography was significantly increased according to the increased number of the diffusion - sensitizing gradient directions ( p < 0.01 ) ( table 2 ) . our result showed that higher numbers of diffusion - sensitizing gradient directions can provide more detailed information about the myocardial fiber structure on in vitro dt - mri at 3 t . to the best our current knowledge , no consensus exists for the optimal number of diffusion - sensitizing gradient directions for dt - mri . jones ( 19 ) insisted that the mean diffusivity , fa and tensor orientation requires a dt - mri sampling scheme in which there are at least 30 diffusion - sensitizing gradient directions by using monte carlo simulations . our study also suggested that one should use as many unique sampling orientations as time will allow for applications such as fiber tractography . ( 13 ) demonstrated that dt - mri in the cervical spinal cord with using 15 diffusion - sensitizing gradient directions showed significantly better quality than that using 6 directions . yet dti using 32 directions did not show a significant improvement of quality over that using 15 directions . they suggested that the increased numbers of diffusion - sensitizing gradient directions in vivo dt - mri require longer scan times and there may be a greater risk for motion artifacts . this is a first report on using a higher number of diffusion - sensitizing gradient directions for cardiac dt - mri . most studies have used low diffusion resolution with employing 6 diffusion - sensitizing gradient directions for cardiac dt - mri . wu et al . ( 14 ) recently used dt - mri with medium diffusion resolution with employing 15 diffusion - sensitizing gradient directions for the evaluation of myocardial fiber pathways in canine heart samples fixed in formalin . they revealed that the long fiber pathways were found to predominantly run circumferentially with small helix angles , and this dominated the fiber architecture in the myocardium . however , they only investigated the myocardial fiber pathway distribution and they did not analyze the effect of medium diffusion resolution for the dt - mri quality for the evaluation of myocardial anisotropy and fiber tracking . in this study , we demonstrated the effect of high diffusion resolution by using 32 diffusion - sensitizing gradient directions for in vitro dt - mri . we suggest that high resolution dt - mri may be used as a tool for delineating and monitoring the detailed myocardial fiber structure after a myocardial infarction has responded to various treatments such as stem cell therapy . although the advantages of mri at 3 t over the 1.5 t systems have not been established for the use of cardiac dt - mri , a better depiction of fiber tracts at 3 t compared with 1.5 t has been demonstrated with performing high spatial resolution dt - mri in brain ( 20 - 22 ) . the sensitivity - encoded ( sense ) mr technique , as a parallel imaging method , is now feasible with using a commercial machine and with no dedicated hardware . using the sense technique , the duration of the echo train is reduced by faster filling of the k - space and so this results in a wider bandwidth in the phase - encoded direction ; therefore , the susceptibility artifacts are reduced ( 23 , 24 ) . to the best of our knowledge , there is no consensus concerning the optimum method for evaluating the quality of dt - mri . ( 25 ) investigated the optimum imaging parameters of dt - mri in brain , and they quantitatively evaluated the numbers of reconstructed fibers and the visual image quality . in a similar fashion , we evaluated the qualities of the dt - mri with using different numbers of diffusion - sensitizing gradient directions by quantifying the numbers and length of the tracked fibers , as well as by visually comparing the image quality of the fiber tractography . our results demonstrated that the numbers and length of the tracked fibers were significantly increased with the increased number of diffusion - sensitizing gradient directions , which suggests that the image quality of the fiber tractography was significantly improved . however , the validity of using fiber tracking as a means to determine the accuracy of dt - mri measurements was not proven experimentally . without loss of generality , the dti - derived fa index ( 26 ) , which is a commonly used rotationally invariant index of diffusion anisotropy , is examined as a function of the left ventricular wall depth and the circumferential and longitudinal locations . jiang et al . ( 27 ) reported that the diffusion anisotropy measured by dt - mri in the fixed sheep myocardium remained relatively constant from the epicardium to the midwall and then it decreased steadily toward the endocardium . ( 12 ) also demonstrated that in vivo dt - mri of the postinfarct myocardium in patients with myocardial infarction revealed a significant decrease in fa , indicating there was altered tissue integrity . furthermore , the redistribution of the fiber architecture correlated with the infarct size and the left ventricular function . therefore , exactly measuring the fa is important for characterizing such tissue parameters as the extracellular volume fraction as well as the fiber orientation on cardiac dt - mri . chang et al . ( 28 ) revealed , by using the histogram method , that the image quality of the fa map of a brain was significantly improved as the number of diffusion - sensitizing gradient directions increased . they also reported that that the histogram showed that the fa values and their variance were increased as the number of diffusion gradient directions decreased , and this was probably due to the overestimation of the fa values . it was also shown in our study that the mean fa and its standard deviation were significantly reduced with the increased number of diffusion - sensitizing gradient directions . first , we have no direct histopathological correlations to validate our findings . however , it is difficult to precisely quantify the numbers and the length of myocardial fibers on histopathological exam . the increased scan time may have produced more motion - related artifacts on the in vivo dt - mri . optimizing the number of diffusion - sensitizing gradient directions should be considered as a tradeoff between increasing the image quality and minimizing the scan time for in vivo dt - mri . advanced mr technology will be required to overcome such problems as the low signal - to - noise ratio and the long scan time for in vivo dt - mri . third , we did not consider several important parameters such as the b - value , the numbers of excitations and the slice thickness for cardiac dt - mri . further study will be needed to combine several individual parameters for optimizing the acquisition of in vivo dt - mri before it can be applied to clinical settings . finally , we did not separately evaluate the alterations in tissue integrity , such as the fa of both the infarcted and normal myocardium , because the purpose of our study was only to evaluate the effect of the number of diffusion - sensitizing gradient directions on the image quality of dt - mri . from this study , we conclude that the image quality of in vitro dt - mri is significantly improved as the number of diffusion - sensitizing gradient directions is increased .	objectivewe wanted to evaluate the effect of the number of diffusion - sensitizing gradient directions on the image quality for evaluating myocardial anisotropy and fiber tracking by using in vitro diffusion tensor mr imaging ( dt - mri).materials and methodsthe dt - mr images , using a sense - based echoplanar imaging technique , were acquired from ten excised porcine hearts by using a 3 t mr scanner . with a b - value of 800 s / mm2 , the diffusion tensor images were obtained for 6 , 15 and 32 diffusion - sensitizing gradient directions at the midventricular level . the number of tracked fibers , the fractional anisotropy ( fa ) , and the length of the tracked fibers were measured for the quantitative analysis . two radiologists assessed the image quality of the fiber tractography for the qualitative analysis.resultsby increasing the number of diffusion - sensitizing gradient directions from 6 to 15 , and then to 32 , the fa and standard deviation were significantly reduced ( p < 0.01 ) , and the number of tracked fibers and the length of the tracked fibers were significantly increased ( p < 0.01 ) . the image quality of the fiber tractography was significantly increased with the increased number of diffusion - sensitizing gradient directions ( p < 0.01).conclusionthe image quality of in vitro dt - mri is significantly improved as the number of diffusion - sensitizing gradient directions is increased .
You are an expert at summarizing long articles. Proceed to summarize the following text: to identify htert partners , we stably overexpressed a tandem affinity peptide ( tap)-tagged htert protein in hela - s cells , isolated htert immune complexes , and identified a heterogeneous mixture of 38 rna sequences associated with htert ( supplementary fig . 2 ; supplementary table 1 ) . we found that 5% of the sequences corresponded to hterc and the rna component of mitochondrial rna processing endoribonuclease ( rmrp ) . rmrp is a 267 nt non - coding rna that is a small nucleolar ( sno ) rna , like hterc , and is also found in mitochondria8,14 . mutations of rmrp are found in the pleiotropic inherited syndrome , cartilage - hair hypoplasia ( chh)15 . from a single immune complex , we confirmed that either overexpressed or endogenous htert interacts with rmrp and hterc by isolating tap - htert ( fig . 1b ) complexes in both hela and 293 t cells under conditions where we failed to recover the ribozyme rnase p. we also found that the abundance of htert - rmrp and htert - hterc complexes was similar even though hterc was expressed at five - fold higher levels than rmrp in these cells ( fig . 1c ; supplementary fig . 3 ) . to characterize the interaction of htert and rmrp , we used tert truncation mutants and found that the aminoterminal end of htert ( 1531 ) was necessary for interactions with rmrp ( supplementary fig . these observations demonstrate that htert and rmrp form a novel ribonucleoprotein complex distinct from the htert - hterc enzyme . to test whether rmrp substitutes for hterc to reconstitute telomerase activity , we combined recombinant htert with hterc or rmrp rnas transcribed in vitro . 5 ) , we failed to detect telomerase activity when htert and rmrp were co - incubated . tert has also been shown to act as a terminal transferase17 , and htert shares sequence similarity to both viral reverse transcriptases and rna dependent rna polymerases ( rdrps)18 . rdrps participate in the endogenous rnai pathway and in the regulation of posttranscriptional gene silencing1923 . to examine whether the htert - rmrp complex exhibits rdrp and/or terminal transferase ( tt ) activity , we established an rna synthesis activity assay with recombinant htert protein ( supplementary fig . 6 ) and rna molecules transcribed in vitro . we predicted three modes that the htert - rmrp complex might use to elongate rna : [ i ] as an rdrp that uses a de novo synthesized rna primer to elongate a complementary strand ( fig . 2a left panel ) ; [ ii ] as an rdrp that uses a 3 fold - back ( back - priming ) configuration of template rna as a primer ( middle panel ) ; or [ iii ] as a tt ( right panel ) . viral rdrps24,25 have been shown to use the first two modes to prime rdrp activity , and cellular rdrp in fission yeast26 and fungi23 use similar priming mechanisms to produce double - stranded ( ds ) rnas that serve as precursors for rnai . we found that recombinant htert and rmrp produced 2 different products depending on the salt concentration ( fig . specifically , we found ~267 nt ( corresponding to sense rmrp ) and ~534 nt sized products ( hereafter referred to as sense + antisense rmrp products ) under high salt conditions and rmrp - sized products under low salt conditions . to discriminate among these modes rnase t1 treatment eliminated the ~267 nt rmrp - sized rna products produced under low salt concentrations ( data not shown ) , indicating that 32p - utp was incorporated by tt activity . in contrast , under high salt conditions , we found two rnas ( ~267 nt and ~534 nt ) that collapsed into a single ~267 nt band after treatment with rnase t1 ( fig . 2c ) . to eliminate the possibility that the sense + antisense product represented partially denatured rnas , we treated the products of the rdrp assay with bacterial rnase iii to digest dsrna and found that only the input ~267 nt rna remained ( fig . furthermore , when we left out adenine or guanine ribonucleotides , we failed to detect the sense + antisense product ( fig . these observations confirm that the ~534 nt sense + antisense products are formed by rdrp activity and represent a ds hairpin structure created by an rna molecule composed of sense and antisense strands of rmrp . to confirm that the interaction of htert and rmrp was required for rdrp activity , we performed an rdrp activity assay using combinations of recombinant mutant htert proteins and rmrp . we failed to detect rdrp reaction products when htert and hterc were co - incubated ( supplementary fig . moreover , when we used the htert - ht1 mutant that does not bind rmrp ( supplementary fig . 8) under conditions where we detected two different rna products in reactions containing wild - type htert and rmrp . we previously described a catalytically inactive htert mutant ( dn htert ) that fails to elongate telomeres11,27 . we confirmed that the recombinant dn htert mutant retained the ability to bind rmrp ( fig . 2f ) but that the dn htert - rmrp complex lacked detectable rdrp activity ( fig . thus htert serves as the catalytic subunit for both the telomerase reverse transcriptase and rdrp activities . these observations suggest that the htert - rmrp rdrp synthesizes ds rna in a template - dependent manner . to confirm the synthesis of the rmrp complementary strand we detected the antisense strand of rmrp in reactions containing recombinant wt htert protein and rmrp but not in reactions containing dn htert and rmrp ( fig . furthermore , we detected the sense + antisense product in the rdrp assay using the antisense strand of rmrp as a probe ( supplementary fig . these observations indicate that the htert - rmrp rdrp produces ds rnas in template - dependent manner in vitro . to determine whether the htert - rmrp rdrp uses a back priming mechanism , we examined the priming process using htert and rmrp as a model system and found that elongation products appeared in time - dependent manner ( fig . 10 ) . to assess whether the rmrp rna forms a 3 fold - back configuration , we generated 3 rmrp truncation mutants and failed to find any reaction products ( fig . thus , unlike what has been described for other cellular rdrps , the htert - rmrp rdrp exhibits a restricted preference for rna molecules that can be used as a template . indeed , when we incubated purified recombinant htert together with total cellular rna and 32p - utp , we identified a limited number of labeled rnas ( fig . although the secondary structure adopted by rmrp to create the 3 fold - back is not known , these observations suggest that rmrp can itself serve as a primer for the polymerization process using a 3 fold - back structure . to ascertain whether this rdrp activity also occurs in vivo , we used the sense strand of rmrp as a probe and found ~534 nt rnas that contain antisense rmrp in rna derived from 293 t , hela and mcf7 cells ( fig . moreover , we detected both sense + antisense and sense products using rmrp antisense strand probe ( fig . these observations confirmed that the ~534 nt products contain both sense and antisense rmrp sequences . to determine whether htert was necessary for the appearance of antisense rmrp in cells , we examined the levels of the complementary rmrp strand in cells : ( i ) that do not express htert and hterc ( va-13)28 ; ( ii ) that transiently express low levels of htert ( bj)27,29,30 ; and ( iii ) that constitutively express htert ( 293 t and hela ) . we also introduced a control vector or a vector that encodes htert in va-13 and bj cells . we detected the complementary rmrp strand using both a quantitative rnase protection assay with a sense strand probe that detects antisense rmrp ( fig . 13 ) and northern blotting with both sense and antisense strand - specific rmrp probes ( fig . to assess the consequences of overexpressing the htert - rmrp complex on rmrp levels , we introduced rmrp into cells that lack htert expression ( va-13 ) , that transiently express htert in a cell - cycle dependent manner ( bj fibroblasts ) and that constitutively express htert ( va-13 and bj fibroblasts expressing ectopic htert , hela and mcf7 cells ) . upon expressing rmrp in cells lacking htert ( va-13 ) , we found that rmrp levels were increased ( fig . in contrast , in cells that express htert , we found that the steady state levels of rmrp were decreased when rmrp was overexpressed regardless of the promoter that was used to express rmrp ( fig . we also found that forced expression of htert in va-13 or bj cells suppressed rmrp expression ( fig . consistent with these findings , suppression of htert in hela cells led to increased rmrp expression ( fig . 4c ) . since the 3 end of rmrp was essential for htert - rmrp activity ( fig . 2i ) , we examined the effects of expressing rmrp truncation mutants lacking 3 ends and found that only truncation mutants lacking intact 3 ends were readily overexpressed ( fig . these observations demonstrate that rmrp expression levels are dependent on the htert - rmrp rdrp and suggest that rmrp levels are controlled by an rdrp - dependent , negative feedback control mechanism . in other organisms , rdrps synthesize ds rnas that are processed into active sirnas31 . since manipulating htert and rmrp levels affected rmrp expression , we hypothesized that the htert - rmrp complex produces rmrp - specific sirna to regulate rmrp levels . to test this possibility , we used sense and antisense probes corresponding to rmrp ( nucleotides 2140 ) in northern blotting and found ds 22 nt rnas ( fig . . 11b ) . since sirnas contain 5 monophosphates and 3 hydroxyl groups3234 , we characterized the chemical nature of the small rna ends . we found that calf intestinal phosphatase ( cip ) slowed the migration of these short rnas and subsequent incubation with polynucleotide kinase ( pnk ) and atp restored the mobility of the short rnas , indicating that either the 5 or 3 end of this small rna is monophosphorylated ( fig . moreover , incubation with pnk in the absence of atp did not alter the migration ( fig . 4f ) , and oxidation and -elimination treatment increased the migration of these small rnas ( fig . 4 g ) , indicating that the 3 ends bear vicinal 2 , 3 dihydroxyls . together , these observations confirm that these small rnas contain 5 monophosphate and 3 hydroxyl groups and therefore share the size and chemical composition of known sirnas . to demonstrate that ds rnas produced by the htert - rmrp rdrp are processed into sirna when we suppressed dicer expression in hela , 293 t or mcf7 cells , we found that endogenous rmrp levels increased up to 3.7 fold ( fig . 5b ) . suppressing dicer expression in va-13 cells that lack htert did not affect the levels of single - stranded rmrp ( fig . 5b ) but did increase levels of the elongated sense + antisense rmrp products in cells that constitutively express htert ( supplementary fig . moreover , we found that only the sense strands of these endogenous rmrp - specific sirnas were associated with human ago2 ( fig . these observations indicate that the endogenous rmrp - specific sirnas are processed by the rna - induced silencing complex , similar to other small rnas that are processed into sirna . to confirm that these small rnas act as sirna , we identified small rnas from total rna that hybridized to probes spanning rmrp , synthesized sirna corresponding to the identified sequences and tested the consequences of introducing this sirna in hela , 293 t and mcf7 cells . these observations provide evidence that similar to other cellular rdrps , the tert - rmrp rdrp synthesizes ds rnas that serve as a precursor for sirna . here we demonstrate that htert and rmrp form distinct ribnucleoprotein complex that exhibits the ability to produce ds rnas ( supplementary fig . 1 ) . like rdrps found in other organisms , the htert - rmrp complex produces ds rnas that serve as substrates for the generation of sirna . however , unlike other cellular rdrps23,26,31,35,36 , the htert - rmrp rdrp exhibits a strong preference for rna templates that can form 3 fold - back structures . since other cellular rdrps have been identified using assays that require primer independent rdrp activity23,26,36 , the substrate specificity of the htert - rmrp rdrp may , in part , account for the difficulty in identifying mammalian enzymes that exhibit rdrp activity . although the cellular rdrps described to date do not exhibit a primer requirement , several viral rdrps use both primer - dependent and primer - independent mechanisms , and fungal and yeast rdrps are also able to employ a back - priming mechanism23,26 . since tert is a closed right - handed polymerase37 evolutionarily related to both reverse transcriptases and viral rdrps18 , these observations are consistent with prior observations that indicate that right - handed rdrps exhibit primer - dependent rdrp polymerase activity38 . using rmrp as a template , the htert - rmrp rdrp produces ds rnas that are processed by dicer into 22 nt ds rnas that contain 5 monophosphate and 3 hydroxyl groups and are loaded into ago2 , confirming that these short rnas represent endogenous sirnas . recent work has shown that in oocytes and embryonic stem cells , endogenous sirna can also be formed by the transcription of complementary sense and antisense strands3941 . thus , in mammals at least two mechanisms lead to the production of ds rnas that are processed into sirna . further work will be necessary to determine whether there are tissue - dependent differences in the use of these two mechanisms and if other mammalian rdrps exist . we found that the htert - rmrp rdrp regulates rmrp levels through a negative feedback control mechanism . the identities and functions of the rnas other than rmrp that serve as templates for the htert - rmrp rdrp remain to be identified ( fig . however , since endogenously encoded sirnas suppress l1 retrotransposition in human cells42 , these observations suggest that the htert - rmrp complex may regulate the expression of other genes by generating sirnas . since mutations in rmrp are found in chh15 , these findings suggest that perturbation of the htert - rmrp complex is involved in the pathogenesis of this disorder . the involvement of htert in two syndromes characterized by stem cell failure ( chh and dyskeratosis congenita)7,8,43 suggests that ribonucleoprotein complexes containing htert play a critical role in stem cell biology . indeed , overexpression of mtert in mice lacking mterc leads to defects in normal hair follicle stem cell function12 at least in part by altering gene expression programs related to stem cell function44 . in mammals , tert may regulate both telomere biology and gene expression through these two ribonucleoprotein complexes . rnas that bind htert were identified from hela - s cells expressing a tap - epitope tagged version of htert . rnas that bound to htert after two rounds of purification were analyzed using an experion capillary electrophoresis device ( bio - rad laboratories , inc . ca , usa ) to visualize rna species . for rna cloning and the sequencing , the same samples were separated using a 7 m urea/15% polyacrylamide gel , and rnas recovered from gel were cloned using the small rna cloning kit ( takara ) . purified gst - htert was isolated from e. coli and incubated with either hterc or rmrp transcribed in vitro to assess the ability of such complexes to exhibit telomerase or rdrp activity . rnai was used to suppress htert and to show that the htert - rmrp complex also produces ds rna in cells . northern blotting with sense and anti - sense probes specific for rmrp ( nt 2140 ) identified 22 nt ds , small rnas that contained a 5 monophosphate and a 3 hydroxyl group , which were loaded into human ago2 . to determine the function of these rmrp - derived small rnas , a chemically synthesized sirna corresponding to these small rnas ( sirna : 5-ggctacacactgaggactc-3 ; dharmacon ) was transfected into hela , 293 t and mcf7 cells .	constitutive expression of telomerase in human cells prevents the onset of senescence and crisis by maintaining telomere homeostasis . however , accumulating evidence suggests that the human telomerase catalytic subunit ( htert ) contributes to cell physiology independent of its ability to elongate telomeres . here we show that htert interacts with the rna component of mitochondrial rna processing endoribonuclease ( rmrp ) , a gene that is mutated in the inherited pleiotropic syndrome cartilage - hair hypoplasia . htert and rmrp form a distinct ribonucleoprotein complex that exhibits rna dependent rna polymerase ( rdrp ) activity and produces double - stranded rnas that can be processed into small interfering rna in a dicer - dependent manner . these observations identify a mammalian rdrp composed of htert in complex with rmrp .
