Datasets:

ewhfef
/

mix_cpt

Dataset card Viewer Files Files and versions Community

Split (1)

train · 29.6k rows

prompt stringlengths 0 466k
ochronosis ( alkaptonuria ) is a rare inborn error of metabolism with an incidence of < 1 per 250,000 live births.1 the cause of alkaptonuria is the lack of an enzyme homogentisate 1,2-dioxygenase , which results in an accumulation of homogentisic acid . some of the homogentisic acid is secreted in urine , while the rest is accumulated in skin and connective tissue leading to hyperpigmentation of skin and sclera , and the degeneration of cartilage inducing premature arthritis . the color of the pigment is brownish - yellowish ( ochre ) under a microscope ; hence the term ochronosis was coined by virchow in 1866 for this disease.1 it forms stiff complexes with the cartilage making it more susceptible to mechanical damage during normal loading , leading to its speedy breakdown and early development of osteoarthritis.2 homogentisate 1,2-dioxygenase levels are elevated from birth , but pigmentation takes many years to become noticeable . recently , interleukin-6 has been implicated to be involved in increasing ochronotic pigmentation in alkaptonuria.3 the typical presentation of ochronosis includes darkening of urine due to oxidation and discoloration of diapers in children . in addition , there may be grayish discoloration of skin , sclera , eyelids , ear cartilage , forehead , cheeks , nail beds , buccal mucosa , tympanic membrane , and palmer aspects along with early degenerative arthritis involving the axial skeleton and large joints . the pigment may also be deposited in outer eye structures , cardiovascular system , and in urinary calculi.4 in early cases , obvious scleral discoloration or degenerative arthritis may not be observed , but the discoloration of urine is a universal symptom . we present two cases of alkaptonuria from pakistan who had ochronotic arthropathy with ossifications of the intervertebral disks , skin changes , and scleral pigmentation . a 48-year - old male presented to the outpatient department with a 15-year history of chronic pain in lower back and both knees . pain was nontraumatic , progressive , dull - aching in nature , and aggravated on exertion . he denied rash , fever , morning stiffness , sciatica , night pains , and other associated symptoms . he had been taking nonsteroidal anti - inflammatory drugs ( including ibuprofen , naproxen , diclofenac , and piroxicam ) and muscle relaxants for the last 10 years with temporary pain relief . his father had a similar problem with joint pains at a young age and died when he was 59 years old . the patient was a retired navy sailor and recalled that his knee and back pain made his job very difficult for him . he lived in a hilly area with his wife and four children . on physical examination , he was a middle - aged male , looking older than his chronological age . he disclosed that his height had been 165 cm at enrollment in navy 25 years back . the minimum standard for induction into pakistan navy is 162 cm , which confirmed that he actually lost his height in the last 15 years . 1a and b ) and grayish blue papules on the bilateral extensor surface of the second finger ( fig . his straight leg raise was 80 on both sides ( normal , 90 ) with mildly reduced spinal flexion . there was palpable crepitus in both knee joints with flexion reduced to 100 ( normal , 130 ) because of pain . the laboratory analysis , including a complete blood count , liver , and renal function tests were normal . x - rays of the cervical and lumbosacral spine showed advanced degenerative changes with intervertebral disk space narrowing and osteophyte formation ( figs . 2a x - rays of the knee joints showed reduced joint space and osteophyte formation with loose bodies , suggestive of osteoarthritis knees ( figs . based on history , physical examination , and investigations , a provisional diagnosis of ochronotic arthropathy was made . when the patient s urine sample was allowed to stand his family screening was initiated and two of his children were found to be positive . home - based stretching and strengthening exercises were taught , and he was provided with a walking stick to aid in his gait and offload the arthritic joint . he was prescribed acetaminophen for his pain along with 1 g of ascorbic acid ( vitamin c ) daily and advised to continue medication for hypertension and hyperlipidemia . he is doing well with the treatment and is living with his disease with regular follow - up at the outpatient rehabilitation and cardiac departments . he has been briefed about the option of joint replacements of the large weight - bearing joints , if the condition becomes worse or unbearable . a 60-year - old female presented with insidious onset of a chronic , dull , aching pain in both knees and dorsal spine for the past 15 years . she had a fall one year before , which resulted in spinal cord compression and incomplete thoracic paraparesis . she had a gradual , but partial recovery in legs , following open discectomy and laminectomy . she had diabetes and hypertension for the past two years but was not taking regular medications . twenty years ago , she had noticed gradual grayish - blue discoloration of her nose , index fingers , palms , and thumbs . she was unable to get an explanation for her problem , because there was no physician in her remote rural area . , she was an old woman , lying in bed with flexion contractures at both knees . she had grayish - blue patches over her nose , proximal palms , index fingers , thumbs , dorsal foot , and macules in sclera and over face , ears , and knees ( figs . she had a normal tone and power in upper limbs with grade 1 + spasticity ( modified ashworth scale ) in both legs . muscle stretch reflexes were grade 3 + in legs , while the plantar reflex was down going . her urine turned dark , when kept in the open for 24 hours ( fig . the x - rays of her dorso - lumbosacral spine showed reduced intervertebral disk spaces consistent with age and calcification of the intervertebral disks , which were more prominent in the lumbosacral region . the postsurgical magnetic resonance imaging revealed anterior wedging with partial fusion of t10 and t11 vertebrae , postsurgical architectural distortion , and loss of posterior elements , seen also at that level . her hemoglobin value was low ( 8.7 g / dl , normal > 12 g / dl ) , while total leukocyte count , platelet count , liver and renal function tests , plasma glucose profile , and electrocardiogram results were normal . the two - dimensional echocardiogram revealed grade - i diastolic dysfunction with mild left ventricular hypertrophy . because caregivers were not available , she could not be managed thoroughly on inpatient rehabilitation . her caregivers were also trained in applying superficial heat modalities and range of motion , stretching , and strengthening exercises . for analgesia , she was prescribed acetaminophen and meloxicam tablets and local application of flurbiprofen gel . a 48-year - old male presented to the outpatient department with a 15-year history of chronic pain in lower back and both knees . pain was nontraumatic , progressive , dull - aching in nature , and aggravated on exertion . he denied rash , fever , morning stiffness , sciatica , night pains , and other associated symptoms . he had been taking nonsteroidal anti - inflammatory drugs ( including ibuprofen , naproxen , diclofenac , and piroxicam ) and muscle relaxants for the last 10 years with temporary pain relief . his father had a similar problem with joint pains at a young age and died when he was 59 years old . the patient was a retired navy sailor and recalled that his knee and back pain made his job very difficult for him . he lived in a hilly area with his wife and four children . on physical examination , he was a middle - aged male , looking older than his chronological age . he disclosed that his height had been 165 cm at enrollment in navy 25 years back . the minimum standard for induction into pakistan navy is 162 cm , which confirmed that he actually lost his height in the last 15 years . 1a and b ) and grayish blue papules on the bilateral extensor surface of the second finger ( fig . his straight leg raise was 80 on both sides ( normal , 90 ) with mildly reduced spinal flexion . there was palpable crepitus in both knee joints with flexion reduced to 100 ( normal , 130 ) because of pain . the laboratory analysis , including a complete blood count , liver , and renal function tests were normal . x - rays of the cervical and lumbosacral spine showed advanced degenerative changes with intervertebral disk space narrowing and osteophyte formation ( figs . 2a x - rays of the knee joints showed reduced joint space and osteophyte formation with loose bodies , suggestive of osteoarthritis knees ( figs . based on history , physical examination , and investigations , a provisional diagnosis of ochronotic arthropathy was made . when the patient s urine sample was allowed to stand his family screening was initiated and two of his children were found to be positive . home - based stretching and strengthening exercises were taught , and he was provided with a walking stick to aid in his gait and offload the arthritic joint . he was prescribed acetaminophen for his pain along with 1 g of ascorbic acid ( vitamin c ) daily and advised to continue medication for hypertension and hyperlipidemia . he is doing well with the treatment and is living with his disease with regular follow - up at the outpatient rehabilitation and cardiac departments . he has been briefed about the option of joint replacements of the large weight - bearing joints , if the condition becomes worse or unbearable . a 60-year - old female presented with insidious onset of a chronic , dull , aching pain in both knees and dorsal spine for the past 15 years . she had a fall one year before , which resulted in spinal cord compression and incomplete thoracic paraparesis . she had a gradual , but partial recovery in legs , following open discectomy and laminectomy . she had diabetes and hypertension for the past two years but was not taking regular medications . twenty years ago , she had noticed gradual grayish - blue discoloration of her nose , index fingers , palms , and thumbs . she was unable to get an explanation for her problem , because there was no physician in her remote rural area . , she was an old woman , lying in bed with flexion contractures at both knees . she had grayish - blue patches over her nose , proximal palms , index fingers , thumbs , dorsal foot , and macules in sclera and over face , ears , and knees ( figs . she had a normal tone and power in upper limbs with grade 1 + spasticity ( modified ashworth scale ) in both legs . muscle stretch reflexes were grade 3 + in legs , while the plantar reflex was down going . her urine turned dark , when kept in the open for 24 hours ( fig . the x - rays of her dorso - lumbosacral spine showed reduced intervertebral disk spaces consistent with age and calcification of the intervertebral disks , which were more prominent in the lumbosacral region . the postsurgical magnetic resonance imaging revealed anterior wedging with partial fusion of t10 and t11 vertebrae , postsurgical architectural distortion , and loss of posterior elements , seen also at that level . her hemoglobin value was low ( 8.7 g / dl , normal > 12 g / dl ) , while total leukocyte count , platelet count , liver and renal function tests , plasma glucose profile , and electrocardiogram results were normal . the two - dimensional echocardiogram revealed grade - i diastolic dysfunction with mild left ventricular hypertrophy . because caregivers were not available , she could not be managed thoroughly on inpatient rehabilitation . her caregivers were also trained in applying superficial heat modalities and range of motion , stretching , and strengthening exercises . for analgesia , she was prescribed acetaminophen and meloxicam tablets and local application of flurbiprofen gel . a total of 950 patients of alkaptonuria have been identified worldwide , including four cases from pakistan.5 in a hospital - based study from pakistan , out of 2000 children under two years screened for inborn errors of metabolism , only one case of alkaptonuria was detected.6 five cases of ochronosis from pakistan have been documented in the literature . all except one were adults ( 2655 years ) , who presented with joints and back pain.711 all of these cases , similar to our cases , were prescribed high - dose ascorbic acid ( vitamin c ) , although there is not much evidence to support its use in ochronosis . these vitamins mostly serve as placebo rather than actually altering the course of the disease . musculoskeletal manifestations in ochronosis usually become apparent in the third or fourth decade , starting with the axial spine followed by the involvement of weight - bearing large joints.12 small joint involvement of hands and feet is uncommon . symptoms initially present as low back pain , stiffness , and limitation of range of motion that gradually ascends involving the thoracic spine and chest , occasionally leading to decreased chest expansion.13 osteoarthritis is common among patients with ochronosis , but pathological fractures are rare . , there is an acute onset of sharp pain due to rupture of nucleus pulposus , and this may be the initial presentation of the disease especially in males . the probable cause of the late onset of musculoskeletal complaints is the progressive inability of kidneys to excrete homogentisic acid . with age , the high tissue turnover and a gradual decline in renal functions cause homogentisic acid accumulation in the body and symptoms manifest . ochronosis usually leads to osteoarthritic - type changes , but in few cases it can manifest as inflammatory changes in the joints as well . the weakened architectural structure of the soft tissues leads to tendonitis and occasionally causes tendon rupture at these sites.1 aortic valve stenosis and calcifications have been observed in patients with ochronosis,14 and pericardial calcifications have been reported.15 cholelithiasis , renal calculi , and prostatic calculi also occur in the course of disease in some patients . osteoporosis occurs in patients with ochronosis leading to the loss of bone architecture and increased risk of fractures.16 the x - ray findings of the axial skeleton are similar to those of degenerative arthritis and ankylosing spondylitis ( as ) and hence must be differentiated from the two . they include diffuse narrowing , osteophyte formation , wafer - like calcification of intervertebral disks , vacuum phenomenon , and osteoporosis.5 x - rays of peripheral large joints show changes of osteoarthritis , including decreased joint space , marginal sclerosis , and osteophyte formation . calcification of intervertebral disks due to calcium hydroxyapatite and marked sclerosis including sis can also be observed . apart from history and age of presentation , ochronosis can be differentiated from as in that it does not have annular sclerosis and si erosions are usually absent . the si joints can have narrowing and marked sclerosis in ochronosis.17 other differential diagnoses include rheumatoid arthritis , hyperparathyroidism , amyloidosis , and diffuse idiopathic skeletal hyperostosis . the most common ocular findings in ochronosis include symmetric brown sclera pigmentation , oil drops ( brown pigment spots in the limbus ) , conjunctival pigmentation , conjunctival vessels with increased diameter , and chamber angle pigmentation.18 the simplest diagnostic tests are observation of urine for discoloration , silver nitrate test , and urine test for the presence of homogentisic acid . . a few drops of 10% ammonia are added to a fresh sample of urine followed by the addition of 3% silver nitrate solution . the development of greenish - black color indicates the presence of a substantial amount of homogentisic acid.19 the management options in ochronosis are many , but they have not proven to be of much benefit . these include high - dose ascorbic acid , low protein diet , and physiotherapy.20 another possible management option is , nitisinone , a drug that inhibits 4-hydroxyphenylpyruvate , which is an enzyme involved in the conversion of hydroxyphenylpyruvate to homogentisic acid.21 currently , the us food and drug administration has approved it only for the treatment of hereditary tyrosinemia type i , and there are concerns about the side effects . these side effects can be ameliorated by reducing dietary intake of tyrosine patients with ochronosis have a normal life expectancy , despite the debilitating arthritis that may lead to a poor quality of life . ochronosis is rare , but it should be kept in mind as a differential diagnosis to other spondyloarthropathies including as . these and similar case reports highlight the aspects of management of rheumatologic disorders in low - resourced countries with inadequate health care systems . both cases reported here had symptoms for more than a decade but could not get a clear - cut diagnosis . even when the diagnosis was made , one of them had no resources to continue treatment , left in the middle , and was lost to follow - up . the health care systems in developing countries mostly focus on the prevention and management of communicable diseases . musculoskeletal disorders , although common , are not a priority , and complaints related to the musculoskeletal system can be ignored or can not be investigated . this is further complicated by the strong presence of a parallel traditional health care system and untrained quacks posing as health care professionals who can be readily accessed and start their treatment for pain relief . there is a need for developing better health care systems in the low - resourced countries and improve the management of musculoskeletal disorders . no specific treatment is available , but early diagnosis , regular follow - up , and conservative management can improve the quality of life .
key language abilities , such as perception and production , are governed by multiple regions in the brain . these abilities can quickly become jeopardized in people with brain tumors , epilepsy , or other structural abnormalities . many of these patients require resection of pathological tissue near eloquent language areas to prolong or improve quality of life . thus , functional language mapping for precise localization of eloquent language areas is necessary for achieving optimal surgical outcomes in such patients . functional language mapping for perioperative planning in individual patients is of utmost importance given the high variability in structural anatomy and function across individuals . most typically , language mapping is achieved using electrical cortical stimulation ( ecs ) mapping . while ecs is widely considered the gold standard , , it does have noteworthy limitations . second , ecs increases the risk of after - discharges or seizures that result from active stimulation of the cortex using electrical impulses . finally , ecs can be difficult to accomplish in the subset of pediatric patients and patients with psychiatric and cognitive comorbidities . these issues have prompted recent and increasingly encouraging investigations suggesting that passive methodologies , such as electrocorticography ( ecog ) or functional magnetic resonance imaging ( fmri ) , may prove useful for functional mapping and may have distinct advantages in efficiency , morbidity , or the range of patients that can benefit from it , , , , , , , , . unfortunately , traditional mapping of expressive language function with any of these existing techniques carries the additional requirement that patients actually speak , i.e. , fully participate in specific tasks such as verb generation , object naming , or counting . this requirement currently precludes the use of these techniques in many patients , such as those with aphasia or cognitive deficits or very young patients . together , these limitations and requirements preclude or greatly impede functional mapping of expressive language areas in certain clinical circumstances ( such as during awake craniotomies ) or with certain populations ( such as pediatric patients ) . hence , it is desirable to have access to a technique that does not electrically stimulate the brain and that eliminates or reduces the requirement for patient participation . such a technique may eventually reduce ecs mapping time by guiding the clinician with a preliminary map of eloquent expressive language cortex . this would not only diminish the risks of patient morbidity , discomfort , and iatrogenic seizures but would also increase the number of patients who could be eligible for functional mapping of expressive language areas . identification of eloquent expressive language cortex without requiring the patient to speak is supported by several findings . previous fmri studies reported activations of the left , and bilateral , , , inferior frontal gyri while subjects listened to speech stimuli but did not perform any overt speaking task . in addition , suarez et al . demonstrated using fmri that a passive listening task recruited similar cortical areas as a verb generation task in a cohort of 15 pediatric patients . however , fmri is still expensive and requires substantial expertise that is not available in all centers , and its reliability in the context of functional mapping is still uncertain , . electrocorticographic recordings also provide opportunities for functional mapping in the context of mapping of motor , , , , or language , function , in pediatric patients , and in the operating room , . together , these studies demonstrated that ecog - based mapping can be achieved in real time ( i.e. , while signals are being recorded ) , does not require expertise in signal analysis , and can produce clinically useful results that can readily be compared with ecs results in a few minutes . however , evidence for its utility in identifying expressive language without subject participation was lacking . indeed , only two previous neuroscientific ecog studies reported activations in the inferior frontal cortex during a passive listening task , , but they did not determine whether these activations could be identified using a common analysis approach , establish the concordance between locations resulting from ecog- and ecs - based mapping , or discuss the feasibility of such passive mapping ecog protocol in the context of presurgical or intraoperative mapping . all three subjects were patients at albany medical center ( albany , new york ) . subject a was diagnosed with a low - grade glioma in the left frontal lobe after presenting with new - onset seizures . all subjects underwent temporary placement of subdural electrode grids to localize seizure foci and eloquent cortex prior to surgical resection . the electrode grids were approved for human use ( ad - tech medical corp . , racine , wi and pmt corp . , chanhassen , mn ) and covered different areas within frontal , temporal , and parietal lobes of the left hemisphere . most importantly , all three subjects had coverage of frontal lobe language areas , and two of the three ( subjects b and c ) also had coverage of temporal lobe language areas . electrodes consisted of platinum iridium discs ( 4 mm in diameter , 2.33 mm exposed ) , were embedded in silicone , and were spaced 610 mm apart . the total number of implanted electrodes was 61 , 98 , and 134 in subjects a c , respectively . following subdural grid implantation , each subject had postoperative anterior posterior and lateral radiographs , as well as computer tomography ( ct ) scans to verify grid location . preoperative language lateralization ( ll ) had been assessed previously with fmri in subject a and with wada testing in subjects b and c. based on these evaluations , language was lateralized to the left hemisphere in all three subjects . all subjects signed informed consent to participate in the study , which was approved by the institutional review board of albany medical college and the human research protections office of the us army medical research and materiel command . once subjects recovered postoperatively , we recorded ecog signals at the bedside using general - purpose bci2000 software , , which controlled eight 16-channel g.usbamp biosignal acquisition devices ( g.tec , graz , austria ) . to ensure integrity of clinical data collection , a connector split the electrode cables into two separate sets one set was connected to the clinical monitoring system , and another set was connected to the g.usbamp acquisition devices . the ecog signals were amplified , digitized at 1200 hz , and stored by bci2000 . we used electrode contacts distant from epileptogenic foci and areas of interest for reference and ground . we created 3d cortical brain models for each subject by submitting preoperative high - resolution magnetic resonance imaging ( mri ) scans to freesurfer software ( http://surfer.nmr.mgh.harvard.edu/ ) . we coregistered mri scans with postoperative ct images using spm software ( http://www.fil.ion.ucl.ac.uk/spm/ ) and identified the stereotactic coordinates of each grid electrode using custom matlab scripts ( the mathworks inc . , natick , ma ) . finally , we visualized the cortical surface of each subject and ecog grid locations using neuralact software . in our study , we asked the subjects to listen to four short stories narrated by a male voice ( stimulus duration : 17.1535.70 s ; interstimulus interval ( isi ) of 10 s ) which were part of the boston aphasia battery . the stimuli were digitized at 44.1 khz in waveform audio file format and binaurally presented to each subject using in - ear monitoring earphones ( 12 to 23.5 khz audio bandwidth , 20 db isolation from environmental noise ) . the subjects did not perform any overt task ( such as repeating words and generating verbs in response to the words they heard ) . we identified ecog activations by detecting task - related changes in the broadband gamma ( 70170 hz ) band . activity in this band has been shown to be related to the average firing rate of neuronal populations directly underneath an electrode , , . a large number of studies have shown that broadband gamma activity increases reliably in task - related cortical areas , , including locations traditionally thought to be active during speech perception , , . to identify those locations that responded to auditory stimulation , we first removed channels that did not contain clear ecog signals ( e.g. , ground / reference channels , channels with broken connections , or channels corrupted by environmental artifacts or interictal activity ) . of a total of 61 , 98 , and 134 channels , this left 59 , 79 , and 132 channels for subjects a c , respectively , which we submitted to subsequent analyses . in these analyses , we high - pass filtered the signals at 0.1 hz to remove drifts and re - referenced the signals to a common average reference ( car ) montage . we band - pass filtered the results in the broadband gamma band using a butterworth filter of order 16 . we then obtained the power of these signals by computing the square of the analytical signal of the hilbert transform , followed by a low - pass filter at 4 hz and down - sampling to 120 hz . finally , we normalized the resulting broadband gamma power estimates by subtracting from them the signal mean calculated from a baseline period ( 6 to 0.5 s prior to the onset of the auditory stimulus ) and by dividing them by the standard deviation of the signal during the baseline period . we determined those locations whose ecog broadband gamma activity following onset of the auditory stimulus ( i.e. , the response period ) was different from that during the baseline period . several studies have shown that , in receptive auditory areas , broadband gamma activity reliably tracks the time course of the envelope of the intensity of the auditory stimulus , or speech stimulus . a few isolated reports documented discrete and brief broadband gamma activations in inferior frontal cortex after the onset of an auditory speech stimulus , that occurred after the activations in receptive auditory areas . based on these reports , we defined the response period as 250750 ms following the onset of the auditory stimulus . then , for each location , we determined the magnitude of the change in ecog broadband gamma power that was related to auditory stimulation by calculating the coefficient of determination ( pearson 's r value ) . finally , we determined the statistical significance of each r value , i.e. , the probability that ecog broadband gamma samples differed in amplitude between the response and baseline periods , using a permutation test . in this test , we cut the ecog broadband gamma power time courses into blocks of 500 ms ( thereby preserving the autocorrelation of the signal ) , randomly permutated the resulting blocks , and finally calculated the corresponding random r value . we repeated the permutation step 1000 times , thus generating a distribution of 1000 random r values at each location . we considered r values to be significant at the 95th percentile of that distribution ( p = 0.05 , bonferroni - corrected for the total number of electrodes in each subject ) . the result of this procedure was a set of locations whose ecog broadband gamma activity was significantly different between the baseline and the response periods and , hence , responded to the speech stimuli . among the resulting locations , we identified those that were situated within inferior frontal cortex . this included all electrodes whose talairach coordinate was within x 28 to 55 , y 8 to + 34 , and z 0 to 28 , consistent with previous observations . the subjects took part in two simple tasks commonly used for this purpose : a picture - naming task , during which subjects were asked to verbally name sequentially presented pictures of simple objects and a verb generation task , during which subjects had to verbally generate verbs associated with simple nouns presented auditorily . different electrode pairs were stimulated to establish whether a given pair induced a disruption of expressive language function , e.g. , speech arrest or hesitation . stimulation intensity typically started at 2 ma and was increased in incremental steps of 2 ma until the neurologist observed clinical effects or after - discharges or reached the 10 ma threshold . all three subjects were patients at albany medical center ( albany , new york ) . subject a was diagnosed with a low - grade glioma in the left frontal lobe after presenting with new - onset seizures . all subjects underwent temporary placement of subdural electrode grids to localize seizure foci and eloquent cortex prior to surgical resection . the electrode grids were approved for human use ( ad - tech medical corp . , racine , wi and pmt corp . , chanhassen , mn ) and covered different areas within frontal , temporal , and parietal lobes of the left hemisphere . most importantly , all three subjects had coverage of frontal lobe language areas , and two of the three ( subjects b and c ) also had coverage of temporal lobe language areas . electrodes consisted of platinum iridium discs ( 4 mm in diameter , 2.33 mm exposed ) , were embedded in silicone , and were spaced 610 mm apart . the total number of implanted electrodes was 61 , 98 , and 134 in subjects a c , respectively . following subdural grid implantation , each subject had postoperative anterior posterior and lateral radiographs , as well as computer tomography ( ct ) scans to verify grid location . preoperative language lateralization ( ll ) had been assessed previously with fmri in subject a and with wada testing in subjects b and c. based on these evaluations , language was lateralized to the left hemisphere in all three subjects . all subjects signed informed consent to participate in the study , which was approved by the institutional review board of albany medical college and the human research protections office of the us army medical research and materiel command . once subjects recovered postoperatively , we recorded ecog signals at the bedside using general - purpose bci2000 software , , which controlled eight 16-channel g.usbamp biosignal acquisition devices ( g.tec , graz , austria ) . to ensure integrity of clinical data collection , a connector split the electrode cables into two separate sets . one set was connected to the clinical monitoring system , and another set was connected to the g.usbamp acquisition devices . the ecog signals were amplified , digitized at 1200 hz , and stored by bci2000 . we used electrode contacts distant from epileptogenic foci and areas of interest for reference and ground . we created 3d cortical brain models for each subject by submitting preoperative high - resolution magnetic resonance imaging ( mri ) scans to freesurfer software ( http://surfer.nmr.mgh.harvard.edu/ ) . we coregistered mri scans with postoperative ct images using spm software ( http://www.fil.ion.ucl.ac.uk/spm/ ) and identified the stereotactic coordinates of each grid electrode using custom matlab scripts ( the mathworks inc . , finally , we visualized the cortical surface of each subject and ecog grid locations using neuralact software . in our study , we asked the subjects to listen to four short stories narrated by a male voice ( stimulus duration : 17.1535.70 s ; interstimulus interval ( isi ) of 10 s ) which were part of the boston aphasia battery . the stimuli were digitized at 44.1 khz in waveform audio file format and binaurally presented to each subject using in - ear monitoring earphones ( 12 to 23.5 khz audio bandwidth , 20 db isolation from environmental noise ) . the subjects did not perform any overt task ( such as repeating words and generating verbs in response to the words they heard ) . we identified ecog activations by detecting task - related changes in the broadband gamma ( 70170 hz ) band . activity in this band has been shown to be related to the average firing rate of neuronal populations directly underneath an electrode , , . a large number of studies have shown that broadband gamma activity increases reliably in task - related cortical areas , , including locations traditionally thought to be active during speech perception , , . to identify those locations that responded to auditory stimulation , we first removed channels that did not contain clear ecog signals ( e.g. , ground / reference channels , channels with broken connections , or channels corrupted by environmental artifacts or interictal activity ) . of a total of 61 , 98 , and 134 channels , this left 59 , 79 , and 132 channels for subjects a c , respectively , which we submitted to subsequent analyses . in these analyses , we high - pass filtered the signals at 0.1 hz to remove drifts and re - referenced the signals to a common average reference ( car ) montage . we band - pass filtered the results in the broadband gamma band using a butterworth filter of order 16 . we then obtained the power of these signals by computing the square of the analytical signal of the hilbert transform , followed by a low - pass filter at 4 hz and down - sampling to 120 hz . finally , we normalized the resulting broadband gamma power estimates by subtracting from them the signal mean calculated from a baseline period ( 6 to 0.5 s prior to the onset of the auditory stimulus ) and by dividing them by the standard deviation of the signal during the baseline period . we determined those locations whose ecog broadband gamma activity following onset of the auditory stimulus ( i.e. , the response period ) was different from that during the baseline period . several studies have shown that , in receptive auditory areas , broadband gamma activity reliably tracks the time course of the envelope of the intensity of the auditory stimulus , or speech stimulus . a few isolated reports documented discrete and brief broadband gamma activations in inferior frontal cortex after the onset of an auditory speech stimulus , that occurred after the activations in receptive auditory areas . based on these reports , we defined the response period as 250750 ms following the onset of the auditory stimulus . then , for each location , we determined the magnitude of the change in ecog broadband gamma power that was related to auditory stimulation by calculating the coefficient of determination ( pearson 's r value ) . finally , we determined the statistical significance of each r value , i.e. , the probability that ecog broadband gamma samples differed in amplitude between the response and baseline periods , using a permutation test . in this test , we cut the ecog broadband gamma power time courses into blocks of 500 ms ( thereby preserving the autocorrelation of the signal ) , randomly permutated the resulting blocks , and finally calculated the corresponding random r value . we repeated the permutation step 1000 times , thus generating a distribution of 1000 random r values at each location . we considered r values to be significant at the 95th percentile of that distribution ( p = 0.05 , bonferroni - corrected for the total number of electrodes in each subject ) . the result of this procedure was a set of locations whose ecog broadband gamma activity was significantly different between the baseline and the response periods and , hence , responded to the speech stimuli . among the resulting locations , we identified those that were situated within inferior frontal cortex . this included all electrodes whose talairach coordinate was within x 28 to 55 , y 8 to + 34 , and z 0 to 28 , consistent with previous observations . the subjects took part in two simple tasks commonly used for this purpose : a picture - naming task , during which subjects were asked to verbally name sequentially presented pictures of simple objects and a verb generation task , during which subjects had to verbally generate verbs associated with simple nouns presented auditorily . different electrode pairs were stimulated to establish whether a given pair induced a disruption of expressive language function , e.g. , speech arrest or hesitation . stimulation intensity typically started at 2 ma and was increased in incremental steps of 2 ma until the neurologist observed clinical effects or after - discharges or reached the 10 ma threshold . 1 . this figure highlights those locations that were identified by our analyses of the ecog signals corresponding to the presentation of the speech stimuli ( filled circles ) and locations that produced arrest of expressive language function using ecs mapping ( yellow circles ) . locations identified by ecog mapping included the expected locations ( highlighted by gray - filled circles ) in superior temporal gyrus and/or perisylvian areas ( all subjects ) as well as in premotor and/or supplementary motor areas ( subjects a and c ) . consistent with previous observations ( see fig . 8 in ) , our method also identified responsive locations on or close to superior precentral gyrus ( patient c ) . most relevant in the context of the present study , our ecog - based mapping identified locations ( highlighted by blue - filled circles ) in inferior frontal cortex ( pars triangularis and/or pars opercularis ) in all three subjects . 1c also presents exemplary time courses of ecog broadband gamma activity in patient c. electrical cortical stimulation mapping identified 12 locations in which stimulation produced expressive language arrest in each subject ( yellow circles ) . the ecs - positive sites overlapped with the sites identified using ecog or were located no more than one contact away . in our study of three patients with chronically implanted subdural electrode grids , we provide initial evidence that it is possible to use passively recorded ecog in response to presentation of speech stimuli to identify not only locations in the receptive language network that are located primarily in the temporal lobe but also locations within the expressive language network in the inferior frontal cortex . with further refinement of the protocol and validation in more subjects , the passive mapping approach described here could lead to a mapping method that may have important clinical implications . the ability to map expressive language cortex with greatly reduced needs for patient participation expands the utility of functional language mapping . specifically , it enables functional mapping of expressive language in patients who are unable to cooperate productively such as pediatric populations or patients suffering from aphasia or psychiatric and cognitive comorbidities . we envision passive language mapping using ecog to either complement existing ecs or fmri mapping protocols or provide an alternative when other expressive language mapping techniques are inadequate . the ecog passive mapping may also have distinct advantages in the time - limited settings of the intraoperative environment . a preliminary map of eloquent expressive language cortex could inform ecs mapping , likely resulting in reduced ecs mapping time and thereby diminishing the risks of patient morbidity , discomfort , and iatrogenic seizures . recent studies already demonstrated the feasibility of intraoperative real - time mapping of motor , and language , , mapping using acutely placed subdural grids . one important general question that remains to be answered is the reason for the variable congruency between ecs and passive ecog in the context of language mapping . using traditional ecog - based mapping tasks ( such as verb generation , picture naming , and passive listening ) , previously reported concordance rates between ecog and ecs range from 38%89% in sensitivity and from 48%92% in specificity , , , . other potential explanations for the discrepancies between ecs and ecog involve the statistical issues that necessarily result from the comparison of the single - electrode ecog method with the pair - wise ecs method , and the fundamental difference between a lesion - based model approach versus a task - based physiologic approach , : while ecog should identify all locations at which neuronal populations subserve the specific function , ecs will only identify the ( potentially small ) subset of those locations that completely disrupt function . thus , ecog can be expected to define a larger area for preservation and underestimate the margin for safe resection . in this context , it is worth noting that patients have been reported to have postoperative language deficits after resection of an ecog(+)/ecs( ) node , , , , , . in a study of 77 patients , postoperative language deficits could be predicted by the number of ecog(+ ) language nodes resected . at present , most resections are based primarily on ecs results even though ecs has never been validated in randomized , clinical trials . this reality implies that , with continued refinement and validation , the ecog method may play an even larger role in presurgical functional mapping in the future . at the same time , without additional information , we currently do not suggest replacing exhaustive ecs mapping but rather argue that ecog - based mapping provides useful and complementary information . another critical question raised by the present study is to what extent the encouraging results presented here generalize to a larger number of patients . for two reasons , we are optimistic that the results in a larger number of patients will echo the initial results reported here . first , several groups have reported activation of the inferior frontal gyrus in response to presentation of passive speech stimuli , , , , , . mazoyer et al . first demonstrated activation of the left inferior frontal gyrus on positron emission tomography ( pet ) scans in 16 subjects while listening to lists of words and stories . several fmri , , , , and ecog , studies have replicated these results using similar tasks . furthermore , it is well known that the blood - oxygen level - dependent ( bold ) signal changes detected using fmri correlate very well with the broadband gamma increases in ecog , , , , , , , which are the basis of ecog - based functional mapping . second , recent evidence indicates that ecog - based mapping can identify locations in expressive language areas when sites in receptive language areas are stimulated using electrical stimulation ( corticocortical evoked potentials ( cceps ) ) , , , . for example , matsumoto et al . described the technique of delivering a single pulse electrical stimulation in the inferior frontal language area and recording a cortical evoked potential in the temporal parietal area , establishing structural neuronal connectivity between the two functional regions . in a smaller subset of patients , they were able to elicit cceps in the inferior frontal and basal temporal regions with stimulation of the temporo parietal language area . this bidirectional connectivity is likely mediated at least in part by the arcuate fasciculus , although the anatomical distribution of the arcuate fasciculus may be more complex than historically assumed , , , . more generally , the language network connectivity model appears to be much more complex than initially believed , with an interplay of numerous cortical regions and white matter tracts , , , . while our initial results are encouraging , different circumstances could temper the significant positive implications of expressive language mapping using passive stimuli . when applied in intraoperative scenarios , different surgical realities ( such as intermittent irrigation on the subdural grid , cable adjustment , variable clinical or cognitive status of the patient ) may lead to lower signal - to - noise ratio and a resultant decrease in ability to detect task - related ecog changes . the duration of mapping may be increased if the grid requires repositioning with reinitiation of tasks . furthermore , it is possible that passive engagement of expressive language function may not elucidate the whole expressive language network . finally , the current study is only reporting results for 3 subjects . further investigation in a larger number of patients is required to assess the potential benefit of our findings to resective neurosurgical planning . furthermore , while our method successfully identified expressive language sites in a patient diagnosed with a left frontal tumor in close proximity to broca 's area ( subject a ) , it is not possible to predict how our method would generalize to patient populations with different types of distorting pathologies . it would also be valuable to determine if our method can identify eloquent expressive language cortex in patients with aphasia . one important general question that remains to be answered is the reason for the variable congruency between ecs and passive ecog in the context of language mapping . using traditional ecog - based mapping tasks ( such as verb generation , picture naming , and passive listening ) , previously reported concordance rates between ecog and ecs range from 38%89% in sensitivity and from 48%92% in specificity , , , . other potential explanations for the discrepancies between ecs and ecog involve the statistical issues that necessarily result from the comparison of the single - electrode ecog method with the pair - wise ecs method , and the fundamental difference between a lesion - based model approach versus a task - based physiologic approach , : while ecog should identify all locations at which neuronal populations subserve the specific function , ecs will only identify the ( potentially small ) subset of those locations that completely disrupt function . thus , ecog can be expected to define a larger area for preservation and underestimate the margin for safe resection . in this context , it is worth noting that patients have been reported to have postoperative language deficits after resection of an ecog(+)/ecs( ) node , , , , , . in a study of 77 patients , postoperative language deficits could be predicted by the number of ecog(+ ) language nodes resected . at present , most resections are based primarily on ecs results even though ecs has never been validated in randomized , clinical trials . this reality implies that , with continued refinement and validation , the ecog method may play an even larger role in presurgical functional mapping in the future . at the same time , without additional information , we currently do not suggest replacing exhaustive ecs mapping but rather argue that ecog - based mapping provides useful and complementary information . another critical question raised by the present study is to what extent the encouraging results presented here generalize to a larger number of patients . for two reasons , we are optimistic that the results in a larger number of patients will echo the initial results reported here . first , several groups have reported activation of the inferior frontal gyrus in response to presentation of passive speech stimuli , , , , , . mazoyer et al . first demonstrated activation of the left inferior frontal gyrus on positron emission tomography ( pet ) scans in 16 subjects while listening to lists of words and stories . several fmri , , , , and ecog , studies have replicated these results using similar tasks . furthermore , it is well known that the blood - oxygen level - dependent ( bold ) signal changes detected using fmri correlate very well with the broadband gamma increases in ecog , , , , , , , which are the basis of ecog - based functional mapping . second , recent evidence indicates that ecog - based mapping can identify locations in expressive language areas when sites in receptive language areas are stimulated using electrical stimulation ( corticocortical evoked potentials ( cceps ) ) , , , . for example , matsumoto et al . described the technique of delivering a single pulse electrical stimulation in the inferior frontal language area and recording a cortical evoked potential in the temporal parietal area , establishing structural neuronal connectivity between the two functional regions . in a smaller subset of patients , they were able to elicit cceps in the inferior frontal and basal temporal regions with stimulation of the temporo this bidirectional connectivity is likely mediated at least in part by the arcuate fasciculus , although the anatomical distribution of the arcuate fasciculus may be more complex than historically assumed , , , . more generally , the language network connectivity model appears to be much more complex than initially believed , with an interplay of numerous cortical regions and white matter tracts , , , . while our initial results are encouraging , different circumstances could temper the significant positive implications of expressive language mapping using passive stimuli . when applied in intraoperative scenarios , different surgical realities ( such as intermittent irrigation on the subdural grid , cable adjustment , variable clinical or cognitive status of the patient ) may lead to lower signal - to - noise ratio and a resultant decrease in ability to detect task - related ecog changes . the duration of mapping may be increased if the grid requires repositioning with reinitiation of tasks . furthermore , it is possible that passive engagement of expressive language function may not elucidate the whole expressive language network . finally , the current study is only reporting results for 3 subjects . further investigation in a larger number of patients is required to assess the potential benefit of our findings to resective neurosurgical planning . furthermore , while our method successfully identified expressive language sites in a patient diagnosed with a left frontal tumor in close proximity to broca 's area ( subject a ) , it is not possible to predict how our method would generalize to patient populations with different types of distorting pathologies . it would also be valuable to determine if our method can identify eloquent expressive language cortex in patients with aphasia . in this paper , we report initial results of an approach to functional mapping of expressive language function that could greatly reduce the need for subject participation . with further refinement and validation , the approach described here may lead to a simple , easy - to - use protocol that would simultaneously identify receptive and expressive language areas for surgical planning . this protocol would be widely applicable in a significantly greater number of patients . finally , because our approach does not require the patient to speak , it opens up the possibility for applying it to patients under general anesthesia . thus , this approach has the potential to completely revolutionize functional language mapping in neurosurgery ; the initial results presented here clearly encourage further investigation . the authors report no conflict of interest concerning the materials or methods used in this study or the findings specified in this paper .
chronic granulomatous disease is a hereditarily determined illness , characterized by inability of the body 's phagocytic cells to destroy certain microorganisms . as a consequence , patients with cgd have an increased susceptibility to infections caused by certain bacteria and fungi ( frequently staphylococcus aureus , and aspergillus species , respectively ) . this insufficiency in microbial killing is usually caused by a defect in the nicotinamide adenine dinucleotide phosphate ( nadph ) oxidase enzyme complex . nadph is the enzyme that generates the microbicidal respiratory burst [ 2 , 3 ] . the deficiencies of oxidative metabolism are usually detected with either the nitroblue tetrazolium ( nbt ) dye test or the dihydrorhodamine ( dhr ) oxidation test . these tests are based on the ability of products of oxidative metabolism to alter the oxidation states of reporter molecules so that they can be detected microscopically ( in the case of nbt ) or by flow cytometry ( in the case of dhr ) . however , nbt test , although more conventionally used , is sometimes not sufficiently sensitive . therefore , many investigators have preferred the use of the dhr test . in cgd , phagocytes manage to ingest bacteria normally ; however they can not destroy them . patients usually have an elevated incidence of mucosal inflammatory disorders such as colitis , enteritis , and gastric outlet obstruction . cgd is an extremely rare disease that occurs in about 1 in every quarter of a million live births . a libyan boy first presented to the pediatrics department of tripoli medical centre ( libya ) when he was 3 months old suffering from loose stool with streaks of blood . he also had frequent episodes of fever at first presentation to the hospital ; later , he developed persistent cervical lymphadenitis and failed to gain weight . the boy is the 3rd child ( of 4 children ) from related libyan parents . he was born in the 35th week of gestation with a birth weight of 2400 grams . the first child of the family ( a girl ) had a similar medical history , with persisting pneumonia , suspected tuberculosis , and anemia . however , his younger sister was found to be a carrier of the disease ; but otherwise healthy and has no significant susceptibility to infections up to the present date . the patient presented to the university children 's hospital of bonn ( germany ) at the age of 10 months ; and because of a positive tuberculin skin test and previous history of bcg vaccination , an infection with bcg was suspected . the patient was later transferred to charite children 's hospital of berlin to continue his treatment , and further investigations were carried out . a lymph node of the left axilla was surgically removed , and a culture from the biopsy grew bacteria . these findings have lead to a suspicion of a primary immune deficiency disorder . at the age of 12 months , he again showed recurrent episodes of pneumonia , diarrhea and enlargement of lymph nodes . a few months later , following an immunological profile for his case , a negative nbt and dhr assay was detected . the final diagnosis of chronic granulomatous disease was confirmed by molecular analysis , which revealed a defect in the p22-phox component of the cyba gene . the results of his investigations were as follows : stool analysis revealed the presence of clostridium difficile ; however , no parasites were found . the excised cervical lymph nodes ( ln ) yielded the growth of enterococcus faecalis and klebsiella pneumoniae on culture . there was no growth of mycobacteria on culture of fluids from the bronchial lavage performed . gastroduodenoscopy and coloscopy showed redness and swelling of the mucous membrane of the stomach and the colon , respectively . serum antibody levels were as follows : igg 1697 mg / dl , iga 161 mg / dl , igm 100 mg / dl . indicating that humoral immunity of the patient was functioning normally . normal values were detected for sodium , potassium , calcium , chloride , creatinine , transaminases , ldh and alkaline phosphatase . ultrasound imaging ( usi ) showed enlarged cervical ln ( maximum diameter 22 mm ) , and slightly enlarged mesenteric ln ( 11 mm ) . furthermore , the liver was moderately enlarged ( figure 1 ) . ultrasound image showing a mild hepatomegaly . x - rays of the chest showed that the left diaphragm was lower than the right , and the left lung was smaller than the right , with central infiltrates on both sides . a high - resolution computed tomography ( ct ) scan of the chest confirmed the x - ray readings and showed hypoplastic left lung with diffuse dystelectasis ; however , no other specific infiltrates were found ( figure 2 ) . high - resolution ct - scan showing a left hypoplastic lung . magnetic resonance imaging ( mri ) of the chest confirmed the usi findings and revealed multiple enlarged cervical ln , and one large mediastinal ln on the right side in addition to a nonspecific mass situated on the right paravertebral area at the level of chest vertebral body number 11 and 12 . positron emission tomography ( pet ) showed focally intense signals of the upper lobe of the right lung ( paravertebrally ) and in the glandula submandibularis ( cervical ln ) , and a less intense signal in the inferior lobe of the left lung ( figure 3 ) . pet image showing intense signals on the upper lobe of the right lung ( yellow arrow ) . pet - ct fusion technique which allows accurate correlation of great anatomic details ( from the ct scan ) and informative metabolic information ( from the pet scan ) was used , and it confirmed the ct scan findings ( figure 4 ) . genetic analysis of the patient 's nadph oxidase revealed a deletion of 7 base pairs ( bp ) in exon 5 on both alleles of the p22-phox gene . the bp deleted were from 323 to 329 ( the investigation was done in dresden , germany ) . pet - ct fusion scan showing the location of the focally intense signals from the upper lobe of the right lung paravertebrally , and the less intense signals from the left lung , indicating a hypoplastic left lung . , it is estimated that cgd affects approximately one infant per quarter of a million live births [ 6 , 8 ] . worldwide , however , the incidence of the disease varies among the populations studied , with variations from 1 case per 160 thousands individuals to 1 case per 1 million people . surprisingly , for libya , and after a thorough literature search , we confirm that this is the first reported case of cgd . four genes have been connected to cgddthe cybb gene , encoding the gp91-phox subunit ; the cyba gene , encoding for p22-phox ; the ncf1 gene , encoding p47-phox ; and the ncf2 gene which encodes for p67-phox . cgd is frequently inherited ( 60% of cases ) in an x - linked recessive manner where most patients are boys , who have hemizygous mutations on the x - linked gene coding for gp91-phox . however , among the other subtypes of cgd , the autosomal recessive forms ( 40% of cases ) may be associated with milder disease . the extent to which environmental factors and secondary genetic defects may influence the course of the disease a wide variety of molecular defects have been described in the genes for the gp91-phox component , the p22-phox component , and the p67-phox component . these defects include frame shifts ; deletions ; and nonsense , missense , spliceregion , and regulatory region mutations . the protien , p40-phox , has been involved in the regulation of the nadph oxidase , but no individual with a mutation in this protein has been found so far . a new variant of cgd has been described ; this form is caused by an inhibitory mutation in rac2 , which regulates activity of the neutrophil respiratory burst and actin assembly . mutations in the genes for p67-phox ( ncf2 ) and p22-phox ( cyba ) are usually the rarest , accounting for fewer than 10% of cases of cgd . morbidity due to infections remains significant , particularly in those with the x - linked type . currently , the yearly mortality rate is a little more than 1.5% per year for persons with autosomal recessive cgd and over 5% for those with x - linked cgd the long - term survival rates of patients who present with symptoms after the end of their first year of age is significantly better than that of patients whose illness starts in infancy . fortunately , since the introduction of prophylactic antibacterials and anti - fungals the prognosis for patients with cgd has greatly improved , with patients frequently living to see their 30th and 40th birthdays [ 12 , 13 ] . in our case and because of the detection of clostridium difficile in stool and enterococcus faecalis and klebsiella pneumoniae in the excised cervical lymph node the patient 's condition has improved greatly and the degree of inflammation ( as monitored by the level of crp and leukocyte count ) has decreased . although generally , the patient became better , nevertheless , fresh blood spots were still noticeable in stools . because nonspecific colitis was assumed to be associated with his condition , he was treated with oral prednisone at an initial dose of 1 mg / kg body weight ( bw ) however , the two anal fissures which were found on physical examination , might explain the fresh blood streaks of the stool in some of the instances . while in germany , the patient was vaccinated with pneumococcus vaccine and with the measles , mumps and rubella ( mmr ) a few months later . therefore , with the previous vaccines he took ( in libya ) his vaccination status is now considered complete . in view of the fact that patients with cgd usually have recurrent bactarial and fungal infections , which may lead to abscess formation in the skin , lymph nodes and viscera , our patient was put on a lifelong antibiotic ( cotrimoxazole , 5 mg tmp / kg bw ) and antimycotic ( itraconazole 10mg / kg bw ) prophylaxis plan . the last respiratory system examination revealed a clear chest with normally breathing lungs devoid of infections . his parents are pleased with the outcome of the treatment so far , and are constantly monitoring his condition with regular follow - up visits to the hospital . alternative methods of treating cgd include interferon - gamma injections , white blood cells ( wbc ) infusions , and bone marrow transfusion ( bmt ) . gammainterferon , although widely used in the usa , in europe it is usually preserved for the difficult and persistent infections . the route of administration ( an injection given twice weekly ) is also a drawback . transfusion of wbc from healthy donors is sometimes used but not preferred for its obvious side effects in the form of transfusion reactions that can occur especially after repeated transfusions . gene therapy is also an option for cgd cases , where patients own stem cells are removed and the defective genes replaced with normal genes before reinjecting them back to the patient . by presenting this typical case of cgd , the authors advise that primary immune deficiency diseases , particularly cgd , should be considered in cases of chronic unresponsive infections , especially in children . after confirming the diagnosis , all cases of cgd should be put on a life - long aggressive antibiotic and antifungal prophylaxis treatment ; and for infections , special antibiotic and antifungal therapy regimes should be started for periods up to 3 times longer than that for patients with other similar conditions . early detection and treatment of such congenital disorders will certainly decrease the many complications that may arise in the course of the disease . furthermore , cgd patients should have frequent and regular consultations with their health care providers , and have access to cgd resources for information in the form of booklets and websites dedicated to the disease .
dietary berries , a rich source of bioactive compounds , especially the polyphenols , have been associated with protective effects against chronic diseases , especially lowering risk factors of cardiovascular disease ( cvd ) [ 13 ] . oxidative stress is one of the major contributors to the pathophysiology of cvd and is triggered by many factors , such as obesity , elevated serum lipids , and low dietary and cellular antioxidant status [ 4 , 5 ] . the antioxidant system is a complex network of various biomolecules that individually and synergistically counteract free radicals and protect against oxidative damage . the antioxidant enzymes , such as catalase and the superoxide dismutase ( sod ) , serve as first line defenses against hydrogen peroxide and superoxide anions , respectively , while the glutathione enzyme system counteracts the peroxide molecules generated as by - products of dismutase activity , and from the oxidation of biomolecules that results in lipid peroxides . in addition to these antioxidant enzymes , dietary micronutrients , such as vitamins c and e , and trace elements , such as copper , iron , selenium and zinc , also play an important role in antioxidant and pro - oxidant activities . many polyphenol - containing foods and beverages , such as berries , cocoa , and green tea , as well as their extracts , have been reported to enhance the activities of antioxidant enzymes and to chelate metal ions , thereby improving oxidative stress [ 79 ] . however , few clinical studies have examined their effects in adults with cardiovascular risk factors , such as those with obesity , dyslipidemia , and the metabolic syndrome . among the popular sources of dietary berries , strawberries have been shown to alleviate cvd risk factors in clinical studies as well as in animal models of atherosclerosis . however , only a few studies have reported their effects on antioxidant biomarkers , especially on antioxidant enzyme functions such as catalase and the glutathione enzyme system . using an animal model of oxidative stress , pretreatment with strawberries was shown to attenuate the ethanol - induced decreases in catalase and sod activities in the gastric mucosa of rats . similar findings have been reported from other studies using green tea and fruit extracts [ 12 , 13 ] . clinical trials mostly in studies of short duration in healthy volunteers have shown the effects of different forms of dietary berries in increasing plasma antioxidant capacity and thiol groups , but no effects on glutathione enzymes . in a previously reported eight - week study of green tea supplementation in adults with the metabolic syndrome , we reported a significant increase in whole blood glutathione and a decrease in plasma iron as a result of green tea intervention . emerging research supports the role of berries , such as raspberries and raspberry seed oil , and native fruit extracts such as the grewia asiatica fruit in increasing the intracellular concentrations of glutathione and in modulating antioxidant enzyme activities in experimental models of oxidative stress and dyslipidemia [ 1618 ] . while these study findings are interesting , the practical relevance is limited based on the dosing , as well as the use of test agents that are part of complementary or folk medicine and not commonly consumed in the daily human diet . thus , there is a need to investigate the effects of berries on antioxidant biomarkers in clinical studies using achievable dietary doses . in a dose - response study , our group previously reported the effects of dietary freeze - dried strawberries in lowering total and ldl - cholesterol and lipid peroxidation in adults with abdominal obesity and elevated serum lipids . using stored samples from our previous study , we measured selected biomarkers of antioxidant status following low and high dose strawberry intervention . in the current report , we hypothesize that dietary strawberries will improve selected biomarkers of plasma antioxidant status , thus potentially benefitting cardiovascular health , in adults following a 12-week supplementation of two doses of freeze - dried strawberry beverages compared to the calorie and fiber - matched controls . thus , our specific study objectives were to examine the effects of strawberries on circulating antioxidant biomarkers using stored samples , specifically plasma antioxidant capacity , plasma catalase , glutathione peroxidase and glutathione reductase enzyme activities , whole blood glutathione concentrations , and plasma trace elements in obese adults with above normal serum lipids . briefly , this was a randomized controlled trial involving low and high doses of freeze - dried strawberries and corresponding calorie- and fiber - matched controls . the study was approved by the institutional review board at the university of oklahoma health sciences center and at oklahoma state university . the trial is registered with clinicaltrials.gov supported by the us national library of medicine at the national institutes of health ( https://clinicaltrials.gov/show/nct01883401 ) . inclusion and exclusion criteria have been described previously . men and women [ aged 49 10 y ( means sds ) ] with abdominal adiposity and elevated serum lipids and who were free of any chronic diseases were enrolled in this randomized controlled study . recruitment and study procedures were conducted at the clinical research center at the university of oklahoma health sciences center and at the nutritional sciences clinical assessment unit at oklahoma state university . table 1 describes the composition of the freeze - dried strawberry beverages and the fiber and calorie - matched control beverages used in the study . the freeze - dried strawberries were kindly donated by the california strawberry commission ( csc ) , and the mixture of strawberries used to generate the powder contained the university of california public cultivars as follows : camarosa ( 37% ) , ventana ( 13% ) , diamante ( 13% ) , and 2 proprietary varieties ( 37% ) in production in 2010 . participants were randomly assigned to consume one of the following four beverages for 12 wk : ( 1 ) low dose fds [ ld - fds ; 25 g reconstituted in 2 cups ( 474 ml ) of water ] ; ( 2 ) low dose calorie- and fiber - matched control [ ld - c ; 4 g of fiber and 5 teaspoons ( 20 g ) of cane sugar , blended in 2 cups ( 474 ml ) of water ] ; ( 3 ) high dose fds [ hd - fds ; 50 g reconstituted in 2 cups ( 474 ml ) of water ] ; or ( 4 ) high dose calorie- and fiber - matched control [ hd - c ; 8 g of fiber and 9 teaspoons ( 36 g ) of cane sugar , blended in 2 cups ( 474 ml ) of water ] . the fiber used in control beverages was composed of vegetable fibers and natural gums and contained both insoluble and soluble fiber ( 1 : 2 ) per serving ( fiberstir ) . in addition , the control beverages contained added red food color ( mccormick & company , baltimore md ) and artificial strawberry - flavored kool - aid ( kraft foods , pittsburgh pa ) to mimic the color and flavor of the fds beverages . participants were asked to consume one cup in the morning and the second in the evening , at least 68 h apart . participants were instructed to add the strawberry or control beverages as a snack to their usual diet , and not to use it to replace any meals . since the strawberry powder is sticky in consistency , especially when reconstituted in water , the participants were provided specific instructions on the preparation and storage of the test drinks and demonstration on how to rinse the cups to ensure no wastage of the test powder . compliance was assessed by the return of unused test powder and mandatory three days per week visit to the clinic for monitored consumption of the beverages . body weight was recorded on an uncarpeted surface with the seca 644 multifunctional hand rail scale ( seca ) and recorded to the nearest 0.1 kg . height was measured without shoes using the accustat genentech stadiometer and recorded to the nearest 0.1 cm . waist circumference was measured at the superior iliac crest using the gulick ii tape measure ( vital signs ) . fasting blood samples were collected , and serum was promptly transported to the university of oklahoma medical center laboratory for analyses of glucose , lipid profiles ( total cholesterol , tg , ldl - cholesterol , and hdl - cholesterol ) , and other blood variables , including safety variables ( hemoglobin , platelets , white blood cells , liver enzymes , creatinine , and blood urea nitrogen ) using automated diagnostic equipment ( abbott architect instruments ) following standard protocols at the university of oklahoma medical center . micronutrient intakes were estimated based on three - day food records collected at screening and 12 wk of the study . three - day averages ( two weekdays and one weekend day ) of micronutrient and fruit and vegetable intakes were analyzed using nutritionist pro ( version 3.2 , 2007 ; axxya systems ) . reduced glutathione content in heparinized whole blood sample was measured using the method described by beutler et al . . briefly , 100 l of hemolyzed blood sample and 200 l of 2.5 louis , missouri ) were mixed in tubes containing 1.9 ml tris - hcl buffer ( ph 8.0 ) . calibration curve was used to calculate concentration and was expressed as micrograms per gram hemoglobin . serum catalase activity and glutathione reductase activity were measured using catalase assay kit and the glutathione reductase assay kit ( cayman chemical company , ann arbor , michigan , usa ) using the spectrophotometric assays based on the manufacturer 's protocol . glutathione peroxidase was measured by using gpx-340 ( oxisresearch ) based on the manufacturer 's protocol . plasma levels of copper , iron , selenium , and zinc were measured using inductively coupled plasma quadrupole mass spectroscopy ( elan 9000 ; perkin elmer , norwalk , ct ) as described . all plasma samples were diluted 20-fold ( 200 l diluted to 4 ml ) with 0.1% nitric oxide ( gfs chemicals , powell , oh ) in ultrapure water . standard solutions of selected trace elements were prepared by dilution of certified standard solutions ( perkin elmer , norwalk , ct ) . the calibration standards were prepared in 0.1% nitric acid solution at 0 , 50 , and 100 g / l . / l gallium as an internal standard ( perkin elmer , norwalk , ct ) . newton , nc ) was used for reagent and sample preparation to avoid metal contamination . quality control samples ( utak laboratories , inc . , valencia , ca ) were used to verify method performance and confirm obtained values were within recommended ranges . quantitative analyses were performed using the scanning mode of data acquisition . for each element , peak area ( signal ) was divided ( normalized ) by the signal from the internal standard . based on triplicate analyses , the estimated average interassay cv for copper , iron , selenium , and zinc was in the range of 27% . for all measures , descriptive statistics were calculated and graphs drawn to identify outliers ; no data points were determined to be outliers . target sample size was calculated to include 15 participants per group to detect a minimum difference of 12% in whole blood glutathione with 80% power based on our previous study . our primary groups of comparisons were as follows : low dose fds versus high dose fds , and low and high dose fds versus calorie- and fiber - matched control groups . for each variable , mean differences between strawberry and control groups at baseline and at 12 weeks were assessed using the multivariate analysis of variance ( manova ) , followed by bonferroni post hoc analyses . spss for windows ( version 15.0 , spss , 2006 ) was used for the statistical calculations . no significant differences in baseline characteristics were observed among the strawberry groups and the corresponding control groups . as shown in figure 1 , a total of 85 participants were screened for the study , and 66 were enrolled upon satisfying the inclusion and exclusion criteria . among those enrolled , six participants withdrew because of time constraints and thus , 60 participants completed the 12-wk study in the strawberry and control arms . among these participants , 97% for the control groups , as assessed by mandatory weekly visits ( 3 d / wk ) and return of any unconsumed beverages on the days the participants did not come to the clinic . ellagic acid was detectable in the strawberry group at 12 weeks , but not at baseline as well as in the control groups as reported previously . plasma antioxidant capacity and whole blood glutathione were not statistically different at baseline , but were significantly higher in the low and high dose strawberry groups compared to their calorie- and fiber - matched controls ( all p < 0.01 ; table 3 ) . while plasma antioxidant capacity did not differ between the low and high dose strawberry groups , blood glutathione was significantly higher in the high dose versus low dose strawberry group at 12 weeks of the study ( p < 0.05 ; table 3 ) . serum catalase activity tended to be lower in the high dose strawberry when compared to the calorie- and fiber - matched controls ( p = 0.06 ) , while catalase activity was significantly higher in the low dose strawberry versus low dose calorie- and fiber - matched controls at 12 weeks ( p < 0.01 ; table 3 ) . no differences were noted in glutathione peroxidase and glutathione reductase enzyme activities among any groups at baseline or at 12 weeks of the study ( table 3 ) . we did not observe any differences in plasma copper , iron , selenium , and zinc among any groups at baseline and at 12 weeks of the study ( table 3 ) . dietary intakes of selected micronutrients , including trace elements , did not significantly vary among groups at any time point ( table 4 ) . in this 12-week clinical study , we examined the dose - response effects of dietary strawberries on selected biomarkers of antioxidant status in obese adults with elevated serum lipids . overall , our findings reveal strawberry intervention to increase plasma antioxidant capacity and whole blood glutathione when compared to the matched controls ; the higher dose was associated with a greater increase in glutathione when compared to the lower dose of strawberries . serum catalase activity was increased only in the low dose strawberry group compared to the controls , while no effects of either dose were noted on glutathione peroxidase and glutathione reductase enzyme activities . plasma copper , iron , selenium and zinc were also not affected by the strawberry intervention . to our knowledge , this is the first clinical study to report the effects of two achievable dietary doses of strawberries on circulating antioxidant biomarkers in adults with cvd risk factors . these findings may further explain the protective associations of berry fruit intake against cvd risk factors , especially obesity and diabetes as observed in prospective cohort studies [ 2 , 23 ] . plasma antioxidant capacity , a biomarker of enzymatic as well as nonenzymatic antioxidants has been shown to be increased by many studies using strawberries and other berry polyphenols . in healthy volunteers , strawberry intervention at doses comparable to those used in our study showed a significant increase in plasma antioxidant capacity indicating a direct absorption of strawberry antioxidants such as polyphenols and vitamins and/or an enhanced production of endogenous antioxidants [ 2426 ] . among the endogenous antioxidant defense mechanisms , catalase and the glutathione enzyme system play key roles in neutralizing oxidative damage induced by hydrogen peroxide and its subsequent ability to generate the hydroxyl radical . using animal models of oxidative stress , berry polyphenols have been shown to upregulate the synthesis of intracellular glutathione and glutathione peroxidase activity and attenuate mitochondrial oxidative stress . these mechanistic findings have been supported by a few clinical studies reporting the effects of berries on antioxidant enzymes . a six - week dietary intervention study in junior athletes who were administered an acai berry - based juice blend showed a trend towards increased catalase and glutathione reductase activities , but no effects on glutathione peroxidase at one - hour after exercise phase . however , no effects were noted in enzyme activities in the resting state in these young athletes . another three - week intervention of an antioxidant rich berry juice blend in hemodialysis patients revealed a significant increase in blood glutathione levels , thus improving oxidative stress in people with chronic kidney disease . in a two - week intervention study in healthy volunteers , a polyphenol - rich juice was also shown to upregulate leucocyte protein expression of the phase ii anticarcinogenic and antioxidant enzyme glutathione - s - transferase . in our study , we observed a dose - dependent increase in blood glutathione in our participants with cvd risk factors and a higher activity of catalase enzyme only in the low dose strawberry group . interestingly , we also observed a trend towards decreased catalase activity following high dose strawberry intervention , similar to a decrease in erythrocyte catalase activity observed after an intervention with high polyphenol orange juice . these effects have been explained by the ability of polyphenols to spare endogenous antioxidants and/or regenerate other antioxidants to improve their synergistic action in vivo . in general , whole strawberries contain vitamins and carotenoids as antioxidants in addition to polyphenols , and these may modulate endogenous enzyme activities depending on the baseline antioxidant status in our participants . while we did not measure plasma vitamins in our study , we report low dietary intakes of vitamin c and e , as well as of fruits and vegetables in our participants when compared to the dietary recommendations [ 33 , 34 ] . nevertheless , in view of the fact that more than 80% of the us population do not meet the national recommendations of intakes for fruits and vegetables , our study reveals supplementation of low as well as high dose strawberries confer some antioxidant protection in obese adults . some trace elements , such as copper and iron , have been shown to increase oxidative stress , while others such as zinc and selenium are essential constituents of the antioxidant enzymes , especially superoxide dismutase and the glutathione enzyme system [ 4 , 6 , 35 ] . polyphenols have been shown to chelate metal ions including iron and have been proposed as treatment agents in iron overload conditions such as thalassemia . grape seed polyphenol supplementation in healthy piglets were shown to cause a slight decrease in liver concentrations of copper and zinc , though both elements were within the normal physiological limits when compared to control animals . cereal grain polyphenols have been shown to decrease postprandial zinc absorption in young adults , while a three - month supplementation of green tea polyphenols was reported to increase serum zinc and lower serum iron in obese adults . we have previously reported the effects of green tea polyphenols in lowering plasma iron in obese adults with the metabolic syndrome . in our current study , dietary strawberries at low and high doses had no effects on plasma trace elements in obese adults with elevated serum lipids . thus , further studies are needed on the role of polyphenols derived from different dietary sources in modulating trace element status in adults with cvd risk factors . our study has some limitations including a small sample size and the selection of otherwise healthy obese adults with above optimal serum lipids , and these may explain some of our null findings . also , while we previously measured lipid peroxidation which revealed a decrease with strawberry supplementation , other biomarkers of oxidative stress , such as protein carbonyls and biomarkers of dna damage , must also be determined in future studies . in addition , we did not measure other biomarkers of antioxidant status , such as circulating or tissue vitamin c , which also play an important role in the cellular antioxidant defense mechanism . finally , we measured levels of these antioxidants in the fasting or resting state following the strawberry intervention ; but as shown in previous studies , stress - inducing conditions , such as exercise or the postprandial phase , may elicit a more pronounced difference in these measures of antioxidant enzymes . our study findings support the hypothesis that dietary strawberries selectively increase antioxidant biomarkers in obese adults with elevated serum lipids , especially plasma antioxidant capacity , glutathione , and catalase enzyme activity . obesity is an underlying risk factor for many chronic conditions , including cvd , and has been associated with increased oxidative stress and antioxidant deficiencies . thus , dietary strawberries , in addition to providing a significant source of antioxidant polyphenols and vitamin c , can also increase endogenous antioxidant capacity . this may offer additional protection against obesity - related conditions , such as cvd , the metabolic syndrome , and type 2 diabetes .
fungal endocarditis is an uncommon occurrence ; its incidence was reported as 1.3 to 6% of infective endocarditis cases ( 1 ) . aspergillus species contributes to approximately 25% of all cases of fungal endocarditis , second to the candida species in frequency . several conditions predispose patients to aspergillus infections including underlying cardiac abnormalities , prosthetic heart valves , indwelling central venous catheters , prolonged use of broad - spectrum antibiotics , and intravenous drug abuse ( 1 , 2 ) . we present a case of aspergillus endocarditis of a native valve , presenting as a femoral artery occlusion . four months previously , he underwent a pericardiocentesis for a fever and massive pericardial effusion ; no organism was found in the pericardial effusion . a precordial systolic murmur was heard during auscultation of the heart , and a right femoral artery pulse was not detected . the transthoracic echocardiography revealed severe mitral insufficiency with large mobile vegetations on the anterior and posterior mitral valve leaflets ( fig . the computed tomographic angiography showed an embolic occlusion of both common iliac arteries ( fig . the patient underwent emergency replacement of the mitral valve with a 29 mm prosthetic mechanical mitral valve ( sjm masters series , st . paul , mn , u.s.a . ) , and bilateral ilio - femoral artery thromboembolectomy with a fogarty catheter through both femoral arteries . gross findings in the surgical field revealed 1.51.5 cm round irregular vegetations on the middle portions of both mitral valve leaflets . culture of the valvular tissue on sabouraud dextrose agar confirmed the aspergillus species ( fig . anti - fungal medication was planned with intravenous amphotericin b for six weeks then oral itraconazole for 12 weeks . therefore , we started intravenous amphotericin b ( 5 mg / kg / day ) . a computed tomography showed multiple aneurysmal changes of the superior mesenteric artery ( sma ) , splenic artery , hepatic artery and left iliac artery despite amphotericin b treatment ( fig . 2 ) . the patient underwent sma aneurysmectomy and arterial reconstruction with bovine pericardium , and left iliac artery repair . amphotericin b was changed to oral itraconazole ( 800 mg / day ) at 6 weeks after the first operation . fifty - eight days after the first operation , the patient had hematochezia , and had a colonoscopy that revealed multifocal intestinal bleeding . the patient was discharged 78 days after surgery on oral itraconazole and warfarin . on follow - up , the itraconazole was discontinued 10 weeks later . aspergillus is a ubiquitous mold capable of causing several diseases in both healthy humans and immunocompromised hosts . aspergillus species endocarditis is an ominous condition and its prevalence is increasing in the hospital population . men are more commonly affected than are women with a peak incidence during the third to fourth decades of life ( 1 , 3 ) . previous valvular surgery is the most important risk factor , and was reported in 40% to 50% of patients diagnosed with aspergillus endocarditis ( 1 , 2 ) . aspergillus endocarditis of native valves is rare and experience in diagnosis and treatment is limited ( 1 , 4 ) . only 28 cases of aspergillus endocarditis were found in a medline search from 1995 to 2006 , and the mortality rate was reported to be higher than 90% despite aggressive surgical and anti - fungal therapies ( 1 ) . in most cases , predisposing factors were found including underlying cardiac conditions , prosthetic cardiac devices , central venous catheters , and previous antibiotic treatment . in 3.4% of cases with fungal endocarditis , , the patient underwent pericardiocentesis for pericardial effusion , but we could not find any predisposing factors . because of the ubiquitous nature of the organism , establishing a definitive diagnosis of disease caused by aspergillus is difficult ( 5 ) . recently , antigen detection methods and the polymerase chain reaction have been developed to improve the diagnosis of invasive aspergillosis ( 6 ) . the vegetations in aspergillus endocarditis are large and highly mobile and peripheral embolization is common in early stage disease ( 1 ) . in this case , the patient presented with iliac artery occlusions and with large mobile vegetations of the mitral valve . in general , the largest databases for aspergillosis treatment include amphotericin b and various surgical modalities ( 5 ) . in this case , we used a combination of amphotericin b , itraconazole and aggressive surgical treatment , but severe disseminated fungemia reappeared unexpectedly during the early postoperative period with a sma aneurysm and peripheral artery embolic occlusions . these complications may have been due to delay of antifungal treatment after surgery and dissemination by cardiopulmonary bypass before antifungal therapy was started . relapsing fungal endocarditis is a complication seen in as many as 30 to 40% of patients who have fungal endocarditis and who survive to complete short - term therapy ( 7 ) . thus , all patients who survive long enough to complete acute treatment are potential candidates for long - term suppressive antifungal therapy ( 1 , 3 , 8) . native valve aspergillus endocarditis is uniformly fatal without immediate and extensive surgical intervention combined with prolonged antifungal therapy .
to report a case of a cyclodialysis cleft that was successfully managed with gas endotamponade and cyclocryotherapy . a 37-year - old male victim of a severe blunt ocular trauma was referred to our service for evaluation and treatment of a left eye hypotony . clinical examination revealed an intraocular pressure of 2 mm hg , a cyclodialysis cleft extending from the 11 to 1 o'clock positions and a hypotonic maculopathy . the patient failed to respond to conservative treatment with atropine 1% , so a single bubble of 16% c2f6 was injected into the vitreous cavity , followed by superior quadrant transconjunctival cyclocryotherapy . after gas absorption , the intraocular pressure increased to 11 mm hg and became steady during the 24 months of follow - up . cryotherapy associated with gas endotamponade is a minimally invasive technique that could be considered for patients with cyclodialysis clefts that fail to respond to medical therapy . a cyclodialysis cleft results from a disinsertion of the meridional ciliary muscle fibers from the scleral spur [ 1 , 2 ] . this creates an abnormal route of drainage of aqueous humor into the suprachoroidal space , resulting in chronic ocular hypotony [ 1 , 2 ] . choroidal effusion , retinal folds , optic nerve edema , engorgement and stasis of retinal veins , shallow anterior chamber and cataract are frequent secondary complications of chronic ocular hypotony [ 1 , 2 ] . cyclodialysis clefts usually occur either as a surgical complication or after blunt ocular trauma [ 1 , 3 ] . the main goal of the treatment is to restore the apposition of the ciliary body to the sclera and consequently increase intraocular pressure ( iop ) . we report a case of a cyclodialysis cleft that was successfully managed with gas endotamponade and cyclocryotherapy . a 37-year - old male victim of a car crash with severe head injury and blunt ocular trauma was referred to our service for evaluation and treatment of a left eye hypotony 5 weeks after the accident . on ophthalmic examination , anterior segment examination revealed a shallow anterior chamber in the left eye and anisocoria , with a dilated left pupil . left eye gonioscopy revealed a cyclodialysis cleft extending from the 11 to the 1 o'clock position , which was confirmed by ultrasound biomicroscopy ( ubm ; fig . 1 ) . dilated fundus examination revealed an optic disc edema and hypotonic maculopathy in the left eye ( fig . the patient started conservative treatment with topical atropine 1% twice daily , but after 4 weeks , there was no visual acuity improvement , and the left eye remained hypotonic . it was then decided to perform gas endotamponade followed by cyclocryotherapy . in the operating room and under general anesthesia , a single bubble of 16% hexafluoroethane - air mixture ( c2f6 , 0.5 ml ) was injected into the vitreous cavity via the pars plana , followed by ocular decompression through a paracentesis of the anterior chamber . superior quadrant transconjunctival cryotherapy was then performed ( 8 applications , each with a duration of 20 s and a temperature of 80c , 2 mm behind the limbus ) . the patient was told to rest with his head up for 1 week to achieve endotamponade . atropine 1% twice daily was maintained for 2 months . during the first week after the procedure , there was no hypertensive spike after cleft closure or intraocular inflammation in the postoperative period . following gas absorption , at the third week , the iop was 12 mm hg . one month after the procedure , there was a complete resolution of the hypotonic maculopathy , and the bcva improved to 9/10 . complete closure of the cleft and ciliary body reattachment was confirmed with gonioscopy and ubm ( fig . informed consent was obtained , and the study was conducted in accordance with the tenets of the declaration of helsinki . the identification of the full extent and location of the cleft is of particular importance for appropriate treatment [ 1 , 4 ] . initial management should be conservative since some patients recover spontaneously or with the use of mydriatics . topical atropine can help close the cleft through relaxation of the ciliary muscle , allowing the apposition of the detached meridional ciliary muscle to the sclera . various techniques have been described as an alternative to traditional direct cyclopexy ; however , a review of the published literature does not indicate a clear gold standard technique [ 1 , 3 , 5 , 6 ] . if medical treatment fails , further management with argon laser photocoagulation , applied within the cleft , seems to be a good option in small clefts , but an adequate gonioscopy is a problem in patients with a too shallow anterior chamber [ 2 , 7 ] . the laser can induce an inflammatory response , which triggers cleft closure . other techniques like internal cerclage with a capsular tension ring or the haptics of large iols to compress the cleft against the sclera and achieve closure have recently been described [ 3 , 8 , 9 ] . nevertheless , the number of studies evaluating their efficacy and safety is still scarce . the use of transconjunctival cryotherapy , isolated or in conjunction with pars plana vitrectomy and internal gas endotamponade , has been applied in the treatment of persistent cyclodialysis clefts [ 5 , 10 ] . helbig and foerster described the successful management of hypotonous cyclodialysis with pars plana vitrectomy , gas tamponade and cryotherapy . however , this technique requires an experienced vitreoretinal surgeon and has the risks connected with vitrectomy . traditional direct cyclopexy involves the creation of a partial or full - thickness scleral flap and suture of the ciliary body directly to the sclera . nevertheless , this is an invasive technique with the risk of major hemorrhage from the ciliary body or endophthalmitis [ 1 , 2 ] . ceruti et al . reported the successful resolution of a large cleft using gas endotamponade with a single bubble of 20% sulfur hexafluoride ( sf6 ) in conjunction with cryotherapy . this technique combines the principle of direct mechanical apposition of the detached ciliary muscle to the sclera by a gas bubble and inflammation and scar induction by cryotherapy . in our case , we injected c2f6 instead of sf6 as the former takes longer to absorb and therefore has a longer - lasting effect ; our anatomic and visual results were also good . cryotherapy associated with gas endotamponade is a rapid and technically simple surgical procedure that can be performed on an outpatient basis and without the need of direct visualization of the cyclodialysis cleft . in spite of being an intraocular procedure , although to the best of our knowledge this is only the second published case to be treated with this technique , we believe that this procedure should be used in the treatment of cases that fail to respond to medical therapy before other more invasive techniques are tried .