You are an expert at summarizing long articles. Proceed to summarize the following text: alzheimer 's disease ( ad ) is a progressive neurodegenerative disorder and causes significant dementia in elderly . the neuropathological hallmarks of ad include deposits of amyloid fibrils in senile plaques and presence of abnormal tau protein filaments in the form of neurofibrillary tangles . hippocampus , limbic system , and cortex are the primary areas involved in the pathophysiology of ad . the etiopathogenesis of this disorder is multifactorial and oxidative stress has been reported to play a significant role in the onset and progression of ad . considering the mechanistic aspects , it has been recognized that -amyloid aggregates and iron accumulation both synergistically cause oxidative damage by free radical generation [ 3 , 4 ] . centrally administered colchicine - induced cognitive dysfunction is a well - known model that represents sporadic dementia of alzheimer 's type ( sdat ) . colchicine , a microtubule disrupting agent causes cytoskeletal alterations and axonal transport dysfunction leading to death of cerebellar granule cells , olfactory bulb neurons , cells of subventricular zone , dentate gyrus cells , and basal forebrain cholinergic neurons , thus causing cognitive impairment . it induces neurofibrillary degeneration by binding to tubulin , principal structural protein of microtubules , thereby inhibiting axoplasmic transport , and mitosis . in addition , central administration of colchicine causes excessive free radical generation and oxidative damage that can be positively correlated with the extent of cognitive impairment . phytopharmaceuticals are gaining importance as modern medicine as well as traditional system of medicine owing to their therapeutic potential . novel antioxidants may offer an effective and safe means of bolstering body 's defense against free radicals and thereby provide protection against ad like problems . various natural antioxidants like curcumin , rosmarinic acid , huperzine a have been reported to have a neuroprotective effect against ad [ 1214 ] . hydrocotyle asiatica l. ) belonging to family apiaceae ( umbelliferae ) is a psychoactive medicinal plant being used from centuries in ayurvedic system of medicine as a medhya rasayna . it has been reported to possess various pharmacological effects on cns such as stimulatory - nervine tonic , rejuvenant , sedative , anxiolytic , and intelligence promoting property . previous report also demonstrated that centella asiatica leaf extract involved in the morphology of hippocampal ca3 and amygdal neuronal dendritic arborization in neonatal rats . the whole plant has been shown to improve general mental ability of mentally retarded children . it has also been shown to decrease the oxidative stress parameters [ 16 , 20 ] . however , its exact mechanism of action in the treatment and management of alzheimer disease has not been fully understood . therefore , present study was designed to investigate the possible neuroprotective effect of centella asiatica against colchicine - induced cognitive impairment and associated oxidative damage in rats . young male wistar rats ( 180200 g ) procured from central animal house , panjab university , chandigarh were used . following surgery , animals were kept under standard conditions of a 12-hour light / dark cycle with food and water ad libitum in groups of 2 , in plastic cages with soft bedding . the protocol was approved by the institutional animal ethics committee of panjab university , chandigarh , india , and carried out in accordance with the indian national science academy guidelines for the use and care of laboratory animals . animal was anesthetized with thiopental sodium ( 45 mg / kg ) and positioned in a stereotaxic apparatus . the head was positioned in a frame and a midline sagittal incision made in the scalp . two holes were drilled in the skull for the placement of the injection cannula into both the lateral cerebral ventricles . co - ordinates for the intracerebroventricular ( icv ) cannula implantation were 0.8 mm posterior to bregma , 1.8 mm lateral to the sagittal suture , and 3.6 mm beneath the cortical surface . gentamicin ( 5 mg / kg , ip ) was applied to the surgical area in order to prevent sepsis . special care of the animals was taken during the postoperative period to provide food and water inside the cage of rats . rats were infused icv with either artificial cerebrospinal fluid ( acsf ; in mmol / l : 147 nacl , 2.9 kcl , 1.6 mgcl2 , 1.7 cacl2 , and 2.2 dextrose ) or 15 g colchicine dissolved in acsf . solution ( 5 l ) was injected using a hamilton microsyringe positioned in the injection cannula and the syringe was kept in place for 2 minutes in order to allow for the diffusion of the injected volume and prevents pressure - induced damage . louis , usa ) and standardized aqueous extract of centella asiatica ( ca ) ( dabur research foundation , ghaziabad , india ) were used . colchicine was prepared in acsf such that a 15 g dose was delivered in a 5 l injection volume for icv administration . for oral administration , aqueous extract of ca was administered in a dose of 0.5 ml/100 g body weight . animals were divided randomly based on their body weights into seven groups of 7 animals each . the doses of ca aqueous extract were selected based on the previous studies in the laboratory and those reported in the literature . elevated plus maze paradigmthe elevated plus maze consisted of two opposite black open arms ( 50 10 cm ) , crossed with two closed walls of the same dimensions with 40 cm high walls . the arms were connected with a central square of dimensions 10 10 cm . the entire maze was elevated to a height of 50 cm from the floor . animal was placed individually at one end of the open arm facing away from the central square . the time taken by the animal to move from the open arm to the closed arm animal was allowed to explore the maze for 20 seconds after recording the itl and then returned to the home cage . if the animal did not enter the enclosed arm within 90 seconds , it was guided on the back into one of the enclosed arm and the itl was given as 90 seconds . retention of memory was assessed by placing the rat in an open arm and the retention latency was noted on day 14 and day 21 of itl and was termed as the first retention transfer latency ( 1st rtl ) and second retention transfer latency ( 2nd rtl ) , respectively . the elevated plus maze consisted of two opposite black open arms ( 50 10 cm ) , crossed with two closed walls of the same dimensions with 40 cm high walls . the arms were connected with a central square of dimensions 10 10 cm . the entire maze was elevated to a height of 50 cm from the floor . animal was placed individually at one end of the open arm facing away from the central square . the time taken by the animal to move from the open arm to the closed arm animal was allowed to explore the maze for 20 seconds after recording the itl and then returned to the home cage . if the animal did not enter the enclosed arm within 90 seconds , it was guided on the back into one of the enclosed arm and the itl was given as 90 seconds . retention of memory was assessed by placing the rat in an open arm and the retention latency was noted on day 14 and day 21 of itl and was termed as the first retention transfer latency ( 1st rtl ) and second retention transfer latency ( 2nd rtl ) , respectively . spatial navigation taskthe acquisition and retention of a spatial navigation task was evaluated by using morris water maze . animals were trained to swim toward a visible platform in a circular pool ( 180 cm in diameter and 60 cm in height ) located in a test room . in principle , rats can escape from swimming by climbing onto the platform and over time the rats apparently learn the spatial location of the platform from any starting position at the circumference of the pool . thus the platform offers no local cues to guide the escape behavior of the rats . the pool was filled with water ( 28 2c ) to a height of 40 cm , a movable circular platform ( 9 cm diameter ) , mounted on a column , was placed in a pool 2 cm above the water level during the acquisition phase . a similar platform was placed in the pool 2 cm below the water level for the maze retention phase . four equally spaced locations around the edge of the pool ( n , s , e , and w ) were used as starting points and this divided the pool into four equal quadrants.(1 ) maze acquisition phase ( training ) . animals received a training session consisting of 4 trials on day 13 . in all 4 trials , a trial began by releasing the animal into the maze facing towards the wall of the pool . the latency to find the escape platform was recorded to a maximum of 90 seconds . if the rat did not escape onto the platform within this time , it was guided to the platform and was allowed to remain there for 20 seconds . the time taken by rat to reach the platform was taken as the initial acquisition latency ( ial).(2 ) maze retention phase ( testing for retention of the learned task ) . following 24 hour ( day 14 ) and 8 days ( day 21 ) after ial , the rat was released randomly from one of the edges facing the wall of the pool . the time taken to find the hidden platform was recorded and termed as first retention latency ( 1st rl ) and second retention latency ( 2nd rl ) on day 14 and day 21 following central administration of colchicines , respectively . the acquisition and retention of a spatial navigation task was evaluated by using morris water maze . animals were trained to swim toward a visible platform in a circular pool ( 180 cm in diameter and 60 cm in height ) located in a test room . in principle , rats can escape from swimming by climbing onto the platform and over time the rats apparently learn the spatial location of the platform from any starting position at the circumference of the pool . thus the platform offers no local cues to guide the escape behavior of the rats . the pool was filled with water ( 28 2c ) to a height of 40 cm , a movable circular platform ( 9 cm diameter ) , mounted on a column , was placed in a pool 2 cm above the water level during the acquisition phase . a similar platform was placed in the pool 2 cm below the water level for the maze retention phase . four equally spaced locations around the edge of the pool ( n , s , e , and w ) were used as starting points and this divided the pool into four equal quadrants . a trial began by releasing the animal into the maze facing towards the wall of the pool . the latency to find the escape platform was recorded to a maximum of 90 seconds . if the rat did not escape onto the platform within this time , it was guided to the platform and was allowed to remain there for 20 seconds . the time taken by rat to reach the platform ( 2 ) maze retention phase ( testing for retention of the learned task ) . following 24 hour ( day 14 ) and 8 days ( day 21 ) after ial , the rat was released randomly from one of the edges facing the wall of the pool . the time taken to find the hidden platform was recorded and termed as first retention latency ( 1st rl ) and second retention latency ( 2nd rl ) on day 14 and day 21 following central administration of colchicines , respectively . gross behavioral activity was observed on days 1 , 7 , 14 , and 21 following icv colchicine injection . animal was placed in a square ( 30 cm ) closed arena equipped with infrared light - sensitive photocells using digital photoactometer . the animals were observed for a period of 5 minutes and the values were expressed as counts/5 minutes . on day 24 , after behavioral assessments a ( 10% w / v ) homogenate was prepared in 0.1 m phosphate buffer ( ph 7.4 ) . the homogenate was centrifuged at 10,000 g for 15 minutes and aliquots of supernatant was separated and used for biochemical estimation . the amount of malondialdehyde ( mda ) was measured by reaction with thiobarbituric acid at 532 nm using perkin elmer lambda 20 spectrophotometer . the values were calculated using the molar extinction coefficient of chromophore ( 1.56 10(mol / l)cm ) . a 1-ml supernatant was precipitated with 1 ml of 4% sulphosalicylic acid and cold digested for 1 hour at 4c . the samples were then centrifuged at 1,200 g for 15 minutes at 4c . to 1 ml of the supernatant obtained , 2.7 ml of phosphate buffer ( 0.1 mmol / l , ph 8) and 0.2 ml of 5 , 5 dithio - bis ( 2-nitrobenzoic acid ) ( dtnb ) was added . the developed yellow color was measured at 412 nm using perkin elmer lambda 20 spectrophotometer . results were calculated using the molar extinction co - efficient of the chromophore ( 1.36 10 ( mol / l)cm ) . the accumulation of nitrite in the supernatant , an indicator of the production of nitric oxide , was determined by a colorimetric assay with greiss reagent according to green et al . . the assay system consisted of edta 0.1 mm , sodium carbonate 50 mm and 96 mm of nitro blue tetrazolium ( nbt ) . in the cuvette , 2 ml of the above mixture , 0.05 ml of hydroxylamine , and 0.05 ml of the supernatant were added , and the auto - oxidation of hydroxylamine was measured for 2 minutes at 30-second interval by measuring the absorbance at 560 nm using perkin elmer lambda 20 spectrophotometer . catalase activity was assessed by the method of luck , wherein the breakdown of hydrogen peroxide is measured . briefly , the assay mixture consisted of 3 ml of h2o2 phosphate buffer and 0.05 ml of the supernatant of the tissue homogenate . the change in absorbance was recorded for 2 minutes at 30-second interval at 240 nm using perkin elmer lambda 20 spectrophotometer . the activity of glutathione - s - transferase was assayed by the method of habig and jakoby . briefly , the assay mixture consisted of 2.7 ml of phosphate buffer , 0.1 ml of reduced glutathione , 0.1 ml of 1-chloro-2 , 4-dinitrobenzene ( cdnb ) as substrate , and 0.1 ml of supernatant . the increase in the absorbance was recorded at 340 nm for 5 minutes at 1-minute interval using perkin elmer lambda 20 spectrophotometer . acetyl cholinesterase ( ache ) is a marker of extensive loss of cholinergic neurons in the forebrain . the change in absorbance was measured for 2 minutes at 30-second interval at 412 nm using perkin elmer lambda 20 spectrophotometer . the protein content was estimated by biuret method using bovine serum albumin as a standard . the behavioral assessment data were analyzed by a repeated measures two - way anova with drug - treated groups as between and sessions as the within - subjects factors . in the present experiment , mean itl on day 13 for each rat was relatively stable and showed no significant variation among different groups . all the rats entered the closed arm within 90 seconds . following training , sham - operated , acsf - injected , and ca - treated ( 150 and 300 mg / kg , po ) rats entered closed arm quickly as compared to colchicine treated rats . mean retention transfer latencies ( 1st rtl and 2nd rtl ) to enter closed arm on days 14 and 21 were shorter as compared to itl on day 13 of each group , respectively . in contrast , colchicine - injected rats performed poorly throughout the experiment and did not show any change in the mean retention transfer latencies on days 14 and 21 as compared to pretraining latency on day 13 , demonstrating that colchicines - induced marked memory impairment . chronic administration of ca ( 150 and 300 mg / kg ) beginning prior to colchicine injection significantly decreased the mean retention latencies on days 14 and 21 following colchicine injection ( p < .05 versus icv colchicine group ) ( table 2 ) . the mean transfer latencies of ca- treated ( 150 and 300 mg / kg , po ) and icv colchicines - treated groups were significantly different from that of ca per se groups on days 14 and 21 ( p < .05 ) ( table 2 ) . sham - operated , acsf - injected , and ca per se ( 150 and 300 mg / kg , po ) group of animals quickly learned to swim directly to the platform in the morris water maze on day 13 . colchicine - treated rats showed an initial increase in escape latency , which declined with continued training during the acquisition of a spatial navigation task on day 13 . ca ( 150 and 300 mg / kg , po ) group of rats was also performed similarly during the acquisition of a spatial navigation task on day 13 ( versus acsf - injected group ) . there was a significant difference in the mean ial of colchicines - treated group compared to acsf - injected group on day 13 indicating colchicine - induced impaired acquisition of spatial navigation task ( p < .05 ) . in contrast , ca ( 150 and 300 mg / kg , po ) treatment significantly decreased the ial to reach the platform in the pretrained rats as compared to colchicine treated rats on day 13 following colchicine administration ( table 3 ) . following training , the mean retention latencies ( 1st and 2nd rl ) to escape onto the hidden platform were significantly decreased in sham - operated and acsf - injected rats on days 14 and 21 , respectively , as compared to ial on day 13 following colchicine administration . on the contrary , the performance in the colchicines - treated rats was changed after initial training in the water maze on days 14 and 21 , with significant increase in mean retention latencies compared to ial on day 13 . the results suggest that colchicine caused significant cognitive impairment . however , chronic ca treatment ( 150 and 300 mg / kg , po ) starting before colchicine administration showed a significant decline in the 1st and 2nd rl as compared to colchicines - treated rats on days 14 and 21 , respectively , following colchicine administration ( table 3 ) and improved the retention performance of the spatial navigation task . in the present series of experiments , the mean scores of locomotor activity for each rat were relatively stable and showed no significant variation among different groups . the mean scores in sham - operated , acsf- , and colchicines - treated rats remained unchanged . further , both the dose of ca ( 150 and 300 mg / kg , po ) did not cause any significant alteration in the locomotor activity as compared to colchicine treated rats on days 14 and 21 ( figure 1 ) . central administration of colchicine caused significant rise in brain mda , nitrite levels , depletion of gsh , glutathione - s - transferase , sod , and catalase levels as compared to acsf . however , chronic ca ( 150 and 300 mg / kg , po ) treatment significantly attenuated the increase in mda , nitrite levels , and restored decrease in reduced gsh ( table 3 ) . ca treatment also caused a significant increase in glutathione - s - transferase , sod , and catalase levels ( table 4 ) . intracerebroventricular administration of acsf did not show any significant effect on brain acetylcholinesterase levels as compared to sham - operated rats . in contrast , central colchicine injection showed significant increase in the brain ache activity as compared to acsf - injected rats . however , chronic oral administration