across the developed world , the provision and financing of long - term care is increasingly becoming a central policy issue , challenging policymakers and governments alike.1 changing dynamics in both the demographic composition of the population and the policy context in the area of long - term care , underpin the academic and policy debate in this area.24 recent documents in the british policy landscape , such as the dilnot report , have emphasised the importance of appropriate housing to address the needs of older people , but also the need to develop further alternatives of long - term care for a growing number of home owners whose resources and expectations are different to previous generations of individuals.5 6 as such , understanding the pathways into different types of long - term care accommodation in later life is important from the perspective of both policymakers and individuals . this paper uses evidence from england and wales in order to examine the under - researched topic of transitions into sheltered accommodation . long - term care in the uk expanded through free services in the post - wwii period , before witnessing a period of financial austerity in the late 1970s and the 1980s . the introduction of the 1990 national health service ( nhs ) and community care act simultaneously decreased the availability of residential and paid - for domiciliary care provided by local authorities , and tightened the conditions attached to its receipt . the act 's principal aim was to reduce the number of older people in institutional care , and to develop community care provision in order to enable older people to live in their own homes for as long as possible . during the same time , the unit costs of providing long - term care increased , resulting in a greater focus of decreasing statutory resources on older people who are most in need.7 alongside the decrease in the overall level of social care provided , the literature has highlighted the increasing participation of the private sector in the mix of long - term care and the concomitant decrease in the level of care provided by local authorities.8 since the 1990s , different types of long - term care have developed , responding to the policy aim of successive governments since the 1980s to provide greater choice to users of long - term care . different long - term care providers typically cater for different groups of the older population depending on individuals health and social care needs , as well as key demographic and socioeconomic characteristics , such as their partnership status and ability to purchase privately provided care.9 10 against this context , sheltered accommodation has developed as a key alternative within the mixed market of long - term care , is mainly but not exclusively for older people , and usually takes the form of a group of small bungalows or flats supervised by a scheme manager , who offers help and support in emergencies . living in sheltered accommodation can provide greater independence for older people than other types of long - term care , and may be associated with relatively good health . at the same time , older people 's socioeconomic status can also act as a critical determinant factor in terms of living in sheltered accommodation . this is because the current system of long - term care includes the assessment of an individual 's care needs , living arrangements and their carers circumstances by the local council , which can impact on the package of care an individual is offered and the contribution they are expected to make.11 international research on pathways into long - term care in later life has emphasised a combination of factors as predictors affecting such transitions . for example , luppa et al12 conducted a review ( 36 articles ) of the predictors of nursing home placement in later life in canada , the usa , europe , australia and hong kong , and found that one 's increased age , poor health , functional and cognitive impairment , prior placement in nursing care and a high number of medication prescriptions , were consistently strong predictors . not having one 's own home was also a strong predictor of entering nursing care , which was consistent with other studies of moving into institutional care13 and nursing or residential care in northern ireland.14 qualitative research outside the british context has also explored the views of older people on the advantages and disadvantages of living in different types of accommodation,15 finding that older people in sheltered accommodation reported a higher level of perceived autonomy , sense of security and quality of life , compared with those living in private homes . within england and wales , research on the determinants of moving into long - term care has tended to focus on residential care , usually including nursing homes , residential homes and long - stay hospital accommodation , but not on sheltered accommodation . such previous research has explored the impact of demographic , socioeconomic and health factors on older people 's likelihood of living in a long - term care institution . the literature focusing on demographic factors has emphasised characteristics such as living arrangements and having children as key predictors of moving into residential care , which may operate in opposite directions for men and women . for example , breeze and stafford16 analysed the longitudinal study ( ls ) and found that being single in 1971 and 1981 was a strong predictor for both women and men being in residential care in 1991 ; however , living alone was a strong predictor for men but not for women . analysis of the british household panel survey ( bhps ) 19911998 by evandrou et al17 showed that age and health measures were important predictors of institutionalisation in later life . recent data on individuals aged 65 and over in 1991 who were still alive in 2001 , analysed by grundy and jitlal,18 indicated that women carried a higher risk of moving into residential care than men , and that for both sexes , living alone in 1991 and being unmarried in 2001 , as well as reporting a long - term illness , increased the likelihood of being in residential care in 2001 . subsequent analysis of the ls confirmed the association between living in rented accommodation in 2001 and being unmarried at the end of that decade , with being in an institution at end of that decade.19 finally , recent analysis of the bhps20 has shown that older age and poor health are key determinants of moving into residential care in the uk . the impact of an individual 's socioeconomic status on their risk of moving into long - term care has also been explored in the context of england and wales , drawing a strong link between such indicators as housing tenure , reflecting low socioeconomic resources and the transition into residential care . for example , glaser et al21 used data from the ls from 1971 , 1981 and 1991 in order to analyse factors associated with older women 's move into co - residential ( or supported ) private households or residential care , and found that owner occupiers were more likely than tenants to move into co - residential private households . socioeconomic predictors indicating low socioeconomic status have been found to be equally important for men and women , with living in rented accommodation and in a household without access to a car in 1971 , resulting in a 3545% higher risk of being in an institution in 1991.16 the protective effect of owning one 's home as opposed to renting accommodation with regard to moving into long - term care accommodation has also been highlighted elsewhere in the literature.22 also drawing on the ls , grundy and jitlal18 found that living in rented accommodation in 1991 , which is associated with a lower socioeconomic status , increased an individual 's risk of being in residential care 10 years later . finally , evandrou et al20 found that having been a hospital inpatient for 15 days or more in the previous year remained an important predictor of moving into residential care even after controlling for health and sociodemographic factors . our paper draws on such existing research in order to conceptualise moves into sheltered accommodation as being affected by a wide range of factors such as the demographic , health and socioeconomic characteristics of the older person , as well as policy - related factors which include the receipt of state support ( see figure 1 ) . long - term care in the uk expanded through free services in the post - wwii period , before witnessing a period of financial austerity in the late 1970s and the 1980s . the introduction of the 1990 national health service ( nhs ) and community care act simultaneously decreased the availability of residential and paid - for domiciliary care provided by local authorities , and tightened the conditions attached to its receipt . the act 's principal aim was to reduce the number of older people in institutional care , and to develop community care provision in order to enable older people to live in their own homes for as long as possible . during the same time , the unit costs of providing long - term care increased , resulting in a greater focus of decreasing statutory resources on older people who are most in need.7 alongside the decrease in the overall level of social care provided , the literature has highlighted the increasing participation of the private sector in the mix of long - term care and the concomitant decrease in the level of care provided by local authorities.8 since the 1990s , different types of long - term care have developed , responding to the policy aim of successive governments since the 1980s to provide greater choice to users of long - term care . different long - term care providers typically cater for different groups of the older population depending on individuals health and social care needs , as well as key demographic and socioeconomic characteristics , such as their partnership status and ability to purchase privately provided care.9 10 against this context , sheltered accommodation has developed as a key alternative within the mixed market of long - term care , is mainly but not exclusively for older people , and usually takes the form of a group of small bungalows or flats supervised by a scheme manager , who offers help and support in emergencies . living in sheltered accommodation can provide greater independence for older people than other types of long - term care , and may be associated with relatively good health . at the same time , older people 's socioeconomic status can also act as a critical determinant factor in terms of living in sheltered accommodation . this is because the current system of long - term care includes the assessment of an individual 's care needs , living arrangements and their carers circumstances by the local council , which can impact on the package of care an individual is offered and the contribution they are expected to make.11 international research on pathways into long - term care in later life has emphasised a combination of factors as predictors affecting such transitions . for example , luppa et al12 conducted a review ( 36 articles ) of the predictors of nursing home placement in later life in canada , the usa , europe , australia and hong kong , and found that one 's increased age , poor health , functional and cognitive impairment , prior placement in nursing care and a high number of medication prescriptions , were consistently strong predictors . not having one 's own home was also a strong predictor of entering nursing care , which was consistent with other studies of moving into institutional care13 and nursing or residential care in northern ireland.14 qualitative research outside the british context has also explored the views of older people on the advantages and disadvantages of living in different types of accommodation,15 finding that older people in sheltered accommodation reported a higher level of perceived autonomy , sense of security and quality of life , compared with those living in private homes . within england and wales , research on the determinants of moving into long - term care has tended to focus on residential care , usually including nursing homes , residential homes and long - stay hospital accommodation , but not on sheltered accommodation . such previous research has explored the impact of demographic , socioeconomic and health factors on older people 's likelihood of living in a long - term care institution . the literature focusing on demographic factors has emphasised characteristics such as living arrangements and having children as key predictors of moving into residential care , which may operate in opposite directions for men and women . for example , breeze and stafford16 analysed the longitudinal study ( ls ) and found that being single in 1971 and 1981 was a strong predictor for both women and men being in residential care in 1991 ; however , living alone was a strong predictor for men but not for women . analysis of the british household panel survey ( bhps ) 19911998 by evandrou et al17 showed that age and health measures were important predictors of institutionalisation in later life . recent data on individuals aged 65 and over in 1991 who were still alive in 2001 , analysed by grundy and jitlal,18 indicated that women carried a higher risk of moving into residential care than men , and that for both sexes , living alone in 1991 and being unmarried in 2001 , as well as reporting a long - term illness , increased the likelihood of being in residential care in 2001 . subsequent analysis of the ls confirmed the association between living in rented accommodation in 2001 and being unmarried at the end of that decade , with being in an institution at end of that decade.19 finally , recent analysis of the bhps20 has shown that older age and poor health are key determinants of moving into residential care in the uk . the impact of an individual 's socioeconomic status on their risk of moving into long - term care has also been explored in the context of england and wales , drawing a strong link between such indicators as housing tenure , reflecting low socioeconomic resources and the transition into residential care . for example , glaser et al21 used data from the ls from 1971 , 1981 and 1991 in order to analyse factors associated with older women 's move into co - residential ( or supported ) private households or residential care , and found that owner occupiers were more likely than tenants to move into co - residential private households . socioeconomic predictors indicating low socioeconomic status have been found to be equally important for men and women , with living in rented accommodation and in a household without access to a car in 1971 , resulting in a 3545% higher risk of being in an institution in 1991.16 the protective effect of owning one 's home as opposed to renting accommodation with regard to moving into long - term care accommodation has also been highlighted elsewhere in the literature.22 also drawing on the ls , grundy and jitlal18 found that living in rented accommodation in 1991 , which is associated with a lower socioeconomic status , increased an individual 's risk of being in residential care 10 years later . finally , evandrou et al20 found that having been a hospital inpatient for 15 days or more in the previous year remained an important predictor of moving into residential care even after controlling for health and sociodemographic factors . our paper draws on such existing research in order to conceptualise moves into sheltered accommodation as being affected by a wide range of factors such as the demographic , health and socioeconomic characteristics of the older person , as well as policy - related factors which include the receipt of state support ( see figure 1 ) . the overall aim of this study is to understand the predictors of moving into sheltered accommodation in later life , focusing on factors which have been used in the past to examine transitions into other types of long - term care , specifically residential care . as such , the study aims to bridge the gap between existing literature on one 's transition into residential care with such transitions into sheltered accommodation . the research question addressed in this paper is : what are the determinants of transitions into sheltered accommodation in later life ? this paper employs waves 218 of the bhps ( 19932008 ) to study transitions into sheltered accommodation in england and wales . the bhps is a nationally representative longitudinal survey of households in the uk , collecting individual and household - level information on demographic and socioeconomic characteristics , health , care and well - being , finances and other indicators.23 an assessment of quality and attrition in waves 113 of the bhps sample24 concluded that the bhps data do not present substantial bias resulting from attrition . the analytical sample focused on people aged 65 and over in england and wales , living in private housing at the first observation and observed at two consecutive points ( n=23 589 ) . individuals with these characteristics were identified sequentially in each pair of waves , and waves 218 were stacked to create one large data set . the model selection process relied on manual forward selection starting from a model including only an intercept , and adding the explanatory variables in thematic groups thereafter ( demographic ; health status and use of care services ; socioeconomic ; interaction terms ) . the model selection process stops when further significant improvement in fit can not be reached . likelihood ratio tests , using the change in the l2 goodness - of - fit statistic , were used to test the significance of terms and interactions , and to inform the decisions about their inclusion in the next stage of the model selection process . robust ses were obtained to control for the non - independence of observations due to the longitudinal nature of the data , and finally spss v.22 and stata v.12 were used for the data set construction and the analysis . the outcome variable was the respondent 's transition into sheltered accommodation at the second point of observation ( t1 ) , and all explanatory variables were collected at time 0 ( t0 ) , allowing for the investigation of an individual 's circumstances prior to the transition . key indicators of status change between t0 and t1 were constructed ( eg , change in use of social worker between t0 and t1 ) , and interaction terms between the respondents use of services such as home help , and their age and number of days spent in the hospital as an inpatient , were also included in order to test for the relationship between age and indicators of need among older people . the inclusion of data set wave controls for changes in the risk of moving into sheltered accommodation over time , while the inclusion of region takes into account the geographical dispersion of unpaid care provision which can affect transitions into sheltered accommodation.25 demographic characteristics include the respondent 's sex ; the number of natural ever born children as potential sources of informal support ; household type controlling for the effect of living alone or with other persons ; and marital status controlling for the protective effect of having a spouse in later life.18 the respondent 's health status is measured through the change in health status between t0 and t1 ; one 's general health questionnaire ( ghq ) score and disability status at t0 ; the change in these two indicators between t0 and t1 ; and the presence and number of health problems such as hearing or blood pressure between t0 and t1 . the use of formal care services by the respondents was also included in the analysis focusing on : the number of visits to the general practitioner ( gp ) in the past 12 months ; hospital inpatient days at t0 ; and the use of services at t0 such as from a health visitor , home help , meals on wheels or a social worker , as well as the change in such use of services between t0 and t1 . socioeconomic and financial characteristics , which are proxies for an individual 's socioeconomic status,26 are measured at t0 and include the respondent 's : highest educational qualification , occupational social class based on last occupation , access to a car / van ; housing tenure ; central heating ; having a washing machine ; subjective financial status ; equivalised household income in quintiles ; and receipt of attendance allowance , income support , disability allowance or second pension ( includes a pension from an ex - employer , spouse 's ex - employer , private pension or annuity ) . based on the analysis of the bhps , between 1992 and 2008 in england and wales , 175 individuals moved from their private home into sheltered accommodation . the proportion of individuals in the data set making the move decreased during this period , reflecting the changes in the policy context of long - term care discussed in the background section of this paper ( figure 2 ) . source : british household panel survey ( bhps ) , waves 118 , unweighted data . note : for example , in 1993 , 8 out of 573 older persons moved into sheltered accommodation ( 1.39% of older people in that year ) . the descriptive analysis ( table 1 ) showed significant relationships between the move into sheltered accommodation and key demographic characteristics , such as age , marital status and one 's household type , and table 2 presents the distributions within the group of older people who moved into sheltered accommodation , and those who did not . variables reflecting an older person 's health status and their use of services are significantly associated with moving into sheltered accommodation , for example , one 's ghq score , and their use of services from meals on wheels , a health visitor or a social worker , all measured prior to the respondents move into such accommodation . in addition to the geographical region , a range of socioeconomic indicators , such as one 's education , housing tenure , access to car and having a washing machine , were also associated with their move into sheltered accommodation . variables associated with an older person 's move into sheltered accommodation ( bivariate analysis ) source : bhps , waves 218 . note : categories of missing responses were included in the analysis but are not shown above . all variables measured at t0 unless otherwise stated . * * * p<0.001 ; * * p<0.01 ; * p<0.05 . bhps , british household panel survey ; ghq , general health questionnaire ; gp , general practitioner . distribution of statistically significant variables among movers into sheltered accommodation and non - movers ( bivariate analysis ) source : bhps , 19932008 , authors calculations , n=23 589 ( 175 movers , 23 414 non - movers ) . note : categories of missing responses were included in the analysis but are not shown above . bhps , british household panel survey ; ghq , general health questionnaire ; gp , general practitioner . transitions into sheltered accommodation were significantly associated with one 's age and service use ( table 3 ) . individuals aged 75 and over were more likely to move into sheltered accommodation than those aged below 75 ( although the cis in the ors between the groups overlapped , indicating that there is not much difference between the age groups over age 75 ) . individuals who had visited the gp between six and nine times in the past 12 months were more likely to make such a move than those who had made no such visits ( or 2.97 ) , as were those who had started using a health visitor 's services between t0 and t. interestingly , although health was significant in the bivariate analysis , no health variables remained significant in the final multivariate analysis once other factors had been taken into account ( see online supplementary tables s4 and s5 ) . more variables relating to service use were also statistically significant in the initial models shown in online supplementary tables s4 and s5 but were not significant in the final model . the odds of moving into sheltered accommodation among respondents renting their house from a local authority or housing association were 6.13 times the odds among those who owned their home outright , while those with no washing machine were more likely than those with one to move into sheltered accommodation . finally , there was also a regional effect on an individual 's odds of moving into sheltered accommodation , with the odds among individuals in the south of england being three times the odds among those in london . determinants of moving into sheltered accommodation ( final model ) source : bhps , 19932008 , authors calculations , n=23 589 , * * * p<0.001 ; * * p<0.01 ; * p<0.05 . note : categories of missing responses were included in the analysis but are not shown above . based on the analysis of the bhps , between 1992 and 2008 in england and wales , 175 individuals moved from their private home into sheltered accommodation . the proportion of individuals in the data set making the move decreased during this period , reflecting the changes in the policy context of long - term care discussed in the background section of this paper ( figure 2 ) . source : british household panel survey ( bhps ) , waves 118 , unweighted data . note : for example , in 1993 , 8 out of 573 older persons moved into sheltered accommodation ( 1.39% of older people in that year ) . the descriptive analysis ( table 1 ) showed significant relationships between the move into sheltered accommodation and key demographic characteristics , such as age , marital status and one 's household type , and table 2 presents the distributions within the group of older people who moved into sheltered accommodation , and those who did not . variables reflecting an older person 's health status and their use of services are significantly associated with moving into sheltered accommodation , for example , one 's ghq score , and their use of services from meals on wheels , a health visitor or a social worker , all measured prior to the respondents move into such accommodation . in addition to the geographical region , a range of socioeconomic indicators , such as one 's education , housing tenure , access to car and having a washing machine , were also associated with their move into sheltered accommodation . variables associated with an older person 's move into sheltered accommodation ( bivariate analysis ) source : bhps , waves 218 . note : categories of missing responses were included in the analysis but are not shown above . all variables measured at t0 unless otherwise stated . * * * p<0.001 ; * * p<0.01 ; * p<0.05 . bhps , british household panel survey ; ghq , general health questionnaire ; gp , general practitioner . distribution of statistically significant variables among movers into sheltered accommodation and non - movers ( bivariate analysis ) source : bhps , 19932008 , authors calculations , n=23 589 ( 175 movers , 23 414 non - movers ) . note : categories of missing responses were included in the analysis but are not shown above . bhps , british household panel survey ; ghq , general health questionnaire ; gp , general practitioner . transitions into sheltered accommodation were significantly associated with one 's age and service use ( table 3 ) . individuals aged 75 and over were more likely to move into sheltered accommodation than those aged below 75 ( although the cis in the ors between the groups overlapped , indicating that there is not much difference between the age groups over age 75 ) . individuals who had visited the gp between six and nine times in the past 12 months were more likely to make such a move than those who had made no such visits ( or 2.97 ) , as were those who had started using a health visitor 's services between t0 and t. interestingly , although health was significant in the bivariate analysis , no health variables remained significant in the final multivariate analysis once other factors had been taken into account ( see online supplementary tables s4 and s5 ) . more variables relating to service use were also statistically significant in the initial models shown in online supplementary tables s4 and s5 but were not significant in the final model . the odds of moving into sheltered accommodation among respondents renting their house from a local authority or housing association were 6.13 times the odds among those who owned their home outright , while those with no washing machine were more likely than those with one to move into sheltered accommodation . finally , there was also a regional effect on an individual 's odds of moving into sheltered accommodation , with the odds among individuals in the south of england being three times the odds among those in london . determinants of moving into sheltered accommodation ( final model ) source : bhps , 19932008 , authors calculations , n=23 589 , * * * p<0.001 ; * * p<0.01 ; * p<0.05 . note : categories of missing responses were included in the analysis but are not shown above . previous literature has discussed the characteristics associated with older persons transitions into residential care , highlighting particular demographic ( eg , being female ) , health ( eg , reporting poor health ) and socioeconomic ( eg , indicating lower socioeconomic status ) characteristics as predictors of moving into residential care . for example , evandrou et al20 found that older age , poor health and being widowed or single are strongly associated with moves into residential care . by contrast , this paper examined predictors associated with an older person 's transition into sheltered accommodation . the results suggest that the move into sheltered accommodation is associated with a complex set of factors and a unique pathway into long - term care in later life . indicators of an older person 's socioeconomic circumstances appear to have strong effect on the risk of such transitions , although demographic characteristics and geographical region are also important . the key difference between moving into sheltered accommodation and other types of long - term care , which indicates a unique pathway for the former , appears to be the complex influence of a range of factors.20 for example , variables indicating contact with health professionals ( visits to the gp and the start of use of health visitor 's services ) , and factors reflecting low socioeconomic status ( not having a washing machine and living in socially rented accommodation prior to the transition ) were found to be significant predictors of moves into sheltered accommodation . such a set of factors may indicate that contact with key gatekeepers is important in facilitating older people 's move to this type of accommodation . it is noteworthy that more factors associated with an individual 's health status , such as the use of a health visitor 's services and the report of disability , were significant in the initial models ( see online supplementary tables s4 and s5 ) , suggesting that we can not ignore the relative contribution of such factors in transitions into sheltered accommodation . as such , the factors associated with the risk of moving into sheltered accommodation may be linked to the characteristics of this type of accommodation , as well as the likely relationship between age and health status of individuals at the time of making the transition . although moves into sheltered accommodation are more likely to take place at a later part of old age , they may be experienced by individuals whose health status does not result in a critical demand for entering long - term care , but who may still receive support for particular tasks . in addition , places in sheltered accommodation may also be allocated for renting by local councils to individuals of lower socioeconomic status , which could explain the importance of indicators in the model which reflect a lower socioeconomic status . such indicators may also be reflective of the extent to which individuals make use of housing ( and other ) wealth before moving into sheltered accommodation , or in order to move into such accommodation.27 finally , our analysis did not show an impact of one 's living arrangements ( household type ) or marital status on the risk of moving into sheltered accommodation , which contrasts with previous findings on the protective effect of marriage in later life.18 in this sense , the move into sheltered accommodation may be a joint choice for couples at an earlier point of their old age , when the move into long - term care is not necessitated by one partner 's critical care need . the paper has certain limitations which should be considered when interpreting the findings of the analysis . first , the bhps data set offers information about older people 's move into long - term stay institutions ; however , older people who were considered too frail to interview have been excluded from the sample , therefore the analysis is likely to be underestimating the proportion of older people moving into such institutions . second , the data set does not include any information on the receipt of informal care from relatives or friends , which is a key determinant of the residual of an older person 's need for long - term care . variables indicating an individual 's demographic characteristics and living arrangements , such as their de facto marital status and whether they have children or not , may partly contribute to our assumption of informal care availability ; however , informal care receipt remains an unknown factor in our analysis . an additional limitation is the fact that the analysis does not take step - children or adopted children into account , which could also increase the availability of informal care . similarly , the analysis only focuses on individual moves , rather than the moves of couples . equally important to take into account is the fact that moves into sheltered accommodation are a rare event , a fact which we have tried to address by using a paired wave approach in our analysis . finally , due to the nature of the data , we can not establish causal links but only associations between the response and the explanatory variables . the results of this paper have implications both for the design of social care provision for older people and for older people 's quality of life during periods when their housing arrangements change . such results need to be contextualised in recent policy debates in britain , which have emphasised the importance of maintaining independence for older people for as long as possible , and promoting greater choice among housing options in later life , which are both value for money and adequate for their health and social care needs.6 overall , the findings suggest that a complex set of demographic and socioeconomic factors , as well as factors reflecting contact with health professionals , are important determinants of moves into sheltered accommodation , indicating that access to this type of housing option may be an option for individuals with limited financial resources who are referred by gatekeepers and who move as part of lifecourse planning . most sheltered housing for rent is provided by councils and housing associations.28 the findings indicate that existing local authority tenants may have greater access to such housing than those in the private sector . given the beneficial outcomes of sheltered housing in comparison with independent housing in the community,15 one implication is that policymakers and planners could consider making such a housing option available to all , so that those most in need can access it , as well as providing incentives to the housing and building sectors to include more lifecourse - sensitive design . previous studies have focused on transitions into residential care however ; to date , transitions into sheltered accommodation have not been explored . such studies have shown that transitions into residential and nursing care are associated with older age , poor health , single marital status and indicators of low socioeconomic status . this study uses a nationally representative and longitudinal data set to examine the predictors associated with an older person 's move into sheltered accommodation . the results show that such transitions are significantly associated with one 's demographic characteristics ( age ) ; contact with health professionals ( number of visits to general practitioner , start of use of health visitor 's services ) ; geographical location ( region ) ; and socioeconomic factors ( housing tenure , having a washing machine ) . in addition , the results indicate a unique pathway of transitioning into sheltered accommodation , compared with other types of long - term care accommodation , such as residential care , suggesting that such transitions may be undertaken by individuals who have been in contact with key gatekeepers prior to the move and/or who are already resident in social housing .
patients undergoing induction chemotherapy for acute leukemias are at a particularly high risk of developing neutropenic fever ( nf ) due to the prolonged duration of severe neutropenia . in the majority of these cases , the rapid administration of broad spectrum antimicrobials decreases the risk of progression to septic shock and death . despite advances in antimicrobial therapy and supportive care measures , infection - related complications frequently prolong the duration of hospitalization and continue to be the main causes of early mortality in patients undergoing chemotherapy for acute leukemias . the initiation of broad - spectrum antimicrobials for nf generally occurs at the time of fever . although most patients stabilize after starting treatment , a subgroup of patients deteriorates rapidly into septic shock despite prompt initiation of antimicrobials . a strategy to improve outcomes is the use of antibiotic prophylaxis which has been shown to reduce infection - related mortality , especially with the use of fluoroquinolones . however , antibiotic resistance , fungal overgrowth , and antibiotic - related adverse effects ( e.g. clostridium difficile colitis and allergic responses ) have limited the routine use of antibiotic prophylaxis . an alternative strategy is to initiate antimicrobial therapy just prior to the onset of fever . this strategy may reduce the incidence of infection - related complications by treating at an earlier time point when the pathogen burden is lower and the patient s condition is relatively more stable . to successfully implement this strategy , a practical method for the prediction of nf pro - inflammatory cytokines such as interleukin ( il)-6 , il-1 family members , and tumor necrosis factor - alpha ( tnf- ) substantially increase in response to systemic infections . when they reach the central nervous system , they are able to increase the temperature set point and cause fever through induction of central mediators such as prostaglandins . given that a threshold concentration of these cytokines is required before a fever response is initiated , we hypothesize that increases in their blood concentration should precede the onset of nf . previous studies have focused mainly on the use of biomarkers measured at the time of nf for the prediction of adverse outcomes such as bacteremia or septic shock . in contrast , only a small number of studies have investigated the utility of biomarkers for the prediction of nf . a few of these studies reported an increase in il-6 and il-8 levels before the onset of fever . a common limitation with all these studies is the low frequency of measurement , ranging from three times per week to at most once daily . this limitation may obscure the predictive potential of a biomarker if the change occurs temporally close to the onset of fever . gov identifier nct01144793 ) to assess the feasibility of frequent serial monitoring of blood biomarkers for the prediction of nf in hospitalized patients undergoing intensive chemotherapy for hematologic malignancies . we selected a panel of biomarkers that have previously been shown to be elevated in response to an infection and are thus most likely to rise prior to the onset of fever . we also included protein c which in contrast to the other biomarkers , has been shown to be decreased in the setting of sepsis and therefore its level may drop prior to fever onset . the study had two aims : i ) to identify potential predictive biomarkers that are worthy of further study in a larger cohort to predict nf , and ii ) to assess the feasibility of frequent monitoring of blood biomarkers for future implementation of a bedside device . disease - specific eligibility criteria included adult patients ( 18 years ) with acute myeloid or lymphoid leukemia who were evaluated in the stanford outpatient infusion treatment area ( ita ) or inpatient hematology service . patients undergoing induction or consolidation chemotherapy from april to june in 2008 were enrolled in the study . in our study , we defined neutropenia as an absolute neutrophil count ( anc ) < 0.510/l and fever as a single body temperature greater than 38c . this definition was chosen because it would trigger the initiation of broad - spectrum antibiotics on our inpatient service . enrolled patients were required to have an indwelling catheter in place before sampling could begin . vitals signs were measured at least once every 8 hours and more frequently depending on the patients clinical status . this study received approval from the stanford institutional review board ( irb ) and the stanford cancer institute scientific review committee ( src ) . a full written informed consent was obtained from all patients . whole blood collection from the patient s central venous access line was initiated promptly following informed consent . the protocol specified collection of samples every 8 hours before the onset of fever and within 2 hours after fever developed . sample collection changed to every 6 hours while patients were febrile , and reverted to every 8 hours after patients defervesced and the anc rose above 1.010/l . blood was refrigerated at 4c immediately upon collection and transported to an off - site central facility for further processing . the bulk of the sample was centrifuged and the plasma fraction was aliquoted into 250 l barcoded vials . the plasma samples were then flash frozen in liquid nitrogen and stored at 80c for subsequent measurement of the biomarkers using searchlight protein arrays ( pierce biotechnology , woburn , ma , usa ) . the following nine biomarkers were measured : c - reactive protein ( crp ) , protein c , il-6 , il-8 , il-10 , il-1 , tnf- , monocyte chemotactic protein-1 ( mcp-1 ) , and intercellular adhesion molecule-1 ( icam-1 ) . a small volume of whole blood was used for comparative analysis by a micro sample test ( theranos , palo alto , ca , usa ) . during this development and validation phase , analysis of samples using the micro sample test was performed at an off - site facility . the micro sample processing and analytical system developed by theranos consists of single - use consumables that require only a small volume of blood sample ( 25 l ) for analysis and instrumentation and software enabling serial multiplexed enzyme - linked immunosorbent assays of a wide spectrum of biomarkers . the sample preparation and assays are fully automated and analysis takes less than 1 hour to complete . in this study , the level of significance in the difference between fold - changes for each biomarker was determined using the wilcoxon signed rank test . this test compares the difference between matched pairs ( distal vs proximal value of an individual patient ) and does not assume the fold - change values to be normally distributed . the pearson s correlation coefficient was used to determine strength of correlation between crp levels measured using the searchlight assay and the theranos micro sample test . the graphpad prism software ( version 6 , graphpad software , la jolla , ca , usa ) was used for all calculations . disease - specific eligibility criteria included adult patients ( 18 years ) with acute myeloid or lymphoid leukemia who were evaluated in the stanford outpatient infusion treatment area ( ita ) or inpatient hematology service . patients undergoing induction or consolidation chemotherapy from april to june in 2008 were enrolled in the study . in our study , we defined neutropenia as an absolute neutrophil count ( anc ) < 0.510/l and fever as a single body temperature greater than 38c . this definition was chosen because it would trigger the initiation of broad - spectrum antibiotics on our inpatient service . enrolled patients were required to have an indwelling catheter in place before sampling could begin . vitals signs were measured at least once every 8 hours and more frequently depending on the patients clinical status . this study received approval from the stanford institutional review board ( irb ) and the stanford cancer institute scientific review committee ( src ) . whole blood collection from the patient s central venous access line was initiated promptly following informed consent . the protocol specified collection of samples every 8 hours before the onset of fever and within 2 hours after fever developed . sample collection changed to every 6 hours while patients were febrile , and reverted to every 8 hours after patients defervesced and the anc rose above 1.010/l . blood was refrigerated at 4c immediately upon collection and transported to an off - site central facility for further processing . the bulk of the sample was centrifuged and the plasma fraction was aliquoted into 250 l barcoded vials . the plasma samples were then flash frozen in liquid nitrogen and stored at 80c for subsequent measurement of the biomarkers using searchlight protein arrays ( pierce biotechnology , woburn , ma , usa ) . the following nine biomarkers were measured : c - reactive protein ( crp ) , protein c , il-6 , il-8 , il-10 , il-1 , tnf- , monocyte chemotactic protein-1 ( mcp-1 ) , and intercellular adhesion molecule-1 ( icam-1 ) . a small volume of whole blood was used for comparative analysis by a micro sample test ( theranos , palo alto , ca , usa ) . during this development and validation phase , analysis of samples using the micro sample test was performed at an off - site facility . the micro sample processing and analytical system developed by theranos consists of single - use consumables that require only a small volume of blood sample ( 25 l ) for analysis and instrumentation and software enabling serial multiplexed enzyme - linked immunosorbent assays of a wide spectrum of biomarkers . the sample preparation and assays are fully automated and analysis takes less than 1 hour to complete . in this study , the level of significance in the difference between fold - changes for each biomarker was determined using the wilcoxon signed rank test . this test compares the difference between matched pairs ( distal vs proximal value of an individual patient ) and does not assume the fold - change values to be normally distributed . the pearson s correlation coefficient was used to determine strength of correlation between crp levels measured using the searchlight assay and the theranos micro sample test . the graphpad prism software ( version 6 , graphpad software , la jolla , ca , usa ) was used for all calculations . the median age of the patients enrolled was 49 years ( range : 22 - 70 years ) . the underlying diagnoses were acute myeloid leukemia ( n=12 ) , acute b- or t - lymphoblastic leukemia ( n=3 ) , and chronic myeloid leukaemia in either lymphoid or myeloid blast crisis ( n=2 ) . two of the patients were monitored in the outpatient ita for either all or part of the pre - fever portion of sampling . a total of 1302 samples were drawn over the study period representing 96.5% of the planned draws . in order to determine the relative change in the level of a biomarker prior to the onset of fever , a baseline measurement from which all comparisons are made the sample collected 5 to 7 days prior to the onset of first fever was used as the baseline in our study . the baseline measurement was not available in 5 patients and they were excluded for further analysis . one patient did not have a sample collected within 8 hours prior to onset of first fever and was also excluded . logistical issues with blood sampling included the need for venous catheter line removal due to suspected line infections ( n=2 ) and patient refusal of blood draws ( n=1 ) . for patients who were febrile at the time of enrollment , they were included if the fever resolved within 48 hours of enrollment and was followed by at least a 10-day afebrile interval before onset of the next fever . for this subgroup of patients , the second fever was used as the reference point for analysis . an additional patient was excluded because he was not neutropenic at the time of fever . as a result , of the six patients included for further analysis , five of them had acute myeloid leukemia and the remaining patient had b - cell acute lymphoblastic leukemia ( table 1 ) . all the patients received induction chemotherapy regimens except for patient # 9 who received consolidation therapy for aml . the median duration between the start of chemotherapy and subsequent fever was 8.7 days ( range : 6.8 - 12.7 days ) . the median interval between blood draws in the pre - febrile period was 9 hours ( range : 2 - 45 hours ) and dropped to 7 hours ( range : 2 - 24 hours ) in the 72-hour period following the onset of fever . a source or site of infection was identified in three of the six patients ( table 1 ) . notably , patient # 4 developed septic shock requiring care in the intensive care unit as a result of a klebsiella pneumoniae infection . to identify candidate biomarkers with the potential to predict nf , we determined the fold - changes at two time points for each biomarker and patient . the first one , henceforth referred to as proximal , was the ratio of the measurement drawn just prior to the onset of fever to the baseline measurement collected 5 to 7 days prior to fever onset . the second one , henceforth referred to as distal , was the ratio of the measurement taken between 2.5 to 3.5 days prior to onset of fever to the day 5 - 7 baseline measurement . since the concentration of a predictive biomarker should progressively increase over time prior to the onset of fever , the proximal fold - change should correspondingly be higher than the distal fold - change . of the nine biomarkers measured , only il-6 and crp had a statistically significant ( p<0.05 ) difference between the proximal and distal fold - changes ( figure 1 ) . the mean proximal fold - changes for il-6 and crp were 24.7 ( range : 6.5 - 91 ) and 38.2 ( range : 0.179 - 135 ) and mean distal fold - changes were 1.6 ( range : 1.03 - 1.99 ) and 0.78 ( range : 0.19 - 2.06 ) , respectively . we next determined the time at which il-6 and crp predicted the onset of fever . for each biomarker , the mean of the distal fold - changes plus two standard deviations was used as the cut - off value above which fever was predicted to occur . this method of determining the cut - off assumes that the distal fold - changes reflected mainly physiologic variations in the concentration of the biomarker and were not a direct response to the inciting infection that eventually caused the fever . using this approach , il-6 levels crossed the cut - off value for all patients at a median of 1.3 ( range : 0.4 - 2.3 ) days prior to the onset of fever . for crp , the cut - off was crossed in 4 of the 6 patients at a median of 1.7 ( range : 1.2 - 2.3 ) days before fever onset . a closer inspection of the fever curves of 4 of the study patients in conjunction with their il-6 and crp levels over time clearly demonstrates an upward trend of these biomarkers prior to the onset of fever ( figure 2 ) . taken together , our analysis provides evidence that il-6 and crp may be useful in predicting the onset of nf with a lead time of 1 to 2 days . to demonstrate the feasibility of serial biomarker monitoring with the micro sample test system , we measured the level of crp and protein c in parallel using the same patient samples . because crp proved to be a potentially useful predictive biomarker , we focused our analysis on this biomarker . crp levels of the six fully evaluable patients measured using the micro sample test correlated highly with values obtained using the commercially available searchlight protein arrays ( figure 3 ) . the pearson s correlation coefficient ( r ) between the theranos and searchlight measurements was 0.85 . measurements using the micro sample test also demonstrated a rise in crp levels prior to the onset of fever ( figure 2 ) . a larger study is required to determine if the micro sample test system can be used interchangeably with standard laboratory assays which would support its use to predict nf in the hospital setting . although several cytokines including il-6 , il-1 family members , and tnf- have been implicated in mediating the fever response , il-6 was the only pro - inflammatory cytokine in our array screen that demonstrated promise in the prediction of nf . this finding suggests that il-6 is a predominant cytokine mediating the febrile response in neutropenic patients . crp , which is an acute phase reactant induced by il-6 , was correspondingly also predictive of nf in our study population . these results are in agreement with prior studies that examined changes in il-6 and crp levels . engel et al . reported a significant increase in il-6 levels 24 to 48 hours prior to onset of fever . two other studies reported a similar upward trend 24 to 48 hours before onset of fever with il-6 . as mentioned previously , the frequency of measurement in these prior studies was only three times a week which may be insufficient for the prediction of nf on an individual basis . an advantage of our study is the relatively high frequency of measurements which increases the temporal resolution of biomarker trends and demonstrates the predictive power of il-6 and crp in individual patients . however , there were some challenges to the collection of blood samples at this high frequency including missed draws from nursing staff , the need for central line removal for suspected line infection , and infrequent patient refusal of blood draws . improved communication with the nursing staff and patients as well as a more streamlined sample collection protocol should help overcome the challenges identified in this pilot study . the ability to reliably predict the onset of nf may permit early implementation of broad - spectrum antibiotics in order to reduce the likelihood of infection - related morbidity and mortality . although the number of fully evaluable patients in this pilot , hypothesis - forming study was small , our results point to further exploration of the biomarkers il-6 and crp for prediction of nf . future prospective studies with a larger cohort of patients using the micro sample test system for real - time measurements of these and additional biomarkers are needed to validate our results and determine the sensitivity and specificity of this approach .
radiotherapy plays an important role in the management of head and neck cancer , especially oropharyngeal and nasopharyngeal cancer . radiotherapy is usually recommended as the primary treatment , as an adjunct to surgery , in combination with the chemotherapy , or as a palliative measure . the radiation dose needed for the treatment of cancer depends upon the location and the type of the malignancy and whether or not radiotherapy is the sole treatment or is to be given in combination with other modalities . most patients treated with curative intent receive a total dose between 50 and 70 gy , usually given over a 5 - 7 week period ; treatment being given once a day , five days a week , with 2 gy per fraction . however , in addition to its antitumor effects , ionizing radiation can cause damage to normal tissue located in the field of radiation . in the oral cavity there are complex areas with several dissimilar structures that respond differently to radiation , e.g. , mucosal lining , skin covering , submucosal connective tissue , salivary gland tissue , teeth , and bone / cartilage . acute changes produced by radiotherapy can be observed in the oral mucosa ( oral mucositis ) , skin ( erythema , desquamation ) , salivary glands ( hyposalivation ) , taste buds ( decrease acuity ) , and teeth ( radiation caries ) . at later stages gingival and periodontal changes , including loss of attachment at the radiation sites , have been reported . these changes are not specific and often cause confusion . to the best of our knowledge , in june 2009 , a 30-year - old female patient was referred to the department of periodontics , manipal college of dental sciences , manipal , india , by an ent specialist and oncologist for evaluation of enlargement of the gingiva of 6 months duration and swelling of the lip of 7 months duration . the patient was a known case of carcinoma of the nasopharynx and had received radiotherapy in january 2007 . she gave history of ulcers ( mucositis ) in the oral cavity during the radiotherapy . the gingival swelling had slowly increased in size and turned red in color over the last 6 months . the swelling of the left side of the lower lip had also increased over 7 months though it had been relatively stable the last 1 month . the patient complained of an unaesthetic appearance , discomfort while closing the lips , bleeding while brushing her teeth , and inability to carry out routine oral hygiene procedures . extraoral examination revealed a slight swelling of the lower lip , especially on the left side [ figure 1 ] . the patient did not give any history of trauma ( e.g. , biting her lip ) or insect bite . lymphadema of the lower lip intraoral examination revealed decreased salivary flow , with thick and ropy saliva . there was diffuse gingival enlargement involving the maxillary anterior labial gingiva , with the sweling extending from the mesial surface of the right maxillary canine to the mesial surface of the left canine [ figure 2 ] . left buccal view of the gingival enlargement hard tissue examination showed missing 36 , 37 , and 38 ; the presence of root stumps of 18 , 16 , 45 , and 46 ; and grossly decayed 28 and 48 . all the remaining teeth ( 17 , 15 , 14 , 13 , 12 , 11 , 21 , 22 , 23 24 , 25 , 26 , 27 , 35 , 34 , 33 , 32 , 31 , 41 , 42 , 43 , 44 , and 47 ) showed the presence of caries with periapical changes . considering the history of chemoradiotherapy , the clinical features , and the other changes in the oral cavity , our differential diagnosis included post radiotherapy gingival enlargement and metastasis to the gingiva . the treatment plan was explained to the patient and was modified according to her needs . before beginning the dental treatment , the treatment plan was discussed with the oncologist and the patient 's consent was obtained . antibiotics ( amoxicillin , 1 g , was administered before tooth extraction , with 500 mg t.i.d to be taken for three days post extraction ) all the root stumps were extracted . teeth 17 , 14 , 24 , 26 , 27 , and 47 were decayed and pulpally involved . the patient was given the option of root canal treatment ( rct ) with post - endodontic restorations for these teeth ; however , she refused rct despite several motivational appointments and therefore these teeth were also extracted . rct was done for all the other maxillary and mandibular teeth , and post - endodontic restoration was planned . the treatment plan for the diffuse gingival enlargement was undisplaced flap ( internal bevel gingivectomy ) . during the surgical procedure we encountered unusual bleeding , which was managed without any complications [ figure 3 ] . internal bevel gingivectomy healing after 6 months histopathological analysis did not show any metastatic deposits . gingival tissue from the anterior maxillary region revealed connective tissue stroma that was edematous and densely infiltrated with acute and chronic inflammatory cells . there were numerous dilated blood vessels engorged with red blood cells and a few hemorrhagic areas . the connective tissue was hyperplastic , edematous , parakeratinized stratified squamous epithelium infiltrated with acute and chronic inflammatory cells . the patient was referred to the department of oral and maxillofacial surgery for management of the swelling of the lips , with a provisional diagnosis of lymphedema of the lips secondary to radiotherapy . the patient was referred to the department of oral and maxillofacial surgery for management of the swelling of the lips , with a provisional diagnosis of lymphedema of the lips secondary to radiotherapy . there are several case reports describing the multiple oral changes following radiothrapy.[111 ] among these , oral mucositis appears to be the most common . conventional fractionated radiotherapy ( i.e. , one dose per day , 5 days a week , for 5 - 7 weeks ) and in 100% of patients receiving altered fractionated radiotherapy ( two or more doses per day ) . the incidence of oral mucositis is higher in patients with primary tumors of the oral cavity , oropharynx , or nasopharynx and in those who receive concomitant chemotherapy . it has also been reported that females have an increased risk of developing oral mucositis . in the present case , the post - radiotherapy oral changes seen in this patient included thick ropy saliva , decreased salivary flow , lymphedema of the lower lip , multiple teeth with radiation caries , partial loss of taste sensation , and gingival enlargement . oral mucositis has been postulated to result from the direct toxic effect of radiotherapy or chemotherapy on stem cells in the basal and suprabasal layers of the epithelium . sonis and colleagues , in 2004 , proposed five stages in the pathogenesis of oral mucositis , as follows : initiation of tissue injury , upregulation of inflammation via generation of messenger signals , signaling and amplification , ulceration and inflammation and , finally , healing . the generation of reactive oxygen species , upregulation of proinflammatory cytokines such as tnf- , and expression of adhesion molecule and cyclooxygenase-2 during the five stages of pathogenesis are responsible for causing tissue injury , apoptosis of cells within the submucosa , primary injury of the cells within the basal epithelium , and angiogenesis . in addition , fibronectin breakdown leads to macrophage activation and subsequent tissue injury , which is mediated by matrix metalloproteinase and production of additional tnf-. in addition to the above mechanisms there is also increase in leukocyte adhesion to e - selectin or increase in endothelial intercellular adhesion molecules ( icam-1 ) , which promotes a radiation - induced inflammatory response in squamous epithelium . there is also decrease in the level of salivary epidermal growth factor , with consequent inhibition of the protective mechanisms of oral mucosa . the gingiva is a part of the oral mucosa and the mechanism of pathogenesis may be the same as that described for oral mucositis . another possible mechanism for the gingival enlargement is related to increase in gram - negative bacilli . a shift in the oral microflora and increase in the level of endotoxins released by gram - negative bacilli could play a major role in the development inflammatory changes in the gingiva . hyposalivation and altered flow and consistency of the saliva also contribute to the alteration in the oral microflora and the normal defense mechanisms , which can initiate the changes in the gingiva . loss of teeth , partial loss of taste sensation , hyposalivation , and change in the life events bring about changes in the quantity and quality of food intake , with the resulting nutritional deficiencies leading to altered tissue response and consequent gingival enlargement . in the present case , gingival enlargement and enlargement of the lower lip tissues with a rapid turnover manifest acute reactions ( early effect ) , whereas tissues with slower turnover may not show evidence of damage for months or even years after therapy . gingival connective tissue and the other components of the periodontium have different turnover rates and respond differently to radiation . in the present case , several carious teeth with pulpal involvement could have been restored and maintained in the dental arch . however , the stress associated with cancer therapy and the life event changes made the patient unwilling to undergo rct and opt , instead , for extraction of the teeth . it is important that patients undergoing radiotherapy receive appropriate motivation and education regarding dental care , which is necessary for the proper management of oral changes , especially of carious teeth . any unusual appearance of the gingiva that is not related to plaque should be evaluated early . the lesion should be subjected to histopathological evaluation so that appropriate treatment can be provided at an early stage .
microspordia are emerging pathogens in recalcitrant stromal keratitis.1 the disease is difficult to diagnose both clinically and by laboratory diagnosis . existing reports have shown clinical and histological evidence that the disease is restricted to the stroma , with no recurrence after penetrating keratoplasty.12 currently , there is little evidence demonstrating penetration into the anterior chamber ( ac ) . we report a case of stromal microsporidial keratitis with presence of an intact descemet membrane ( dm ) and demonstrable microsporidial spores in the ac exudates . a 26 year old healthy male presented on november 1 , 2008 with a one - year history of recurrent redness , pain and watering in the right eye . the patient was a non - diabetic , with good general health and nutritional status . the condition waxed and waned despite multiple ophthalmology consults , and therapy that included topical antibiotics , corticosteroids and oral antiviral medication . slit lamp examination showed intact , edematous epithelium , while the underlying stroma showed multiple , gray - white irregular to oval shaped flocculent infiltrates with indistinct borders ; diffusely distributed over the entire cornea ( except the limbus ) , involving the deep stroma [ figures 1a and b ] . ( a and b ) slit lamp photographs showing the dense corneal infiltrates at presentation . the smear revealed multiple oval , spore - like structures , with a waist - band which was gram positive , 1% acid fast positive and showed blue fluorescence on potassium hydroxide with calcofluor white stain , confirming a diagnosis of microsporidial stromal keratitis . medical therapy was instituted with topical 0.02% chlorhexidine gluconate ever half - hour and oral albendazole 400 mg twice daily ; however here was no response even after three weeks [ figure 1c ] . a 9.5 mm corneal graft was sutured with 16 interrupted sutures into a 10 mm recipient bed . postoperatively , the patient was prescribed topical chlorhexidine 2% eight times a day ( formulated in the hospital pharmacy ) which was discontinued after three weeks , topical prednisolone acetate 1% eight times a day tapered over the next several months , and topical atropine sulphate 1% three times a day for two weeks . however , a year later , the patient presented with severe allograft rejection ( he had stopped topical steroids ) and subsequently the graft failed . an endothelial keratoplasty was performed and the patient was doing well at the last follow - up , two years postoperatively . the histopathology of the corneal button revealed an ulcerated cornea with dense inflammatory infiltrates in the stroma composed of neutrophils , lymphocytes and plasma cells with stromal necrosis . numerous microsporidial spores were present in the deeper stroma upto the dm [ figures 2a c ] on gram stain and 1% acid - fast stain . the ac exudates noted in some sections showed the presence of microsporidial spores [ figure 2d arrow ] . ( a ) section of the cornea shows epithelial ulceration , dense stromal infiltrates and ac exudates posterior to and separate from the dm ( h and e , 10 ) . ( b ) 1% acid fast stain shows brightly stained microsporidial spores within the posterior stroma . ( c ) under higher magnification ( 100 ) , the spores show the characteristic waist - band . ( d ) 100 magnification with 1% acid fast stain showing presence of microsporidial spore ( arrow ) in the ac exudate microsporidial keratitis is an emerging , opportunistic clinical entity caused by parasites belonging to the genus microspora.1 clinically the stromal form presents with mid to deep stromal infiltrate mimicking stromal hsv keratitis . vemuganti et al , reported the largest series ( five cases ) of stromal microsporidial keratitis from this center that underwent penetrating keratoplasty , where the presentation ranged from stromal infiltrate to thinning with descemetocele formation.1 interestingly , font et al , reported a case of stromal microsporidial keratitis which had recurrence of infection following therapeutic dalk ; requiring a penetrating keratoplasty.2 das et al , recently reported a case of microsporidial keratits with the spores noted in the ac exudates.3 there have been reports on intraocular microsporidiosis causing endophthalmitis45 or sclero - uvetis with retinal detachment,6 however the mechanism of spread was presumed to be a systemic in these reports and none - of these patients had corneal involvement . with the current cases being reported , it is possible that the spread could have been through the intact ocular tissues rather than a hematologic route . our case clearly demonstrates the presence of microsporidia in the ac exudates ; which to our knowledge is the second case reported in literature . this finding may suggest a hitherto unknown , additional pathogenic mechanism of microsporidia with an ability to penetrate the intact dm ( similar to fungi , under which these organisms have been reclassified7 ) . with an increasing trend towards dalk , it would be important to note that in the presence of endothelial exudates or ac exudates , a penetrating keratoplasty is preferred over lamellar keratoplasty , as the latter may be associated with recurrence of infection .
diabetic neuropathy is the most common microvascular complication of diabetes , and it is a major cause of morbidity and mortality . neuropathy is estimated to be present in 10%90% of the patients with diabetes although it changes according to diagnostic criteria and patient population . diabetic peripheral neuropathy is the most common type of diabetic neuropathy , and it is frequently used synonymously with it . early diagnosis and appropriate treatment are important to prevent disease complications , especially diabetic foot and ulceration , but there is not a single and simple method that can be used to diagnose diabetic peripheral neuropathy . according to american diabetes association ( ada ) recommendations , diabetic peripheral neuropathy diagnosis in clinical practice is made in the presence of signs and symptoms of peripheral nervous system dysfunction after other causes of neuropathy are excluded in patients with diabetes . considering that 50% of the patients with diabetic peripheral neuropathy have no symptoms consistent with neuropathy , neurological examination of the patients should be carefully performed . to confirm the diagnosis , quantitative electrophysiological tests and sensory and autonomic function tests the aim of this study was to compare the effectiveness of michigan neuropathy screening instrument ( mnsi ) , neurothesiometer , and electromyography ( emg ) in detecting diabetic peripheral neuropathy in patients with diabetes type 2 . the study was conducted in ankara numune education and research hospital department of endocrinology from september 2009 to february 2010 . 106 type 2 diabetes patients with or without symptoms of neuropathy were enrolled in the study . patients who had conditions that could present with neuropathy such as hereditary sensory neuropathy , vitamin b12 or folate deficiency , paraneoplastic conditions , autoimmune diseases , uremia , hypothyroidism , and ethanol abuse were excluded . patients ' height and weight were measured and used to calculate body mass index ( bmi ) . hypertension was defined as 140/90 mmhg at examination or presence of antihypertensive treatment . medication history ( use of insulin , oral antidiabetic , antihypertensive , and lipid - lowering drugs ) was noted . retinopathy was classified into five categories using an international system of classification : absence of retinopathy , mild nonproliferative retinopathy , moderate nonproliferative retinopathy , severe nonproliferative retinopathy , and proliferative retinopathy . the study complied with the declaration of helsinki and was approved by the local research ethics committee . lipid profile ( total cholesterol ( tc ) , triglycerides ( tg ) , and high - density lipoprotein cholesterol ( hdl - c ) ) were measured with colorimetric enzymatic method ( aerost device , abbott diagnostics , usa ) . low - density lipoprotein cholesterol ( ldl - c ) hyperlipidemia was considered present when lipid - lowering drugs were in use or when samples at admission showed total cholesterol 200 mg / dl or triglycerides 150 mg / dl . glycosylated hemoglobin ( hba1c ) was measured by immunoturbidimetric method ( c8000 device , abbott company , usa ) . for the diagnosis of nephropathy , the patients were asked to collect urine for 24 hours after urinating the first urine in the morning and not to do any exercise 24 hours before and during the collecting procedure . urinary albumin excretion ( uae ) was measured with multigent microalbumin ( alb ) turbidimetric immunoassay method ( aerost device , abbott diagnostics , usa ) . we considered < 30 mg / day as normoalbuminuria , 30300 mg / day as microalbuminuria , and > 300 mg / day as macroalbuminuria . microalbuminuria is defined as a total of three positive 24-hour urine collections measured at different days to confirm the diagnosis . plasma creatinine levels of the patients were measured , and glomerular filtration rate ( gfr ) was calculated using the chronic kidney disease epidemiology collaboration ( ckd - epi ) formula . b12 levels of all patients were measured by chemiluminescence method on an advia centaur xp analyser . all patients were evaluated for diabetic peripheral neuropathy using mnsi , emg , and neurothesiometer . a 15-item questionnaire form of mnsi consisting of yes / no questions was applied to all the patients . 13 items assess symptoms of diabetic peripheral neuropathy , 1 item assesses peripheral vascular disease , and 1 item assesses general asthenia . answer the following yes or no questions based on how you feel in your legs and feet.are your legs and/or feet numb ? have you ever had burning sensation in your legs and/or feet?are your feet too sensitive to touch?do you get muscle cramps in your legs and/or feet ? have you ever had any prickling feelings in your legs or feet?does it hurt when the bed covers touch your skin?when you get into the tub or shower , are you able to distinguish the hot water from the cold water?have you ever had an open sore on your foot ? has your doctor ever told you that you have diabetic neuropathy?do you feel weak all over most of the time?are your symptoms worse at night?do your legs hurt when you walk?are you able to sense your feet when you walk?is the skin on your feet so dry that it cracks open?have you ever had an amputation ? when you get into the tub or shower , are you able to distinguish the hot water from the cold water ? are you able to sense your feet when you walk ? is the skin on your feet so dry that it cracks open source : a practical two - step quantitative clinical and electrophysiological assessment for the diagnosis and staging of diabetic neuropathy . diabetes care 1994 ; 17 : 1281 - 9 . after the questionnaires , patients were evaluated neurologically . in physical examination , feet were evaluated for deformity , dry skin , callus , infection , and ulceration . foot deformities included prominent metatarsal heads , hallux valgus , joint subluxation , and charcot joint . one point was given if any of these signs were present and an additional one point was given if ulceration was present . vibrating fork was located on the interphalangeal joint of the right great toe . if the patient could not perceive vibration , two points were given . if the patient perceived vibration on the great toe , diaposone was located over ankle ( inner malleolus ) while it was still vibrating and the patient was asked to compare vibrations from two locations . if vibration was perceived better in ankle , 1 point was given . zero point was accepted as normal , 1 point showed mild - moderate deficit , and 2 points showed a severe deficit . patients with normal achilles reflex were given 0 point while patients with decreased achilles reflex got 0.5 point and patients with no reflex got 1 point . in physical examination , feet were evaluated for deformity , dry skin , callus , infection , and ulceration . foot deformities included prominent metatarsal heads , hallux valgus , joint subluxation , and charcot joint . one point was given if any of these signs were present and an additional one point was given if ulceration was present . vibrating fork was located on the interphalangeal joint of the right great toe . if the patient could not perceive vibration , two points were given . if the patient perceived vibration on the great toe , diaposone was located over ankle ( inner malleolus ) while it was still vibrating and the patient was asked to compare vibrations from two locations . if vibration was perceived better in ankle , 1 point was given . zero point was accepted as normal , 1 point showed mild - moderate deficit , and 2 points showed a severe deficit . patients with normal achilles reflex were given 0 point while patients with decreased achilles reflex got 0.5 point and patients with no reflex got 1 point . positive responses and abnormal physical examination findings were recorded in the questionnaire form . in the questionnaire form risk of neuropathy diabetic peripheral neuropathy was diagnosed in patients with a physical examination score 2.5 . in this study mnsi was accepted as a diagnostic test according to ada recommendations . for neurothesiometer evaluation a tsa ii device ( neurosensory analyzer model tsa ii , medoc ltd . , thermal tests quantitatively measure hot , cold sensations and pain sensation induced by these and compare them with corresponding age group . deviance from normal values may show presence of peripheral nervous system disease . in vibratory tests , the same type measures are made and compared with vibration thresholds of the population . patients sat comfortably in a quiet room with a room temperature of 1822c . before the test , the patient was informed about the procedure and a trial was made without recording . thermod was fixed to the surface to be tested ( in our study to right palmar thenar and to right foot 1 . metatarsal regions ) , with metal surface contacting adequately with skin . for sensory measurements , patients were asked to push the button as soon as they perceived the heat changes . in thermal test mode , thermod was attached to patients ' skin ( first to the right palmar thenar surface , then to the right foot plantar 1 . after a few seconds patients could not perceive any difference in temperature . for threshold detection , data were recorded by a computer when the patient pushed the button in her / his hand and each cyclus of the measurement was completed after this . cold sensation perceived by a delta fibers was generally 1 - 2c below adaptation temperature . the threshold value of pain sensation induced by heat which is generally conducted with c fibers and partially a delta fibers was approximately 45c . the pain sensation induced by cold which is conducted both with c and a delta fibers had a threshold value of 10c . for pain measurements patients were told that it was not a pain tolerance test and they should push the button as soon as they perceive pain . sense of vibration was measured from plantar side of the right foot , the 1st metatarsal region . one of them was increasing stimulus intention till it was perceived and the other was decreasing stimulus intention till it could not be perceived . then printouts were obtained . heat sensation conducted with c fibers was generally 1 - 2c above adaptation temperature . cold sensation perceived by a delta fibers was generally 1 - 2c below adaptation temperature . the threshold value of pain sensation induced by heat which is generally conducted with c fibers and partially a delta fibers was approximately 45c . the pain sensation induced by cold which is conducted both with c and a delta fibers had a threshold value of 10c . for pain measurements patients were told that it was not a pain tolerance test and they should push the button as soon as they perceive pain . sense of vibration was measured from plantar side of the right foot , the 1st metatarsal region . one of them was increasing stimulus intention till it was perceived and the other was decreasing stimulus intention till it could not be perceived . threshold values for heat , cold , and vibration were measured in all the patients . nerve conductions were studied using nihon kohden meb-9104k neuropack device ( tokyo , japan ) . nerve conduction studies were as follows : ulnar nerve sensory and motor conductions in upper extremity and deep peroneal motor , posterior tibial motor , and sural nerve conductions in both lower extremities . based on the results of a study of the turkish population , the normal limits for nerve conduction evaluations were determined as follows : distal latency for ulnar nerve motor conduction was 3.3 ms , compound muscle action potential ( cmap ) amplitude was 7 mv , motor conduction velocity was 39.6 m / s ; ulnar nerve distal sensory conduction speed was 37.3 m / s , amplitude was 7 v ; deep peroneal nerve motor conduction distal latency was 5.8 ms , amplitude was 3.6 mv , conduction speed was 40.9 m / s , f response latency was 52 ms ; sural nerve conduction speed was 33.8 m / s , amplitude was 5 v . at least two pathological nerve conductions , one of which was in the sural nerve , led to symmetric polyneuropathy diagnosis . statistical evaluations of the results of this study were done using ibm spss ( statistical package for social sciences ) for windows 20.0 . in the assessment , in addition to descriptive statistical methods ( frequency , mean , and standard deviation ) , t - test was used for the comparison of data and logistic regression analysis was used for diagnostic comparisons . we used a 95% confidence interval and considered a p value < 0.05 as statistically significant . demographic data of 106 patients with diabetes type 2 included in this study are given in table 1 . four patients recently had diabetes diagnosis and they were not receiving diabetes treatment at the time of testing . fifty - seven patients were using oral antidiabetics , 24 were using insulin , and 21 were using insulin and oral antidiabetic combination . of the patients with hyperlipidemia , 21 patients were on statins , and 14 were on fenofibrate treatment . mean values for ldl cholesterol and triglyceride levels were 108.1 mg / dl and 176.4 mg / dl , respectively . retinopathy was detected in 26 patients ( 16 mild nonproliferative , 4 severe nonproliferative , and 6 proliferative retinopathy ) and nephropathy was detected in 28 patients ( 23 patients had microalbuminuria and 5 had macroalbuminuria ) . mean glomerular filtration rate was 92 ml / min/1.73 m. in the assessment for neuropathy , the mean score of the patients obtained in the mnsi questionnaire form was 6.7 2.7 ( maximum 12 , minimum 3 points ) . after the questionnaire , physical examination part of mnsi was applied to the patients . according to mnsi , diabetic peripheral neuropathy ( score 2.5 ) mean diabetic period for the 34 patients diagnosed with diabetic peripheral neuropathy by mnsi was 125.9 ( 0300 ) months . the diabetic period was longer compared to the patients not diagnosed by mnsi , and the difference was statistically significant ( p = 0.04 ) . while 13 patients had hypertension , 25 patients were diagnosed with hyperlipidemia and 11 patients were on lipid - lowering treatment because of this . there was no statistically significant difference between the groups in terms of hypertension , hyperlipidemia , and obesity ( p = 0.72 , p = 0.07 , and p = 0.08 , resp . ) . retina examination showed proliferative retinopathy in 6 patients , mild nonproliferative retinopathy in 4 patients , and severe nonproliferative retinopathy in 3 patients . retinopathy was higher in the group diagnosed with diabetic peripheral neuropathy by mnsi compared to the group without diabetic neuropathy ( p = 0.01 ) . in the neuropathic group , 12 patients had microalbuminuria and 3 had macroalbuminuria . there was no significant difference between the groups ( p = 0.089 , p = 0.18 , resp . ) . as a result of emg evaluations , neuropathy was diagnosed in 54 patients ( 50.9% ) . of these patients , 10 patients had sensory neuropathy , 9 patients had motor neuropathy , and 30 patients had both sensory and motor neuropathies . neurothesiometer evaluations revealed change in heat and/or vibration thresholds in 79 of 106 patients ( 74.5% ) . increase in threshold was detected in cold sensation in 5 patients and in heat sensation in 10 patients . eighteen patients had threshold increase both in cold and heat sensations , 13 patients had increase in vibration sense threshold , and 33 patients had increase in both thermal ( cold and heat ) and vibration sense thresholds . when only mnsi score was used for diagnosis , diabetic peripheral neuropathy was detected in 34 of 106 patients ( 32.1% ) . polyneuropathy findings were detected in 49 patients ( 46.2% ) with emg and in 79 patients ( 74.5% ) with neurothesiometer ( table 2 ) . 30 ( 91.2% ) of the patients diagnosed with diabetic peripheral neuropathy by mnsi were diagnosed with thin fiber neuropathy by neurothesiometer and 20 ( 58.8% ) had emg consistent with diabetic peripheral neuropathy . in neurothesiometer evaluation , threshold increases were detected in both thermal and vibration senses in 12 patients , in thermal sense in 4 patients , in heat and vibration senses in 7 patients , only in vibration sense in 4 patients , in cold and vibration senses in 1 patient , and in heat sense in 2 patients . in emg evaluation 14 patients had distal peripheral sensory and motor neuropathy , 4 patients had only motor , and 2 patients had only sensory neuropathy . emg was normal in 14 patients who had neuropathy detected by mnsi . in neurothesiometer evaluation increase in thermal and/or vibration senses consistent with diabetic peripheral neuropathy was detected in 79 patients included in this study . in 30 ( 39.2% ) of these patients neuropathy was also detected by mnsi and in 45 ( 42% ) patients polyneuropathy was detected by emg . mnsi questionnaire form revealed findings consistent with neuropathic pain ( number of positive responses 7 ) in 44 patients who were detected to have diabetic peripheral neuropathy by neurothesiometer . these results showed that probability of neuropathy according to both mnsi questionnaire form and mnsi physical examination results was high in patients detected to have nerve conduction defects by neurothesiometer ( p < 0.01 ) . in 17 ( 37.5% ) patients detected to have dysfunction by neurothesiometer , neuropathy could not be detected by mnsi or emg . in emg evaluation 49 patients ( 46.2% ) had diabetic polyneuropathy . in 20 ( 37% ) of these patients , neuropathy was also present according to mnsi examination score . in patients detected to have nerve conduction deficit with emg , probability of being symptomatic ( questionnaire score 7 ) according to the questionnaire form was 58.5% . no significant difference could be detected between emg and mnsi ( p > 0.05 ) . in neurothesiometer evaluation nerve conduction deficit was detected in 89.7% of the patients who had dysfunction consistent with neuropathy in emg ( p < 0.001 ) . in 4 patients ( 11.8% ) who had dysfunction in emg positive and negative predictive values when two methods used together were 40% and 73% , respectively . epidemiologic studies have identified the duration and severity of hyperglycemia as major risk factors for the development of diabetic neuropathy in patients with diabetes [ 9 , 10 ] . in our study we identified a longer diabetic period in the group diagnosed with diabetic peripheral neuropathy than in the group without diabetic neuropathy . however , we did not find any difference in the glycemic regulations of the groups . a study on the role of glucose control on the neuropathy in patients with type 1 and type 2 diabetes suggests that in type 1 diabetes , glucose control has a large effect on the prevention of neuropathy ; therefore , future efforts should continue to concentrate on this avenue of treatment . in contrast , patients with type 2 diabetes , glucose control does not play a significant role in the prevention of neuropathy . vascular risk factors also appear to be associated with the risk of developing diabetic neuropathy . evidence of this association comes from the european diabetes ( eurodiab ) prospective complications study . in addition to duration of diabetes and glycosylated hemoglobin value , the incidence of neuropathy was significantly associated with increased triglyceride level , body mass index , smoking , and the presence of hypertension at baseline . similarly , in our study , we evaluated 106 patients with diabetes type 2 not only in terms of neuropathy prevalence but also for vascular risk factors . we found no significant difference between the 34 patients diagnosed with diabetic peripheral neuropathy by mnsi and those without a diagnosis of neuropathy in terms of hypertension , hyperlipidemia , and obesity prevalence . however , we observed an increased rate of retinopathy , another microvascular complication of diabetes , in patients diagnosed with neuropathy . in this study we compared the effectiveness of three different methods that can be used in the diagnosis of diabetic polyneuropathy . emg and neurothesiometer were used to confirm diagnosis and to evaluate the diagnostic efficiency of each of the methods used in this study . mnsi score was 2.5 in 34 patients involved in our study and diagnosis of diabetic neuropathy was made . this test was developed by neurology department of michigan university and had first been applied to 56 patients with diabetes . these patients had also been evaluated for diabetic neuropathy according to san antonio consensus statement and mayo clinic protocol . neuropathy had been detected in 28 of 29 patients that had an mnsi score > 2 . in questionnaire form of mnsi , 20 patients with diabetic neuropathy and 18 patients without diabetic neuropathy had given positive responses to 6 questions . but 2 patients that had not had neuropathy and 14 patients that had neuropathy had given positive responses to 7 questions . these results had shown that many patients without neuropathy gave positive responses to 6 questions . similarly , in our study of 34 patients who were diagnosed as diabetic neuropathy based on mnsi , 24 gave positive responses to 7 questions , and of the 72 patients who were not diagnosed as diabetic neuropathy , 28 gave positive responses to 7 questions . these results suggest that diagnosing neuropathy depending only on symptoms can be misleading . in the second part of our study , emg was performed to all the patients included in our study . like our study nerve conduction studies were made in the second part of the test recommended by michigan university to confirm the diagnosis and to grade neuropathy . in the section called michigan diabetic neuropathy score ( mdns ) , patients were evaluated with neurological examination , nerve conduction studies , neuropathic deficiency score ( nds ) , vibration threshold , autonomic function tests , and neuropathy symptom profile ( nsp ) , and results were graded from 0 to 3 . abnormal nerve conduction results were seen in 69% of patients detected to have neuropathy with mnsi . in our study , in 20 of the patients ( 58.8% ) diagnosed with neuropathy by mnsi , nerve conduction defect was detected with emg . in our study , apart from evaluation made by michigan university , emg was also applied to patients who could not be diagnosed with mnsi . in this group of patients mnsi failed to diagnose neuropathy , and peripheral nerve conduction deficits were observed in 29 patients . although abnormal electrodiagnostic tests are not considered as diagnostic by themselves , this result has shown that nerve conduction deficits developed at a high rate even in patients who were not diagnosed with neuropathic based on signs and symptoms . these patients have an increased risk for complications based on neuropathy and they should be followedup . in this multicenter cross - sectional study done in turkey , neurologic examinations and nerve conduction studies along with clinical diabetic neuropathy score and leeds assessment of neuropathic symptoms and signs pain scale were performed on 1113 patients with diabetes to determine the prevalence of diabetic peripheral neuropathy . prevalence of diabetic peripheral neuropathy determined only by clinical examination was 40.4% and it rose to 62.2% , when nerve conduction studies were combined with clinical examination . similarly , in our study , we observed that using clinical examinations and nerve conduction studies together is important for accurate diagnosis of dpn . if neuropathy mainly affects thin , unmyelinated nerve fibers , electrophysiological tests are frequently normal . neurothesiometer device was developed in recent years for quantitative sensory testing ( qst ) ( case iv device was developed by peter dyck and colleagues ) . it allows appropriate evaluation of threshold values for vibration , heat , and pain senses . neurothesiometer allows evaluations in which intensity and features of the stimulus are controlled well ( e.g. , tests applied to the same patient at different times and in different centers give the same results ) . qst is a valuable device to follow progression of neuropathy in patients with diabetic neuropathy . in our study , neurothesiometer evaluation was applied to all the patients as a qst and threshold values for vibration , heat , and pain were evaluated . in neurothesiometer evaluation increased threshold was detected in 79 patients . in 30 ( 39.2% ) of these patients neuropathy was present in mnsi . according to mnsi questionnaire form positive response number was 7 in 44 ( 57.7% ) patients . in 30 of 34 patients diagnosed with neuropathy by mnsi , neurothesiometer showed nerve conduction deficit . in 89.7% of patients detected to have a dysfunction consistent with neuropathy in emg , nerve conduction deficit was also detected with neurothesiometer ( p < 0.001 ) . this test is a noninvasive screening test , but it can not be diagnostic by itself because of its subjective nature . it was used to evaluate neuropathy incidence in 1011 patients who had a diagnosis of diabetes for more than 10 years in spain to evaluate neuropathy prevalence . diagnosis of neuropathy was confirmed by dn4 questionnaire form developed by french neuropathic pain group which includes both history and physical examinations . after the study neuropathy this study suggests that polyneuropathy is underdiagnosed and quantitative evaluation will be helpful . in a study by kincaid et al . , clinical evaluation , nerve conduction study , and neurothesiometer were compared in the diagnosis of diabetic neuropathy . in a multicenter study involving 227 patients with diabetes mellitus , vibration threshold was measured with neurothesiometer , and peroneal , tibial , and sural nerves were evaluated with nerve conduction studies . results of this study showed that these tests can not be used interchangeably , but they could be complementary . a study of 152 patients with diabetic peripheral neuropathy gave the patients electrodiagnostic evaluation and quantitative vibration perception thresholds testing with the vibratron ii and neurothesiometer and concluded that vibration perception thresholds determined with the neurothesiometer are less variable than the thresholds determined with the vibratron and they are more reflective of peripheral nerve function . the results of this study indicate that the neurothesiometer can be used reliably in clinical research trials . in a study with 2022 diabetic patients , peripheral polyneuropathy was diagnosed by vibration perception threshold at the tip of both great toes using a 128-hz tuning fork and a neurothesiometer . vibration perception threshold was also measured in 175 nondiabetic control subjects to define normal values . finally , the vibration perception threshold measured by the neurothesiometer was 2.5 times higher in patients with an abnormal tuning fork test . the plot of the difference of both methods against their mean yielded a good agreement of the two vpt measurements . in conclusion , this study evaluated 106 diabetic patients and found dysfunction consistent with neuropathy in 34 patients with mnsi , in 54 patients with emg , and in 79 patients with neurothesiometer . although electrodiagnostic evaluations do not have diagnostic value themselves according to ada , they are thought to confirm the diagnoses . however in our study a higher rate of neuropathy was observed in electrophysiologic tests than in anamnesis and physical examination . symptoms consistent with neuropathy were also detected in patients who were diagnosed with neuropathy by emg and neurothesiometer but were not diagnosed neuropathy by mnsi . according to these data , diagnosing with diabetic neuropathy based only on anamnesis and physical examination will cause underdiagnosis of the problem . mnsi can be performed easily by a physician at office conditions although emg requires an experienced neurologist and neurology laboratory . to perform neurothesiometer , but if early diagnosis of diabetic peripheral neuropathy and thus prevention of complications with high morbidity are taken into account , common use of electrodiagnostic methods can be considered to be cost - effective .