of ca ( 150 mg / kg and 300 mg / kg , po ) significantly attenuated enhanced ache activity compared to colchicines - treated group ( figure 2 ) . the present study investigated the effect of centella asiatica ( ca ) extract in the prevention of sporadic dementia of alzheimer 's type using intracerebroventricular colchicines - induced rats . salient findings of this study are that pre- and postcolchicine treatment with ca improved cognition , decreased malondialdehyde , and nitrite levels , restored decrease in gsh , increased activities of glutathione - s - transferase , catalase , and sod . this illustrates that central administration of colchicine is characterized by progressive deterioration of learning and memory , oxidative stress , and decrease in acetylcholine turnover [ 32 , 33 ] . colchicine is an alkaloid derivative that binds irreversibly to microtubules and causes their depolymerization , thereby inhibiting their assembly . this leads to impaired intracellular trafficking of neurotrophic factors , synaptic loss , and increased axonal excitotoxicity . in the present study , colchicine when given centrally resulted in significant memory impairment in elevated plus maze and morris water maze tasks which were attenuated by chronic ca treatment . in the present study , chronic administration of ca was able to improve the cognitive deficit and attenuated oxidative stress , suggesting that ca improves cognitive task and has antioxidant - like effect [ 16 , 36 ] . additionally , ca leaf extract has been reported to improve spatial learning performance and enhance memory retention in neonatal rats during growth spurt period and also found efficient in enhancing hippocampal ca3 neuronaldendritic arborization in rats [ 18 , 37 ] . the key metabolites of lipid oxidation are malondialdehyde ( mda ) and 4-hydroxynonenal ( hne ) . further , it has been supported that the level of hne also found abundantly in on apolipoprotein e in vitro and on cyto skeletal proteins in cell culture . our results also proved that the administration of colchicine produced the increased mda levels which are more responsible for the oxidative damage in rats . a growing body of evidence supports the fact that free radicals are the most likely candidates responsible for producing neuronal changes mediating the behavioral deficits in ad [ 39 , 40 ] . although colchicine is one of the major oxidative medication of proteins resulting from peroxynitrite which is associated with free radical and nitric oxide , central administration of colchicine causes oxidative stress by increasing glu / gaba ratio and increasing nos production in the brain . this results in an excessive glutamate activity and no production thereby resulting in oxidative stress and extensive neuronal damage . it has been reported that activated microglia are widely abundant in most senile plaque in ad which are responsible for the production of nitric oxide . so it seems that the production of nitric oxide produced by oxidative stress with colchicine is an additional link to lower incidence of ad with use of antioxidant agent . in the present study , ca per se did not show any significant effect on the oxidative stress markers in the brain of normal animals . however , ca treatment significantly attenuated the colchicines - induced oxidative stress . the main chemical constituents of ca are triterpenes mainly pentacyclic triterpenic acids and their respective glycosides , including asiatic acid , asiaticoside , madecassic acid , madecassoside , brahmoside , brahmic acid , brahminoside , thankuniside , isothankuniside , centelloside , madasiatic acid , centic acid , and cenellicacid . beside triterpenoids and essential oils , ca has also been reported to contain numerous flavonoids , including quercetin , kaempferol , catechin , rutin , and naringin , some of which are major contributors in particular to the antioxidative activity of ca . ca has been recently indicated to show antilipid peroxidative and free radical scavenging activities [ 49 , 50 ] . it has been shown to react with free radicals and prevent generation of hydroxyl free radicals . the decreased level of gsh and glutathione - s - transferase activity in colchicines - treated animals indicates that there is an increased generation of free radicals and reduced activity of glutathione system in combating oxidative stress . ca treatment was able to restore the gsh levels and also cause a significant increase in the glutathione - s - transferase activity . central administration of colchicine causes an increase in expression of nos resulting in increased levels of no which is neurotoxic to cholinergic neurons . nitric oxide also acts as a precursor for peroxynitrite free radical which results in neuronal damage . this explains that central administration of colchicine caused a significant increase in the nitrite levels in the brain and ca treatment was able to decrease the raised nitrite levels . jin et al . showed that ca aqueous extract which contains asiaticoside has an anti - inflammatory property that is brought about by inhibition of no synthesis . central administration of colchicine produces marked destruction of hippocampal granule cells and septohippocampal pathways resulting in loss of cholinergic neurons and decreased activities of acetylcholinesterase and choline acetyltransferase . in the present study , colchicine caused a significant increase in the acetylcholinesterase activity thereby leading to learning and memory deficits . ca was able to ameliorate the colchicine induced decrease in ache activity . in summary , the present study suggests that chronic administration of ca prevents colchicine - induced cognitive impairment and associated oxidative stress . thus , the use of ca is promising for the treatment of ad and other neurodegenerative disorders .	oxidative stress appears to be an early event involved in the pathogenesis of alzheimer 's disease . the present study was designed to investigate the neuroprotective effects of centella asiatica against colchicine - induced memory impairment and oxidative damage in rats . colchicine ( 15 g/5 l ) was administered intracerebroventricularly in the lateral ventricle of male wistar rats . morris water maze and plus - maze performance tests were used to assess memory performance tasks . various biochemical parameters such as lipid peroxidation , nitrite , reduced glutathione , glutathione - s - transferase , superoxide dismutase , acetylcholinesterase were also assessed . icv colchicine resulted marked memory impairment and oxidative damage . chronic treatment with centella asiatica extract ( 150 and 300 mg / kg , p.o . ) for a period of 25 days , beginning 4 days prior to colchicine administration , significantly attenuated colchicine - induced memory impairment and oxidative damage . besides , centella asiatica significantly reversed colchicines administered increase in acetylcholinesterase activity . thus , present study indicates protective effect of centella asiatica against colchicine - induced cognitive impairment and associated oxidative damage .
You are an expert at summarizing long articles. Proceed to summarize the following text: bazex syndrome or acrokeratosis paraneoplastica is a rare paraneoplastic dermatosis and is characterized by psoriasiform hyperkeratotic lesions . in most cases , the underlying malignancy is squamous cell carcinoma of the upper aerodigestive tract or cervical lymph nodes from an unknown primary site . for the cutaneous lesions , steroid and topical treatments are not effective , but treatment of the underlying tumor provides relief . we here report a 63-year - old man with bazex syndrome caused by squamous cell carcinoma of the cervical lymph nodes from an unknown primary site , who had hypoalbuminemia and severe ascites . moreover , after surgery , not only the lesions , but also the hypoalbuminemia and ascites were improved . a 63-year - old man with chronic hepatitis developed a neck mass and diffuse psoriasiform hyperkeratosis and bullae affecting his face , hands , and feet ( fig . 1 ) . he had no past or family history of psoriasis or other skin disease . excisional biopsy of the neck mass was performed , and the pathological diagnosis was squamous cell carcinoma . he was diagnosed with bazex syndrome with squamous cell carcinoma of cervical lymph nodes from an unknown primary origin and was referred to our hospital . on admission , his height was 165 cm , his body weight was 62 kg , his temperature was 37.5c , his blood pressure was 132/72 mm hg , his pulse rate was 78 beats / min , his oxygen saturation was 96% on room air , his oral intake was normal , and his serum albumin was 2.3 g / dl . computed tomography revealed multiple masses on the right side of the neck and mild ascites . pathological examination demonstrated metastases of well - differentiated squamous cell carcinoma of level iia and iii lymph nodes , and extranodal spread was seen in the iia lymph node . his serum albumin dropped to 1.4 g / dl by 3 days after surgery . at 10 days after surgery ascites aspiration showed clear fluid with a specific gravity of 1.017 , and a protein level of 2.0 g / dl ; the rivalta test was negative and cytology was normal . his ascites improved at 2 months after surgery , with improvement of his lesions . at 5 years after surgery , he had no evidence of recurrence , with the absence of ascites , and his serum albumin was 3.9 g / dl . bazex syndrome can present with hypoalbuminemia and ascites , and symptoms can be improved by treatment of the underlying tumor . hypoalbuminemia is associated with several different diseases , including cirrhosis , burns , malnutrition , nephrotic syndrome , sepsis , and cachexia . moreover , he did not show weight loss ; we therefore ruled out cachexia . in the case in addition to burns , bullae of bazex syndrome may also cause hypoalbuminemia and ascites . bolognia et al . reported that 16% of such patients developed vesicles , bullae , and crusts , in addition to psoriasiform hyperkeratosis . additionally , robert et al . reported a patient with bazex syndrome who developed ascites , but the association was not described . in this case , ascites first became severe after surgery , but he improved by 2 months after surgery . this was fortunate , as we may not have opted for cancer treatment if the onset of severe ascites occurred before the treatment . this case suggests that not only the lesions , but also hypoalbuminemia and ascites can be improved after treatment of the underlying tumor . the mechanism by which bazex syndrome causes hypoalbuminemia and ascites has not been fully elucidated .	bazex syndrome is a rare paraneoplastic dermatosis . the underlying malignancy frequently is squamous cell carcinoma of the upper aerodigestive tract or cervical lymph nodes from an unknown primary site . we report a 63-year - old man with squamous cell carcinoma of cervical lymph nodes from an unknown primary site . he developed a mass on the right side of his neck , cutaneous lesions diagnosed as bazex syndrome , hypoalbuminemia , and severe ascites . right neck dissection was performed . after neck dissection , not only the cutaneous lesions , but also the severe hypoalbuminemia and severe ascites were improved . bazex syndrome may be associated with hypoalbuminemia and ascites .
You are an expert at summarizing long articles. Proceed to summarize the following text: children afflicted with nephrotic syndrome lose proteins to urine , resulting in hypoproteinemia and generalized edema . idiopathic nephrotic syndrome occurs in two or more children out of 100,000 and is the most common chronic glomerular disease in children . many patients have minimal change nephrotic syndrome , and most respond well to steroid therapy , but up to half of them develop frequently relapsing nephrotic syndrome or steroid - dependent nephrotic syndrome ( frns / sdns ) . a total of 1020 % of idiopathic nephrotic syndrome patients show steroid resistance ( steroid - resistant nephrotic syndrome : srns ) , defined as persisting proteinuria after a 4-week course of oral steroids . standard treatments for frns / sdns are immunosuppressive agents , such as cyclophosphamide , chlorambucil , cyclosporine ( cya ) , and levamisole , and cya is often used for treatment of srns [ 35 ] . most affected children are helped by these drugs ; however , some still show complicated clinical courses . a total of 1020 % of children with frns / sdns on cya have frequent relapses [ 6 , 7 ] , and approximately 30 % of childhood srns patients have steroid - sensitive frequent relapses after achievement of complete remission . in addition , cya can cause side effects , especially chronic nephrotoxicity [ 9 , 10 ] , suggesting that cya treatment should be discontinued after its long - term use . however , discontinuing cya almost always results in frequent relapses or steroid dependence , requiring long - term steroid therapies , which also pose a long - term risk to children . collectively , at least 1020 % of children with idiopathic nephrotic syndrome still show frequent relapses or steroid dependence under or after immunosuppressive therapies . we have defined these conditions as complicated frns / sdns . additionally , approximately 23 % of children with idiopathic nephrotic syndrome show resistance for steroids and any immunosuppressive agents , which is defined as refractory srns , posing a high risk of end - stage renal failure ( table 1 ) . therefore , development of new treatments for complicated frns / sdns and for refractory srns is urgently needed.table 1definitions of terms in nephrotic syndromefrequent relapsing nephrotic syndrome ( frns)two or more relapses within 6 months after initial remission or 4 or more relapses within any 12-month periodsteroid - dependent nephrotic syndrome ( sdns)two consecutive relapses during the reduction of steroid therapy or within 2 weeks of discontinuation of steroid therapysteroid - resistant nephrotic syndrome ( srns)when the daily administration of prednisolone at 60 mg / m / day does not lead to remission within 4 weekscomplicated frns / sdns(1 ) diagnosed with frequent relapse ( frns ) or steroid dependence ( sdns ) after completion of immunosuppressive drug therapy ( such as cyclosporine , cyclophosphamide , mizoribine , or mycophenolate mofetil)(2 ) diagnosed with frequent relapse ( frns ) or steroid dependence ( sdns ) during immunosuppressive drug therapy ( such as cyclosporine , cyclophosphamide , mizoribine , or mycophenolate mofetil)(3 ) with a history of steroid resistance and diagnosed with frequent relapse or steroid dependence during or after the completion of immunosuppressive drug therapy ( such as cyclosporine or combination of cyclosporine and methylprednisolone)refractory srnswhen the combination of steroids and immunosuppressive agents including calcineurin inhibitors does not lead to remission definitions of terms in nephrotic syndrome rituximab is a chimeric anti - cd20 monoclonal antibody , which inhibits cd20-mediated b - cell proliferation and differentiation , resulting in depletion of peripheral blood b lymphocytes . this drug was developed for the treatment of b - cell non - hodgkin s lymphoma and is now indicated for the treatment of patients with autoimmune diseases , including rheumatoid arthritis , wegener s granulomatosis , and microscopic polyangiitis [ 11 , 12 ] . in the past 10 years , there have been anecdotal reports of rituximab being effective for nephrotic syndrome . in 2004 , a patient suffering from sdns complicated with idiopathic thrombocytopenic purpura underwent rituximab treatment , resulting in long - term remission of nephrotic syndrome and idiopathic thrombocytopenic purpura . in 2005 , nozu et al . reported that rituximab treatment induced long - term remission in recurrent nephrotic syndrome and posttransplant lymphoproliferative disorder after renal transplantation . however , other reports have shown that none of the patients treated with rituximab achieved remission in recurrent nephrotic syndrome after renal transplantation . reported three complete and two partial remissions in five patients with refractory srns receiving rituximab . although other case reports and case series , as well as the above - mentioned reports , have suggested that rituximab treatment is effective in some patients with refractory srns [ 1924 ] , there is no evidence that rituximab is effective in patients with refractory srns . indeed , magnasco et al . reported the results of an open - label , randomized trial including 31 children with refractory srns who received calcineurin inhibitors and prednisolone , and 16 of them received an additional two rituximab infusions . however , proteinuria remained unchanged in rituximab - treated patients and none of them had partial or complete remission . several case reports and case series , as well as survey studies , have suggested that rituximab is effective for patients with complicated ( difficult to treat ) frns / sdns , allowing discontinuation or reduction steroids and/or immunosuppressants [ 22 , 24 , 2630 ] . treated 46 children with idiopathic nephrotic syndrome maintained in remission with steroids and calcineurin inhibitors ( i.e. , complicated frns / sdns ) with one to five rituximab courses . they found that the 6-month probability of remission was 48 % after the first remission [ 31 ] . reported the effects of rituximab therapy followed by immunosuppression withdrawal on disease recurrence in 30 patients ( including 10 children ) with complicated frns / sdns . in their report , participants received one or two doses of rituximab , and all of them were in remission at 1 year [ 32 ] . conducted an open - label , randomized , controlled trial to examine the short - term effects of rituximab in children with steroid- and calcineurin - dependent nephrotic syndrome ( i.e. , complicated frns / sdns ) . they concluded that rituximab and lower doses of prednisone and calcineurin inhibitors are non - inferior to standard therapy in maintaining short - term remission [ 33 ] . taken together , these findings suggest that rituximab is effective for children with complicated frns / sdns . however , these studies were case reports , case series , retrospective surveys , and single - arm or short - term trials . therefore , well - designed controlled trials are required to establish the value of rituximab in this condition . to evaluate the efficacy and safety of rituximab in childhood - onset complicated frns / sdns , a multicenter , double - blind , randomized , placebo - controlled trial was carried out by the research group of childhood - onset refractory nephrotic syndrome ( rcrns ) in japan ( rcrns01 ) ( clinical trials registry i d : umin000001405 ) . at the same time , an open - label , multicenter , pharmacokinetic trial ( rcrns-02 ) ( clinical trials registry i d : umin000001406 ) was also carried out . these two trials were investigator - initiated clinical