epilepsy , which is characterized by recurrent seizures , is one of the most common neurological disorders in the world . abnormal synchronization of neuronal discharges plays critical role in seizures ( carlen et al . , 2000 ) . besides chemical synapses , direct coupling via gap junction ( gj ) channels provides a second major pathway contributing to pathologic neuronal synchronous firing in various in vitro ( ross et al . , 2000 ; khling et al . , 2001 ; traub et al . , 2001 ; jahromi et al . , 2002 ) and in vivo ( perez - velazquez et al . , 1994 ; szente et al . , 2002 ; traub et al . , 2002 ; gajda et al . , each gj channel consists of two hemichannels termed connexon , each of which is composed of six subunit proteins called connexin ( cx ) . progressive understanding of the role of gjs in neuronal synchronization and generation of epileptic discharges has led to the identification of cxs as potential molecular targets for development of antiepileptic drugs ( meldrum and rogawski , 2007 ) . temporal lobe structures and notably hippocampus are among most susceptible regions involved in acquisition of epilepsies and therefore temporal lobe epilepsy is the most common form of epilepsy ( wiebe , 2000 ) . there is strong evidence that gjs play a role in the fast oscillations that precede the onset of seizures discharges in the hippocampus ( lebeau et al . , 2003 ; traub et al . , 2011 ) . in ca1 subfield of the hippocampus , paravalbumin positive gabaergic interneurons form a vast dendrodendritic network , which is responsible for synchronized oscillations in hippocampus and thereby promote inhibitory transmission ( fukuda and kosaka , 2000 ) . morphological ( fukuda and kosaka , 2000 ; baude et al . , 2007 ) and electrophysiological ( venance et al . , 2000 ) evidence indicate that electrical coupling between gabaergic interneurons in this region is mediated by cx36 . hence , it might be anticipated that enhancement of cx36 gj communication ( gjc ) in this region can reinforce the inhibitory circuit and thereby limit neuronal hyperexcitability and propagation of abnormal discharges to the neighboring areas . ( 2010 ) that cx36 knockout mice has a markedly lowered seizure threshold for generalized tonic - clonic seizures compared to wild type animals . furthermore , pharmacologic blockade of cx36 gjs induces an excitatory effect on seizure - like activity in rat cortical slices ( voss et al . , 2009 ) . quinine , the old anti - malaria drug , is the only available specific blocker of cx36 ( srinivas et al . , 2001 ) , which is currently used as a pharmacologic tool in research on the function of cx36 in seizures ' mechanisms . quinine suppresses ictal epileptiform activity in vitro without decreasing neuronal excitability ( bikson et al . , 2002 ) . quinine has anticonvulsive effect at the already active epileptic focus and suppresses seizure activity in rat neocortex in vivo ( gajda et al . , 2005 ) . it also decreases amplitude and frequency of epileptiform spikes in penicillin model of epilepsy ( bostanci and bagirici , 2007 ) . quinine protects mice and rats against ptz - induced seizures ( nassiri - asl et al . , 2008 , 2009 ) . moreover , quinine injection into the entorhinal cortex of seizing rats has diminished the frequency and amplitude of the discharges in the hippocampus ( medina - ceja and ventura - meja , 2010 ) . in contrast , quinine has proconvulsant effect on rat cortical slices ( voss et al . , 2009 ) . moreover , transgenic mice lacking cx36 are seizure prone ( jacobson et al . , 2010 ) . cx36 blockade has been ineffective in reducing seizure - like activity in neocortical mouse slices ( voss et al . , 2010 ) . in spite of these extensive in vitro and in vivo investigations , role of cx36 containing gjs present in ca1 area of the hippocampus , in seizure initiation and development of epilepsy is not directly evaluated . in this study , we examined effect of intra - ca1 injection of quinine , on amygdala - kindled seizures . furthermore , impact of cx36 blockade on acquisition of kindled seizures ( epileptogenesis ) was also examined . male wistar rats ( 270 - 320 g , pasteur institute of iran ) were used throughout this study . the animals were housed in standard plexiglas cages with free access to food ( standard laboratory rodent 's chow ) and water . the animal house temperature was maintained at 23 1 c with a 12 h light / dark cycle ( light on from 6.00 am ) . animal experiments protocol was approved by the review board and ethics committee of pasteur institute and conformed to european communities council directive of november 1986 ( 86/609/eec ) . stereotaxic surgery and kindling procedure the rats were anesthetized with intra - peritoneal ( i.p . ) injection of 60 mg / kg ketamine ( rotex medica , germany ) and 10 mg / kg xylazine ( candelle , ireland ) . the animals were then stereotaxically implanted with bipolar stimulating and monopolar recording stainless - steel teflon - coated electrodes ( a.m. systems , usa , twisted into a tripolar configuration ) , in the basolateral amygdala ( coordinates : a , -2.5 mm from bregma ; l , 4.8 mm from bregma and v , 7.3 mm from dura ) of the right hemisphere ( paxinos and watson , 2005 ) . an injection guide - cannula was also implanted into the ca1 area of right hippocampus ( coordinates : a , 3.8 ; l , 2.3 and v , 2.4 mm from dura ) . the animals were given 7 days for recovery after surgery , before the kindling protocol was started . one week after surgery , afterdischarge ( ad ) threshold was determined in amygdala by a 2-sec , 100-hz monophasic square - pulse stimulus of 1 msec per pulse . the stimulation was initially delivered at 50 a and then at 5-min intervals , increasing stimulus intensity in increments of 50 a was delivered , until at least 5 sec of ad was recorded ( beheshti et al . , 2010 ) . then , the animals were stimulated at ad threshold once daily until three consecutive stage 5 seizures were elicited according to racine classification as stage 1 , facial clonus ; stage 2 , head nodding ; stage 3 , forelimb clonus ; stage 4 , rearing and bilateral forelimb clonus ; stage 5 , rearing , loss of balance and falling ( racine , 1972 ) . quinine ( hemisulfate salt monohydrate , sigma - aldrich ) and artificial cerebrospinal fluid ( acsf with composition ( in mm ) of 124.0 nacl , 25 nahco3 , 10 d - glucose , 4.4 kcl , 2 mgso4 , 1.25 kh2po4 , and 2 cacl2 ) were infused ( 1 l in 5 min ) into ca1 by a 27-gauge cannula , which was extended 1 mm below the tip of guide cannula . effect of intra - ca1 injection of quinine on kindled seizures quinine at doses of 1 , 50 , 100 , 500 , and 2000 m / rat was infused into ca1 of 5 groups of kindled rats ( n=7 ) and after 10 and 30 min time intervals , amygdala was stimulated at ad threshold . this time point was selected based on previous report indicating that peak effect of quinine appears 10 min after cerebral application ( gajda et al . , 2005 ) . ad duration ( add ) , behavioral seizure severity ( ss ) , and duration of stage 5 seizure behavior ( s5d ) were then measured in each animal . the animals served as their own control groups ; i.e. the rats received acsf intra - ca1 24 h before quinine administration , and evoked seizure parameters were recorded at above mentioned time intervals . effect of intra - ca1 injection of quinine on kindling rate twenty - four h after determination of ad threshold , the rats were divided into four groups of seven rats in each . they received quinine ( 1 , 30 , and 100 m / rat , intra - ca1 ) or acsf ( 1 l / rat , intra - ca1 ) once daily . daily electrical stimulation was delivered 10 min before quinine or acsf injections until the animals became fully kindled . ss and add were recorded after each stimulation . at the end of the experiments , the brains were removed , processed , cut into 50-m thick slices and stained by the method previously described ( beheshti et al . stained slices were qualitatively analyzed for cannula and electrode positions and also any lesion , using a stereoscopic microscope ( olympus , japan ) and a light microscope ( zeiss , germany ) . the data of the animals , in which the cannula and electrode were in false placement , were not included in the results . if data had a normal distribution , they were analyzed by parametric test ( anova with repeated measures for post hoc analysis ) . otherwise , the data were analyzed by nonparametric test ( kruskal - wallis analysis of variance ) . in all experiments , at the end of the experiments , the brains were removed , processed , cut into 50-m thick slices and stained by the method previously described ( beheshti et al . stained slices were qualitatively analyzed for cannula and electrode positions and also any lesion , using a stereoscopic microscope ( olympus , japan ) and a light microscope ( zeiss , germany ) . the data of the animals , in which the cannula and electrode were in false placement , were not included in the results . data are presented as mean sem . if data had a normal distribution , they were analyzed by parametric test ( anova with repeated measures for post hoc analysis ) . otherwise , the data were analyzed by nonparametric test ( kruskal - wallis analysis of variance ) . in all experiments , the mean ad threshold obtained for the animals was in the range of 50 - 150 a . histological evaluation of the brains confirmed correct position of the electrode and cannula in all of the animals . neither of the applied doses of quinine affected kindled seizure parameters at 10 and 30 min post administration periods . 1 ) ) . quinine 1 m caused a 1.5 fold increase in add at the time of focal seizures acquisition ( behavioral seizure stage 2 ) compared to control group . chronic administration of quinine 100 m resulted in 1.5 fold enhancement in add when the animals became fully kindled ( showed stage 5 ) . furthermore , at the dose of 100 m the animals need lower number of stimuli to reach the kindled state . neither of the applied doses of quinine affected kindled seizure parameters at 10 and 30 min post administration periods . 1 ) ) . quinine 1 m caused a 1.5 fold increase in add at the time of focal seizures acquisition ( behavioral seizure stage 2 ) compared to control group . chronic administration of quinine 100 m resulted in 1.5 fold enhancement in add when the animals became fully kindled ( showed stage 5 ) . furthermore , at the dose of 100 m the animals need lower number of stimuli to reach the kindled state . results of the present study indicate that blockade of gjs composed of cx36 in the ca1 area of the rat hippocampus accelerates progression of kindling but does not affect kindled seizures . most in vivo studies on the effect of quinine on seizures have been performed in 4-aminopyridine ( 4-ap ) model of epilepsy ( gajda et al . , 2005 ; medina - ceja and ventura - meja , 2010 ) . the 4-ap model can be regarded as semi - chronic epilepsy model , as its specific feature is prolonged epileptiform activity in a manner that at least 25 seizures occur spontaneously during a 60-min period ( gajda et al . , 2005 ) . this specificity enables investigator to apply the investigating drug during seizures and observe the effect of drug on active state of gjs . in hyperexcitable conditions , conformation of gj channels changes to active state , and results in increase electrical communication between adjacent cells ( sez et al . , 2010 ) this might in turn cause more efficient binding of quinine to cx36 and therefore more functional blockade . however , in cases of acute seizures such as kindled seizures , duration of epileptic activity is not as long as that in 4-ap model . . this assumption might be the reason of ineffectiveness of quinine on kindled seizures . in our study , the rats which received quinine 100 m , the dose which maximally blocks cx36 gjs ( srinivas et al . , 2001 ) , developed generalized seizures much earlier than control rats . in the kindling model , the behavioral seizure stages 1 , 2 , and 3 most often originate from foci within the limbic system and are considered as focal seizures , while behavioral stages 4 and 5 represent secondary generalized motor seizures ( racine , 1972 ) . our finding suggests that cx36 gjs have a critical role in kindling epileptogenesis and inhibit seizure propagation from limbic focus to the rest of the brain and consequent generalizations of the seizures . this result is in agreement with our previous finding that gene and protein of hippocampal cx36 are over - expressed during amygdala kindling ( beheshti et al . , 2010 ) . apart from hippocampus , cx36 is also present in the mature cerebral cortex as the most common neuronal cx , and its expression appears to be restricted almost exclusively to a subclass of inhibitory interneurons , parvalbumin - containing basket cells ( deans et al . , 2001 ; liu and jones , 2003 ; markram et al . , 2004 ) . interestingly , blocking of cortical cx36 gjs by quinine significantly reinforces both the frequency and amplitude of seizure - like activity in rat cerebral cortex ( voss et al . , 2009 ) . closing cx36 gjs and consequent disinhibitory effect on pyramidal cell activity is suggested to be involved in this proconvulsant effect of quinine . moreover , it has been shown that knockout of cx36 promotes epileptic hyperexcitability ( pais et al . , 2003 ) and decreases threshold of generalized tonic - clonic seizures induced by ptz ( jacobson et al . , 2010 ) . these results together with our finding in the present study confirm that cx36 gjs , present in gabaergic interneuron network , play a critical role in inhibitory control of excitatory runaway activity ( jacobson et al . , 2010 ) . in contrast to these results , it has been reported that the blockade of cx36 gjc attenuates seizures in some epilepsy models . application of quinine significantly decreases duration of the seizures induced by 4-ap ( gajda et al . , 2005 ) . quinine acts as an antiepileptic drug in penicillin model of cortical seizures ( bostanci and bagirici , 2007 ) . moreover , quinine signicantly decreases duration of ptz - induced seizures in a dose - dependent manner ( nassiri - asl et al . , 2009 ) . likewise , injection of quinine into the entorhinal cortex decreases amplitude and frequency of epileptic discharges in seizing rats ( medina - ceja and ventura - meja , 2010 ) . two explanations can be suggested for the paradoxical effects of quinine on seizures ; 1 ) different models of seizures with different mechanisms of action have been used in these studies . for instance , in 4-ap model , blockade of k channels as well as glutamate release , promote convulsions ( medina - ceja and ventura - meja , 2010 ) . penicillin induces seizures due to its similar structure to gabaa receptor antagonist bicuculline ( bostanci and bagirci , 2007 ) . on the other hand , voss et a. ( 2009 ) induced seizure - like activity by perfusion of cerebral cortical slices with low magnesium acsf . in the present study , we used kindling model of epilepsy in which glutamatergic and gabaergic neurotransmission are involved in seizure manifestation . therefore , it can be postulated that anticonvulsant or proconvulsant effect of quinine observed in the different studies , depends on the level of involvement of chemical or electrical synapses in the particular epilepsy model used in each study . here , we directly applied quinine into the ca1 area . ca1 pyramidal cells are involved in generalization of amygdala kindled seizures ( hewapathirane and burnham , 2005 ) . it seems that spread of activity within the inhibitory circuit in ca1 area is decreased by quinine , which in turn amplifies seizure propagation to outside of hippocampus . however , in other studies with opposite findings , the cx36 gjs present in inhibitory circuit , might not be affected in this manner . 2 ) in the reports regarding anticonvulsant effect of quinine , a wide range of doses has been used . although quinine is a specific blocker of cx36 gj ( ec50 = 32 m , maximal blockade at 100 m ) ( srinivas et al . , 2001 ) , it can also block cx45 ( ec50 = 300 m ) , ip3-induced ca release ( ec50 = 250 m ) , cx50 ( ec50 = 73 m ) , sodium currents ( ec50 > 20 m ) , voltage - dependent k channels ( ec50 = 8 m ) , atp - sensitive k channels ( ec50 = 3 m ) and nicotinic receptors ( ec50 = 1 m ) ( juszczak and swiergiel , 2009 ) . therefore , the possibility exists that the anticonvulsant effect of quinine observed in the other studies may be related to the off - target actions of this agent . it has recently been reported that long term potentiation ( ltp ) is reduced in the hippocampal ca1 region of cx36 knockout mice ( wang and belousov , 2011 ) . kindling is a model of epileptogenesis and synaptic plasticity , in which ltp of synaptic transmission occurs ( mcnamara et al . , 1980 ) . according to our results , blocking cx36 gjs in ca1 region facilitates epileptogenesis and therefore ltp . our finding appears to be in contrast to finding of wang and belousov ( 2011 ) . however , it has been well documented that cx36 knockout mice have an increased gabaergic tone as a compensation for their lack of interneuron gjs , which results in enhancement of feedback inhibition ( de zeeuw et al . , 2003 ; cummings et al . , 2008 ; voss et al . , 2010 ) . hence , reduction of hippocampal ltp in mice lacking cx36 might not be necessarily mediated by lack of interneuronal gjs , rather by compensatory overactivity of gabaergic interneurons . in conclusion , we found that chronic intra - ca1 injection of quinine , at the dose of 100 m , which specifically blocks cx36 gjs , facilitates epileptogenesis by acceleration of kindling development . cx36 can be considered as a molecular target in prevention of epilepsy . due to possible confusing effect made by compensatory neurophysiological changes in knockout animals , design and availability of specific cx36 gj openers
two molecules of each of the core histone proteins - h2a , h2b , h3 and h4 - form an octamer , the protein component of the nucleosome core particle , around which 147 basepairs of dna are wrapped . one histone molecule of the linker or h1 class binds to the octamer near the point where the dna enters and exits the nucleosome and seals two full turns ( approximately 166 basepairs ) of dna around the octamer . histone h1 also associates with linker dna between nucleosomes to stabilize higher - order structures . as nucleosomal structure is similar in all metazoans , it is not surprising that histones are among the most highly conserved proteins in terms of both structure and sequence . but in higher organisms each histone subtype , with the possible exception of histone h4 , is represented by a family of genes encoding multiple non - allelic primary - sequence variants . a demand for high gene expression at specific times might require multiple active transcriptional units - for example , in the case of histones large amounts are needed during s phase when dna is replicated and packaged into nucleosomes . in this case , heterogeneity at the protein - sequence level may be the result of genetic drift and would be of little consequence . an extension of this view might include heterogeneity at the level of regulation : multiple histone genes with distinct expression patterns during differentiation , in specific tissues , or under certain metabolic conditions might be necessary to ensure that adequate amounts of each histone are present in all cells . evidence for this in higher organisms comes from the presence of replacement variants that , unlike most other histones , are expressed throughout the cell cycle and serve as a source of chromatin components needed during repair or recombination of dna or to replace histones lost through turnover in quiescent cells . protein sequence variation would be expected to be limited , but variants with greater stability might be evolutionarily selected . different histone variants can contribute to distinct or unique nucleosomal architectures , which could potentially be exploited to regulate nuclear functions such as transcription , gene silencing , replication or recombination . in this case , the amino - acid sequence variation among the individual variants within a subtype is presumed to be the driving force for creating and maintaining diversity . i refer to this as ' functional heterogeneity ' , with the reservation that the extent and mechanisms by which it achieves functional effects are far from clear . of course , aspects of each of these driving forces may be in operation simultaneously , and experimental demonstration , especially in the case of functional heterogeneity , is difficult . for the most part , the core histones have only a small number of variants and the degree of amino acid sequence variation within a subtype is limited . replacement variants and partially replication - dependent variants have been described for each subtype except histone h4 , and the heterogeneity is probably mostly regulatory . but there are several examples of highly divergent variants and evidence that these histones have specialized functions ( table 1 ) . core histone variants with potential unique functions cenp - a , a highly conserved histone h3-like variant , is specifically localized to centromeric chromatin in mammals and yeast . the carboxy - terminal two thirds of the cenp - a protein is 62% identical in sequence to histone h3 , contains the histone - fold domain , and is required for localizing the protein to centromeric heterochromatin . cenp - a synthesis is coordinated with centromeric replication during the mid - s to early g2 phases of the cell cycle . this appears to be important , because expression of cenp - a under control of a histone h3 promoter , which is active early in g1 phase , does not result in centromeric localization of cenp - a . targeted deletion of the mouse cenp - a homolog results in early embryonic death and disruption of centromeric chromosome organization . the incorporation of this variant in place of histone h3 may serve to episomally mark centromeres for kinetochore assembly , which is required for coordinated separation of sister chromosomes during mitosis . histone macroh2a is an extremely divergent variant consisting of an amino - terminal region that has 64% identical amino acids to full - length histone h2a , followed by a large region ( 57% of the total protein ) that is not related to any known histone . the nonhistone region contains a putative leucine - zipper domain and also has similarity to proteins involved in viral rna replication . immunofluorescence studies showed that macroh2a is concentrated in the inactive x chromosome of female mammals and remains associated with this chromosome through metaphase . this localization may be mediated through interactions of macroh2a with xist , a non - coding rna that is tightly associated with the inactive x chromosome . macroh2a associates with the inactive x chromosome at or near the time of its inactivation in preimplantation mouse embryos , but in differentiating mouse embryonic stem cells the association occurs well after initiation and propagation of inactivation . also , conditional deletion of part of the xist locus from the inactive x chromosome leads to loss of macroh2a association but does not affect maintenance of x inactivation . macroh2a is found at other chromosomal locations as well as the inactive x chromosome , and it may play a more general role in gene silencing . the strong evolutionary conservation of macroh2a among species , including chickens , which do not display x - chromosome inactivation , supports the idea of a conserved function related to the regulation of gene expression . interestingly , a novel h2a variant has been recently identified and shown to have characteristics distinctly different from those of macroh2a : h2a - bbd , which is only 42% identical to histone h2a , is markedly excluded from the inactive x chromosome and may be associated with transcriptionally active regions of the genome . h2a.z , a minor h2a variant , is found in a wide range of organisms from yeast to mammals . the sequences of h2a.z variants of different species are more similar to one another than any single h2a.z is to the major histone h2a in the same organism . this conservation may reflect a unique functional role , an idea that is supported by the demonstration that h2a.z is essential for viability in both tetrahymena and drosophila . swapping experiments , in which regions of h2a.z were replaced with homologous regions from the major histone h2a , identified a distinct domain of h2a.z required for the rescue of the developmental defect observed in h2a.z - null flies . this study is particularly relevant as it provides the strongest direct evidence of functional heterogeneity to date . the essential region mapped to a domain important for docking the h2a / h2b dimer to the h3/h4 tetramer to form the histone octamer , and the crystal structure of core particles containing h2a.z revealed subtle but significant differences from that of particles containing the major h2a proteins . recent results indicate that h2a.z can modulate the folding of nucleosomal arrays into higher - order structures and that knockout of the h2a.z genes in mice results in embryonic death just after implantation ( d. tremethick , personal communication ) . the linker or h1 class of histones seems the most likely to display functional heterogeneity . the number of h1 variants and their degree of divergence is much greater than that of the core histones . this heterogeneity is limited , however , and it is conserved across biological kingdoms , suggesting that individual h1 variants might have unique properties ( table 2 ) . the h1 proteins play a direct role in stabilizing nucleosomal and higher - order chromatin structures and may function as general or specific repressors of transcription by limiting access of transcriptional activators to chromatin ( figure 1 ) . disruption or modification of the binding of histone h1 to the nucleosome maybe a necessary step in the activation of many genes , and qualitative or quantitative differences in the modulation of chromatin structure by individual h1 variants might constitute an expression of functional heterogeneity . ( a ) linker histones stabilize and/or promote the formation of transcriptionally inert higher - order chromatin structures . ( b ) the removal or modification of the binding of histone h1 to relaxed chromatin structures may be a prerequisite for initiating a series of events resulting in transcriptional activation . these events may include covalent modification ( for example acetylation ) of core histones , chromatin remodeling by sliding or removal of nucleosome cores , and the establishment of a transcription preinitiation complex . differences among h1 variants in their ability to promote or antagonize any of these transitions could contribute to transcriptional regulation . linker histone variants with potential unique functions circumstantial evidence in favor of this hypothesis comes from several types of observation . the somatic variants differ in their expression patterns during development and differentiation , in their turnover rates , and in the extent and schedule of phosphorylation during the cell cycle . an extensive collection of in vitro data , starting from the work of r.d . cole , demonstrates that individual variants differ in their ability to condense a variety of chromatin and dna substrates . finally , if h1 variants have distinct functions one would expect them to be non - randomly distributed within the nucleus and with respect to active versus inactive genes , and evidence for this has recently been reported . as persuasive as these observations are collectively , the case for functional heterogeneity would be strengthened if specific physiologically significant effects associated with perturbing the stoichiometry of individual h1 variants could be demonstrated in vivo . a clear example of the importance of h1 variant heterogeneity in gene expression is the developmental regulation of 5s rrna synthesis in frogs . in xenopus laevis there are two clusters of 5s genes , the somatic and the oocyte clusters , which share the same transcription factors , such as tfiiia . in contrast , the oocyte 5s genes are expressed in oocytes and during early embryogenesis but are repressed near the mid - blastula transition . at the same approximate time during embryogenesis , adult histone h1 genes are expressed and begin to replace the cleavage - stage variant h1m(b4 ) , which is incorporated into nucleosomes during embryogenesis . manipulation of the levels of adult h1 protein by injection of cdna or ribozymes demonstrated that the switch in h1 variant type was causal for the specific repression of oocyte 5s gene expression . subsequent studies suggested that differential nucleosome positioning underlies this selective repression , such that the oocyte 5s genes bind adult histone h1 more avidly than they bind the transcription factor tfiiia , whereas the opposite holds for the somatic 5s genes . of note for this discussion , although nucleosome positioning is important , the replacement of embryonic h1 m by adult histone h1 is essential to reinforcing the selective repression of the oocyte 5s genes . in the mouse there are at least eight h1 variants , including six somatic variants found in most cells and two germline - specific isotypes . the testis - specific h1 t variant is found in substantial amounts only in pachytene spermatocytes and early spermatids . in vitro reconstitution studies suggest that , relative to somatic variants , histone h1 t imparts a more open chromatin structure . in vivo this property could facilitate recombination or the subsequent chromosomal protein transitions during sperm maturation when histones are replaced by sperm - specific proteins . surprisingly , three groups have independently demonstrated that mice lacking h1 t are fertile and undergo normal spermatogenesis . in these h1t - null mice other h1 variants are deposited on chromatin in place of h1 t to maintain normal , or near normal , amounts of total h1 histone . presumably , at least some of these variants are able to compensate for the function of h1 t . it may be significant that even in the h1t - deficient mice the chromatin of the germ cells contains , relative to somatic cells , higher levels of histones h1a and h1c and much less h1d and h1e . the function , if any , of the recently described oocyte - specific h100 variant is unclear , but its expression pattern and its sequence similarity to the xenopus embryonic variant h1 m suggest a potential role in the regulation of gene expression during oogenesis and early embryogenesis . the role of somatic histone h1 heterogeneity in mammals was explored by inducibly overexpressing individual variants in homologous 3t3 fibroblasts . overexpression of the mouse h1 variant led to a transient delay in cell - cycle progression and to reduced steady - state levels of all the polymerase ii transcripts that were studied . overexpression of another variant , h1c , had no effect on cell - cycle progression , however , and led to either no change or a dramatic increase in steady - state transcript levels of all the genes tested . it was subsequently shown that the differential effects of overexpression of these two variants are due to differences in their central globular domains . structural studies indicate that the globular domains of these two variants are very similar , suggesting that subtle differences in the structures of these regions and perhaps in the way they interact with the nucleosome have important consequences for chromatin function . it should be noted that chronic overexpression of either variant for several days results in compensatory responses and the development of cell populations with cell - cycle parameters and gene - expression profiles identical to those of unperturbed cells ( d. sittman , personal communication ) . skoultchi and colleagues have developed a systematic series of histone h1 knockouts in mice ( and a. skoultchi and y. fan , personal communication ) . homozygous inactivation of any one of the somatic h1 variants does not affect viability or development . in each of the single - gene knockout mice , upregulation of the remaining histone h1 genes resulted in a normal , or near normal , stoichiometry of total h1 histone to nucleosomes . skoultchi and co - workers went on to create compound knockouts , in which several h1 genes were simultaneously disrupted . triple - knockout mice lacking h1c , h1d , and h1e die during embryogenesis at embryonic day 9.5 - 10.5 . analysis of the chromatin in these embryos revealed a reduction in the ratio of h1 histone to nucleosomes of approximately 50% . one clear conclusion from these results is that a major reduction in total histone h1 stoichiometry , which would be expected to have a significant impact on chromatin higher - order structure , is indeed detrimental to mammalian development . but the embryonic lethality in mice lacking multiple h1 variants might actually make it difficult to demonstrate a functional significance for specific variants . what is required are rescue experiments , to create animals in which the total amount of h1 histone is near normal but the repertoire of expressed variants is reduced . the available evidence seems to indicate that for the extremely modified core histones a strong case can be made for functional heterogeneity . the widespread observation of compensatory responses and the lack of any demonstration of an essential function for an h1 variant suggest a level of functional redundancy . does this mean that the presence of multiple h1 variants in mammals represents primarily a dosage - compensation or ' regulatory ' heterogeneity ? the evolutionary and circumstantial evidence cited above can not be dismissed and certainly suggests that functional heterogeneity among h1 variants is possible . the loss of one variant might be compensated for by another variant that has similar biological properties but perhaps not by any h1 variant . finally , it should be stressed that the range of assayable phenotypes is limited both in knockout studies with whole organisms and in overexpression studies with cultured cells . the development of new techniques , such as the direct measurement of histone dynamics in living cells , should provide additional insights into the properties and potential functions of specific histone variants in vivo . i thank donald sittman , susan wellman , and asmita kumar for critical reading of the manuscript and art skoultchi and david tremethick for communicating experimental results prior to publication .
alpha-1 acid glycoprotein ( agp ; also known as orosomucoid ) is a 44 kda , heavily glycosylated protein synthesized primarily by hepatocytes and secreted into the plasma , where it circulates under normal conditions in humans at 830 m [ 1 , 2 ] . during the acute phase response , circulating levels of human agp are elevated over baseline values by 2- to 7-fold ; in rats , rabbits , and mice , the elevation of either circulating agp or hepatic agp mrna ranges from 10- to 200-fold [ 48 ] . the biological function of agp is unclear . suggested roles for this plasma protein include the modulation of the immune response ; the stabilization of plasminogen activator inhibitor-1 ( pai-1 ) functional activity ; and the maintenance of normal capillary permeability and selectivity . evidence from perfusion or cell culture systems supports a role for agp in maintaining capillary permselectivity . perfusion studies using isolated rat skeletal muscle or kidneys or frog mesenteric preparations initially showed that the rate of negatively charged protein loss from the perfusate ( e.g. , albumin or lactalbumin ) was reduced in the presence of agp . these findings lead to the hypothesis that agp binds to the capillary vessel wall and increases its negative charge . agp binding to endothelial cells in culture has also been demonstrated [ 1517 ] . the protein has furthermore been suggested to form part of the glycocalyx , a dynamic endothelial surface layer of glycosaminoglycans , proteoglycans , and adsorbed plasma proteins deduced by indirect examination , for instance as a red cell exclusion zone in intravital microscopy . most recently , transfused human agp was shown to exert renal effects by restoring normal glomerular filtration rates in rats rendered nephrotic by puromycin aminoglycoside administration . it has long been known that enzymatic removal of terminal sialic acid residues , and exposure of terminal galactose moieties , converts agp into a high - affinity ligand of the asialoglycoprotein receptor , leading to its rapid removal from the mammalian circulation [ 2023 ] . relatively few studies , however , have examined the in vivo clearance of the unmodified plasma glycoprotein [ 2426 ] , and none have examined the consequences of complete removal of glycans on the clearance and catabolism of agp . since agp is a relatively small protein of approximately 43 kda , with 45% of its mass being contributed by its carbohydrates , we hypothesized that removal of its sugars would render it filterable in the kidneys and accelerate its clearance from the circulation . in the current study , we tested this hypothesis and in addition investigated the consequences to agp clearance of systemic disruption of the glycocalyx . affi - gel blue chromatography resin and bio - gel ht hydroxyapatite resin were purchased from bio - rad laboratories ( hercules , ca ) . concanavalin a ( con a ) , sepharose 4b , and t4 dna ligase were from ge healthcare ( piscataway , nj ) . reverse transcription reagents rneasy and sensiscript rt kits and heat - stable hotstartaq dna polymerase were from qiagen ( chatsworth , ca ) . neuraminidase , peptide n - glycosidase : f ( pngase f ) , and phusion heat - stable dna polymerase were purchased from new england biolabs ( ipswich , ma ) . streptomyces hyaluronidase , commercial agp , goat antihuman agp antibodies , and alkaline phosphatase conjugated anti - goat igg were from sigma ( st . louis , mo ) . a glycan differentiation kit was purchased from roche applied science ( mannheim , germany ) . biotinylated hyaluronic acid binding protein was from associates of cape cod ( east falmouth , ma ) . alexa fluor 488 labeling kits , streptavidin conjugated alexa fluor 647 , alexa fluor 488-griffonia simplicifolia lectin-1b4 ( gs-1b4 ) , pichia pastoris strain x-33 and zeocin , thermalace high fidelity dna polymerase , the pcdna 3.1 vector , and e. coli dh5 cells were all purchased from invitrogen corporation ( carlsbad , ca ) . restriction and dna modification enzymes were supplied by either fermentas life sciences ( burlington , on ) , or fisher scientific ( unionville , on ) . hepg2 ( human hepatocellular carcinoma ) cells were obtained from the american type culture collection ( manassas , va ) . experiments involving animals were carried out under the terms of animal utilization protocols approved by the animal research ethics board of the faculty of health sciences of mcmaster university . rabbits ( new zealand white , 2.1 to 2.8 kg , male and female , specific pathogen - free ) were purchased from charles river ( st . constant , quebec ) , as were c57 black 6 ( c57bl/6 ) male mice of 2030 g body weight . agp was purified exactly as described by herv et al . from citrated plasma obtained from healthy volunteer donors , collected with informed consent using a protocol approved by the hamilton health sciences research ethics board . the plasma pool was combined , using equal volumes from each donor , aliquoted and frozen at 80c until use ; the same five donors ( 4 caucasian , 1 black ) were used for all preparations employed in this study . the terminal sialic acid chains of purified agp were removed by treatment with clostridium perfringens neuraminidase , using 5 units of enzyme per g of agp in 50 mm sodium citrate , ph 6.0 , overnight at 37c . entire n - linked glycan chains were removed from agp using peptide : n - glycosidase f ( pngase f ) . for electrophoretic use , agp ( 0.02 mg ) was denatured by boiling in 0.5% sds , 80 mm dithiothreitol for ten minutes , then reacted with 2500 units pngase f at 37 for one hour , after dilution into 1% np-40 , 50 mm sodium phosphate ph 7.5 . for radiolabeling and in vivo use , 0.2 mg agp in 5.0 m urea was incubated for one hour at room temperature , then diluted 1 : 1 with 10,000 units of pngase f in 0.1 m sodium phosphate ph 7.5 , and incubated overnight at 37c , prior to dialysis against phosphate buffered saline . a human agp cdna was obtained by reverse transcription / pcr of hepg2 cell mrna , employing rneasy and sensiscript rt kits ( qiagen ) and oligonucleotide primers ml13047 ( 5-gaatggatcc aaggtgactg caccctgc-3 ) and ml13048 ( 5-atcgaattcg gtacacatgt cgggttgg-3 ) . the latter plasmid was amplified using phusion polymerase under conditions recommended by the manufacturer ( new england biolabs ) , and sense oligonucleotide primer 07 - 1495 ( 5 acgtctcgaga aaagacagat cccattgtgt gccaacc-3 ) and antisense oligonucleotide primer 07 - 1493 ( 5 cagtgaattc ctagtgatgg tgatgggattccccctcctc ctgttt-3 ) . the resulting pcr product was restricted with xhoi and ecori and inserted between these sites in yeast expression vector ppicz9ssamp to form ppicz9ssagph6 . this plasmid was modified by pcr in site - directed mutagenesis reactions that altered 5 asn ( n ) codons 15 , 38 , 54 , 75 , and 85 to gln ( q ) , forming ppicz9ssagp - n(5)q - h6 . all dna constructs were verified by dna sequencing ( mobix , mcmaster university ) prior to expression and utilization of recombinant agp . plasmids ppicz9ssagph6 and ppicz9ssagp - n(5)q - h6 were separately used to transform pichia pastoris x33 yeast to zeocin resistance , and resulting cell lines were cultured and induced with methanol ; conditioned media was neutralized and secreted recombinant proteins were purified by nickel affinity chromatography , as previously described . purified plasma - derived , enzymatically treated , or recombinant forms of agp were iodinated using the iodogen method and injected into the marginal ear vein of rabbits , as previously described . at timed intervals ( 0.083 , 0.5 , 1 , 2 , 4 , 6 , 8 , 24 , 48 , 72 , 96 , and 168 hours or until the recovered radioactivity declined lower than 0.1% of the injected dose ) blood samples were taken from the marginal vein of the other ear , centrifuged to obtain plasma , and the trichloroacetic acid - precipitable radioactivity was determined by counting . for each rabbit , semilogarithmic substrate disposition graphs of residual plasma radioactivity against time were generated , and analyzed using pk solutions version 2.0 software ( summit research services , montrose , co , usa ) . briefly , the software was employed to fit the data using noncompartmental ( area ) methods based on the trapezoid rule . for this purpose , radioactive doses were converted into pmoles using the measured specific activity of radiolabeling , and molecular weights of 43 , 33 , and 23 kda for pdagp , pngase - agp , and ragp n(5)q , respectively . the specific activity of radiolabeling was similar for all three proteins , ranging from 3.94 to 7.05 x 10cpm/g . in some experiments , the tissue distribution of radioactivity 30 minutes after intravenous injection of radioiodinated agp or derivatives was measured as described ; briefly , organs were excised , rinsed in ice cold saline , weighed , and either a portion or the entire organ , depending on its size , was counted . results were expressed as a fraction of the total radioactive dose injected . in other experiments , either 4.0 g of -methyl - d - mannopyranoside ( -methyl - mannoside ) in 20 ml sterile saline , or 0.54 g of d - galactose in 10 ml sterile saline , was injected intraperitoneally immediately prior to intravenous injection of radioiodinated protein in an effort to block glycan - dependent uptake via hepatic receptors . clearance of radiolabeled human agp in c57bl/6 mice was followed as previously described [ 30 , 34 ] by measuring acid - precipitable plasma radioactivity in plasma samples . plasma radioactivity was reported as percentage of the injected dose , using as a dilution factor the plasma volume divided by the sample volume . plasma volume was calculated as the product of the weight of the mouse in grams x 0.078 ml blood volume per gram body weight x ( 1-the hematocrit ) , using a hematocrit of 0.44 ( us nih reference values from http://oacu.od.nih.gov/arac/ ) . in some experiments louis , mo , usa ) by intravenous injection of 47 u ( to deliver 30 u / ml estimated plasma volume ) of the enzyme in 0.1 ml sterile saline coinjected with iodinated human agp . anesthetized mice ( 2030 g body weight ) were cannulated via the right jugular vein , the abdomen opened , and a lobe of the liver placed on the heated plexiglas stage of a leica dmi 6000 b confocal microscope . the liver microvasculature was photographed using a hamamatsu c9100 - 12 back - thinned emccd camera attached to a leica dmi 6000 b confocal microscope using the 63x objective . either 15 g biotinylated bovine hyaluronic acid binding protein ( bhabp ) complexed to streptavidin - conjugated alexa fluor 647 ( associates of cape cod , falmouth , ma , usa ) or 40 g griffonia simplicifolia 1b4 ( gs-1b4 , ) lectin directly conjugated to alexa fluor 488 ( invitrogen , carlsbad , ca , usa ) baseline images were obtained over the next 15 minutes , then hyaluronidase was injected as described above , and images were acquired for an additional hour . in some experiments purified human agp ( 165 mg / kg body weight ) was injected after bhabp : streptavidin alexa fluor 647 administration and baseline image capture and 15 minutes prior to hyaluronidase treatment . the ability of various forms of agp to react with digoxigenin - labeled lectins was assessed following sds - page and electrical transfer of proteins to nitrocellulose ; blots were analyzed using a dig glycan differentiation kit as suggested by the manufacturer ( roche diagnostics , mississauga , on , canada ) . statistical analysis was performed using graphpad instat version 3.06 software ( graphpad software inc , san diego , ca ) , using one - way analysis of variance ( anova ) for multiple comparisons and student 's t - tests for paired comparisons . nonparametric methods were employed if data did not pass tests of normality and equivalence of standard deviation ; further details are provided in figures 16 and table 1 . the in vivo clearance of agp treated with neuraminidase to remove the terminal sialic acid residues has been widely investigated , to a greater extent than that of the unmodified protein [ 21 , 24 , 35 , 36 ] . as shown in figure 1(a ) , neuraminidase treatment increased the electrophoretic mobility of agp and eliminated its recognition by sambucus nigra agglutinin ( sna ) , which binds to sialic acid linked to galactose . five minutes after injection , 45.5 4.0% of the injected agp was detected in plasma , compared to 0.77 0.36% of neuraminidase - treated agp , a difference of 82-fold . by fifteen minutes , the proportion of agp remaining in the circulation was unchanged for native agp ( 42.0 5.5% ) but had further declined to 0.25 0.5% in the case of the neuraminidase - treated form ( figure 1(b ) ) . enzymatic and recombinant dna methods were used to reduce or eliminate the number of n - linked glycan chains attached to agp . denaturation of agp was required to obtain any significant reduction in its extent of glycosylation using pngase f , which removes glycan chains in their entirety at their point of attachment to asparagine residues on the polypeptide backbone of agp . as shown in figure 2 , transient denaturation with urea allowed the partial removal of 05 glycans per agp molecule ; full denaturation with sds removed all glycans . that the most rapidly migrating pngase f reaction product of agp was fully deglycosylated was indicated by its comigration both with sds and pngase f - treated agp , and with a form of recombinant agp mutated to abrogate n - linked glycosylation ( ragp n(5)q ) ( figure 1(a ) ) , and by the loss of recognition of all of these putatively deglycosylated species with sna lectin ( data not shown ) . in keeping with its intermediate state of deglycosylation , pngase f - treated agp exhibited more rapid clearance in rabbits than unmodified agp , but was retained in the circulation to a greater extent than ragp n(5)q ; these differences were apparent as early as 30 minutes after injection ( figure 2(b ) ) . electrophoresis and autoradiography of postinjection plasma samples revealed that the most rapidly migrating deglycosylated forms of agp ( e.g. , 1 versus 2 in figure 3(b ) ) were lost from plasma more rapidly than less rapidly migrating forms ( e.g. , 3 or 4 in figure 3(b ) ) . in terms of organ distribution , both pngase f - treated agp and ragp n(5)q were found in the kidney to a greater extent than native agp , the effect being more pronounced for the fully deglycosylated form ( figure 3(d ) ) . the differences in clearance of the three forms of agp were apparent not only on substrate disposition versus time graphs , such as those shown in figure 2 , in which the proteins were compared on the basis of residual radioactivity , but also following pharmacokinetic analysis , in which the proteins were compared based upon their dose in pmoles and their residual plasma concentration in pmol / ml ( table 1 ) . pngase - agp and ragp n(5)q exhibited decreased areas under the clearance curve , decreased mean retention times , and decreased half - lives , but the decreases were only statistically significant for ragp n(5)q . the volumes of distribution and clearance rates were significantly increased for both altered forms ( e.g. , mean cl was increased 4.9-fold for pngase - agp and 45-fold for ragp n(5)q , p < 0.001 versus pdagp in both cases ) . the disappearance of injected radiolabeled ragp - wt from the rabbit circulation , which like ragp - n(5)q , was c - terminally hexahistidinylated to facilitate purification , but which unlike the mutated agp , retained all five sites of n - linked glycosylation , was also examined . as shown in figure 4(a ) , ragp - wt was much more rapidly removed from the circulation than its mutant ragp - n(5)q counterpart . thirty minutes after injection of equal doses of either radiolabeled ragp - wt or ragp n(5)q , the residual plasma concentration of the latter exceeded the former by more than 10-fold ( figure 4(a ) ; 2.2 0.5% versus 26 3% , p < 0.0001 by unpaired t - test , welch corrected ) . coadministration of -methylmannoside , but not galactose , significantly reduced the loss of ragp - wt from the circulation ( to 6 1% , p < 0.05 by kruskal - wallis test ) ; neither sugar significantly altered the concentration of ragp n(5)q in the circulation , suggesting that the yeast glycans contained terminal mannose residues ( figure 4(a ) ) . electrophoresis showed that ragp - wt migrated more rapidly than pdagp , consistent with its modification with shorter n - linked glycans than in plasma - derived agp ( figure 4(b ) ) , and ligand blotting showed that ragp - wt , but not plasma - derived human agp , bound galanthus nivalis agglutinin ( gna ) , which is a lectin specific for glycans terminating in mannose residues ( figure 4(b ) ) . in contrast , ragp - n(5)q was unreactive with all lectins , consistent with its intended lack of glycosylation ( data not shown ) . intravenous administration of hyaluronidase prior to injection of radiolabeled agp changed both its recovery and distribution in mice for several hours after treatment . initially , the recovery of agp rose from 80.2 5.8 in the absence of hyaluronidase to 96.8 6.0 ( p = 0.0007 by two - tailed unpaired t - test ) ; as seen in figure 5 , the elevation of agp in the plasma in hyaluronidase - treated mice remained detectable until 3 hours after treatment . the area under the observed curve ( t = 0 to t = 6 hours ) was increased from 250 30%-hr to 300 30%-hr ( p = 0.037 by two - tailed unpaired t - test ) by hyaluronidase treatment . we next sought independent confirmation that hyaluronidase was having its intended effect on the murine vasculature , using intravital confocal microscopy of livers of mice treated with or without hyaluronidase . treatment with the enzyme reduced sinusoidal vessel staining with fluorescently labeled habp but left vascular binding by fluorescent gs-1b4 unchanged ( figure 6 , compare ( a ) to ( b ) and ( d ) to ( e ) ) . the distribution of habp was also altered by administration of 3.3 mg intravenous human agp ( 10 - 20 times endogenous agp levels ) without hyaluronidase treatment . this intervention left 5- to 6-fold more habp in the plasma column than in the absence of agp treatment ( figures 6(c ) and 6(f ) ) . although hyaluronidase treatment altered the clearance and distribution of agp , and agp injection increased habp retention in plasma , agp did not bind to immobilized hyaluronan in vitro in microtiter plates , unlike habp , which demonstrated avid binding ( data not shown ) . in this study we explored the effects of altered , diminished , or absent glycosylation of agp on its in vivo clearance . although neuraminidase - treated agp ( also called asialoagp or asialoorosomucoid ) has been widely employed for many years as an injectable ligand and competitor for the hepatic asialoglycoprotein receptor in vivo [ 21 , 24 , 35 , 36 ] , the clearance of glycosylated agp has been less extensively examined . reported a terminal catabolic half - life of 68.5 hours for iodinated human agp injected into a single 3.8 kg rabbit ; this value is similar to our finding of 59 4 hours ( mean sd , n = 6 , range 5365 hours , weight range 2.522.79 kg ) . some of the difference may derive from our use of noncompartmental modeling and pharmacokinetic software , as opposed to the compartmental model and manual calculation employed in the older report ; alternatively , our use of lighter rabbits may also be a contributing factor . in this regard , others employing noncompartmental analysis of agp clearance in rats reported steady state weight - adjusted volumes of distribution similar to that observed in rabbits in this study . for pdagp in rabbits , we observed 160 20 ml / kg , while others reported 150 ml / kg and 90 30 ml / kg . taken together , these comparisons suggest that our clearance findings with respect to pdagp are reasonable in light of previous reports in the literature and form a sound basis for comparison to the novel deglycosylated forms of agp that we generated . we used two strategies to reduce or eliminate entire n - linked glycans from agp : enzymatic treatment with pngase f , or mutation of the five asparagine residues to which the glycans are ordinarily attached . the enzymatic strategy was complicated by the resistance of agp to deglycosylation in the absence of treatment with sds . we elected to employ urea , since it could be removed by dialysis , promoting refolding , as opposed to sds , which binds tightly to proteins and can not readily be removed . pngase f treatment was only partially effective in altering agp clearance , likely due to the presence of some unaltered , multiply glycosylated agp in the mixture ; however , the least glycosylated forms of agp in that mixture were most rapidly removed from the circulation . a more convincing difference between native agp and nonglycosylated agp was achieved via the mutational strategy ; nonglycosylated ragp - n(5)q exhibited a 15-fold decrease in area under the clearance curve ( extrapolated to infinity ) and a 45-fold increase in clearance rate compared to plasma - derived agp . although it was not possible to control the ragp - n(5)q experiments with wild - type recombinant agp made in the same experimental system , due to the high mannose - type glycosylation typical of yeast , our results were consistent with previous data . these data were obtained by investigators who employed metabolic labeling of rat hepatocytes in the presence of an inhibitor of n - linked glycosylation ( tunicamycin ) and immunoaffinity purification to obtain nonglycosylated rat agp . although the difficulty in obtaining radiolabeled agp by this route prevented replication and kinetic analysis in this study , the 50% dose retention time was noted to decrease from 100 minutes to 5 minutes for nonglycosylated agp , as compared with native agp , consistent with our findings , as was increased renal clearance of nonglycosylated agp . having shown that appropriately terminated n - linked glycans keep agp from exhibiting accelerated clearance either via glomerular filtration or via hepatic receptors specific for abnormal glycosylation , we turned to the issue of agp interaction with the vessel wall . intravenous administration of hyaluronidase to hamsters led to a decrease in the fitc - dextran 70 permeation zone defined using intravital microscopy , one consistent with degradation of the glycocalyx , a surface layer of glycosaminoglycans , proteoglycans , and adsorbed plasma proteins [ 18 , 41 ] thought to contain agp [ 42 , 43 ] . while hyaluronidase treatment of rabbits would have been ideal in the context of this study , we found such treatment impractical in this larger laboratory animal . in mice , we found that hyaluronidase treatment decreased the initial clearance of agp , an effect consistent with an agp - glycocalyx action as a normal part of its distribution . hyaluronidase treatment appeared to be specific in that habp binding to liver sinusoidal vessels was reduced , but that of gs-1b4 , an -galactose - specific lectin that mainly binds to animal endothelial cells , was unaffected . agp administration also increased the amount of habp found in the plasma column within liver sinusoids . this increase could have occurred due to agp binding to hyaluronan in the glycocalyx , or its binding to a component of the glycocalyx that affected the access of habp to hyaluronan . we favour the second explanation because we were unable to detect agp - hyaluronan binding in vitro ; nevertheless , we can not exclude the possibility that this interaction occurs in vivo . although our primary reason for examining the liver microcirculation was technical in that this organ is amenable to intravital microscopy , it has also been shown that this microcirculatory bed is greatly enriched in hyaluronan as opposed , for instance , to those of lung or heart . our results support the suggestion that agp is a component of the glycocalyx , as previously suggested [ 17 , 42 , 47 , 48 ] . from a biotechnological point of view , our results also provide novel information with respect to targeting of recombinant agp to either renal or hepatic destinations . lipocalins bind many drugs and metabolites within a central binding pocket of the polypeptide . interestingly , in this regard lipocalin libraries have been described with engineered binding properties . our biological distribution results raise the possibility that engineered agps with defined ligand binding specificities could be directed to renal or hepatic destinations using either the n(5)q mutant , or mannosylated ragp - wt produced in yeast . in the latter instance , producing agp ( e.g. , for conjugation to dna , as has been previously reported for gene targeting [ 51 , 52 ] ) or an agp fusion protein in pichia pastoris could provide hepatic targeting in a single step , without the need for neuraminidase treatment . it would have been preferable to use homologous rabbit agp or murine agp in rabbits and mice , respectively , but our efforts to isolate rabbit agp by adapting a protocol designed for the purification of rat agp were not successful , and it was impractical to purify sufficient quantities of murine agp from murine plasma for our purposes . our study was also limited to human agp purified from the plasma of healthy individuals , and clearance was similarly investigated in healthy animals . as such , our results do not address the possibility that agp glycosylation or clearance properties are altered during inflammation , as has been suggested [ 5456 ] . our use of plasma purified from a small pool of healthy donors to purify agp was aligned with the concept that this material might be a future therapeutic product of plasma fractionation [ 57 , 58 ] . our results show that n - linked glycosylation of agp is a critical contributor to its plasma residency , in that reducing the number of glycans accelerated clearance ; this was most clearly demonstrated for a mutant agp completely lacking n - linked glycans . in this regard , agp resembles antithrombin , in which mutation of any one of four sites of n - linked glycosylation has been shown to lead to accelerated clearance in vivo in rabbits , but not albumin , in which either naturally occurring or engineered sites of n - linked glycosylation accelerate the clearance of the plasma protein . glycosylation thus contributes to maintaining a circulating pool of agp for exchange into the glycocalyx , where it may contribute to the maintenance of vascular permeability .
uscaca is a non - exclusive organization that welcomes all who wants to volunteer time and effort to support cancer research and education . the mission of uscaca is to facilitate collaborations among chinese and american professionals in the field of cancer research , treatment , and prevention ; promote knowledge and information exchange between the professionals in the us and china ; and provide educational information to serve cancer patients , their families , and the community . the members of uscaca work hard to bring clinical trials and new approved therapeutics to china to benefit cancer patients . professor of beijing cancer hospital , school of oncology , peking university , president of chinese medical association ( cma ) , oncology . xishan hao , m.d . , president of tianjin medical university , president of tianjin cancer research institute & hospital , president of chinese anti - cancer association ( caca ) . , donald w. seldin distinguished chair , chairman , department of medicine , ut southwestern medical center at dallas ; past president of asco . wei zhang , ph.d . , professor of pathology and cancer biology , director , cancer genomics core laboratory , the university of texas m. d. anderson cancer center .
differential diagnosis ( ddx ) includes malaria , typhoid fever , dengue fever , chikungunya fever , influenza and hepatitis a ( hav ) , , . fever and chills suggest malaria , but may be present in dengue , chikungunya and influenza . atypical lymphocytosis may be are present in malaria , dengue fever , chikungunya fever and influenza , but not typhoid , , , . thrombocytopenia can be profound in dengue fever , but is also present in influenza and malaria . mildly increased serum transaminases are common in malaria , typhoid fever , dengue fever , chikungunya fever and influenza . while very high serum transaminases point to hepatitis a or hepatitis e , , ( table 1 ) . we present a young woman after returning from the amazon with atypical lymphocytosis , splenomegaly , and luekopenia who was diagnosed with hepatitis a. two weeks after returning from the amazon ( manaus , brazil ) , a 40-year - old female developed fever , chills , headache , and myalgias with temperatures to 103.5 f , and saw a physician . she had been vaccinated for yellow fever and took atovaquone / proguanil for malaria prophylaxis . her white blood cell ( wbc ) count was 6.9 k/l ( n = 3.911.0 k/l ) , hemoglobin 9.8 g / dl ( n = 11.616.3 g / dl ) , hematocrit 33.1% ( n = 3648% ) , and platelet count 411 k/l ( n = 160320 k/l ) . her ast was 37 iu / l ( n = 1339 headache and chills continued which prompted hospitalization . on admission , her review of systems was negative except for myalgias and left upper quadrant pain . her wbc count was 3.6 k/l ( atypical lymphocytes = 5% ) , hemoglobin 10.4 g / dl , hematocrit 33.5% , and platelet count 172 k/l . serum ferritin was unelevated , and her lactate dehydrogenase ( ldh ) was 1167 iu / l ( n = 100250 the left upper quadrant pain prompted an abdominal ct scan which showed mild splenomegaly , . her aminotransferases became prominently elevated with a rise in ast to 1757 iu / l and alt to 1375 her igm anti - hav was markedly elevated , confirming the diagnosis of acute hepatitis a infection . this case presented a diagnostic dilemma as a febrile traveler with leukopenia , atypical lymphocytosis , elevated ldh and splenomegaly as hepatitis a is often neglected in the differential diagnosis of returned torpical travelers . the presentation is interesting for several reasons as the serum aminotransferases were not substantially elevated at the time of presentation , atypical lymphocytosis in hav infection is not usual and splenomegaly is not generally a feature of acute hepatitis a infection . in this case , unless a combination of infections were present timultaneously , the presentation of acute hav infection was particularly atypical . hav infection should always be in the differential diagnosis of travelers returning from high risk areas even with initially minimally elevated aminotransferases . later during hospitalization her hav igm titer was > 400 mg / dl ( n = < 300 mg / dl ) , confirming the diagnosis of acute hav . secondly , serum transaminases are usually highly elevated early , which was not the case here . thirdly , she had splenomegaly which is not usually a feature of hav . furthermore , atypical lymphocytes are unusual in hav . hav may mimic other infections if unusual clinical laboratory findings are present as was the case here , e.g. , splenomegaly , atypical lymphocytes , decreased hemoglobin / hematocrit and elevated ldh , . if the diagnosis remains unclear , serial non - specific tests may , during hospitalization , suggest the correct diagnosis and prompt specific testing , . we conclude that hav should always be in the ddx of febrile returning travelers even with initially minimally elevated transaminases .
to survive and adapt to their native surroundings , plants have developed mechanisms that detect and rapidly respond to assaults by both pathogens and arthropods . plants recognize the plant - derived chemical , electrical , and hydraulic signals associated with wounding , as well as the chemical signals that are introduced by herbivore saliva , midgut regurgitant , and oviposition fluid ( felton and tumlinson , 2008 ; howe and jander , 2008 ; fatouros et al . , 2009 ; walling , 2009 ; wu and baldwin , 2009 ) . plants perceive the duration , quantity , and quality of these chemical and mechanical signals , and use these infestation - alert cues to induce resistance traits that act directly to antagonize insect settling , growth and development , and indirectly by synthesizing and releasing volatiles to attract natural enemies . these defenses limit damage by the plant s attacker , stimulate defenses to counter future attacks , preserve vegetative growth and reproduction , yet minimize fitness costs to the plant ( koornneef and pieterse , 2008 ; dicke and baldwin , 2010 ; heil , 2010 ; mooney et al . , 2010 ) . these complex biochemical and physiological responses are dynamic and often result in a local or systemic resistance to further challenge ( de vos et al . , 2006 ; de vos and jander , 2009 ) . plants deploy defense - signaling pathways regulated by salicylic acid ( sa ) , jasmonic acid ( ja ) , ethylene , and reactive oxygen species ( ros ) in response to herbivores and pathogens ( glazebrook , 2005 ; walling , 2009 ) . these pathways are interconnected and can act antagonistically , additively , or synergistically ( mur et al . , 2006 ) . the convergence of these pathways at key signaling nodes ( npr1 , wrky70 , and glutaredoxin ) may enable prioritization of the signaling pathways allowing deployment of the most effective local and systemic defenses against an intruder ( koornneef and pieterse , 2008 ) . in addition , these defense pathways communicate with abscisic acid ( aba ) , auxin , gibberellic acid , and brassinosteroid signaling pathways to coordinate the magnitude and quality of the defense response activated ( lpez et al . there is accumulating evidence for additional defense - signaling pathways that are modulated after herbivore attack ; however the identities of these pathways have yet to be revealed ( van de ven et al . , 2000 ; glazebrook , 2005 ; de vos et al . , 2006 ; de vos and jander , 2009 ; bhattarai et al . , 2010 ) . plant defense responses to insects in the order hempitera are distinct , as these insects use their stylets and salivary secretions in disparate manners to recover nutrients from their host plants . for example , mirid bugs , pyrrhocorids , lygaeids , planthoppers , and leafhoppers are destructive , since they lacerate cells , solubilize cell contents , and consume the cellular slurry ( miles , 1999 ; walling , 2009 ) . at the cellular level , these hemiptera can be as damaging as caterpillars or beetles that cut and tear foliage . at the other end of the spectrum are aphids and whiteflies ( tjallingii , 2006 ; walling , 2008 ) . aphids will puncture numerous mesophyll cells in their search for phloem sieve elements , while whiteflies rarely damage cells on their stylet s path to the phloem . over 1,555 whitefly species have been described , although most studies have focused on polyphagous whiteflies , such as the bemisia tabaci species complex and trialeurodes vaporariorum ( westwood ) , that interfere with agricultural and horticultural productivity ( de barro et al . , 2005 ; martin and mound , 2007 ) . trialeurodes vaporariorum is a common pest of greenhouses worldwide and fields in temperate climates , while b. tabaci ( gennadius ) biotype b , also known as bemisia argentifolii ( bellows and perring ) , is more widespread , destructive , and invasive ( van lenteren and noldus , 1990 ; inbar and gerling , 2008 ) . the success of b. tabaci biotype b likely is due to a variety of strategies including : ability to adapt to a wide range of plant habitats , broad host range , voracious feeding that may allow it to infest plants with phloem sap of different nutritional values , increased fecundity , breeding strategies that promote invasiveness , and rapid emergence of insecticide - resistant strains ( liu et al . the destructiveness of b. tabaci biotype b is correlated with depletion of photosynthates , deposition of large amounts of excreta ( honeydew ) that supports sooty mold growth , and its ability to vector over 111 virus species ( inbar and gerling , 2008 ) . in addition , this whitefly causes plant developmental disorders that can contribute to agricultural losses including tomato fruit irregular ripening and the curcurbit leaf - silvering disorder , the characteristic used in the common name of this biotype ( the silverleaf whitefly ) ( schuster et al . recently , two newly identified biotypes ( ms , ug6 ) also were shown to cause silvering , thus demonstrating that this trait has been acquired several times ( delatte et al . several studies have evaluated the response of crop and model plants to b. tabaci feeding . in the model plant arabidopsis thaliana ( l. heynh ) , bemisia tabaci biotype b causes a profound reprogramming of gene expression ( kempema et al . , 2007 ) . b. tabaci causes increases in sa - regulated pathogenesis - related ( pr ) protein gene transcripts and decline in ja - regulated defense rnas in infested leaves ( locally ) and systemically in apical , non - infested leaves ( zarate et al . , 2007 ) . use of defense - response mutants and transgenic lines that alter the activity of the sa- and ja - regulated defense - signaling pathways ( coi1 , npr1 , cev1 , cim10 , and nahg ) and methyl jasmonate ( meja ) treatments show that b. tabaci induces decoy defenses ( zarate et al . , 2007 ) . the suppressed ja - regulated defense pathway , not the induced sa - regulated defense pathway , controls the resistance traits that retard nymph development . the role of the ja , sa , and ethylene defense - signaling pathways in regulating the expression of the resistance traits in crop plants that deter b. tabaci nymph development is less well characterized . studies in squash show that plants can discriminate the elicitors / effectors ( chemical signals ) introduced by two different b. tabaci biotypes ( van de ven et al . , 2000 ) . slw1 ( a m20b peptidase - like gene ) and slw3 ( a leaf - specific -glucosidase - like gene ) rnas accumulate preferentially in response to b. tabaci biotype b feeding but not b. tabaci biotype a. both slw1 and slw3 appear to be regulated by sa - independent pathways ( van de ven et al . , 2000 ) . slw1 rnas accumulate after ja and ethylene treatments , while slw3 transcripts do not accumulate in response to known defense signals . changes in peroxidase , chitinase , and -1,3-glucanase activities have been noted after b. tabaci infestations of cassava , squash , and tomato ( jimnez et al . , 1995 ; mayer et al . , 1996 ; antony and palaniswami , 2006 ) . in addition , b. tabaci biotype b infestation of phaseolus vulgaris ( l. ) causes the release of volatiles that are recognized by its parasitoid encarsia formosa ( gahan ) ( birkett et al . , 2003 ) . however , in cotton , no changes in volatile bouquets were detected ( rodriguez - saona et al . the levels of two pathogenesis - related ( pr ) protein gene rnas ( pr69b and p6 ) are known to accumulate during b. tabaci biotype b infestation ( snchez - hernndez et al . , 2006 ) . furthermore , 244 differentially regulated genes were identified using spotted cdna arrays after b. tabaci infestation of tomato ( estrada - hernandez et al . , 2009 ) . given the ability of plants to discriminate between b. tabaci biotypes , macrosiphum . euphorbiae ( thomas ) biotypes , and tetranychus urticae ( koch ) lines ( van de ven et al . , 2000 ; , 2007 ; kant et al . , 2008 ) , it was of interest to develop a more comprehensive understanding of the changes in plant defense - response gene expression in response to two species of whiteflies with distinctive host ranges and abilities to induce developmental disorders and vector viruses . to this end , the temporal and spatial expression of nine tomato genes that respond to wound / defense signals , including systemin , ja , ethylene , aba , and sa , were monitored after feeding by b. tabaci biotype b or t. vaporariorum . in addition , the roles of wound signals in the tomato - bemisia interaction were investigated using a transgenic tomato line expressing a lapa1:gus ( leucine aminopepetidea1:-glucuronidase ) reporter gene construct , which is a sensitive monitor for wounding . plant growth , insect colonies and whitefly infestations tomato plants ( solanum lycopersicum cv . rutgers and cv . pto238r ) were grown in uc soil mix iii in a growth chamber at 25c with a 16/8-h l : d . at planting , these plants had 15 leaves , and leaves were numbered beginning at the base of the plant . silverleaf whitefly [ b. tabaci ( gennadius ) biotype b ; also known as bemisia argentifolii ( bellows and perring ) ] and greenhouse whitefly [ trialeurodes vaporariorum ( westwood ) ] colonies were raised on phaseolus vulgaris ( l. ) plants . bemisia tabaci cultures were assayed periodically for isozyme variants to ensure culture purity.when plants were 7-wk old , the 7th and 8th leaves were encased individually in nylon - mesh bags , and 250 whiteflies adults ( 200 females and 50 males ) were placed inside each bag . control plants were encased in a similar manner , except no insects were added ( bagged control ; control b ) . a second set of control plants was neither bagged nor infested to assess the impact of bagging on wound- and defense - response gene expression ( unbagged control ; control u ) . after 9 d of feeding , adult whiteflies were removed by aspiration , and the infested tomato leaves ( leaves 7 and 8) and apical , non - infested leaves ( leaf 9 ) were harvested directly in liquid nitrogen . in time - course experiments , infested and control leaves were harvested at 0 , 1 , 3 , 5 , 7 , and 9 d post infestation . experiments were repeated once and in each experiment each sample was a pool of leaves from three different plants . similar nymph densities have been noted in field - grown tomatoes ( gusmo et al . , 2006).excised shoots from 3- to 4-wk - old tomato ( peto 238r ) plants were treated with 10 m meja ( 24 hr ) , 100 m aba ( 24 hr ) , 29 ppm ethylene ( 24 hr ) , 1 pmol systemin ( 12 hr ) , or 0.1 , 0.25 or 0.5 mm salicylic acid ( 24 hr ) . treatments and controls have been described previously ( gu et al . , 1996 ; chao et al . , 1999 ) . rna extractions and rna blot hybridizations leaves ( 2.5 g ) were ground to a fine powder in liquid n2 . after n2 evaporation , 5 ml extraction buffer ( 100 mm licl , 100 mm tris - hcl , ph 8.0 , 10 mm edta , 1% sds ) at 80c and 5 ml of water - saturated phenol ( 80c ) were added . after vortexing for 30 sec , 6 ml chloroform : isoamyl alcohol ( 24:1 ) were added . the sample was vortexed for 30 sec and centrifuged at 3,200 g at 4c for 60 min . the aqueous layer was removed and mixed with one volume of 4 m licl . after 1 hr at 80c , total rna was recovered by centrifugation at 3,200 g at 4c for 60 min , washed with 70% etoh , resuspended in water , and stored at 80c.total rnas ( 15 g ) were size fractionated on 1.0% formaldehyde - agarose gels , blotted to nylon membranes ( hybond - n , amersham , piscataway , nj , usa ) , hybridized with p - labeled probes , and washed under conditions of high stringency as described in pautot et al . autoradiographic signals were quantitated using a phosphoimager ( molecular dynamics).the pr-1 ( p6 protein , pp6 ) , pr-4 ( p2 protein , ppr - p2 ) , chi3 ( acidic chitinase , pchi3 ) , chi9 ( basic chitinase , pchi9 ) , glub ( basic -1,3-glucanase , pglubas ) , and gluac ( acidic -1,3-glucanase , pgluac ) cdna clones were provided by dr . pierre de wit ( wageningen agricultural university , wageningen , the netherlands ) ( van kan et al . , 1995 ) . the proteinase inhibitor 2 ( pin2 ; pt2 - 47 ) cdna clone was provided by dr . c.a . ryan ( washington state university , pullman , wa , usa ) ( graham et al . , 1985 ) . the lapa1 partial cdna clone ( pdr57 ) was previously described ( pautot et al . , 1993 ) . there are two genes ( lapa1 and lapa2 ) encoding lap - a that are 98% identical at the nucleotide level ( gu et al . , 1996 ) ; transcripts for both genes are detected under the hybridization conditions utilized . the pal gene family in tomato ( cv . craigella ) consists of 26 family members ( chang et al . , 2008 ) . rnas for only two pal genes ( pal1 and pal5 ) have been detected in tomato ( lee et al . , 1992 ) . the pal1 rna is not abundant , whereas the pal5 rna accumulates during development and in response to abiotic and biotic stresses ( chang et al . , 2008 ) . the tomato pal5 cdna clone ppal1 - 16 was 1.6 kb in length and was isolated as a whitefly - induced cdna by using differential rna display from cv rutgers ( d.p . walling , unpublished results ) . partial sequence of this clone showed 97% nucleotide identity with pal5 of tomato cv . gus histochemical and fluorometric assays the lapa1:gus line u78 was characterized previously ( chao et al . , 1999 ) . homozygous lapa1:gus or uc82b ( wild - type control ; wt ) tomato plants were planted per 1-gallon pot ( 2 plants / pot ) and grown in the greenhouse in insect cages . at 3 wk , pots were encased in nylon mesh bags , and plants were infested with 100 b. tabaci biotype b or served as non - infested controls . after 21 d of infestation , second , third and early fourth instar nymphs were feeding on the abaxial leaf surfaces . at this time , developmentally matched leaves from the control and infested plants were harvested for gus staining . leaves from 6-wk - old control ( wt ) and lapa1:gus plants grown in insect - free cages were wounded by pricking the abaxial surface of leaflets with a straight pin . pin pricks were administered to reflect the density of feeding whitefly nymphs ( 10 pricks per cm ) . six - wk - old control ( wt ) and lapa1:gus plants were mechanically wounded by crushing of the leaf lamina as previously described chao et al . ( 1999 ) . pin - pricked and crushed leaves , as well as developmentally matched leaves from non - damaged wt ( control ) and lapa1:gus plants , were harvested 24 hr later . all tissues were stored at 80c until use.extraction and measurement of gus activity in leaves was according to jefferson ( 1987 ) with the following modifications . leaves were ground to a fine powder in liquid nitrogen , and 30 mg of tissue were homogenized in gus extraction buffer ( 50 mm napo4 , ph 7.0 , 10 mm -mercaptoethanol , 10 mm edta , 0.1% sodium lauryl sarcosine , 0.1% triton x-100 ) . extracts ( 10 l ) were assayed in a 500-l reaction with gus assay buffer ( 2 mm 4-methylumbelliferyl--d - glucuronide in gus extraction buffer ) with 20% ( v / v ) methanol to reduce endogenous gus activity ( kosuge et al . , 1990 ) . after 0 , 30 , and 60 min , 100-l aliquots were removed and added to 1.9 ml 0.2 m na2co3 . methlyumbelliferone ( mu ) concentrations were determined by using a dyna quant 200 fluorimeter using mu standards . protein concentrations were determined with the bicinchoninic acid ( bca ) assay ( pierce , rockford , il , usa ) using bovine serum albumin standards . protein samples were pretreated with 0.1 m iodoacetamide in 0.1 mm tris - hcl ( ph 8.0 ) at 37c for 20 min prior to the bca assay to reduce interference caused by -mercaptoethanol ( hill and straka , 1988).for gus histochemical staining , 3-wk - old , greenhouse - grown lapa1:gus tomato seedlings were infested or wounded . infested plants were monitored for appearance of first , second , and third instar nymphs . feeding sites of immature insects in each instar were evaluated on at least three different plants after 20 d of feeding . infested leaves were harvested and stained for gus activity ( jefferson , 1987 ) . in brief , tomato leaves were harvested into gus staining buffer ( 100 mm napo4 , 0.5 mm k3[fe(cn6 ) ] , 0.5 mm k4[fe(cn6 ) ] , 10 mm edta , 0.5 mg / ml x - gluc , 0.1% triton x-100 , 20% methanol ) . x - gluc ( 5-bromo-4-chloro-3-indoyl -d - glucuronic acid ) was purchased from research products international ( mt . prospect , il , usa ) . after vacuum infiltration for 5 min at 2025 mm hg , tissue was incubated at 37c overnight . tomato leaves were cleared with repeated changes of 95% ethanol and viewed in a dissecting scope . while arabidopsis gene - trap lines demonstrated that the gus histochemical assay was working ( data not shown ) , gus activities were not detected histochemically in infested or wounded lapa1:gus plants . increasing infiltration times , increasing number of 5-min infiltrations , pretreating leaves by dipping in hexane for 10 sec to 1 min , or performing gus staining reactions in the presence of 1%4% dmso or 0.05%0.5% silwet ( a wetting agent ) did not enhance histochemical detection of gus activity in the mature lapa1:gus leaves . whiteflies do not increase levels of lapa or pin2 rnas whiteflies do not cause extensive damage to plant tissues since their stylets follow an intercellular path to reach phloem sieve elements . therefore , it was important to determine if ( a ) the occasional epidermal cell piercing , ( b ) passage of the whitefly stylet through the leaf cell s extracellular matrix , and ( c ) the puncturing of phloem elements would be perceived as a wound response in tomato . to this end , the levels of rnas for two well - studied wound - response genes leucine aminopeptidase ( lapa ) and proteinase inhibitor 2 ( pin2)were used as sentinels to monitor the activation of the tomato wound - signaling pathway.the 7th and 8th leaves of 8-wk - old tomato plants were enclosed in fine - mesh nylon bags and each leaf was infested with 250 adult whiteflies / leaf ( 4 females:1 male ) . to control for possible responses to the inadvertent mechanical damage that occurred during the infestation procedures and plant handling , two sets of controls some control plants had their leaves encased in nylon bags but insects were not added ( control b ) . a second set of control plants were not bagged or infested ( control u ) . the levels of lapa and pin2 rnas were determined in the infested and apical non - infested leaves at 0 , 1 , 3 , 5 , 7 , and 9 days after whitefly infestation ( fig . a leaves 7 and 8 of 8-wk - old tomato plants were infested with 250 adult besimia tabaci biotype b ( bt ) or trialeurodes vaporariorum ( tv ) . leaves from non - infested control plants ( c ) were encased in nylon - mesh bags but no insects were added . after 9 d of infestation , adult whiteflies were removed and infested leaves and apical , non - infested leaves ( leaf 9 ) were harvested . total rnas isolated and rna blots ( 15 g / lane ) were hybridized with p - labeled probes for leucine aminopeptidase ( lapa ) , proteinase inhibitor 2 ( pin2 ) , and phenylalanine ammonia lyase ( pal ) . film exposure times were 3 ( pal ) or 6 ( lapa , pin2 ) days . b plants were infested with b. tabaci biotype b ( bt ) or t. vaporariorum ( tv ) as described in panel a. infested and apical , non - infested leaves were harvested 0 , 1 , 3 , 5 , 7 , and 9 d after infestation . leaves from control plants that had leaves 7 and 8 encased in insect bags ( control b ) and untreated plants ( control u ) were harvested at 0 , 1 , 3 , 5 , 7 , and 9 d. total rna blots were hybridized with a p - labeled pal probe . results from infested leaf 7 and apical leaf 9 are displayed ( a , b ) . infested leaf 8 was also analyzed and results were similar to that of leaf 7 ( data not shown)throughout the 9-day infestation , adults fed , mated , and oviposited . during the first 3 days of infestation , only whitefly adults were feeding ( 500 per plant ) . during this period , no increases in lapa or pin2 rnas were detected ( data not shown ) . between days 3 and 5 , eggs began to hatch and first - instar nymphs established feeding sites . the numbers of feeding nymphs increased over the 9-day period . at the time of harvest , there were approximately 2,000 immature insects and 250 adult insects associated with each infested tomato leaf . most nymphs were in their second and third instars . despite the large numbers of whitefly nymphs ( 10 nymphs / cm leaf area ) , neither the lapa nor pin2 transcripts were detected in the infested leaves at 9 days post infestation ( fig . 1a ) or at earlier times ( data not shown).since many wound - response genes are expressed systemically and local and systemic responses can be distinct , the levels of lapa and pin2 rnas in apical , non - infested leaves were determined . lapa and pin2 rnas were not detected in apical leaves from control or infested plants after 9 days ( fig . this is in sharp contrast to the rapid increase in lapa or pin2 mrna levels that have been previously reported after mechanical wounding or caterpillar feeding ( pautot et al . , 1993 ; howe et al . , 1996).although visual damage is not observed after whitefly feeding , wound - response genes ( lapa and pin2 ) might be expressed in a subset of leaf cells ( i.e. , the epidermal cells that were pierced ) , and rna signals may be diluted by the majority of non - responding cells . for this reason , it was of interest to determine if wound - response genes were activated in leaf cells immediately surrounding the stylet path or at the whitefly feeding sites . to this end , transgenic tomato plants expressing the wound - activated lapa1 gene promoter fused to the -glucuronidase ( gus ) coding region ( lapa1:gus ) were used in whitefly infestation studies . due to the exceptional stability of gus in plant cells , gus was the reporter gene of choice in these studies . gus activity can be detected for several days after promoter activation ( weinmann et al . three - wk - old lapa1:gus and wt plants were infested with 100 b. tabaci . after 21 d of infestation , leaves had second , third , and early fourth - instar nymphs . as positive controls , leaves from developmentally matched plants were wounded by crushing or pin pricking . both histochemical and fluorometric assays were performed.using the gus histochemical detection method , no gus activity was detected in controls or , more surprisingly , in wounded or ja - treated samples ; however , gus activities were readily detected using a gus fluorometric assay ( table 1 ) . the inability to detect gus staining in older leaves in this study contrasted to previous reports that readily detected gus histochemically after ja treatments in 7- to 10-day - old lapa1:gus seedlings or in fruit or flowers ( chao et al . , 1999 ) . the reason gus activity was difficult to detect in mature tomato leaves using the gus histochemical method has not been identified . variation of substrate infiltration regimes and pretreatments with hexane , dmso or silwet did not allow reproducible histochemical gus detection in mature tomato leaves ( see methods and materials ) . table 1fluorometric analysis of gus activity in transgenic lapa1:gus tomato plants in response to wounding and whitefly feedingtreatmentgus activity ( pmol 4-mu / min / mg protein)averageuntreated195.1 9.5248.9 81.42342.6 8.5209.1 2.0b . tabaci430.8 26.4459.1 265.80296.6 17.5843.1 13.3266.0 31.8crushing5585.5 118.46325.2 3328.47 * 10123.7 360.2pin pricks2416.6 215.31293.3 806.761334.7 38.8638.2 6.3783.5 101.9gus activity in leaf extracts from 6-week - old lapa1:gus control plants ( untreated ) or lapa1:gus plants infested with bemisia tabaci biotype b ( 20 d ) , wounded by leaf lamina crushing ( 24 hr ) , or wounded by pricking the leaf with a straight pin ( 24 hr ) . gus activities were measured in triplicate from individual plants and therefore reflect plant - to - plant variation in treatment responses . gus and protein levels were determined as described in methods and materials . one representative experiment is displayedoverall average for each treatment ( + / standard deviation ) . bold numbers are statistically different from the untreated sample determined by a t - test ( 2-tailed , unequal variance , 0.05 level ) . numbers designated with an asterisk are significantly different from the b. tabaci treatment determined by a t - test ( 2-tailed , unequal variance , 0.05 level)for the reasons above , gus activities in leaf extracts were monitored fluorometrically . these assays showed plant - to - plant variability in gus activity levels in all treatments and controls ; however , trends in gus activities in the treated and control plants were readily discerned . control , non - infested lapa1:gus plants had low levels of gus activity ranging from 195 to 342 pmol 4-mu / min / mg protein ( table 1 ) similar to that observed by chao et al . bemisia tabaci feeding caused no significant changes of gus activity ( table 1 ) . lapa1:gus leaf lamina that were pin pricked to mimic mechanical damage ( similar to that inflicted during feeding by some species of aphids ) had higher levels of lapa promoter activity ( 2.6- to 9.7-fold ) ; however , due to plant - to - plant variation , these values were not statistically significant from untreated leaves . larger and statistically significant increases in lapa1 promoter activity ( 7 to 40-fold ) were detected after the more severe mechanical wound ( leaf crushing ; table 1 ) , which is known to activate lapa1 ( chao et al . changes in lapa , pin2 , and pal gene expression after whitefly feeding . a leaves 7 and 8 of 8-wk - old tomato plants were infested with 250 adult besimia tabaci biotype b ( bt ) or trialeurodes vaporariorum ( tv ) . leaves from non - infested control plants ( c ) were encased in nylon - mesh bags but no insects were added . after 9 d of infestation , adult whiteflies were removed and infested leaves and apical , non - infested leaves ( leaf 9 ) were harvested . total rnas isolated and rna blots ( 15 g / lane ) were hybridized with p - labeled probes for leucine aminopeptidase ( lapa ) , proteinase inhibitor 2 ( pin2 ) , and phenylalanine ammonia lyase ( pal ) . film exposure times were 3 ( pal ) or 6 ( lapa , pin2 ) days . b plants were infested with b. tabaci biotype b ( bt ) or t. vaporariorum ( tv ) as described in panel a. infested and apical , non - infested leaves were harvested 0 , 1 , 3 , 5 , 7 , and 9 d after infestation . leaves from control plants that had leaves 7 and 8 encased in insect bags ( control b ) and untreated plants ( control u ) were harvested at 0 , 1 , 3 , 5 , 7 , and 9 d. total rna blots were hybridized with a p - labeled pal probe . . results from infested leaf 7 and apical leaf 9 are displayed ( a , b ) . infested leaf 8 was also analyzed and results were similar to that of leaf 7 ( data not shown ) fluorometric analysis of gus activity in transgenic lapa1:gus tomato plants in response to wounding and whitefly feeding gus activity in leaf extracts from 6-week - old lapa1:gus control plants ( untreated ) or lapa1:gus plants infested with bemisia tabaci biotype b ( 20 d ) , wounded by leaf lamina crushing ( 24 hr ) , or wounded by pricking the leaf with a straight pin ( 24 hr ) . gus activities were measured in triplicate from individual plants and therefore reflect plant - to - plant variation in treatment responses . gus and protein levels were determined as described in methods and materials . one representative experiment is displayed overall average for each treatment ( + / standard deviation ) . bold numbers are statistically different from the untreated sample determined by a t - test ( 2-tailed , unequal variance , 0.05 level ) . numbers designated with an asterisk are significantly different from the b. tabaci treatment determined by a t - test ( 2-tailed , unequal variance , 0.05 level ) pal is not a good molecular sentinel for whitefly feeding increases in pal transcripts have been correlated with wounding , pathogen infection and aphid feeding ( lee et al . , 1994 ; moran and thompson , 2001 ) . therefore , the changes in pal rnas in response to b. tabaci and t. vaporariorum feeding were monitored from 0 to 9 days after infestation of tomato plants . analysis of temporal and spatial rna blot studies showed that pal rna levels increased transiently ( days 15 ) and then declined ( days 79 ) in both bagged ( control b ) and unbagged ( control u ) leaves and in apical leaves of control , non - infested plants ( fig . these data indicated that the small mechanical stresses that occurred during movement of the plants within the insect cages and not the process of encasing leaves in nylon bags were sufficient to increase pal transcript levels . in some experiments , large increases in pal transcripts were detected in infested leaves after 9 days of feeding by b. tabaci or t. vaporariorum relative to controls ( fig . in other experiments , pal rnas were only slightly elevated after b. tabaci feeding relative to controls on day 9 ( fig . while it appears that tomato pal genes respond to whitefly feeding , pal was not a reliable molecular marker for whitefly feeding responses . whiteflies cause pr rna accumulation to determine if tomato pr rnas accumulated after whitefly feeding , the levels of glub ( basic -1,3-glucanase ) , chi9 ( basic chitinase ) , pr-1 ( p6 protein ) , pr-4 ( p2 protein ) , gluac ( acidic -1,3-glucanase ) , and chi3 ( acidic chitinase ) transcripts were determined at 9 days after b. tabaci or t. vaporariorum infestation . overall , similar gene expression patterns were noted after infestations with both species of whiteflies . glub , chi9 , and pr-1 transcripts accumulated to high levels in infested leaves relative to the controls ( fig . smaller increases in pr-4 and chi3 rnas were detected in infested leaves and gluac transcripts were not detected ( fig . a tomato plants were infested with besimia tabaci biotype b ( bt ) or trialeurodes vaporariorum ( tv ) or served as non - infested controls ( c ) . control leaves were encased and nylon bags but insects were not added as described in fig . total rna blots were hybridized with p - labeled basic -1,3-glucanase ( glub ) , basic chitinase ( chi9 ) , pr-1 ( p6 ) , pr-4 , acidic chitinase ( chi3 ) , or acidic -1,3-glucanase ( gluac ) cdna probes . film exposure times were : 3 d for chi9 , glub , and pr-4 ; 2 d for pr-1 , 4 days for chi3 ; 6 d for glua , b , c plants were infested as in fig . infested and apical , non - infested leaves were harvested 0 , 3 , 5 , 7 , and 9 d after b. tabaci biotype b ( bt ) or t. vaporariorum ( tv ) infestation . controls were leaves from bagged but non - infested ( control b ) or untreated ( control u ) plants . rna blots were hybridized to each p - labeled pr gene probe in panel a ; only data from the glub ( panel b ) or pr-1 ( panel c ) probes are shown in panel b. stained gels visualizing rrnas are shown as a loading control . film exposures time were 2 dthe levels of pr rnas from infested and control plants were evaluated in infested and apical , non - infested leaves on days 0 , 1 , 3 , 5 , 7 , and 9 after b. tabaci and t. vaporariorum infestation . while six pr gene rnas were evaluated in this study ( table 2 ) , only the glub and pr-1 data are presented here ( fig . 2 ) . glub transcripts were first detected 5 days after infestation with b. tabaci and t. vaporariorum . glub rnas also were detected in the apical , non - infested leaves on day 7 . glub transcripts were not detected in the leaves from the two sets of control plants that had either had their leaves encased in insect - proof bags ( control b ) or were not manipulated ( control u ) ( fig . table 2tomato wound- and defense - response gene expressiongeneproteinrelative rna increases in response to wound and defense signalswfmejaethabasyssalapaleucine aminopeptidaseo++++++++pin2proteinase inhibitor iio+++++++palphenylalanine ammonia lyase+/+++++oglubbasic -1,3-glucanase+++++o+chi9basic chitinase+++++ooopr-1p6 protein ( pr-1-like protein)+++++++oo+++gluacacidic -1,3-glucanaseo++++oochi3acidic chitinase+++++o++pr-4p2 protein ( win - like protein)+o+++ooofold increase in rnas relative to control samples was determined by phosphoimager quantitation of rna blot signals . rnas that were unchanged or declined relative to control are indicated with a zero ( o ) or minus symbol ( ) , respectively . rnas that increased are indicated with plus symbols : from 1.5 to 3.0 fold ( + ) , 3.1 to 10 fold ( + + ) , and greater than 10 fold ( + + + ) . treatments included silverleaf or greenhouse whitefly infestations ( wf ) , 100 m methyl jasmonate ( meja ) , 29 ppm ethylene ( eth ) , 100 m abscisic acid ( aba ) , 1 pmol systemin ( sys ) , and 0.25 mm salicylic acid ( sa)defense chemical treatment data are from chao et al . ( 1999 ) . whitefly - response data appear in this paperthe pin2 probe was hybridized to a rna blot similar to that shown in fig . 3 and autoradiographic signals quantitated ( data not shown ) . whitefly response data appear in this paperdefense chemical treatment and whitefly - response data appear in this papercontrol samples had elevated levels of these transcripts relative to other genes , therefore increases in these rna levels may be underestimated . ( 1999)the spatial and temporal patterns of pr-1 rna accumulation were more complex . over the 9-day infestation period , this conclusion was based on the fact that pr-1 rnas were detected at low levels in the non - infested leaves from both controls on days 13 and increased between days 5 and 7 ( fig . in addition , low levels of pr-1 rnas were detected in apical leaves on days 59 , reflecting the younger age of these leaves and the beginning of the pr-1 developmental program ( fig . it should be noted that these leaves showed no signs of senescence , and therefore pr-1 transcript levels could not be attributed to initiation of the senescence program , as has been previously reported ( john et al . , 1997 ) . despite this developmental regulation , it was clear that both b. tabaci and t. vaporariorum feeding enhanced pr-1 transcript accumulation in infested leaves relative to control plants . differences in pr-1 transcript levels in apical leaves from infested or non - infested plants also were observed in this experiment ( fig . a tomato plants were infested with besimia tabaci biotype b ( bt ) or trialeurodes vaporariorum ( tv ) or served as non - infested controls ( c ) . control leaves were encased and nylon bags but insects were not added as described in fig . total rna blots were hybridized with p - labeled basic -1,3-glucanase ( glub ) , basic chitinase ( chi9 ) , pr-1 ( p6 ) , pr-4 , acidic chitinase ( chi3 ) , or acidic -1,3-glucanase ( gluac ) cdna probes . film exposure times were : 3 d for chi9 , glub , and pr-4 ; 2 d for pr-1 , 4 days for chi3 ; 6 d for glua , b , c plants were infested as in fig . infested and apical , non - infested leaves were harvested 0 , 3 , 5 , 7 , and 9 d after b. tabaci biotype b ( bt ) or t. vaporariorum ( tv ) infestation . controls were leaves from bagged but non - infested ( control b ) or untreated ( control u ) plants . rna blots were hybridized to each p - labeled pr gene probe in panel a ; only data from the glub ( panel b ) or pr-1 ( panel c ) probes are shown in panel b. stained gels visualizing rrnas are shown as a loading control . film exposures time were 2 d tomato wound- and defense - response gene expression fold increase in rnas relative to control samples was determined by phosphoimager quantitation of rna blot signals . rnas that were unchanged or declined relative to control are indicated with a zero ( o ) or minus symbol ( ) , respectively . rnas that increased are indicated with plus symbols : from 1.5 to 3.0 fold ( + ) , 3.1 to 10 fold ( + + ) , and greater than 10 fold ( + + + ) . treatments included silverleaf or greenhouse whitefly infestations ( wf ) , 100 m methyl jasmonate ( meja ) , 29 ppm ethylene ( eth ) , 100 m abscisic acid ( aba ) , 1 pmol systemin ( sys ) , and 0.25 mm salicylic acid ( sa ) defense chemical treatment data are from chao et al . whitefly - response data appear in this paper the pin2 probe was hybridized to a rna blot similar to that shown in fig . 3 and autoradiographic signals quantitated ( data not shown ) . whitefly response data appear in this paper defense chemical treatment and whitefly - response data appear in this paper control samples had elevated levels of these transcripts relative to other genes , therefore increases in these rna levels may be underestimated . ( 1999 ) changes in chi3 , chi9 , gluac , and pal transcripts in response to wound and defense signals the responses of the tomato pr genes encoding the glub , pr-4 , and pr-1 to wound and defense signals ( i.e. , meja , systemin , aba , ethylene , and sa ) in the tomato cultivar uc82b were reported previously ( chao et al . , 1999 ) and are summarized in table 2 . to understand the potential defense signals important in the regulation of other tomato defense genes used in this study , the accumulation of transcripts for chi3 , gluac , chi9 , and pal5 was determined after sa , meja , systemin , aba , and ethylene treatments ( fig . 3 ; table 2 ) . like previously characterized pr genes ( chao et al . , 1999 ) , gluac , chi9 , and chi3 rnas did not accumulate in response to systemin or aba treatments . 3rna blot analyses of wound- and defense - response rnas in tomato plants treated with defense signals . excised tomato seedlings were treated with 10 m meja , 29 ppm ethylene ( eth ) , 100 m aba , 1.0 pmol systemin ( sys ) , or 0.1 , 0.25 , or 0.5 mm sa . total rna blots were hybridized to p - labeled pal , lapa , chi9 , chi3 , and gluac probes . transcript sizes are shown in kb and were determined using a rna marker run in a parallel lane . stained gels visualizing rrnas are shown as a loading control . the stained gel for the pal5 blot is not shown . exposure times were 2123 hrboth chi9 and glub encode proteins with a vacuolar location ( van kan et al . , 1995 ) . chi9 transcripts accumulated with a pattern similar to glub rnas ; chi9 and glub rnas were most abundant after meja and ethylene treatments ( fig . 3 ; chao et al . , 1999 ) . the dependence of glub , chi9 , and pr-1 rna accumulation on ethylene signal transduction also has been supported by the analysis of mutant tomatoes expressing the nr mutation , over - expressing the wild type nr , or down - regulating tomato etr genes ( ciardi et al . , 2001 ) . chi9 rna levels also were elevated in control treatments , as previously reported for glub and pr-1 ( chao et al . , 1999 ) . this may be due to a volatile released by control plants that accumulates in the enclosed environments used for the ethylene and meja treatments . notably , lapa , chi3 and gluac were not modulated by this additional defense signal.chi3 and gluac encode apoplastic proteins ( van kan et al . , 1995 ) . similar to the pattern previously reported for pr4 ( chao et al . , 1999 ) , chi3 and gluac transcripts were most abundant after ethylene treatments ( fig . 3 ) . of the three pr genes examined in this study , only chi3 transcripts accumulated in response to exogenous sa . ( 1995 ) who showed increases in chi3 and gluac rnas after treatment with 1 mm sa . ( 1995 ) used a different tomato cultivar , applied sa to petioles ( vs. seedling shoots in this paper ) , and/or used a higher concentration of sa ( 1 mm ) . in the excised seedling assay used here , 1 mm sa caused necrosis in the uc82b cultivar and could not be evaluated ( chao et al . , 1999).surprisingly little is known about pal5 expression after biotic stress in tomato plants ( gorlach et al . , 1995 ) . figure 3 shows that tomato pal5 transcripts were detected in all control and treated leaf samples . pal5 rnas increased in response to meja ( 3-fold ) and smaller increases ( 1.4- to 2.0-fold ) were seen with ethylene and aba treatments ( fig . in contrast , pal5 rna levels declined after treatments with 0.1 , 0.2 and 0.5 mm sa relative to control . rna blot analyses of wound- and defense - response rnas in tomato plants treated with defense signals . excised tomato seedlings were treated with 10 m meja , 29 ppm ethylene ( eth ) , 100 m aba , 1.0 pmol systemin ( sys ) , or 0.1 , 0.25 , or 0.5 mm sa . for each treatment , the corresponding control is shown ( c ) . total rna blots were hybridized to p - labeled pal , lapa , chi9 , chi3 , and gluac probes . transcript sizes are shown in kb and were determined using a rna marker run in a parallel lane . stained gels visualizing rrnas are shown as a loading control . the stained gel for the pal5 blot is not shown . the ability of plants to quickly and accurately perceive their biotic attackers is essential for mounting an effective defense . plants must identify and respond to the chemical ( effectors ) and mechanical signals that accompany pest attack ( felton and tumlinson , 2008 ; howe and jander , 2008 ; walling , 2009 ; wu and baldwin , 2009 ) . previous studies have indicated that plants can discriminate signals introduced by closely related arthropods , such as whitefly , aphid and spider mite biotypes ( van de ven et al . , 2000 ; for example , squash plants can perceive differences in the signals delivered by b. tabaci biotypes a and b. only biotype b causes the squash leaf silvering disorder and preferentially induces the defense - response genes slw1 and slw3 ( van de ven et al . it is presumed that the b. tabaci biotype b effectors , which elicit these biotype - specific changes in gene expression and leaf development programs , are of insect or endosymbiont origin and introduced via the rapidly gelling or watery salivas of the whitefly ( van de ven et al . , 2000 ) . for the reasons above , it was of interest to understand if two distinct whitefly species b . tabaci and t. vaporariorum would provoke similar or distinct defense gene expression programs in tomato . while b. tabaci and t. vaporariorum both have broad host ranges and use similar mechanical strategies to recover nutrients from the phloem , their ability to vector viruses and cause developmental disorders are distinct ( inbar and gerling , 2008 ) . bemisia tabaci biotype b , but not t. vaporariorum , causes the tomato irregular fruit - ripening disorder ( schuster et al . , 1990 ) , but neither of these whiteflies induces leaf silvering in tomato . the data presented here showed that b. tabaci and t. vaporariorum feeding on tomato leaves induce similar temporal and spatial patterns of defense- and wound - response gene expression . these results indicate that these whiteflies must introduce effectors with similar chemical structure(s ) or activities to regulate wound- and defense - response gene expression . furthermore , these whiteflies must also introduce species - specific effectors to cause the irregular - ripening disorder . this study used nine tomato wound- and defense - response genes to assess defense responses to b. tabaci and t. vaporariorum . these genes included two well - characterized wound - response genes ( pin2 and lapa ) that are known to be ja - responsive and dependent on the jasmonate receptor jai1 ( coi1 ) ( chao et al . pal5 , which encodes a rate - limiting enzyme for the shikimate pathway that provides the chemical precursors for phenolic compounds used for cell wall strengthening and as anti - nutritive compounds , also has been studied ( dixon et al . , 2002 ) . pal5 rnas accumulate in response to a wide variety of biotic stresses ; however , little was known about tomato pal5 responses to defense signals the studies presented here show that tomato pal5 rnas decreased in response to sa and increase after meja , ethylene , and aba treatments ( table 2 ) . pal5 rna accumulation patterns reported here are consistent with the results of lee et al . these investigators reported two pal5 rna forms ; the long pal5 rna is detected constitutively , while the short pal5 rna accumulates in response to wounding and pathogen infection . the third group of tomato genes studied included six pr genes ( glub , chi9 , pr-1 , gluac , chi3 , and pr-4 ) that respond to pathogen attack ( van kan et al . , 1995 ) . treatments of excised seedlings with meja , aba , sa , systemin , and ethylene indicate that these genes display four basic expression programs ( table 2 ; chao et al . , 1999 ) . all pr genes were ethylene responsive , and their response to exogenous meja and/or sa distinguished the pr genes further . glub , chi9 , and pr-1 ( p6 ) transcripts increased in response to exogenous meja . however , their regulation was distinctive from pin2 and lapa , since glub , chi9 , and pr-1 rnas did not increase in response to exogenous aba or systemin ( table 2 ; chao et al . , 1999 ) . unlike glub and chi9 , pr-1 rnas increased after sa treatments ( table 2 ) . in contrast , chi3 and pr-4 transcripts accumulated to low levels and gluac rnas were barely detected in response to exogenous meja ; only chi3 rna levels were modulated by sa ( table 2 ; chao et al . , 1999 ) . one prevailing theme from the studies presented here is that the tomato response to phloem - feeding whiteflies has a compelling similarity to pathogen infection ( van loon et al . , 2006 ) . pr rnas and proteins accumulate after infection with both biotrophic and necotrophic pathogens in tomato including avirulent and virulent cladosporium fulvum ( cooke . ) ( van kan et al . , 1992 ) , fusarium oxysporum ( schlecht ) ( rep et al . , 2002 ) , phytophthora infestans ( mont . de bary ) ( christ and mosinger , 1989 ) , and botrytis cinerea ( pers . ) both b. tabaci and t. vaporariorum infestations resulted in similar patterns of pr gene expression . pr rnas were not detected at 1 or 3 days after whitefly infestation , indicating that a total of 500 adult whiteflies per plant ( 250 adults / leaf 2 leaves ) were insufficient to cause pr rnas to accumulate locally or systemically . five days after infestation , glub , chi9 , and pr-1 transcripts became abundant in the whitefly - infested leaves , and glub rnas accumulated systemically by day 7 . chi3 and pr-4 rnas also increased but were less abundant and gluac rnas were barely detected after whitefly feeding . the increases in pr rnas correlated with the time of crawler emergence from eggs and the initiation of nymph feeding . therefore , it is not clear if adults lacked the salivary effectors to activate pr gene expression , or if the changes in pr gene expression were dependent on the larger number of insects feeding during days 59 . it is noteworthy , that b. tabaci biotype b leaf silvering of squash plants was thought initially to be a nymph - specific disorder , since as few as three feeding nymphs can cause squash leaf silvering ( costa et al . , 1993 ) . recently , it was shown that large numbers of male b. tabaci biotype b infest squash are capable of inducing leaf silvering ( de barro and khan , 2007 ) . these data suggest that large numbers of adult whiteflies may be needed for tomato or squash plants to perceive whitefly effectors to induce defense genes and developmental disorders , respectively . this may reflect differences in the potency or quantities of effectors in adult whitefly saliva or the amount of time adults spend salivating relative to nymphs . when the responsiveness of different pr genes to whitefly feeding and exogenous hormone treatments were examined collectively , the role of the defense - signaling pathways in the tomato - whitefly interactions could be proposed ( table 2 , fig . 3 , chao et al . , 1999 ) . this was based on the presumption that exogenous hormone treatments accurately report the roles of defense hormone signaling pathways after whitefly infestation . it is clear that all six pr genes examined in this study were complexly regulated , since these pr genes responded to two or more defense - hormones ( i.e. , meja , ethylene , and/or sa ) . as developed below , it is clear that no one defense hormone can explain pr gene regulation after whitefly infestation . therefore , it is likely that multiple hormones act together to orchestrate this defense response ; the possibility of a novel signal transduction pathway involvement can not be excluded at this time . it appears unlikely that a rise in ethylene can explain the induction of pr genes after whitefly feeding . this conclusion is based on the facts that all six pr rnas accumulated in response to exogenous ethylene , but gluac rnas did not accumulate after whitefly feeding . increases in ethylene and induction of ethylene pathway genes have been noted during aphid infestations of both susceptible and resistant tomato , barley and melon plants ( argadona et al . , 2001 ; mantelin et al . , 2009 ; anstead et al . , 2010 ) . in the m. eurphorbiae - tomato interaction , the ability to perceive ethylene is important for basal resistance ( innate immunity ) but not gene - for - gene resistance ( mantelin et al . , 2009 ) . pr rna levels after whitefly feeding were not correlated with responsiveness to sa , for only three of the five pr rnas that accumulated were sa - regulated . this is a fundamental difference in the regulation of pr genes in tomato vs. arabidopsis . most pr genes in arabidopsis are sa - regulated and suppressed by whitefly feeding ( van loon et al . finally , the pr rnas that were most abundant after whitefly feeding also increased markedly after meja treatments . however , it should be noted that there was not a strict correlation of meja and whitefly responsiveness , since gluac rnas accumulated in response to meja treatments but not after whitefly infestation , and pr-4 was whitefly induced but did not respond to exogenous meja . this includes a whitefly - induced tomato gene ( wfi1 ) that encodes a subunit of the nadph oxidase ( d.p . walling , unpublished results ) and the squash slw1 gene that is preferentially induced by the b. tabaci biotype b ( van de ven et al . , 2000 ) . these observations in tomato are in marked contrast to the changes in gene expression observed after the b. tabaci interactions in arabidopsis , where sa - regulated pr rnas accumulate and ja - regulated wound / defense response genes are suppressed ( kempema et al . , 2007 ; zarate et al . , 2007 ) in addition , b. tabaci infestations of lima bean ( zhang et al . , 2009 ) and arabidopsis ( zarate , navarre and walling , unpublished results ) cause increases in sa levels ; the changes in sa and ja levels after whitefly infestation of tomatoes has not yet been assessed . while ja - regulated pr rnas are abundant after whitefly feeding , this was not the case for ja - regulated wound - response genes . two sets of data indicate that heavy infestations ( up to 10 insects per cm ) by b. tabaci and t. vaporariorum did not activate the wound - signaling pathway in tomato . first , feeding by over 500 b. tabaci adults ( day 3 ) and over 2,000 b. tabaci nymphs and 500 adults ( day 5 ) per tomato leaf were not sufficient to increase lapa or pin2 transcripts to detectable levels locally or systemically . second , b. tabaci infestation of transgenic lapa1:gus tomato plants showed that the lapa1 promoter activity was similar in leaves of b. tabaci - infested and non - infested control plants . these data suggest that the whitefly stylet s piercing of epidermal cells , movement between cells ( which disrupts essential cell - to - cell contacts ) , puncturing of the sieve elements , and consumption of phloem nutrients were not perceived as sufficient physical or mechanical stresses to activate the tomato ja - dependent wound - response pathway ( walling , 2008 ) . these data also indicate that tomato responses to whitefly adult and nymph feeding were distinct from responses to tissue - damaging herbivores . caterpillars , beetles , and cell - content feeding spider mites and thrips all induce ja - regulated wound - response gene expression in tomato ( pautot et al . , 1993 ; li et al . , 2002 ; ament et al . , this regulation occurs at the transcriptional level , since pin2 and lapa promoter : reporter genes are activated by wounding and caterpillar feeding in transgenic tomato , potato , tobacco , silver birch , arabidopsis , and white spruce ( thornburg et al . pin2 genes also are induced in some , but not all , aphid - plant interactions ( thornburg et al . , 1990 ; fidantsef et al . , 1999 ; de ilarduya et al . , 2003 ) . consistent with aphids piercing mesophyll cells in their search for a phloem - sieve element , the potato aphid ( m. euphorbiae ) and green peach aphid [ myzus persicae ( sulzer ) ] infestations of tomato plants cause pin1 and pin2 rna levels to increase transiently ( 612 hr post infestation ) , and prior to the accumulation of pr rnas ( 1248 hr post infestation ) ( de ilarduya et al . , 2003 ) . consistent with this result , pin2 rnas were not detectable 7 days after m. euphorbiae feeding ( fidantsef et al . , 1999 ) . interestingly , the pin2 promoter was not activated after a non - synchronous aphid infestation of transgenic pin2:cat tobacco plants in the field ( thornburg et al . , 1990 ) . whiteflies may avoid activation of wound - responses due to their refined feeding behaviors that avoid puncturing mesophyll cells , which distinguishes feeding by whiteflies from aphids ( tjallingii , 2006 ; walling , 2008 ) . it is also possible that chemical constituents of the watery and gelling salivas of whitefly adults and nymphs do not activate the ja - dependent wound signaling pathway . alternatively , whitefly salivary factors may directly or indirectly antagonize the tomato wound - response pathway . since whiteflies are known to increase sa levels during infestation of arabidopsis and lima beans ( zhang et al . , 2009 ; zarate , navarre , and walling , unpublished results ) , it is possible that the increases in sa promote the antagonistic cross - talk between the ja- and sa - defenses . cross - talk , which is known to occur in the b. tabaci - arabidopsis and in other biotic interactions , may suppress the ja - regulated traits that slow nymph development ( thaler et al . in addition , there is substantial evidence for constituents of hemipteran saliva influencing insect - plant interactions ( miles , 1999 ; felton and tumlinson , 2008 ; walling , 2009 ) . some aphid salivary proteins appear important in chelating calcium to influence wound - induced protein coagulation at stylet punctures of the phloem ( will et al . , 2007 ) . saliva constituents also contribute to aphid fitness , activate / suppress plant gene expression , induce a local resistance to further aphid infestations , and induce infestation symptoms ( lapitan et al . , 2007 ; mutti et al . , 2008 ; de vos and jander , 2009 ) . some caterpillars and beetles these interactions include : the corn earworm [ helicoverpa zea ( boddie ) ] with tobacco [ ( nicotiana tabacum ( l. ) ] , the beet armyworm [ spodoptera exigua ( hbner ) ] with medicago truncatula ( gaertn ) , the colorado potato beetle [ leptinotarsa decemlineata ( say ) ] with tomato , and the small white butterfly larvae [ pieris rapae ( l. ) ] with arabidopsis ( reymond et al . , 2000 ; musser et al . , 2002 ; , 2006 ; lawrence et al . , 2007 ) . avoiding activation of wound - responses may contribute to the success of b. tabaci and t. vaporariorum on their hosts ( walling , 2008 ) , and this appears to be the case for b. tabaci interactions in arabidopsis ( kempema et al . , 2007 ; zarate et al . , 2007 ) . however , in tomato , the role of ja - regulated defense traits against whiteflies is not as well understood . ( 2006 ) showed that the tomato spr2 ( suppressor of prosystemin - mediated responses2 ) mutant and transgenic line that ectopically expresses prosystemin ( 35s : prosys ) influences whitefly - tomato interactions . the spr2 mutant blocks ja biosynthesis and alters volatile emission profiles ( snchez - hernndez et al . , the 35s : prosys line over - expresses the wound peptide precursor prosystemin and has constitutively activated wound - response genes ( mcgurl et al . , 1994 ) . bemisia tabaci adults prefer to oviposit on spr2 plants , indicating that ja is essential for the production of volatiles that deter b. tabaci acceptance of tomato plants ; however , 35s : prosys plants did not display the expected reciprocal phenotype ( i.e. , repellency ) ( snchez - hernndez et al . , 2006 ) . when adult eclosion from fourth - instar nymphs was monitored , fewer adults emerged from 35s : prosys plants than wild - type or spr2 plants ( snchez - hernndez et al . , 2006 ) . these data suggest that ectopic expression of the tomato wound - response pathway may impede b. tabaci development at the level(s ) of nymph settling or development . therefore , avoiding activation of the wound - response pathway of tomato would be advantageous to whitefly success , as it is in the model plant arabidopsis ( zarate et al . , 2007 ) . the importance of pr gene products in defense against phloem - feeding insects is not understood at the present time . in tomato , the pr genes that responded most strongly to whitefly feeding encoded proteins with either a vacuolar ( chi9 and glub ) or an apoplastic ( pr-1 ) location ( van kan et al . , 1995 ) . aphid feeding also causes glub and pr-1 rnas to increase in tomato ( de ilarduya et al . unlike aphids , it is anticipated that whiteflies would have limited contact with the vacuolar pr proteins , since their mouthparts rarely pierce mesophyll cells during the search for a feeding site in the phloem . it seems likely that whiteflies would contact the apoplastic proteins , such as pr-1 protein . the exterior of whitefly mouthparts would have limited physical contact with pr-1 due to the salivary sheath that encases the flexible whitefly stylet . in contrast , whiteflies may consume minute quantities of apoplastic proteins and chemicals , as they secrete and then ingest , a watery saliva to taste the chemical environment of the apoplast ( lei et al . it is thought that whiteflies use these gustatory cues as indicators of host - plant suitability and as signals to guide the stylet s route to the phloem sieve element . consistent with this is the fact that the tomato resistance gene mi-1 , which mediates a modest resistance to whiteflies , appears to influence resistance traits that act prior to phloem feeding ( jiang et al . , 2001 ) . since whiteflies recover their nutrients from the phloem and occasionally drink water from xylem ( lei et al . , 1998b ) , the phloem and xylem are additional sites for proteins / chemicals that can influence whitefly - plant interactions . for example , some aphid - resistance ( r ) genes control a phloem - localized resistance traits ( kaloshian et al . , 1995 ; klingler et al . , 1998 ) . it is not clear whether the tomato pr proteins accumulate in the phloem or xylem after hemipteran feeding , although some pr proteins have been reported in xylem sap of fusarium oxysporum - infected tomato plants ( rep et al . , 2002 ) . furthermore , the transcriptome of phloem sap , phloem tissue and vascular - enriched tissue have shown that some stress - related rnas , including some pr rnas , are detected in the phloem ( le hir et al . , 2008 ) . the role of phloem- or xylem - localized prs or other phloem - localized proteins that deter aphids ( yoo et al . , 2000 ) , on whitefly host acceptance , longevity , fecundity , and nymph development has yet to be tested .
injection of botulinum toxin type a ( bont / a ) is a frequently administered aesthetic treatment for the reduction or prevention of hyperkinetic facial lines and rhytids . however , since the introduction of bont / a to aesthetic medicine,1 studies evaluating the effects of this treatment have predominantly relied on semi - quantitative evaluation tools , such as the rating scale for hyperkinetic facial lines , as proposed by kim et al2 or other self - designed analog scores adapted to the specific design of their associated studies.3,4 even in recent trials , semi - quantitative analog scale - derived analyses of subjects and investigators subjective perceptions were used for comparing differences between injection volumes and dilutions5 and for comparing bont / a versus bont / a with epinephrine.6 the reference method for quantitative evaluation of the bont / a blocking action on skeletal muscle in neurology is electromyography . while quantitative analysis of bont / a efficacy with evaluation of the compound muscle action potential ( cmap ) m - wave7 seems reasonable in neurological diseases , the spatial resolution , in general , is too limited for distinctive monitoring of bont / a efficacy in aesthetics . despite this , it has recently been proposed for follow - up of global bont / a action on the frontalis muscle.8 to date , quantitative image analyses of the aesthetic effects of bont / a have been limited to the evaluation of the eyebrow height or eyebrow mobility after injections into the glabellar area , with respect to the mid - pupillary line or to directly related nearby locations.9,10 to overcome some of the above - mentioned limitations of current quantitative image analyses , and to avoid semi - quantitative analog scale - based methods and electromyography , a new quantitative , two - dimensional method skin displacement analysis ( sda ) with a high resolution of a few millimeters is presented here . specifically , the proof - of - principle of the method is demonstrated by analysis of skin displacement before and after bont / a injection in the fronto - glabellar area . consenting individuals requesting routine fronto - glabellar bont / a injections were treated with bont / a at a standardized dosage . patients were marked on the right and central frontal area with a removable 0.25 cm grid ( thermage inc , hayward , ca , usa ) , thus providing a length of 5 mm between 2 crossings ( figure 1a ) . facial photo - documentation was carried out pre - treatment ( day 0 ) and during the week after administration of the toxin ( days 1 , 2 , 3 , and 7 ) , as described below . each 100 unit vial of lyophilized bont / a ( xeomin , merz pharmaceuticals , frankfurt , germany ) was dissolved in 2.5 ml physiological saline and then injected intramuscularly using a 0.3 ml insulin syringe with an 8 mm 30 g needle . this purified bont / a preparation is free from complexing proteins , has demonstrated equivalence to the first market - available bont / a preparation for efficacy and duration of action,11 and has shown a lack of development of neutralizing antibodies in preclinical studies.12 in total , 18 units of bont / a were injected into the fronto - glabellar area and 6 units were injected laterally to both eyebrows ( figure 1a ) . first , 4 units were injected in the midline into the central part of the procerus , followed by 2 units 15 mm above this ( figure 1a ) . three units were then injected 10 mm above and 15 mm laterally to the first procerus injection , into the medial parts of right and left corrugator supercilii close to the medial ending of the eyebrow ( figure 1a ) ; another 3 units were injected 15 mm laterally and 5 mm above this injection ( figure 1a ) . finally , 3 units were injected into the orbital rim , immediately at the lateral end of the eyebrows into the lateral and upper parts of the orbicularis oculi ( figure 1a ) . horizontal skin displacement due to maximum contraction of the fronto - glabellar area was analyzed at day 0 immediately before the injection of bont / a , and at days 1 , 2 , 3 , and 7 post - injection . figure 1b shows a patient with relaxed fronto - glabellar muscle tonus and the removable marking grid in place with an additionally drawn midline . vertical and horizontal black lines cross at the medial canthus of the right eye ( x1 , y1 ) , which serves as the fixed - point of the geometric system , thereby allowing shifts or movements of the face at other points to be calculated from a standardized reference point . vertical and horizontal black lines also cross at one sample point of interest above the right eyebrow ( x2 , y2 ) . the same 2 points are marked during maximum fronto - glabellar contraction , as shown in figure 1c . the horizontal shift of the point of interest above the eyebrow during maximum fronto - glabellar contraction ( x2 contraction ; figure 1c ) compared with its position under relaxed conditions ( x2 relaxed ; figure 1b ) forms the basis of numeric calculations for sda . the amplitude of the horizontal shift from the relaxed to the contracted situation relative to the fixed reference point x1 at the inner canthus was calculated as follows : x=[(x2 contractionx1)(x2 relaxed x1)]where x is given in the dimension of pixels in the digital photograph . to obtain movement amplitudes in millimeters , the value of x is normalized for the number of pixels along the length of each 5 mm box in each digital photograph . digital photographs were taken at day 0 , before injection of bont / a , and at days 1 , 2 , 3 , and 7 post - injection . at each time - point , 3 cycles of relaxed muscle tension and maximum contraction were captured . statistical analyses , including calculation of means , standard deviations ( sd ) and p - values of t - tests , were performed using microsoft excel software . the study was carried out in accordance with the declaration of helsinki and its later extensions . consenting individuals requesting routine fronto - glabellar bont / a injections were treated with bont / a at a standardized dosage . patients were marked on the right and central frontal area with a removable 0.25 cm grid ( thermage inc , hayward , ca , usa ) , thus providing a length of 5 mm between 2 crossings ( figure 1a ) . facial photo - documentation was carried out pre - treatment ( day 0 ) and during the week after administration of the toxin ( days 1 , 2 , 3 , and 7 ) , as described below . each 100 unit vial of lyophilized bont / a ( xeomin , merz pharmaceuticals , frankfurt , germany ) was dissolved in 2.5 ml physiological saline and then injected intramuscularly using a 0.3 ml insulin syringe with an 8 mm 30 g needle . this purified bont / a preparation is free from complexing proteins , has demonstrated equivalence to the first market - available bont / a preparation for efficacy and duration of action,11 and has shown a lack of development of neutralizing antibodies in preclinical studies.12 in total , 18 units of bont / a were injected into the fronto - glabellar area and 6 units were injected laterally to both eyebrows ( figure 1a ) . first , 4 units were injected in the midline into the central part of the procerus , followed by 2 units 15 mm above this ( figure 1a ) . three units were then injected 10 mm above and 15 mm laterally to the first procerus injection , into the medial parts of right and left corrugator supercilii close to the medial ending of the eyebrow ( figure 1a ) ; another 3 units were injected 15 mm laterally and 5 mm above this injection ( figure 1a ) . finally , 3 units were injected into the orbital rim , immediately at the lateral end of the eyebrows into the lateral and upper parts of the orbicularis oculi ( figure 1a ) . horizontal skin displacement due to maximum contraction of the fronto - glabellar area was analyzed at day 0 immediately before the injection of bont / a , and at days 1 , 2 , 3 , and 7 post - injection . figure 1b shows a patient with relaxed fronto - glabellar muscle tonus and the removable marking grid in place with an additionally drawn midline . vertical and horizontal black lines cross at the medial canthus of the right eye ( x1 , y1 ) , which serves as the fixed - point of the geometric system , thereby allowing shifts or movements of the face at other points to be calculated from a standardized reference point . vertical and horizontal black lines also cross at one sample point of interest above the right eyebrow ( x2 , y2 ) . the same 2 points are marked during maximum fronto - glabellar contraction , as shown in figure 1c . the horizontal shift of the point of interest above the eyebrow during maximum fronto - glabellar contraction ( x2 contraction ; figure 1c ) compared with its position under relaxed conditions ( x2 relaxed ; figure 1b ) forms the basis of numeric calculations for sda . the amplitude of the horizontal shift from the relaxed to the contracted situation relative to the fixed reference point x1 at the inner canthus was calculated as follows : x=[(x2 contractionx1)(x2 relaxed x1)]where x is given in the dimension of pixels in the digital photograph . to obtain movement amplitudes in millimeters , the value of x is normalized for the number of pixels along the length of each 5 mm box in each digital photograph . digital photographs were taken at day 0 , before injection of bont / a , and at days 1 , 2 , 3 , and 7 post - injection . at each time - point , 3 cycles of relaxed muscle tension and maximum contraction were captured . statistical analyses , including calculation of means , standard deviations ( sd ) and p - values of t - tests , were performed using microsoft excel software . the study was carried out in accordance with the declaration of helsinki and its later extensions . thirteen patients were enrolled and included in the study ( female , n = 12 ; male , n = 1 ) . the median age of the patients was 39 years ( range , 1962 years ) . ten of the participants had never previously received bont / a , 2 had not received bont / a during the past 12 months , and 1 had received bont / a 6 months previously but did not show any remaining action . horizontal skin displacement from a relaxed to a contracted state above the eyebrow showed a linear correlation up to 35 mm lateral to the midline ; horizontal skin displacement started to plateau at 40 and 45 mm ( figures 2a and 2b ) . the mean ( sd ) amplitude of horizontal skin displacement 15 mm lateral to the midline was 3.2 1.0 mm , with a range of 1.94.9 mm ( table 1 ) . the mean ( sd ) amplitude of horizontal skin displacement doubled at 30 mm lateral to the midline to 6.5 1.4 mm , with a range of 4.08.5 mm ( table 1 ) . a linear regression analysis of pre - injection horizontal skin displacement amplitudes from the midline up to 35 mm laterally ( table 1 and figure 2b ) was performed with the equation [ y = m x + t ] , where y is the horizontal skin displacement amplitude and x is the distance of the point of interest from the midline under relaxed conditions . the constant parameters m and x were calculated as 0.22 and 0.12 mm , respectively , with t close enough to zero to support calculating distances from the midline . a slope of m = 0.22 resulted in horizontal skin displacement at maximum contraction of 22% of the distance to the midline under relaxed conditions . for example , a specific point 30 mm lateral to the midline under relaxed conditions would be 22% closer to the midline under contracted conditions , resulting in a new position 23.5 mm lateral from the midline . figure 3a shows the horizontal skin displacement amplitudes from a relaxed to a contracted state for the patient shown in figure 1 at days 0 ( pre - injection ) , 1 , 2 , 3 , and 7 . skin displacement analysis was performed on the grid points located immediately above the right eyebrow . similar to the variability of horizontal skin displacement before bont / a injection in different patients ( figures 2a and 2b ) , the bont / a - induced reduction in horizontal skin displacement amplitude in the fronto - glabellar area also showed intersubject variability . to allow better comparison of bont / a action kinetics , data obtained at days 1 , 2 , 3 , and 7 ( post - injection ) were normalized to each subject s skin displacement data obtained at day 0 ( pre - injection ) . the horizontal skin displacement profiles of 13 individual patients 30 mm lateral to the midline ( normalized to pre - injection values ) are shown in figure 3b . statistical analysis by paired double - sided t - testing revealed that a significant reduction in horizontal displacement was detectable at day 1 compared with pre - injection data ( p = 0.03 ) . the significance of the reduction compared with pre - injection data increased at days 2 , 3 , and 7 post - injection ( p < 0.0001 for all versus day 0 ) . interindividual variability in the time course of bont / a action was observed , as were differences in the final level of blockage of horizontal contraction at day 7 ( figure 3b ) . based on visual assessment , individuals with a slower response to bont / a injection also had lower maximum blockage of horizontal contraction compared with individuals who had a rapid reduction in contraction amplitude . comparing the 6 patients with the least blocking action on day 7 with the 6 patients with the strongest blocking action on day 7 , the mean ( sd ) contraction capability at day 1 was 98% 17% and 79% 17% , respectively , of values taken pre - injection ( p = 0.08 for between - group comparison ) . at day 7 , mean ( sd ) contraction capability was reduced to 32% 10% and 4% 7% , respectively ( p = 0.0003 for between - group comparison ) . on average , a 50% reduction in horizontal skin displacement from a relaxed to contracted state at 30 mm lateral to the midline was achieved between 2 and 3 days after bont / a injection ( figure 3c ) . specifically , relative to day 0 , the maximum horizontal skin displacement 30 mm lateral to the midline showed a time - dependent and highly significant ( p < 0.001 ) reduction to a mean ( sd ) of 62% 23% at day 2 , and a further reduction to 17% 16% at day 7 ( table 2 ) . corresponding values for maximum horizontal skin displacement 15 mm lateral to the midline were 62% 29% at day 2 and 15% 20% at day 7 ( table 2 ) . the blockage kinetics was fastest at 20 and 25 mm , in the middle of the 2 injection points at 15 and 30 mm lateral to the midline , whereas points 40 and 45 mm lateral to the midline showed a slightly less pronounced reduction in horizontal contraction ability ( figure 3d and table 2 ) ; these differences were not significant . the only adverse event reported was a frontal headache in 1 patient at days 1 and 2 after injection . thirteen patients were enrolled and included in the study ( female , n = 12 ; male , n = 1 ) . the median age of the patients was 39 years ( range , 1962 years ) . ten of the participants had never previously received bont / a , 2 had not received bont / a during the past 12 months , and 1 had received bont / a 6 months previously but did not show any remaining action . horizontal skin displacement from a relaxed to a contracted state above the eyebrow showed a linear correlation up to 35 mm lateral to the midline ; horizontal skin displacement started to plateau at 40 and 45 mm ( figures 2a and 2b ) . the mean ( sd ) amplitude of horizontal skin displacement 15 mm lateral to the midline was 3.2 1.0 mm , with a range of 1.94.9 mm ( table 1 ) . the mean ( sd ) amplitude of horizontal skin displacement doubled at 30 mm lateral to the midline to 6.5 1.4 mm , with a range of 4.08.5 mm ( table 1 ) . a linear regression analysis of pre - injection horizontal skin displacement amplitudes from the midline up to 35 mm laterally ( table 1 and figure 2b ) was performed with the equation [ y = m x + t ] , where y is the horizontal skin displacement amplitude and x is the distance of the point of interest from the midline under relaxed conditions . the constant parameters m and x were calculated as 0.22 and 0.12 mm , respectively , with t close enough to zero to support calculating distances from the midline . a slope of m = 0.22 resulted in horizontal skin displacement at maximum contraction of 22% of the distance to the midline under relaxed conditions . for example , a specific point 30 mm lateral to the midline under relaxed conditions would be 22% closer to the midline under contracted conditions , resulting in a new position 23.5 mm lateral from the midline . figure 3a shows the horizontal skin displacement amplitudes from a relaxed to a contracted state for the patient shown in figure 1 at days 0 ( pre - injection ) , 1 , 2 , 3 , and 7 . skin displacement analysis was performed on the grid points located immediately above the right eyebrow . similar to the variability of horizontal skin displacement before bont / a injection in different patients ( figures 2a and 2b ) , the bont / a - induced reduction in horizontal skin displacement amplitude in the fronto - glabellar area also showed intersubject variability . to allow better comparison of bont / a action kinetics , data obtained at days 1 , 2 , 3 , and 7 ( post - injection ) were normalized to each subject s skin displacement data obtained at day 0 ( pre - injection ) . the horizontal skin displacement profiles of 13 individual patients 30 mm lateral to the midline ( normalized to pre - injection values ) are shown in figure 3b . statistical analysis by paired double - sided t - testing revealed that a significant reduction in horizontal displacement was detectable at day 1 compared with pre - injection data ( p = 0.03 ) . the significance of the reduction compared with pre - injection data increased at days 2 , 3 , and 7 post - injection ( p < 0.0001 for all versus day 0 ) . interindividual variability in the time course of bont / a action was observed , as were differences in the final level of blockage of horizontal contraction at day 7 ( figure 3b ) . based on visual assessment , individuals with a slower response to bont / a injection also had lower maximum blockage of horizontal contraction compared with individuals who had a rapid reduction in contraction amplitude . comparing the 6 patients with the least blocking action on day 7 with the 6 patients with the strongest blocking action on day 7 , the mean ( sd ) contraction capability at day 1 was 98% 17% and 79% 17% , respectively , of values taken pre - injection ( p = 0.08 for between - group comparison ) . at day 7 , mean ( sd ) contraction capability was reduced to 32% 10% and 4% 7% , respectively ( p = 0.0003 for between - group comparison ) . on average , a 50% reduction in horizontal skin displacement from a relaxed to contracted state at 30 mm lateral to the midline was achieved between 2 and 3 days after bont / a injection ( figure 3c ) . specifically , relative to day 0 , the maximum horizontal skin displacement 30 mm lateral to the midline showed a time - dependent and highly significant ( p < 0.001 ) reduction to a mean ( sd ) of 62% 23% at day 2 , and a further reduction to 17% 16% at day 7 ( table 2 ) . corresponding values for maximum horizontal skin displacement 15 mm lateral to the midline were 62% 29% at day 2 and 15% 20% at day 7 ( table 2 ) . the blockage kinetics was fastest at 20 and 25 mm , in the middle of the 2 injection points at 15 and 30 mm lateral to the midline , whereas points 40 and 45 mm lateral to the midline showed a slightly less pronounced reduction in horizontal contraction ability ( figure 3d and table 2 ) ; these differences were not significant . horizontal skin displacement from a relaxed to a contracted state above the eyebrow showed a linear correlation up to 35 mm lateral to the midline ; horizontal skin displacement started to plateau at 40 and 45 mm ( figures 2a and 2b ) . the mean ( sd ) amplitude of horizontal skin displacement 15 mm lateral to the midline was 3.2 1.0 mm , with a range of 1.94.9 mm ( table 1 ) . the mean ( sd ) amplitude of horizontal skin displacement doubled at 30 mm lateral to the midline to 6.5 1.4 mm , with a range of 4.08.5 mm ( table 1 ) . a linear regression analysis of pre - injection horizontal skin displacement amplitudes from the midline up to 35 mm laterally ( table 1 and figure 2b ) was performed with the equation [ y = m x + t ] , where y is the horizontal skin displacement amplitude and x is the distance of the point of interest from the midline under relaxed conditions . the constant parameters m and x were calculated as 0.22 and 0.12 mm , respectively , with t close enough to zero to support calculating distances from the midline . a slope of m = 0.22 resulted in horizontal skin displacement at maximum contraction of 22% of the distance to the midline under relaxed conditions . for example , a specific point 30 mm lateral to the midline under relaxed conditions would be 22% closer to the midline under contracted conditions , resulting in a new position 23.5 mm lateral from the midline . figure 3a shows the horizontal skin displacement amplitudes from a relaxed to a contracted state for the patient shown in figure 1 at days 0 ( pre - injection ) , 1 , 2 , 3 , and 7 . skin displacement analysis was performed on the grid points located immediately above the right eyebrow . similar to the variability of horizontal skin displacement before bont / a injection in different patients ( figures 2a and 2b ) , the bont / a - induced reduction in horizontal skin displacement amplitude in the fronto - glabellar area also showed intersubject variability . to allow better comparison of bont / a action kinetics , data obtained at days 1 , 2 , 3 , and 7 ( post - injection ) were normalized to each subject s skin displacement data obtained at day 0 ( pre - injection ) . the horizontal skin displacement profiles of 13 individual patients 30 mm lateral to the midline ( normalized to pre - injection values ) are shown in figure 3b . statistical analysis by paired double - sided t - testing revealed that a significant reduction in horizontal displacement was detectable at day 1 compared with pre - injection data ( p = 0.03 ) . the significance of the reduction compared with pre - injection data increased at days 2 , 3 , and 7 post - injection ( p < 0.0001 for all versus day 0 ) . interindividual variability in the time course of bont / a action was observed , as were differences in the final level of blockage of horizontal contraction at day 7 ( figure 3b ) . based on visual assessment , individuals with a slower response to bont / a injection also had lower maximum blockage of horizontal contraction compared with individuals who had a rapid reduction in contraction amplitude . comparing the 6 patients with the least blocking action on day 7 with the 6 patients with the strongest blocking action on day 7 , the mean ( sd ) contraction capability at day 1 was 98% 17% and 79% 17% , respectively , of values taken pre - injection ( p = 0.08 for between - group comparison ) . at day 7 , mean ( sd ) contraction capability was reduced to 32% 10% and 4% 7% , respectively ( p = 0.0003 for between - group comparison ) . on average , a 50% reduction in horizontal skin displacement from a relaxed to contracted state at 30 mm lateral to the midline was achieved between 2 and 3 days after bont / a injection ( figure 3c ) . specifically , relative to day 0 , the maximum horizontal skin displacement 30 mm lateral to the midline showed a time - dependent and highly significant ( p < 0.001 ) reduction to a mean ( sd ) of 62% 23% at day 2 , and a further reduction to 17% 16% at day 7 ( table 2 ) . corresponding values for maximum horizontal skin displacement 15 mm lateral to the midline were 62% 29% at day 2 and 15% 20% at day 7 ( table 2 ) . the blockage kinetics was fastest at 20 and 25 mm , in the middle of the 2 injection points at 15 and 30 mm lateral to the midline , whereas points 40 and 45 mm lateral to the midline showed a slightly less pronounced reduction in horizontal contraction ability ( figure 3d and table 2 ) ; these differences were not significant . the only adverse event reported was a frontal headache in 1 patient at days 1 and 2 after injection . since the introduction of different preparations of bont / a to aesthetic medicine,1 studies assessing their effectiveness have predominantly relied on semi - quantitative analog scale - derived evaluation tools.26 electromyography , the standard method for evaluation of bont / a action on skeletal muscle in neurology , does not allow the analysis of bont / a action with a 2-dimensional resolution of a few millimeters , as is frequently required in aesthetic indications . despite this , electromyography has been proposed for the follow - up of global bont / a action on the frontalis muscle.8 attempts to introduce quantitative image analysis of bont / a action in aesthetic settings have , so far , been restricted by their limitation to the analysis of the mobility of existing anatomical structures , such as the evaluation of the eyebrow motion or eyebrow height after bont / a injections into the glabellar area.9,10 to overcome some of the limitations of previous evaluation methods , this article describes sda , a quantitative technique that can be used to evaluate skin movements related to the insertion and contraction of any given mimetic muscle of the face and neck area in any direction . in this study , we were able to effectively demonstrate evaluation of horizontal skin displacement related to fronto - glabellar contraction . one of the major advantages of sda is that it allows the evaluation of single points of interest , even those remote from anatomical structures such as the eyebrows . the basis for sda is the appropriate marking of the area to be evaluated with a suitable marking system or pattern . for simplicity in this study the contraction - related displacements of single points of the fronto - glabellar area were then calculated relative to the coordinates of the medial canthus , which served as the fixed - point origin of the whole geometric system . due to the characteristics of this evaluation method , even limited vertical or horizontal movements of the patient s head , which could compromise results with other methods , were eliminated . furthermore , due to the characteristics of the cosine function , even limited rotation of the head had minimal influence on the calculation of skin displacements . for example , a clockwise rotation of the head of 10 would cause an error of only 1.5% when calculating a horizontal skin displacement using the factor cos(10 ) . additionally , the dimensions of any useful marking system , such as the removable grid tattoo with a 5 mm grid used in the current study , allows for the calibration of any contraction - related skin displacement . in this study , it was possible to quantitatively analyze contraction - related skin displacement of the fronto - glabellar area . in general , the horizontal shortening from relaxed to contracted state along the length of the corrugator muscle was 22% pre - bont / a injection , as determined by linear regression analysis . the pre - treatment range of shortening amongst individual patients varied from 13% to 33% , resembling a shortening from one - eighth to one - third of the relaxed corrugator muscle length . interestingly , the maximum horizontal contraction amplitude above the eyebrow showed a linear correlation to the position measured from the midline up to about 35 mm laterally ; horizontal contraction amplitudes then stabilized at 40 and 45 mm lateral to the midline ( figure 2b ) , suggesting that the average length of the corrugator muscle did not exceed 35 mm . close to the midline , evaluation of contraction - induced horizontal skin movements showed some limitations . contraction effects are superimposed by shifting and folding of excessive skin in a more or less random fashion , finally resulting in deep lines and rhytids in the central glabellar area , for which bont / a injection aims to correct . in our study , at the midline , where all horizontal skin movement amplitudes should be zero , measured values ranged from 1.3 to 0.7 mm , reflecting these random skin movements . furthermore , some of the negative skin movement values at the midline might have been caused by asymmetrical use of the corrugator muscles in an individual patient . in the current study , regardless of age , mass of corrugator muscles , and severity of lines and rhytids , all patients received a fixed dose of 18 units of bont / a in the fronto - glabellar area in order to provide standardized conditions with the dosage of the drug used . with this moderate dose of bont / a , a full blockage of mimetic muscles of the fronto - glabellar area was not expected in all subjects . therefore , the study design was able to provide some interesting information in addition to the proof - of - principle of the sda method . specifically , the limited dose of bont / a in relation to the individual strength of the corrugator muscle may have been the reason that some patients ended up with only about 50% blockage of horizontal contraction 7 days after injection , while others reached 100% blockage of their horizontal fronto - glabellar contraction capability . interestingly , a slower onset of action of bont / a after injection seemed to be related to less pronounced final blockage of contraction . nevertheless , as displayed in figure 3b , all patients showed a reduction in contraction - related skin displacement in the horizontal direction 3 days after injection of bont / a . at day 7 , all patients reached a stronger level of blockage of contraction amplitudes . by extrapolating findings from the current trial , sda could be used in future studies to assess how different doses of bont / a affect blockage action or how an increased or decreased number of injection sites could influence blockage of muscle contraction . the method could also be used to assess loss of bont / a action weeks and months after injection . other potentially interesting fields of study could include the analysis of different dilutions of bont / a and comparisons between different products , including between different pharmaceutical or cosmetic substances claiming to reduce the activity of mimetic muscles in the face or neck area . we have successfully demonstrated the use of a new method for assessing skin movements elicited by muscles inserting the overlaying skin . sda demonstrated high accuracy to within a few millimeters when evaluating bont / a - induced blockage of horizontal contraction in the fronto - glabellar area . this method could help to more accurately assess the effects of injected bont / a in aesthetic indications in the face or neck area and to overcome some of the limitations of semi - quantitative analog scale - based analyses .