trials , which sought to gain approval from the ministry of health , labour and welfare , japan to make rituximab available for patients with childhood - onset complicated frns / sdns . these trials were supported by a health and labor sciences research grant for the large scale clinical trial network project ( cct - b-2001 ) . when patients developed relapse of nephrotic syndrome , they underwent a screening examination and were registered once their eligibility , including steroid sensitivity , was verified . the rituximab group received intravenous rituximab of 375 mg / m body surface area ( maximum 500 mg ) once weekly for 4 weeks , and the placebo group received placebo at the same frequency . prednisolone treatment was gradually discontinued after obtaining remission , and patients were treated with prednisolone when they developed relapses during the study period . tapering of the cya dose was started on day 85 , and the drug was discontinued by day 169 . all of the patients were observed for 1 year , unless the patients dropped out of the study . patients were considered to have treatment failure if ( 1 ) relapse occurred by day 85 , ( 2 ) frns or sdns was diagnosed between day 86 and day 365 , or ( 3 ) steroid resistance was diagnosed during the observation period . the secondary endpoints were time - to - treatment failure , relapse rate , time to frns / sdns , and steroid dose after randomization . a gold standard , double - blind , placebo - controlled trial was adopted because the use of rituximab in treatment of nephrotic syndrome was not yet approved in any country . in the trial , treatment failures were defined , and in the event that patients had treatment failure , the allocation code was urgently disclosed . if patients were allocated to the placebo group , they were able to enter a separately conducted rituximab pharmacokinetic trial ( rcrns02 ) after discontinuation or completion of rcrns01.fig . ns nephrotic syndrome , mmf mycophenolate mofetil , mzb mizoribine , cya cyclosporine study design . ns nephrotic syndrome , mmf mycophenolate mofetil , mzb mizoribine , cya cyclosporine sixty - three patients were screened , and 52 were randomized . twenty - seven patients were allocated to the rituximab group and 25 to the placebo group . twenty - four patients in each group ( total 48 ) received the intervention and were included in the analysis on an intention - to - treat basis . four patients from the rituximab group and 20 from the placebo group had discontinued the intervention , mostly because of treatment failure . however , no patients dropped out of the study before the first relapse ( the primary endpoint ) . all of the patients with treatment failure in the placebo group were enrolled into rcrns02 after discontinuation ( n = 18 ) or completion ( n = 2 ) of rcrns01 . all of the patients were treated with steroids and/or immunosuppressants at relapse immediately before assignment . over 70 % of patients reported side effects from steroid treatment . by the end of the observation period , relapses were reported in 17 patients in the rituximab group and 23 in the placebo group . the 50 % relapse - free period was 267 days [ 95 % confidence interval ( ci ) 223374 days ] in the rituximab group and 101 days ( 95 % ci 70155 days ) in the placebo group . this relapse - free period was significantly longer in the rituximab group than in the placebo group ( hazard ratio [ hr ] = 0.267 , 95 % ci 0.1350.528 , p < 0.0001 ) . treatment failure was reported in 10 patients in the rituximab group and 20 in the placebo group . the time - to - treatment failure was significantly longer in the rituximab group than in the placebo group ( hr = 0.268 , 95 % ci 0.1220.589 , p = 0.0005 ) , and the relapse rate was significantly lower in the rituximab group than in the placebo group ( 1.542 [ 29/18.81 ] vs. 4.171 [ 46/11.03 ] per person - years , hr = 0.370 , 95 % ci 0.2310.591 , p < 0.0001 ) . significantly , fewer patients in the rituximab group experienced frequent relapses or steroid dependence compared with those in the placebo group ( hr = 0.169 , 95 % ci 0.0610.464 , p = 0.0001 ) . the daily steroid dose after randomization in the rituximab group was significantly lower than that in the placebo group ( 9.12 5.88 vs. 20.85 9.28 mg / m / day , p < 0.0001 ) . the majority of adverse events that were reported were mild and no deaths were reported . although the rate of serious adverse events was higher in the rituximab group than in the placebo group ( 42 % [ 10/24 ] vs. 25 % [ 6/24 ] ) , but this difference was not significant ( fisher s exact test , p = 0.3587 ) . mild infusion reactions were reported more frequently in the rituximab group ( 79 % [ 19/24 ] ) than in the placebo group ( 54 % [ 13/24 ] ) , but this difference was not significant ( fisher s exact test , p = 0.1246 ) . no grade 3 or 4 infusion reactions , rituximab is safe and effective , at least for 1 year , for the treatment of childhood - onset , complicated frns / sdns [ 34 ] . based on the results from rcrns01 and rcrns02 , the use of rituximab for patients with complicated frns / sdns was approved , for the first time , by the ministry of health , labour and welfare , japan on august 29 , 2014 . serious adverse events have occurred in only a limited number of these patients , while in the majority of patients , rituximab is safe and well tolerated . however , notably , there have been several reports on serious adverse events related to rituximab . fetal hepatitis by reactivation of hepatitis b virus is also a serious adverse event induced by rituximab . in recent studies of patients with complicated nephrotic syndrome who had been taking rituximab , also reported that respiratory events , such as cough , bronchospasm , and dyspnea , are relatively common as adverse effects of rituximab . sellier - leclerc et al . reported a patient with fulminant myocarditis due to enterovirus who underwent heart transplant surgery . additional severe adverse effects reported in childhood nephrotic syndrome include pneumocystis carinii pneumonia [ 28 , 40 ] and severe immune - mediated ulcerative colitis . although long - term safety data on anti - cd20 therapy are broadly reassuring , a mortality rate of 3 % has been reported in the 3 years following its initiation in patients with a variety of autoimmune diseases , mainly due to infection . the exact pathogenesis of nephrotic syndrome is unknown , but t - cell - mediated immunological abnormalities are thought to play a role . a number of studies have shown that b cells promote t - cell activation , mediate antibody - independent autoimmune damage , and provide co - stimulatory molecules and cytokines , which can sustain t - cell activation in autoimmune diseases [ 4447 ] . this action leads to b - cell depletion , and thus suppression of b - cell t - cell interactions , which might prevent recurrence of nephrotic syndrome . impaired regulatory t ( t - reg ) cell function in patients with minimal change nephrotic syndrome and induction of remission in nephrotic syndrome by t - reg cells have been previously reported [ 4951 ] . rituximab may induce an increase in the number and function of t - reg cells . rituximab - maintained remission in nephrotic syndrome might be due to restoration of t - reg cell function . recently reported that rituximab directly binds to an acid sphingomyelinase - like phosphodiesterase 3b on the cell surface of podocytes , resulting in stability of podocyte structure and function . this may lead to prevention of recurrent focal segmental glomerulosclerosis . whether a similar mechanism functions in complicated frns / sdns remain to be determined . however , this drug does not cure nephrotic syndrome because all of the patients in the rnrns01 trial had relapsed by 19 months [ 34 ] . to extend the relapse - free period , further modification of rituximab therapy , including repeated courses and adjunct immunosuppressive therapies , may be necessary . indeed , a multicenter , double - blind , randomized , placebo - controlled trial to examine the efficacy and safety of mycophenolate mofetil after rituximab therapy for treatment of complicated frns / sdns in children will be started in 2015 in japan . moreover , comparison of the efficacy , safety , and cost - effectiveness of various rituximab dosing regimens and b - cell - driven regimens remains to be examined . further studies are required to examine the long - term effects of rituximab use , particularly in children . a retrospective long - term follow - up study of patients enrolled in rcrns01 and rcrns02 , focusing on clinical courses , treatments after the clinical trial , growth , and late adverse effects , will be carried out soon in japan . at present recently reported that additional rituximab combined with conventional methylprednisolone pulse therapy and immunosuppressive agents is a promising option for overcoming refractory srns . a multicenter , single - arm trial to examine efficacy and safety of rituximab combined with methylprednisolone pulse therapy and immunosuppressive agents	in the past 10 years , many reports have suggested that rituximab , a chimeric anti - cd20 monoclonal antibody , is effective for children with complicated , frequently relapsing or steroid - dependent nephrotic syndrome ( frns / sdns ) . however , those reports were case reports , case series , retrospective surveys , and single - arm or short - term trials . therefore , well - designed controlled trials are required to establish the value of rituximab in this condition . to evaluate the efficacy and safety of rituximab in childhood - onset , complicated frns / sdns , a multicenter , double - blind , randomized , placebo - controlled trial was carried out by the research group of childhood - onset refractory nephrotic syndrome ( rcrns ) in japan ( rcrns01 ) . rcrns01 showed that rituximab is safe and effective for the treatment of childhood - onset , complicated frns / sdns . in 2014 , the use of rituximab for patients with complicated frns / sdns was approved , first in the world , by the ministry of health , labour and welfare , japan .
You are an expert at summarizing long articles. Proceed to summarize the following text: it is estimated that 2040% of the general population and 5090% of obese people have nonalcoholic fatty liver disease ( nafld ) [ 1 , 2 ] . the presence of nafld has been described as an independent risk factor for the development of cardiovascular disease [ 35 ] , and it often accompanies other obesity - related diseases such as type 2 diabetes and is considered the hepatic manifestation of the metabolic syndrome . further , nafld is associated with increases in all - cause and liver - related mortality [ 7 , 8 ] . as a result , the examination of affordable treatment options for nafld , such as exercise or omega-3 polyunsaturated fatty acid ( n3pufa ) supplementation , is becoming more imperative . unfortunately , there is a paucity of studies investigating exercise and exercise combined with n3pufa supplementation as treatments for nafld . most exercise research has been focused on prevention , and not on treatment or reversal of preexisting nafld . we have previously used the otsuka long - evans tokushima fatty ( oletf ) rats to investigate nafld because they spontaneously develop obesity , insulin resistance , and nafld which progressively worsens with advancing age [ 9 , 10 ] . oletf rats lack the cholecystokinin-1 receptor resulting in hyperphagia due to defective satiety signaling . further , a novelty of this particular model is their intrinsic aptitude for exercise ( ex ) on voluntary running wheels , a characteristic that is uncommon in obese rodent models . we have previously shown that ex on voluntary wheel running beginning at 4 weeks of age in oletf rats prevents the development of hepatic steatosis , effects that were associated with prevention of insulin resistance and increased hepatic fatty acid oxidation ( fao ) . moreover , we have established that locking of the wheels and ceasing daily ex in oletf rats quickly activate a subgroup of precursors and processes known to initiate hepatic steatosis , including decreased hepatic mitochondrial oxidative capacity , increased hepatic expression of de novo lipogenesis proteins , and increased hepatic malonyl coa levels . other labs have also shown that exercise can prevent fatty liver in rodents fed a high - fat - diet to induce obesity [ 13 , 14 ] . although we and others have established that daily exercise is an invaluable intervention to prevent nafld , it remains unknown if exercise is an effective treatment strategy for preexisting nafld . dietary polyunsaturated fatty acids ( n3pufas ) have also been studied as a treatment for nafld . n3pufas both activate a transcription factor that is important for hepatic oxidative capacity ( peroxisome proliferator - activated receptor ( ppar ) ) and inactivates a master regulator of hepatic lipid synthesis ( sterol regulatory element binding protein ( srebp)-1c ) in rodents [ 1522 ] and humans [ 23 , 24 ] . this dual action on hepatic metabolism suggests that n3pufas could lower hepatic fat content . in oletf rats , dietary intake of n3pufas beginning at 5 weeks of age prevented hepatic steatosis by decreasing the activity of lipogenic enzymes such as fatty acid synthase ( fas ) and stearoyl coa desaturase ( scd)-1 and decreasing mrna expression of several key lipogenic genes including srebp-1c and acetyl coa carboxylase ( acc ) . the authors also found that mrna expression and activity of cpt , a protein that is controlled by ppar , were increased in the liver of n3pufa - fed oletfs . these results indicate that n3pufas were effective at preventing increased liver tag accumulation in oletf rats ; however , this study also addressed prevention and not treatment of nafld . seven days of dietary consumption of n3pufas led to reductions , but not complete reversal , of hepatic steatosis , and systemic insulin resistance in ob / ob mice , associated with the down - regulation of srebp-1c . the authors also observed increased activation of ppar and its associated gene targets suggesting increased -oxidation in the liver , but lacked a quantitative measure of fao . in another study , dietary intake of n3pufas attenuated , but was again not able to completely reverse , liver tag content following high - fat - diet - induced hepatic steatosis . to our knowledge , we are unaware of any studies that have examined the individual and combined effects of exercise and n3pufa supplementation on hepatic mitochondrial fao and treatment of nafld . thus , the purpose of this study was to examine the individual and combined effects of exercise and the dietary intake of omega-3 fatty acids ( 3% of energy from fish oil ) to treat preexisting hepatic steatosis in oletf rats . we also examined the effects of these treatments on factors known to play a role in the development of hepatic steatosis including peripheral insulin sensitivity , hepatic fao , and markers of hepatic lipogenesis . we hypothesized that both exercise and n3pufas would reverse or attenuate progression of nafld in obese rats and that the combination of treatments would have an even greater effect on treating nafld . the animal protocol was approved by the institutional animal care and use committee at the university of missouri . male oletf rats were generously provided by the tokushima research institute , otsuka pharmaceutical ( tokushima , japan ) and arrived at 4 weeks of age . rats were given ad libitum access to normal chow food ( purina formulab diet , 5008 ) and water in a temperature- and light - controlled room ( 12 h light-12 h dark cycle ) . at 13 weeks of age , an age when obesity , insulin resistance , and nafld are present in sedentary oletf rats , oletfs were randomly divided into 4 groups ( n = 8/group ) : ( 1 ) remained sedentary ( sed ) on normal chow , ( 2 ) was provided access to voluntary running wheels ( ex ) with normal chow , ( 3 ) was provided diet supplemented with 3% of energy from fish oil ( n3pufa - sed ) , and ( 4 ) had access to running wheels and diet supplemented with 3% of energy from fish oil ( n3pufa+ex ) . thus , treatments began at 13 weeks of age and ended at 20 weeks of age when rats were euthanized . food consumption and body weights were assessed weekly , and running distances ( wheels outfitted with a sigma sport bc 800 bicycle computer ( cherry creek cyclery , foster falls , va , usa ) for measuring daily running activity ) in ex and n3pufa - ex rats were measured daily following the end of the dark cycle during the 8-week treatment period . after being fasted and having wheels locked for a 5 h period , rats were anesthetized with sodium pentobarbital ( 100 mg / kg ) , tissue and blood were collected , fat pads were weighed , and rats were euthanized by exsanguination . louis , mo , usa ) which we have used in previous studies in which the oletf rats develop steatosis [ 9 , 10 ] . the n3pufa diet was custom - formulated at the university of missouri using an ain-93 g diet supplemented with 3% of energy from menhaden fish oil . ( houston , tex , usa ) and was stabilized with a synthetic antioxidant ( 0.2 g / kg tertiary butyl - hydroquinone ( tbhq ) ) and 1000 mg / kg mixed tocopherols to protect it from autooxidation . the percent of energy provided by fat was the same between the formulab 5008 and n3pufa diet , 16.7% , respectively . baseline glucose values were determined following a 12 h overnight fast one week prior to sacrifice ( 19 weeks of age ) . g / kg ) was then administered intraperitoneally , and tail blood draws were taken prior to and 15 , 30 , 45 , 60 , and 120 min following the bolus of glucose as performed previously by our group . whole body composition was determined using a hologic qdr-1000/w dexa machine calibrated for rats as performed previously by our group . louis , mo , usa ) , insulin ( millipore , billerica , mass , usa ) , -hydroxybutyrate ( stanbio laboratory , boerne , tex , usa ) , triglycerides ( sigma aldrich ) , and free fatty acids ( wako , richmond , va , usa ) in plasma were measured using commercially available kits . livers were quickly excised from anesthetized rats and were either immediately freeze - clamped in liquid nitrogen , placed in 10% formalin , or placed in ice - cold isolation buffer and then homogenized as previously described . fresh tissue fatty acid oxidation ( fao ) using radiolabeled c palmitate ( perkin elmer , boston , mass , usa ) was performed as previously described . briefly , both co2 , representing complete fatty acid oxidation , and c - labeled acid soluble metabolites ( c asm ) , representing incomplete fatty acid oxidation , were collected in the previously described trapping device and then counted on a liquid scintillation counter . in addition to the c palmitate , the reaction buffer contained a final concentration of 50 m cold palmitate and 0.5% bovine serum albumin . carnitine palmitoyl transferase-1 ( cpt-1 ) activity , -hydroxy - acyl - coa dehydrogenase activity ( -had ) , and citrate synthase activity assays were performed as described previously by our group . nuclear extraction of fresh liver tissue was performed using a commercially available kit ( marligen biosciences , ijamsville , md , usa ) . briefly , fresh tissue was immediately placed into hypotonic lysis buffer , homogenized , washed , vortexed , and centrifuged . samples were incubated on ice followed by a 30 min high - speed centrifugation at 4c . briefly , liver tissue was homogenized in ice - cold trizma / edta buffer and lipids were extracted in chloroform / methanol / acetic acid ( 2 : 1 : 0.15 ) . extracted lipids were then run on a thin - layer chromatography ( tlc ) silica plate in a tank containing hexane , diethyl ether , and acetic acid ( 70 : 30 : 1 ) . triglyceride and diacylglycerol fractions were scraped from the tlc plate and were then methylated by incubating with toluene , methanol , and acetyl chloride ( 0.5 : 1.2 : 0.1 ) at 100c for 60 min and separated in hexane . fatty acid methyl esters were analyzed by gas chromatography ( agilent technologies , wilmington , de , usa ) . hematoxylin and eosin ( h&e ) staining was performed on formalin - fixed paraffin - embedded section of liver as described previously to assess lipid vacuolization . western blots were performed to detect protein levels of ppar ( santa cruz biotechnology , santa cruz , calif , usa ) , ppar ( thermo scientific , rockford , il , usa ) , ppar ( cell signaling , beverly , ca ) , srebp-1c ( santa cruz biotechnology ) , fatty acid synthase ( fas ) ( cell signaling ) , acetyl coenzyme a carboxylase ( acc ) ( cell signaling ) , and stearoyl coa desaturase ( scd)-1 ( alpha diagnostic international , san antonio , tex , usa ) as performed previously . liver samples were homogenized in ice - cold lysis buffer , separated by sds - page gels , transferred to pvdf membranes , and probed with primary antibodies . protein bands were quantified using a densitometer and band densities were corrected for total protein loaded by staining with 0.1% amido black ( sigma ) as described previously . quantitative rt - pcr was performed as previously described for mrna expression of ppar and ppar . briefly , on the day of sacrifice , fresh tissue was collected and placed in rnalater ( ambion , austin , tex , usa ) stored at 4c for 24 h and then stored at 20c . liver samples were pulverized in rlt buffer using the qiagen tissuelyser system ( valencia , calif , usa ) . rna was then isolated using a commercially available kit ( qiagen , valencia , calif , usa ) . reverse transcription and cdna synthesis were performed according to the manufacturer instructions ( promega , madison , wis , usa ) . taqman master mix ( applied biosystems , foster city , calif , usa ) for gene targets ppar and ppar were loaded into a 96-well microplate along with the cdna sample ( 5 g/l ) and placed into the abi 7000 sequence detection system for polymerization . critical threshold ( ct ) values for the housekeeping gene did not differ among groups ( data not shown ) . treatment differences were analyzed by one - way analysis of variance ( anova ) with main effect significance set at p < 0.05 . significant main effects were then followed up by least significant difference ( lsd ) post hoc comparisons ( spss 17.0 ) . data are presented as means se , and significance was set at p < 0.05 . final body weight and fat pad mass ( omental + retroperitoneal ) were significantly different among all groups ( table 1 ) . body fat percentage was highest in the sed and n3pufa - sed rats ; ex rats had the lowest body fat percentage , over 2.5fold lower than sed and n3pufa - sed and 1.6fold lower than n3pufa+ex . fat pad mass mirrored the body fat percentage measures except that n3pufa - sed was lower than sed . weekly food intake ( grams ) was reduced in the ex and n3pufa+ex groups as compared to sed and n3pufa - sed . however , when weekly food intake ( grams ) was normalized to body weight , the ex group consumed more than the sed , n3pufa - sed , and n3pufa+ex groups . weekly caloric intake per body weight was also highest in the ex compared to all other groups . in addition , the sed group consumed more kcal per body weight than the two groups who received n3pufa supplementation . all 3 treatment conditions significantly lowered circulating tag and ffas compared with sed rats . ex and n3pufa+ex rats were given access to running wheels at 13 weeks of age . there were no differences in weekly run distances between the two groups ( figure 1(a ) ) . peak running distances in both groups were approximately 56 and 55 km per week ( approximately 8 km per night ) at 16 weeks and slowly declined to about 34 and 33 km per week ( 5 km per night ) by 20 weeks of age . as shown in figure 1(b ) , ex and n3pufa+ex rats showed a decline in body weight the first two weeks following introduction to wheel running and then began gaining weight again while sed and n3pufa - sed rats continued to gain weight during the 8 weeks of treatment . hepatic tag content from previously studied 13-week - old oletf - sed rats ( n = 8) was used as a baseline measure of hepatic steatosis allowing us to determine if the 8-week treatments could reverse steatosis . as shown in figure 2(a ) , ex rats had lower tag content at 20 weeks of age as compared to the baseline tag content of sed-12 wk rats ( p = 0.03 ) , indicating ex effectively treated nafld . although the beneficial effects of ex were partially blunted in the n3pufa+ex animals , liver tag content was significantly lower than sed-20 wk ( p = 0.001 ) . unexpectedly , n3pufa supplementation in sedentary , hyperphagic rats exacerbated hepatic steatosis above that measured in both sed groups ( p < 0.05 ; figure 2 ) . hepatic dag content ( figure 2(b ) ) followed similar trends as tag content , with ex and n3pufa+ex both offering protection against the accumulation of dags in the liver as compared to sed and n3pufa - sed . the n3pufa content eicosapentaenoic acid ( epa ) and docosahexaenoic acid ( dha ) were measured in the liver and showed that epa and dha were incorporated into the liver at a higher level in n3pufa - fed rats with n3pufa - sed having the highest content ( figure 2(c ) ) . representative images of h&e staining for lipid vacuolization ( figure 2(c ) ) demonstrate a visual presence of steatosis in n3pufa - sed and sed rats as shown by the large size and number of lipid droplets , whereas ex and n3pufa+ex displayed noticeably less lipid droplets . blood glucose and insulin levels were elevated in sed rats as compared to ex , n3pufa - sed , and n3pufa+ex ( table 1 ) . glucose and insulin aucs during the ipgtt did not differ between n3pufa and sed groups , whereas ex rats had significantly lower glucose and insulin aucs ( p < 0.01 ) , and n3pufa - ex rats only had lower insulin aucs ( p < 0.05 ) as shown in figures 3(b ) and 3(c ) . only the ex group had higher cpt-1 activity than sed ( figure 4(a ) ; p < 0.05 ) . ex and n3pufa+ex had higher citrate synthase activity followed by sed ( figure 4(e ) ) , and there were no differences among groups in -had activity , though a main effect of treatment groups versus sed approached significance ( figure 4(f ) ; p = 0.059 ) . rats in the n3pufa - sed and n3pufa+ex groups had significantly higher total fao ( co2 + c asm ) as compared to sed and ex rats ( figure 4(c ) ) . this elevation in total fao was due to elevated incomplete fatty acid oxidation as shown by higher asm production ( data not shown ) . further , in the presence of etomoxir , which inhibits cpt-1 thereby ceasing the transport of long - chain fatty acids to the mitochondria , n3pufa - sed and n3pufa+ex had higher rates of fao than the ex group but not the sed group ( figure 4(d ) ) . this suggests that the dietary intake of n3pufas increases extramitochondrial total fao in both sed and ex conditions . in addition , ex was the only group to have significantly higher complete fao ( co2 ) as compared to sed , n3pufa - sed , and n3pufa+ex as shown in figure 4(b ) . ppar mrna expression was significantly lower in ex and n3pufa+ex ( figure 5(a ) ) . the expression of ppar , a transcription factor associated with mitochondrial biogenesis and fatty acid oxidation , was 3-fold higher in ex as compared to sed , n3pufa - sed , and n3pufa+ex ( figure 5(b ) ) . however , there were no differences in protein expression of ppar or among groups as shown in figures 5(c ) and 5(d ) . the nuclear protein content of srebp-1c did not differ among groups , although there was a trend toward significance ( p = 0.09 ) as seen in figure 6(a ) . there also was a trend ( p = 0.09 ) for a main effect for treatment on acc protein content . however , the ex rats had significantly lower fas protein content ( p = 0.02 ) as compared to sed , n3pufa - sed , and n3pufa+ex . there were no differences in ppar protein content among groups ( representative western blot shown in figure 6(f ) ) . ex rats also had the lowest protein content of scd-1 as compared to the other groups ( figure 6(d ) ) . scd-1 desaturase index was lowest in ex and highest in n3pufa - sed rats as estimated by product ( 16 : 1 ) to substrate ( 16 : 0 ) ratio for the enzyme ( figure 6(e ) ) . the primary objectives of the current study were to determine if exercise and n3pufa supplementation , alone or in combination , could effectively treat hepatic steatosis in obese oletf rats and to determine if these treatment strategies were associated with changes in insulin sensitivity , hepatic mitochondrial fao , or markers of hepatic lipogenesis . the major findings include the following : ( 1 ) exercise treatment reversed preexisting hepatic steatosis in association with elevated hepatic complete fao and cpt-1 activity , improved systemic insulin sensitivity , and decreased markers of hepatic lipogenesis ; ( 2 ) n3pufas supplemented at 3% of diet increased tag accumulation in the liver and , when combined with exercise n3pufas , did not lead to additive health benefits , but instead partially blunted the beneficial effects of exercise to reduce hepatic tag accumulation and improve insulin sensitivity . ex was the only treatment that reversed liver tag content below the pretreatment levels measured in 13-week - old sedentary oletf animals . it is likely that ex lowered hepatic steatosis in part by slowing gains in body weight and fat mass that normally occur in sed conditions . however , the data also supports the notion that ex induced a hepatic metabolic phenotype that played a role in reducing steatosis as well . evidence suggests that ex increased both the mitochondrial entry rate ( higher cpt-1 activity ( figure 4(a ) ) and complete catabolism of long - chain fatty acids ( increased complete palmitate oxidation to co2 ( figure 4(b ) ) . the increase in complete oxidation is likely due to a more efficient coupling of increased -oxidation and tca cycle flux . ex also lowered extramitochondrial hepatic fao ( oxidation that occurs in the presence of cpt-1 inhibition with etomoxir ( figure 4(d ) ) . our assumption is that extramitochondrial oxidation is primarily driven by peroxisomes , organelles that break down longer chain fatty acids so that they can then be oxidized in the mitochondria . peroxisomal activity has previously been shown to be higher in the sed oletf and when not paired with increased mitochondrial fao [ 3133 ] could lead to the accumulation of fatty acid metabolites and oxidative stress . livers were examined 5 hours after the last exercise bout , opening the possibility that the exercise - induced adaptations were primarily due to the last bout of exercise rather than a result of chronic training . in a previous study from our group , oletf rats exercised on voluntary running wheels for xx weeks before we locked the wheels to stop exercise . we then examined hepatic responses 5 hours , 53 hours ( 2 days ) , and 173 hours ( 7 days ) after the last exercise bout allowing us to determine if 2 or 7 days of inactivity led to different outcomes than the group studied 5 hours after the last bout . in addition , all 3 groups were also compared to oletfs who were never provided access to running wheels . most measures of mitochondrial content were unchanged by 7 days of inactivity and were still higher than sedentary livers , while markers of de novo lipogenesis ( fas and acc protein content and malonyl coa ) increased significantly 2 and 7 days after the cessation of exercise . hepatic tag did not increase significantly 7 days after the cessation of exercise and remained significantly lower than the content measured in sedentary rats . thus , these data suggest that some hepatic adaptations to ex treatment are sustained and due to chronic training while others are dependent on the effects of the last bout . importantly , high levels of circulating insulin activate srebp-1c , a master regulator of lipid synthesis . here we report that ex had the most powerful effects on reducing glucose and insulin levels during the ipgtt . similar to our previous reports of exercise preventing the development of insulin resistance in the oletf model [ 9 , 12 , 34 ] , here we demonstrate that exercise also can be used as a treatment to improve insulin sensitivity . we also originally hypothesized that ex or dietary n3pufas would reduce the mature form of srebp-1c and would play a key role in downregulating fatty acid synthesis in the liver [ 16 , 18 , 3537 ] . in addition , we hypothesized that n3pufas would activate ppar and , as n3pufas are known to be natural ligands and potent activators of ppars . surprisingly , the mature , nuclear form of srebp-1c was not significantly altered by any of the treatments and n3pufas did not potently increase expression or protein content of ppars . however , although there were no changes in srebp-1c , protein content of fas and scd-1 , its downstream targets , was dramatically reduced with ex . it is possible that the trend for lowering of nuclear srebp-1c was enough to lower fas and scd-1 or that ex lowered these factors through other pathways . through the conversion of saturated fatty acids to monounsaturated fatty acids , hepatic scd-1 contributes to abnormal partitioning of fatty acids by reducing fao and increasing fatty acid synthesis . ex significantly suppressed scd-1 expression and activity , resulting in lower desaturation of the fatty acid within hepatic tag which is consistent with our previous results . in contrast , n3pufa did not impact scd-1 content and slightly increased activity as shown by the desaturase index . fas is also a critical step in the conversion of carbohydrates to fatty acids through de novo lipogenesis . all told , ex lowered markers of hepatic lipogenesis , but because this occurred without a clear lowering of nuclear srebp-1c content , we are unsure these changes are directly linked to reduced circulating insulin and improved systemic insulin sensitivity . contrary to our original hypothesis and the results of others , we found that n3pufa supplementation in sed oletfs led to increased tag accumulation in the liver [ 16 , 19 , 20 , 35 , 38 ] . although our results are conflicting with a large majority of the literature , it should be noted that the majority of fish oil / n3pufa research conducted in animals uses excessive amounts ( 660% of energy ) that are not likely physiologically relevant [ 16 , 3541 ] . here we used a diet consisting of 3% of total energy from fish oil which is a concentration that can safely be consumed by humans . consequently , it may require higher dosages of n3pufas to yield the health benefits found by others in their rodent models . in addition , we started treatment at 13 weeks of age , an age where oletfs several obesity - induced comorbidities such as nafld , systemic insulin resistance , and increased adiposity are present which may explain the differences seen between prevention and treatment with n3pufas . an alternative and more probable explanation is that dietary consumption of healthy fatty acids can not likely overcome a hyperphagic , chronic state of positive energy balance and daily weight gain in sedentary rats . excess energy intake , regardless of the source , will likely result in increased adiposity and ectopic fat storage if not matched with increased energy expenditure . rather , either lowering total energy intake or increasing energy expenditure is likely needed to effectively treat hepatic steatosis . future experiments are needed to determine if n3pufa intake would be more effective in reducing steatosis in animals in which the rate of weight gain is reduced by limiting caloric consumption . there are also human clinical implications to these findings . if patients are in a constant positive energy balance and continuing to gain weight , it is unlikely that increasing dietary n3pufa would lower hepatic fat content . in conclusion , our study documents the detrimental effects of overeating while remaining sedentary on adiposity , insulin sensitivity , hepatic mitochondrial function , and hepatic steatosis . moreover , these adverse events occurred regardless of supplementing n3pufas in the diet . however , daily exercise effectively treats hepatic steatosis in obese oletf rats in part by increasing hepatic mitochondrial function and complete fatty acid oxidation , decreasing activation of the lipid synthesis pathway , and improving systemic insulin sensitivity . furthermore , treatment with n3pufas partially blunted the beneficial effects of exercise in this hyperphagic animal model by unknown mechanisms .	background and aims . this study examined if exercise and omega-3 fatty acid ( n3pufa ) supplementation is an effective treatment for hepatic steatosis in obese , hyperphagic otsuka long - evans tokushima fatty ( oletf ) rats . methods . male oletf rats were divided into 4 groups ( n = 8/group ) : ( 1 ) remained sedentary ( sed ) , ( 2 ) access to running wheels ; ( ex ) ( 3 ) a diet supplemented with 3% of energy from fish oil ( n3pufa - sed ) ; and ( 4 ) n3pufa supplementation plus ex ( n3pufa+ex ) . the 8 week treatments began at 13 weeks , when hepatic steatosis is present in oletf - sed rats . results . ex alone lowered hepatic triglyceride ( tag ) while , in contrast , n3pufas failed to lower hepatic tag and blunted the ability of ex to decrease hepatic tag levels in n3pufas+ex . insulin sensitivity was improved in ex animals , to a lesser extent in n3pufa+ex rats , and did not differ between n3pufa - sed and sed rats . only the ex group displayed higher complete hepatic fatty acid oxidation ( fao ) to co2 and carnitine palmitoyl transferase-1 activity . ex also lowered hepatic fatty acid synthase protein while both ex and n3pufa+ex decreased stearoyl coa desaturase-1 protein . conclusions . exercise lowers hepatic steatosis through increased complete hepatic fao , insulin sensitivity , and reduced expression of de novo fatty acid synthesis proteins while n3pufas had no effect .