in the treatment of osteoporosis , bisphosphonates have demonstrated their clinical efficacy , particularly their anti - fracture efficacy , and have become the most widely used anti - osteoporotic drugs worldwide . the anti - fracture efficacy of ibandronate was first demonstrated in the bone study ( oral ibandronate osteoporosis vertebral fracture trial in north america and europe ) that examined treatment with oral ibandronate ( 2.5 mg / day and 20 mg intermittently ) . the mobile study ( monthly oral ibandronate in ladies ) was conducted to assess gains in bone mineral density ( bmd ) with oral ibandronate ( 100 and 150 mg / month ) . the diva study ( dosing intravenous administration ) was also conducted to assess gains in bmd with quarterly intravenous ( iv ) ibandronate injection ( 3 mg/3 months ) . analysis of pooled data from the mobile and diva trials showed that , for all clinical fractures , non - vertebral fractures , and clinical vertebral fractures , there was a significantly longer time to fracture events in the ibandronate group than in the placebo group over 5 years . meta - analyses of the clinical studies also demonstrated that ibandronate had significant efficacy with respect to the risk reduction of not only key non - vertebral fractures but also of all non - vertebral fractures and clinical fractures [ 5 , 6 ] . the relationship between increases in bmd and fracture risk reduction has been examined in meta - analyses of ibandronate . the increase in bmd in the lumbar spine over 2 years showed a reverse relationship with the incidence of clinical fractures , and the increase in hip bmd was associated with a reduction in the risk of non - vertebral fractures . gains in hip and lumbar spine bmd were also associated with a reduction in vertebral fracture risk , explaining a substantial proportion of the anti - fracture effect of ibandronate ( 2337 % at 2 and 3 years ) . in fact , it has been reported elsewhere that decreased bmd is strongly associated with increased fracture risks and that increased bmd is predictive of the anti - fracture efficacy of treatment . the mover study ( monthly intravenous ibandronate versus daily oral risedronate ) the primary endpoint was the non - inferiority of ibandronate versus risedronate to prove its efficacy with respect to the incidence of non - traumatic vertebral fractures at 3 years . since the anti - fracture efficacy of risedronate had been already demonstrated in randomized comparative studies [ 1113 ] , risedronate was selected as a suitable active comparator in the mover study . the incidence rate of first new or worsening vertebral fractures was 16.1 % in the iv ibandronate 1 mg / month treatment group and 17.6 % in the oral risedronate 2.5 mg / day treatment group at 3 years . the hazard ratio of iv ibandronate 1 mg against risedronate was 0.88 ( 95 % confidence interval [ ci ] 0.611.27 ) . significant increases in bmd were observed in ibandronate 1 mg group as compared to the risedronate group . based on the efficacy and safety data , monthly iv ibandronate 1 mg was approved for the treatment of osteoporosis in japan . the current analysis from the mover study was conducted to examine the relationship between changes in hip bmd and the incidence of vertebral fractures , especially the impact that initial bmd gains have on the future incidence of vertebral fractures . the design of the mover study is already described . briefly , 1,265 patients with primary osteoporosis diagnosed according to the diagnosis criteria of primary osteoporosis in japan were randomized . the per - protocol population for the endpoint analysis comprised 376 patients in the ibandronate 0.5 mg group , 382 in the ibandronate 1 mg group , and 376 in the risedronate group ( totally 1,134 patients ) . baseline patient characteristics were well balanced between the treatment groups ( table 1 ) . morphometric vertebral fractures were assessed using semiquantitative methodology and quantitative morphometry by a central committee . bmd in lumbar spine ( l2l4 ) and total hip was centrally measured at baseline , 6 , 12 , 24 , and 36 months using dual - energy x - ray absorptiometry ( dxa ) of hologic and lunar bone densitometers . in the current study , the patients in the ibandronate 1 mg group and the risedronate group were sorted by whether or not they developed vertebral fractures over the 3 years of treatment . the increase in bmd in the hip during the treatment period was examined to characterize its correlation with the anti - vertebral fracture efficacy of the drugs . estimation of odds ratios and probabilities of developing vertebral fractures were performed based on logistic regression analysis . a separate logistic regression analysis was conducted for each of the treatment groups , and the dependent variable was the occurrence of fractures ( with fractures ) or non - occurrence of fractures ( without fractures ) during each of the treatment periods , while the independent variables included the change in hip bmd at 6 months ( 0 , > 0 to 3 , or > 3 % ) , number of existing fractures at screening ( 1 vs. 2 fractures ) , age at baseline ( < 75 vs. 75 years ) , change in adjusted urinary c - telopeptide levels at 6 months , and change in bone - specific alkaline phosphatase levels also at 6 months . using the estimated regression parameters and the data of the individual subjects considered for the estimation of those parameters , the probability of fractures in each subject was calculated . this analysis was performed using sas version 9.2 ( sas institute inc . , cary , nc , usa).table 1baseline patient characteristicsibandronate 0.5 mg ( n = 376)ibandronate 1 mg ( n = 382)risedronate ( n = 376)women , n ( % ) 356 ( 94.7)354 ( 92.7)343 ( 91.2)mean age , years ( sd)72.9 ( 6.34)72.2 ( 6.38)73.0 ( 6.29 ) aged 6074 years , n ( % ) 219 ( 58.2)245 ( 64.1)227 ( 60.4 ) aged 75 years , n ( % ) 157 ( 41.8)137 ( 35.9)149 ( 39.6)mean weight , kg ( sd)50.6 ( 8.00)50.9 ( 7.36)51.1 ( 8.35)mean height , cm ( sd)149.2 ( 6.66)149.5 ( 6.56)149.4 ( 6.70)mean bmd t - score ( sd ) lumbar spine ( l2l4)2.71 ( 1.01)2.68 ( 1.01)2.59 ( 1.06 ) femoral neck2.48 ( 0.73)2.41 ( 0.80)2.53 ( 0.79 ) total hip2.17 ( 0.87)2.09 ( 0.86)2.18 ( 0.86)prevalent vertebral fractures , n ( % ) 1186 ( 49.5)184 ( 48.2)183 ( 48.7 ) 297 ( 25.8)106 ( 27.7)95 ( 25.3 ) > 293 ( 24.7)92 ( 24.1)98 ( 26.1)mean uctx , g / mmol cr ( sd)382.4 ( 226.2)368.6 ( 209.9)373.2 ( 261.0)mean untx , nm bce / mm cr ( sd)73.6 ( 39.31)69.4 ( 35.42)68.9 ( 35.16)mean balp , iu / l ( sd)33.6 ( 13.15)33.9 ( 13.11)32.4 ( 11.96)mean 25-oh vitamin d , ng / ml ( sd)19.6 ( 6.44)20.0 ( 6.69)19.7 ( 6.56 ) balp bone - specific alkaline phosphatase , bce bovine collagen equivalent , bmd bone mineral density , cr creatinine , sd standard deviation , uctx creatinine - corrected urinary collagen type 1 cross - linked c - telopeptide , untx creatinine - corrected urinary collagen type 1 cross - linked n - telopeptide baseline patient characteristics balp bone - specific alkaline phosphatase , bce bovine collagen equivalent , bmd bone mineral density , cr creatinine , sd standard deviation , uctx creatinine - corrected urinary collagen type 1 cross - linked c - telopeptide , untx creatinine - corrected urinary collagen type 1 cross - linked n - telopeptide the mean gains in bmd at 6 months relative to baseline in the ibandronate 1 mg and risedronate treatment groups were 1.7 and 1.3 % in the hip and 5.1 and 3.9 % in the lumbar spine , respectively , in the mover study . among patients receiving iv ibandronate 1 mg , the mean changes in hip bmd ( fig . 1a ) in the group without vertebral fractures were 1.9 3.2 % ( mean sd ) ( n = 305 ) at 6 months , 2.9 3.3 % ( n = 290 ) at 1 year , 3.6 3.3 % ( n = 265 ) at 2 years , and 3.5 3.4 % ( n = 242 ) at 3 years . among patients receiving iv ibandronate 1 mg , the mean changes in hip bmd in the group with vertebral fractures were 0.7 4.9 % ( n = 48 ) at 6 months , 1.2 3.7 % ( n = 47 ) at 1 year , 1.5 4.4 % ( n = 42 ) at 2 years , and 1.5 5.0 % ( n = 37 ) at 3 years . among patients receiving oral risedronate 2.5 mg , the mean changes in hip bmd ( fig . 1b ) in the group without vertebral fractures were 1.5 3.1 % ( n = 290 ) at 6 months , 2.3 3.3 % ( n = 276 ) at 1 year , 2.3 3.7 % ( n = 251 ) at 2 years , and 2.2 3.5 % ( n = 228 ) at 3 years . among patients receiving oral risedronate 2.5 mg , the mean changes in hip bmd in the group with vertebral fractures were 0.4 4.9 % ( n = 60 ) at 6 months , 1.2 5.4 % ( n = 59 ) at 1 year , 1.5 5.3 % ( n = 53 ) at 2 years , and 1.5 5.9 % ( n = 49 ) at 3 years . in both treatment groups , the increases in hip bmd were substantially greater at all measurement times in the groups without vertebral fractures than in the groups with fractures.fig . 1mean increases ( + sd ) in total hip bmd in ( a ) ibandronate - treated patients with ( black circle ) or without ( black square ) vertebral fractures ; ( b ) risedronate - treated patients with ( white circle ) or without ( white square ) vertebral fractures mean increases ( + sd ) in total hip bmd in ( a ) ibandronate - treated patients with ( black circle ) or without ( black square ) vertebral fractures ; ( b ) risedronate - treated patients with ( white circle ) or without ( white square ) vertebral fractures the gains in hip bmd at 6 months were categorized into 3 groups ( 0 , > 0 to 3 , and > 3 % ) . the probability of incidence of vertebral fractures in these 3 groups was estimated at 12 , 24 , and 36 months ( fig . 2a , ibandronate ; fig . 2b , risedronate ) . in the ibandronate group , the median probabilities of developing vertebral fractures at 12 months in each of the 3 groups were 9.5 % ( n = 80 ) , 4.6 % ( n = 144 ) , and 3.2 % ( n = 114 ) , respectively . in the risedronate group , the median probabilities of developing vertebral fractures at 12 months were 14.0 % ( n = 113 ) , 9.2 % ( n = 138 ) , and 8.2 % ( n = 86 ) , respectively . the median probabilities of developing vertebral fractures at 24 months were 16.8 % ( n = 77 ) , 9.2 % ( n = 136 ) , and 5.1 % ( n = 109 ) in the 3 ibandronate groups and 18.8 % ( n = 111 ) , 11.2 % ( n = 133 ) , and 8.6 % ( n = 85 ) in the 3 risedronate groups , respectively . the median probabilities of developing vertebral fractures at 36 months were 21.4 % ( n = 72 ) , 10.5 % ( n = 128 ) , and 8.9 % ( n = 102 ) in the 3 ibandronate groups and 25.3 % ( n = 100 ) , 16.7 % ( n = 119 ) , and 13.0 % ( n = 78 ) in the 3 risedronate groups , respectively . the numbers of vertebral fracture events that actually occurred ( table 2 ) were comparable to the probabilities of future vertebral fractures estimated by the logistic regression analysis.fig . 2estimated probability of incidence of vertebral fractures according to gains in hip bmd in patients treated with ibandronate ( a ) and risedronate ( b ) at 12 months ( left column ) , 24 months ( middle ) , and 36 months ( right ) . the cross indicates the mean value and the horizontal line indicates the median valuetable 2numbers of vertebral fracture events according to change in hip bmd at 6 monthstreatmentibandronaterisedronatehip bmd at 6 months0 % > 0 to 3 % > 3 % 0%>0 to 3 % > 3 % ( months)(n = 85)(n = 150)(n = 118)(n = 116)(n = 145)(n = 89)1210 ( 12.5 % ) 9 ( 6.3 % ) 6 ( 5.3 % ) 18 ( 15.9 % ) 16 ( 11.6 % ) 8 ( 9.3 % ) 2414 ( 18.2 % ) 12 ( 8.8 % ) 7 ( 6.4 % ) 23 ( 20.7 % ) 17 ( 12.8 % ) 8 ( 9.4 % ) 3619 ( 26.4 % ) 17 ( 13.3 % ) 12 ( 11.8 % ) 27 ( 27.0 % ) 22 ( 18.5 % ) 11 ( 14.1 % ) treatmentibandronaterisedronatelumbar spine bmd at 6 months 0 % > 0 to 3 % > 3 % 0 % > 0 to 3 % > 3 % ( months)(n = 44)(n = 81)(n = 236)(n = 61)(n = 100)(n = 190)123 ( 7.7 % ) 5 ( 6.3 % ) 11 ( 4.8 % ) 3 ( 5.2 % ) 10 ( 10.3 % ) 17 ( 9.3 % ) 245 ( 12.8 % ) 7 ( 9.2 % ) 15 ( 7.0 % ) 5 ( 9.1 % ) 10 ( 10.6 % ) 21 ( 11.7 % ) 366 ( 17.1 % ) 15 ( 22.4 % ) 23 ( 11.2 % ) 5 ( 10.0 % ) 11 ( 12.8 % ) 32 ( 20.3 % ) cases in which vertebral fractures occurred within the first 6 months were eliminated estimated probability of incidence of vertebral fractures according to gains in hip bmd in patients treated with ibandronate ( a ) and risedronate ( b ) at 12 months ( left column ) , 24 months ( middle ) , and 36 months ( right ) . the cross indicates the mean value and the horizontal line indicates the median value numbers of vertebral fracture events according to change in hip bmd at 6 months cases in which vertebral fractures occurred within the first 6 months were eliminated the odds ratios for each group with a positive bmd response ( > 0 to 3 % increase from baseline , and > 3 % increase ) against the group with inadequate bmd response ( 0% ) were compared for bmd gains in the hip and in the lumbar spine in the first 6 months of treatment ( table 3 ) . with respect to the bmd gains in the hip , although the ratios were mostly numerically lower in the ibandronate group than in the risedronate group , it was shown that the bmd gains in the hip at 6 months promised similarly effective reduction in the risk of future vertebral fracture . the gains in bmd in the femoral neck showed similar trends in reduction of risk of future vertebral fracture ( data not shown ) . with respect to the bmd gains in the lumbar spine at 6 months , the odds ratios were higher in the risedronate group than in the ibandronate group.table 3odds ratios of vertebral fracture incidence at 12 , 24 , or 36 months according to gains in hip or lumbar spine bmd at 6 months by treatment with ibandronate and risedronategain in hip bmd at 6 monthstreatment durationagainst 0odds ratio ( 95 % ci)ibandronaterisedronate12 months>0 to 3 % 0.52 ( 0.20 , 1.41)0.79 ( 0.37 , 1.70)>3 % 0.40 ( 0.13 , 1.21)0.54 ( 0.22 , 1.36)24 months>0 to 3 % 0.55 ( 0.23 , 1.31)0.64 ( 0.32 , 1.31)>3 % 0.41 ( 0.15 , 1.14)0.41 ( 0.17 , 1.00)36 months>0 to 3 % 0.51 ( 0.24 , 1.09)0.69 ( 0.35 , 1.33)>3 % 0.47 ( 0.20 , 1.09)0.44 ( 0.20 , 0.99)gain in lumbar spine bmd at 6 months treatment durationagainst 0odds ratio ( 95 % ci)ibandronaterisedronate12 months>0 to 3 % 0.87 ( 0.18 , 4.16)2.65 ( 0.67 , 10.46)>3 % 0.77 ( 0.18 , 3.21)2.31 ( 0.62 , 8.65)24 months>0 to 3 % 0.76 ( 0.20 , 2.79)1.46 ( 0.46 , 4.68)>3 % 0.70 ( 0.21 , 2.29)1.68 ( 0.57 , 4.96)36 months>0 to 3 % 1.54 ( 0.51 , 4.63)1.65 ( 0.52 , 5.25)>3 % 0.72 ( 0.25 , 2.03)3.01 ( 1.05 , 8.64 ) cases in which vertebral fractures occurred within the first 6 months were eliminated odds ratios of vertebral fracture incidence at 12 , 24 , or 36 months according to gains in hip or lumbar spine bmd at 6 months by treatment with ibandronate and risedronate cases in which vertebral fractures occurred within the first 6 months were eliminated the mean gains in bmd at 6 months relative to baseline in the ibandronate 1 mg and risedronate treatment groups were 1.7 and 1.3 % in the hip and 5.1 and 3.9 % in the lumbar spine , respectively , in the mover study . among patients receiving iv ibandronate 1 mg , the mean changes in hip bmd ( fig . 1a ) in the group without vertebral fractures were 1.9 3.2 % ( mean sd ) ( n = 305 ) at 6 months , 2.9 3.3 % ( n = 290 ) at 1 year , 3.6 3.3 % ( n = 265 ) at 2 years , and 3.5 3.4 % ( n = 242 ) at 3 years . among patients receiving iv ibandronate 1 mg , the mean changes in hip bmd in the group with vertebral fractures were 0.7 4.9 % ( n = 48 ) at 6 months , 1.2 3.7 % ( n = 47 ) at 1 year , 1.5 4.4 % ( n = 42 ) at 2 years , and 1.5 5.0 % ( n = 37 ) at 3 years . among patients receiving oral risedronate 2.5 mg , the mean changes in hip bmd ( fig . 1b ) in the group without vertebral fractures were 1.5 3.1 % ( n = 290 ) at 6 months , 2.3 3.3 % ( n = 276 ) at 1 year , 2.3 3.7 % ( n = 251 ) at 2 years , and 2.2 3.5 % ( n = 228 ) at 3 years . among patients receiving oral risedronate 2.5 mg , the mean changes in hip bmd in the group with vertebral fractures were 0.4 4.9 % ( n = 60 ) at 6 months , 1.2 5.4 % ( n = 59 ) at 1 year , 1.5 5.3 % ( n = 53 ) at 2 years , and 1.5 5.9 % ( n = 49 ) at 3 years . in both treatment groups , the increases in hip bmd were substantially greater at all measurement times in the groups without vertebral fractures than in the groups with fractures.fig . 1mean increases ( + sd ) in total hip bmd in ( a ) ibandronate - treated patients with ( black circle ) or without ( black square ) vertebral fractures ; ( b ) risedronate - treated patients with ( white circle ) or without ( white square ) vertebral fractures mean increases ( + sd ) in total hip bmd in ( a ) ibandronate - treated patients with ( black circle ) or without ( black square ) vertebral fractures ; ( b ) risedronate - treated patients with ( white circle ) or without ( white square ) vertebral fractures the gains in hip bmd at 6 months were categorized into 3 groups ( 0 , > 0 to 3 , and > 3 % ) . the probability of incidence of vertebral fractures in these 3 groups was estimated at 12 , 24 , and 36 months ( fig . 2a , ibandronate ; fig . 2b , risedronate ) . in the ibandronate group , the median probabilities of developing vertebral fractures at 12 months in each of the 3 groups were 9.5 % ( n = 80 ) , 4.6 % ( n = 144 ) , and 3.2 % ( n = 114 ) , respectively . in the risedronate group , the median probabilities of developing vertebral fractures at 12 months were 14.0 % ( n = 113 ) , 9.2 % ( n = 138 ) , and 8.2 % ( n = 86 ) , respectively . the median probabilities of developing vertebral fractures at 24 months were 16.8 % ( n = 77 ) , 9.2 % ( n = 136 ) , and 5.1 % ( n = 109 ) in the 3 ibandronate groups and 18.8 % ( n = 111 ) , 11.2 % ( n = 133 ) , and 8.6 % ( n = 85 ) in the 3 risedronate groups , respectively . the median probabilities of developing vertebral fractures at 36 months were 21.4 % ( n = 72 ) , 10.5 % ( n = 128 ) , and 8.9 % ( n = 102 ) in the 3 ibandronate groups and 25.3 % ( n = 100 ) , 16.7 % ( n = 119 ) , and 13.0 % ( n = 78 ) in the 3 risedronate groups , respectively . the numbers of vertebral fracture events that actually occurred ( table 2 ) were comparable to the probabilities of future vertebral fractures estimated by the logistic regression analysis.fig . 2estimated probability of incidence of vertebral fractures according to gains in hip bmd in patients treated with ibandronate ( a ) and risedronate ( b ) at 12 months ( left column ) , 24 months ( middle ) , and 36 months ( right ) . the cross indicates the mean value and the horizontal line indicates the median valuetable 2numbers of vertebral fracture events according to change in hip bmd at 6 monthstreatmentibandronaterisedronatehip bmd at 6 months0 % > 0 to 3 % > 3 % 0%>0 to 3 % > 3 % ( months)(n = 85)(n = 150)(n = 118)(n = 116)(n = 145)(n = 89)1210 ( 12.5 % ) 9 ( 6.3 % ) 6 ( 5.3 % ) 18 ( 15.9 % ) 16 ( 11.6 % ) 8 ( 9.3 % ) 2414 ( 18.2 % ) 12 ( 8.8 % ) 7 ( 6.4 % ) 23 ( 20.7 % ) 17 ( 12.8 % ) 8 ( 9.4 % ) 3619 ( 26.4 % ) 17 ( 13.3 % ) 12 ( 11.8 % ) 27 ( 27.0 % ) 22 ( 18.5 % ) 11 ( 14.1 % ) treatmentibandronaterisedronatelumbar spine bmd at 6 months 0 % > 0 to 3 % > 3 % 0 % > 0 to 3 % > 3 % ( months)(n = 44)(n = 81)(n = 236)(n = 61)(n = 100)(n = 190)123 ( 7.7 % ) 5 ( 6.3 % ) 11 ( 4.8 % ) 3 ( 5.2 % ) 10 ( 10.3 % ) 17 ( 9.3 % ) 245 ( 12.8 % ) 7 ( 9.2 % ) 15 ( 7.0 % ) 5 ( 9.1 % ) 10 ( 10.6 % ) 21 ( 11.7 % ) 366 ( 17.1 % ) 15 ( 22.4 % ) 23 ( 11.2 % ) 5 ( 10.0 % ) 11 ( 12.8 % ) 32 ( 20.3 % ) cases in which vertebral fractures occurred within the first 6 months were eliminated estimated probability of incidence of vertebral fractures according to gains in hip bmd in patients treated with ibandronate ( a ) and risedronate ( b ) at 12 months ( left column ) , 24 months ( middle ) , and 36 months ( right ) . the cross indicates the mean value and the horizontal line indicates the median value numbers of vertebral fracture events according to change in hip bmd at 6 months cases in which vertebral fractures occurred within the first 6 months were eliminated the odds ratios for each group with a positive bmd response ( > 0 to 3 % increase from baseline , and > 3 % increase ) against the group with inadequate bmd response ( 0% ) were compared for bmd gains in the hip and in the lumbar spine in the first 6 months of treatment ( table 3 ) . with respect to the bmd gains in the hip , although the ratios were mostly numerically lower in the ibandronate group than in the risedronate group , it was shown that the bmd gains in the hip at 6 months promised similarly effective reduction in the risk of future vertebral fracture . the gains in bmd in the femoral neck showed similar trends in reduction of risk of future vertebral fracture ( data not shown ) . with respect to the bmd gains in the lumbar spine at 6 months , the odds ratios were higher in the risedronate group than in the ibandronate group.table 3odds ratios of vertebral fracture incidence at 12 , 24 , or 36 months according to gains in hip or lumbar spine bmd at 6 months by treatment with ibandronate and risedronategain in hip bmd at 6 monthstreatment durationagainst 0odds ratio ( 95 % ci)ibandronaterisedronate12 months>0 to 3 % 0.52 ( 0.20 , 1.41)0.79 ( 0.37 , 1.70)>3 % 0.40 ( 0.13 , 1.21)0.54 ( 0.22 , 1.36)24 months>0 to 3 % 0.55 ( 0.23 , 1.31)0.64 ( 0.32 , 1.31)>3 % 0.41 ( 0.15 , 1.14)0.41 ( 0.17 , 1.00)36 months>0 to 3 % 0.51 ( 0.24 , 1.09)0.69 ( 0.35 , 1.33)>3 % 0.47 ( 0.20 , 1.09)0.44 ( 0.20 , 0.99)gain in lumbar spine bmd at 6 months treatment durationagainst 0odds ratio ( 95 % ci)ibandronaterisedronate12 months>0 to 3 % 0.87 ( 0.18 , 4.16)2.65 ( 0.67 , 10.46)>3 % 0.77 ( 0.18 , 3.21)2.31 ( 0.62 , 8.65)24 months>0 to 3 % 0.76 ( 0.20 , 2.79)1.46 ( 0.46 , 4.68)>3 % 0.70 ( 0.21 , 2.29)1.68 ( 0.57 , 4.96)36 months>0 to 3 % 1.54 ( 0.51 , 4.63)1.65 ( 0.52 , 5.25)>3 % 0.72 ( 0.25 , 2.03)3.01 ( 1.05 , 8.64 ) cases in which vertebral fractures occurred within the first 6 months were eliminated odds ratios of vertebral fracture incidence at 12 , 24 , or 36 months according to gains in hip or lumbar spine bmd at 6 months by treatment with ibandronate and risedronate cases in which vertebral fractures occurred within the first 6 months were eliminated the purpose of this analysis of the mover study was to examine the relationship between gains in bmd and the occurrence of vertebral fractures by analyzing the gains in hip bmd in the initial 6 months and the subsequent development of vertebral fractures over time . first , we compared the hip bmd gains in ibandronate- or risedronate - treated patients who developed vertebral fractures with those who had not developed vertebral fractures during the 3 years of treatment . in both the ibandronate and the risedronate treatment groups , hip bmd gains were greater in the patients who developed no vertebral fractures during the treatment period than in the patients who developed vertebral fractures . the hip bmd gains in the fracture - negative ibandronate group were consistently greater than in the fracture - negative risedronate group . on the other hand , both fracture - positive groups showed similarly low bmd gains . these results suggested that hip bmd gains could be an effective parameter with which to predict the future incidence of vertebral fractures . next , we categorized the patients into 3 groups according to the gains in hip bmd in the first 6 months of treatment , and we used logistic regression analysis to estimate future vertebral fracture risk reduction at 12 , 24 , and 36 months . greater gains in hip bmd at 6 months were associated with a greater reduction in the risk of subsequent non - traumatic vertebral fractures over the 3-year treatment period . the bmd gains in the hip at 6 months , which might be the time - point when the effects of bisphosphonates begin to be seen , were shown in our analysis to predict the risk of vertebral fracture incidence . in all treatment periods , the probability of developing vertebral fractures tended to be lower in groups that had hip bmd gains of greater than 3 % than in those that had lesser gains in hip bmd . the odds ratios in the hip bmd gains were low overall under 1 over the 3 years and the values decreased according to the bmd gains in the both treatment groups . those results might explain why hip bmd gains might predict the future risk reduction of vertebral fracture . with respect to the bmd gains in the lumbar spine at 6 months , the odds ratios in the risedronate group were higher ( but not significantly higher ) than in the ibandronate group . it is recently reported that a bisphosphonate which has a lower mineral binding affinity such as ibandronate or risedronate could be efficiently delivered to the cortical bone area . it might be one of explanations that ibandronate showed the greater gains of bmd in the hip in a short period of 6 months [ 16 , 17 ] . it has been also reported that the changes in lumbar spine bmd by treatment with risedronate contributed only 18 % ( 95 % ci 10 , 26 % ) of its efficacy against vertebral fractures . the number of vertebral fracture events in the risedronate group ( > 0 to 3 , and > 3 % lumbar spine bmd increase ) was greater than in the ibandronate group . those might be a part of the reasons why the odds ratios in the risedronate group were over 1 . however , further analysis of the individual cases is needed . many reports have said that bmd might be a factor predictive of future fractures in general . additionally , when the bmd measurements of the lumbar spine , femoral neck , femoral trochanter , and hip were compared , hip bmd was reported to be better at predicting future incidence of all fractures than was lumbar spine bmd . bmd measurements in all sites including hip were performed centrally at each time using dxa machine because the mover study was a randomized multicenter study . we examined the mean bmd values of each treatment group in the study , however , least significant change or coefficient of variation is important on bmd measurement . in clinical practice , due to variability of hip bmd measurement , there might be a difficulty to obtain the accurate data even though the treatment would express the efficacy at 6 months . the relationship between bmd in the first 6 months and the time - course of incidence of hip fractures should also be investigated ; however , we did not get any information due to the low number of non - vertebral fractures including hip that occurred in the mover study . our analysis did not show the contribution rate of bmd gains to the expression of the anti - fracture efficacy in the mover study . it has been reported previously that bmd gains by ibandronate would explain approximately one - third ( 2437 % ) of ibandronate s anti - fracture efficacy . that contribution rate was derived from analysis of the bone and iv studies in which the annual cumulative exposure ( ace ) was under 5.5 mg . however , the ace in the mover study was 12 mg ; thus , the contribution of bmd gains in the mover study might be much bigger . our current analysis indicated that greater gains of bmd in the hip in a relatively short period of 6 months of treatment were associated with a greater reduction in the risk of future vertebral fracture incidence . in fact , the bmd measurements using dxa machine are reimbursable every 4 month in japan and the physicians like to measure bmd to evaluate the treatment regimen . we , in japan , suggest to measure bmd after 6 months of therapy and keep to do every 6 month . in case the bmd measurement is not available or practical , the measurement of bone turnover markers ( btms ) could be supportive . in these days , not only physicians but also patients would discuss their laboratory data including bmd or btms values together , which is desirable to keep better adherence to therapy for osteoporosis . if there is no gain in bmd , would be one of next options and to add another drug would be also an alternative . the results suggest that the hip bmd value at 6-month treatment might be a useful predictor to prevent the future vertebral fracture incidence and provide an opportunity to assess the treatment options .
the replication of genomic dna is a central event in the division and propagation of a bacterial cell . the nucleoprotein complex responsible for dna replication is the replisome , which precisely coordinates the action of several discrete factors to efficiently and rapidly couple dna unwinding with high - fidelity nucleic acid synthesis . since the strands of template dna are antiparallel , and because dna polymerases are only capable of strand synthesis in the 53 direction , genomic replication proceeds asymmetrically . one daughter strand , termed the leading strand , is continually synthesized in the same direction as the unwinding of the fork . the other , the lagging strand , is synthesized in the opposite direction in short bursts called okazaki fragments ( 1 ) . replication of the lagging strand is complicated by the inability of dna polymerases to initiate strand synthesis . to overcome this challenge , cells utilize a special rna polymerase , termed primase , to initiate each okazaki fragment with a short oligoribonucleotide . the bacterial primase , dnag , is recruited to the replication fork by an association with the replicative helicase , dnab , where it synthesizes an rna primer every 1.52 kb ( 24 ) . working together , the helicase and primase unwind the dna template and initiate thousands of regularly - spaced okazaki fragments to promote fork progression at a rate of 1000 bases per second in rapidly dividing escherichia coli cells . for example , primase increases both the atpase and helicase activities of dnab ( 5 ) . similarly , dnab can modulate the overall activity of dnag , as well as the length of primers synthesized by the primase and its initiation specificity ( 68 ) . since isolated dnag is weakly active in vitro , with a kd of 110 m for single - stranded template dna , a km of 3050 m for rntps , and a maximum rate of approximately three primers per hour , activation of primase by dnab is essential for replication to proceed at the rates observed in vivo ( 2,810 ) . the importance of the helicase primase interaction is underscored by certain viral systems , such as t7 bacteriophage gene product 4 ( t7gp4 ) , in which a dnab - type helicase is fused with a dnag - type primase in a single polypeptide to create a covalently tethered primase helicase complex . the physical mechanisms by which primase and helicase regulate each other 's activity have been the focus of recent interest . since enhancement of primase activity is unrelated to either the atpase or helicase functions of dnab ( 11 ) , the simplest models posit that dnab may activate dnag merely by serving as a mobile docking station to increase the local concentration of single - stranded dna template relative to primase . such a structural role for the helicase is supported by a recent crystal structure of the t7gp4 primase helicase , which shows that primase domains are loosely constrained to one side of the helicase ring , but that the structure of their catalytic center remains virtually unchanged from that determined in the absence of the helicase ( 12,13 ) . however , this tethering model does not fully explain the more subtle aspects of the relationship between primase and helicase , such as how dnab regulates the usage of primer initiation sites and alters the distribution of primer lengths synthesized by dnag . this review will touch on a few recent developments that are beginning to shed light on this interplay and its importance to dna replication . in its active state , dnab oligomerizes into a homo - hexameric ring ( 1417 ) . each subunit of the hexamer contains two domains important for function ( figure 1 ) . the c - terminal domain of dnab , which comprises two - thirds of the protein , contains the atpase activity of the helicase and is the principal organizing factor for ring formation ( figure 2 ) ( 18 ) . the n - terminal domain is an -helical globule that is required for helicase activity ( 1822 ) . together with the linker to the c - terminal region , the n - terminal domain of dnab mediates the helicase 's interactions with dnag ( figure 1 ) ( 5,23 ) . dnag is a similarly modular protein , but with three independent domains ( figure 1 ) . an n - terminal zinc binding domain , so named for its internal zinc - ribbon motif , has been proposed to recognize a trinucleotide initiation site on template dna ( figure 2 ) ( 2426 ) . the zinc binding domain is followed by the rna polymerase domain , which carries out primer synthesis ( 27,28 ) . the isolated polymerase domain of bacterial dnag is capable of synthesizing primers in vitro ; however , bacteriophage primases require both the zinc binding domain and the rna polymerase domain for activity either in vitro or in vivo ( 27,29,30 ) . recent structural and biochemical data from t7gp4 have suggested that the zinc binding domain can dissociate from its rna polymerase domain , possibly acting as a tethered , but mobile , regulatory element ( 13,31 ) . although the zinc binding and rna polymerase domains are essentially conserved with phage primases , bacterial primases contain an extra element at their c - termini , termed the interaction ( or p16 ) domain . this module binds to the n - terminus and linker region of dnab ( 21,23,3234 ) , as well as to ssb ( 35 ) . many dnag temperature sensitive replication mutations map to the interaction domain ( 36 ) , underscoring the need for dnag to interact with other proteins in the replisome . the interaction domain is principally composed of a helical bundle and terminates in a small helical hairpin that mediates its interaction with the replicative helicase ( figure 2 ) ( 21,32 ) . surprisingly , recent structural and biochemical studies have shown that the helical bundle of the dnag interaction domain is related in fold to the n - terminus of dnab and is required for co - activation of the helicase by primase ( 21,32 ) . several lines of evidence indicate that the interaction between primase and helicase has been fine - tuned among different organisms . to date , three distinct types of association have been observed . the first relies on non - covalent and relatively unstable contacts , as exemplified by e.coli , in which the primase helicase complex can only be detected in vitro by relatively sensitive methods ( 7,18,21 ) . the second class , which includes the bacillus stearothermophilus and phage t4 primase helicase complexes , also associates non - covalently , but forms stable interactions that can persist over a gel filtration column and may be visualized by electron and atomic force microscopy ( 5,37,38 ) . the third class , typified by t7gp4 , is distinguished by deletion of the interaction domain and the direct fusion of primase with the helicase into a single polypeptide chain ( figure 1 ) . the covalent association between primase and helicase in t7gp4 directly facilitates the inclusion of up to six or seven primases per helicase ring ( figure 2 ) . this assembly is complicated , however , by the expression in vivo of a truncated form of t7gp4 that both lacks the n - terminal primase zinc binding domain and is incapable of primer synthesis ( 29 ) . while these truncated monomers can assemble with full - length t7gp4 to alter the primase : helicase ratio in vivo , the functional significance of this mixture is currently unknown . even in systems with non - covalent primase / helicase associations , for example , isothermal titration calorimetry ( itc ) indicates that between four and six subunits of the t4 bacteriophage gp61 primase can bind the gp41 helicase in vitro ( 39 ) . helicase complex shows that 23 primases bind each helicase ( 5 ) , a value in excellent agreement with data obtained for the e.coli dnab / g complex from fluorescence anisotropy and cross - linking / gel filtration analyses ( 40 ) . although primases from bacteria or t4 bacteriophage are monomers in the absence of substrate , the presence of ssdna template provided by the helicase may favor the multimerization of primase molecules . early hints to this behavior derived from studies published over 20 years ago , which indicated that a 2:1 complex of dnag to ssdna containing a phage g4 replication origin was required for optimal primer synthesis in vitro ( 41 ) . more recently , fluorescence anisotropy and cross - linking studies have indicated that e.coli primase binds single - stranded oligonucleotides cooperatively , with a hill coefficient between 1.5 and 2 . here , binding was determined to occur via a sequential dimerization pathway , in which one primase subunit first associates with template as a monomer , followed by the binding of a second primase to form a ternary complex ( 42 ) . in phage t4 , itc and fluorescence anisotropy experiments indicate that four to six molecules of the gp61 primase bind a relatively short piece of single - stranded dna ( 39,43 ) , and electron micrographs taken in the presence of ssdna reveal six - membered rings that are of approximately the same diameter as the dnab - related t4 gp41 helicase ( 38 ) . first , the interaction of these proteins increases the local concentration of ssdna available to primase . second , the arrangement co - localizes multiple primase subunits within close proximity of each other . since binding of primase to ssdna appears to induce multimerization of the protein , these properties may allow multiple primases arrayed upon the helicase to coordinate their activies . in bacterial systems , multiple lines of evidence indirectly signify that primer synthesis is controlled by helicase - mediated primase oligomers . for example , e.coli primase associates similarly with both wild - type dnab and an atpase-/helicase - deficient mutant ( 11 ) . in priming assays , binding to either the wild - type or mutant protein down - regulates primase processivity to yield a distribution of primer lengths that ranges from 8 to 30 nt . however , when atp--s is substituted for atp with either active or inactive dnab , the average primer length shifts to 1560 nt ( 11 ) . although atp--s is not known to affect primase , this nucleotide has been shown to cause the helicase to transition from a 6-fold symmetric state to a 3-fold symmetric structure ( 14,17 ) . it thus appears that modifying the symmetry of the helicase , and thereby the spatial relationship of one primase to another , may be one factor that could influence the synthetic characteristics of primase . consistent with this model , afm studies have indicated that primase itself may induce a change in symmetry of the b.stearothermophilus helicase upon binding ( 37 ) , although how this conformational change might affect the activity of primase has not yet been investigated in this system . for bacteriophage primase / helicase complexes , productive crosstalk between primase subunits has been directly observed in both the t7 and t4 systems . in both viruses , only full - length primases containing the zinc binding and rna polymerase domains are capable of primer synthesis . however , truncated primases containing only the rna polymerase domain can be complemented in vitro by catalytically inactive , full - length primase mutants ( 43,44 ) . these data provide concrete evidence that priming can be regulated by communication between primases tethered to the same helicase . such an event may occur by interactions that allow the regulatory zinc binding domain of one subunit to cooperate with the catalytic rna polymerase domain of another in trans . indeed , recent structural and biochemical studies indicate that bacterial primases can modulate their activity and processivity through crosstalk between the zinc binding and rna polymerase domains ( 45 ) . thus , in addition to increasing the local concentration of the ssdna template , the association of primase with the helicase ring may also increase the likelihood that intermolecular primase contacts will occur , thereby modulating primer synthesis . one model for the control of okazaki fragment initiation posits that monomeric primase is relatively inactive in isolation , but that an association between the zinc binding domain of one primase may activate and regulate the rna polymerase domain of a second primase in trans ( figure 3 ) . under this model , primase would be specifically activated at a replication fork by the helicase , which is known to localize multiple primases to newly unwound lagging strands and to leading strand gaps occurring at sites of dna damage ( 46 ) . although cells require the relatively non - specific de novo synthesis activity of primase for dna replication , they must also strictly limit primase action to the replication fork . failing to do so could result in the synthesis of rna primers at non - replisomal single - stranded regions within the genome , possibly to deleterious effect . although these regions would likely be coated with ssb , an unregulated association between ssb and an active primase could lead to rna incorporation within the genome . indeed , bacteriophage g4 primes its own replication by recruiting bacterial dnag to a specific location via carefully spaced ssb molecules and stem loop structures ( 47,48 ) . in bacteria , the low intrinsic activity of primase likely prevents the enzyme from inadvertently synthesizing primers at random locations , either alone or as part of a fortuitous complex with ssb , whereas its association with dnab constrains primase to act on the proper template for appropriate synthesis at a replication fork . it is tempting to speculate that in bacteria , a helicase - mediated association between multiple primases may serve to further regulate function , since dnag oligomers would only efficiently form in vivo upon binding to dnab . in addition to restricting the location of primer synthesis , the e.coli replisome also reduces the frequency of priming so as to ignore 19 out of every 20 possible initiation sites , thereby yielding the 1.52 kb okazaki fragments observed in vivo ( 49,50 ) . interestingly , in t7 bacteriophage the isolated rna polymerase domain can bind single - stranded dna almost as well as the entire primase fragment , but lacks sequence specificity ( 31 ) . this may indicate that the catalytic core of primase constantly binds to and dissociates from its template , but that it does so non - productively . if an interaction between adjacent primases bound to the replicative helicase were required to recognize and act upon a trinucleotide initiation site ( figure 3b ) , a productive association between the zinc binding and rna polymerase domains would occur less frequently , greatly reducing the frequency of priming . the zinc binding domain of one primase might thus enforce sequence specificity by recognizing an initiation site within single - stranded dna that is bound to the rna polymerase domain of another primase . since the rate - limiting step of primer synthesis appears to be at or before the formation of the first phosphodiester bond ( 9 ) , it is possible that the zinc binding domain increases activity and enforces specificity by stabilizing two incoming ribonucleotides within the active site of a second primase , thereby favoring primer initiation . since there are only 50100 primase molecules per e.coli cell ( 2 ) , but thousands of okazaki fragments , dnag must be recycled from each primer for successive rounds of primer synthesis . it has been shown that a dissociative interaction between the primase and helicase determines the frequency of okazaki fragment synthesis and thereby adjusts this replication fork clock ( 51,52 ) . in bacteria , binding of the interaction domain to the single - stranded dna binding protein forces a primase primer / template complex to dissociate from the helicase ( 53,54 ) , while in phage t7 , h - n hsqc nmr experiments have revealed that the gp4 zinc binding domain can stably interact with primed rna / dna heteroduplexes ( 13,31 ) . recent single molecule experiments with the t7 replication system have also shown that the primase 's zinc binding domain is necessary to cause pausing of the entire replication fork after each priming event ( 55 ) . these findings suggest that bacterial primase remains associated with the newly synthesized primer / template , possibly as a means to stabilize the relatively short rna / dna heteroduplex and to ensure appropriate transfer to the replicative polymerase . it also appears that the dissociation of primase from the helicase in bacteria may be a controlled process that contributes to the timing of okazaki fragment synthesis by rendering the primosome inactive after each priming event ( 56 ) . if a stable primase primer / template interaction exists both to remove a primase subunit from the helicase and to help protect the nascent heteroduplex , this complex might also be an effective signal that one round of primer synthesis has been successfully completed . since multiple primases normally bind the replicative helicase , the dissociation of one subunit would leave a lower concentration of primase at the replication fork . if primase crosstalk helps favor okazaki fragment initiation , the probability that any remaining primase(s ) could associate with each other would be reduced , thereby further decreasing the frequency of priming . the controlled , post - synthesis dissociation of dnag from dnab , coupled with a propensity for multiple primases to coordinate initiation site selection and primer synthesis , might therefore be an effective mechanism to this could in turn prevent immediate re - priming , an event that would lead to abnormally short okazaki fragments . in contrast , excess levels of dnag would serve to increase the occupancy of primase bound to dnab and decrease okazaki fragment length , a phenomenon observed in vitro ( 51,52,57 ) . future work to investigate how helicase - directed primase oligomers regulate primer synthesis both in vitro and in vivo should shed light upon this poorly understood process and the role it plays in appropriately regulating dna replication . bacterial dnab is a two - domain protein with an n - terminal interaction domain and a c - terminal helicase domain . dnag is a three - domain protein with an n - terminal regulatory zinc binding domain , central rna polymerase domain and c - terminal interaction domain . the phage t4 gp41 helicase and gp61 primase are minimalized versions of dnab and dnag , respectively . the phage t7 gp4 protein , on the other hand , fuses dnab- and dnag - related domains into a single polypeptide . structures of the dnag primase and dnab helicase . ( a ) atomic structures of domains from dnag ( pdb codes 1d0q , 1dde , and 1t3w ) ( 21,24,27 ) are colored as in figure 1 and connections between domains are shown as dotted lines . ( b ) the n - terminal domain of dnab has been solved by nmr and x - ray crystallography ( pdb codes 1jwe and 1b79 ) ( 20,22 ) , whereas the c - terminal region likely resembles that of the related t7gp4 helicase domain ( pdb code 1e0j ) ( 58 ) . domains are colored as in figure 1 and for clarity the n - terminal domain has been omitted from the face - on view . only one of six n - terminal domains is shown in the side view , and the two domains are shown separated from each other . interestingly , the helical bundles of the n - terminus of dnab and c - terminus of dnag adopt very similar folds ( 21,32 ) . helicase ( lacking the n - terminal zinc binding domain ) illustrates the relative locations of the primase ( orange ) and helicase ( red ) modules ( 12 ) . domains of the dnag primase are outlined in black , while those of the dnab helicase are not . ( a ) as the helicase unwinds the parental strands , single - stranded dna containing a trinucleotide primer initiation site ( white rectangle ) is extruded from the helicase ring and non - specifically passes through the catalytic center of a primase 's rna polymerase domain . ( b ) the zinc binding domain of one primase molecule may form a ternary complex with a second primase 's rna polymerase domain and the dna template , forming an active primase unit to allow the recognition of the primer initiation site and the activation of primer synthesis .
corneal hydrops is a condition of acute stromal edema that occurs after a rupture in descemet 's membrane . this is not an uncommon sequelae of late keratoconus and is a frequent indication for penetrating keratoplasty ( pkp ) . approximately , 3% of keratoconus patients experience one or more episodes of corneal hydrops.1 rarely , it can occur in a corneal graft and is frequently an extension of a break in descemet 's membrane from the host cornea to the donor graft . this has been reported in two separate case reports.23 to the author 's knowledge , hydrops in a donor corneal graft has not been described outside of the context of keratoconus . we present two patients with no history of keratoconus that developed acute hydrops in the donor corneal graft . a 44-year - old human immunodeficiency virus positive hispanic male with undetectable viral load presented to the clinic with a 5-week history of decreased vision , 1 year after undergoing pkp in the left eye . the patient had a history of herpes keratitis complicated by severe glaucoma in that eye . he had received a corneal transplant 2 years before for corneal decompensation . on the day of presentation , his best - corrected vision was 20/20 in the right eye and hand - motion at 6 feet in the left eye . his corneal graft was very edematous , opaque , and protuberant making it impossible to measure the intraocular pressure in the left eye . ocular coherence tomography ( oct ) of the anterior segment showed a deep stromal cystic cavity consistent with hydrops in the left eye [ figure 1a ] . ultrasound biomicroscopy ( ubm ) of the anterior segment revealed a descemet 's membrane detachment and severe corneal edema with stromal cystic cavities [ figure 1b ] . , the glaucoma drainage tube was noted to be positioned close to the cornea and was trimmed under the host cornea rim . pathology examination revealed a rupture and recoil of descemet 's membrane centrally and a near perforation with a substantial amount of corneal stromal edema , consistent with hydrops [ figure 2 ] . ( a ) high - definition anterior segment optical coherence tomographic image of corneal hydrops . there is marked fluid within the corneal stroma ( b ) ultrasound biomicroscopy of acute corneal hydrops . note the apparent break in descemet 's membrane pathology slide showing a focal break in descemet 's membrane and large amounts of stromal edema a 91-year - old caucasian male with a history of pkp in the right eye was referred to the clinic for descemetocele evaluation . , he had light perception with projection in the right eye and 20/25 best - corrected vision in the left eye . intraocular pressure was not measurable in the right eye and was 14 mm hg in the left eye . a very large pedunculated cyst was seen within the corneal graft in the right eye [ figure 3 ] . oct of the anterior segment revealed a deep stromal cystic cavity consistent with the hydrops . ubm of the anterior segment showed the presence of an anterior chamber intraocular lens and a large cystic cavity with a suspected break in the superior region of descemet 's membrane . the anterior chamber intraocular lens was an open - loop kelman - style and was left in place . a 44-year - old human immunodeficiency virus positive hispanic male with undetectable viral load presented to the clinic with a 5-week history of decreased vision , 1 year after undergoing pkp in the left eye . the patient had a history of herpes keratitis complicated by severe glaucoma in that eye . he had received a corneal transplant 2 years before for corneal decompensation . on the day of presentation , his best - corrected vision was 20/20 in the right eye and hand - motion at 6 feet in the left eye . his corneal graft was very edematous , opaque , and protuberant making it impossible to measure the intraocular pressure in the left eye . ocular coherence tomography ( oct ) of the anterior segment showed a deep stromal cystic cavity consistent with hydrops in the left eye [ figure 1a ] . ultrasound biomicroscopy ( ubm ) of the anterior segment revealed a descemet 's membrane detachment and severe corneal edema with stromal cystic cavities [ figure 1b ] . , the glaucoma drainage tube was noted to be positioned close to the cornea and was trimmed under the host cornea rim . pathology examination revealed a rupture and recoil of descemet 's membrane centrally and a near perforation with a substantial amount of corneal stromal edema , consistent with hydrops [ figure 2 ] . ( a ) high - definition anterior segment optical coherence tomographic image of corneal hydrops . there is marked fluid within the corneal stroma ( b ) ultrasound biomicroscopy of acute corneal hydrops . note the apparent break in descemet 's membrane pathology slide showing a focal break in descemet 's membrane and large amounts of stromal edema a 91-year - old caucasian male with a history of pkp in the right eye was referred to the clinic for descemetocele evaluation . the patient reported frequent eye rubbing . on examination , he had light perception with projection in the right eye and 20/25 best - corrected vision in the left eye . intraocular pressure was not measurable in the right eye and was 14 mm hg in the left eye . a very large pedunculated cyst was seen within the corneal graft in the right eye [ figure 3 ] . oct of the anterior segment revealed a deep stromal cystic cavity consistent with the hydrops . ubm of the anterior segment showed the presence of an anterior chamber intraocular lens and a large cystic cavity with a suspected break in the superior region of descemet 's membrane . the anterior chamber intraocular lens was an open - loop kelman - style and was left in place . hydrops within a corneal donor graft is a rare complication after corneal transplant for patients with a history of keratoconus . in prior reports , it was believed to occur in patients who developed a tear in descemet 's membrane within the host corneal rim . this break would then extend into the donor cornea and allow the cornea to imbibe the fluid . corneal edema after corneal transplant can also be secondary to corneal graft failure from endothelial dysfunction or corneal transplant rejection . in those occasions the large fluid clefts in this case series demonstrated by anterior segment oct and ubm show focal collections of fluid rather than a diffuse distribution consistent with corneal edema secondary to rejection or endothelial failure . those cases highlight the importance of clinical suspicion and thorough diagnostic evaluation to rule out these other causes since the treatment would be markedly different . we could not find other reports of patients without a history of keratoconus who developed hydrops in the donor corneal graft . an anterior chamber intraocular lens and a glaucoma drainage tube were the suspected culprits in the two patients who were surgically treated . the common feature in these patients was eye rubbing , which might be implicated in the unexpected dislocation of intraocular devices and damage of the descemet 's membrane .
atrial standstill or silent atrium is a rare condition presenting with the absence of electrical and mechanical activity in the atria . it presents with the absence of p waves , bradycardia , and wide qrs complex in the electrocardiogram ( ecg ) and has several substantially different etiologies , ranging from hereditary mutational causes to secondary conditions such as amyloidosis.1 , 2 this case report features a patient with familial atrial standstill diagnosed accidentally . our patient was a 32-year - old man referred to the electrophysiology clinic with episodes of headache and dizziness since the previous month and an unusual rhythm in the ecg ( figure 1 ) . with normal clinical work up for headaches , he had no experience of any cardiac symptoms such as palpitation , chest pain , dyspnea , or syncope and could easily perform such hard physical activities as climbing and playing football . interestingly , his mother had a cerebrovascular accident at the age of 35 years and received a permanent pacemaker ( ppm ) due to atrial standstill . also , his brother underwent ppm implantation at the age of 13 following several episodes of seizure with similar diagnosis . in echocardiography , both atria were mildly enlarged and no a wave was observed in the tricuspid and mitral inflow pulse in doppler recording . tissue doppler imaging also confirmed no visible atrial contracture ( figure 2 ) . in a 24-hour electrocardiogram holter monitoring , the patient s minimum , maximum , and mean heart rates were 44 , 45 , and 59 bpm , respectively . the patient s electrophysiological study revealed a wide complex qrs bradycardia ( 40 45 bpm ) without any discernable p wave . also , no potential for the right atrium could be recorded , and electrical stimulation failed to provoke atrial depolarization . there was a lack of atrial capture during high output , right atrium and coronary sinus pacing , without his potential around the his bundle . no ventricular arrhythmia could be induced during programmed ventricular stimulation . after excluding the secondary causes of atrial standstill , a single - chamber ppm in the vvir mode was implanted with its active lead positioned in the right ventricular apex . our findings pointed toward a diagnosis of atrial standstill , which is a rare condition . familial atrial standstill is usually diagnosed in the third to fifth decade of life , with low cardiac output symptoms , syncopal attacks , peripheral embolism , and neurological symptoms . the former has been observed in drug intoxication ( e.g. digitalis or quinidine ) , hyperkalemia , and acute myocardial infarction or following open cardiac surgery . a digenic inheritance of polymorphism has been reported in patients with congenital form , linked to scn5a ( a cardiac sodium channel ) and connexin 40 ( an atrial - specific gap junction connexin ) , and the coexistence of both genes is necessary for atrial standstill.1 , 2 our patient had an idiopathic , familial , diffuse persistent atrial standstill . however , the main etiology remained unknown as our patient did not give consent for a genetic evaluation . in such patients , implanting a ppm is thought to confer a better life style and symptom reduction.3
we studied 64 subjects divided into three groups matched for age and sex : 24 healthy nondiabetic subjects , 22 diabetic subjects with no clinical peripheral neuropathy , and 18 neuropathic diabetic subjects . presence of diabetic peripheral neuropathy was determined according to standard clinical techniques as previously described ( 5 ) . endothelium - dependent vasodilation in the macro- and microcirculation was measured as previously described ( 6 ) . phosphorus-31 mri data were acquired on a ge 3 t whole - body mr scanner ( general electric medical systems , milwaukee , wi ) . separate images of pcr and pi cellular metabolites were acquired using a rapid acquisition with relaxation enhancement ( rare ) pulse sequence with chemical selectivity capabilities ( 7 ) . the pcr and pi images were acquired simultaneously in a single 6-min scan . after the p imaging , standard t2-weighted ( t2-w ) proton ( h ) spin - echo mri the scan time for the t2-w 1h images was 6 min and 24 s. the spatial resolution of the pcr and pi images was 0.47 0.47 2.5 cm ( voxel volume = 0.55 cm ) and the t2-w images 0.06 0.06 0.25 cm ( voxel volume = 0.0009 cm ) . for the measurements of the intramuscular lipid and water content , single - voxel h spectra were acquired using the point resolved spectral selection ( press ) technique without water suppression . for each subject , the pcr and pi concentrations in the metatarsal head region were calculated as previously described ( 8) . a pcr / pi map was generated by dividing the pcr image by the pi image . the resulting pcr / pi map was registered to the t2-w anatomical images to identify the muscle beds that had abnormal pcr / pi ratios . statistical analysis was performed in collaboration with a biostatistician ( c.g . ) . for parametrically distributed data , the anova test was used . the contribution of cytokines and growth factors in the variation of mri measurements was assessed by univariate and multivariate stepwise regression analysis . presence of diabetic peripheral neuropathy was determined according to standard clinical techniques as previously described ( 5 ) . endothelium - dependent vasodilation in the macro- and microcirculation was measured as previously described ( 6 ) . phosphorus-31 mri data were acquired on a ge 3 t whole - body mr scanner ( general electric medical systems , milwaukee , wi ) . separate images of pcr and pi cellular metabolites were acquired using a rapid acquisition with relaxation enhancement ( rare ) pulse sequence with chemical selectivity capabilities ( 7 ) . the pcr and pi images were acquired simultaneously in a single 6-min scan . after the p imaging , standard t2-weighted ( t2-w ) proton ( h ) spin - echo mri the scan time for the t2-w 1h images was 6 min and 24 s. the spatial resolution of the pcr and pi images was 0.47 0.47 2.5 cm ( voxel volume = 0.55 cm ) and the t2-w images 0.06 0.06 0.25 cm ( voxel volume = 0.0009 cm ) . for the measurements of the intramuscular lipid and water content , single - voxel h spectra were acquired using the point resolved spectral selection ( press ) technique without water suppression . for each subject , the pcr and pi concentrations in the metatarsal head region were calculated as previously described ( 8) . a pcr / pi map was generated by dividing the pcr image by the pi image . the resulting pcr / pi map was registered to the t2-w anatomical images to identify the muscle beds that had abnormal pcr / pi ratios . statistical analysis was performed in collaboration with a biostatistician ( c.g . ) . for parametrically distributed data , the anova test was used . the contribution of cytokines and growth factors in the variation of mri measurements was assessed by univariate and multivariate stepwise regression analysis . the clinical characteristic of the three studied groups are shown in table a1 in the online appendix ( available at http://care.diabetesjournals.org/cgi/content/full/dc09-0536/dc1 ) . mri t1-weighted and pcr / pi images from a healthy control subject , a diabetic non - neuropathic patient , and a neuropathic patient are shown in the figure in the online appendix . 1 a. there were significant differences among all groups , being higher in the control subjects ( 3.23 0.43 ) followed by the non - neuropathic group ( 2.61 0.36 ) , whereas the pcr / pi ratio was lowest in the neuropathic group ( 0.60 1.02 ) ( p < 0.0001 ) . the results of the total p concentration are shown in fig . 1b . there were no differences between the control ( 28.7 5.4 ) and non - neuropathic groups ( 25.0 5.5 ) , but the neuropathic group had a lower concentration ( 6.0 10.5 ) ( p < 0.0001 ) . the lipid / water ratio was also similar in the control ( 0.18 0.11 ) and the non - neuropathic groups ( 0.27 0.17 ) and higher in the neuropathic group ( 1.56 0.52 ) ( p < 0.0001 ) ( fig . the pcr / pi was significantly higher in the control group ( c ) followed by the non - neuropathic group ( dm ) and was lowest in the neuropathic group ( pdn ) ( * vs. vs. : p < 0.0001 ) . the p concentration was similar in the control and the non - neuropathic group and lower in the neuropathic group ( * vs. : p < 0.0001 ) . the ratio was similar in the control and the non - neuropathic group and lower in the neuropathic group ( * vs. : p < 0.0001 ) . when all subjects were considered as one group , significant correlations were found between pcr / pi ratio and flow - mediated dilation ( fmd ) ( r = 0.51 , p < 0.0001 ) , neuropathy disability score ( nds ) ( r = 0.75 , p < 0.0001 ) , vibration perception threshold ( r = 0.72 , p < 0.0001 ) , semmes weinstein monofilaments ( r = 0.83 , p < 0.0001 ) , granulocyte colony stimulating factor ( r = 0.29 , p < 0.05 ) , platelet - derived growth factor aa ( r = 0.29 , p < 0.05 ) , tumor necrosis factor- ( r = 0.30 , p < 0.05 ) , se - selectin ( r = 0.35 , p < 0.01 ) , soluble intracellular adhesion molecule ( r = 0.36 , p < 0.01 ) , and soluble vascular cell adhesion molecule ( svcam ) ( r = 0.40 , p < 0.01 ) . borderline significances were found in the correlations between pcr / pi ratio and the skin blood flow at the dorsum of the foot ( r = 0.25 , p = 0.059 ) and vascular endothelial growth factor ( r = 0.26 , p = 0.054 ) . on stepwise multivariate analysis , nds , fmd , and se - selectin contributed 59 , 6 , and 5% , respectively , to the variation of the pcr / pi ratio . the total p concentration correlated with fmd ( r = 0.41 , p < 0.001 ) , nds ( r = 0.73 , p < 0.0001 ) , vibration perception threshold ( r = 0.68 , p < 0.0001 ) , semmes weinstein monofilaments ( r = 0.81 , p < 0.0001 ) , tumor necrosis factor- ( r = 0.30 , p < 0.05 ) , and soluble vascular cell adhesion molecule ( r = 0.38 , p < 0.05 ) . on stepwise multivariate analysis , nds , svcam , and fmd contributed 56 , 4 , and 2% , respectively , to the variation of the total p concentration . to exclude neuropathy as a confounding factor , we performed the same analysis as above in a separate group that included the control and non - neuropathic subjects but excluded the diabetic neuropathic patients . in this analysis , the pcr / pi ratio correlated with fmd ( r = 0.42 , p < 0.01 ) and vascular endothelial growth factor ( r = 0.35 , p < 0.05 ) . the total p concentration inversely correlated with the skin blood flow at the dorsum of the foot ( r = 0.39 , p < 0.01 ) and vascular endothelial growth factor ( r = 0.39 , p < 0.05 ) . seven diabetic patients ( three non - neuropathic and four neuropathic , four males , mean age 55 7 years ) had a second mri spectroscopy test after an average 23-month period from the first one . there was a significant decline in the pcr / pi ratio ( 0.18 0.18 , p < 0.05 ) but no difference in the total p concentration levels ( 1.1 2.32 , ns ) . the main findings of the present study are that there are significant differences in the muscle energy reserves among all three studied groups . thus , the pcr / pi ratio was highest in the control group , followed by the non - neuropathic group , and lowest in the neuropathic group . in addition , the total p concentration , an indication of the muscle volume , was decreased in the neuropathic group but was comparable in the control and non - neuropathic groups . similarly , the lipid / water ratio , an indication of muscle atrophy , was increased in the neuropathic group , whereas no differences existed between the control and non - neuropathic groups . finally , muscle changes were associated with changes in the nerve function , endothelial function of the large vessels , and serum cytokines . there are limited data available regarding the effects of diabetes and peripheral neuropathy on muscle energy reserves . previous studies have shown reduced energy reserves in diabetic patients at skeletal muscles during resting and exercise and the myocardium ( 811 ) . the results of the present study indicate that compared with healthy control subjects , there is a stepwise reduction in the foot muscle energy reserves in diabetic patients without peripheral neuropathy and a more severe reduction in diabetic patients with clinical neuropathy . the main reason for identifying this difference is the technology we used , which has a higher spatial resolution than previous methods , resulting in more accurate measurements . our findings also suggest that diabetes and the associated endothelial dysfunction and inflammation have an adverse effect on the foot muscle energy reserves even before the development of clinical neuropathy . however , the development of neuropathy has a much higher impact and leads to a considerable deterioration of these abnormalities . further studies will be required to examine the effect of diabetes in muscles that are not affected so severely by peripheral neuropathy , such as the forearm or leg muscles . in the present study , we have also examined the changes in mri spectroscopic measurements over a 23-month period on average . it is of interest that we noted a deterioration of the pcr / pi ratio but no changes in the total p concentration . these results indicate that functional changes can progress even in the absence of atrophy progression over a 23-month period . confirmation of these finding by future studies may lead to the use of these mri spectroscopic measurements as surrogate end points that will evaluate the effect of new therapeutic approaches on the muscle function of diabetic patients with or without peripheral neuropathy and/or ischemia .
a number of bioceramic mixtures have been evaluated in terms of their ability to promote cellular attachment and induction of osteogenic differentiation . there have been many reports of enhanced cellular bioactivity using biosilicates ( p2o5-na2o - cao - sio2),1 calcium - magnesium - silicate ceramics,2 calcium - silica ceramics,3 and bioactive glass ( ca - sr - na - zn - si).4 mesoporous silica particles are also being used for controlled release scaffolds,5 and many bioceramics include a silica component . silica is a ceramic material that has been successfully used for regeneration of bone and cartilage . it exists naturally in small quantities in a water - soluble form , but is most often found in an insoluble form.6 orthosilicic acid ( si[oh]4 ) , a soluble form of silicon , does not affect the synthesis of type i collagen for bone tissue regeneration , whereas an insoluble form , silica ( sio2 ) , enhances the synthesis of type i collagen and alkaline phosphate.7 silica - based ceramics are mechanically strong and suitable for bone regeneration.8 silicon nitride is resistant to bacterial infection during bone regeneration,9 and silicon increases the proliferation and osteogenic differentiation of osteoblast - like cells.10 in addition , silica - based bioglass ceramics and biosilicates enhance bone - like structure formation.1,2 a mixture of silicon and calcium,3,11 or mixtures with various other materials , including zinc and magnesium,12 improve both gene expression and biological performance . adult mesenchymal stem cells can be isolated from various tissues , including bone marrow , umbilical cord blood , cord matrix , and adipose tissues . recently , adipose tissue - derived stem cells ( adscs ) have been used in the tissue engineering field owing to their abundance and ease of separation.13,14 adscs have been used for tissue regeneration to induce osteogenic differentiation in cell therapy . adscs combined with an hydroxyapatite bioceramic scaffold can construct vascularized tissue - engineered bone.15 adscs strongly induce osteogenic differentiation when applied to multiple - combination , such as electromagnetic field , ultrasound , and cyclic strain.16 the extracellular signal - related kinase ( erk)1/2 signaling pathway is a mitogen - activated protein kinase ( mapk ) pathway that transduces signals from receptors and endocytosis at the cell surface.17,18 erk1/2 signaling is involved in biopolymer - induced proliferation and differentiation of stem cells . the erk1/2 and wnt signaling pathways are also involved in biomaterial - induced osteogenic differentiation.19 signaling by janus kinase ( jnk ) , a member of the mapk family , activates cell death from hypoxia / reoxygenation condition in cultured adscs.20,21 apoptosis of adscs driven by mir10b and mir23b expression occurs via the p38 signaling pathway.22 most studies have evaluated bioceramic materials containing multiple components with silica . no evidence regarding silica alone as a biomaterial component is available . given that mixtures of ceramic compounds are used to construct bioscaffolds , interference in the components of the mixture may occur , and their effects on the cellular response could differ . when chemically synthesized silica is suspended in culture medium , it contains differently sized particles . it is unclear whether particle size affects the effect of silica on human adscs ( hadscs ) . therefore , in this study , we examined whether single - component silica containing different sized silica particles , ie , nanoparticles ( nps ) or microparticles ( mps ) , has a differential effect on proliferation and mapk signaling in hadscs . hadscs were isolated and cultured as described previously.23 informed consent was obtained from patients in accordance with the requirements of the institutional review board at seoul st mary s hospital , republic of korea ( kc11t - nms0095 ) . raw lipoaspirates from patients were washed thoroughly with sterile phosphate - buffered saline ( life technologies , carlsbad , ca , usa ) , minced , and then digested with 0.1% type i collagenase ( sigma - aldrich , st louis , mo , usa ) in phosphate - buffered saline for 30 minutes at 37c in a 5% co2 atmosphere with gentle agitation . the collagenase was inactivated with an equal volume of culture medium containing 10% fetal bovine serum ( wisent inc , st bruno , qc , canada ) . cells were harvested by centrifugation at 250 g for 5 minutes and filtered through 100 m mesh to remove debris . the cells were plated onto conventional culture plates in dulbecco s modified eagle s medium ( dmem , life technologies ) containing 10% fetal bovine serum and 1% antibiotic / antimycotic ( life technologies ) at 37c in a humidified atmosphere containing 5% co2 . silica gel was prepared via a chemical neutralization reaction by mixing hydrochloric acid with a solution of reagent grade sodium silicate ( sio2 26.5% , na2o 10.6% , and h2o 62.9% , sigma aldrich ; figure 1a and b ) . silica gel of 6 g synthesized from the sodium silicate solution of 23 g according to the law of conservation of mass . after thorough washing with phosphate - buffered saline and sterilization , the gel was added to 100 ml of dmem for 48 hours . the gel - containing medium was filtered through a 0.22 m filter ( thermo , waltham , ma , usa ) . silica mps purchased from ditto technology ( anyang city , korea ) were suspended same concentration of silica np medium in dmem ( silica mp medium ) . the particle concentration in each type of medium was measured using an inductively coupled plasma optical emission spectrometer ( varian 710-es , varian , melbourne , australia ) . the size of the silica nps was determined by transmission electron microscopy ( jem1010 , jeol ltd , tokyo , japan ) . basic fibroblast growth factor ( sigma - aldrich ) was used as a positive control . to evaluate cell proliferation and apoptosis , total dna content was measured using the cyquant cell proliferation assay kit ( life technologies ) , according to the manufacturer s protocol . cells were cultured in a 96-well plate at 37c in a 5% co2 atmosphere for 1 , 3 , and 5 days at a density of 3,000 cells / well with dmem ( with 1% fetal bovine serum ) containing silica nps and mps , and then washed with phosphate - buffered saline to remove nonadherent cells . cells were mixed in lysis buffer for an hour and cyquant gr dye was mixed with lysis buffer in a 96-well plate , which was then incubated for 10 minutes . fluorescent signals were detected with excitation at 480 nm and emission at 520 nm using a spectrofluorometer ( gemini , spectromax , sunnyvale , ca , usa ) . cells were cultured in a 12-well plate at a density of 30,000 cells / well for confluency . they were then treated with 1 phosphate - buffered saline and transferred to a fluorescence - activated cell sorting tube with phosphate - buffered saline at a concentration of 25,000 cells / ml and centrifuged at 1,000 g. the cells were stained with annexin v and propidium iodide ( biobud inc , seoul , korea ) according to the manufacturer s protocol . the cells were mixed with 500 l of 1 binding buffer and incubated with 1.25 l of annexin v in the dark for 15 minutes . after treatment , the cells were collected , mixed with 500 l of 1 binding buffer and 10 l of propidium iodide , and analyzed immediately by flow cytometry ( bd facscalibur , bd biosciences , san jose , ca , usa ) . cells were cultured in a six - well plate at 37c in a 5% co2 atmosphere for 3 days at a density of 70,000 cells / well . cultured cells with nps or mps were incubated for 7 days at 37c in a 5% co2 atmosphere . culture medium was removed and dapi reagent ( vector laboratories inc , burlingame , ca , usa ) was added . the stained cells were observed using a fluorescence microscope ( axiovert200 , carl zeiss , oberkochen , germany ) . cultured cells were washed twice with ice - cold phosphate - buffered saline , and 100 l of t - per protein extraction reagent ( thermo scientific , rockford , il , usa ) was added to the culture dish . after scraping , the contents of the dish were transferred to a 1.5 ml tube and shaken at 4c for a minute . the samples were centrifuged for 15 minutes at 4c and 11,000 g. the supernatant was transferred to a 1.5 ml flash tube . quantitative analysis was performed using the bradford assay ( bio - rad , hercules , ca , usa ) . for western blotting , equal amounts of protein ( 15 g ) were electrophoresed in 10% sodium dodecyl sulfate - acrylamide gels . the proteins were transferred from the gel to a 0.45 m nitrocellulose transfer membrane ( whatman gmbh , dassel , germany ) using an electrical transfer system . nonspecific binding was blocked with 5% skim milk ( bd biosciences ) in tbst buffer ( 5 mm tris - hcl [ ph 7.6 ] , 136 mm nacl , 0.1% tween 20 ) for an hour . the blots were then incubated with the appropriate primary antibody ( dilution 1:1,000 ) for 24 hours at 4c , after which they were washed three times with 1 tbst . next , the blots were incubated for 2 hours at room temperature with a secondary antibody ( 1:5,000 ) . the blots were washed three times with 1 tbst and developed using electrochemiluminescence western detection reagents ( ge healthcare , little chalfont , uk ) . blots were analyzed using a luminescent image analysis instrument ( fuji photofilm , tokyo , japan ) . the primary antibodies used were specific for erk1/2 ( cell signaling technology inc , danvers , ma , usa ) , p - erk1/2 ( cell signaling ) , jnk ( cell signaling ) , p - jnk ( cell signaling ) , p38 ( cell signaling ) , p - p38 ( cell signaling ) , and actin ( sigma - aldrich ) . the secondary antibodies were anti - rabbit and anti - mouse immunoglobulin g - horseradish peroxidase conjugates ( both from santa cruz biotechnology inc , santa cruz , ca , usa ) . cells were grown to 70% confluency , after which the medium was replaced with fetal bovine serum - free dmem . after 24 hours , the cells were treated with pd98059 ( 40 m ; cell signaling technology inc ) for 30 minutes , followed by incubation for 10 minutes with dmem containing silica nps or mps . the negative control group was not treated with silica - containing medium , and the positive control group was treated with basic fibroblast growth factor . hadscs were isolated and cultured as described previously.23 informed consent was obtained from patients in accordance with the requirements of the institutional review board at seoul st mary s hospital , republic of korea ( kc11t - nms0095 ) . raw lipoaspirates from patients were washed thoroughly with sterile phosphate - buffered saline ( life technologies , carlsbad , ca , usa ) , minced , and then digested with 0.1% type i collagenase ( sigma - aldrich , st louis , mo , usa ) in phosphate - buffered saline for 30 minutes at 37c in a 5% co2 atmosphere with gentle agitation . the collagenase was inactivated with an equal volume of culture medium containing 10% fetal bovine serum ( wisent inc , st bruno , qc , canada ) . cells were harvested by centrifugation at 250 g for 5 minutes and filtered through 100 m mesh to remove debris . the cells were plated onto conventional culture plates in dulbecco s modified eagle s medium ( dmem , life technologies ) containing 10% fetal bovine serum and 1% antibiotic / antimycotic ( life technologies ) at 37c in a humidified atmosphere containing 5% co2 . silica gel was prepared via a chemical neutralization reaction by mixing hydrochloric acid with a solution of reagent grade sodium silicate ( sio2 26.5% , na2o 10.6% , and h2o 62.9% , sigma aldrich ; figure 1a and b ) . silica gel of 6 g synthesized from the sodium silicate solution of 23 g according to the law of conservation of mass . after thorough washing with phosphate - buffered saline and sterilization , the gel was added to 100 ml of dmem for 48 hours . the gel - containing medium was filtered through a 0.22 m filter ( thermo , waltham , ma , usa ) . silica mps purchased from ditto technology ( anyang city , korea ) were suspended same concentration of silica np medium in dmem ( silica mp medium ) . the particle concentration in each type of medium was measured using an inductively coupled plasma optical emission spectrometer ( varian 710-es , varian , melbourne , australia ) . the size of the silica nps was determined by transmission electron microscopy ( jem1010 , jeol ltd , tokyo , japan ) . basic fibroblast growth factor ( sigma - aldrich ) was used as a positive control . to evaluate cell proliferation and apoptosis , total dna content was measured using the cyquant cell proliferation assay kit ( life technologies ) , according to the manufacturer s protocol . cells were cultured in a 96-well plate at 37c in a 5% co2 atmosphere for 1 , 3 , and 5 days at a density of 3,000 cells / well with dmem ( with 1% fetal bovine serum ) containing silica nps and mps , and then washed with phosphate - buffered saline to remove nonadherent cells . cells were mixed in lysis buffer for an hour and cyquant gr dye was mixed with lysis buffer in a 96-well plate , which was then incubated for 10 minutes . fluorescent signals were detected with excitation at 480 nm and emission at 520 nm using a spectrofluorometer ( gemini , spectromax , sunnyvale , ca , usa ) . cells were cultured in a 12-well plate at a density of 30,000 cells / well for confluency . they were then treated with 1 phosphate - buffered saline and transferred to a fluorescence - activated cell sorting tube with phosphate - buffered saline at a concentration of 25,000 cells / ml and centrifuged at 1,000 g. the cells were stained with annexin v and propidium iodide ( biobud inc , seoul , korea ) according to the manufacturer s protocol . the cells were mixed with 500 l of 1 binding buffer and incubated with 1.25 l of annexin v in the dark for 15 minutes . after treatment , the cells were collected , mixed with 500 l of 1 binding buffer and 10 l of propidium iodide , and analyzed immediately by flow cytometry ( bd facscalibur , bd biosciences , san jose , ca , usa ) . cells were cultured in a six - well plate at 37c in a 5% co2 atmosphere for 3 days at a density of 70,000 cells / well . cultured cells with nps or mps were incubated for 7 days at 37c in a 5% co2 atmosphere . culture medium was removed and dapi reagent ( vector laboratories inc , burlingame , ca , usa ) was added . the stained cells were observed using a fluorescence microscope ( axiovert200 , carl zeiss , oberkochen , germany ) . cultured cells were washed twice with ice - cold phosphate - buffered saline , and 100 l of t - per protein extraction reagent ( thermo scientific , rockford , il , usa ) was added to the culture dish . after scraping , the contents of the dish were transferred to a 1.5 ml tube and shaken at 4c for a minute . the samples were centrifuged for 15 minutes at 4c and 11,000 g. the supernatant was transferred to a 1.5 ml flash tube . quantitative analysis was performed using the bradford assay ( bio - rad , hercules , ca , usa ) . for western blotting , equal amounts of protein ( 15 g ) were electrophoresed in 10% sodium dodecyl sulfate - acrylamide gels . the proteins were transferred from the gel to a 0.45 m nitrocellulose transfer membrane ( whatman gmbh , dassel , germany ) using an electrical transfer system . nonspecific binding was blocked with 5% skim milk ( bd biosciences ) in tbst buffer ( 5 mm tris - hcl [ ph 7.6 ] , 136 mm nacl , 0.1% tween 20 ) for an hour . the blots were then incubated with the appropriate primary antibody ( dilution 1:1,000 ) for 24 hours at 4c , after which they were washed three times with 1 tbst . next , the blots were incubated for 2 hours at room temperature with a secondary antibody ( 1:5,000 ) . the blots were washed three times with 1 tbst and developed using electrochemiluminescence western detection reagents ( ge healthcare , little chalfont , uk ) . blots were analyzed using a luminescent image analysis instrument ( fuji photofilm , tokyo , japan ) . the primary antibodies used were specific for erk1/2 ( cell signaling technology inc , danvers , ma , usa ) , p - erk1/2 ( cell signaling ) , jnk ( cell signaling ) , p - jnk ( cell signaling ) , p38 ( cell signaling ) , p - p38 ( cell signaling ) , and actin ( sigma - aldrich ) . the secondary antibodies were anti - rabbit and anti - mouse immunoglobulin g - horseradish peroxidase conjugates ( both from santa cruz biotechnology inc , santa cruz , ca , usa ) . cells were grown to 70% confluency , after which the medium was replaced with fetal bovine serum - free dmem . after 24 hours , the cells were treated with pd98059 ( 40 m ; cell signaling technology inc ) for 30 minutes , followed by incubation for 10 minutes with dmem containing silica nps or mps . the negative control group was not treated with silica - containing medium , and the positive control group was treated with basic fibroblast growth factor . silica ( 99.8% purity ) was prepared as reported previously ( figure s1a ) and was synthesized in a dose - dependent manner form the ratio of sodium silicate reagent ( figure s1b ) . the silica was then incubated in serum - free dmem at 37c for 48 hours and filtered through 0.22 m mesh to obtain the silica np fraction ( figure 1a and b ) . when we examined each type of medium by transmission electron microscopy , 89% of particles in the silica np medium were around 50120 nm in size ( figure 2a ) . figure s2a and b show the respective size distributions for the silica nps and mps . when hadscs were incubated with each type of silica particle - containing medium for 24 hours , treatment of silica mps showed no visible particles inside the cells like untreated cells ( figure 2c and d ) , whereas silica nps entered the cytosol of cells ( figure 2e and f ; figure s3a and b ) . we therefore concluded that only silica nps entered the cytosol , and in part through endocytosis . since silica composites are known to promote proliferation of mesenchymal stem cells , we tested whether differentially sized particles containing a single component , ie , silica , affect proliferation of mesenchymal stem cells . after incubation with the particles for one , 3 , and 5 days , hadscs underwent quantification of their dna content using the cyquant cell proliferation assay kit ( figure 3a ) . the same amount of silicon was used in each culture to compare the cellular activity of the particles . silica nps increased cell proliferation significantly , but silica mps showed no stimulation of cell proliferation , even at day 5 . analysis of apoptotic cells by annexin v staining confirmed that hadscs exposed to silica mps undergo apoptosis ( 6.49% ) in a 1% serum medium , albeit at a low degree . in contrast , silica nps had no effect on apoptosis ( 0.16% ; figure 3b ) . dna fragmentation , detected by dapi staining , was observed only in silica mp - treated cells and not in silica np - treated cells ( figure 3c ) . thus , we concluded that silica nps stimulated proliferation of adscs , whereas silica mps induced apoptosis , albeit at a very low level . after adscs were exposed to silica np or mp medium for 10 to 60 minutes , we measured the phosphorylation levels of erk1/2 , p38 , and jnk ( figure 4a ) . as shown in figure 4b , the silica np medium markedly increased the phosphorylation of erk1/2 after 10 minutes , and phosphorylation decreased gradually thereafter . the silica np medium did not significantly affect p38 phosphorylation , but the silica mp medium showed increased levels of the phosphorylated form of p38 ( figure 4c ) . however , there was no change in phosphorylation of jnk in either the silica np or mp medium ( figure s4b ) . to confirm the involvement of the erk signaling pathway pd98059 indeed abolished phosphorylation of erk1/2 in both basic fibroblast growth factor - treated and silica np - treated cells . silica ( 99.8% purity ) was prepared as reported previously ( figure s1a ) and was synthesized in a dose - dependent manner form the ratio of sodium silicate reagent ( figure s1b ) . the silica was then incubated in serum - free dmem at 37c for 48 hours and filtered through 0.22 m mesh to obtain the silica np fraction ( figure 1a and b ) . when we examined each type of medium by transmission electron microscopy , 89% of particles in the silica np medium were around 50120 nm in size ( figure 2a ) . figure s2a and b show the respective size distributions for the silica nps and mps . when hadscs were incubated with each type of silica particle - containing medium for 24 hours , treatment of silica mps showed no visible particles inside the cells like untreated cells ( figure 2c and d ) , whereas silica nps entered the cytosol of cells ( figure 2e and f ; figure s3a and b ) . we therefore concluded that only silica nps entered the cytosol , and in part through endocytosis . since silica composites are known to promote proliferation of mesenchymal stem cells , we tested whether differentially sized particles containing a single component , ie , silica , affect proliferation of mesenchymal stem cells . after incubation with the particles for one , 3 , and 5 days , hadscs underwent quantification of their dna content using the cyquant cell proliferation assay kit ( figure 3a ) . the same amount of silicon was used in each culture to compare the cellular activity of the particles . silica nps increased cell proliferation significantly , but silica mps showed no stimulation of cell proliferation , even at day 5 . analysis of apoptotic cells by annexin v staining confirmed that hadscs exposed to silica mps undergo apoptosis ( 6.49% ) in a 1% serum medium , albeit at a low degree . in contrast , silica nps had no effect on apoptosis ( 0.16% ; figure 3b ) . dna fragmentation , detected by dapi staining , was observed only in silica mp - treated cells and not in silica np - treated cells ( figure 3c ) . thus , we concluded that silica nps stimulated proliferation of adscs , whereas silica mps induced apoptosis , albeit at a very low level . we examined whether differently sized silica particles affected mapk signaling . after adscs were exposed to silica np or mp medium for 10 to 60 minutes , we measured the phosphorylation levels of erk1/2 , p38 , and jnk ( figure 4a ) . as shown in figure 4b , the silica np medium markedly increased the phosphorylation of erk1/2 after 10 minutes , and phosphorylation decreased gradually thereafter . the silica np medium did not significantly affect p38 phosphorylation , but the silica mp medium showed increased levels of the phosphorylated form of p38 ( figure 4c ) . however , there was no change in phosphorylation of jnk in either the silica np or mp medium ( figure s4b ) . to confirm the involvement of the erk signaling pathway pd98059 indeed abolished phosphorylation of erk1/2 in both basic fibroblast growth factor - treated and silica np - treated cells . many studies have shown that silica - based scaffolds and silica - coated plates induce cell proliferation , attachment , and biocompatibility.2427 in previous reports , silicon has been shown to be released into culture medium and to induce cell proliferation.28,29 interestingly , we found that silica nps ( around 50120 nm in size ) have effects on mapk signaling and cell proliferation that were different from those of silica mps ( around 24 m in size ) . consistent with our observations , ceramic nps have been reported to stimulate cell growth to a greater extent than mps.30 protein adsorption is also enhanced on nanostructured silicon,31 and nano - features increase the formation and adhesive strength of fibroblast cells.32 silica - based scaffolds33 and coated plates34 have hydrophilic properties . when we examined the interaction of silica - np or silica - mp with adscs , only silica nps entered the cells and some were clustered in the vesicles , suggesting that silica nps enter the cells in part through endocytosis . of note , no particles additionally , figure s3 shows endocytosis of silica - nps that have been entering into the cytosol of cell . this finding indicates that silica nps in vesicles and the cytosol may affect signaling pathways.17,18 in contrast , silica mps were not transferred to the cytosol ( figure 2d ) , suggesting that their particle size might have impeded access . interestingly , we found that silica nps increased growth of hadscs , whereas silica mps induced apoptosis ( figure 3 ) . therefore , it is possible that endocytosis of silica nps accelerates cell growth whereas cell membrane stress caused by silica mps induces apoptosis.35 to further address the mechanism of action of these differentially sized particles , we examined the effects of silica nps and mps on the mapk pathway ( figure 4a ) . involvement of erk1/2 signaling in cell growth has been reported previously.36 exposure of cells to silica np medium initially resulted in potent activation of erk1/2 signaling , followed by a return to basal levels ( figure 4b ) . although the results of this experiment can not be directly introducing exocytosis but cell metabolism was circulated according to endocytosis and exocytosis.37 silica nps had no effect on phosphorylation of jnk ( figure s4b ) , which is involved in apoptosis and inflammation.38,39 the p38 signaling pathway is related to cell stress and apoptosis.36,39 consistent with previous reports , the p38 signaling pathway was not affected significantly by silica nps , whereas silica mps increased p38 phosphorylation levels ( figure 4c ) . we confirmed the effect of silica nps on erk signaling by inhibiting mek , an upregulator of erk signaling . the proliferation - related mek - erk1/2 signaling pathway is suppressed by pd98059 via mek signaling inhibition,40 while phosphorylation of jnk and p38 signaling are unaffected.38 our results showed that pd98059 dose - dependently decreased phosphorylation of erk in the silica np medium ( figure s4a ) . thus , the data indicate that pd98059 inhibits mek - erk1/2 signaling driven by silica nps . consistent with the proliferation effect of silica nps , pd98059 also suppressed the proliferation of hadscs stimulated by silica nps ( figure 4e ) . together , the results indicate that silica nps induce cell proliferation by activating the erk1/2 signaling pathway ( figure 5 ) . attenuation and stabilization of growth factor signaling by endocytic control has been shown.18 it is still unclear whether endocytosis of silica nps affects activation of erk . in future , we will evaluate the signaling pathways involved in the multidifferentiation potency of hadscs containing silica - np and mp products . our results confirm that silica nps enter the cytosol through the cell membrane by endocytosis , and silica nps have accelerated cell growth . these data suggest that a silica np size in the range of 50120 nm is more effective in promoting stem cell growth by stimulating the erk signaling pathway and that silica mps induce apoptosis . . we will identify to the relevance of silica mps and apoptosis as a future study . therefore , selection of silica particle size is important when producing a scaffold used in tissue engineering and cell therapy . notes : ( a ) purity ( 99.81% ) of prepared silica gel was determined by x - ray fluorescence analysis . ( b ) standard curve indicates that the amount of silicon is proportional to the amount of sodium silicate that was reacted with hydrochloric acid . notes : ( a ) silica np distribution according to size , ie , < 50 nm ( 1.6% ) , 5080 nm ( 21% ) , 80120 nm ( 68% ) , and 120150 nm ( 8.9% ) . ( b ) silica mp distribution according to size , ie , < 2 m ( 5% ) , 24 m ( 78% ) , and > 4 m ( 17% ) ( * p<0.01 ) . notes : ( a ) and ( b ) show cell membrane that vesicles entered to cytosol by endocytosis and triangle arrow indicates endocytosis of nanoparticles . notes : ( a ) phosphorylation of erk induced by silica nps is inhibited by pd98059 in a dose - dependent manner . ( b ) quantitative analysis of jnk phosphorylation level of adscs by densitometric analysis according to silica nps and silica mps . reproduced with permission from kim kj , jeon yj , lee jh , et al . the effect of silicon ion on proliferation and osteogenic differentiation of human adscs . korea tissue engineering and regenerative medicine . 2010;7(2):171177.1 abbreviations : nps , nanoparticles ; mps , microparticles ; erk , extracellular signal - related kinase ; jnk , jun amino - terminal kinases ; pd98059 , mek - erk inhibitor .
we studied the results of six patients operated on by the national university hospital ( nuh ) diabetic foot team in singapore between october 2011 and january 2012 . there were four malays , one indian , and one chinese ranging in age 4767 , the average being 54 years old . the diabetic foot infections were abscesses ( two cases ) , wet gangrene ( three cases ) , and necrotizing fasciitis of the foot ( one case ) . all infections did not extend beyond the midfoot level to allow for adequate management of the infection during the surgery . clinical evaluation included the examination for presence or absence of palpable posterior tibial and dorsalis pedis pulses along with abi . preoperative blood tests performed included glycated hemoglobin ( hba1c ) , hemoglobin ( hb ) , total white cell count ( wbc ) , c - reactive protein ( crp ) , erythrocyte sedimentation rate ( esr ) , albumin , and creatinine ( cr ) levels . a total of 14 sessions of hyperbaric oxygen therapy postoperatively was also administered for all patients . the patient is positioned supine on a radiolucent operating table . a well - padded pneumatic thigh tourniquet is then applied and the ipsilateral buttock is raised slightly with a sandbag to ensure the foot is in neutral position . the malleoli , sustenaculum tali , and posterior tibial artery are palpated and the incision is marked ( fig . the anterior flap runs from one - finger breadth below the distal tip of the medial malleolus ( fig . 1a , point a ) over the anterior aspect of the ankle to the tip of the lateral malleolus ( fig . 1b , point b ) . the posterior flap runs vertically downwards from the distal tip of the medial malleolus to the sole of the foot to the lateral border of the foot . the vessels ( saphenous vein and dorsalis pedis artery ) are ligated and divided while the extensor and peroneal tendons are transected along the line of incision . the anterior capsule is incised to expose the articular surfaces of the tibia and talus . the deltoid ligament of the ankle is sectioned on the medial side , with care to preserve the posterior tibial artery , and the talus is then excised and removed . the anterior talar articular surface , middle talar articular surface , and posterior talar articular surface of the calcaneum are then exposed . the distal part of the foot containing the cuboid is then excised by leaving the calcaneum in the plantar flap ( fig . a vertical osteotomy is performed on the calcaneum just behind the anterior talar articular surface . the distal one quarter of the calcaneum is then osteotomized ( figs . 2 and 3a ) with the line of osteotomy ( point c to d ) being perpendicular to the calcaneum ( fig . an oblique osteotomy is then performed from point d to e at the posterior border of the upper end of the calcaneum ( fig . ( a ) lateral view of the foot showing the two lines of osteotomy ( cd and de ) at the calcaneum . ( b ) diagram showing the line of tibial osteotomy ( fg ) and the bones removed ( shaded ) in a modified pirogoff 's amputation . using an oscillating saw , the line of osteotomy ( line fg ) is perpendicular to the tibia ( fig . the medial malleolus ( point f ) and the lower part of the fibula ( point g ) are osteotomized along the line of the tibial osteotomy ( fig . two 7.0-mm partially threaded cannulated screws are then inserted over the kirschner wires . to achieve compression , the screws are tightened , and their positions are confirmed to be satisfactory via intra - operative fluoroscopy ( fig . the anterior and posterior flaps are opposed with one single layer of 30 prolene sutures , and tulle gras dressing is applied over the wound . gauze and cotton wool is then used to wrap the lower extremity stump before a crepe bandage is applied in a figure - of - eight fashion followed by a stockinette . postoperatively , once the wound is healed , the lower extremity stump is fitted with a prosthesis at 2 months . patients are then allowed to ambulate in full weight - bearing status by using the prosthesis . in our study , all patients were able to walk with the prosthesis in 3 months postoperatively . ( a ) lateral and anteroposterior radiographic views of immediate postoperative modified pirogoff 's amputation showing compression of the tibio - calcaneal surfaces by two partially threaded cannulated screws . ( b ) lateral and anteroposterior radiographic views of a pirogoff 's amputation showing the presence of initial union at the tibio - calcaneal arthrodesis at 3 months postoperatively . ( c ) lateral and anteroposterior radiographic views of a pirogoff 's amputation showing the presence of significant union at the tibio - calcaneal arthrodesis at 6 months postoperatively . table 1 shows the patient 's characteristics , whereas table 2 shows the clinical parameters documented . all of the studied patients had palpable posterior tibial and dorsalis pedis pulses except one patient ( case 2 ) who had a palpable posterior tibial pulse but absent dorsalis pedis pulse . case 4 was initially an abscess of the toe , and cases 5 and 6 were initially presented with wet gangrene of the toes . the above cases further progressed to the associated rays , and the infection was spreading towards the midfoot by the time of surgery while there was no viable flap coverage possible for more distal operations , such as a transmetatarsal or chopart 's amputation . the pirogoff 's amputation was hence performed for adequate management of the infection with resultant viable local flap coverage . patient characteristics clinical vascular examination all patients had received intravenous broad - spectrum antibiotic coverage from time of diagnosis to the time prior to surgery . intravenous antibiotic coverage was then continued for another 5 days after surgery before converting to appropriate oral antibiotics for a total of 2 weeks in duration depending on sensitivity results of available intra - operative cultures . all patients completed 14 sessions of hyperbaric oxygen therapy sessions and were followed up for a period of 10 months . all cases achieved bony fusion confirmed with plain radiographs at 6 months postoperatively ( fig . prostheses were fitted at 3 months postoperatively , and patients were able to ambulate in full weight - bearing status with the prosthesis . this study has shown that the modified pirogoff 's amputation can achieve good results , even when used for surgery in the management of diabetic foot complications . in our study , patient selection criteria included the presence of a palpable posterior tibial pulse and an abi of more than 0.7 . pinzur et al . in 2003 have emphasized the importance of wound healing parameters , which included an abi of more than 0.5 ( 4 ) . in addition a hb level of more than 10 g / dl and serum albumin level of more than 30 g / l was also recorded in our patient population because the importance of serum albumin of more than 2.5 g / dl was also emphasized by pinzur et al . in 2003 the authors have also utilized hyperbaric oxygen therapy to improve wound healing in all of the patients postoperatively . there is increasingly strong evidence that hyperbaric oxygen therapy can significantly improve the healing of diabetic wounds in the short term ( 12 , 13 ) and the authors used this modality as an adjunctive therapy to improve wound healing in the postoperative period . one of the most important aims of early surgical intervention for diabetic foot infections is to prevent major amputation and limb loss . when the modified pirogoffs amputation is successfully performed , its various advantages include a weight - bearing stump , minimal limb length discrepancy , and easier fitting of prosthesis when compared to that of syme 's amputation ( 14 ) . the modified pirogoff 's amputation is a viable option as a distal hindfoot or minor amputation for the diabetic foot , as classified by nather and wong in order to prevent limb loss in patients with diabetic foot problems ( 14 ) . limitations of this study include a lack of comparison of results with and without hyperbaric oxygen therapy , and lack of comparison of the modified pirogoff 's amputation versus other surgical amputation modalities . future progress in this field should include a prospective trial comparing the modified pirogoff 's operation versus other surgical modalities and an evaluation of the efficacy of hyperbaric oxygen therapy in diabetic patients undergoing an amputation . the modified pirogoff 's amputation has shown good results in carefully selected patients with diabetic foot infections . the selection criteria included a palpable posterior tibial pulse , distal infections not extending proximally beyond the midfoot level , abi of more than 0.7 , hb level of more than 10 g / dl , and a serum albumin level of more than 30 the authors declare that they have no conflict of interest and have not received any funding or benefits from industry to conduct this study .
acute coronary syndrome is rare in patients with hemophilia , potentially due to shorter lifespan or perhaps because of coagulation factor viii abnormality.1 ) hemophilia a directly protects against the development of coronary artery disease . 2)3 ) however , patients with hemophilia might not be protected against atherosclerosis , as demonstrated by clinical studies4 ) and autopsy reports on hemophiliacs with fatal myocardial infarction showing extensive atherosclerotic lesions , but only rarely fresh thrombi.5 ) girolami et al.5 ) studied 36 cases of acute coronary syndrome in patients with hemophilia a. in most cases , the event occurred during or after the infusion of recombinant factor viii concentrates , desmopressin ( ddavp ) , and prothrombin complex concentrates . the treatment of choice in patients with acute coronary syndrome is primary coronary angioplasty with stent implantation , although invasive treatment carries the risk of hemorrhagic adverse events . we report a case of hemophilia a with acute coronary syndrome , not precipitated by anticoagulation therapy , who was successfully treated by percutaneous transluminal coronary angioplasty with stent implantation . a 52-year - old male patient presented to the emergency department with intermittent chest pain at rest . the patient had no cardiovascular risk factors except for a 20 pack - year history of smoking . the patient reported that he had received coagulation factor viii on occasion because of bleeding into the knee joints . physical examination revealed a body temperature of 36.6 , blood pressure 110/70 mmhg , pulse rate 70/minute , and respiration rate 20/minute . the electrocardiogram ( ecg ) showed t - wave inversions in precordial leads v1 to v6 and slight elevation of the st segment in precordial leads v1 and v2 . the mb fraction of creatine kinase was 2.1 ng/ ml ( normal , < 5.0 ng / ml ) and troponin - i was 0.194 ng / ml ( normal , < 0.5 ng / ml ) . factor viii activity was less than 1% ( normal , 60 - 140% ) and factor viii inhibitor antibodies were 0.26 ( normal , < 0.01 ) . echocardiography showed regional wall motion abnormalities at the anterior and septal wall of the apex and preserved left ventricular systolic function with a 51.8% ejection fraction . chest pain decreased during infusion of isosorbide dinitrate , and the patient was admitted to the coronary care unit . after admission , a coronary ct scan was performed and showed significant narrowing in the proximal left anterior descending artery ( lad ) . therefore , the patient was prepared for coronary angiography ( cag ) and angioplasty . following the advice of a hematologist , the patient received 2,500 iu of monoclonal coagulation factor viii ( greenmono , baxter , deerfield , il , usa ) prior to the procedure in addition to 1,500 iu of factor viii at 12 , 24 , and 48 hours after the procedure . the patient received 70 iu / kg of unfractionated heparin and a loading dose of clopidogrel ( 300 mg ) . cag revealed an 80% stenosis of the proximal segment and 40% in the mid segment of the lad , some non - stenotic changes in the left circumflex , and a diminished right coronary artery ( fig . balloon angioplasty was performed at the proximal lad . however , the outcome was suboptimal and a cobalt - chromium coronary stent 3.518 mm ( vision , abbott inc , santa clara , ca , usa ) was implanted ( fig . 1b ) . to stop bleeding at the puncture site , we compressed the site manually for about 30 minutes . the patient was discharged on aspirin 100 mg / d and clopidogrel 75 mg / d for 1 month , followed by long - term aspirin therapy 100 mg / d and regular coagulation factor viii supplements . ten months after the initial procedure , the patient was admitted to perform a follow - up cag for evaluation of the patency of the implanted stent . the patient had taken aspirin , an angiotensin receptor blocker , nicorandil , and a calcium channel blocker , and also had received regular coagulation factor viii supplements . the echocardiography showed a normal ejection fraction ( 63.8% ) without regional wall motion abnormalities . however , the cag revealed 50% tubular concentric luminal narrowing of the proximal segment of the lad stent ( fig . the diagnosis of severe hemophilia in a patient with acute coronary syndrome should not delay invasive procedures and optimal medical therapy . anti - thrombotic treatment , particularly with percutaneous coronary intervention ( pci ) and stent implantation , poses a therapeutic dilemma in patients with impaired coagulation . pci requires the use of anticoagulants in patients with hemophilia , which can increase the risk of local complications . substituting the missing coagulation factor can reduce the bleeding risk during the procedure , even though it may increase the risk of acute thrombosis in a patient with unstable atherosclerotic plaques . according to the world federation of hemophilia recommendations , patients with hemophilia a that are going to undergo major surgery should be supplemented with factor viii before the procedure to achieve the level of 80 - 100% of factor viii activity . however , there is no similar protocol for coagulation supplementation prior to pci . anticoagulation therapy is important to avoid thrombosis both from procedure - related complications and from further progression of coronary luminal narrowing ; heparin is usually titrated to an optimal activated clotting time.6 ) bivalirudin does not require monitoring and has a low rate of bleeding complications because it inhibits circulating and clot - bound thrombin directly , unlike heparin.7)8 ) antiplatelet therapies are as important as anticoagulation therapy for the prevention of acute thrombosis in an implanted stent;9 ) hemophilia is not associated with abnormalities of platelet number or platelet function . current guidelines recommend dual antiplatelet therapy with aspirin and clopidogrel for at least 1 month for bare - metal stents and for at least 1 year for drug - eluting stents.10 ) however , antiplatelet therapy can increase the hemorrhagic tendency in these patients . even with disturbed coagulation , antiplatelet therapy is important for hemophiliacs with pci to prevent stent thrombosis . bovenzi et al.11 ) reported a case of acute stent thrombosis in a patient with hemophilia b after coronary stent implantation who was not treated with aspirin or clopidogrel . in our case aspirin as secondary prophylaxis against ischemic coronary events has been reported in patients with mild and moderate hemophilia.12 ) here , long - term aspirin did not increase the incidence of hemorrhagic events , probably due to regular substitution of coagulation factor viii . when long - term aspirin is needed in patients with severe hemophilia , ferrario et al.13 ) there are no reports on the use of drug - eluting stent implantation in patients with hemophilia ; however , with concerns about bleeding diathesis , bare - metal stents are regarded as safe . in conclusion , a pci in a patient with severe hemophilia and acute coronary syndrome has acceptable complication risks . antiplatelet therapy is important for preventing thrombus formation in the implanted stent even in patients with abnormal coagulation .
central nervous system toxoplasmosis is a common opportunistic infection in immunocompromised patients especially in human immunodeficiency virus ( hiv ) positive patients . involvement of spinal cord due to toxoplasmosis presenting as myelopathy is rarely seen in this era of antiretroviral therapy . vacuolar myelopathy , an underrecognized entity is the most common cause of spinal cord disease in hiv patients . however , other infectious causes can present as myelopathy especially in severely immunocompromised patients . hence detail neurological examinations , serological studies and relevant imaging studies , we report a rare case of toxoplasmic myelitis in immunocompromised patient presenting as acute onset paraparesis associated with bladder dysfunctions . physician should keep in mind this rare entity while treating hiv patients presenting as myelopathy . a 40-year - male patient admitted with the complaint of progressive weakness in both lower limbs since last 2 months . the weakness was associated with decrease sensations over both lower limbs below the umbilicus and bladder involvement in the form of retension of urine that required catheterization . patient denied any history of fever , chronic diarrhea , weight loss , cough , trauma to back or any chronic illness in the past . patient was recently diagnosed to be hiv positive at the local hospital 10 days back . he was not receiving any retroviral therapy or prophylaxis for opportunistic infections at the time of hospitalization . he did not give any history of blood transfusions and denied any history of high risk behavior . on examination patient was conscious with normal mini mental state examination score ( 30/30 ) . general examination did not reveal any rash , lymphadenopathy , oral thrush , neck stiffness , spine deformity or tenderness , genital ulcer . neurological examination showed grade i / v power in both lower limbs associated with spasticity and brisk knee and ankle reflexes with no clonus . sensory system examination of both lower limbs revealed loss of all modality of sensations ( pain , touch , vibration and joint position ) below t10 spine level . complete blood count showed hemoglobin of 8.8 g / dl , total leukocyte count of 6900/mm , platelet count of 3 , 21,000/mm and erythrocyte sedimentation rate of 20 mm/1 h. his renal parameters , liver profile were within the normal limit . a gadolinium enhanced magnetic resonant image ( mri ) of spine [ figure 1 ] revealed the presence of intramedullary ring enhancing lesion of 1.5 by 1.1 cm at t9 vertebral level . a gadolinium enhanced mri of brain [ figure 2 ] also showed the presence of a single ring enhancing intra - axial lesion in the occipital lobe without any edema . cerebrospinal fluid ( csf ) examination showed a proteins level of 16 mg / dl ( normal 15 - 45 mg / dl ) , glucose of 58 mg / dl ( with parallel blood sugar of 92 mg / dl ) , ada of 7.8 ( normal < 15 ) with normal cytology ( white blood cell count of 5/mm ) . csf examinations for stain and culture for bacteria , fungi and acid fast bacilli did not reveal any positive findings . india ink preparation of csf for cryptococcus was negative along with negative csf cryptococcus antigen titer . his anti - toxoplasma immunoglobulin g ( igg ) titer by elisa was positive at 4.37 ( < 0.8 = negative ) . after pretest counseling and consent , hiv testing by elisa was carried out which came out be reactive for hiv 1 and results were confirmed with positive western blot assay . patient 's cd4 cell count was carried out which came to 94 cell / mm . chest radiograph and ultrasound examination of the abdomen and pelvis did not reveal any positive finding . gadolinium enhanced magnetic resonant image of spine showing intramedullary ring enhancing lesion ( 1.5 cm 1.1 cm ) at t9 vertebral level gadolinium enhanced magnetic resonant image of the brain showing single ring enhancing intra - axial lesion in the occipital lobe in view of the spine and brain mri findings , positive serology and csf for toxoplasma and immunocompromised state , patient was started on antitoxoplasma therapy in the form of trimethoprim - sulfamethoxazole combination ( 160 mg-800 mg ) 2 tablet twice a day along with antiretroviral therapy in the form of zidovudine , lamivudine and efavirenz . at 5 days after starting on treatment , patient had significant improvement in weakness in both lower limbs ( grade iv / v power ) . since , there was a significant improvement in weakness in both lower limbs , further aggressive approach for diagnosis in the form of biopsy was deferred and the patient was discharged on the same treatment with a plan to repeat mri spine after 4 weeks . toxoplasmosis , a parasitic infection caused by intracellular protozoan , toxoplasma gondii is mostly commonly seen in immunocompromised host especially in acquired immunodeficiency syndrome ( aids ) patients having cd4 lymphocytes count below 100 cell / mm . toxoplasmosis and cns lymphoma are the leading causes of focal brain lesions in aids patients . however in developing country tuberculoma and neurocysticercosis are also important causes for cerebral mass lesions . although brain has been the most common site for toxoplasma infections in aids patients , rarely involvement of spinal cord by toxoplasma has been found . although spinal cord involvement may be present in around 20% of patients suffering from the aids , concurrent presence of other neurological disorder such as aids dementia complex , meningoencephalitis , peripheral neuropathies or other associated intracerebral lesions make it difficult to recognize clinically associated myelopathy . hiv - associated myelopathy , better known as vacuolated myelopathy is the major cause of myelopathy in aids patients . other causes of non - vacuolated myelopathy in hiv patients include tuberculoma especially in developing countries , lymphoma and viral infections such as cytomegalovirus , herpes simplex and varicella - zoster . a review study by garcia - gubern et al . most common clinical presentations of these patients were lower extremities weakness ( paraparesis ) associated with bilateral sensory loss below specific spinal cord level , urinary retension , local pain , fever and brisk deep tendon reflex and extensor plantar response . the presence of discrete sensory loss associated with back pain distinguishes it from the vacuolated or hiv associated myelopathy . definite diagnosis of toxoplasmosis can be made only after the demonstration of an organism on tissue biopsy . a presumptive diagnosis of toxoplasmosis can be made especially in immunocompromised patients with cd4 lymphocyte cell count less than 100 cell / mm by seropositivity for t. gondii igg antibodies has not been receiving prophylaxis for toxoplasma and imaging studies showing typical ring enhancing lesion on radiography . csf examinations for diagnosis of toxoplasmosis in hiv patients mostly show inconclusive findings such as slight raised in protein content and mild mononuclear pleocytosis . pcr of csf for detection of t. gondii deoxyribonucleic acid ( dna ) can be used for confirmation of the diagnosis . however various studies have shown high specificity and relatively low sensitivity of csf pcr for diagnosis . hence , it can be used for the confirmation of diagnosis but should not used for exclusion of diagnosis . mri spine along with other supportive evidences is the important investigation for diagnosis of toxoplasmic myelitis and to rule out other causes of myelopathy in hiv patients such as bony lesion , epidural abscess , cytomegalovirus polyradiculitis , herpes myelitis , lymphoma , tuberculoma or hiv vacuolated myelopathy . typical mri finding in toxoplasmic myelitis consists of intramedullary ring enhancing lesion in the affected region . other disorders which can present with similar findings include primary central nervous system lymphoma ( pcnl ) , tuberculoma , neurocysticercosis or rarely brain abscess due to staphylococcus , streptococcus , salmonella , aspergillus , nocardia , or rhodococcus . important point which favors diagnosis of toxoplasmosis over pcnl includes multiple lesions of < 4 cm in diameter . although single lesions can be seen in toxoplasma infection , solitary lesion of > 4 cm is more suspicious for pcnl . in such cases detection of epstein - barr virus dna in csf by pcr thallium single photon emission computed tomography is also a useful imaging modality to confirm the diagnosis of pcnl since thallium is more avidly taken up to tumor cells . the first line treatment for toxoplasmic encephalitis in aids patients consist of combination of pyrimethamine ( 200 mg of loading dose , 50 mg / day ) and sulfadiazine ( 4 - 6 g / day ) along with folinic acid combinations of pyrimethamine and clindamycin can be used as alternative to pyrimethamine and sulfadiazine in patients having side - effects or allergy to sulfa drugs , however it has been associated with increase relapse rate during the maintenance phase of treatment . there are no studies available which specify the treatment regimens for spinal toxoplasmosis ; hence they are treated with same regimens as toxoplasmic encephalitis . several alternative regimens are available for treatment of toxoplasmic encephalitis which includes trimethoprim - sulfamethoxazole , pyrimethamine plus atovaquone , pyrimethamine plus azithromycin or sulfadiazine plus atovaquone . among these various regimens , trimethoprim - sulfamethoxazole has been found to be as effective as first line treatment with pyrimethamine and sulfadiazine and could be used as first line treatment especially in resource limited setting . a study by torre et al . has shown that patients treated with trimethoprim - sulfamethoxazole are more likely to achieve complete radiological response after acute therapy and has significant less adverse reactions as compared to pyrimethamine plus sulfadiazine . clinical improvement starts appearing within 1 week of starting the treatment and most of the patients show clinical improvement by 10 - 14 days . no response or clinical deterioration after 2 weeks should raise the possibility of alternate diagnosis and such patients should be subjected for biopsy for confirmation of diagnosis . toxoplasmic myelitis is a rare cause of myelopathy in immunocompromised host in whom a presumptive diagnosis can be made based on immune status of patient , typical radiological appearance and serological status of patient . here , we report a case of toxoplasmic myelitis in immunocompromised patient presenting as myelopathy along with typical ring enhancing lesions on mri and positive serology for toxoplasm . hence toxoplasmic myelitis should be kept in mind in immunocompromised patients presenting as myelopathy so as to start therapy as soon as possible and to avoid unnecessary invasive diagnostic procedures .
the rehabilitation of large bone defects may be achieved by different types of grafting materials , from natural or synthetic origin . autologous grafting is the option exhibiting the highest success rate . despite of its several advantages , this grafting type may cause the morbidity of the donor area , increase the recovering time of the patient , and may possible result in progressive resorption . moreover , the grafting availability is limited , demanding the intervention in another region of the body ; in some cases , the hospital environment is necessary . allogenous grafting can also be employed ; however , there is the risk of disease transmission and longer incorporation time of the graft . considering these aforementioned factors , the research lines have searched for effective bone substitute materials that provided less morbidity . the use of a composite graft of rhbmp-2/acs - ccfdab - prp regenerates bone in large vertical ridge augmentations as predictably as 100% autogenous graft with less morbidity , equal cost , and more viable new bone formation . this composite graft represents an in situ tissue engineering concept that is able to achieve results equivalent to autogenous grafts in large vertical ridge augmentations without donor bone harvesting . biomolecular research on bone repair and development allowed the discovery of a family of bone- and cartilage - forming regulatory proteins in vivo . these proteins were named by urist , in 1965 , as bone morphogenetic proteins ( bmp ) . they present osteoinductive and osteoconductive capacity and are capable of initiating the bone neoformation when placed in extra - bone sites . hence , researchers started to produce it laboratorially through the cloning and replication of its genetic code , consequently obtaining a cell bank at the desired amount and concentration . the cloned protein was named recombinant human bone morphogenetic protein type 2 ( rhbmp-2 ) , and it is capable of inducing bone formation at its pure state and high doses . therefore , it is necessary to evaluate whether the site where the protein will be placed is favorable to the migration of growth factors , has the proper skeleton to accommodate it with good blood supply and lack of secretions ; also , bmp demands the association with a carrier . absorbable collagen sponge ( acs ) acs allows the conduction of enough rhbmp-2 at the applied site and assures a uniform distribution without surpassing the site limits . notwithstanding , acs does not have the mechanical resistance needed for maintaining the space up to the primary bone formation ; therefore it is necessary the use of an additional material to keep this skeleton . toxic , immunogenic , or carcinogenic side effects have not been observed with the use of rhbmp-2 , because the material is biocompatible and have little immunogenic effect . the aim of this case was to report a clinical case of the reconstruction of the atrophic maxilla by using rhbmp-2 associated with acs as grafting material , with a following - up of almost 3 years . patient mb , 52-years - old female , wearing an upper complete denture , sought dental treatment for oral rehabilitation through osseointegrated implants . the patient reported an aesthetical complaint because of the increase of facial wrinkles and masticatory and phonetic difficulty due to the instability provided by the complete denture . at clinical examination , the complete absence of the upper teeth and the partial loss of the lower teeth were observed [ figure 1 ] . maxillary alveolar ridge : occlusal pre - operative view at the preoperatively imaging examination , the computed tomography revealed the severe atrophy of the anterior area of the maxilla , at both horizontal and vertical directions . pre - operative tomography : axial view the following treatments were proposed : ( 1 ) reconstruction of the maxilla through autologous bone graft harvested from either the tibia or the calvaria ; ( 2 ) reconstruction of the maxilla through allogenous bone graft coming from bone bank ; ( 3 ) bilateral zygomatic implants and ( 4 ) reconstruction of the maxilla through the rhbmp-2/acs combined . the dental team and the surgery was executed in august of 2008 at ztola dental institute , curitiba / pr , brazil . the patient was submitted to both endovenous sedation executed by the anesthesiologist and local anesthesia . after intra- and extra - oral antisepsis , a straight incision was executed on the maxillary alveolar ridge through size 15 scalpel blade from the left to right first molar . following , a releasing vertical incision was performed on the area of the labial frenulum . the total - thick flap was raised by using a molt elevator towards to the vestibule bottom to expose the bone remnant [ figure 3 ] . the total - thick flap raised with the aid of a round diamond bur a window was bilaterally opened in the maxillary sinus ( caldwell - luc access ) . next , the maxillary sinus membrane was lifted and a synthetic bone substitute was grafted ( bone ceramic 500 - 1000 micrometers , straumann , basel , suisse ) follow the manufacturer 's recommendations . two 1.5 mm profile titanium plates of 1.5 ( osteosin , so paulo , brazil ) were fixed at both sides of the anterior region of maxilla with 5 mm 1.5 mm screws ( osteosin , so paulo , brazil ) [ figure 4 ] . next , rhbmp-2/acs combined ( infuse bone graft , 3.2ml , medtronic sofamor danek usa , inc ) was prepared according to the manufacturer 's recommendations and placed below the titanium plates [ figure 5 ] . the collagen membranes were sutured with simple sutures on the plates aiming to prevent the movement of the grafting [ figure 6 ] . the flap was coronally positioned and sutured with 5 - 0 vycril running simple suture . titanium plates fixed material placed below the skeleton created by the titanium plates collagen membrane sutured on the titanium plates post - operative medication comprises amoxicillin 875 mg + potassium clavulanate 125 mg every 12 h ; paracetamol , 750 mg , every 6 h ; diclofenac sodium , 50 mg , every 24 h ; and 0.12% chlorhexidine digluconate every 12 h. trans- and post - operative period was uneventful without pain , but with edema . the patient was followed - up every 2 weeks [ figure 7 ] during 6 months . maxillary alveolar ridge : 15-day post - operative following - up , occlusal view tomography showed the ridge augmentation after 8 moths [ figure 8 ] . the installation of the implants required the removal of the titanium plates [ figure 9 ] . six straumann implants were installed at both the central incisor area ( 4.0 mm 10 mm ) and at the posterior area of the maxilla ( 4.0 mm 12 mm ) [ figure 10 ] . all implants were locked at above 45n and the provisional denture was installed after 4 days [ figures 11 and 12 ] . tomography showing the ridge augmentation after 8 moths reopening procedure , after 8 months to remove the titanium plates and installed implants panoramic radiograph showing all the implants installed patient 's profile wearing the provisional denture patient 's profile wearing the provisional denture clinical and imaging examinations were performed during the post - operative period , the smile analysis not been taken . after 2 years and 5 months of following - up , an satisfactory functional and aesthetical rehabilitation was achieved [ figure 13 ] . bmp 's have a large clinical application by the stimulus of the regeneration of bone defects in craniomaxillofacial areas . the protein may be used in dentistry in the following situations : bone defect cavities ( either tooth sockets or maxillary sinus grafts ) , thickness and height augmentation ( appositional and interpositional grafts ) , large continuing defects ( large bone loss after trauma or tumor exeresis ) and cleft lip and palate rehabilitation . among the options for the treatment of the case reported here , the first option ( autogenous bone graft ) was excluded by the team because of its morbidity and the need of a hospital environment and general anesthesia . the graft through bone bank ( second option ) was excluded because of the higher risk of disease transmission and longer time between bone integration and the installation of the implants . the zygomatic implants ( third option ) thus , the fourth option was chosen because it provided less morbidity , faster patient recovering than the other procedures , and it could be performed at an ambulatorial environment . this present case report demonstrated the clinical success of the use of rhbmp-2/acs combined in the treatment of severe maxillary atrophy . this success can be partially explained by the osteogenic capacity of rhbmp-2 , which occurs because of the differentiation of the undifferentiated mesenchymal cells ( umc ) into bone matrix secreting osteoblasts . additionally , they are capable of modifying cells already differentiated ( myoblasts ) into osteoblasts . thus , it can benefit from the cells of the surrounding muscle tissue to help bone neoformation . to act efficiently a clinical study showed that rhbmp-2/acs combined at a concentration of 1.5 mm / ml was very effective to reach bone regeneration in the treatment of maxillofacial bone defects . in this case report this combination and concentration was employed and favorable clinical outcomes were reached . the combination between acs and rhbmp-2 is biocompatible and malleable . notwithstanding , it does not promote space maintenance , which demands the use of other materials to act as a skeleton and keep the desired volume titanium mesh and plate . biomaterials such as calcium triphosphate and hydroxyapatite ( ctp / ha ) has also been used with this purpose . in this case report , the titanium plate was used as a skeleton because it has been successful reported by the literature ; effective fixation without possibility of movements ; and small surgical trauma during its insertion . the use of rhbmp-2/acs combined has been effective to form viable bone to receive osseointegrated implants and functional load . satisfactory amount and quality of bone height and thickness was achieved 8 months after the surgery and the placement of six implants was possible , locked close at 45n . the bone quality was clinically evaluated during the installation of the implants ; at that moment a type 3 bone was found . the amount and quality of the bone structure could be seen in the post - operative radiographs and tomographies . additionally , the long - term following - up of this case report showed the effectiveness of this treatment . nevertheless , some disadvantages should be attributed to this form of treatment , such as high cost and postoperative edema , these findings corroborate the results recently published . recently published article reports the clinical success of application and outcomes of the use of a combined approach to treat a patient with a severe alveolar defect with recombinant human bone morphogenetic protein-2 in an absorbable collagen sponge carrier , along with autogenous bone graft , bovine bone mineral , platelet - rich plasma , and guided bone regeneration . histologically , studies have demonstrated that bone neoformation obtained after the use of rhbmp-2/acs combination exhibits normal features with viable cells . however , being a relatively new treatment option , there are few clinical studies with this material and do not have systematic reviews on this topic . in the case reported here , the use of rhbmp-2 combined with acs as grafting material was efficient , and enabled the long - term successful functional and aesthetical rehabilitation of the patient .
we restricted our analyses to peridomestic cases that were reported in the geographic region previously determined to be at high risk on the basis of environmental factors ( 6 ) . thus , we included 123 ( 75.9% ) of 162 cases reported in new mexico during the study period . we also restricted our analyses to the cbgs that had population densities within the range of densities found in plague - positive cbgs ( 0.05 and 1,425.40 persons / km ) . this restriction avoided comparing rural to urban cbgs because plague tends to occur in rural to lightly suburbanized areas . the final area considered encompassed 17% of new mexico ( 6 ) and included the entirety or portions of 483 cbgs ( figure ; table 1 ) . areas of new mexico , usa , considered in the current analysis on the basis of those defined as high risk for human plague by eisen et al . ( 6 ) for each time frame examined . distributions of human cases are displayed and census block groups are color coded as negative or positive for plague cases . census block group boundaries are indicated in light gray , and counties are outlined in dark gray . ovals or circle indicate census block groups with significantly ( p<0.05 ) high human plague incidence rates per 1,000 persons , identified by using the kulldorff space scan statistic ( 9 ) . analyses were conducted by using the poisson probability model and 999 monte carlo replications to test for significance . * values are medians ( interquartile ranges ) for plague - positive and negative census block groups in the respective time frames . defined by the us census bureau as the proportion of the population living near or below the federal poverty line , which is based on household income adjusted for number of household members . the definition of the federal poverty line changed between the 1980 and 1990 censuses # defined by the us census bureau as lacking > 1 of the following : hot and cold piped water , a flush toilet , and a bathtub or shower . a housing unit was considered to have complete plumbing only if plumbing fixtures were for exclusive for the residents of that unit . in 1990 identified as the convergence of the rocky mountain / great basin open and closed coniferous woodland habitats by eisen et al . ( 6 ) . to relate plague occurrence to socioeconomic conditions of cbgs at times when cases occurred , we divided the study period into 3 time frames centered on the most recent census . thus , 19761985 cases were associated with 1980 census data , 19861995 cases with 1990 census data , and 19962007 cases with 2000 census data . variables that described economic status and housing conditions were extracted from each census , normalized to us census 2000 cbg boundaries ( geolytics , inc . , east brunswick , nj , usa ; www.geolytics.com ) , and compared between plague - positive and plague - negative cbgs by using wilcoxon rank sum tests ( table 1 ) . for each time frame , the risks of cbgs having at least 1 case of human plague on the basis of significant variables were then evaluated by using 2 2 tables . cbgs were divided into high and low categories by using median values of each variable as division points . plague risk was positively associated with cbgs that had an ecotone habitat identified by eisen et al . ( 6 ) as especially suitable for human plague cases ( e.g. , convergence of the rocky mountain / great basin open and closed coniferous woodland habitats ; odds ratio 4.18 , 95% ci 2.666.57 ) . therefore , to ensure that we were measuring differences in socioeconomic conditions and not the presence or absence of the ecotone habitat in cbgs , we also calculated adjusted odds ratios for each variable and time frame by using mantel - haenszel tests . our results suggested temporal changes in socioeconomic factors associated with location of human plague cases . in the 1980s , plague tended to occur in cbgs with poor housing conditions ( e.g. , old homes with incomplete plumbing ) and high proportions of the population living near or below the poverty line , but this second association was confounded by presence of ecotone habitat ( table 2 ; figure ) . beginning in the 1990s , plague cases began to be associated with cbgs with higher median incomes and home values , and by the 2000s , wealthier cbgs with higher proportions of newer homes were positively associated with plague cases ( table 1 , table 2 ) . high proportions of homes using wood fuel were consistently associated with positive cbgs for each time frame ( table 1 , table 2 ) , which supported suggestions from previous studies that availability of harborage for rodents ( e.g. , wood piles ) in and around domestic environments may increase human plague risk ( 2,58 ) . * defined by the us census bureau as the proportion of the population living near or below the federal poverty line , which is based on household income adjusted for number of household members . the definition of the federal poverty line changed between the 1980 and 1990 censuses , therefore , rates are not directly comparable across decennials . variables that continued to be significant after controlling for presence of ecotone habitat . defined by the us census bureau as lacking > 1 of the following : hot and cold piped water , a flush toilet , and a bathtub or shower . a housing unit was considered to have complete plumbing only if plumbing fixtures were for exclusive for the residents of that unit . in 1990 , the requirement of exclusive use was dropped . a general change in the distribution of plague cases during the study period was also observed . in the 1980s , plague cases were more widely distributed across new mexico and were particularly common in the northwestern region of mckinley and cibola counties ( figure ) . however , by the 1990s , plague cases became less common there and more focused in the north - central region of the state ( santa fe albuquerque and surrounding counties ; figure ) . we implemented the kulldorff spatial scan statistic ( 9 ) by using satscan ( 10 ) to identify clusters of cbgs with high incidence rates of plague cases per 1,000 persons for each of the time frames to quantify these changes . significant clusters were detected only in the santa fe albuquerque region for each time frame ( figure ) . changes consistent with the overall analysis in which plague occurrence shifted from poorer to wealthier cbgs and occurred in more new homes were observed when this region was considered alone . our analysis also suggested that migration of middle to upper class families into suitable plague habitat throughout the high - risk areas of the state was associated with locations of plague cases . for example , in the 1990s , 28 ( 96.6% ) of 29 plague - positive cbgs experienced population growth between the 1980 and 1990 censuses , in contrast to 337 ( 78.4% ) of 430 nonplague cbgs that experienced growth . likewise , 17 ( 85% ) of 20 plague - positive cbgs in the 2000s occurred where there was growth between the 1990 and 2000 censuses versus growth in only 327 ( 75% ) of 434 nonplague cbgs . moreover , for the census 2000 period , population growth was more likely to have occurred in cbgs that had ecotone habitat than cbgs without ecotone habitat ( p = 0.004 , by fisher exact test ) . migration of persons into suitable plague habitat would potentially increase the likelihood of human exposure to infected rodents and their fleas ( 7 ) . overall , our results confirmed the role of living in or near habitats that support maintenance of sylvatic plague as a risk factor for human y. pestis infection , but also suggested migration of middle to upper class families into such areas may be contributing to changes in the locations of plague cases . the north - central region of new mexico surrounding santa fe and albuquerque was identified as a persistent focus of human plague cases , and it appears to be the predominate region for current cases . it is unclear why cases have become rare in the northwestern region of new mexico because socioeconomic conditions have not generally improved there . however , the high numbers of cases observed there in the 1980s were associated with favorable climatic conditions for plague ( 11 ) . although we detected changes in the socioeconomic indictors associated with the locations of plague - positive cbgs , what shifting individual behavioral factors may have accompanied these trends are unknown . in particular , we were unable to determine whether the socioeconomic status of individual plague case - patients has changed from poor to middle or upper income classes . future investigations are needed to characterize the characteristics and behaviors of persons to verify and fully understand the changing factors associated with plague cases in new mexico .
kumar1 claimed that people have difficulty using the hamstrings , muscles that are prone to shortening . ayala2 argued that the hamstrings play a significant role in effective walking and running , and that short hamstrings have often been observed in people , especially athletes . in addition , extended hamstring muscle contraction prevents complete extension and reduces flexibility . as stated by kim3 , stretching is one of the most popular methods to increase muscular flexibility ; thus , self - myofascial release with a foam roller has gradually become preferred to improve muscular flexibility , particularly since it is a low - cost intervention . faulkner4 also asserted that self - myofascial stretching improves one s sense of physical awareness and joint sensitivity , and improves the function of the proprioceptors , which function in balance and motor skills . muscular flexibility of the hamstrings can be examined using the sit and reach test , passive toe touch test , and straight leg raise ( slr test ) . the sit and reach test is highly reliable ; thus , it is used as a valid testing method5 , 6 . ultrasound delivers heat deep into the muscles , resulting in better flexibility of the collagen fibers and muscles7 , 8 . the therapeutic effects of ultrasound include relaxed joint contracture , better adhesion , and reduced joint stiffness , pain , and muscular rigidity7 , 9 . therefore , this study explored the positive effects of self - myofascial release on hamstring muscular flexibility and proprioception and investigated the comparative effectiveness of the stretch combined with therapeutic ultrasound . this study involved 30 university students ( mean age , 21.8 0.81 years ; 1:1 male : female ratio ; mean height , 167.6 8.49 cm ; mean weight , 62.5 8.13 kg ) with no history of pain in the achilles tendon or hamstrings within the most recent 6 months . written informed consent was obtained from each subject . this study was approved by the ethics committee of the kaya university ( kaya irb-78 ) . the subjects participated in two experiments . in the first experiment ( ms ) , they performed self - myofascial stretching using a foam roller daily for 1 week . in the second experiment ( msu ) , the same participants performed the self - myofascial stretching after the 15-minute application of ultrasound . ultrasound therapy were applied to the biceps femoris , semitendinosus , and semimembranosus muscles for 5 minutes each ( frequency , 1 hz ; strength , 3 w / cm ; velocity : 2 cm / sec ) . this study included pre- and post - tests of hamstring muscle flexibility and hip joint proprioception . this study used the sit and reach test to evaluate hamstring flexibility , while dual inclinometers were used to test hip joint proprioception . a paired t - test was used to test differences between the pre- and post - test results , while an independent t - test was used to test differences between the two experiments . the use of self - myofascial stretching in the ms experiment had a significant effect on hamstring flexibility and hip joint proprioception . however , the addition of ultrasound to self - myofascial stretching in the msu experiment had no additive effect ( table 1table 1.comparison of hamstring flexibility and hip joint proprioception before versus after the ms and msu interventionsbeforeafterdifferencesmssrt ( cm)7.42 10.2110.92 9.84 * 9.58 10.12jps ( degrees)3.57 2.491.41 1.30 * 0.40 1.02msusrt ( cm)5.42 11.3310.67 9.73 * 9.36 10.48jps ( degrees)7.45 4.281.37 2.12 * 0.79 1.82ms : self - myofascial stretching ; msu : self - myofascial stretching with ultrasound ; srt : sit and reach test ; jps : joint position sense ( * p<0.05 , mean sd ) ) . ms : self - myofascial stretching ; msu : self - myofascial stretching with ultrasound ; srt : sit and reach test ; jps : joint position sense ( * p<0.05 , mean sd ) as suggested by sherer11 , self - myofascial stretching had a significant effect on increased hamstring flexibility and improving hip joint proprioception . longo12 also investigated the muscle and tendon stiffness after stretching with feet lifted 20 degrees toward the shin , that is , in dorsi - flexion , using an electromyogram and an ultrasound . as shown in the aforementioned research , this study also presented the same result that self - myofascial stretching using a foam roller immediately increased hamstring flexibility and enhanced hip joint proprioception . however , the results of this study showed that the use of therapeutic ultrasound for 15 minutes prior to the self - myofascial stretching had no additional effect on hamstring flexibility or hip joint proprioception . therapeutic ultrasound delivers heat to the soft tissues , which helps increase blood circulation and induce relaxation . as suggested by kondo13 , the application of heat on leg contractures in mice did not increase muscular flexibility . however , further research should be performed since lounsberry14 presented the contradictory result that therapeutic ultrasound treatment applied to the hamstrings can increase muscular flexibility . the current study concluded that self - myofascial stretching immediately increased hamstring flexibility and improved hip joint proprioception but that the addition of therapeutic ultrasound offered no further benefit .
venolymphatic malformations ( vlms ) are tumor - like lesions combining dysplastic lymphatic and venous vessel structures . the international society for the study of vascular anomalies has divided vascular lesions into hemangiomas and vascular malformations ( vms ) . hemangiomas are characterized by rapid growth in neonatal life , endothelial proliferation and spontaneous slow regression while vms are present at birth have normal rate of endothelial turnover and continue to grow throughout the patients ' lifetime . they are also classified as slow - flow ( capillary , venous , lymphatic ) and fast - flow ( arterial , arteriovenous [ av ] ) lesions . these two types of lesions have different clinical behavior and require different diagnostic and therapeutic strategies . the present case of venolymphatic malformation of the parotid gland extending into the parapharyngeal space was asymptomatic and presented for cosmetic purpose . magnetic resonance imaging ( mri ) confirmed the diagnosis and described the exact location and extent of the lesion which was successfully treated by surgery . a 21-year - old male patient came with a complaint of swelling over the left side of the face extending into the neck since birth . the swelling was initially small and gradually increased in size for the last 45 years , reaching up to the present size of 8 cm 5 cm . there was a history of operative procedure done at the age of 2 years , the details of which were not available . ( a ) clinical photograph showing swelling over preauricular region extending into the neck , ( b ) pre - contrast magnetic resonance imaging showing the lesion , ( c ) post - contrast magnetic resonance imaging showing mild post - contrast enhancement of the lesion with a large draining vein at the lateral aspect , ( d ) t2-weighted magnetic resonance imaging showing the predominantly t2-bright lesion in the superior part of the parotid ultrasonography ( usg ) with color doppler and computed tomography ( ct ) was suggestive of a low - flow venous malformation occupying the lower pole of the superficial lobe of parotid . the part of retromandibular vein was seen traversing through the mass . multiplanar , multisequence mri of neck was performed which demonstrated a predominantly t2-hyperintense , t1-isointense mass in the left parotid region with extension into the deep ipsilateral parapharyngeal space [ figure 1b d ] . there was a large draining vein at the lateral aspect of the lesion [ figure 1c ] . there was a hypointense t2-focal area in the lesion corresponding to the focal calcification on ct . considering the involvement of multiple compartments , abnormal prominent draining vein and focal calcification , a diagnosis of venolymphatic malformation was made . in view of the above investigations , the patient was taken up for surgery and superficial parotidectomy was performed along with the excision of the lesion from the parapharyngeal space [ figure 2a ] . on gross examination , a partially encapsulated mass was received measuring 5.5 cm 4 cm 3 cm . the cut surface was spongy , reddish brown and grossly , many vascular channels of varying sizes were seen [ figure 2b ] . ( a ) photograph showing intraoperative removal of the mass from parotid , ( b ) gross photograph showing spongy cystic reddish brown mass microscopically , the lesion was composed of numerous vascular channels of varying sizes , many of which were dilated [ figure 3a d ] . some of the vessels were lined by single flat layer of endothelium suggestive of venules and veins . other small to medium sized vascular channels were lined by flattened endothelial cells . these had patchy smooth muscles in the vessel wall and were filled with eosinophilic proteinaceous material and were suggestive of lymphatic channels . the adjacent tissue showed fatty stroma and presence of lymphocytes , lymphoid follicles and smooth muscle [ figure 3b and d ] . on immunohistochemistry ( ihc ) , the vascular endothelial cells expressed cd31 [ figure 4a ] while the lymphatics were highlighted by d2 - 40 [ figure 4b ] . based on the histology and the ihc findings , a diagnosis of venolymphatic malformation was made . ( a ) photomicrograph showing salivary gland along with vascular channels ( h&e stain , 40 ) , ( b ) photomicrograph showing venous and lymphatic channels with lymphoid follicles within the stroma ( h&e stain , 40 ) , ( c ) photomicrograph showing endothelial lined lymphatic and venous channels . stroma shows adipose and lymphoid tissue ( h&e stain , 40 ) , ( d ) photomicrograph showing presence of lymph inside the lymphatic channels along with acini of parotid gland ( h&e stain , 100 ) ( a ) cd31 positivity in venous and lymphatic channels ( ihc stain , 40 ) , ( b ) d2 - 40 ( podoplanin ) positivity in lymphatic channels ( ihc stain , 40 ) postoperatively , the patient was followed up and did not have any complaints pertaining to the swelling . nearly 50% vms occur in the head and neck region with lip , oral cavity , tongue , masseter , temporalis muscle and airway mucosa being the common sites of involvement . they have also been reported rarely in the mediastinum , lower extremity , intestine and heart . vms are caused by a disturbance in the late stages of angiogenesis ( truncal stage ) and result in the persistence of av anastomosis present during embryonic life . venous malformations are mediated by germline or somatic mutations in the tek ( chromosome 9p ) gene which encodes the endothelial cell tyrosine kinase receptor tie2 . the increased phosphorylation of tie2 leads to the uncoupling between endothelial cells and normal recruitment of smooth muscle cells . their presence has also been linked to the errors in the receptor tyrosine kinase tie2 gene . hormonal influences , infection , trauma or surgery caused by birth control pills , puberty and pregnancy may cause vm to enlarge and become more symptomatic . diagnosis was made usually in the fourth decade of life though age ranged from 19 to 54 years . clinical presentation was of a mass present since birth or childhood with a slow growth more after puberty as in the present case . these vms were seen as slow - growing soft mobile masses with no facial nerve palsy . symptoms when present were related to either long - standing nature of the tumor ( dyspnea , dysphagia with raised hemivelum ) or to micro - thrombotic events ( pain causing phleboliths ) . nearly 90% cases were treated with surgery . as they are rare , vlm of parotid are not usually considered in the differential diagnosis and are mistaken for common cystic parotid lesions , pleomorphic adenoma and warthin 's tumor . usg and color doppler imaging has proven to be helpful in the initial diagnosis and shows a slow flow lesion , presence of phleboliths and vein traversing through the lesion . although ct scan with contrast can be done , mri has proven to be the mainstay in the diagnosis and to correctly delineate the full extent of the lesion which is needed to plan the treatment . a specific aspect of venous malformation is the presence of phleboliths with a hyperintense t2-weighted signal on mri . diagnosis is confirmed on histopathological examination which shows the presence of dilated ectatic venules lined by flat endothelial lining and lymphatic vessels showing patchy smooth muscle in the wall . stroma shows the presence of adipose tissue , lymphoid follicles and smooth muscle as was seen in the present case . ihc shows positivity to vascular markers such as cd31 and cd34 while lymphatics are specifically stained by d2 - 40 or podoplanin . treatment of vms depends on the size , location , symptoms and proximity to the vital structures . moreover , as vm have poorly defined borders and tendency to infiltrate normal tissues , they require calculated treatment decisions in the effort to preserve the surrounding architecture . treatment of vlm of parotid is usually surgical resection with sparing of the facial nerve . other treatment modalities for vm include sclerosing agents such as ethanol , sodium tetradecyl sulfate and bleomycin which are injected under imaging guidance or even intraoperatively . laser therapy using neodymium : yttrium - aluminum - garnet laser is also used in some cases . vlms of the parotid gland are rare lesions which are present from birth but show a spurt in growth during puberty or due to hormonal changes . mri is necessary to confirm the diagnosis , know the extent of lesion and to plan the treatment . histopathology shows the presence of both veins and lymphatics which can be confirmed by ihc studies .
ultrafast laser technology in the last two decades progressed to the point where heterodyne - detected four wave mixing ( fwm ) experiments can fully characterize the third - order optical response . in such experiments , three excitation pulses , separated by two time delays t1 and t2 , induce a coherent signal in a molecular sample , which is emitted during signal time t3 . such fwm signals are best displayed as 1 vs 3 correlation plots between absorption events during the coherence time t1 and signal emissions during time t3 . such plots are called two - dimensional ( 2d ) optical spectra in close analogy to 2d methods used throughout the nmr community . 2d optical spectroscopy , first developed in the infrared ( ir ) domain , has been brought to the visible and other domains over the past decade . analysis of 2d spectrograms is focused either on peak intensity and position or on the peak shape , where peak intensity and position are usually much simpler to interpret . for instance , at short waiting times t2 0 cross peak intensities bear information on the relative angle between the involved transition dipole moments . 2d ir was thus used to elucidate molecular or protein structure , as well as chemical exchange . similarly , the evolution of cross peak magnitudes are instrumental for tracking excitation and relaxation pathways in multichromophoric systems such as natural and artificial light harvesting complexes . line shapes of individual peaks in 2d spectra are related to fluctuations of transition frequencies as caused by spectral diffusion processes . in some instances , peak shapes reflect molecular structure or energy deactivation networks , but more typically , 2d line shapes are heavily influenced by the environment of the probed molecular system . although peak positions and intensities are explained quantitatively , detailed calculations of 2d line shapes are relatively costly and comparison between simulation and experiment is often left to visual inspection . this rationalizes the need for a simple quantitative characterization of 2d line shapes in the electronic domain . ideally , such measures would allow for a simple parametrization of standard microscopic models of spectral diffusion . moreover , these measures should also be well - defined for more complicated line shapes , i.e. , for atypical parameter regimes or microscopic models . there are two limiting cases for 2d peak shapes : ( i ) fast and homogeneous spectral fluctuations induce lorentzian star - like profiles , as typically found in 2d nmr . and ( ii ) slow gaussian spectral diffusion produces characteristic 2d ir gaussian peaks , the contours of which are approximately elliptic . elongation of such elliptic peaks along the diagonal is a measure for inhomogeneous disorder and its waiting time ( t2 ) evolution shows the extent of relaxation during spectral diffusion processes described by the frequency frequency correlation function ( ffcf ) . several measures of 2d peaks have been introduced to characterize spectral diffusion , such as contour eccentricity , nodal lines of the dispersive part of the spectrum or center lines slopes ( cls ) of the absorptive parts . the ratio of a peak s diagonal d and antidiagonal ad width is connected to the ffcf for gaussian line shapes . this measure is useful when the diagonal elongation is caused predominantly by static disorder . however , the concept has no reasonable extension beyond the very limit of slow gaussian spectral diffusion , which is not always obeyed for electronic spectra and it is also difficult to identify if the 2d spectrum has deviated from a gaussian line shape . nodal line dynamics reflect the relaxation of the line shape and can thus be used to infer relaxation time scales . however , we have no analytical expression relating the nodal line slope to other model parameters . in contrast , the center line ( cl ) as obtained by maximization of a 2d signal along the 1 axis at fixed waiting times t2 is a more robust concept . for slow , approximately gaussian , spectral diffusion , typical for vibrational spectra measured in the ir domain , the cl is linear and its slope manifests the frequency a scenario , the dynamics of a gaussian coordinate is entirely defined by the ffcf , and thus spectral diffusion is completely characterized by the dependence of cls on the waiting time t2 . dynamics of electronic transitions are often different . intermediate time scales of spectral diffusion , significant bath reorganization effects such as stokes shift and vibrational progression of electronic spectra induce complex , non - gaussian line shapes . however , we will demonstrate that it still carries information about dynamics and helps with parametrization of a spectral diffusion model . in the present paper we will analyze the cls concept in the context of 2d electronic spectroscopy ( 2d es ) . after explaining all factors influencing cls in 2d es , we apply our findings on experimental data of zinc phthalocyanine ( znpc ) , where the main diagonal peak shows different sections with linear or curved cl , a behavior rather dissimilar from that for the paradigmatic ir or nmr 2d spectra . we interpret 2d ir spectra as dynamical maps of a diffusive coordinate and review the concept of cls . in section 3 we introduce spin boson dynamics as a convenient model of gaussian fluctuations of electronic transitions . it will be related to the stochastic picture of section 2 for a certain parametric limit . we will show how more general parametrization allows us to analyze cls in the presence of typical phenomena for the electronic domain such as stokes shift . we will also discuss limitations imposed by the spin boson model and investigate the effects of non - gaussian spectral diffusion in section 4 . in section 5 we apply our models to experimental electronic 2d spectra of znpc . in section 6 , we conclude by evaluating cls analysis as a tool for parametrizing dynamics of electronic transitions . we start this section with a short review of 2d spectroscopy . in fwm experiments , three short laser pulses impinge upon the sample at time delays t1 and t2 and the resultant third - order signal field generated at a delay t3 is mixed with a local oscillator field . consider a two - level chromophore , whose transition frequency (t ) undergoes stochastic spectral fluctuations . the signal is a function of the three time intervals and reads1e corresponds to the so - called rephasing signal ( r ) and e to the nonrephasing signal ( n ) . equation 1 shows clearly why 3 , t2 , 1 is the standard domain for 2d spectroscopy . we will focus on the real part of the spectrum , e.g.,2the total ( absorptive ) signal r combines rephasing and nonrephasing contributions3 in the infrared , spectral diffusion is typically a slow process leading to stable transition frequencies 1 and 3 during the t1 and t3 intervals . the total signal ( eq 3 ) is then interpreted as two - time joint densities of (t)4spectral fluctuations are most often of gaussian type and entirely characterized by the two - point correlation function , where (t ) (t ) (t). substituting the standard prescription for two - point joint density of a gaussian process with vanishing mean (t) = 0 into eq 4 yields5the gaussian line shape r delivers elliptical contours as shown in figure 1 for several waiting times t2 . line shapes develop from highly eccentric contours at short waiting times t2 0 ( left panel ) to the circular limiting case for t2 ( right panel ) and depend on the extent of relaxation given by . the obvious task is to extract the correlation function from the experimental 2d line shapes . center lines bcl ( black ) and fcl ( red ) for gaussian 2d line shapes ( eq 5 ) with , and / = 4000 . waiting time increases from left to right t2 = 0.01 , 1 , 10 . throughout the text , 2d plots are normalized to maximal value and for figures 1 , 3 , 4 , 79 contour lines are plotted at 5% steps , and the same color scale applies . the black curve in each panel of figure 1 depicts the center line 1bcl(3 ) . it was obtained by finding position 1bcl of maximal signal r(3,t2,1 ) along axis 1 at given 3as far as we consider the 2d line shape to be a joint probabilistic density of a classical stochastic variable as in eq 4 , 1bcl(3 ) is the most probable value of (t ) at t = 0 given that the frequency at a later time t = t2 is 3 . the center line thus represents backward - time evolution and we abbreviate this center line as bcl ( backward - time center line ) . the bcl line of a gaussian peak ( eq 5 ) is linear becausewith a slope given by the inverse of the normalized correlation function 6 alternatively , one can search for the maximal signal along the 3 axis . the associated red line 3fcl(1 ) ( figure 1 ) represents a typical spectral diffusion trajectory (t ) , which starts from (0 ) = 1 and has the most probable position (t2 ) = 3fcl(1 ) after waiting time t2 . hence , 3fcl(1 ) represents the ordinary time - forward picture of a stochastic process and will be abbreviated fcl ( forward - time center line ) . for a gaussian peak ( eq 5 ) , fcl is again linear with a slope given directly by the normalized correlation function c(t)7 the symmetry between bcl and fcl evident from comparing eqs 6 and 7 has a fundamental background . the joint density of equilibrium stochastic processes is subjected to the microscopic time reversibility8the line shapes are symmetric along the diagonal , bcl can be deduced from fcl and vice versa because they are axial images ; fcl and bcl carry similar information in this case , as illustrated in figure 1 . experimentally , it is inequivalent to determine the bcl and fcl , as 3 is typically measured directly in frequency domain via spectrally dispersed detection , whereas 1 is obtained in postprocessing from time - domain data . equation 8 then provides a meaningful relation between experimentally accessible bcl and the ordinary forward - time picture of fcl . beyond the assumptions underlying eq 4 , however , the bcl and fcl may become dissimilar , so we continue to discuss both of them throughout this paper . here we note that the gaussian joint density ( eq 5 ) forms the backbone of most experimental line shape measures of the ffcf . for instance , the ratio of a peak s diagonal d and antidiagonal width ad within the limit of eq 5 is connected to c(t ) as9for gaussian line shapes c(t ) can thus be extracted similarly well from bcls , fcls or the eccentricity ad/d . however , eccentricity is limited to elliptical contours and can not be easily generalized beyond gaussian line shapes . in contrast , fcl and bcl allow the detection of non - gausianities by deviations from linearity . in the following , we develop a theoretical framework for bcls and fcls , going beyond the limit of gaussian line shapes . although modulation of vibrational transition frequencies originates in the solvent and with few exceptions can be considered classical , electronic transitions in molecular systems incorporate a more complex modulation of vibrations and show clear signatures of quantum behavior ( e.g. , stokes shift ) . we start with reinterpreting the transition frequency in eq 1 from the classical diffusive variable to a quantum coordinate (t ) eg + q(t ) and introduce the standard dynamical model of an electronic transition . electronic transitions in molecules are always modulated by vibrations . by approximating them by a set of harmonic oscillators10which are eventually displaced in the electronic excited state , we adopted the spin boson hamiltonian , which is well documented in literature . thus , each electronic level is accompanied by a handful of vibrational states forming a band , and there is a number of transitions between them which are overlapping and merge into a single peak ( or few peaks ) at room temperature . we thus understand the electronic 2d line shape as a map of a transition between a single electronic ground and excited level with the transition ( gap ) frequency dynamically modulated by vibrations . within the standard condon approximation the transition frequency represents the difference between ground and excited state surfaces , i.e. , q = e g eg = jmjj2djxj . its time profile is found by switching into the dirac picture q(t ) = eqe . it represents quantum gaussian fluctuations at arbitrary time scales around the mean of the transition frequency eg . in this quantum case the excited and the ground state dynamics are different and the total 2d signal of a single transition is defined by four liouville space pathways depicted in figure 2.11where ground state bleaching diagrams ( gsb ) propagate within the electronic ground state during waiting time t2 , and stimulated emission diagrams ( se ) through the excited state . liouville space pathways for the third - order responses of a two - level chromophore . as in the classical case , all properties of quantum gaussian noise are described by the ffcf , which is now a complex - valued quantity12obeying the fluctuation dissipation relation between its real and imaginary components ( see eq 47 for fourier transform conventions)13where is the boltzmann factor , i.e. , the inverse temperature = 1/kt . at high - temperatures 0 the real part dominates , corresponding to the classical case of eq 5 . boson dynamics are solvable and the third - order response function can be calculated exactly using the second cumulant ( eqs 4245 ) that is reviewed in appendix a. we next address several phenomena typical for electronic spectra that are rare for vibrational transitions in the infrared . first , potential surfaces of electronic ground and excited states are significantly different , and thus frequencies of emitted photons are lower than those absorbed . this stokes shift commonly represents a simple displacement between ground and excited state harmonic potential surfaces . for instance , differences between the curvature of electronic ground and excited states induces nonlinear electronic solvent coupling that results in non - gaussian spectral diffusion , which will be treated along with anharmonicity of potential surfaces in the section 4 . in many cases the electronic transition is coupled to underdamped vibrations that appear as side bands in the absorption spectrum in a vibronic progression . moreover , this coupling modulates both the amplitude and peak shape of the primary peak as a function of time . last , when the transition frequency is altered rapidly during t1 and t3 , gaussian frequency fluctuations do not translate into gaussian line shapes . rather the line shapes are motionally narrowed and the slow fluctuation approximation introduced above ( eq 4 ) fails . although motional narrowing is not unknown in the infrared , electronic transitions quite typically exhibit some of these signatures and thereby limit the use of the straightforward analysis of section 2 . analysis within the present section will neglect the interference between levels of multilevel and multichromophoric systems , namely pathways of excited state absorption and cascading processes whose complex effects escape simple classification . instead , we focus on a single transition between electronic ground and excited state and the effects of stokes shift , finite fluctuation time - scales and vibrational structure on center lines will be addressed in the coming sections 3.13.3 . in the following we will outline quantum - classical correspondence and formally reproduce the classical case of figure 1 . in principle , the ffcf can be chosen arbitrarily , only bounded by eq 13 . the most common spectral diffusion model ( see appendix a for details ) describes overdamped quantum motion ( diffusion ) in a harmonic potential at moderately high temperatures ( tanh(/2 ) /2 in eq 13 ) , with relaxation rate , and coupling .14model 14 thus refers to figure 1 with magnitude of fluctuations15the overdamped ffcf of eq 14 is capable of describing both the stokes shift and effects of diffusion time scale . the gaussian shape of eq 5 will be recovered in the slow fluctuation limit , which is specified by comparing the relaxation rate to the magnitude of fluctuations , i.e. , . following the procedure of ref ( 29 ) ( see appendix a ) , we approximate eqs 4245 by16171819where g is the auxiliary line broadening function20the classical , real valued ffcf implies i m (t ) = 0 . in this case , we recover the gaussian line shape of eq 5 by insertion of eqs 1619 into eqs 2 and 11 . the correspondence between dynamics generated by the spin boson hamiltonian and classical gaussian fluctuations is thus established . , the photon emission follows the evolution during waiting time t2 on the excited state potential surface . according to the franck condon principle the waiting time evolution of q starts from the ground state equilibrium . if the excited state equilibrium is different , microscopic reversibility ( eq 8) is violated and the energy is dissipated , resulting in the stokes shift . in contrast , the gsb pathways exhibit similar frequencies of absorbed and emitted photons . the ground state evolution obeys eq 8 and remains much closer to the stochastic line shapes of section 2 . line shapes of gsb pathways21are gaussians ( eq 5 ) around transition frequency eg . the se contributions are different due to the factor e in eqs 17 and 19 . the gaussian line shapes defined by eq 5 are retained , but the peak is shifted along the 3 axis below the diagonal by 4 i m (t2):22the total 2d signal ( eq 11 ) is thus a combination of the two shifted gaussian peaks . the waiting time evolution ( figure 3 ) shows two combined effects : ( i ) correlation loss similar to that in figure 1 ( i.e. , change of contours from elongated ellipse to circle ) and ( ii ) the development of stokes shift for se contributions . at short times t2 0 , the stokes shift i m (t2 ) is small with no apparent influence on shape . with increasing t2 , the stokes shift becomes significant ( asymptotically i m ( ) ) and deforms the elliptic peak shapes . effects of the time dependent ( t2 = 0.1 , 0.5 , 1 from left to right ) stokes shift on bcl ( black ) and fcl ( red ) . we now examine the extent to which the ffcf can be measured by cls in the presence of the stokes shift . three distinct regions with different bcls were uncovered in figure 3 , right panel . for 3 eg the line shape is dominated by gsb contribution and the bcls followsfor 3 eg 4 i m (t2 ) , the bcls follows the se contribution and thusthis indicates that ffcf can be measured on the peak s periphery . unfortunately , as will be demonstrated below , the peripheral bcls is often distorted by motional narrowing or anharmonic effects . in the central region the relation between ffcf and bcls is complex , because the taylor expansion around the peak center suggeststhe bcls is thus inapplicable as a direct measure of the ffcf in the presence of stokes shift . we next turn to the fcls , maximizing the signal along 3 . in a typical situation shown in the left and central panels of figure 3 gsb and se contributions are strongly overlapped . their sum exhibits only a single maximum , located halfway between the maxima of gsb and se signalsthe fcl is linear , shifted by 2 i m (t2 ) from the diagonal , but its slope remains unchanged following both the gsb and se . we thus conclude that , from a theoretical point of view , the fcls is a better measure for the ffcf . for large stokes shift the se and gsb peaks start to separate , and the line shape along 3 is flat . the global maximum becomes ill defined , as demonstrated in the right panel of figure 3 around 1 = 1.8. for very large stokes shift se and gsb peaks become separated , and center lines are better considered as local measures for each observed peak . exact response functions ( eqs 4245 ) of the spin boson model apply to both slow and fast spectral diffusion . line shapes in the regime of fast spectral diffusion will be analyzed in the limit of eq 14 , i.e. , approximating the ffcf by the peaks in 2d electronic spectra are lorentzian in this limit , with purely vertical ( horizontal ) bcl ( fcl ) and no waiting time dynamics , defined by23where ( 2)/( ) and represents the rate of pure dephasing . finite fluctuation time scales shall be treated numerically , / is varied in figure 4 . contours in the intermediate regime change significantly from the edges to the center of the peak . eg reflect deviations far from equilibrium , where relaxation is fast and the contours assume star - like structures ( eq 23 ) of fast ( homogeneous ) processes . the bcl is then aligned almost vertically to the 3 axis , even for slow spectral diffusion shown in the right panel of figure 4 . near the center of the peak at eg min(, ) , the relaxation is slow and the gaussian structures of eq 5 can be observed , with elliptic contours and with a bcl and fcl closer to the diagonal representing ffcf along with eqs 6 and 7 in figure 1 . the bcls is sensitive to waiting time t2 primarily in the central region where the bcls can be deduced . note that time scale effects do not modify time - reversal symmetry ; line shapes with insignificant stokes shift i m (t ) 0 obey a symmetry relation similar to eq 8 beyond the slow fluctuation limit . the fcl thus still approximates a mirror image of the bcl . interpolating from slow bath ( / = 10 , left panel ) to fast bath limit ( / = 0.5 in the right panel ) at waiting time t2 = 0.5 , with = 0.001 . the form of eq 23 , with dephasing rate as the only line shape - determining parameter , is reminiscent of effects of spontaneous emission on line shapes . indeed , radiative dephasing can be accounted for by adding a gaussian coordinate with to the correlation function . however , the relation between cls and ffcf ( eq 6 or 7 ) becomes less straightforward . because the radiative rate is often known , one can speculate that 2d spectra could be more easily interpreted , when the effect of on line shapes is removed by post processing of the 2d data in the time domain , i.e. , by multiplying the response function by e. solving practical difficulties of such a procedure is , however , left for future work . vibrations appear in the absorption spectrum as additional displaced peaks , referred to as vibrational ( vibronic ) progression . in 2d , besides a rich dynamical peak structure , vibrations also induce waiting time oscillatory dynamics of the principal peak , which will be the focus of this section . we separate the environmental effects on an electronic transition into a solvent - related response r and a vibrational response r , e.g.,24and similarly for the other pathways of figure 2 . for the solvent response , we assume the gaussian line shapes of the slow diffusion limit eq 1619 , the response of an underdamped vibration r can still be calculated in the framework of the spin boson hamiltonian ; i.e. , we can use the cumulant expressions eqs 4245 , but with the ffcf of a weakly damped harmonic oscillator ( see appendix b ) approximated by25where is the vibrational frequency , v is vibrational coupling , and is the damping rate . equations 14 , 24 , and 25 fully define the model and were used to simulate the results shown in figures 5 and 6 . for a better understanding , we will analyze some important limits of this model . waiting time evolution of center lines for a vibrationally modulated transition as described in eq 25 in the parametric regime consistent with eq 26 . top panel : evolution of bcls for a vibrationally modulated two - level system at the solvent relaxation time scale . the rephasing , nonrephasing , and total absorptive signal are shown in blue , red , and black , respectively . bottom panel : the same at the vibrational relaxation time scale . other parameters are / = 100 , / = 3.75 , / = 0.1 , v/ = 0.0025 , = 0.01 . simulations were carried out using the full cumulant solution eqs 24 , 25 , 50 , and 4245 . damping rate retrieved by different measures . black line : vibrational decay ( to be retrieved ) e. black dots : bcls . red dashed line : peak volume of dp2 peak ( diagonal peak representing first vibration ) . parameters are / = 100 , / = 2.5 , / = 0.1 , v/ = 0.0025 , = 0.01 . oscillatory amplitudes were retrieved from the difference between consecutive local maxima and minima along t2 , followed by normalization at t2 = 0.52 to e. simulated 2d electronic spectra depend on parametrization . we adopt a regime related to experiments on znpc , where the principal peak at ( eg , eg ) is spectrally resolved ( > , v ) from peaks in the vibronic progression at ( eg n , eg m ) . we can then expand the response function in powers of v/ and neglect components oscillating in t1 and t3 intervals sin(t1,3 ) , cos(t1,3 ) . the only harmonic variation relevant for the principal peak occurs during the waiting time interval cos t2 , sin t2 . to first order in v/ , using eqs 4245 and 49 , we thus approximate we next use eq 24 and combine the vibrational contribution with the solvent response r in the slow limit as expressed in eqs 1619 . transformation into the frequency domain eq 2 is made with the use of the convolution theorem . for example , the nonrephasing contribution is a convolution of gaussian line shape ( eq 5 ) with the fourier image of the characteristic function of the t1 , t3 > 0 quadrant where p.v . stands for the ( cauchy ) principal value . after summing r and n signals and taking the real part ( eqs 2 and 3 ) , we obtain for gsb responseswhere i = i ( eg 2v ) . the se response functions read26with 1 = 1 ( eg 2v ) and 3 = 3 ( eg + 4 i m (t2 ) the standard gaussian solvent line shape of absorptive nature represented by the first line in eq 26 is modulated by the second , harmonic term the sin(t2 ) terms cancel in the total signal , when the solvent stokes shift vanishes , i m (t2 ) 0 , rendering it negligible in most realistic cases . the numerical simulations based on full cumulant expressions ( eqs 4245 ) are shown in figure 5 . line shapes of the principal peak are similar to those in figure 4 , but the bcls , fcls is oscillating with the waiting time t2 . in figure 5 the bcls of total , rephasing and nonrephasing signals were extracted from the central ( linear ) area of the peak . we noted three significant dynamical time scales : ( i ) the overall trend of bcls represents solvent relaxation on a time scale ( figure 5 , top panel ) , ( ii ) vibrational oscillations of the bcls on a time scale mainly derive from the nonrephasing part of signal which are ( iii ) damped away with a rate of . in the present simulation we separated time scales in a realistic parametric regime of > ( i.e. , underdamped vibration , damped still before the solvent is relaxed ) . we shall next analyze the bcls quantitatively and discuss the possibility of extracting , , , v , , etc . from experiments . the effects of the oscillatory cos ( t2 ) term on bcl are complicated , but they can be circumvented by averaging the signal over a period of 2/. the solvent ffcf can thus be measured by averaging the bcls over the period from which the solvent parameters , can be deduced according to section 2 . the relation between the oscillations of the bcls and the vibrational ffcf is complicated . we can straightforwardly measure the vibrational frequency . in certain parametric regimes , an exponential decay of oscillatory amplitude may be observed and attributed to vibrational damping . our simulations show ( bottom panel of figure 5 ) , however , that such an approach for determining works surprisingly poorly at early t2 times where the peaks are narrow and the bcl ( fcl ) is almost static . we have addressed this behavior in appendix c , eq 52 , where line shapes were analyzed around the peak center . neglecting solvent stokes shift , the bcls has been approximated by27and fcls as its axial image . at short times , c(t2 ) 1 t2 , the magnitude of oscillations is modulated by a singular prefactor t23/2 , which thwarts direct extraction of using a simple fit of an exponential form e. instead , using the form of eq 27 , one can substantially improve the experimental determination of . in figure 6 we compare methods for deducing out of the 2d spectrum . , we will study oscillations of bcls and its correction obtained by multiplying bcls by t to eliminate the singular factor t ( eq 27 ) , as just disscused . the other approach is based on measuring peak volumes in electronic 2d spectra . in particular , we measured the oscillations of the volume of the principal peak ( dp1 ) and for the first diagonal peak of the vibrational progression ( dp2 ) . oscillatory amplitudes shown at figure 6 were defined as the difference between consecutive local maximum and minimum of the bcls oscillatory curve of figure 5 . a typical result is shown in figure 6 in the semilog scale , where the exponential decays are linear lines . we conclude that the peak volume of the higher lying diagonal peak dp2 and the corrected bcls reproduce the correct decay rate , whereas the untreated cls and the volume of dp1 fail to do so . we note that differences between the dp1 and dp2 peaks is due to the constructive ( destructive ) interference of r and n signals for dp2 ( dp1 ) . the cls correction factor retrieved from eq 27 has been shown to be essential for extracting the correct decay rate . we note that the need of the correction factor can be lesser beyond the slow fluctuation limit . we also investigated the role of the parametric regime ( v , , , i m 0 ) used in our analysis . we compared eqs 26 and 27 with the full simulations used in figures 5 and 6 . we found that the quadratic term ( v/ ) should not be completely neglected in real situations ( whenever the vibronic modulation is apparent ) , so one should not rely on eqs 26 and 27 quantitatively . however , all the features discussed above , such as the amplitude of cls oscillations , their damping , and the short time t modulation , are kept beyond the linear regime and are in fact even more clearly pronounced . the elementary understanding of 2d line shapes outlined by eq 4 suggests additional explanations for the emergence of atypical ( nonlinear ) cl such as observed in znpc . a linear cl is a direct consequence of harmonic potential surfaces within the spin boson model . another example emerges when the transition frequency is a nonlinear function of a harmonic coordinate . boson hamiltonian , where a full quantum - mechanical treatment is difficult , and researchers mostly approximate by calculating few higher cumulants . we thus prefer to approximate the 2d line shape by a joint distribution of electronic transition frequencies ( eq 28 ) following a classical diffusive coordinate q. a two - level system modulated by a classical diffusive anharmonic coordinate should be analyzed by means of stochastic quantum dynamics ( sqd ) , which has been elaborated in detail elsewhere . to bring sqd to finite temperatures , the ground state vg ( gsb diagram ) and the excited state ve ( se diagram ) state potential surfaces for the spectral diffusion are allowed to be different . this modification of classical sqd was introduced by ref ( 55 ) and , for harmonic surfaces , it is equivalent to the kubo ( eq 4 ) the gsb can be approximated as a joint probability of transition frequency following equilibrium spectral diffusion on the ground state potential surface28the se contribution is represented by a joint distribution of transition frequencies following nonequilibrium spectral diffusion on the excited state potential29 the diffusion of a classical coordinate q on the potential surface is described by a smoluchowski equation30where is reciprocal temperature , and d the diffusion constant . the potential surface vi is different for the electronic ground vg and excited states ve . diffusion can be equivalently modeled by an asymmetric random walk with step length , sampling time t and probabilities to step forwardand backward31 coordinate q is not changed during excitation ( franck condon principle ) . the smoluchowski equation ( eq 30 ) thus should be solved with the initial conditionwhich is the ground state boltzmann distribution for both gsb and se diagrams . condon principle , the transition frequency (q ) reflects gap between electronic ground and excited state32 the joint distribution of the q coordinates should be transformed into frequency joint distributions using33 in the simplest case the q coordinate is linear to the fluctuations of the transition frequency and can be rescaled to represent them directly34equation 33 then reads . the overdamped brownian oscillator correlation function ( eq 14 ) used corresponds to diffusion on harmonic potential surfaces35where is the force constant related to coupling in eq 14 by = 1/(2 ) . the joint distribution ( eq 30 ) for the gsb is a gaussian36with ffcf and obeys eq 8 . correspondence to figure 1 is established with 2d and 1/(2 ) . the maximum of the gaussian packet ( eq 36 ) qg(t ) started from qg(t=0 ) = q(0 ) and approaches the center of potential at q = 0 as qg(t ) = eq(0 ) . this shows directly that the fcl is linear with the slope e. the time - reversal symmetry ( eq 8) guarantees for the 2d line shape axial symmetry along the diagonal rgsb(1,t2,3 ) = rgsb(3,t2,1 ) . the bcls thus assumes the slope e , in perfect agreement with the results of section 2 . similar analysis of diffusion on excited state surface recovers line shapes of se pathway . we next discuss cl in the presence of the anharmonic potential surfaces . as the additional effect of stokes shift would not affect our conclusions on anharmonic spectral diffusion , we adopt the high temperature limit where the stokes shift becomes much smaller than the peak width and thus rse rgsb in the following simulations . we start with a simple form of an anharmonic potential37 the above potential is in part harmonic , but the linear back force has different force constants for positive and negative q. far from the center , the line shapes are approximately gaussian and related to figure 1 by mapping = 2d and = for low ( ) and ( + ) high frequencies , respectively . fcl follows a typical trajectory q(t ) = eq(0 ) for q 0 , and q(t ) = eq(0 ) for q 0 , where d is the diffusion constant . figure 7 shows simulation results of the diffusion model outlined by eqs 30 , 31 , and 37 with the predicted asymptotic properties , i.e. , a cl with two linear sections and a transition region around eg . waiting time evolution of a 2d - signal for a potential that is harmonic in parts , eq 37 , shown at times t2 = 0.1 , 0.4 , 0.8 for parameters +/ = +/ = 0.2 . similar behavior can be observed in figure 8 for a more realistic and smooth form of anharmonicity , which is achieved after adding a cubic term to the harmonic ground state potential38the curvature of bcl is proportional to 3 and evolves with waiting time . we thus conclude that spectral diffusion in an anharmonic potential is represented by a curved cl in electronic 2d spectra . waiting time evolution of a 2d - signal for a cubic anharmonic potential , eq 38 , at t2 = 0.1 , 0.4 , and 0.8 . the extent of anharmonicity is characterized by the ratio of harmonic and cubic terms at the equilibrium half - width = 3.75 . we shall now analyze the cl when the ground and excited state surfaces are harmonic but have a different curvature e g39the transition frequency in the condon approximation ( eq 32 ) becomes a nonlinear function of the harmonic coordinate q40the q - coordinate during diffusion on both excited and ground state is gaussian , however , the transition frequency is not . a nonlinear transformation , eq 40 , between gaussian q and non - gaussian distributions must be simulated with full use of the general rule , eq 33 . the resulting 2d spectra are shown in figure 9 , where we observe a moderate curvature of the cl that is t2 dependent and e g proportional . we note that in this model the cl is visually only moderately curved unless differences between e and g are rather large ( > 10% ) . effect of nonlinear coupling ( eq 39 ) when the ground and excited electronic potentials have different curvatures the ground state width is defined as . the shift between ground and excited state the diffusive motion of the gaussian coordinate q still follows qg(t ) = eqg(0 ) in the ground state ( eq 36 ) . the initial position q(0 ) shall be obtained from inverting eq 4041where we assumed 4( eg)(e g ) < 1 . in the present subsection stands for taylor expansion to second order in (0 ) eg . the maxima of q and distributions may be slightly different due to the jacobian in eq 33 , but the difference is usually small and we shall neglect it for the present analysis . the frequency evolution in ground state is thenand the fcl is represented by graphing (0 ) vs g(t ) . the joint probability for se pathways ( eq 30 ) isthe center of this gaussian distribution approaches the excited state potential minimum asthe evolution of transition frequency readsgsb and se line shapes are usually similar , being only slightly shifted along 3 . we can thus conclude that cl of eq 39 are curved e g , which was confirmed by the full simulation shown in figure 9 . as a simple test case for the methodology developed in the previous sections , we analyze the 2d spectra of zinc phthalocyanine ( znpc ) . znpc is a rigid , planar , and square symmetric ( d4h ) molecule ( see figure 10 for its molecular structure ) . the absorption spectrum ( bottom panel ) shows a narrow electronic transition at 14 850 cm . peaks of lower intensity shifted by a 700 cm and b 1600 cm are readily identified as vibronic side bands . bottom left : absorption spectrum of znpc dissolved in benzonitrile ( solid blue line ) . top left : 2d electronic spectrum of znpc dissolved in benzonitrile measured at room temperature and t2 = 96 fs . the experimental details of the 2d es measurements of znpc ( figure 10 ) have been published previously . briefly , excitation pulses tunable throughout the visible spectral range are provided by a home - built noncollinear optical parametric amplifier , pumped by a regenerative titanium - sapphire amplifier system ( rega 9050 , coherent inc . ) at 200 khz repetition rate . pulse spectra were chosen to overlap with znpc s absorption spectrum ( figure 10 , lower panel ) and compressed to a width of sub-8 fs that was determined using intensity autocorrelation . the pulses were attenuated by a neutral density filter to yield 8.5 nj per excitation pulse at the sample . this corresponds to a fluence of less than 3.0 10 photons / cm per pulse . the setup employed for 2d es relies on a passively phase stabilized setup with a transmission grating and has a temporal resolution of 0.67 fs for t1 , and 5.3 fs for t2 . the emerging third - order signal was spectrally resolved in 3 by a grating - based spectrograph and recorded with a ccd camera . at given t1 and t2 delays , sample circulation was accomplished by a wire - guided drop jet with a flow rate of 20 ml / min and a film thickness of approximately 180 m . znpc was dissolved in benzonitrile , and the concentration was set to obtain an optical density of 0.13 od measured directly in the flowing sample jet . an example 2d spectrum is shown at delay time t2 = 96 fs in figure 10 . the signal has positive and negative features , the latter indicating excited state absorption ( esa ) . we therefore consider an energy level structure involving three states , i.e. , electronic ground , one first excited and one doubly excited state . vibrational modes identified in the absorption spectra are considered as two underdamped harmonic oscillators as described in section 3.3 . we next analyze the shape and the center line of the principal peak dp1 of the znpc spectrum ( figure 10 ) using the models presented in the previous sections . focusing on the bcl ( black line ) , the main experimental observations are as follows : ( i ) the center line is curved and the slopes within the high and low frequency regions are somewhat different . ( ii ) the larger slope in low frequency periphery can be attributed to motional narrowing described in sub section 3.2 . in the high frequency periphery no signatures of motional narrowing were apparent due to interference with other peaks such as the esa . ( iii ) the slope shows fast periodic modulation on time scales similar to the period of 700 cm vibrational mode , in line with the discussion of sub section 3.3 . ( iv ) the effect of the stokes shift on the cls of dp1 , as discussed in section 3.1 , is negligible given its relatively small value of 175 cm and its large associated time scale of up to 2.5 ps compared to 96 fs of our experiment . and finally ( v ) quantum chemical studies suggest that anharmonicity of the involved potential energy curves is negligible for znpc and thus anharmonic corrections discussed in section 4 are not relevant to this discussion . thus , we reach a qualitative understanding of znpc using the bcl . given the multitude of influencing factors stated above , no simple expression for bcl of fcl can be given for znpc . instead , both quantities must be retrieved from modeled spectra . in an effort to quantitatively describe the experimental znpc spectra , we therefore implemented the spin boson model with two underdamped oscillators with prescribed as eq 25 ; esa contributions were included using eq 46 and homogeneous dephasing as the fast component of relaxation . the conventional approach to evaluate the quality of a fit between model and experiment is to visually compare simulated and measured 2d spectra . such a qualitative assessment can be made in figure 11 , where experimental and simulated 2d spectra of znpc are plotted . the experimental data were collected with a waiting time step of 12 fs from 0 to 96 fs covering two periods of a slower ( 700 cm ) vibrational mode with period of 48 fs . visually , the experimental and simulated dp1 peak seems quite similar and the cl also compares well . slight differences between the cl s can be observed in the low frequency periphery of dp1 and are attributed to the lower stability of cl in peripheral regions as well as interference from a low energy cross peak in the simulation that is not present or , at best , not well resolved in the experimental data . as described , visual inspection of 2d plots can often be misleading ; we thus focus on center lines and slopes as these lower - dimensional objects are easier to compare . comparison of experimental ( top row ) and simulated ( bottom row ) 2d es of znpc at waiting times t2 = 2496 fs . simulations assume a three - level chromophore modulated by an overdamped solvent mode ( eq 14 ) and two underdamped vibrational modes ( eq 25 ) . the color scale is the same as in figure 10 . parameters for simulation were retrieved as follows : a = 700 cm , b = 1600 cm , eg = 15000 cm . vibrational parameters : v , a = 40 cm , v , b = 160 cm , a = 10 cm , b = 150 cm . parameters for esa pathway ( eq 46 ) ef = 15300 cm , gff = gee . temperature t = 300 k. figure 12 compares the slopes of bcl for simulated and experimental data . the bcls were measured by linear regression using only the central part of bcl for both experimental and simulated 2d spectra . it was found that the central part is more linear than the periphery and thus better for regression analysis without practical difficulties . for znpc , practical values for the linear region of the bcl slope are for maxima determined for peak values greater than 0.70.8 of the peak intensity ( with respect to dp1 maximum ) . inverse of bcls extracted from experimental ( black line ) and simulated ( red line ) 2d es of znpc . the cls dynamics for znpc within the experimental time window show a dominant oscillatory modulation with the expected period of 48 fs associated with the underdamped 700 cm mode . the simulation parameters , eg , a , and b were estimated from the absorption spectrum . global properties of 2d spectra ( such as antidiagonal width of peaks ) determined homogeneous rate . couplings and vibrational relaxation time scales ( , v , ) were obtained by fitting the bcls dynamics in figure 12 . solvent relaxation was determined to be negligible ( < 5 cm ) though due to the temporal resolution of the experiment , this estimate is uncertain . note that the retrieved coupling constant of the dominant mode v , a = 40 cm , fitted form bcls corresponds to the huang rhys factors , i.e , v , a = 39.2 cm reported from analysis of the absorption spectrum . generally , the experimental and simulated bcls show similar trends ; the discrepancy at early waiting times arguably result from pulse overlap artifacts that were not included in the model . we note that moderate changes of the model parameters had a pronounced effect on bcls . this is in contrast to visual control of 2d peaks , where only rather extreme changes are visually recognizable . comparison via clss ( figure 12 ) is thus a better indicator of successful simulation than comparison of 2d plots . here we summarize the merits of cls analysis of electronic 2d spectra . compared to 2d ir spectra , where the cls is often a straightforward measure of the ffcf , our interpretation of typical electronic transition met several obstacles . we analyzed physical processes and regimes typical for electronic transitions such as stokes shift , finite fluctuation time scales , and anharmonicity of electronic surfaces . these processes result in non - gaussian line shapes , where the linear character of the cl breaks down , and thereby result in a less direct relation between cls and ffcf . we still , however , identified specific regions of the cl , where the ffcf can be extracted in a simple manner and in other cases connected the geometric characteristics of the cl with microscopic parametrizations . we also highlighted differences between bcl and fcl and their dynamical implications . to assess the applicability of cl , we analyzed experimental data of znpc , where 2d es showed atypical curved ( or multilinear ) bcls . we explained this feature using the spin boson hamiltonian in a parametric regime where ( i ) motional narrowing affects the low frequency periphery of the peak and ( ii ) the high frequency region is affected by interference with esa pathways . cls analysis proved to be a sensitive test for line shape oscillations originating from underdamped vibrations . these oscillations were superimposed on a slow exponential decay of cls caused by solvent spectral diffusion . this provided a correct measure of vibrational damping and other parameters that would otherwise be difficult to access . although cl analysis of electronic 2d spectra is certainly less straightforward and less powerful than in the ir , the method presented here provides a benchmark to estimate the quality of simulated data . cl analysis in 2d es thereby helps to characterize all system parameters , even for electronic transitions , and serves as a one - dimensional reduction of complex two - dimensional electronic spectra and thereby facilitates the quality assessment of simulated data .