You are an expert at summarizing long articles. Proceed to summarize the following text: it has been shown that the fat distribution rather than total amount of fat is associated with increased cardiovascular disease ( cvd ) risk . since cd36 is a cell surface glycoprotein that belongs to class b scavenger receptor family , it is considered as multifunctional receptor : in adipocyte it acts as a fatty acid translocase of long - chain fatty acids ; however , in monocyte / macrophage , it regulates oxldl uptake . on the other hand , lox-1 is classified among e - type scavenger receptor family , is expressed in vascular endothelium , and recognizes oxldl , cellular debris , and several structurally unrelated molecules as a ligand ; it is highly expressed in the cardiovascular system by proinflammatory and prooxidative stimuli [ 5 , 6 ] . lox-1 and cd36 favor the development of atherosclerosis through their ability to bind and internalize modified ldl facilitating formation of macrophage foam cells and their location to subendothelial space promoting endothelial dysfunction and cvd . additionally , several studies associate an increase of soluble form of cd36 ( scd36 ) in symptomatic carotid stenosis with metabolic disorders , such as type 2 diabetes mellitus ( t2 dm ) . meanwhile , the soluble form of lox-1 ( slox-1 ) has been mainly associated with diverse atherogenic diseases like arterial stiffness , t2 dm , and myocardial infarction and it is even proposed as a biomarker for acute coronary syndrome [ 718 ] . several studies showed an inflammatory paracrine interaction between adipocytes and macrophages which could be dependent on scavenger receptors ; this pathogenic process involves a state of dysmetabolic profile and chronic inflammation which contributes to abdominal obesity development [ 19 , 20 ] . however , the association of scd36 and slox-1 levels with fat redistribution and metabolic markers is not known . the aim of our study was to determine the association between cd36 and lox-1 in presence of age and abdominal obesity . in this cross - sectional study , we recruited 151 adults aged between 20 and 59 years of general population of mexico . they were classified according to the recommendations of world health organization expert consultation , by wc , waist - hip ratio ( whr ) , and waist - to - height ratio ( whtr ) , into two groups : the first group includes individuals with abdominal obesity , if any of the following conditions were present : wc 90.0 cm , whr 0.90 , and whtr 0.525 in men and wc 80.0 cm , whr 0.80 , and whtr 0.530 in women ; the second group includes individuals without abdominal obesity , a group which has lower values of these measurements . in relation to age , an age of 30 years was established as a cutoff and two groups were stablished : < 30 years old and 30 years old . we consider additional criteria for disease risk associations : bmi from 18.50 to 24.99 kg / m was considered without disease risk ; for increased disease risk : bmi 25.00 to 29.99 kg / m plus wc < 102.0 cm ( in men ) or < 88.0 cm ( in women ) was considered ; for high disease risk , we consider wc 102.0 cm ( in men ) or 88.0 cm ( in women ) and bmi 30.0 kg / m plus any wc measurement was classified as very high disease risk [ 2123 ] . we included individuals who at the time of the study did not present with glucose intolerance , infectious diseases , hypertension , pregnancy , anemia , diagnosis of cvd , malignancy , and renal and metabolic diseases such as t2 dm . we excluded subjects with current medication , smoking , or drugs use . for ethics conduct before enrolment , participants were informed about the study and signed a consent form following helsinki declaration guidelines , and the institutional ( guadalajara university ) review boards committees ensured appropriate ethical and biosecurity conduct . all individuals who satisfied inclusion criteria were clinically evaluated by a physician who performed a complete medical history ; assessment of general health status and vital signs were included : blood pressure ( executed 3 times with the subject in the sitting position and relaxing for 15 minutes before the measurement ) , heart , respiratory rate , and body temperature . we evaluated the following body measurements : height was measured to the nearest 1 mm by using a stadiometer ( seca gmbh & co. kg . , hamburg , germany ) and body weight , total body fat mass , and trunk body fat mass ( absolute , kg , and relative , % ) were determined by using bioelectrical impedance analysis ( tanita bc-418 segmental body composition analyzer , tokyo , japan ) to the nearest 0.1 kg . wc , hip circumference ( hc ) , and coronal abdominal diameter were measured by using an anthropometric fiberglass tape ( gulick length 0180 cm precision 0.1 , usa ) . at the level of the iliac crest ( l4 - 5 ) , sagittal abdominal diameter was measured using a sliding - beam , abdominal caliper ( precision 0.1 cm , holtain ltd . , sa41 3uf , uk ) with the patient lying in a supine position in the examination table [ 2529 ] . five measures of skinfold thicknesses ( i.e. , biceps , triceps , subscapular , suprailiac , and abdominal ) were obtained on the right side of the body by using a harpenden skinfold caliper ( opened 80 mm and precision of 0.2 mm , constant pressure : 10 g / mm ; holtain ltd . , crosswell , crymych , pembs . all these measurements were carried out by the same anthropometrist in duplicate following the procedures recommended by anthropometric indicators measurement guide [ 30 , 31 ] . to determine obesity and adiposity indexes , the following math calculations were used , bmi , kg / m = weight ( kg)/height ( m ) ; whr = wc cm / hc cm ; whtr = wc cm / height ( cm ) ; conicity index ( ci ) = wc ( cm)/0.109weight ( kg)/height ( cm ) ; total adipose area ( taa , cm ) = wc/4 ; visceral area ( va , cm ) = (wc/2 abdominal skinfold ) ; subcutaneous abdominal area ( cm ) = taa va ; visceral adipose index ( vai ) : for males , vai = ( wc/36.58 + ( 1.896bmi))6(tg/0.81)6(1.52/hdlc ) , and for females , vai = ( wc/39.68 + ( 1.886bmi))6(tg/1.03)6(1.31/hdlc ) ; abdominal volume index ( avi , l ) = [ 2 wc + ( 0.7 cm)(wc hc)/1000 ] ; and homeostasis model assessment - insulin resistance ( homa - ir ) = [ basal glucose mg / dl ( basal insulin ui / ml)/405 ] [ 33 , 34 ] , in addition to the sum of the 5 skin fold thicknesses ( st5 ) . we confirmed overnight fast of 12 hours in all subjects and obtained two venous blood samples , with and without anticoagulant ( paxgene blood rna tube cat . 368159 , bd diagnostic systems montenegro 1402 ( c1427and ) , buenos aires , argentina , resp . ) . samples were allowed to clot for 30 minutes at 20c before centrifugation for 10 minutes/20c at 1509 rcf ( rotanta 460r , andreas hettich gmbh & co. kg . ) ; serum was collected and stored immediately at 86c until further analysis . we quantified serum concentration of basal glucose , mg / dl , and lipid profile , mg / dl , which included triglycerides , total cholesterol , hdlc , ldlc , and vldlc ( high , low , and very low density lipoprotein cholesterols , resp . ) , apolipoproteins a1 and b ( apo - a1 and apo - b ) , mg / dl , free fatty acids ( ffa , mmol / ml ) , serum c3 , mg / dl , high sensitivity crp with a limit of detection of 0.15 mg / l , with routine colorimetric , enzymatic , and immunoturbidimetry methods ( randox laboratories , 55 diamond road , crumlin co. antrim , northern ireland , uk ) , and erythrocyte sedimentation rate ( esr , mm / h ) by wintrobe method . through using commercial enzyme - linked immunosorbent assays ( elisa ) , we determined soluble levels of insulin sensitivity of 0.399 ui / ml ( alpco , 26-g keewaydin drive , salem , nh 03079 ) , scd36 sensitivity of 312.5 ng / ml , and slox-1 sensitivity of 5.0 pg / ml ( aviscera bioscence , inc . , 2348 walsh avenue , suite c , santa clara , ca 95051 ) . based on the lipid profile measurements , we calculated the following atherogenic indexes : tc / hdlc , ldlc / hdlc , tg / hdlc , and apo - a1/apo - b . mononuclear cells from the subjects were isolated by density gradient media with separating solution lymphoprep ( axis - shield , p.o . purified mononuclear cells were used directly for total rna isolation ; it was performed according to the manufacturer 's procedure using trizol ls reagent ( ambion , invitrogen , by life technologies , 5791 van allen way , carlsbad , ca 92008 ) based on the single - step rna isolation modified method reported by chomczynski and sacchi [ 39 , 40 ] . the complementary dna synthesis ( cdna ) was performed with 2 g of each total rna sample using a reaction size of 20 l with oligo ( dt ) 18-primer ( 100 ng/l ) , rnase - free , depc treated water and moloney murine leukemia virus reverse transcriptase ( m - mlv rt ) kit ( applied biosystems , 850 lincoln centre drive , foster city , ca 94404 ) and stored at 20c until being used for expression analyses . real - time quantitative polymerase chain reaction ( qpcr ) was conducted using the stepone detection system , express sybr greener qpcr supermix universal , and sequence detector software ( applied biosystems , 850 lincoln centre drive , foster city , ca 94404 ) was used for data analysis . a threshold cycle ( ct ) value was determined from each amplification plot . in brief , cd36 mrna expression was performed in a final reaction volume of 20 ml ( 40 m forward and reverse primer , 50 nm rox , 2x sybr green qpcr master mix and cdna 100 ng ) . the conditions of the reaction were as follows : holding at 95c/10 min , cycling ( 35 cycles of 95c/15 s and 60c/60 s ) , and melt curve at 95c/15 s , 60c/60 s , and 95c/15 s. expression of target genes was normalized by the endogenous reference gene gapdh ; sequence specific primers were forward : 5-ggagcgagatccctccaaaat-3 and reverse : 5-ggctgttgtcatacttctcatgg-3 and for cd36 target gene they were forward : 5-ctatgctgtatttgaatccgacgtt-3 and reverse : 5-cctgtgtacatttcacttcctcatt-3. the relative expression fold changes of target genes were calculated using the comparative ct method with 2 equation . for quality control , a blank and samples previously confirmed as positive for each gene were used as controls . , chicago , il , usa ) and with graphpad prism v6.01 ( 2014 inc . the data distribution of clinical and laboratory variables was evaluated with z kolmogorov - smirnov test ; parametric and nonparametric tests were performed as appropriate . an age and gender ( male or female ) adjusted ancova analysis was made in individuals included in the study . the clinical and laboratory characteristics of the study group were analyzed with unpaired student 's t - test or mann - whitney u test to compare quantitative data in two groups . data from serum concentrations of scavenger receptors , laboratorial assessment , and adiposity variables were subjected to pearson 's correlation tests . we included 151 individuals that were classified by age and presence of abdominal obesity ; 70% were females . kg / m ) , 37% of these individuals were categorized with cvd risk , almost 70% of the group were older than 30 years ( data no shown ) , and 78% were identified with an increased body fat storage . when comparing subgroups with abdominal obesity , we observed a similar distribution of trunk fat storage in young and older individuals , while older subjects presented higher measurements on triceps , subscapular , and suprailiac skinfold thickness compared to younger subjects ( table 1 ) . additionally , in the abdominal obesity subgroup , we observed increased whtr in older ( 0.619 0.054 ) versus younger ( 0.574 0.042 ) individuals ( p = 0.019 ) . we found that individuals below 30 years of age with abdominal obesity showed alterations on basal glucose , total cholesterol , hdlc levels , and proinflammatory profile ; this same scenario was seen in older individuals with similar adiposity characteristics in which a decreased level of apo - a1 and hdlc was also found ( table 2 ) . those individuals with abdominal obesity , regardless of age , presented higher measurements of abdominal adiposity and atherogenic indexes ( figure 1 ) . the subgroup of individuals below 30 years of age compared with the subgroup of individuals over 30 years of age showed an increase in accumulation of abdominal fat deposits in association with a dyslipidemic profile , which was in accordance with an increase in atherogenic indexes and metabolic markers ( figures 1(a ) and 1(c ) and table 2 ) . we observed that individuals over 30 years of age with abdominal obesity presented lower scd36 levels compared to individuals without abdominal obesity , while individuals aged below 30 years showed higher levels ( figure 2(a ) ) . on the other hand , a more detailed analysis was performed , in which 21% ( = 67,802.625 ; p = 0.001 ) of scd36 levels are affected by sex , and 35% ( = 3,891.21 ; p = 0.006 ) are affected by the combination of sex and abdominal skinfold thickness on an age adjusted ancova . we observed in young individuals with abdominal obesity a slight increase in relative expression ( 1.11 fold times versus individuals without abdominal obesity ) ; on the other hand , the group over 30 years of age with abdominal obesity showed subexpression ( 54% less , figure 2(c ) ) . in the case of slox-1 and ffa levels , a positive correlation with scd36 was observed , in contrast with the negative correlations in both scavenger receptors with abdominal adiposity and body fat mass distribution and inflammatory and metabolic markers which are displayed in table 3 . abdominal obesity is generated when there is excess accumulation of adipose tissue in a progressive manner , preferably in the central region of the body . in this setting , we evaluated scavenger receptors production with metabolic , inflammatory , and adiposity profiles in two groups of adults without clinical manifestations of disease . we found a significant percent of individuals with high risk of cvd associated with the presence of abdominal obesity . although bmi is a useful tool to identify individuals at risk , there are other criteria that help recognize earlier cvd risk in an age - independent manner [ 22 , 23 ] . in the context of this study , clinical and anthropometric profile in individuals below 30 years of age versus individuals over 30 years of age suggests that abdominal obesity is independent of aging , which involves different phenotypes observed in several clinical stages during development of the pathogenic process . in our study , all individuals with abdominal obesity showed increased adiposity indexes and low - grade inflammation status with dyslipidemic profile . it has been reported that accumulation of fat mass in abdominal area presents diverse subclinical alterations characterized by changes on lipid and carbohydrate metabolism [ 25 , 45 ] . this process starts an abnormal mechanism with the following sequential steps : the monocytes from the bloodstream migrate to adipose tissue ; these cells polarize to m1 macrophages and secrete proinflammatory cytokines that can act locally in paracrine way favoring the low - grade inflammation , which is redundantly perpetuated [ 20 , 45 ] . although age is an important factor in the development of metabolic alterations , a remarkable observation is that , in presence of abdominal obesity , our younger group presented high atherogenic indexes compared to its corresponding older group . we also noticed that the accumulation of abdominal fat leads to higher fasting glucose and dyslipidemia observed in individuals with abdominal obesity . these evidences confirm that the abdominal obesity can be a modifiable cardiovascular risk factor , unlike other metabolic diseases such as atherosclerosis , hypertension , and t2 dm . soluble cd36 levels have been reported not only in patients with carotid stenosis and unstable atheromatous plaque but also in chronic inflammatory related states such as diabetic nephropathy , polycystic ovary syndrome , and severity of hepatic steatosis and insulin resistance and individuals with morbid obesity [ 4750 ] . in our study we observed in individuals below 30 years of age increased levels of scd36 in parallel with body fat deposits predominately on abdominal area . these results contrast with the opposite case observed in older individuals , where scd36 levels decreases with age and presence of abdominal obesity . a consistent elevation of scd36 in patients with t2 dm , insulin resistance , and obesity has been documented ; after bariatric surgery in adults , scd36 levels decline and metabolic markers improve [ 8 , 10 , 14 ] ; meanwhile , there are reports of low receptor membrane expression on peripheral blood mononuclear cells in women with obesity and pharmacologically treated rheumatoid arthritis patients with subclinical atherosclerosis [ 51 , 52 ] . based on these reports our results showed two subsets of cd36 expression in soluble levels related to age below and above 30 years , while a low soluble lox-1 pattern in older individuals with abdominal adiposity negative correlates with several adiposity indexes . on the contrary , we observed positive correlations between ffa and slox-1 levels with scd36 which suggest the interaction of these scavenger receptors in states of pathological adipose tissue distribution . increased slox-1 levels have been associated with acute coronary syndrome or t2 dm patients that denote their contribution in atherosclerosis development [ 5355 ] . in our study we showed an alternative scenario to what is reported in previous studies in subjects with metabolic diseases ; our findings could be explained in part by a strict compliance on the inclusion criteria used in our study and by taking into account abdominal obesity indicators . even though there is a functional redundancy in scavenger receptors it seems that in undefined circumstances they work as coreceptors to display several responses in different clinical context ; this interplay between receptors has not been completely elucidated . while cd36 soluble receptor levels are considered an early marker of insulin resistance , it could also be considered that modulation of scavenger receptor could represent a precompensation mechanism in individuals with an altered metabolism . based on our results , we could hypothesize that low soluble cd36 levels and their gene subexpression may be an early homeostatic state previous to the establishment of metabolic syndrome , thereby reinforcing the central role of dysfunctional adipose tissue as a trigger for the metabolic complications associated with long - term obesity . the multiple functions and the heterogeneity of cells that express this receptor make it difficult to isolate the exact role of these receptors in diverse clinical contexts . in this study , individuals over 30 years of age presented low soluble scavenger receptors levels pattern and cd36 gene subexpression , which suggest the chronic metabolic dysregulation in abdominal adiposity .	background . obesity study in the context of scavenger receptors has been linked to atherosclerosis . cd36 and lox-1 are important , since they have been associated with atherogenic and metabolic disease but not fat redistribution . the aim of our study was to determinate the association between cd36 and lox-1 in presence of age and abdominal obesity . methods . this is a cross - sectional study that included 151 healthy individuals , clinically and anthropometrically classified into two groups by age ( < 30 and 30 years old ) and abdominal obesity ( according to world health organization guidelines ) . we excluded individuals with any chronic and metabolic illness , use of medication , or smoking . fasting blood samples were taken to perform determination of cd36 mrna expression by real - time pcr , lipid profile and metabolic and low grade inflammation markers by routine methods , and soluble scavenger receptors ( cd36 and lox-1 ) by elisa . results . individuals 30 years old with abdominal obesity presented high atherogenic index , lower soluble scavenger receptor levels , and subexpression of cd36 mrna ( 54% less ) . on the other hand , individuals < 30 years old with abdominal adiposity presented higher levels in the same parameters , except lox-1 soluble levels . conclusion . in this study , individuals over 30 years of age presented low soluble scavenger receptors levels pattern and cd36 gene subexpression , which suggest the chronic metabolic dysregulation in abdominal obesity .