bladder cancer ( bca ) was estimated to be the seventh most common type of cancer worldwide in 2009 . in poland , bca was the third most frequent malignant tumor in men and thirteenth in women in 2009 . etiology of bca includes environmental factors such as exposure to tobacco smoke , occupational exposure , and geography of selected infectious diseases like schistosomiasis . the group of patients with non muscle invasive disease ( nmibc ) covers 75% and muscle invasive disease ( mibc ) covers 25% of bca patients . about 20% of nmibc occur as recurrences of mibc and are related with an increased risk of metastases and low survival . therefore , more extensive studies are currently in progress to elucidate the importance of the various tumor characteristics or genetic factors in the areas of bca risk , recurrence or progression [ 5 , 6 ] . mmps are implicated in various stages of physiological processes such as embryonic development , ovulation , wound healing , and pathophysiological processes like heart failure , arthritis , atherosclerosis , periodontal disease , bone remodeling , and carcinogenesis . mmps can hydrolyze most of the extracellular matrix ( ecm ) components , a range of non matrix proteins , matrix substrates , and bioactive substrates . mmps can also release from the ecm the signaling molecules important in tumor progression and metastasis . mmps are the enzymes that are able to organize the tissue architecture required in the process of carcinogenesis and contribute to cell adhesion , epithelial to mesenchymal transition , and tumor angiogenesis . mmp7 also known as matrilysin1 or pump1 , possesses broad substrate specificity , and can degrade collagen types : iv , v , ix , x , xi , aggrecan , entactin , laminin , vitronectin , fibrin / fibrinogen , tenascin , gelatin , fibronectin , and other substrates of the ecm components . mmp7 expression can promote cancer cell growth and thus can be associated with tumor invasion , recurrence and poorer survival for various malignances [ 916 ] . mmp8 , commonly known as collagenase2 or neutrophil collagenase , hydrolyzes collagen types : i , ii , iii , vii , x , gelatin , entactin , tenascin , aggrecan , and other ecm components . mmp8 is one of mmps that has been found to produce anticancer effects due to its ability to inhibit tumorigenesis and metastasis [ 17 , 18 ] . cancer studies conducted over eight years have found an association between the development of specific cancer sites and functional polymorphisms that can alter gene expression located in the promoter regions of mmp7 ( rs11568818 ) and mmp8 ( rs11225395 ) [ 1923 ] . however , there have been no association studies of mmp7 and mmp8 polymorphisms in bca risk in the caucasian population . therefore , the objective of this association study was to evaluate polymorphisms in mmp7 and mmp8 and characterize their associations with bca susceptibility in a population of patients from d . bca patients were recruited from the first department of urology , medical university of ldz and nofer institute of occupational medicine in d from 2007 to 2013 . the 241 bca patients and 199 healthy population controls were recruited from an ethnically homogeneous polish population . data on histological cancer grades diagnosed at the first department of urology were not accessible for all cases . all of the bca patients underwent transurethral resection and had histopathologically confirmed nmibc or mibc at various tumor ( t ) stage and grade ( g ) of neoplasm . the tumor stage ( 87.1% of diagnosed bca patients ) , and tumor grade ( 89.2% of diagnosed patients ) were included in the association analyses . to evaluate differences between mmp7 or mmp8 genotypes and tumor grade or stage , patients with bca were divided into categories : group 1 ) with g1 , and group 2 ) with g2 and g3 or group 1 ) with t1 , and group 2 ) with t2t4 , respectively . all patients with missing data were excluded from these analyses . additionally , to examine the joint effects of mmp7 or mmp8 genotypes and tobacco smoking status on bca risk , we stratified cases and controls into three categories : 1 ) never smokers persons who had never smoked in their lifetime , 2 ) ex smokers individuals who were abstinent for at least 1 year before the interview , 3 ) smokers persons who stated they currently smoked cigarettes or who were abstinent for up to 1 year before the interview . the study was approved by the local ethical committee of the nofer institute of occupational medicine . the genomic dna was isolated from the peripheral blood samples of the study subjects using commercial dna kits qiaamp dna mini kits ( qiagen ) following the manufacturer 's protocol . the promoter single nucleotide polymorphisms ( snps ) in the mmp7 ( rs11568818 ) and mmp8 ( rs11225395 ) genes were genotyped using taqman fluorescent probes , assays on demand ( assay i d : c_27852953_10 and c_1366493_10 , respectively ) ( life technologies ) . all patients and controls were genotyped using real time pcr cfx96 system ( biorad ) . group characteristics were determined by the ( chi square ) test and student 's t test . weinberg equilibrium ( hwe ) was tested by comparing the observed and expected genotype frequencies in cases and controls at equilibrium based on the test at a significant level of p < 0.05 . the strength of the association between genetic polymorphisms in the mmp and bca susceptibility was measured by odds ratios ( ors ) corresponding to 95% confidence interval ( 95% ci ) . ors and 95% ci were determined by logistic regression analyses using additive models that included adjustment for age , gender , and cigarette smoking status . major allele homozygotes served as the reference group , and heterozygotes and minor allele homozygotes were separately compared . the association between the mmps genotype frequencies and characteristics was estimated by fisher 's exact test using the stata 11 ( statacorp lp , usa ) software . all statistical tests presented in this paper are two sided and p values were considered to be statistically significant when p 0.05 . bca patients were recruited from the first department of urology , medical university of ldz and nofer institute of occupational medicine in d from 2007 to 2013 . the 241 bca patients and 199 healthy population controls were recruited from an ethnically homogeneous polish population . data on histological cancer grades diagnosed at the first department of urology were not accessible for all cases . all of the bca patients underwent transurethral resection and had histopathologically confirmed nmibc or mibc at various tumor ( t ) stage and grade ( g ) of neoplasm . the tumor stage ( 87.1% of diagnosed bca patients ) , and tumor grade ( 89.2% of diagnosed patients ) were included in the association analyses . to evaluate differences between mmp7 or mmp8 genotypes and tumor grade or stage , patients with bca were divided into categories : group 1 ) with g1 , and group 2 ) with g2 and g3 or group 1 ) with t1 , and group 2 ) with t2t4 , respectively . all patients with missing data were excluded from these analyses . additionally , to examine the joint effects of mmp7 or mmp8 genotypes and tobacco smoking status on bca risk , we stratified cases and controls into three categories : 1 ) never smokers persons who had never smoked in their lifetime , 2 ) ex smokers individuals who were abstinent for at least 1 year before the interview , 3 ) smokers persons who stated they currently smoked cigarettes or who were abstinent for up to 1 year before the interview . the study was approved by the local ethical committee of the nofer institute of occupational medicine . the genomic dna was isolated from the peripheral blood samples of the study subjects using commercial dna kits qiaamp dna mini kits ( qiagen ) following the manufacturer 's protocol . the promoter single nucleotide polymorphisms ( snps ) in the mmp7 ( rs11568818 ) and mmp8 ( rs11225395 ) genes were genotyped using taqman fluorescent probes , assays on demand ( assay i d : c_27852953_10 and c_1366493_10 , respectively ) ( life technologies ) . all patients and controls were genotyped using real time pcr cfx96 system ( biorad ) . group characteristics were determined by the ( chi square ) test and student 's t test . weinberg equilibrium ( hwe ) was tested by comparing the observed and expected genotype frequencies in cases and controls at equilibrium based on the test at a significant level of p < 0.05 . the strength of the association between genetic polymorphisms in the mmp and bca susceptibility was measured by odds ratios ( ors ) corresponding to 95% confidence interval ( 95% ci ) . ors and 95% ci were determined by logistic regression analyses using additive models that included adjustment for age , gender , and cigarette smoking status . major allele homozygotes served as the reference group , and heterozygotes and minor allele homozygotes were separately compared . the association between the mmps genotype frequencies and characteristics was estimated by fisher 's exact test using the stata 11 ( statacorp lp , usa ) software . all statistical tests presented in this paper are two sided and p values were considered to be statistically significant when p 0.05 . we analyzed genetic polymorphisms in the promoter region of mmp7 and mmp8 in 241 bca patients and 199 controls from poland . in table 1 we summarized demographics , cigarette smoking status , and clinical characteristics of the patients . statistically significant differences were observed between bca cases and controls in terms of the distribution of gender ( p = 0.001 ) and tobacco smoking status ( p = 0.001 ) . at the time of bca diagnosis , patients were between ages 64.9 and 67.7 years ( mean 66.1 10.4 ) and were at the same age as the controls ( mean 66.3 10.6 ) ( p = 0.872 ) . the genotype distributions of both chosen polymorphisms were consistent with hardy weinberg equilibrium ( table 2 ) . selected characteristics of the bca patients and healthy controls at the time of diagnosis the number of cases and controls may vary because of some missing data chi square test was used to determine p test was used to determine p value never smokers persons who had never smoked ex smokers individuals who were abstinent for at least 1 year smokers individuals who currently smoke or who were abstinent for up to 1 years before the interview ; nmibc non muscle invasive bladder cancer ; mibc muscle invasive bladder cancer summary of the genetic polymorphisms in the mmp analyzed in this study minus indicates promoter region major / minor alleles and frequencies , as determined by the distribution among the case and controls a major allele , b minor allele hardy weinberg equilibrium p value for the genetic polymorphisms in the mmp7 ( rs11568818 ) and mmp8 ( rs11225395 ) genes , significant differences between genotyped bca patients and controls were not observed . prevalence of mmp7 g / g genotype was only slightly different among patients ( 22.1% ) and controls ( 16.1% ) , and bca risk among mmp7 g / g was estimated to or , 1.54 ; 95% ci , 0.932.55 ; p = 0.093 ( table 3 ) . association of single mmp7 and mmp8 genotypes with bca risk in groups stratified by tobacco smoking status was assessed . the statistical significance of additive effects was not observed among stratified groups ( data not shown ) . we also studied mmp7 and mmp8 polymorphisms and their risk associated with different histology grade of bca . none of the g and t categorized groups of patients were associated with individual mmp7 or mmp8 polymorphisms ( data not shown ) . in order to examine whether the effect of gene gene interactions in mmp7 and mmp8 polymorphisms might change the bca risk , we analyzed various combinations of genotypes . we observed that the combined effect of mmp7 and mmp8 genotypes did not provide statistically significant differences between cases and controls ( table 4 ) , nor in any tobacco smoking status ( data not shown ) . distribution of the genetic polymorphisms in the mmp7 and mmp8 among controls and bca patients genotypes and frequencies , as determined by the distribution among the cases and controls the number of cases and control may vary because of some missing data or , odds ratio , ci , 95% confidence interval odds ratio adjusted for age , gender and cigarette smoking status risk of bca associated with the gene - gene interactions in mmp7 and mmp8 polymorphisms or , odds ratio , ci , 95% confidence interval major allele homozygotes ( reference group ) we analyzed genetic polymorphisms in the promoter region of mmp7 and mmp8 in 241 bca patients and 199 controls from poland . in table 1 we summarized demographics , cigarette smoking status , and clinical characteristics of the patients . statistically significant differences were observed between bca cases and controls in terms of the distribution of gender ( p = 0.001 ) and tobacco smoking status ( p = 0.001 ) . at the time of bca diagnosis , patients were between ages 64.9 and 67.7 years ( mean 66.1 10.4 ) and were at the same age as the controls ( mean 66.3 10.6 ) ( p = 0.872 ) . the genotype distributions of both chosen polymorphisms were consistent with hardy weinberg equilibrium ( table 2 ) . selected characteristics of the bca patients and healthy controls at the time of diagnosis the number of cases and controls may vary because of some missing data chi square test was used to determine p test was used to determine p value never smokers persons who had never smoked ex smokers individuals who were abstinent for at least 1 year smokers individuals who currently smoke or who were abstinent for up to 1 years before the interview ; nmibc non muscle invasive bladder cancer ; mibc muscle invasive bladder cancer summary of the genetic polymorphisms in the mmp analyzed in this study minus indicates promoter region major / minor alleles and frequencies , as determined by the distribution among the case and controls a major allele , b minor allele hardy weinberg equilibrium p value for the genetic polymorphisms in the mmp7 ( rs11568818 ) and mmp8 ( rs11225395 ) genes , significant differences between genotyped bca patients and controls were not observed . prevalence of mmp7 g / g genotype was only slightly different among patients ( 22.1% ) and controls ( 16.1% ) , and bca risk among mmp7 g / g was estimated to or , 1.54 ; 95% ci , 0.932.55 ; p = 0.093 ( table 3 ) . association of single mmp7 and mmp8 genotypes with bca risk in groups stratified by tobacco smoking status was assessed . the statistical significance of additive effects was not observed among stratified groups ( data not shown ) . we also studied mmp7 and mmp8 polymorphisms and their risk associated with different histology grade of bca . none of the g and t categorized groups of patients were associated with individual mmp7 or mmp8 polymorphisms ( data not shown ) . in order to examine whether the effect of gene gene interactions in mmp7 and mmp8 polymorphisms might change the bca risk , we analyzed various combinations of genotypes . we observed that the combined effect of mmp7 and mmp8 genotypes did not provide statistically significant differences between cases and controls ( table 4 ) , nor in any tobacco smoking status ( data not shown ) . distribution of the genetic polymorphisms in the mmp7 and mmp8 among controls and bca patients genotypes and frequencies , as determined by the distribution among the cases and controls the number of cases and control may vary because of some missing data or , odds ratio , ci , 95% confidence interval odds ratio adjusted for age , gender and cigarette smoking status risk of bca associated with the gene - gene interactions in mmp7 and mmp8 polymorphisms or , odds ratio , ci , 95% confidence interval major allele homozygotes ( reference group ) it is generally believed that the development of the invasive phenotype ( advanced metastatic stage of cancer ) and further poor prognosis may be associated with increased expression of mmps [ 22 , 24 , 25 ] . furthermore , we know that mmps regulatory effect may be related to mmp promoter snps . it is considered that the analysis of snps in mmps as prognostic biomarkers , might identify bca patients at an increased risk of lymph node metastasis even before surgery . mmp gene variants may influence their transcriptional activity and protein expression , function , and activity . therefore , they may be associated with cancer risk , prognosis , and responses to treatment . mmp7 over expression is often observed in various malignancies , which supports action on carcinogenesis , while mmp8 possesses inhibitory effect [ 16 , 17 , 26 ] . genetic polymorphism in the mmp7 181 a / g ( rs11568818 ) promoter have been described in several association studies on lung , breast , colorectal , gastric , and prostate cancer , indicating significant association between at least one mmp7 g allele and gastric cancer risk ( or , 1.90 ; 95% ci , 1.432.51 ) , but no consistent results for other types of cancer . mmp7 genetic polymorphism affects the transcriptional activity of that gene and leads to changes in its expression . studies which investigated serum and plasma levels of mmp7 , identified high levels of mmp7 as predictors of bca outcomes . moreover , mmp7 protein expression can correlate with pathologic parameters like tumor stage , tumor grade , and metastasis in bca [ 2931 ] . recent studies on metastatic potential of breast cancer cells show that over expression of mmp8 protein provides a protective effect in the metastatic process . also , in studies of the squamous cell carcinoma of the tongue it has been found that mmp8 protein expression is correlated with improved survival of patients . however , there are only a few case control studies regarding mmp8 799 c / t ( rs11225395 ) impact on cancer development . in vitro data has suggested that promoter mmp8 polymorphism has putative functional significance and higher transcription activity for minor mmp8 t allele compared with mmp8 c allele . indeed , breast cancer risk ( or , 0.7 ; 95% ci , 0.50.9 ) and survival ( or , 0.4 ; 95% ci , 0.20.8 ) was significantly reduced for women carrying the mmp8 allele t [ 35 , 36 ] . however , a study of polish individuals reported that allele t was associated with risk of developing malignant melanoma . in analyzed individuals from central poland , the frequency of mmp7 g alleles was 0.42 , while for mmp8 t it was 0.44 . to compare , in control individuals from d , the frequency of mmp7 g alleles was 0.45 , while in individuals from szczecin , the frequency was 0.39 . in the present association study we tested the hypothesis whether the functional genetic polymorphisms in the mmp7 and mmp8 genes contributed to bca risk . to our knowledge , this is the first study investigating the relationship between mmp7 ( rs11568818 ) and mmp8 ( rs11225395 ) polymorphisms and bca risk in caucasian population . two studies conducted by srivastava et al . in north india population showed significantly higher risk of bca among mmp7 g / g ( rs11568818 ) individuals ( or , 2.38 ; 95% ci , 1.304.34 ) , while mmp8 c / t+t / t ( rs11225395 ) genotype carriers possessed reduced bca risk ( or , 0.27 ; 95% ci , 0.100.69 ) [ 19 , 23 ] . nevertheless , we found that these genetic polymorphisms do not contribute to risk of bca and cancer grade . however , we observed that individuals with mmp7 g / g genotype were at statistically borderline risk of bca ( or , 1.54 ; 95% ci , 0.932.55 ; p = 0.093 ) . we found no additive effect of smoking and genetic polymorphisms in the mmp7 and mmp8 among never smokers , ex smokers , and smokers . additionally , our investigation of the potential combined effect of gene gene interaction between genetic polymorphisms , reported no correlation with bca risk and cancer grade . in this study , the results show no association between the genetic polymorphisms in biologically relevant candidate genes such as mmp7 ( rs11568818 ) and mmp8 ( rs11225395 ) and bca risk in the caucasian population . the small number of cases studied , some associations were not evident . the search for new biomarkers of cancer is still required and more extensive research on genetic polymorphisms of mmp in bca should be undertaken in the future .
the index patient ( patient b2 - 1 ) was a 47-year - old woman , and patient b3 - 1 was her 29-year - old daughter ( figure 1 ) . both were investigated and followed at the neurology outpatient clinic of turku university hospital . the father of patient b2 - 1 was diagnosed with pd at age 52 and died at age 63 . the father of the index patient was diagnosed with parkinson disease at the age of 52 years . patient b2 - 1 presented at age 42 with intermittent numbness in the right arm and leg and fluctuating dysarthria . three months later , mild bradykinesia without resting tremor , mild dysarthria , and hypomimia were observed . two years later , she developed mild parkinsonian posture with symmetric rigidity of the upper extremities . however , she developed motor fluctuations 1 year after levodopa initiation ( 3 years after presentation ) . dyskinesia was most pronounced in the upper limbs and upper body even at very low doses of levodopa . limb rigidity was mildly pronounced in the right - side extremities ( right : grade 2 , left : grade 1 ) ; eye movements were intact . four years after presentation , the unified parkinson 's disease rating scale motor ( part iii ) off score was 31 and the on score was 8 with troublesome peak - dose dyskinesias . because of the motor fluctuations , 5 years after presentation , the patient received treatment with bilateral subthalamic nucleus deep brain stimulation ( stn - dbs ) that reduced fluctuations and increased on time . [ i]fp - cit spect imaging 4 months after presentation revealed clearly decreased dopamine transporter ( dat ) binding bilaterally in the posterior putamen and right caudate ( figure 2a ) . the specific binding ratios ( sbrs ) were 0.59 in the right posterior putamen and 0.59 in the left , and 1.66 in the right caudate nucleus and 2.15 in the left . transaxial planes of [ i]fp - cit spect on the striatal level are presented for 2 patients with parkinson disease harboring the a53e mutation in snca . note the bilaterally decreased uptake that is more pronounced in the putamen and less so in the caudate , with some loss in the right caudate of both patients . patient b3 - 1 presented at age 25 with gait disturbance and left - hand clumsiness . she had a history of panic disorder and depression at the age of 14 years . moreover , she had spastic gait , and lower - limb reflexes were pathologically brisk . mild resting tremor in the left arm and intermittent head tremor were noted 10 months after presentation . after insufficient response to monoamine oxidase b inhibitors and pramipexole , low - dose levodopa was initiated 12 months after presentation with an excellent response . however , at 15 months after the first presentation , the patient developed dyskinesias that were most pronounced in the upper limbs and upper body . after 4 years of follow - up , dyskinesias were prominent even with a very low daily levodopa dose ( 100 mg ) . [ i]fp - cit spect 1 month after presentation revealed decreased activity bilaterally in the putamen and right caudate ( figure 2b ) . sbrs were 0.54 in the right posterior putamen and 0.51 in the left , and 1.64 in the right caudate and 2.16 in the left . because the family had pd with an autosomal dominant inheritance pattern , analyses of the lrrk2 gene ( genbank nm_198578.3 , nc_000012.11 ) exons 24 , 25 , 27 , 29 , 31 , 35 , 41 , and 44 , and the complete coding region as well as the flanking intronic regions of the snca gene ( genbank nm_000345.3 , nm_001146054.1 analysis of the lrrk2 gene revealed no pathogenic mutations , whereas analysis of the snca gene revealed a heterozygous c.158c > a , p.a53e ( a53e ) alteration in both patients . because the a53e variant had been reported in only one other unrelated finnish family with parkinsonism , next - generation sequencing of 73 genes associated with pd or parkinsonism ( medical neurogenetics , atlanta , ga ) was performed to further elucidate the significance of the a53e variant . in patient b2 - 1 , no further pathogenic mutations were detected . in patient b3 - 1 , in addition to the a53e change , a novel heterozygous kif5a variant ( c.611g > c , p.r204p ) was detected . all investigations and clinical work described in this manuscript were performed in accordance with the ethical guidelines issued by our institution for clinical studies as well as the declaration of helsinki . written informed consent was obtained from all patients . patient b2 - 1 presented at age 42 with intermittent numbness in the right arm and leg and fluctuating dysarthria . three months later , mild bradykinesia without resting tremor , mild dysarthria , and hypomimia were observed . two years later , she developed mild parkinsonian posture with symmetric rigidity of the upper extremities . however , she developed motor fluctuations 1 year after levodopa initiation ( 3 years after presentation ) . dyskinesia was most pronounced in the upper limbs and upper body even at very low doses of levodopa . limb rigidity was mildly pronounced in the right - side extremities ( right : grade 2 , left : grade 1 ) ; eye movements were intact . four years after presentation , the unified parkinson 's disease rating scale motor ( part iii ) off score was 31 and the on score was 8 with troublesome peak - dose dyskinesias . because of the motor fluctuations , 5 years after presentation , the patient received treatment with bilateral subthalamic nucleus deep brain stimulation ( stn - dbs ) that reduced fluctuations and increased on time . [ i]fp - cit spect imaging 4 months after presentation revealed clearly decreased dopamine transporter ( dat ) binding bilaterally in the posterior putamen and right caudate ( figure 2a ) . the specific binding ratios ( sbrs ) were 0.59 in the right posterior putamen and 0.59 in the left , and 1.66 in the right caudate nucleus and 2.15 in the left . transaxial planes of [ i]fp - cit spect on the striatal level are presented for 2 patients with parkinson disease harboring the a53e mutation in snca . note the bilaterally decreased uptake that is more pronounced in the putamen and less so in the caudate , with some loss in the right caudate of both patients . patient b3 - 1 presented at age 25 with gait disturbance and left - hand clumsiness . she had a history of panic disorder and depression at the age of 14 years . moreover , she had spastic gait , and lower - limb reflexes were pathologically brisk . she was diagnosed with pd 6 months after presentation . mild resting tremor in the left arm and intermittent head tremor were noted 10 months after presentation . after insufficient response to monoamine oxidase b inhibitors and pramipexole , low - dose levodopa was initiated 12 months after presentation with an excellent response . however , at 15 months after the first presentation , the patient developed dyskinesias that were most pronounced in the upper limbs and upper body . after 4 years of follow - up , dyskinesias were prominent even with a very low daily levodopa dose ( 100 mg ) . [ i]fp - cit spect 1 month after presentation revealed decreased activity bilaterally in the putamen and right caudate ( figure 2b ) . sbrs were 0.54 in the right posterior putamen and 0.51 in the left , and 1.64 in the right caudate and 2.16 in the left . because the family had pd with an autosomal dominant inheritance pattern , analyses of the lrrk2 gene ( genbank nm_198578.3 , nc_000012.11 ) exons 24 , 25 , 27 , 29 , 31 , 35 , 41 , and 44 , and the complete coding region as well as the flanking intronic regions of the snca gene ( genbank nm_000345.3 , nm_001146054.1 , nc_000004.11 ) were performed . analysis of the lrrk2 gene revealed no pathogenic mutations , whereas analysis of the snca gene revealed a heterozygous c.158c > a , p.a53e ( a53e ) alteration in both patients . because the a53e variant had been reported in only one other unrelated finnish family with parkinsonism , next - generation sequencing of 73 genes associated with pd or parkinsonism ( medical neurogenetics , atlanta , ga ) was performed to further elucidate the significance of the a53e variant . in patient b2 - 1 , no further pathogenic mutations were detected . in patient b3 - 1 , in addition to the a53e change , all investigations and clinical work described in this manuscript were performed in accordance with the ethical guidelines issued by our institution for clinical studies as well as the declaration of helsinki . we report a finnish family with autosomal dominant pd harboring the a53e mutation in snca . both patients exhibited prominent bradykinesia but little tremor and early onset of levodopa - induced dyskinesia even at low doses of levodopa . no cognitive decline or dysautonomia was observed after 45 years of follow - up , whereas these features have been reported in association with other pathogenic snca mutations . the features of all reported patients with the a53e mutation are summarized in the table . features of all published patients with the a53e snca mutation the data presented here support the pathogenicity of the a53e mutation . as all patients with the a53e mutation have thus far been of finnish origin haplogroup comparison with the first reported finnish family with the a53e mutation was not possible . however , detailed family history interviews did not suggest a relationship between these 2 families . as was the case in the first report of the a53e mutation , we were not able to recruit any unaffected family members for segregation analysis . however , recent in vitro studies also support the pathogenicity of the a53e mutation . in addition to the a53e mutation , a heterozygous kif5a variant p.r204p was detected in patient b3 - 1 but not in patient b2 - 1 . this variant has not been reported as a polymorphism , and the amino acid is evolutionarily conserved . we suggest that the corticospinal tract signs observed in patient b3 - 1 ( but absent in patient b2 - 1 ) were due to the kif5a variant detected in this patient . the bilateral dopaminergic defect in posterior putamen detected by dat spect was profound and symmetric . the level and regional distribution of dopaminergic degeneration differed notably from the typical findings in patients with early idiopathic pd ( asymmetric binding defect in the contralateral posterior putamen ) . furthermore , the striatal tracer binding was nearly identical between patients b2 - 1 and b3 - 1 , suggesting that the presynaptic dat binding is determined by the mutation . the a53e mutation in snca results in autosomal dominant , hypokinetic - rigid pd with early - onset , prominent levodopa - induced dyskinesia but without dementia . spect imaging findings suggest that the striatal dopaminergic defect in bilateral posterior putamen is profound and symmetric early in the disease with this mutation . dr . martikainen : study design , drafting the manuscript , acquisition and interpretation of data , reviewing the manuscript for intellectual content . dr . pivrinta and dr . kaasinen : study design , acquisition and interpretation of data , reviewing the manuscript for intellectual content .
respiratory resistance is proportional to the total opposition to breathing caused by frictional forces in the airway passages . at any given time , respiratory resistance is equal to the ratio of respiratory pressure to airflow , given by ( 1)rres=presv , where rres is respiratory resistance , pres is the respiratory pressure gradient , and v is airflow [ 1 , 2 ] . increases in respiratory resistance are symptomatic of a number of restrictive and obstructive pulmonary conditions including copd , asthma , and bronchiolitis . useful feedback during administration of endotracheal tubes , anesthesia , bronchodilator medications , and mechanical ventilation can also be given by respiratory resistance measurements . respiratory resistance is composed of resistances of airways , lung tissue , and chest wall components . spirometry , specifically peak expiratory flow ( pef ) and forced expiratory volume in one second ( fev1 ) , has traditionally been the bedside measurement of choice for diagnosing increased resistance . however , spirometric tests do not directly measure respiratory resistances , are dependent on effort and lung volume , and require complete subject cooperation [ 9 , 10 ] . furthermore , since spirometric measurements are principally made during forced exhalation , little insight is normally provided for diagnosing inhalation - related pathologies . although it has been shown that children as young as 5 years of age are capable of performing spirometry , appropriate coaching is required . in contrast to spirometry , passive measurements of total respiratory resistance are a more attractive option for assessing unconscious or noncooperative patients because they require minimal cooperation on the part of the subject . one such method that relies on passive measurements is the forced oscillation technique ( fot ) . the use of fot in young and uncooperative patients , for example , has been extensively studied since the 1980s , and its theoretical background is comprehensively described . the fot determines the mechanical properties of the entire respiratory system ( all three components ) by superimposing a loudspeaker - generated external pressure signal on the normal breathing pattern of a patient . impulse oscillometry ( ios ) is a form of fot that uses short duration pressure impulses as the external driver . these impulses are confined to the respiratory system by a parallel bias tube acting as an inertance element to allow patients to breathe regularly to the atmosphere . dead volume added to the respiratory system by the bias tube can cause respiratory adjustments in airway caliber and depth of breathing . from the in - phase and out - of - phase components of the measured flows and mouth pressures , the ios machine is able to compute respiratory resistance and reactance over a range of frequencies . ios has been shown to be effective in measuring lung function both of children [ 4 , 1518 ] and of adults [ 19 , 20 ] . because it measures total respiratory resistance , ios is an obvious instrument with which to compare apd measurement the apd is an instrument that is seeking clinical acceptance . its advantages over other measurement techniques are that it is small , lightweight , inexpensive , quick , has little external dead volume , and requires little patient cooperation [ 2123 ] . shown in figure 1 , the apd is composed of a pneumotachograph , two differential pressure transducers , a segmented wheel , motor , and a signal conditioning circuit . the device is held by the patient , while the patient breathes normally through a disposable mouthpiece . a periodic resistance is introduced into the flow path by the rotating wheel with open and screened segments . the depths of these perturbations depend on relative resistance inside the patient and resistance of the apd itself . continuous measurement of mouth pressure and flow gives the resistance to the atmosphere of the apd device . from that , it is relatively simple to calculate the patient respiratory resistance as the depth of the pressure perturbation divided by the depth of the flow perturbation . it has been determined from actual measurements that the resistance measured by the apd includes airways , lung tissue , and chest wall components [ 2123 ] . the apd is theoretically similar to both the fot and the interrupter ( int ) techniques in measuring respiratory resistance . like fot , the apd imposes a periodic perturbation on the breathing waveform . unlike fot , the apd determines resistance in the time domain rather than in the frequency domain , easily separates resistance during inhalation from resistance during exhalation , and requires patient breathing to obtain a signal . some of these characteristics are also shared by int , but the apd only partially obstructs airflow during tidal breathing . both pressure and flow signal components are assessed at the same time , so the problem of lung accommodation time that has discredited int measurements is avoided with the apd . apd measurements have been shown to be reproducible and sensitive to resistance changes in human subjects between the ages of 2 and 88 . for example , respiratory resistances measured by the apd clearly show the expected reduction with age as children grow and also the differentiation expected between adult men and women . similarly , studies have shown the apd to be comparable to the esophageal balloon technique and sensitive to resistance changes in a controlled excised sheep - lung respiratory model . the objective of this study was to compare respiratory resistance measurements made with the apd with those made using ios . this comparison was made using two procedures : ( 1 ) in an artificial , nonbiological respiratory model in which resistances were controllable and known and ( 2 ) in human volunteers with external resistances added to their respiratory systems . first , frequency response of the respiratory system is measured by ios , whereas time response is measured by the apd . therefore , many measurements are taken by the apd in the time that it takes the ios machine to take just one . although the ios impulse makes the ios machine capable of quicker readings than the traditional forced oscillation technique , a series of repetitive readings with acceptable coherences is still required for the ios machine to estimate resistance and reactance . by contrast , the apd is theoretically capable of making measurements as quickly as mouth pressure and airflow can be sampled . to reconcile this difference , ios and apd measurements can be made more comparable by averaging apd measurements over a discrete duration , such as one minute . in addition , because the ios impulse contains a range of frequencies , ios can give resistance and reactance measurements at several different frequencies simultaneously . the commercially available ios instrument used in the system described in this paper displayed resistance values at 5 hz and 20 hz as r5 and r20 , respectively . unless the apd wheel speed is changed , the apd is capable of expressing resistance at only the one wheel speed . the second important difference is that the apd signal is developed across and through the varying resistance of the wheel . consequently , there is no phase angle between mouth pressure and flow , so reactance can not be measured as directly with the apd as with ios . as a result , the system by which the devices are validated must be dominated by resistance and not reactance . moreover , since the ios machine produces its signal with a speaker - like transducer , its signal - to - noise ( s / n ) ratio is highest with no respiratory flow rate ( no noise , only signal ) . on the other hand , the apd requires a respiratory flow rate in order to produce a signal , so the higher the respiratory flow rate , the larger is the perturbation . third , the apd can distinguish easily between resistance during inhalation and resistance during exhalation . the ios unit used with the system described in this paper did not have this capability , so the ios resistance reading was compared to the average of inhalation and exhalation resistances from the apd . lastly , the ios machine requires a large power input in order to produce its signal in addition to a separate computer to operate , while the apd does not require any more power than to rotate the wheel and is completely self - contained . thus , the apd can be small , portable , and compact , while the ios machine is a large instrument . whereas this difference does not directly influence the validation procedure , it does influence the physical layout of the components and the interface with the human volunteers . the artificial respiratory model used for apd / ios comparisons had three components analogous to a biological system : a sinusoidal flow source to model breathing , a compliance chamber to model lung compliance , and a controllable resistance to model respiratory resistance . first , a motorized syringe pump ( no . 17050 - 3 ) purchased from vacumed ( ventura , ca , usa ) was selected to be used as the flow generator . the syringe pump was powered by a motor that generated a smooth , continuous sinusoidal flow . the magnitude and frequency of the flow was controlled by adjusting the stroke volume of the pump and the rotational frequency of the motor . in order to mimic human resting breathing , the stroke volume was set to 0.5 l for all experiments , and the motor frequency was set to 18 rpm to give a volumetric flow , v , of 0.15 l s. second , a glass cylindrical container ( height = 44.5 cm , inner diameter = 14 cm ) was installed at the outlet of the piston pump to act as a compliance chamber . because a positive displacement pump delivers nearly the same output if the fluid being delivered by the pump is incompressible , then the pump delivery would be determined solely by the pump and not by downstream resistance . air , however , is compressible , so there is some effect of downstream resistance as air pressure in the piston cylinder increases or decreases . as a result , adding sufficient compliance to the flow pathway so that the extra downstream resistance causes the air to compress in the compliance chamber rather than to be forced through the resistance is one method to make a piston pump sensitive to downstream resistance changes , as required by the apd . the resistance of the system was changed depending on the type and number of resistors installed . 1 and no . 2 pneumotachographs ( phipps & bird , arlington , va , usa ) were used to provide a low range of resistance ( 0.120.31 kpa l s or 1.23.2 cm h2o l s ) , and hans rudolph standard flow resistors ( series 7100r2 , shawnee , ks , usa ) were used to provide a high range of resistance ( 0.190.95 kpa l s or 1.99.7 cm h2o l s ) . previous testing with the apd on people from ages 2 to 88 has shown that this range incorporates the vast majority of expected resistance values . pneumotachographs were placed end - to - end and sealed with rubber connectors cut from mouth pieces in the pulmonary function filter kit purchased from alliancetech medical , inc . hans rudolph standard flow resistors were also placed end - to - end and connected with hans rudolph small connectors ( series 7023 , 22 mm 22 mm ) . the resistance of each individual resistor and each series combination of resistors was carefully measured from their steady - state flow - pressure relationships to provide a nominal value to compare with ios and apd measurements . a steady flow of 0.16 l s was applied for these measurements . for pressure measurements , a dwyer model 401 ( michigan city , in , usa ) manometer was used , and to monitor flow , a gilmont 40453 ( pelham , nh , usa ) flowmeter was used . the four no . 2 pneumotachographs were labeled pt#214 , and the five hans rudolph standard flow resistors were labeled hr15 . the pressure / flow relationships of the pneumotachographs and hans rudolph standard flow resistors were tested for linearity . the pressure drops across no . 1 and no . 2 pneumotachograph and hans rudolph standard flow resistor were recorded at various flows ranging from 0.05 to 0.70 l s. plastic tubing was fit by compression onto the ends of each pneumotachograph , and each plastic tube was tapped to measure static pressure in close proximity to the pneumotachograph . the pressure drop was measured as the difference in pressures at the tubing pressure taps . this was done to obtain the entire pressure drop across the device and to account for end effects in the pneumotachs . for the hans rudolph standard flow resistors , hans rudolph small connectors were fit by compression onto the ends of each flow resistor . the pressure drop was measured across the pressure taps on these connectors . to account for possible resistance differences due to resistor placement , total pressure drops were also obtained for series combinations of resistors . for the pneumotachographs , the pressure drop was recorded across each series combination as the number of pneumotachographs was increased incrementally up to four no . 2 pneumotachographs and one no a carefusion ( san diego , ca , usa ) masterscreen ios machine was used following the manufacturer specifications to measure the resistance of the validation system . volume , temperature , and pressure calibrations were performed according to the manufacturer specifications . for each resistance configuration of the system , it was decided to use this r5 value as a good choice for comparison with apd measurements because r5 represents respiratory resistance over the entire respiratory system . unlike normal apd operating procedure , no previous apd flow or pressure calibrations were performed before usage . the perturbation frequency on the apd was set , as normally used , to 9.8 hz , with two perturbations occurring with each rotation of the wheel . consistent with the ios procedure , five apd measurements were taken using the same apd unit . the reported inhalation and exhalation resistances ten healthy nonasthmatic male and female volunteers between the ages of 18 and 30 years completed tests of respiratory resistance by the apd and the ios machine . ios measurements were made using a carefusion ( san diego , ca , usa ) masterscreen ios machine following the manufacturer specifications to measure resistance . for both devices , an antibacterial filter from the pulmonary function filter kit purchased from alliancetech medical , inc . ( granbury , tx , usa ) was used as a mouthpiece for the test subjects . inhalation and exhalation resistance values from the apd were averaged during each trial to give rapd . ios measurements of r5 were recorded following completion of apd measurements to compare against rapd . respiratory resistance of the subjects was incrementally increased by adding various series combinations of hans rudolph standard flow resistors ( series 7100r2 ) in between the test subject and the measuring device . the number of flow resistors was increased one at a time from one to four , giving a total range of 0.200.78 kpa l s ) as indicated by the manufacturer , and measurements of respiratory resistance were taken at every increment . resistors were connected by compression fitting using hans rudolph small connectors , and rubber adapters were used to connect resistor combinations to mouthpieces and devices . individual resistors . the resistance of each resistor was calculated using the relationship between pressure and flow , r=p / v. the resistance values were found to be consistent across all no . 2 pneumotachographs and across all hans rudolph standard flow resistors . 1 and no . 2 pneumotachographs and the hans rudolph standard flow resistors , for flow rates between 0.05 and 0.70 l s. dividing the pressure over the flow corresponded to the slope of the regression lines , giving a measure of the resistance value . figure 4 shows that the slopes of the regression lines ( forced through zero ) were within 5% agreement with the measured resistance values of each resistor listed in table 1 , with the exception of the no . 2 pneumotachograph , which was within 15% of the average ( 0.041 kpa l s compared to 0.048 kpa l s , or 0.49 cm h2o l s ) . resistors were coupled together in series in single unit increments for the pneumotachographs and the hans rudolph standard flow resistors , and their resistances calculated from their pressure / flow relationships . resistances of series combinations were approximately ( but not exactly ) equivalent to the algebraic sum of the individual resistors . the differences between the sum of individual resistor values and their combinations are likely due to small interfacing resistances incurred when connecting them together . table 2 summarizes these findings . for both the series combination of pneumotachographs and the series combination of hans rudolph standard flow resistors , the resistance was linearly proportional to the number of resistors in the system . moreover , the proportionality for the series combination of both types of resistors was close to the averaged resistance of the individual resistors . specifically , for the series combination of pneumotachographs , the slope of the linear regression was equal to 0.047 kpa l s per pneumotachograph , compared to 0.048 0.003 kpa l s ( 0.49 cm h2o l s ) , the calibration average of the individual resistances of the no . 2 pneumotachographs . similarly , for the series combination of hans rudolph flow resistors , the slope of the linear regression was equal to 0.190 kpa l s per hans rudolph flow resistor , compared to 0.181 0.002 kpa l s ( 1.85 cm h2o l s ) , the average calibration of the individual resistances of the hans rudolph flow resistors . ios measurements of r5 of the system were recorded for various series combinations of the pneumotachographs and the hans rudolph standard flow resistors . in figure 5(a ) , the resistance measured at 5 hz , r5 , was plotted against the directly measured resistance values ( see table 2 ) , and a linear regression was performed . moreover , the slope of the curve ( 0.921 ) , an indication of how well ios resistance measurements agree with directly measured resistances , suggested only slight underestimation by the ios . apd measurements . because the apd is capable of both inhalation and exhalation measurements of resistance , these measurements were recorded and averaged to produce the apd - measured resistance . in figure 5(b ) , the apd - measured resistance values were plotted against the directly measured resistance values ( see table 2 ) , and a linear regression was performed . consistent with the ios machine , the apd data also fit the regression curve exceptionally well ( r = 0.999 ) . in contrast to the ios machine , the slope of the curve ( 1.155 ) indicated slight overestimation by the uncalibrated apd . despite the slight under and overestimations by the two devices , figure 6 illustrates that a strong correlation exists between the two methods when one is compared against the other . a bland - altman diagram is typically used to compare two clinical measurements when the properties to be measured exhibit significant variation over their range such that correlation may not necessarily equate to agreement . in other words , two measures may be highly correlated yet exhibit substantial differences across their range of values . here , the bland - altman diagram in figure 6(b ) illustrates that the difference between apd rapd and ios r5 depends highly on the magnitude of the resistance . this is indicative of a proportional relationship and conforms to the conclusions indicated by the data in figure 5 . correlations between apd rapd and ios r5 were linear for all subjects breathing through several external resistors . figure 7 shows representative data from a typical subject , highlighting the high degree of linearity . table 3 lists the linear correlation factors as well as the goodness of fit , r. linear regressions were forced through zero . the average correlation factor ( 1.208 0.072 ) this is consistent with the previous results reported above that found a similar overestimation by the apd when measuring the resistance of the mechanical respiratory model . the apd was calibrated to the ios using the calibration factor ( 1/1.263 ) obtained from the comparison made on the mechanical system , and the data from the ten subjects were plotted in figure 8 . both the calibrated apd and ios gave nearly identical resistance measurements , with less than 5% difference between the two . here , we presented data that illustrate that the apd is capable of making airflow resistance measurements comparable to those made by the commercially - available ios instrument . this was shown on a nonbiological , mechanical respiratory system as well as on human subjects . the apd used in these experiments was not calibrated for prior pressure or flow accuracy . normally , it would be expected that each individual apd would require calibration either against the ios system or against the calibrated resistor combination to assure consistency among devices . different apd devices gave slightly different respiratory resistance measurements due to variations in individual component parts . the ratio of apd measurement values to ios measurement values provides a calibration factor that can be used to calibrate apd average resistances . the fact that this factor is nearly the same for human subjects as it is for a mechanical system means that the highly reproducible and reliable mechanical system can be used for this purpose . the coefficient of variation of the correlation factors for all human subjects , an indicator of how random the amount of overestimation is , was 5.92% , suggesting that measurements on human beings are probably not the best to use for calibration purposes . a study by johnson et al . showed that there is a substantial variation in the average respiratory measurements that comes from the human respiratory system and not from the apd . using the calibration factor obtained from the measurements on the mechanical system gave agreement within 5% of human subject respiratory resistances obtained from both devices . considering that resistance measurements on humans can vary by much more than this , about 10% , the agreement by the calibrated apd with the ios is certainly acceptable . both apd and ios measurements correlated well with directly measured resistances of the series combinations , but a slight underestimation by the ios machine and a slight overestimation by the apd were observed . for the ios machine , this error may be due to the compressive nature of air in the compliance chamber . although the inclusion of a compliance component also makes the physical system similar to a human respiratory system , the intent of the compliance chamber was to provide a volume in which the downstream resistance would force air to compress during every stroke of the piston pump . in this way , airflow becomes sensitive to downstream resistance and not just the cycling of the pump , allowing for the measurements of the resistance with the apd . however , since the impulse that the ios machine emits is itself a pressure wave , it may become attenuated by the air within the compliance chamber , resulting in a lower measurement of r5 . in fact , when no resistors were attached , the ios machine gave no reading at all , presumably because the entire impulse was being attenuated ( data not shown ) . additionally , differences between inhalation respiratory resistance and exhalation respiratory resistance can give insight into diagnosing certain respiratory pathologies for example , figure 9 illustrates a sample test subject who appears to exhibit higher respiratory resistance in the inhalation direction than the exhalation direction . it would be expected that exhalation resistance should be higher than inhalation resistance because of the distensible airways and high external pressures during exhalation . this subject may have a respiratory problem , or the difference may be due to the fact that the apd used in these tests was uncalibrated . some might suggest alternate means to fabricate a mechanical system to be used for calibration purposes . a previous attempt at apd validation was based upon a ventilator test lung system ( dual adult training and test lung , michigan instruments , grand rapids , mi , usa ) that relied on the compliance of the test lung to soften the flow source . one of the two parallel test lungs was supplied through a ventilator with compressed air at 50 psi and set to 10 bpm with a 3 second inspiration time to mimic human resting breathing . the flow from the second test lung was subsequently fed into the apd through interchangeable orifices ( pneuflo rp5 and rp20 , michigan instruments ) used as resistances . the problems that were encountered with this system were the inconsistency between trials ( probably due to flow rate dependence of the orifice resistances ) and apd resistance values that differed considerably from the resistance values supplied by the manufacturer . by contrast , the current system diagrammed in figure 2 gave very consistent measurements . based on the results given in this paper , we can conclude that the apd compares well with the ios method , and it can be an accurate method to assess respiratory resistance in patients .
upon recognition of hepatitis c virus ( hcv ) infection by toll - like receptor 3 ( tlr3 ) and retinoic - acid inducible gene i ( rig - i ) , the innate immune response is promptly activated in hepatocytes . the two pattern recognition receptors ( prrs ) recruit their respective adaptors , toll / interleukin-1 receptor - domain containing adaptor inducing interferon ( ifn)- ( trif ) and ifn- promoter stimulator-1 ( ips-1 ) , that relay the signal to downstream ifn regulatory factor-3 ( irf3 ) , leading to the induction of ifn- , known as the front line of host antiviral defenses in the liver [ 1 , 2 ] . hcv ns3/4a serine protease in infected cells cleaves trif and ips-1 and thereby disrupts the signal for ifn- induction [ 35 ] . for example , hcv disrupts jak - stat signaling by ns5a and inhibits protein kinase r by ns5a and e2 proteins . recent studies demonstrated that interference of hcv proteins with ifn production and its action depends on the levels of hcv propagation [ 7 , 8 ] . under the circumstances , we hypothesized that hcv replication - associated interference with the host ifn system may cause changes in hepatic gene expression involved in ifn production at the mrna levels and that , if so , this host feedback response may occur in different fashion according to responsiveness to ifn - based therapy as interference with the host ifn system is considered to be more severe in nonresponders . to gain an insight into this hypothesis , we measured hepatic mrna expression involved in ifn- production , and the results were correlated with copy numbers of liver positive- and negative - strand hcv rnas using pretreatment liver tissues responsive to ifn - based treatment and liver tissues that were nonresponsive to the treatment . liver tissues were obtained from 45 patients with chronic hepatitis c genotype 1 before 48-week treatment with weight - based doses of peg - ifn- 2b ( peg - intron ; msd k.k . , tokyo , japan ) and ribavirin ( rebetol ; msd k.k . ) . a portion of the liver biopsy specimen was immediately frozen and stored at 80c for real - time pcr . slow virologic responders showing hcv rna clearance after week 12 were assigned to 72-week extended treatment . treatment response was analyzed for per protocol population at week 12 ( n = 45 ) , week 24 ( n = 40 ) , and 24 weeks aftertreatment ( n = 38 ) . table 1 summarizes the study cohort regarding achievement of complete early virologic response ( cevr ) ( serum hcv rna clearance at week 12 ) , virologic response at week 24 ( vr24 ) ( hcv rna clearance at week 24 ) , and sustained virologic response ( svr ) ( hcv rna clearance at 24 weeks aftertreatment ) . the svr group was younger and tended to be more treatment - nave than the non - svr group . otherwise , no difference was seen in gender , serum alanine aminotransferase ( alt ) , serum hcv rna , and liver histology . the study was approved by the local research ethics committee in accordance with the 1975 declaration of helsinki , and all patients provided written informed consent . relative mrna expression of tlr3 , rig - i , trif , ips-1 , irf3 , and ifn- was determined by real - time pcr . total hepatic rna was extracted using the trizol reagent ( invitrogen , carlsbad , ca ) . one g of rna was denatured at 65c for 5 min and reverse transcribed in a 20 l reaction mixture containing 4 l of 5 reverse - transcription ( rt ) buffer ( invitrogen ) , 0.2 mol of dtt , 100 u of superscript ii ( invitrogen ) , 20 u of rnasin ( promega , madison , wi ) , 10 nmol of each dntp , and 100 pmol of random hexamers . the rt reaction was performed for 10 min at 25c , 120 min at 42c , and then 15 min at 70c . primers and probes for target and reference genes studied were purchased from applied biosystems ( foster city , ca ) ( taqman gene expression assays hs00152933_m1 [ tlr3 ] , hs00184937_m1 [ rig - i ] , hs00706140_s1 [ trif ] , hs00325038_m1 [ ips-1 ] , hs00155574_m1 [ irf3 ] , hs0027188_s1 [ ifn- ] , and 4310884e [ gapdh ] ) . the cdna product was diluted 1 : 2.5 , and 5 l was amplified in a 20 l reaction mixture containing 10 l of 2 taqman universal pcr master mix and 1 l of 20 gene - specific primers and probe mixture ( applied biosystems ) . pcr cycling was performed as follows : 50c for 2 min , 95c for 10 min , followed by 40 cycles of 95c for 15 s and 60c for 1 min , in an abi prism 7900 sequence detection system ( applied biosystems ) . duplicate cycle threshold ( ct ) values were analyzed by using the comparative ct ( ct ) method . the relative amount of target mrna ( 2 ) was obtained by normalization to an endogenous gapdh reference and expressed relative to the amount from normal liver tissue derived from an hcv - uninfected individual who had received hepatectomy for a metastatic liver tumor . hcv replication was evaluated by serum hcv rna levels ( cobas amplicor hcv monitor test v.2.0 , roche diagnostics k.k . , tokyo , japan ) and copy numbers of liver positive- and negative - strand hcv rnas as measured by strand - specific real - time pcr . an arbitrary value of 0 was attributed to the liver tissues negative by pcr to detect host mrnas and viral rnas . the range of serum hcv rna quantitation was from 3.7 to 6.7 log iu / ml . for statistics , an arbitrary value of 7 log iu / ml was attributed to hcv rna levels of > 6.7 log iu / ml . group comparisons were performed by nonparametric tests ( wilcoxon and mann - whitney ) for continuous variables and by fisher 's exact test for binary variables . spearman rank order correlations were used to study the relationship between the variables . a value of p < 0.05 ( two - tailed ) was considered to indicate significance . the relationship of hepatic prr signaling gene expression with hepatic and circulating hcv loads was analyzed regarding responsiveness to peg - ifn and ribavirin . in liver tissues showing cevr , none of the mrna expressions studied ( tlr3 , rig - i , trif , ips-1 , irf3 , and ifn- ) showed a relationship with liver positive- and negative - strand hcv rnas and circulating hcv rna ( see supplementary figure 1 in supplementary material available online at http://dx.doi.org/10.1155/2013/917261 ) . in contrast , mrna expression of the prr signaling genes involved in ifn- production was uniformly increased in parallel with hcv loads in liver tissues nonresponsive at week 12 . liver positive- and/or negative - strand hcv rna(s ) showed positive correlations with the mrna levels of tlr3 ( r = 0.396 , p = 0.028 and r = 0.303 , p = 0.097 ) , rig - i ( r = 0.595 , p < 0.001 and r = 0.682 , p < 0.001 ) , trif ( r = 0.256 , p = 0.165 and r = 0.414 , p = 0.021 ) , ips-1 ( r = 0.304 , p = 0.096 and r = 0.358 , p = 0.048 ) , and irf3 ( r = 0.397 , p = 0.027 and r = 0.384 , p = 0.033 , resp . ) . however , the correlations of ifn- mrna with positive- and negative - strand hcv rnas did not reach a significant level ( r = 0.309 , p = 0.090 and r = 0.275 , p = 0.134 , resp . ) . unexpectedly , these figures in nonresponders were not seen when hcv propagation was assessed by circulating hcv loads . no relationship was found between serum hcv rna levels and any mrna expression in liver tissues ( figure 1 ) . supplementary figure 2 represents the interrelationship of liver positive- and negative - strand hcv rnas and serum hcv rna in the study cohort . liver positive- and negative - strand hcv rnas were closely correlated ( r = 0.801 , p < 0.001 ) , whereas there were significant but weak correlations between serum hcv rna and liver positive- and negative - strand hcv rnas ( r = 0.474 , p = 0.001 and r = 0.476 , p = 0.001 , resp . ) . the relationship between hepatic gene expression and hcv loads was further investigated with regard to treatment responsiveness at later time points . like liver tissues showing cevr , none of the mrna expression levels showed a relationship with hepatic hcv loads when liver tissues showing vr24 and svr were analyzed . on the other hand , the expression of a certain set of the prr signaling genes , albeit not all , showed significant correlations with hepatic hcv loads in nonresponders . positive- and/or negative - strand hcv rna(s ) were positively correlated with mrna expression of rig - i ( r = 0.797 , p < 0.001 and r = 0.744 , p = 0.002 ) , trif ( r = 0.659 , p = 0.010 and r = 0.620 , p = 0.018 ) , ips-1 ( r = 0.563 , p = 0.036 and r = 0.538 , p = 0.047 ) , and irf3 ( r = 0.647 , p = 0.012 and r = 0.521 , p = 0.056 , resp . ) in liver tissues nonresponsive at week 24 ( table 2 ) . when liver tissues not attaining svr were analyzed , positive- and/or negative - strand hcv rna(s ) were positively correlated with mrna expression of tlr3 ( r = 0.632 , p = 0.009 and r = 0.632 , p = 0.009 ) , rig - i ( r = 0.760 , p < 0.001 and r = 0.693 , p = 0.003 ) , and irf3 ( r = 0.545 , p = 0.029 and r = 0.426 , p = 0.099 , resp . ) ( table 3 ) . again , the relationship of circulating hcv rna with hepatic mrna expression was not evident , regardless of treatment responsiveness . a significant relationship was seen only between serum hcv rna and rig - i mrna expression in liver tissues without svr ( r = 0.511 , p = 0.043 ) . previous studies showed that hcv proteins produced in infected cells impair the prr signaling involved in ifn- production via cleavage of trif and ips-1 [ 35 ] and further impair downstream ifn action in various ways . it has also been demonstrated that impairment of the host antiviral response by hcv depends on hcv propagation . the cleavage of ips-1 by hcv ns3/4a serine protease is more extensive in the liver with high levels of hcv propagation [ 7 , 8 ] . hepatic mrna expression of downstream ifn - stimulated genes ( isgs ) is negatively correlated with hepatic hcv loads , indicating hcv replication - related impairment of antiviral signaling involved in isg expression . how hepatic hcv propagation is related to the expression of various prr signaling genes involved in ifn- production has not been fully clarified . of the prr signaling genes , some are known isgs ( tlr3 , and rig - i ) , while others ( trif , ips-1 and irf3 ) are not . we found that pretreatment hepatic mrna expression of these genes uniformly increased in parallel with hepatic hcv loads in patients not attaining early antiviral response to peg - ifn and ribavirin . in striking contrast hcv replication - related increase in the mrna expression of the prr signaling genes was not accompanied with that in ifn- mrna expression . thus far , impairment of ifn production and its action has not been well studied regarding responsiveness to exogenous ifn . our results may imply differential impairment of the host antiviral response by hcv propagation in liver tissues responsive and nonresponsive to exogenous ifn . hcv propagation may cause more severe impairment in ifn nonresponders compared with responders and , in turn , work host feedback systems to upregulate the prr signaling gene expression involved in ifn production at the mrna level . unlike hepatic hcv loads , circulating hcv loads showed much less evident correlations with the prr signaling gene expression in ifn nonresponders . this discrepancy may imply that circulating hcv loads do not correctly reflect hcv loads in liver tissues , which are the key compartments in which viral propagation occurs , and the hcv proteins produced interfere with ifn production and its action . circulating hcv loads can be modified by various factors after release of hcv particles from hepatocytes , including the degree of immune clearance . indeed , liver positive- and negative - strand hcv rnas were closely correlated in our study cohort , whereas serum hcv rna was weakly correlated with liver positive- and negative - strand hcv rnas . hepatic mrna expression of the prr signaling genes involved in ifn production showed differential relationship with hepatic hcv loads in responders and nonresponders to ifn - based treatment . in liver tissues of nonresponders , the expression of various prr signaling genes was uniformly increased at the mrna levels in parallel with hcv loads . given that interference of hcv proteins with ifn production and its action depends on the levels of hcv replication ; the findings in nonresponders may reflect a host feedback response to severe hcv replication - associated impairment of the ifn system .