You are an expert at summarizing long articles. Proceed to summarize the following text: what i shall call the consent requirement ( cr ) maintains that a subject 's informed consent is a requirement of ethical biomedical research . cr lies at the epicenter of research ethics . as robert veatch puts it , ever since nuremberg , consent has dominated ethics of experimentation. i suspect that it is commonly supposed that cr is so clearly correct as not to require an extended defense . as dan brock puts it , the rule that , with a few exceptions , research with humans should not take place without participants informed consent is a settled ethical and legal principle. the purpose of this article is to ask whether this , i propose to start with , which might appear to be an implausible proposal , namely , that it is legitimate to coerce people into participating in biomedical research . i will argue that contrary to what is commonly supposed , neither a prohibition on coercive participation nor cr can easily be justified by appeal to the sorts of principles that are often cited in its defense such as respect for autonomy , respect for persons , a right not to participate in research without consent , respect for bodily integrity , not treating subjects merely as a means , or the like . rather , i will argue that the best justification for cr is less direct , less simple , less elegant , less definitive , more pluralistic , and more political . in effect , i will argue that we ca n't get to cr through a straightforward moral argument from basic principles ; we can get to something like cr subject to important exceptions through the back door . it is generally assumed that research is ethical only if the research satisfies several additional ethical criteria , for example , that the research has social value , that the design of the research will yield scientifically valid data and , perhaps most importantly , that the risks to subjects are reasonable in relation to the anticipated benefits to subjects or to others . there is some dispute as to whether the reasonable risk criterion places any upper limit to the risks to which subjects can be asked to consent , but there is no dispute that institutional review boards ( irbs ) must determine that the risks to subjects are reasonable before people are offered the opportunity to consent to participate . more importantly for present purposes , although some formulations of cr are quite categorical , it is also commonly accepted that informed consent is not strictly necessary for ethical research . we may think that research without any sort of consent is justifiable when it is exclusively observational , as when psychologists sought to determine whether wealthy drivers behaved more unethically than less wealthy drivers by observing whether drivers of expensive cars were more likely to cut off other vehicles at an intersection . interventional research without informed consent may be justifiable when subjects must be deceived if research is to produce scientifically valid data . because federal regulations explicitly allow for a considerable amount of research without informed consent , alex capron wonders whether the exceptions are so vast as to swallow the rule. indeed , the regulations do not regard a considerable range of research as involving research with human subjects . this includes purely observational research , research with deidentified medical records or tissue specimens . in these cases , the regulations avoid the issue of informed consent by definitional fiat rather than stating that these are forms of research with human subjects that do not require informed consent . in addition , federal regulations explicitly allow for waivers of informed consent under conditions that apply to much social and behavioral research and some biomedical research . d ) an irb may approve a consent procedure which does not include , or which alters , some or all of the elements of informed consent set forth in this section , or waive the requirements to obtain informed consent provided the irb finds and documents that : the research involves no more than minimal risk to the subjects;the waiver or alteration will not adversely affect the rights and welfare of the subjects;the research could not practicably be carried out without the waiver or alteration ; andwhenever appropriate , the subjects will be provided with additional pertinent information after participation . the research involves no more than minimal risk to the subjects ; the waiver or alteration will not adversely affect the rights and welfare of the subjects ; the research could not practicably be carried out without the waiver or alteration ; and whenever appropriate , the subjects will be provided with additional pertinent information after participation . note that provision ( 2 ) presupposes that there is no general right not to be included in research without informed consent . as contrasted with social and behavioral research , the regulations are more likely to require informed consent in biomedical research , but there are exceptions there as well . even if we set aside cases in which surrogates consent for the subject ( for example , children ) , there are special circumstances , such as emergency research in which research may be justified even though no sort of consent is possible ( assuming that surrogates can not be located ) . research without any kind of consent may also be allowed when it involves public health surveillance , collection of data from health records , quality improvement studies , and cluster randomized trials where it is impractical or impossible to seek everyone 's consent . for example , a hospital may want to study the advantages of two regularly prescribed treatments by treating everyone in ward a with treatment x and everyone in ward b with treatment y , but the patients in those wards will not be asked for their consent . it may also be argued that specific consent to participate in research may not be necessary in comparative effectiveness trials where all subjects receive standard treatments for their conditions and where there is little or no incremental risk in receiving one of these treatments as opposed to the other . it is possible , of course , that we should require explicit informed consent ( without deception ) in all research even though doing so would bring much valuable research to a screeching halt . but assuming that something like the common rule 's criteria for waiving informed consent reflects a sensible moral position , it ca n't be the case that people have a strong general right not to be used as a research subject without their valid consent . despite these considerable and important exceptions to cr , there is a wide spectrum of cases particularly in clinical or interventional biomedical research in which cr remains completely uncontroversial . in such cases , the question is not so much whether valid consent is required , but what is required by valid consent , ie when we should regard a participant 's token of consent as valid or morally transformative ? to elaborate on the previous point , there are cases in which we may worry as to whether consent is sufficiently voluntary to be valid . for example , it may be thought that members of certain vulnerable groups such as prisoners can not give valid consent because they are in a coercive environment . some think that one can not give voluntary consent if one has no reasonable alternative but to participate , say because one otherwise lacks access to medical care . some think that offers of payment render consent involuntary or that such offers often constitute undue influence . for example , some argue that those in the grips of the therapeutic misconception are not giving valid consent . we can also ask whether excessive optimism about benefitting from participation invalidates one 's consent . although there is general consensus that informed consent requires that investigators inform the subjects about certain matters but there is controversy as to whether subjects must actually understand that information or what information they must understand . dan brock argues that subjects do not need to understand the entire underlying scientific and medical basis of the research ; rather , they need to know how their lives are likely to be affected , both positively and negatively , by participation in the research. all that said , and with considerable room for disagreement at the margins , it is generally assumed that it is wrong to conduct interventional biomedical research without a subject 's informed consent . in the word of the belmont report , this principle is is it true ? and if it is true , why is it true ? the it is relatively easy to grasp the force of cr if we view research as a private interaction between investigators and subjects in which research involves another 's body or property without their consent , and we are certainly not entitled to coerce them to do what we would like them to do or , for that matter , to do what they have an obligation to do . a ban on intentional interpersonal harm is sufficient . but things look different if we view ( some ) research as an issue of political philosophy , as an interaction between citizens and the state , or researchers whose activities have been authorized by the state . after all , we are inclined to think that it is legitimate for the state to do things to people without consent and there is a wide range of cases where we think that it is legitimate for the state to coerce people to perform acts that are contrary to their interests , for example , to pay taxes , to serve on juries , appear as witnesses at trials , get vaccinations , or purchase car insurance or medical insurance . so we can at least ask whether it would be legitimate for the state to require people to participate in biomedical research . of course i then ask whether the use of coercion is legitimate as contrasted with justifiable . in the major section of this paper , i consider several candidate principles for regarding coercion as illegitimate , per se , and argue that none of them are sufficient . having established a prima facie case for the legitimacy of coercive participation , i then ask whether the use of coercion is justifiable in cases of interventional biomedical research . i conclude that it probably is not . finally , i argue that even if the use of coercion is legitimate and sometimes justifiable as a matter of first - order ethics , there are good moral reasons to adopt a rule or policy that bars coercive participation . in the contexts in which consent should be required , although bioethicists typically discuss consent as if it serves and is entailed by a deontological - type principle such as nmmp or respect for autonomy , the nuremberg code 's insistence on consent was primarily designed to protect subjects from the sorts of palpable and egregious harms imposed by the nazis . the importance of this interest - protecting function of informed consent is reflected in the common rule 's provision that permits waivers of consent only when the interests of subjects are not ( much ) at stake and it is not practicable to obtain their consent and this is so even if the subjects might not want to be included in research . buchanan and brock note that there are several reasons why people have an interest in making significant decisions about their lives for themselves. first , self - determination is instrumentally valuable in promoting a person 's well - being. because people will typically give valid consent to a transaction if but only if the transaction serves their interests , regarding a person 's valid consent as necessary and ( generally ) sufficient method for rendering another 's action permissible when it would otherwise not be permissible is a reasonably reliable method for protecting or promoting a person 's well - being . the tie between consent and advancing a person 's interests or well - being is strengthened to the extent that a person 's interests depend on the particular aims and values of that person. for example , given that prostate surgery may involve a trade - off between some increase in expected survival and a substantial risk of impotence , we can not say whether surgery will enhance a patient 's well - being or interests without knowing the weight that he ( reasonably ) places on these outcomes . in addition , because people want to make decisions for themselves and enjoy doing so , the simple satisfaction of this desire is also a component of their well - being . in addition to advancing welfare or well - being , consent also serves to respect , protect , and promote a person 's autonomy . i want to explore the alleged tension between promoting a person 's interests and respecting a person 's judgement or autonomy . we generally believe that people have a right to make decisions in certain spheres even when the decision does not advance their well - being . thus , we may think that a jehovah 's witness has a right to refuse a life - saving blood transfusion even though the refusal does not advance her well - being ( even allowing for the value that she attaches to her religious commitments ) . the tension between the value of promoting a person 's well - being and the value of protecting and promoting autonomy or self - determination is sometimes overstated . although there are no doubt some cases in which these two values conflict ( if jehovah 's witnesses did not exist , bioethicists would have to invent them ) , it is arguable that we would not value respecting people 's autonomy or their choices if as a general rule people made choices that did not advance their interests or aims . it can not be entirely coincidental that the very conditions that are thought to render an agent 's decisions less than fully autonomous coercion , deception , and incompetence are also conditions that reduce the likelihood that her decisions advance her well - being . interestingly , the tension between considerations of well - being and respect for autonomy is much greater in clinical care than in clinical research . in the former context , there are long - standing debates as to if and when physicians can justify deception or withholding information from patients when they think that full disclosure would not serve a patient 's interests . there are debates as to whether physicians should transfuse a patient who would otherwise die if the patient rejects transfusions on religious grounds . in the research context , however , we are considering whether coercive participation is legitimate even though it is contrary to a person 's interest to participate in research and she would not do so voluntarily . here , the course of action that would promote the person 's well - being and the course of action that would respect her autonomy are on the same side of the street . still , it matters whether we adopt an autonomy or an interest - based justification for cr . if the principal justification for cr is that it protects and promotes the interests of the consenter , then that justification will have relatively little purchase in those cases where participation involves minimal risks and burdens . moreover , even if it were pro tanto wrong to impose minimal risks and burdens without consent , we would also have to ask why the subject 's interests should dominate the interests of present and future people who would benefit from more and faster medical research . perhaps the interests of subjects should be weighed more heavily than the interests of the beneficiaries of research just as the interests of innocent defendants should be weighed more heavily than the public interest in a higher rate of conviction of the guilty . in the previous sections , i have argued that several related arguments for cr and for a ban on coercive participation simply do not work on their own terms and have unacceptable implications . if one appeals to principles such as respect for autonomy or nmmp or a right not to be a research subject without consent , then we can not make sense of a large range of research that takes place without any sort of consent by the subject or , as in much social and behavioral research , without a subject 's informed or undeceived consent . it might be more difficult to justify the use of coercion , but given that many cases of state coercion barely raise our hackles , we need to explain why the prospect of coercing people into participating in research should be regarded as so abhorrent . i have argued that no simple principle would justify cr or entail that coercive participation in interventional biomedical research is illegitimate . contrary to what is often supposed , it is simply not true that informed consent is a fundamental ethical requirement of research or biomedical research . still , i have argued that , all things considered the balance of moral reasons might well tell against the use of coercion in most cases . even if an accurate first - order moral calculation justified the use of coercion in some cases , there may be good second - order reasons to adopt a general prohibition against its use in interventional biomedical research while , perhaps , still allowing the use of coercion in non - interventional biomedical research or behavioral research such as the us census . more generally , there may be good second - order reasons to adopt cr for interventional biomedical research while rejecting cr as a general requirement for ethical research , per se . here we may make a distinction between ( 1 ) research without valid consent and ( 2 ) coercive participation . it is entirely possible , nay likely , that we can follow the general approach of the common rule and carve out exceptions to cr that allow for research without consent or without valid consent ( or with deceived consent ) under certain specific conditions without undermining a commitment to the general importance of consent . the best conception of these exceptions to cr may not be identical with the provisions in the common rule , but they will be similar . not only will such exceptions be defensible on first - order moral grounds , but there may be no strong second - order reasons to bar such exceptions . even if an omniscient moral calculation might support the use of coercion in certain cases , there may be compelling second - order reasons to bar coercion in all but a few cases given that government officials are not omniscient reasoners and are certainly not perceived as such . given the value of clear and firm rules , it may be better to adopt a simple inflexible prohibition against coercion under the actual conditions in which we live . or , to put the point slightly differently , we may sensibly decide to treat or regard the use of coercive participation as illegitimate even if it is not illegitimate at its core . here we encounter an issue that is well known in the law , namely the choice among using rules , standards , and principles . it is a rule that one must be at least 21 to buy alcohol in vermont or that one must be at least 35 to be the president of the united states . a rule may have to be interpreted , as in the old legal chestnut as to whether a rule that says no vehicles in the park applies to bicycles or toy trucks or an old tank mounted on a platform . but once a rule has been interpreted , the application of the rule to the facts is relatively straightforward . standards define a set of mandatory considerations but provide for a greater range of choice and discretion by decision - makers . custody should be awarded to the mother or the primary caregiver if she ( or he ) wishes to have custody would be a rule . by contrast , a law that says , in awarding custody , courts should be guided by the best interests of the child would be to employ a standard . it specifies a mandatory and exclusive guideline , but judges would have considerable discretion as to how to apply it . they identify a consideration that should inform a decision , but they allow that other considerations may be relevant . consider a law that states , in sentencing a person convicted of a crime , judges should take into account the severity of the crime. this principle does not exclude other considerations , such as the prior record of the criminal or whether he represents a danger to the community . it merely states that the severity of the crime should be a factor in the decision . in a world with excellent decision - makers and widespread trust in their capacities , we would not need to rely ( so much ) on hard and fast rules or standards . with respect to the problems discussed in this article , we would ask the decision - makers to decide whether the balance of justificatory considerations requires that subjects be asked for their informed consent , but we would allow them to treat these moral considerations as principles and thus approve the use of coercion ( or allow for research without valid consent ) when it is justified , all things considered , and disapprove its use when it is not . there are at least three related difficulties with opting for discretionary decision processes as opposed to using rules or standards . first , such processes are liable to excessive mistakes . as frederick schauer puts it , rule - based decision - making is premised in part on the belief that none of us , ordinary or not , have the mental capacity incessantly to consider all of the things than an all things considered decision - making model requires of us. consider the regulation of traffic at intersections . there are some intersections where it is efficient and sufficiently safe to use no signs or yield signs . we ask drivers to go when it 's safe and yield to other cars when it 's not . but there are many intersections where the advantages of allowing drivers to use discretion are outweighed by the dangers . the aggregate cost of even relatively few accidents ( frequency x magnitude of cost ) may vastly outweigh the benefit ( time , fuel , etc . ) of avoiding unnecessary stops . and so we use stop signs even though it would often be perfectly safe for drivers to proceed cautiously through the intersection without stopping . second , there are social costs to allowing decision - makers to use discretion when ( too ) many suspect that the criteria are not fairly or correctly applied and can not reliably predict the way in which such decisions will be made . . we could ask sellers to evaluate the maturity of the purchaser than to use an age - based rule . and it is possible that sellers could do a better job of excluding the immature and including the mature than mechanically applying an age - based rule . but , in part , because we do not trust decision - makers to apply that criterion in a reliable or fair way , we prefer to rely on an arbitrary age , full well understanding that this rule allows some to buy alcohol who we should not allow to buy and excludes many who are mature enough to consume alcohol . third , discretionary decision processes can place excessive burdens on the decision - maker . in some contexts , it is plausible to suppose that in child custody cases , the advantages of allowing discretion are sufficient to outweigh the inevitable bad decisions it allows and the costs of litigation and bargaining that it encourages . and the cases are not so frequent so as to impose unacceptable decision - making costs on family court judges . in other contexts , however , the burdens are excessive both psychologically and economically . mill appeals to something like this argument for rules in defending his harm principle . anticipating the argument that it may sometimes be best to paternalistically interfere with a person 's decision , he replies that the strongest of all the arguments against the interference of the public with purely personal conduct , is that when it does interfere , the odds are that it interferes wrongly , and in the wrong place. this line of argument need not deny that interference with purely personal conduct is sometimes justified . after all , for it to be the case that the odds are that interference with purely personal conduct is wrong , it must be the case that interference with such conduct is sometimes right . in effect , mill is claiming that because interference with purely personal conduct is usually wrong and because society can not be trusted to interfere primarily when it is likely that such interference is right , it is better to adopt a rule that bars paternalistic intervention . better to treat all such interference as illegitimate rather than allow decision - makers to determine when such interference is justified and when it is not . there are numerous decision contexts in which we forego attempting to use theoretically optimally principles and make do with rules that are good enough and command widespread social acceptance rather than rely on principles or standards . consider sexual relations between psychotherapists and patients . such relations might be morally permissible if both parties could give valid consent and if such relations were not harmful to patients . but even if those conditions sometimes obtain , as must be the case , there is a good reason to think that neither psychotherapists nor patients are well positioned to judge when that is so . given that the odds are that a patient 's consent is tainted by transference or a function of underlying mental disorders or that the psychotherapist 's judgement is tainted by countertransference , and given that such relations are likely to be harmful to the patients or interfere with a beneficial psychotherapeutic relationship , society is well advised to adopt a hard and fast ban on such relations . it is sometimes said that psychotherapy patients can never give valid consent to sexual relations with their psychotherapists . nonetheless , it may be quite sensible to follow a rule that always treats such consent as invalid or as insufficient to render such relations permissible . so , too , for the use of coercive participation in interventional biomedical research . given that the use of coercion would only rarely be justified , and given the choice between an unreliable mechanism for determining when coercion should be used and the adoption of a rule that prohibits its use , it might be preferable to draw a bright line around interventional biomedical research and simply bar the use of coercion . we would continue to allow coercion in other contexts , such as requiring people to serve on juries or to recycle , but it might be better to adopt a rule that would ban the use of coercion in all interventional biomedical research , than to open the door to allow decision - makers to exercise discretion in determining if and when it should be permitted . as a principle of second - order morality , we adopt the rule that a certain class of research can not go forward without informed consent . i say a certain class of research . in the context of social and behavioral research or non - interventional medical research where the risks of participation are low and it is not feasible to garner individual consent , i believe that the common rule 's criteria for waivers of consent are on the right ethical track in adopting a they allow irbs to exercise discretion and allow for research without consent , although irbs no doubt sometimes refuse to allow such waivers when they should , and sometimes wrongly grant such waivers when they should not . the more discretionary approach to deciding when to require informed consent works reasonably well because most research without consent ( as in cluster randomized trials ) or without valid informed consent ( as in social and behavioral research that uses deception ) is of relatively low visibility . it does not seem to generate the sorts of negative externalities that would likely be generated by the use of coercion . by contrast , given that the costs of allowing coercive participation in the biomedical context would be quite visible and provide a field day for fox news , it is probably better to treat coercion as illegitimate as a matter of course and to require informed consent . it is plausible to assume , for example , that the conditions for altering or waiving informed consent as specified in the common rule meet that test the law that includes these provisions was approved by congress . but even if i am right in suggesting that participation in research often constitutes a collective action problem of the sort for which we regularly use coercion by the state , it is not generally discussed or seen in those terms . it continues to be viewed , and understandably so , as an interaction between investigators and subjects , where individuals are not permitted to intentionally put others at risk or invade a person 's body without consent . although much non - interventional research proceeds without consent or without informed consent , a generalized commitment to the value of consent ( subject to specific exceptions ) is well entrenched . so even if people should treat coercive participation as legitimate and potentially justifiable , it is unlikely that they will do so barring a significant change in public opinion . and that makes a change in policy both politically unlikely and morally questionable given a commitment to democratic norms . to exemplify the previous point , consider the case for barring the ownership of handguns . if we could turn back the clock such that the constitution did not include the second amendment , then we might be well served by the sort of general prohibition on handguns . but there is no turning back , even if a ban on some sorts of firearms ( such as assault weapons ) is at least a political possibility . in a similar vein , i once argued that there are good reasons to adopt a policy of compulsory voting in the united states , as has been done in several other western democracies . i also argued that it is a good idea whose time is either past or has not yet come. also along similar lines , aaron spital has argued that while a policy of conscription of cadaveric organs for transplantation would save lives and would pose no harm to the dead , most people oppose such a policy , and so he reluctantly concludes that this is a stimulating idea whose time has also not yet come . even if coercive participation were legitimate and more often justifiable than i am inclined to think , much the same may be true in the context of interventional biomedical research . and this is particularly so given the fear supported by many bioethicists and the subject protection industry that any weakening of cr would put us on a slippery slope to nazi - like or at least tuskegee - like experimentation with human subjects . same - sex marriage was not on the radar screen 20 years ago , but is now widely accepted . still , i do think that society 's view about the importance of consent in interventional biomedical research is likely to witness a significant change in the foreseeable future . the major purpose of this article is to ask why we should require informed consent to biomedical research . as an argumentative strategy to make progress on these ( and related ) questions , i examined the case for the legitimacy of coercive participation in interventional biomedical research . many seem to think that it is obvious that coercive participation would be wrong and that it is also obvious why that is so . i have argued that the principle and its justificatory story are more complex and pluralistic . it would be nice if we were able to ground cr or a ban on coercive participation in a simple and uncontroversial ethical principle such as respect for persons or not treating people merely as a means or the sanctity of a line around the body. i have argued that if we view participation in interventional biomedical research as an interaction between the state and the individual , then no straightforward argument for regarding coercive participation as illegitimate or for requiring voluntary and informed consent for participation in biomedical research can be made to work . but we can get there through the back door , by seeing the claim that coercive participation is illegitimate as justified as a second - order principle that is rooted in our lack of confidence that any institution has the capacity to make reliable judgements as to when coercive participation is justified by first - order moral principles . indeed , the same strategy can justify treating all deviations from cr as illegitimate in interventional biomedical research . as i have argued throughout , it is the interventional dimension of research that is crucial to the argument for cr , rather than the fact that any such intervention is undertaken as research . we have already accepted as we should a regime in which a great deal of non - biomedical research can take place without the informed consent of participants . we simply do not believe that there is a strong presumption that it is unethical to engage in research as such without the subject 's valid consent . indeed , and as i have noted above , we are prepared to conduct much biomedical research without informed consent as in cluster randomized trials and perhaps in comparative effectiveness studies when they do not involve biomedical interventions that would not occur if the subjects were not participating in research . and if the advocates for a learning health care system have it right , these exceptions should grow in the coming years , particularly given the possibilities of using big data resources with medical records , tissues , etc . of course , even if consent is not required in many types of biomedical research , it may still be morally desirable to obtain consent when it is practicable to do so . but the reasons for seeking informed consent will fall far short of the reasons that are often advanced in its defense . if i am right , the need for consent in interventional biomedical research or , indeed , in any form of research may have little to do with the fact that the interaction between investigators and subjects is pursuant to generalizable knowledge . as an interaction between individuals ( as opposed to an interaction between the state and individuals ) , there are some actions we can undertake that affect others that do not require consent and some that do . and we have to determine when and why consent is required . we can do lots of things that have adverse effects on others without their consent , but , as a general rule , we are not entitled to touch or invade another 's body without their consent . the targets of such interventions should be informed of the purposes , risks , and benefits of such interventions . thus , they should be informed that the purpose of the intervention is research not so much because it 's research and research is subject to special ethical principles . rather , targets of such interventions should have the information relevant to an intelligent decision whatever the purposes of an intervention . in addition , and as a general ethical principle , we are not entitled to ask others to spend time on our projects whatever they are without their undeceived consent , whether or not our projects have anything to do with the development of generalizable knowledge . i am eminently aware that the argument i have given for requiring consent to interventional biomedical research and for regarding coercive participation as illegitimate will prove unattractive to many , as it is decidedly deflationary , inelegant , partially consequentialist , institutional , and , dare i say , political . but if i am right , the truth about cr and the legitimacy of coercive participation is indirect , deflationary , inelegant , partially consequentialist , institutional , and political .	it is widely accepted that informed consent is a requirement of ethical biomedical research . it is less clear why this is so . as an argumentative strategy the article asks whether it would be legitimate for the state to require people to participate in research . this article argues that the consent requirement can not be defended by appeal to any simple principle , such as not treating people merely as a means , bodily integrity , and autonomy . as an argumentative strategy the article asks whether it would be legitimate for the state to require people to participate in research . i argue that while it would be legitimate and potentially justifiable to coerce people to participate in research as a matter of first - order moral principles , there are good reasons to adopt a general prohibition on coercive participation as a matter of second - order morality .
You are an expert at summarizing long articles. Proceed to summarize the following text: mesothelioma is a primary neoplasm originating from the lining of serous cavities of the human body . the pleural cavity is the most frequent localization of the disease , whereas approximately only one fifth of the lesions occur in the peritoneal cavity . mesothelioma develops more commonly in males and the median age of diagnosis is 50 to 60 years . particularly , the peritoneal form of mesothelioma is associated with prolonged exposure to airborne asbestos fibres . mesothelioma occurs in the form of multifocal tumours and infiltrates of various size and shape affecting the parietal peritoneum and the visceral layer . those lesions coalesce into larger nodules and tumours over time and may cover the entire peritoneal surface eventually . pain , increasing abdominal girth , anorexia and weight loss , and recurrent ascites are the most frequent presenting symptoms . in most cases , this insidious disease is recognized at an advanced stage under the clinical mask of carcinomatous peritonitis . most often , the final diagnosis is made after postoperative histopathological assessment supplemented with immunohistochemical tests . malignant mesothelioma cells are characterized by positive staining for epithelial membrane antigen ( ema ) , wilms tumour 1 ( wt1 ) , cytokeratins ( 5/6 , 7 ) and calretinin , whereas there is absence of antigens such as the carcinoembryonic one . the treatment of mesothelioma is palliative in most patients . before 2000 , a combination of cytoreductive surgery and systemic chemotherapy was applied in most centres and the median survival rate ranged from 9 to 15 months . afterwards , more aggressive methods of treatment were implemented , consisting of surgery , followed by intraperitoneal , hyperthermic , multidrug chemotherapy and whole abdominal radiation , and the rate of 5-year survival increased to 50% . however , such comprehensive management is undertaken only in patients after complete surgery , whereas the patients with incomplete cytoreduction , unresectable tumours like in the presented patient and those with extra abdominal lesions are candidates for palliative systemic chemotherapy [ 6 , 7 ] . the article presents a 50-year - old male patient suffering from an incurable form of advanced malignant peritoneal mesothelioma under the clinical mask of fever of unknown origin . the patient , r.o . , age 50 , tall and of heavy build , fell ill at the end of may 2009 , being treated first in an out - patient department of internal medicine . he presented with symptoms of generalized viral infection such as fever , sore throat and myalgia , whereas physical examination was negative . transient alleviation occurred after introduction of nsaids and clarithromycin , followed however by recurrent rises in temperature , paroxysmal and persistent cough , and malaise after a few days . additional studies were negative except for an increase in erythrocyte sedimentation rate ( esr ) to 95 mm / h , a rise in c reactive protein ( crp ) to 46 mg / l and a single gallstone in the gallbladder found on ultrasonography . anti - mycoplasma and anti - epstein - barr virus ( ebv ) antibody levels were assessed due to suspected atypical tracheitis . whereas antibody titres were non - specific , there was still an increase in esr to 120 mm / h . because of persistent symptoms such as fever , weight loss ( 4 kg in a fortnight ) , hacking cough and rising esr , the patient was suspected to have developed sarcoidosis . then , he was admitted to the private clinic certus on 23.06.2009 . there were no abnormalities on physical examination . all the laboratory tests such as complete blood count ( cbc ) , blood smear , liver and kidney function tests , cardiac enzyme studies , and tumour antigens were normal except for a further increase in crp to 103.5 mg / l and non - specific changes on urinalysis . however , urine culture was negative . there were non - specific changes on the chest ct scan and the mediastinal lymph nodes were not enlarged . the bacteriological tests such as mycobacterium tuberculosis detection ( mb / bac t ) , cytological and mycological examination of the bronchial mucus secretion were negative . due to persistent cough and recognized chronic bronchitis , the patient was given methylprednisolone orally , inhalatory steroids and bronchodilatory medications . looking for other sources of infection , abdominal computed tomography ( ct ) was performed on 25.06.2009 . this examination showed inflammatory infiltration along the wall of the hepatic flexure of the colon , a small amount of fluid under the right lobe of the liver , small lymph nodes in the liver hilus and along the aorta and a gallstone 4 cm in diameter in the gallbladder ( fig . diverticula were located in the transverse , descending and sigmoid colon according to subsequent colonoscopy . the patient responded to the treatment , the temperature dropped and the cough went away . he was released home on 2.07.2009 in good general condition on intravenous amikacin for 5 days , to be followed by oral ciprofloxacin , ceftibuten , fluconazole , methylprednisolone and inhalatory ciclesonide and tiotropium . due to recurrent fever up to 39c , malaise and further weight loss at the end of july he consulted a surgeon , who suspected the patient to have developed either perforation of the diverticulum or gallbladder empyema . pyrexia , malaise , mild abdominal pain in the right epigastrium and weight loss ca . physical examination revealed an extensive , immovable mass with blurred borders in the right epigastrium with mild peritoneal signs . there was a small amount of clear fluid in the peritoneal cavity , whereas the entire abdomen was filled with an unresectable omental mass which was encasing the colon , duodenum and small bowel loops , and reached the lateral walls of the peritoneal cavity and the minor pelvis . the parietal peritoneum was covered with multiple nodules similar to cancerous metastases from 1 to a few mm in diameter . there were enlarged lymph nodes in the liver hilus and in the vicinity of the stomach . biopsy specimens were obtained from the omentum and peritoneal nodules and the abdomen was closed . negative immunohistochemical staining for cd20 excluded lymphatic origin of the neoplasm , whereas positive staining for wt1 , cytokeratin 5/6 ( ck5/6 ) , ck7 and calretinin confirmed the diagnosis of the epithelial type of malignant mesothelioma . the patient was then admitted to the department of oncology on 2.09.2009 for chemotherapy . despite intensive treatment after death the patient 's wife reported that he had lived in the vicinity of an asbestos factory until the age of 14 . computed tomography , venous portal phase . selected transverse sections at the level of the lower margin of the right lobe of the liver ( a ) , liver hilus ( b ) , and the antral part of the stomach ( c ) . extensive pathological mass infiltrating the visceral surface of the right liver lobe , the liver hilus , the hepatic flexure of the colon , the antral part of the stomach , and anterior wall of the abdomen in the middle and right epigastric region ( white arrowheads ) pain , increasing abdominal girth , anorexia and weight loss , and recurrent ascites are the most frequent and non - specific presenting symptoms of peritoneal mesothelioma . less common signs , such as persistent fever , night sweats and mechanical bowel obstruction , are regarded as poor prognostic factors . mesothelioma can be also associated with such paraneoplastic signs as thrombocytosis , hypoglycaemia , thrombophlebitis and liver failure . malignant peritoneal mesothelioma manifested clinically under the mask of fever of unknown origin in the presented 50-year - old male patient . pyrexia of more than three weeks duration , with temperatures over 38c and a failure to identify the cause of the fever , is defined as fever of unknown origin . infections and collagen - vascular diseases are the most common causes of the systemic inflammatory response syndrome with elevated temperatures . the presented patient was suspected to have developed sarcoidosis due to the following symptoms : persistent fever , weight loss , non - productive cough and elevated esr . however , persistent fever can also be a presenting sign of more frequently reported malignant diseases such as hodgkin 's lymphoma , leukaemia and renal cancer . indeed , it has been observed that any other malignancy , either a localized tumour or already disseminated disease , can cause neoplastic fever . no clinical features reliably differentiate neoplastic fever from fever due to other causes . therefore , neoplastic fever is a diagnosis of exclusion , confirmed after careful evaluation of other causes of pyrexia . awaiting results of additional studies , an empirical treatment with standard broad - spectrum antibiotic therapy is followed for at least 7 days . if no clinical response to antibiotics occurs and there is no evident cause of infection , the naproxen test can be applied . although the pathophysiology of neoplastic fever and its differences from other causes of fever remain uncertain , it has been shown that significantly more patients with neoplastic fever respond to naproxen compared to others . nevertheless , patients during naproxen treatment require further examination to rule out fever due to other non - neoplastic aetiology . ct facilitates the diagnosis and evaluation of the clinical staging and resectability of the lesions , and it assists the percutaneous needle biopsy . treatment is monitored with ct and it is also a prognostic factor of the neoplasm . a large tumour in the epigastric or hypogastric region , irregular or nodular peritoneal thickening limited to a single quadrant of the abdominal cavity and omental mass are the ct features of malignant mesothelioma . additional findings that could be helpful in the differential diagnosis from other malignancies , including peritoneal carcinomatosis , are the lack of a primary lesion , encasement rather than infiltration of the adjacent organs , absence of lymph nodes or distant metastases and small amount of ascites . a tumour exceeding 5 cm in diameter , nodular thickening of the peritoneum within the small bowel and its mesentery and segmental obstruction of the bowel indicate rather incomplete surgical debulking . ct scans of the presented patient from 25.06.2009 were sent for reassessment to an independent radiologist who was not aware of the final diagnosis . 16 cm in diameter , localized in the liver hilus and under the right lobe of the liver , spreading to the level of the lower pole of the right kidney and encasing the hepatic flexure of the colon , the antrum of the stomach and small bowel loops , infiltrating the anterior wall of the abdomen in the medial and right epigastric region ( fig . a discrepancy between both ct results indicates difficulties in radiological evaluation of lesions originating from the peritoneum such as peritoneal studding , mesenteric thickening and omental mass . however , magnetic resonance imaging ( mri ) , according to some authors , is superior to ct , both in the differentiation of malignant from benign lesions and because of better resolution in visualization of soft tissues . perfusion and diffusion mri are promising new techniques for the assessment of tumour cellularity and microvasculature and can be used for assessment of treatment response . in turn , positron emission tomography ( pet ) is also useful for the differentiation of benign from malignant lesions , and for staging , as well as monitoring response to treatment .	the authors present a patient suffering from malignant peritoneal mesothelioma . differential diagnosis has become the major concern in the fatally ill patient . pain , increasing abdominal girth , anorexia and weight loss , and recurrent ascites are the most frequent presenting symptoms . in this patient , fever of unknown origin was a clinical mask of mesothelioma . the diagnostic process was focused on infections and collagen - vascular diseases since they are the most common causes of the systemic inflammatory response syndrome . however , persistent pyrexia can also occur , less frequently , in the course of any malignant disease .
You are an expert at summarizing long articles. Proceed to summarize the following text: compromised renal functions and previous central nervous system ( cns ) disease have been shown to predispose to this neurotoxicity . we describe a case of acute transient encephalopathy in a patient treated with ceftriaxonefor enteric fever infection . the present case illustrates the diagnostic challenges and management of this rare but potentially severe side effect of one of the most commonly prescribed parenteral antibiotics . an eight - year - old male child presented with a history of diarrhea and high - grade fever . the child was conscious , cooperative , well oriented to time , place and persons . the patient was hospitalized and started on ceftriaxone ( 1 g iv daily ) and intravenous fluids . after three days of treatment with iv ceftriaxone , child became afebrile but showed altered mental status with progressive apathy and somnolence . the patient was referred to the dyanand medical college , ludhiana ( punjab ) . in the emergency department , the patient was not in acute distress , had no fever , was hemodynamically stable , but dehydrated . hb 12 g / dl [ normal range 12 to 15 g / dl ] , hct 38% [ normal range 35.0 to 49.0% ] , tlc 6 10/l l [ normal range 5 to 12 10/l l ] , dlc - n 62 [ normal range 6070% ] , l 27% [ normal range 2040% ] , plt 274 10/l l [ normal range 100 to 300 10/l ] , urea 14 mg / dl [ normal range 825 mg / dl ] , cr 0.6 mg / dl [ normal range 0.51.7 mg / dl ] , na / k 139/4 [ normal range 135147/ 3.55 meq / dl ] , urinalysis revealed no bacteriuria and pyuria , tsb / dsb 0.77/0 [ normal range 0.11.0/ < 0.2 mg / dl ] , sgot / pt 44/23 [ normal range 1147/ 753 iu / l ] , stoolr / e , 2d mri scan of brain did not reveal acute stroke . the patient 's neurological status improved and three days later he was again alert and oriented . the proposed mechanisms include a decrease in -amino butyric acid ( gaba)-mediated inhibition and cephalosporin - mediated release of cytokines . in fact , cephalosporins may decrease gaba release from nerve terminals , increase excitatory amino acid release , and exert a competitive antagonism with gaba . alternatively , cephalosporin treatment has been proposed to induce endotoxin release , which generates cytokines liberation , such as tumor necrosis factor- , a proinflammatory cytokine implicated in septic encephalopathy . pre - existing cns abnormalities have been indicated as a risk factor for -lactams encephalopathy . in this was not the case in our patient , who presented with enteric fever and dehydration corrected with intravenous fluids . in fact , the temporal association of the encephalopathy induction and resolution with ceftriaxone administration and withdrawal makes this antibiotic highly likely to be responsible for the encephalopathy . moreover , the temporal pattern is in accordance with previous publications reporting cephalosporin neurotoxicity , with a latency of one to ten days after drug initiation and regression of all neurological symptoms within two to seven days following ceftriaxone treatment suspension . we could establish a probable causal relationship between ceftriaxone and the encephalopathy ( naranjo score 6 ) . the severity assessment revealed the adr to be moderate , suggesting that required therapeutic intervention and hospitalization prolonged by 1 day but resolved in 24 h or change in drug therapy or specific treatment to prevent a further outcome . since this patient did not have a history of any such reaction due to ceftriaxone , this adverse drug reaction was unpreventable . we describe a case of ceftriaxone - induced acute reversible encephalopathy in a patient treated for enteric fever infection . early recognition of this complication is particularly relevant as discontinuation of ceftriaxone reverts the neurological syndrome .	ceftriaxone is a commonly used , third - generation cephalosporin . encephalopathy is a rare side effect of third- and fourth - generation cephalosporins . renal failure and previous disease of the central nervous system predispose to this neurotoxicity . we describe a case of acute transient encephalopathy in a patient treated with ceftriaxone for enteric fever infection . early detection of this complication is relevant given that stopping the drug usually reverts the neurological syndrome .