congenital hypothyroidism ( ch ) is the most common congenital endocrine disorder in childhood which is associated with irreversible neurological problems and poor growth in untreated individuals . in europe and north america , 1 in 3,000 to 4,000 newborns is affected by this disease [ 1 , 2 ] . in the majority of patients , ch is sporadic and caused by an abnormal development of the thyroid gland ( thyroid dysgenesis ) . hereditary inborn errors in the enzymatic cascade of thyroid hormone synthesis are accounted in 20% of all cases which is defined as thyroid dyshormonogenesis . this disorder typically transmitted in an autosomal recessive manner . of the several genetic defects responsible for thyroid dyshormonogenesis , mutations in thyroid peroxidase ( tpo ) gene are the most prevalent causes of inherited defects in ch . the tpo gene is located on chromosome 2p25 , containing 17 exons encoding a protein of 933 amino acids . thyroid peroxidase protein is a membrane - bound enzyme which involves in the biosynthesis of thyroid hormones . so far more than 60 inactivating mutations associated with tpo gene have been identified including missense and nonsense mutations , splicing errors , deletions , and insertions of nucleotides . prevalent mutations are in exons 8 , 9 , 10 , and 11 ( catalytic site ) [ 624 ] . since 2002 , the neonatal screening program for ch has been initiated in isfahan , iran . the incidence of ch in this population was estimated to be 1 : 357 newborns which is about 10 times higher than reports from north america and europe . this difference is more likely due to iodine deficiency which is the main cause of transient ch . according to the recent studies , but the rate of permanent ch in isfahan is higher than the comparable worldwide rates . further investigation has shown that thyroid dyshormonogenesis is the most common aetiology of ch in this population [ 29 , 30 ] . considering the high prevalence of thyroid dyshormonogenesis in isfahan and the role of tpo gene mutation in the etiology of this type of ch , in the present study , the frequency of tpo gene defects in patients with thyroid dyshormonogenesis was detected . in this cross - sectional study , 41 dyshormonogenetic ch patients , diagnosed and followed up during ch screening program in isfahan endocrine and metabolism research center , were enrolled . the medical ethics committee of the isfahan endocrine and metabolism research center approved the study protocol , and parents of all selected ch patients gave their written consent . according to ch screening guideline , neonates with screening tsh level of > 10 miu / l at 37 days of life recalled . 10 miu / l and t4 < 6.5 mg / dl in second measurements . thyroid hormone replacement therapy was started in the form of l - t4 ( levothyroxine ) within the first 2 weeks of life . permanent cases were determined at 3 years old by measuring tsh and t4 concentration 4 weeks after withdrawal of l - t4 levothyroxine therapy . patients with elevated tsh levels ( tsh > 10 miu / l ) and decreased t4 levels ( t4 < 6.5 g / dl ) at this time were considered as permanent ch . the etiology of ch was determined by thyroid scan and/or ultrasound before treatment in neonatal period or at age of 3 years old after confirming the permanency of ch . patients with thyroid gland of normal size according to radiologic findings ( i.e. , those without thyroid agenesis , hypoplasis , hemiagenesis , or ectopia ) were considered to have dyshormonogenesis . peripheral blood samples were obtained from selected patients and transferred to molecular medicine department of pasteur institute of iran for molecular analysis and determining the tpo gene mutations . serum t4 and tsh were measured by radioimmunoassay ( ria ) and immunoradiometric assay ( irma ) methods , respectively . primers were specially designed using the computer program ( gene runner ) , for all of the 17 exons and exon - intron boundaries of tpo gene . their oligonucleotide sequences and the position of their 5coding sequence ends are listed in table 1 . the 17 exonic regions of the tpo gene , including the splicing regions , were amplified by polymerase chain reaction ( pcr ) . the pcr reaction mixture contained 10 pmol of each forward and reverse primers , 500 ng genomic dna , 2 mm mgcl2 , 200 m of each dntp ( cinnagene , iran ) , 2.5 l 10x pcr buffer , 0.5 u taq dna polymerase ( cinnagene , iran ) at a final volume of 25 l . for amplification of exon 8 , 1 l dimethyl sulfoxide ( dmso ) was added . the pcr reactions were performed in a thermal cycler machine ( eppendorf , germany ) with an initial denaturation of 10 min at 95c , followed by 30 cycles of amplification consisting of denaturation at 95c for 50 second , annealing at 5562c ( depend on suitable annealing temperature for each primer ) for 40 seconds and extension at 72c for 3060 seconds ( depending on pcr products length ) and with a final extension at 72c for 5 min . all amplified pcr products except exon 8 of tpo gene were screened by single - strand conformational polymorphism analysis ( sscp ) from 41 selected patients and normal controls . the gel matrix for sscp contained 8% polyacrylamide gel ( 29 : 1 or 39 : 1 ) ( qiagen , germany ) with 3% glycerol . for sscp , 5 l of pcr products were first mixed with a 7 l sscp loading buffer ( xylene cyanol 005% , bromophenol blue 005% , formamide 95% ) , the mixture was incubated at 95c for 10 minutes and then was transferred quickly in to ice bath . fragments presenting different migration pattern in comparison with normal controls were directly sequenced for nucleotide change identification . sequencing analysis was done based on chain termination method , using forward and reverse primers in table 1 . sequences were analyzed , using chromas program and compared with the normal tpo gene sequence ( gen bank accession number : dq011222 ) by blast online software ( http://www.ncbi.nlm.nih.gov/blast/ ) . in this study , 41 patients ( 15 male and 18 female ) with dyshormonogenetic congenital hypothyroidism were evaluated for tpo gene mutation . mean of screening tsh and t4 level in studied population was 46.2 37.1 ( miu / l ) and 6.0 2.8 ( g / dl ) , respectively . 63% ( 26/41 ) of patients had parental consanguinity ( 18 of them had first - degree parental consanguinity ) . none of them had goiter during clinical examination . tpo gene mutation was detected only in one patient . the mutation was located in exon 15 ( 14th coding exon ) of tpo gene at nucleotide position c.2669 this mutation results in a glycine to arginine substitution at amino acid position 860 p.gly860arg in homozygous form . this mutation has been described previously in the database . for further analysis , sscp and dna sequencing of this exon the data showed that the mutation is present in heterozygous form in the parents ( figure 2 ) . the affected patient was characterized by sscp as having aberrant shift in exon 15 ( 14th coding exon ) that was not detected in normal subject and other patients and was found homozygous for this mutation in sequencing analysis result ( figure 1 ) sscp of exon 15 showed altered migratory patterns in both parents of affected patient , and sequence analysis in them revealed that they carried this mutation ( figure 2 ) . in addition , six known single nucleotide polymorphisms were detected in this cohort by sscp and sequencing analysis . two of them were located in the promoter region and in exon 1 ( a-35 g , g11a ) and others in the reading frame c.859 g > t , c.1207 g > t , c.1283 g > c , c.2088c > t ) . full sequencing of tpo gene in four patients detected no mutation , and sscp results and sequencing analysis results were similar in these patients . tpo gene mutations are the main causes of thyroid dyshormonogenesis [ 624 ] . in the present study , the whole gene scanning of tpo gene by sscp and sequencing was performed in 41 patients with permanent congenital hypothyroidism due to dyshormonogenesis . g > a ( nm_000547.5 ) is located in exon 15 of tpo gene and results in the hydrophobic glycin ( g ) to the positively charged arginine amino acid substitution in the tpo transmembrane region . this change is effected on insertion of the tpo enzyme into the plasma membrane of thyroid follicular cells , and results decrease protein activity in the patient . both parents were heterozygous for this change so the mutation transmits as autosomal recessive traits in the affected family . seven different single nucleotide polymorphisms ( snps ) in exons 1 , 7 , 8 , 11 , and 15 of the tpo gene were detected too . as mentioned , different mutations of tpo gene have been reported previously , commonly in exons 8 , 9 , and 10 . the mutation of c.2669 g > a ( nm_000547.5 ) has been reported by avbelj et al . in slovakia , and thereafter it was not reported in other studies . mutation of exon 15 has been reported by neves et al . in brazil , but it was c.2630 t > c mutation . the patient with mentioned mutation in slovenia had nodular goiter according to the sonographic findings at the age of 16 years . in this study , the patients had not goiter according to both radiologic and clinical findings at the age of 3 years . though it may be due to early initiation of treatment , it needs further studies in this field . in our study , the frequency of tpo gene mutations was lower than slovene and portuguese population studies that had similar inclusion criteria , without doing perchlorate discharge test [ 17 , 19 ] . in a population - based study in japan , narumi et al . have analyzed the prevalence of tpo gene mutation in fourteen ch patients with dyshormonogenesis and detected two biallelic mutations among them . in this study , total iodine organification defect ( tiod ) or partial iodine organification defect ( piod ) as defined by the perchlorate discharge test was not determined in studied patients . some studies have reported that homozygous and compound heterozygous tpo gene mutations are more frequently seen among dyshormonogenic ch patients with tiod [ 32 , 34 ] . it is suggested that low frequency of tpo gene mutations in our studied population may be due to the fact that most of them were dyshormonogenic ch patients with piod , which should be investigated in future studies . in our study , number of patients and determination of permanent ch were similar to previous studies , so low sample size or transient disease can not be the cause of low frequency of tpo gene mutations . it is possible that mutations in intronic sequences or in the promoter region and unexamined regulatory regions of tpo gene are the cases of thyroid dyshormonogenesis in these patients . in addition , other genetic disorders may be more effective than tpo mutations in ch patients with dyshormonogenesis including the sodium symporter ( nis ) gene , the pendrin gene ( pds ) , the thyroid oxidase gene 2 ( thox2 or duox2 ) , and thyroglobulin gene . the technique used in this study , sscp , is a cheap , simple , and suitable method with a good sensitivity . in addition , small deletions and insertions in the genome could be identified by this method . high prevalence of previously reported point mutations in tpo gene and high application of sscp in detection of this type of mutations with another benefits of this method that is mentioned are reasons to choose sscp for this study . approximately 90% of the potential base exchanges are detectable by sscp under optimal conditions . in present study , detection of several single nucleotide polymorphisms in different regions of tpo gene with sscp and similarly results of direct sequence analysis in four patients showed high sensitivity of sscp in our study . so in the present study , there is probability of existing mutations that are unidentified with sscp . we know , long homozygous deletions in the gene are caused of autosomal recessive disorders . in this group of patients , deletion regions can not amplify with pcr method and they are detectable with this way , but patients with long heterozygous deletions because of having one normal copy of gene are not detectable with pcr - sscp method and sequencing analysis . so far , there is no report about long deletions related with tpo gene but the probability of existence of these type of mutationsshould be investigated in studied population in our future studies . in conclusion , because of low prevalence of tpo gene mutation in this study , it is necessary to investigate more studies with large sample by using another screening method besides sscp and screening of intronic and regulatory tpo gene mutations and mutation detection of other genes that had effect on thyroid dyshormonogenesis .
a true aneurysm of the inferior thyroid artery ( ita ) is extremely rare15 ) . despite its rarity , several authors have recommended aggressive management because the lesion has the potential to be highly lethal4 ) . surgical ligation and/or excision and endovascular embolization were reported as possible treatments for this rare disease6 ) . here , we present a case of ruptured ita aneurysm successfully treated with embolization . to the best our knowledge , this is the first report of parent arterial embolization using a single pushable coil for ita aneurysm . a 69-year - old woman was hospitalized in a stupor and was diagnosed with subarachnoid hemorrhage due to rupture of an anterior communicating artery aneurysm . during hospitalization , she developed pneumonia , which worsened and required endotracheal tube insertion , and eventually tracheostomy , despite nearly complete neurologic recovery . the bleeding was too abrupt and massive to be controlled , and the source could not be identified . temporary hemostasis was achieved with manual compression followed by meticulous packing of gauze and pad . neck computed tomography ( ct ) angiogram with three - dimensional reconstruction demonstrated a saccular aneurysm of the right ita ( fig . the patient was immediately prepared for endovascular intervention because the tentative hemostasis and poor general condition of the patient made surgical exploration risky . after groin site puncture , conventional angiography through the thyrocervical trunk ( tct ) revealed an ita aneurysm 8 mm in diameter ( fig . the right tct was superselected , and a microcatheter was placed adjacent to the aneurysm . a single pushable embolization coil ( 18s , 3/2 , tornado embolization microcoils soft , cook , bjaeverskov , denmark ) was inserted and placed in the parent artery immediately proximal to the aneurysm ( fig . the aneurysm was no longer visible on angiogram 10 minutes after insertion of the coil ( fig . 2c ) . follow - up ct three days after embolization evidenced the complete disappearance of the aneurysmal sac ( fig . . detailed history taking to investigate possible causes of the rare aneurysm did not reveal any history of previous neck surgery , percutaneous procedure , or trauma . follow - up angiography on the seventh postoperative day confirmed the absence of the aneurysmal sac . although ita aneurysm is the most common form of tct aneurysm , there have been fewer than 25 cases reported in the literature13 ) . among these , only four cases were treated by coil embolization alone4,5,9,10 ) . various clinical manifestations of these aneurysms have been reported , including palpable neck mass , hoarseness , dysphagia , respiratory distress , or evaluation of a possible thyroid nodule1,8,12,14 ) . ita aneurysms are widely considered to require aggressive management , because mortality has resulted from conservative management in all but one case4 ) . moreover , a report on the only patient who survived conservative management did not include follow - up data , and such treatment was not recommended . an abrupt death could result from hypovolemia due to excessive blood loss into soft tissues or the thorax , including the pleura and mediastinum , or respiratory distress due to airway compression by the hematoma itself . surgical ligation and/or excision , endovascular embolization , and a combination of these tactics have been reported as a treatment of ita aneurysm4,13 ) . among these methods , surgical ligation could be the most suitable , especially in cases of rupture , because the mass effect of the hematoma remains troublesome for airway maintenance after coil embolization . pop et al.13 ) reported a case of ruptured ita aneurysm treated with aneurysmal coil embolization followed by surgical excision . they suggested that embolization had the advantage of easy detection and embolization , while surgical exploration and excision was needed for hematoma evacuation to decompress the airway . surgery , however , also has the disadvantage of risks including recurrent laryngeal or phrenic nerve injury and wound site infection13 ) . in the present case , the aneurysm ruptured during blunt dissection , although it is unclear if the rupture was caused by direct contusion of the aneurysmal sac by hemostat forceps or tearing of previously adhesive aneurysmal sac to adjacent soft tissue by blunt dissection . sharp surgical tool or monopolar electrocautery that could incur an arterial injury was not used at the timing of event . however , there was no absolute evidence of a true aneurysm like pre - procedural image or pathologic specimen in this case . there were several reports about iatrogenic aneurysm near thyroid gland , following vascular catheterization2 ) , percutanous needle biopsy of adjacent organ8 ) and radiotherapy3 ) . there was also a case report of tracheostomy - related pseudoaneurysm that developed in superior thyroid artery11 ) . however , those authors described that it was a revision tracheostomy and they found densely fibrotic change at that site that may leaded blunt injury . moreover , in most cases of iatrogenic pseudoaneurysm , there were delayed intervals between traumatic events and aneurysmal developments , except in that case of penetrating injury . in this case , tornado , the single pushable coil that contains numerous fibrous hairs , completely ablated the vessel within several minutes with minimal mass effect . this method could be also beneficial even in a case of pseudoaneurysm that contains a fragile wall . mass effect from a hematoma was not a problem in this case due to prompt manual compression . selective angiography is the diagnostic modality of choice , particularly in emergency settings , because it can be promptly transformed into a therapeutic procedure . the author suggests that embolization of the parent artery using a pushable coil is a simple and effective treatment modality for ita aneurysm with rupture .
the half - life of knowledge in the medical fields is estimated to be between five and seven years . providers who do not conscientiously pursue a programme to maintain state - of - the - art practice could lose half of their competence in that period of time . this implies that the information base upon which clinical judgements are made is in constant flux . similarly , it suggests that health care policy and interventions must regularly change or adapt in order to keep up with the pace of scientific advances . change and reform in the health sector tend to be imperative and also the norm . the health care needs of a given population change over time , responding to demographic , economic , social , technological and environmental trends as well as access to health services , including health education . the extent to which these needs generate a response may often be a political decision but also reflects the personal motivation of the stakeholders concerned . " the majority of health care interventions in use today are not proven in terms of efficacy and cost effectiveness . it has been argued that 10% of health care expenditure damages patients ' health , 10% has no effect on their health and 80% improves population health . the problem is that no - one knows which therapies lie in the 10 and 80% categories ! " . the resulting relative vacuum in terms of demonstrated effectiveness allows for a significant liberty of action in the health sector , especially among highly autonomous professionals . there is evidence that considerations other than the professional credibility and legitimacy of a given practice are at play . these may include a wide range of factors such as clinical experience , financial incentive , access to equipment , risk taking tolerance and other personal preferences . if health care practices are not selected in terms of efficacy and cost - effectiveness , what is the basis for decision - making ? individuals interacting within a social setting are known to be subject to intrinsic and extrinsic motivation , often manipulated or managed to strategically meet societal and/or organizational goals . the practice of professionals , traditionally granted a high degree of autonomy and working within an environment in constant transition and changing priorities , may be particularly sensitive or vulnerable to the introduction of incentives and disincentives , of whatever nature . there is increasing evidence that the clinical judgement and professional conduct of physicians are affected by economic incentives and disincentives [ 12 - 16 ] . there is very little information however , with regard to the impact of such measures on nurses . on the contrary , nurses have been known to express little interest in economic incentives / disincentives and disclaim any potential influence of remuneration strategies on their professional conduct . a need to verify this perception stimulated recent research . there is a recognized scarcity of information on the subject of economic incentives / disincentives as they relate to nurses in general , and community nurses in particular . research questions were developed to direct the investigation and three major areas of interest were identified : are community nurses aware of economic incentives / disincentives ? what is the impact of economic incentives / disincentives on nurses ? perceptions of nurses providing direct care , the nursing community in general and non - nurse colleagues were considered of equal importance . a qualitative research methodology for the generation , collection and analysis of valid data was developed and implemented . in order to guarantee a range of different economic policies , including remuneration strategies , community nurses and key informants were interviewed from two research sites ( i.e. london and geneva ) and four employment settings that applied five different nurse - payment financing systems : salaried employee in government - financed service ; salaried employee in government - financed service but contracted out ; salaried employee in government - subsidized not - for - profit organization ; independent practitioner ; salaried employee in for - profit agency . a total of 95 individuals provided data ; the research methods included participant observation , individual interviews and focus groups . the research documented a range of remuneration strategies and their effect on nurses ' attitudes and behaviour . the data highlight the presence of two categories of economic measures : a ) financial incentives involving a monetary payment ( e.g. salary , bonus , fee ) , and b ) financed rewards referring to concessions or privileges that have financial implications for the employer ( i.e. cost ) but no direct monetary payment to the recipient ( e.g. subsidized continuing education , additional leave ) . nurses ' attitudes towards and reactions to these economic measures are presented in this paper . the text ends with a discussion of what respondents and key informants felt were significantly valued and socially acceptable economic incentives likely to positively influence the motivation and behaviour of community nurses in the future . analysis of the data provided the basis for recommendations proposing specific reward strategies to be introduced or reinforced . the widespread rejection by respondents of an economic frame of reference as relevant in employment decisions , professional development , clinical activity and self - image was noted throughout the research process . the profession 's past and present do not encourage nurses to accept a definition of their self worth or self image using financial terms of reference . they are nonetheless sensitive to , and may be influenced by , a certain range of economic incentives / disincentives . this knowledge facilitates the creation and introduction of more admissible and strategically powerful motivating factors in the area of nursing . nurses represent the largest category of health workers and provide 80% of direct patient care . nurses are also effective change agents within the health sector and society as a whole . improving the management and energy focus of such a significant workforce is possible with suitably targeted economic incentives / disincentives . this would in turn support the implementation of more viable reforms in the future and enable more realistic predictions of their outcomes . the data presented may bring new insights that will strengthen health services planning and management . for the purposes of this paper , an economic incentive is defined as the payment or concession encouraging effort in work . an economic disincentive is the absence of adequate payment or concession , or its withdrawal , thus discouraging action or effort in work . the term economic incentive is used generically to include all staff concessions requiring an investment or allocation of funds . financial incentives , are defined as a category of economic incentives , specifically referring to direct monetary payment from employer to employee . the attitudes and behaviour of salaried employees and professional workers are acknowledged to be influenced by financial incentives but also financed rewards ( i.e. a concession or privilege that has financial implications for the employer cost but no direct monetary payment to the recipient ) . remuneration strategies the relevance and impact of economic incentives / disincentives vary according to the context and personal value systems of those involved . economic incentives have also been demonstrated to influence career choices as well as priority setting within an assigned list of duties . nurses , as a category of workers , have in the past been portrayed as less likely to be influenced or interested in financial gain . setting aside the traditional image of the nurse as an angel , volunteer or devoted religious sister , modern nurses are still described in the professional press as having an apparent disinterest in monetary rewards : " nursing has never been seen as a financially rewarding career . " " a majority [ of nurses surveyed ] ( 64.5% ) believe nursing to be a vocation . " " the entire idea of offering incentives casts an image of impropriety upon the nursing profession . " " the dedicated nurses keeping services going are not doing it for the money . " several nurses in the study confirmed this attitude : " if they were interested in money , they would n't be here . " " i do n't do it for the money ... i do n't want money . " " nurses did n't come into the profession to focus on pay . " " nurses are not interested in financial reward they are basically committed professionals . " " nurses do n't think in terms of financial incentives . " nurses ' awareness of economic incentives and disincentives in the health sector and how these are perceived are fundamental areas of interest . a summary of the collected data is presented in the following section . among economic incentives and disincentives , direct monetary rewards or compensation although financial incentives / disincentives were in general not mentioned spontaneously , questioning did reveal a range of payments and allocations targeting nurses . financed rewards ( direct and indirect ) proved to be very relevant to community nurses and are included in the analysis . table 2 recapitulates findings in this area . while the list is not exhaustive , it reflects the discussions held with respondents and key informants . nurses working in other countries / settings may benefit from different specific incentives ( e.g. housing allowance ) . nurses ' perceptions of incentives and disincentives contrary to the widespread initial denial by nurses that economic incentives exist , the findings highlighted a wide range of measures . equally significant however were the nurses ' responses to these incentives once they were identified and discussed in more detail . they viewed economic incentives / disincentives with indifference , positively , negatively or with ambiguity . when asked to name the economic incentives in community nursing , almost without exception london interviewees spontaneously responded that there were none . while consistently not perceived as such , salary is a major and usually the most important financial incentive / disincentive . the absence of references made to salary is therefore important as is the complete disassociation observed between basic salary and economic incentive . in an extreme case , this supports the theory that salary may be perceived as a condition of work and not an incentive . specific references made to the higher grade classification of community nurses working in the national health service ( nhs ) recognizing their greater autonomy ( as compared to hospital nurses ) came more frequently from key informants and/or non - nurses . this may suggest that nurse managers or individuals from other disciplines perceive salary and economic incentives differently . the fact that basic pay and grade classification were not mentioned by community nurses indicates a certain indifference or lack of awareness on their part . two nurses recognized that private sector hospitals paid higher salaries and that nhs employment had meant a decrease in salary ( a financial disincentive of approximately 300/month or 30% of a starting salary ) . certain nurses having moved within the nhs reported a lower income in the community as compared with the hospital and community midwifery . this decrease in revenue was not only accepted in the career moves made but was not spontaneously referred to in the interviews . its absence again indicates a degree of indifference on the part of nurses . while there was agreement among the private salaried ( non - profit employer ) nurses that there was no economic incentive to enter community nursing , there was repeated reference to the similar job classification and salary with nurses in the public sector hospital . as in london , the association of financial incentive with income in addition to salary ( as opposed to the salary itself ) was made . geneva nurses repeatedly claimed a disinterest in financial aspects of their work claiming that salary was not a priority or part of employment decision - making . they claimed to be often unaware of salary and benefits before receiving their first pay check . with questioning , there was acknowledgement that the loss of shift differentials ( e.g. night duty ) when transferred to the community did represent a reduction in income . , key informants reported that the higher grade classification of community nurses compensated for the loss of income from a reduced number of shift differentials . this could explain the apparent lack of interest in paycheque composition but not the disregard when considering career moves . london respondents tended not to give value judgements with regard to weekend differentials while in geneva , nurses were quite explicit that the extra pay was not considered a motivating factor . it can be argued that nurses anxious to benefit from the supplementary income provided by shift differentials would not enter community nursing and therefore would not be among the respondents . no indication from the key informants however suggested that shift differentials were a significant motivating factor among nurses in any setting . reported claims for overtime in both settings appeared to be minimal ( except for the geneva for - profit agency ) while the incidence of working overtime varied greatly according to the interviewees . it was said that the infrastructure in hospitals was better and therefore more likely to facilitate the claim process . community nurses tended to take time unofficially when the team workload permitted . in most cases , overtime was linked with working through lunch breaks and often accepted as part of the daily routine in spite of possible harmful health consequences . overtime payment or compensation was a financial incentive offered but often not claimed . nurses working for the geneva for - profit agency reported no economic incentive working in the community although they had received productivitybonuses the preceding year . in addition , they were entitled to merit increases ( as opposed to yearly step increases ) but ignored the criteria applied . the productivity and merit bonuses granted were not considered to have a great impact on nurses ' activities . three factors could be significant : a ) the recent creation of the agency , b ) the high turnover of staff , and c ) the lack of nurses ' awareness with regard to the bonus criteria . while it was appreciated , it was never reported to be a major recruitment or retention tool . applying the classification of economic incentives presented above , community nurses responded to financial incentives ( i.e. monetary rewards and compensation ) with claimed indifference . economic incentives welcomed by nurses and thought to be positive were limited to education - related financed rewards . while there was general appreciation for the professional development opportunities provided , the converted enrolled nurses ( uk ) expressed the greatest benefit claiming to have acquired options for the future . considering the imminent redundancy status of many ens , many nurses however felt that despite the employer 's support , the personal investment in further education was not cost - effective in financial terms but rather a source of professional growth and satisfaction . even in the case of substantial employer subsidies ( e.g. 75% of salary provided by one employer ) , these measures were not perceived as financial incentives or a recruitment advantage . economic incentives need to be considered within the general remuneration strategy which was felt to be inappropriate and " laughable " by one of the focus groups . this is reflected by the numerous reward measures that are perceived by community nurses as having a negative impact . although salary was reported to be unimportant ( see above ) , relative salary generated a much more emotional reaction . geneva nurses repeatedly associated their poor relative pay with a low societal value given to nursing outcomes in general and human well - being in particular . this would suggest that nurses were more sensitive to the social implications of salary / income than the financial gain . " i am always insulted that my hourly tariff compares so badly with other workers . " " the difference does n't justify our education , responsibilities , consequences of care . " " the hourly increased rate is a small , slight progress . if compared with the washing machine repairman who bills chf 100/hour [ as opposed to chf 64/hour for nurses ] , this somehow reflects strange values for the human being . " resentment also was expressed by the independent nurses that much of their work was not recognized and therefore not remunerated . while some nurses felt exploited and obliged to subsidize health care , others accepted a voluntary participation in the health services provided . many however coped with the situation by manipulating the system thereby creating some ethical dilemmas and/or introducing cynical practices in health care . talking 45 minutes with a patient about her anxiety knowing that the nurse wo n't be paid gets to be a bit much . " " we give our time free of charge , subsidizing the health system . " " before we did ' arrange ' invoices claiming partial baths with technical care ... this was known and accepted as a practice although the insurance companies did n't know . " all compensation payments were reported to be inadequate , in other words not covering the costs incurred by the community nurses . for example , car transport was required for carrying out assigned duties but the reimbursement received was said to be insufficient . petrol allowances were felt to be at best a reimbursement but more frequently a partial payment . parking represents not only a financial cost but also a stressful element in the daily life of community nurses . the irony of a public employee fining another public employee was not lost to one of the nhs nurses . furthermore , there was ill feeling with regard to the different treatment reserved for gps and community nurses visiting the same patients ( i.e. access to parking discs ) . for example , a nurse providing extended care to a dying patient and his family had her car clamped and towed although properly identified as being on official public health business . there was great protest when it was learned that the nurse had to leave her wedding ring on deposit to claim back her car ; or another case , where a nurse picking up urgent medications for her patient was delayed for one hour until her car was liberated having been clamped in front of the pharmacy . the elimination of uniforms was considered a positive initiative by many nurses who felt safer making home visits in street clothes . not being identified as a possible source of drugs and/or syringes or as part of the establishment may in certain neighbourhoods be judged a safety measure for staff . considering the inadequate clothes allowance provided staff however , this must also be seen as a cost - saving measure of the employer . the personal cost of purchasing clothes suitable for professional practice and their maintenance was reported to be a significant expense by most nurses and therefore a financial disincentive . cleaning costs of street clothes were also higher than the laundering of uniforms . highlighted in this example is the association of an insufficient reimbursement or compensation with the concept of a pejorative value judgement of the employer . nurses concluded that the payment was in fact an insult as well as a financial disincentive . the tone and content of the interviews suggest that the value judgement was considered more significant . although not specifically mentioned , the shift in cost burden from the employer to the employee forced staff to subsidize the services provided . while it may be argued that many workers do not get a clothes allowance , the important distinction made between hospital and community nurses must in this case be kept in mind . one of the economic incentives mentioned frequently by the respondents was the employer 's investment in guaranteeing adequate staff coverage . critical staff shortages were reported in london while this did not appear to be the case in geneva . responses recorded included low morale , feelings of resentment and exploitation as well as frustration . in both settings , cost - containment measures with regard to supplies and equipment were felt to decrease the ease of access and often increase the nurses ' workload ( e.g. bureaucratic forms , personal responsibility for the delivery of supplies ) . especially in london , the content , lifespan and negotiation process of job contracts were reported to affect staff 's job security , job description , job location , priority setting , accountability and professional development . responses included demotivation , job insecurity , reduced job satisfaction and resentment . in both settings however , short - term contracts were once again being replaced by longer term contracts thus improving staff 's job security and motivation . research has demonstrated that a supportive manager may reduce the negative effects of a less than desirable environment while the lack of manager support is perceived as a source of great stress . it was more evident in london as nurses were still dealing with the recent elimination of team leaders . the great sense of abandonment expressed by the nurses would indicate that access to professional support is a fundamental investment employers must consider . the existence of bonuses was most relevant in the context where the target population was management as opposed to community nurses . nurses , however , were confronted with the reality that these bonuses were based on their productivity while the benefits were not shared with them . the level of resentment was observed to increase as the degree of perceived managerial support decreased . furthermore , the climate of suspicion created by these bonuses and the perceived lack of information concerning them is of interest for future personnel managers and policy makers . the concept of nurses doing the best they can ran through many of the interviews . the possibility of doing better than " best " if given an economic incentive may be unacceptable to nurses and one of the issues that needs to be explored . while some felt the incentives produced stress rather than creativity , others believed the rewards misdirected , channelling savings / benefits to the greater organization rather than reinvesting in the responsible unit . the notion of nurses " doing their best " was echoed in the statement of nurse managers although conceding that incentives had had an impact on the direction of their efforts . i am doing the best i can , but i appreciate the reward once the review period comes to a close . " " i came to the job with the attitude i would always try to do the best possible . in fact , incentives make you focus on the employer 's and manager 's interests . " more than half of the reward strategies identified in the study are perceived to have a negative impact on community nurses . of the four types of economic incentives , nurses were not yet sure of the nature of the overall impact or there was no consensus among the respondents . this suggests that although nurses are often reluctant to accept the existence of economic incentives / disincentives linked to community nursing , their views on most of the related issues are definite once the discussion is opened . while only relevant for london nurses , many respondents had no knowledge of differences in the allocation of area - specific allowances within the trust ( inner / outer london weighting ) . one respondent aware of the financial incentive claimed it had no impact on his career move decision . this was felt to be the case for community nurses in general although contradicted by another source who felt that nurses transfer worksite in order to benefit from the allowance . on the basis of this conflicting information , it is difficult to conclude that geographic allowances motivate or affect career choices . analysis is further complicated as the allowance size differs according to grade and step and may therefore represent a bigger or smaller factor among other considerations . the lack of knowledge on the part of nurses as to the potential impact is significant . a fee - for - service payment system tends to encourage induced demand and/or patient selection ( i.e. generating unnecessary work for personal economic gain and/or choosing patients that will provide the greatest economic advantage for the care provider ) . the potential financial interest for independent nurses to select patients requiring higher as opposed to lower paid interventions existed under the past geneva reimbursement mechanism . while interviewees acknowledged this possibility and a few cases were identified , the occurrence was said to be negligible and eliminated by peer review and pressure . the frequent references to not wishing to abuse the system implies an awareness of potential financial incentives in fee - for - service and fee - for - time reimbursements . in geneva , there was doubt that this financial reward could be considered an incentive for professional advancement . once again , however , an improved social image of the nurse was associated directly with an increase in grade / salary . table 3 represents an overview of the economic measures applied and the nurses ' responses . the relative relevance and acceptability of the four types of reward mechanisms identified is significant for future planning . nurses ' responses to economic measures uk = london nurses , ch = geneva nurses , ch + uk = london and geneva nurses by far , the responses generated by economic incentives tend to be indifference or negative . only financed rewards , both direct and indirect , were perceived to be clearly positive . financial incentives were never recognized as being positive and at best were received with ambiguous reactions . a wide range of economic incentives / disincentives were identified by nurses once the subject was opened with gentle questioning . after review of the data , the impression given is that nurses tend not to express themselves in financial terms and are often reluctant to admit that monetary reward is of any significance . the insistence of geneva nurses in linking economic reward with societal value judgements and relative social image suggests the emotional role played by financial incentives in the development of personal and professional identity . the frequency with which nurses felt they were being devalued by the inadequacy of the existing economic incentives may have resulted in a rejection of defining themselves or their work in terms of money . it may be true that " altruism and service become a form of self - coercion that makes economic inequality and asymmetry appear normal , natural and desirable as the badge of professional status " ( turkoski , quoted in ) . professional pride in the image of nurses doing the very best possible job may make it impossible to accept the concept of working harder for financial gain . the distinction between " token of appreciation " and " motivating factor " may need to be explored with nurses in a future study . knowledge of nurses ' reactions to economic incentives and disincentives facilitates the creation of positive measures that will encourage desired behaviours . looking toward the future , interviewees were asked to identify economic incentives that would be relevant and likely to influence their behaviour in the workplace . possible economic incentives relevant to nurses and likely to influence behaviour were explored with interviewees in both research settings . financial incentives , as a category of economic incentives , were mentioned most frequently although investments in improving working conditions and rewards in kind were suggested as more meaningful for nurses . as a general principle , key informants agreed that direct and indirect economic incentives should exist at comparable levels with other professions . in the light of the indifference nurses showed to monetary payments in the interviews , this suggests that the relative increase may be significant rather than the absolute sum of money . while nurses referred often to their poor salary relativities ( among nursing personnel and/or other occupations ) , comparable pay was never mentioned as a goal for the future . one source felt incentives were helpful in addressing poor performance as opposed to motivating excellence . withholding incentives was seen as a clear way of indicating to individuals the need for change . there did not appear to be consensus however on how nurses perceived financial reward as a motivating mechanism . performance - related pay had been introduced in many sectors of both countries , including the public sector . london nurses having had more experience with performance - related pay , through management bonuses , considered the possibility in greater detail . in general , performance - related pay was believed to be inappropriate for nurses and great concern was voiced as to the criteria used for determining success . nurses continued to claim that their interventions could not easily be measured in a relevant manner ( quality vs. quantity ) although standards of practice had been developed and were applied during clinical audit . the potential negative impact of performance - related pay on interpersonal relationships within the nursing and health teams ( e.g. competition ) as well as with the patient was also feared . at both research sites , interest was expressed in introducing reverse merit awards or penalties associated with a yearly evaluation process . the point was made however that once the amount was divided among the team members , the resulting reward may be quite small ( " peanuts " ) and not a sufficient financial incentive . besides an increase in basic salary already mentioned above , the following suggestions were made : educational programmes better focused on nurses ' interests private health insurance or added health benefits social events to improve team spirit rewards in kind , e.g. airline ticket , no taxes choice of incentive , e.g. extra pay vs. extra vacation . while there was no consensus as to the relevance and power of financial rewards , nurses in general agreed that performance - related pay was inappropriate for nursing care within a social service . it is not difficult to understand that nurses would be against the introduction of performance - related pay considering their history . given their position within a social or caring sector , there are common arguments with practitioners from similar disciplines ( e.g. quality vs. quantity indicators , short vs. long time frame , support vs. product ) . nurses were confronted with the difficulty of predicting the outcomes of nursing interventions within a given period of time determined by fiscal considerations . in addition , nurses have been unable to define and clearly articulate what they do thus hampering the identification of relevant performance indicators . they have consistently been paid unjustly for their interventions thereby generating distrust of any payment mechanism . the validity of team ( as opposed to individual ) incentives while more acceptable in theory was questioned because of their probable small size . having set no limits on the creation of future incentives , the modesty of the suggestions was a surprise . in view of the serious financial disincentives previously mentioned , the recommendation to improve working conditions by providing tea and coffee free of charge could appear to be disproportionate . this may be linked with nurses ' self image and frequently noted lack of assertiveness . it also supports the suggestion that rewards in kind may be more appropriate for nurses or perceived to be more acceptable than monetary incentives . for the purposes of this paper , an economic incentive is defined as the payment or concession encouraging effort in work . an economic disincentive is the absence of adequate payment or concession , or its withdrawal , thus discouraging action or effort in work . the term economic incentive is used generically to include all staff concessions requiring an investment or allocation of funds . financial incentives , are defined as a category of economic incentives , specifically referring to direct monetary payment from employer to employee . the attitudes and behaviour of salaried employees and professional workers are acknowledged to be influenced by financial incentives but also financed rewards ( i.e. a concession or privilege that has financial implications for the employer cost but no direct monetary payment to the recipient ) . remuneration strategies the relevance and impact of economic incentives / disincentives vary according to the context and personal value systems of those involved . economic incentives have also been demonstrated to influence career choices as well as priority setting within an assigned list of duties . nurses , as a category of workers , have in the past been portrayed as less likely to be influenced or interested in financial gain . setting aside the traditional image of the nurse as an angel , volunteer or devoted religious sister , modern nurses are still described in the professional press as having an apparent disinterest in monetary rewards : " nursing has never been seen as a financially rewarding career . " " a majority [ of nurses surveyed ] ( 64.5% ) believe nursing to be a vocation . " " the entire idea of offering incentives casts an image of impropriety upon the nursing profession . " " the dedicated nurses keeping services going are not doing it for the money . " several nurses in the study confirmed this attitude : " " i do n't do it for the money ... i do n't want money . " " nurses did n't come into the profession to focus on pay . " " nurses are not interested in financial reward they are basically committed professionals . " nurses ' awareness of economic incentives and disincentives in the health sector and how these are perceived are fundamental areas of interest . among economic incentives and disincentives , direct monetary rewards or compensation are the most visible . although financial incentives / disincentives were in general not mentioned spontaneously , questioning did reveal a range of payments and allocations targeting nurses . financed rewards ( direct and indirect ) proved to be very relevant to community nurses and are included in the analysis . while the list is not exhaustive , it reflects the discussions held with respondents and key informants . nurses working in other countries / settings may benefit from different specific incentives ( e.g. housing allowance ) . nurses ' perceptions of incentives and disincentives contrary to the widespread initial denial by nurses that economic incentives exist , the findings highlighted a wide range of measures . equally significant however were the nurses ' responses to these incentives once they were identified and discussed in more detail . they viewed economic incentives / disincentives with indifference , positively , negatively or with ambiguity . when asked to name the economic incentives in community nursing , almost without exception london interviewees spontaneously responded that there were none . while consistently not perceived as such , salary is a major and usually the most important financial incentive / disincentive . the absence of references made to salary is therefore important as is the complete disassociation observed between basic salary and economic incentive . in an extreme case , this supports the theory that salary may be perceived as a condition of work and not an incentive . specific references made to the higher grade classification of community nurses working in the national health service ( nhs ) recognizing their greater autonomy ( as compared to hospital nurses ) came more frequently from key informants and/or non - nurses . this may suggest that nurse managers or individuals from other disciplines perceive salary and economic incentives differently . the fact that basic pay and grade classification were not mentioned by community nurses indicates a certain indifference or lack of awareness on their part . two nurses recognized that private sector hospitals paid higher salaries and that nhs employment had meant a decrease in salary ( a financial disincentive of approximately 300/month or 30% of a starting salary ) . certain nurses having moved within the nhs reported a lower income in the community as compared with the hospital and community midwifery . this decrease in revenue was not only accepted in the career moves made but was not spontaneously referred to in the interviews . its absence again indicates a degree of indifference on the part of nurses . while there was agreement among the private salaried ( non - profit employer ) nurses that there was no economic incentive to enter community nursing , there was repeated reference to the similar job classification and salary with nurses in the public sector hospital . as in london , the association of financial incentive with income in addition to salary ( as opposed to the salary itself ) was made . geneva nurses repeatedly claimed a disinterest in financial aspects of their work claiming that salary was not a priority or part of employment decision - making . they claimed to be often unaware of salary and benefits before receiving their first pay check . with questioning , there was acknowledgement that the loss of shift differentials ( e.g. night duty ) when transferred to the community did represent a reduction in income . , key informants reported that the higher grade classification of community nurses compensated for the loss of income from a reduced number of shift differentials . this could explain the apparent lack of interest in paycheque composition but not the disregard when considering career moves . london respondents tended not to give value judgements with regard to weekend differentials while in geneva , nurses were quite explicit that the extra pay was not considered a motivating factor . it can be argued that nurses anxious to benefit from the supplementary income provided by shift differentials would not enter community nursing and therefore would not be among the respondents . no indication from the key informants however suggested that shift differentials were a significant motivating factor among nurses in any setting . reported claims for overtime in both settings appeared to be minimal ( except for the geneva for - profit agency ) while the incidence of working overtime varied greatly according to the interviewees . it was said that the infrastructure in hospitals was better and therefore more likely to facilitate the claim process . community nurses tended to take time unofficially when the team workload permitted . in most cases , overtime was linked with working through lunch breaks and often accepted as part of the daily routine in spite of possible harmful health consequences . overtime payment or compensation was a financial incentive offered but often not claimed . nurses working for the geneva for - profit agency reported no economic incentive working in the community although they had received productivitybonuses the preceding year . in addition , they were entitled to merit increases ( as opposed to yearly step increases ) but ignored the criteria applied . the productivity and merit bonuses granted were not considered to have a great impact on nurses ' activities . three factors could be significant : a ) the recent creation of the agency , b ) the high turnover of staff , and c ) the lack of nurses ' awareness with regard to the bonus criteria . while it was appreciated , it was never reported to be a major recruitment or retention tool . applying the classification of economic incentives presented above , community nurses responded to financial incentives ( i.e. monetary rewards and compensation ) with claimed indifference . economic incentives welcomed by nurses and thought to be positive were limited to education - related financed rewards . while there was general appreciation for the professional development opportunities provided , the converted enrolled nurses ( uk ) expressed the greatest benefit claiming to have acquired options for the future . considering the imminent redundancy status of many ens , many nurses however felt that despite the employer 's support , the personal investment in further education was not cost - effective in financial terms but rather a source of professional growth and satisfaction . even in the case of substantial employer subsidies ( e.g. 75% of salary provided by one employer ) , these measures were not perceived as financial incentives or a recruitment advantage . economic incentives need to be considered within the general remuneration strategy which was felt to be inappropriate and " laughable " by one of the focus groups . this is reflected by the numerous reward measures that are perceived by community nurses as having a negative impact . although salary was reported to be unimportant ( see above ) , relative salary generated a much more emotional reaction . geneva nurses repeatedly associated their poor relative pay with a low societal value given to nursing outcomes in general and human well - being in particular . this would suggest that nurses were more sensitive to the social implications of salary / income than the financial gain . " i am always insulted that my hourly tariff compares so badly with other workers . " " the difference of [ payment ] with aides is not normal . either nurses are not well enough paid or aides are too well paid . the difference does n't justify our education , responsibilities , consequences of care . " " the hourly increased rate is a small , slight progress . if compared with the washing machine repairman who bills chf 100/hour [ as opposed to chf 64/hour for nurses ] , this somehow reflects strange values for the human being . " resentment also was expressed by the independent nurses that much of their work was not recognized and therefore not remunerated . while some nurses felt exploited and obliged to subsidize health care , others accepted a voluntary participation in the health services provided . many however coped with the situation by manipulating the system thereby creating some ethical dilemmas and/or introducing cynical practices in health care . " ... can get tired of doing volunteer work . talking 45 minutes with a patient about her anxiety knowing that the nurse wo n't be paid gets to be a bit much . " " we are only paid for what is done in the field by the patient . we give our time free of charge , subsidizing the health system . " " before we did ' arrange ' invoices claiming partial baths with technical care ... this was known and accepted as a practice although the insurance companies did n't know . " all compensation payments were reported to be inadequate , in other words not covering the costs incurred by the community nurses . for example , car transport was required for carrying out assigned duties but the reimbursement received was said to be insufficient . petrol allowances were felt to be at best a reimbursement but more frequently a partial payment . parking represents not only a financial cost but also a stressful element in the daily life of community nurses . the irony of a public employee fining another public employee was not lost to one of the nhs nurses . furthermore , there was ill feeling with regard to the different treatment reserved for gps and community nurses visiting the same patients ( i.e. access to parking discs ) . for example , a nurse providing extended care to a dying patient and his family had her car clamped and towed although properly identified as being on official public health business . there was great protest when it was learned that the nurse had to leave her wedding ring on deposit to claim back her car ; or another case , where a nurse picking up urgent medications for her patient was delayed for one hour until her car was liberated having been clamped in front of the pharmacy . the elimination of uniforms was considered a positive initiative by many nurses who felt safer making home visits in street clothes . not being identified as a possible source of drugs and/or syringes or as part of the establishment may in certain neighbourhoods be judged a safety measure for staff . considering the inadequate clothes allowance provided staff however , this must also be seen as a cost - saving measure of the employer . the personal cost of purchasing clothes suitable for professional practice and their maintenance was reported to be a significant expense by most nurses and therefore a financial disincentive . cleaning costs of street clothes were also higher than the laundering of uniforms . highlighted in this example is the association of an insufficient reimbursement or compensation with the concept of a pejorative value judgement of the employer . nurses concluded that the payment was in fact an insult as well as a financial disincentive . the tone and content of the interviews suggest that the value judgement was considered more significant . although not specifically mentioned , the shift in cost burden from the employer to the employee forced staff to subsidize the services provided . while it may be argued that many workers do not get a clothes allowance , the important distinction made between hospital and community nurses must in this case be kept in mind . one of the economic incentives mentioned frequently by the respondents was the employer 's investment in guaranteeing adequate staff coverage . critical staff shortages were reported in london while this did not appear to be the case in geneva . responses recorded included low morale , feelings of resentment and exploitation as well as frustration . in both settings , cost - containment measures with regard to supplies and equipment were felt to decrease the ease of access and often increase the nurses ' workload ( e.g. bureaucratic forms , personal responsibility for the delivery of supplies ) . especially in london , the content , lifespan and negotiation process of job contracts were reported to affect staff 's job security , job description , job location , priority setting , accountability and professional development . in both settings however , short - term contracts were once again being replaced by longer term contracts thus improving staff 's job security and motivation . research has demonstrated that a supportive manager may reduce the negative effects of a less than desirable environment while the lack of manager support is perceived as a source of great stress . it was more evident in london as nurses were still dealing with the recent elimination of team leaders . the great sense of abandonment expressed by the nurses would indicate that access to professional support is a fundamental investment employers must consider . the existence of bonuses was most relevant in the context where the target population was management as opposed to community nurses . nurses , however , were confronted with the reality that these bonuses were based on their productivity while the benefits were not shared with them . the level of resentment was observed to increase as the degree of perceived managerial support decreased . furthermore , the climate of suspicion created by these bonuses and the perceived lack of information concerning them is of interest for future personnel managers and policy makers . the concept of nurses doing the best they can ran through many of the interviews . the possibility of doing better than " best " if given an economic incentive may be unacceptable to nurses and one of the issues that needs to be explored . while some felt the incentives produced stress rather than creativity , others believed the rewards misdirected , channelling savings / benefits to the greater organization rather than reinvesting in the responsible unit . the notion of nurses " doing their best " was echoed in the statement of nurse managers although conceding that incentives had had an impact on the direction of their efforts . i am doing the best i can , but i appreciate the reward once the review period comes to a close . " " i came to the job with the attitude i would always try to do the best possible . in fact , incentives make you focus on the employer 's and manager 's interests . more than half of the reward strategies identified in the study are perceived to have a negative impact on community nurses . of the four types of economic incentives , nurses were not yet sure of the nature of the overall impact or there was no consensus among the respondents . this suggests that although nurses are often reluctant to accept the existence of economic incentives / disincentives linked to community nursing , their views on most of the related issues are definite once the discussion is opened . while only relevant for london nurses , many respondents had no knowledge of differences in the allocation of area - specific allowances within the trust ( inner / outer london weighting ) . one respondent aware of the financial incentive claimed it had no impact on his career move decision . this was felt to be the case for community nurses in general although contradicted by another source who felt that nurses transfer worksite in order to benefit from the allowance . on the basis of this conflicting information , it is difficult to conclude that geographic allowances motivate or affect career choices . analysis is further complicated as the allowance size differs according to grade and step and may therefore represent a bigger or smaller factor among other considerations . the lack of knowledge on the part of nurses as to the potential impact is significant . a fee - for - service payment system tends to encourage induced demand and/or patient selection ( i.e. generating unnecessary work for personal economic gain and/or choosing patients that will provide the greatest economic advantage for the care provider ) . the potential financial interest for independent nurses to select patients requiring higher as opposed to lower paid interventions existed under the past geneva reimbursement mechanism . while interviewees acknowledged this possibility and a few cases were identified , the occurrence was said to be negligible and eliminated by peer review and pressure . the frequent references to not wishing to abuse the system implies an awareness of potential financial incentives in fee - for - service and fee - for - time reimbursements . in geneva , the adequacy of the salary differences between clinical grades was questioned . there was doubt that this financial reward could be considered an incentive for professional advancement . once again , however , an improved social image of the nurse was associated directly with an increase in grade / salary . table 3 represents an overview of the economic measures applied and the nurses ' responses . the relative relevance and acceptability of the four types of reward mechanisms identified is significant for future planning . nurses ' responses to economic measures uk = london nurses , ch = geneva nurses , ch + uk = london and geneva nurses by far , the responses generated by economic incentives tend to be indifference or negative . only financed rewards , both direct and indirect , were perceived to be clearly positive . financial incentives were never recognized as being positive and at best were received with ambiguous reactions . indifference however clearly dominated the recorded perceptions of monetary rewards . a wide range of economic incentives / disincentives were identified by nurses once the subject was opened with gentle questioning . after review of the data , the impression given is that nurses tend not to express themselves in financial terms and are often reluctant to admit that monetary reward is of any significance . the insistence of geneva nurses in linking economic reward with societal value judgements and relative social image suggests the emotional role played by financial incentives in the development of personal and professional identity . the frequency with which nurses felt they were being devalued by the inadequacy of the existing economic incentives may have resulted in a rejection of defining themselves or their work in terms of money . it may be true that " altruism and service become a form of self - coercion that makes economic inequality and asymmetry appear normal , natural and desirable as the badge of professional status " ( turkoski , quoted in ) . professional pride in the image of nurses doing the very best possible job may make it impossible to accept the concept of working harder for financial gain . the distinction between " token of appreciation " and " motivating factor " may need to be explored with nurses in a future study . knowledge of nurses ' reactions to economic incentives and disincentives facilitates the creation of positive measures that will encourage desired behaviours . looking toward the future , interviewees were asked to identify economic incentives that would be relevant and likely to influence their behaviour in the workplace . possible economic incentives relevant to nurses and likely to influence behaviour were explored with interviewees in both research settings . financial incentives , as a category of economic incentives , were mentioned most frequently although investments in improving working conditions and rewards in kind were suggested as more meaningful for nurses . as a general principle , key informants agreed that direct and indirect economic incentives should exist at comparable levels with other professions . in the light of the indifference nurses showed to monetary payments in the interviews , this suggests that the relative increase may be significant rather than the absolute sum of money . while nurses referred often to their poor salary relativities ( among nursing personnel and/or other occupations ) , comparable pay was never mentioned as a goal for the future . one source felt incentives were helpful in addressing poor performance as opposed to motivating excellence . withholding incentives was seen as a clear way of indicating to individuals the need for change . there did not appear to be consensus however on how nurses perceived financial reward as a motivating mechanism . performance - related pay had been introduced in many sectors of both countries , including the public sector . london nurses having had more experience with performance - related pay , through management bonuses , considered the possibility in greater detail . in general , performance - related pay was believed to be inappropriate for nurses and great concern was voiced as to the criteria used for determining success . nurses continued to claim that their interventions could not easily be measured in a relevant manner ( quality vs. quantity ) although standards of practice had been developed and were applied during clinical audit . the potential negative impact of performance - related pay on interpersonal relationships within the nursing and health teams ( e.g. competition ) as well as with the patient was also feared . at both research sites , interest was expressed in introducing reverse merit awards or penalties associated with a yearly evaluation process . the point was made however that once the amount was divided among the team members , the resulting reward may be quite small ( " peanuts " ) and not a sufficient financial incentive . besides an increase in basic salary already mentioned above , the following suggestions were made : educational programmes better focused on nurses ' interests private health insurance or added health benefits social events to improve team spirit rewards in kind , e.g. airline ticket , no taxes choice of incentive , e.g. extra pay vs. extra vacation . while there was no consensus as to the relevance and power of financial rewards , nurses in general agreed that performance - related pay was inappropriate for nursing care within a social service . it is not difficult to understand that nurses would be against the introduction of performance - related pay considering their history . given their position within a social or caring sector , there are common arguments with practitioners from similar disciplines ( e.g. quality vs. quantity indicators , short vs. long time frame , support vs. product ) . nurses were confronted with the difficulty of predicting the outcomes of nursing interventions within a given period of time determined by fiscal considerations . in addition , nurses have been unable to define and clearly articulate what they do thus hampering the identification of relevant performance indicators . they have consistently been paid unjustly for their interventions thereby generating distrust of any payment mechanism . the validity of team ( as opposed to individual ) incentives while more acceptable in theory was questioned because of their probable small size . having set no limits on the creation of future incentives , the modesty of the suggestions was a surprise . in view of the serious financial disincentives previously mentioned , the recommendation to improve working conditions by providing tea and coffee free of charge could appear to be disproportionate . this may be linked with nurses ' self image and frequently noted lack of assertiveness . it also supports the suggestion that rewards in kind may be more appropriate for nurses or perceived to be more acceptable than monetary incentives . their relevance and impact vary according to the context and personal value systems of those involved . the nurses ' disassociation of salary and economic incentive is significant as are the social implications of relative salaries . nurses repeatedly claimed that financial factors did not enter the employment decision - making process . compensation payments ( e.g. petrol ) were consistently reported to be inadequate and linked with unspoken derogatory value judgements ( e.g. insulting ) applied by the employer and/or society . at the same time the adequacy of payment determined to a great extent its perception as a financial incentive or disincentive . furthermore , the size of payment was implied to affect its power as a motivator for action . the fact that nurse managers recognized that bonuses did alter their priorities and methods of work suggests that nurses may be sensitive to cash payments but that : a ) the amounts were not considered sufficiently important in light of other considerations , or b ) it was felt unacceptable to admit financial temptations . bonuses were considered to influence behaviour and attitudes but only when the reward criteria were clearly known to the recipients . the nurses ' acceptance of management bonuses tended to depend on the direct support provided by the managers in question . economic incentives linked to financing conditions of work were seen to be significant for nurses ' daily lives . in general , nurses were sensitive to efforts to facilitate or impede their work . nurses tended not to express themselves in financial terms , often reluctant to admit that monetary reward was of any significance . while many nurses recommended a general increase in salary as the most relevant economic incentive , as much importance was given to the relative salary and its impact on social status as to financial gain . other suggested economic incentives were modest in nature and may reflect certain personal characteristics of individuals attracted to nursing . this study investigated the impression that community nurses are not affected by economic incentives / disincentives . using incentives and disincentives to direct individuals ' energies thus rewarding desired behaviours is common practice in many social interactions ( between persons and between groups of persons ) . this is especially apparent within work settings and the health care system is no exception . economic incentives / disincentives exist in the health sector and community nurses are sensitive to their influence . if nurse rewards are to become more effective organizational tools , the data suggest that future initiatives should : improve nurses ' salary / income relativities ( e.g. comparable pay / rates ) . make available a range of financed rewards ( often considered more socially acceptable ) : - direct ( e.g. subsidized education , additional leave , insurance benefits ) ; - indirect ( e.g. better working conditions , access to professional support network , greater participation in decision - making bodies ) . if performance - related bonuses are to be successfully implemented in a clinical setting , criteria should clearly capture qualitative dimensions of care , indicators should be easily monitored , the rewards must be of a significant nature ( e.g. type , monetary value ) and the language should reflect the notion of " appreciation " for work well done as opposed to " incentive " or " bonus " calling for extra effort . the widespread resistance to such schemes , increasing evidence of their potential demotivating effect on creative , professional workers , and the difficulty of measuring qualitative outcomes in a service sector are however serious arguments against their introduction . if we could understand , and could then predict , the ways in which individuals were motivated we could influence them by changing the components of that motivation process . ( handy , 1993 , p2930 ) understanding the value system of community nurses and how they respond to economic incentives / disincentives facilitates the development of reward systems likely to be more relevant and strategic . i would like to take this opportunity to express appreciation for the ongoing support provided by my phd supervisor , yolande coombes , and nursing organizations the international council of nurses and the swiss nurses association . i would also like to thank the respondents and key informants who generously gave of their time , sharing with me their life experiences and knowledge . finally , i would like to thank who colleagues who encouraged me to disseminate the findings of my research .
shoulder pain is one of the most common complaints encountered in patients with rheumatoid arthritis ( ra ) . during the first 2 yr of ra , nearly 50% of patients have shoulder symptoms , and 90% complain of shoulder pain at some time during the course of the disease ( 1 ) . in addition to the synovitis of the glenohumeral ( gh ) joint , shoulder pain in ra arises from pathologies involving diverse periarticular soft tissues , and the involvement of more than one anatomical structure is common . because it is difficult to detect and identify the site of anatomical alterations with clinical examinations even in non - ra shoulders ( 2 ) , correct diagnosis and management of painful ra shoulder by clinical examination alone is often problematic . radiographic assessment of peripheral joints has served as an objective standard for the evaluation of ra progression . however , it is difficult to evaluate complex anatomical structures such as the shoulder joint by conventional radiography alone . ultrasonographic ( us ) evaluation is useful for diagnosing a variety of regional pain syndrome and soft tissue rheumatism and has been increasingly employed in the rheumatologic practice ( 3 ) . given the great improvement in resolution achieved by high frequency ultrasound , it is expected to serve as an important tool for accurate evaluation of ra shoulders . in a study performed in 43 ra patients , us examination detected more erosions in the humeroscapular joint compared to conventional radiography ( 4 ) . in addition , us examination detected synovitis , tenosynovitis , and bursitis in a significant number of patients , implicating its value for the dignosis of shoulder pain in ra patients ( 4 ) . the objectives of this study were : 1 ) to identify the us abnormalities and 2 ) to compare the physical examination with us findings , especially of the rotator cuff abnormalities in ra patients with shoulder pain . sex , age , height , weight , body mass index ( bmi ) , duration of ra , involved joint groups , current ra medications , erythrocyte sedimentation rate ( esr ) , and c - reactive protein ( crp ) were recorded . detailed history of shoulder pain including duration , involved site , previous diagnosis , and the category of previous treatment was obtained . physical examination of the shoulder was performed systemically by one blinded rheumatologist as follows : 1 ) area of tenderness in the gh joint , acromioclavicular ( ac ) joint , bicipital groove , and subacromial space ; 2 ) range of passive and active motion for abduction , forward flexion , external rotation , and internal rotation measured with a goniometer ; 3 ) neer and hawkins tests for shoulder impingement ; 4 ) maneuvers for determining the location of the tendon lesions ( jobe 's test for supraspinatus , patte 's test for infraspinatus , gerber 's lift off test for subscapularis , and yegarson 's test for the long head of the biceps brachii ) . for the impingement maneuver of neer ( 5 , 6 ) , the examiner stands behind the seated patient and uses one hand to prevent rotation of the scapula while passively raising the patient 's arm with the other hand to produce both forward elevation and abduction . in hawkins 's test ( 7 ) , the examiner stands facing the patient and after raising the patient 's arm to 90 of strict forward elevation with the elbow in 90 flexion , rotates the arm medially by lowering the forearm . these tests are positive when patients experience pain during the maneuvers . in jobe 's maneuver ( 8) , the patient places both arms in 90 abduction and 30 horizontal adduction , in the plane of the scapula ; the examiner then pushes the patient 's arms downward while asking the patient to resist the pressure . for patte 's maneuver ( 9 ) , the examiner supports the patient 's elbow in 90 flexion while the patient is asked to rotate the arm laterally . jobe 's and patte 's maneuvers can produce three types of response : 1 ) absence of pain , indicating that the tested tendon is normal ; 2 ) the ability to resist despite pain , denoting tendinitis ; 3 ) the inability to resist with gradual lowering of the arm or forearm , indicating tendon rupture . in gerber 's lift off test ( 10 ) , the patient is asked to place the hand against the back at the level of the waist with the elbow in 90 flexion . the examiner pulls the hand to about 5 - 10 cm from the back while maintaining the 90 bend in the elbow . in yergason 's test ( 11 ) , pain along the course of the biceps tendon produced by resisted supination of the forearm denotes bicipital tendinitis . a linear array 7 mhz transducer ( hdi 5000 , atl ultrasound , bothell , u.s.a . ) was used . investigations included transverse and longitudinal planes from the long head of the biceps , the supraspinatus , the infraspinatus , and the subscapularis tendons ; the subacromial - subdeltoid bursa ; and the gh and ac joints . tendon thickness , homogeneity of the fibrillar pattern , and the presence of calcification were noted . in all patients , images of the bilateral shoulder were obtained in order to compare us findings between 2 shoulders in case of unilateral involvement . the us examination technique for the shoulder is widely described ( 5 , 12 ) . the biceps tendon was examined with the patient seated with the elbow flexed to 90 and the forearm half pronated on the lap . on the anterior aspect of the shoulder , the long head of biceps tendon is imaged as an oval - shaped echogenic structure . anteromedial to the biceps tendon , the hyperechoic subscapularis tendon was identified with slight external rotation of the gh joint . the supraspinatus tendon was examined with the patient 's shoulder in hyperextension and full internal rotation with the dorsum of the hand placed in the small of the back . these tendons appear as a hyperechoic fibrillar layer , convex , tapered and inserting at the greater tuberosity on longitudinal view . the subacromial - subdeltoid bursa was imaged as a hypoechoic line , between the deltoid muscle and the supraspinatus and infraspinatus tendons . the infraspinatus tendon and gh joint were examined with the patient 's hand placed on the contralateral shoulder . the transducer was oriented in the axial plane until the head of the humerus was seen adjacent to the posterior glenoid labrum . the infraspinatus tendon and its insertion were observed by moving the transducer laterally from the gh joint . the ac joint was examined with the transducer oritented along the coronal plane , and the presence of intra - articular fluid was noted . us data are presented as meanstandard deviation for continuous variables and as frequency ( % ) for categorical variables . a p value was calculated by student 's t - test for continuous variables or by chi - squared test for categorical variables . all the statistical analyses were performed using spss for windows ( version 10.0 , chicago , il , u.s.a . ) . physical examination of the shoulder was performed systemically by one blinded rheumatologist as follows : 1 ) area of tenderness in the gh joint , acromioclavicular ( ac ) joint , bicipital groove , and subacromial space ; 2 ) range of passive and active motion for abduction , forward flexion , external rotation , and internal rotation measured with a goniometer ; 3 ) neer and hawkins tests for shoulder impingement ; 4 ) maneuvers for determining the location of the tendon lesions ( jobe 's test for supraspinatus , patte 's test for infraspinatus , gerber 's lift off test for subscapularis , and yegarson 's test for the long head of the biceps brachii ) . for the impingement maneuver of neer ( 5 , 6 ) , the examiner stands behind the seated patient and uses one hand to prevent rotation of the scapula while passively raising the patient 's arm with the other hand to produce both forward elevation and abduction . in hawkins 's test ( 7 ) , the examiner stands facing the patient and after raising the patient 's arm to 90 of strict forward elevation with the elbow in 90 flexion , rotates the arm medially by lowering the forearm . these tests are positive when patients experience pain during the maneuvers . in jobe 's maneuver ( 8) , the patient places both arms in 90 abduction and 30 horizontal adduction , in the plane of the scapula ; the examiner then pushes the patient 's arms downward while asking the patient to resist the pressure . for patte 's maneuver ( 9 ) , the examiner supports the patient 's elbow in 90 flexion while the patient is asked to rotate the arm laterally . jobe 's and patte 's maneuvers can produce three types of response : 1 ) absence of pain , indicating that the tested tendon is normal ; 2 ) the ability to resist despite pain , denoting tendinitis ; 3 ) the inability to resist with gradual lowering of the arm or forearm , indicating tendon rupture . in gerber 's lift off test ( 10 ) , the patient is asked to place the hand against the back at the level of the waist with the elbow in 90 flexion . the examiner pulls the hand to about 5 - 10 cm from the back while maintaining the 90 bend in the elbow . in yergason 's test ( 11 ) , pain along the course of the biceps tendon produced by resisted supination of the forearm denotes bicipital tendinitis . a linear array 7 mhz transducer ( hdi 5000 , atl ultrasound , bothell , u.s.a . ) was used . investigations included transverse and longitudinal planes from the long head of the biceps , the supraspinatus , the infraspinatus , and the subscapularis tendons ; the subacromial - subdeltoid bursa ; and the gh and ac joints . tendon thickness , homogeneity of the fibrillar pattern , and the presence of calcification were noted . in all patients , images of the bilateral shoulder were obtained in order to compare us findings between 2 shoulders in case of unilateral involvement . the us examination technique for the shoulder is widely described ( 5 , 12 ) . the biceps tendon was examined with the patient seated with the elbow flexed to 90 and the forearm half pronated on the lap . on the anterior aspect of the shoulder , the long head of biceps tendon is imaged as an oval - shaped echogenic structure . anteromedial to the biceps tendon , the hyperechoic subscapularis tendon was identified with slight external rotation of the gh joint . the supraspinatus tendon was examined with the patient 's shoulder in hyperextension and full internal rotation with the dorsum of the hand placed in the small of the back . these tendons appear as a hyperechoic fibrillar layer , convex , tapered and inserting at the greater tuberosity on longitudinal view . the subacromial - subdeltoid bursa was imaged as a hypoechoic line , between the deltoid muscle and the supraspinatus and infraspinatus tendons . the infraspinatus tendon and gh joint were examined with the patient 's hand placed on the contralateral shoulder . the transducer was oriented in the axial plane until the head of the humerus was seen adjacent to the posterior glenoid labrum . the infraspinatus tendon and its insertion were observed by moving the transducer laterally from the gh joint . the ac joint was examined with the transducer oritented along the coronal plane , and the presence of intra - articular fluid was noted . us data are presented as meanstandard deviation for continuous variables and as frequency ( % ) for categorical variables . a p value was calculated by student 's t - test for continuous variables or by chi - squared test for categorical variables . all the statistical analyses were performed using spss for windows ( version 10.0 , chicago , il , u.s.a . ) . the majority of patients had active ra with a mean esr of 42.8 mm / hr . sixteen ( 53.3% ) patients were treated with oral corticosteroid . twenty - seven ( 90% ) patients were treated with disease - modifying anti - rheumatic drug ( dmard ) , and the median number of dmards used was 2 . simple radiography findings of the shoulder included 18 ( 60% ) patients with normal findings , 6 ( 20% ) with erosion , 5 ( 16.7% ) with a degenerative change showing osteophytes and joint space narrowing , 2 ( 6.7% ) with total destruction of shoulder bony architecture , and 1 ( 3.3% ) with calcification . overall , painful shoulders showed more positive findings on physical examination compared to non - painful shoulders . the range of motion affected the most by shoulder pain in our patients was abduction , followed by forward flexion and internal rotation . for physical examination of individual tendons however , during the physical examination , we found that it was very difficult to differentiate the failure to resist due to pain or weakness in many of our patients ; patients often refused to continue the test due to elicitation of severe pain by the maneuver . therefore , this examination was recorded as either positive or negative , with positive result including inability to resist the examiner 's force , be it due to pain or weakness . the majority of the shoulder joints exhibited abnormalities in jobe 's test , indicating supraspinatus lesion , followed by gerber 's lift off ( subscapularis ) and pattes ' ( infraspinatus ) test . the most frequent finding was effusion in the long head of the biceps tendon , which was observed in 37.1% of painful shoulders . the mean thickness of the biceps effusion was 3.30 and 3.41 mm in painful and non - painful shoulders , respectively . biceps tendon rupture and subdeltoid effusion were detected in 14.3% of painful shoulders , respectively . among the rotator cuff tendon , except for the teres minor which was not included in our us examination , subscapularis was the most frequently involved , with tendon tear observed in 37% of shoulders . for supraspinatus and infraspinatus tendon , tendon it is of note that tendon tear was also common among non - painful shoulders , with 32 , 28 , and 12% of shoulders showing tear in the subscapularis , supraspinatus and infraspinatus tendons , respectively . multiple tendon tear was also common with rupture of 2 tendons in 12 and 22.9% , and rupture of 3 tendons in 8 and 11% of non - painful and painful shoulders , respectively . calcification in the supraspinatus tendon was observed in 3 ( 5% ) shoulders , among which only 1 showed calcification on simple radiography . gh joint effusion was noted in 20 and 34.3% of non - painful and painful shoulders , respectively , and the mean thickness of the effusion was 5.06 and 3.64 mm , respectively . humeral cortical irregularity was detected in 12 shoulders ( 20% ) , among which 6 showed erosion on simple radiography . age of the patient , sex , the duration of ra , esr , crp , the presence of rheumatoid factor , the presence of erosion in small joints , and the number of involved joint group were not significantly associated with the presence of tendon tear . the number of dmards used , and the presence of gh joint erosion was significantly associated with the presence of tendon tear . table 6 shows the sensitivity and specificity of physical examination for the detection of us tendon tear . as shown , most of the tests for examination of shoulder joint and rotator cuff yielded low sensitivity and specificity . in this study of ra patients with a relatively short disease duration , us abnormalities in the shoulder were common , with many shoulders showing rotator cuff tendon tears . the most frequent us finding of shoulder joints in our patients was effusion in the long head of the biceps tendon . among the rotator cuff tendons , physical examination traditionally used for the diagnosis of shoulder pain had low sensitivity and specificity for detecting tendon tear in the rheumatoid shoulder joint . the frequency of abnormal us findings of rheumatoid shoulder joints differs depending on the patient population studied . in a study evaluating 44 hospitalized ra patients with mean disease duration of 12 yr , subacromial bursitis was the most frequent finding , followed by gh joint synovitis , bicipital tendinitis and abnormalities in the supraspinatus tendon ( 13 ) . in accordance with our result , abduction and forward flexion were often restricted , but clinical findings were non - specific ( 13 ) . in another us study evaluating 90 ra shoulders with a mean disease duration of 5.5 yr ( 2 ) , effusion in the long head of the biceps tendon was noted in 32.2% , and subacromial bursitis in 17.7% , while rotator cuff tear was detected infrequently ( 1.1 for infraspinatus and 4.4% for supraspinatus ) . compared to polymyalgia rheumatica or periarticular disorders of the shoulders not related to ra , rheumatoid shoulders tended to show involvement of all periarticular structures ( 2 ) . this discrepancy from our data may stem from the difference in patient profile as well as the quality of the us equipment or the protocol for the evaluation of the shoulder . in a more recent study ( 14 ) , 57 consecutive ra patients were evaluated using a 7.5 mhz linear probe and a standardized study protocol . rotator cuff tear was noted in 10% of the painful shoulders . in line with our data , tendon tear was most frequently observed in subscapularis tendon in our patients , and this is in contrast with rotator cuff tear in non - ra shoulder pain , which shows tear in supraspinatus most often ( 15 , our unpublished observation ) . whether this is a specific finding in ra shoulder there have been no reports assessing the risk factors for rotator cuff tendon tear in ra patients . in our study , usual indicators of disease activity , such as esr , crp or the presence of hand / foot joint erosion were not significantly correlated with the presence of tendon tear . duration of ra or shoulder pain and rf positivity were not correlated , either , but the presence of gh joint erosion or number of dmards used were . because data were collected cross - sectionally at the time of us evaluation , number of dmards used may be a better indicator of overall disease activity compared to esr or crp . in addition , duration of ra tended to be longer in ra patients with tendon tear compared to those without , and the statistical non - significance might have been due to the small sample size . in line with previous reports ( 5 , 16 ) , our results show that the clinical examination of periarticular conditions in the painful ra shoulder is not accurate . the low sensitivity and specificity of physical examination for ra shoulders may be due to the fact that most ra patients with shoulder pain have multiple periarticular lesions , involving tendons , the subacromial - subdeltoid bursa , and gh joint simultaneously . the failure to distinguish between positive findings due to weakness or pain might also have resulted in the low specificity of physical examination in our patients . in addition , involvement of elbow or wrist joint often hinders from proper examination of the shoulder , decreasing diagnostic accuracy . currently , magnetic resonance imaging ( mri ) has been widely used to evaluate painful shoulders . a recent study compared us examination with dynamic contrast - enhanced mri in shoulders of patients with ra ( 17 ) . although us examination detected significantly more bony erosion compared to conventional radiography , mri was significantly more sensitive for detecting synovitis , tenosynovitis , and bursitis as well as bony erosion than us examination . however , while mri is expensive , time - consuming , and not widely available , us examination is quick , inexpensive , and easy to perform . more recently , us supplemented by power doppler was found to have value in differentiating rheumatoid inflammation from the degenerative shoulder disease by detection of the changes in vascularities , extending the applicability of us examination to the evaluation of the process of inflammation in relation to neoangiogenesis ( 18 ) . although us examination offers considerable benefit for proper evaluation of shoulder joint problems , limitations exist such as lack of visualisation of the posterior aspect of the rotator cuff tendons , limited view of the gh joint , and considerable dependence on the operator . therefore , despite the fact that most rotator cuff lesions involve the " critical zone " in the anterior aspect of the tendons ( 19 ) , us examination may underestimate the prevalence of rotator cuff abnormalities . first , gold standard for assessing the shoulder lesion , such as arthroscopy or mri was not done . although the agreement between us examination and mri in the detection of tendon tear was good in 4 of our patients who underwent mri after us examination ( data not shown ) , the incidence of rotator cuff tear detected by us examination alone might have been incorrect . non - painful shoulders in ra patients showed more us abnormalities compared to asymptomatic shoulders in non - ra patients examined in a separate study ( unpublished observation ) . therefore , our main finding is that ra shoulders exhibit multiple lesions regardless of the presence of pain . conservative treatments of shoulder problems in ra include medical treatment , physiotherapy , and local injections of corticosteroids . the high prevalence of rotator cuff tear in ra shoulders shown in our series warrants precaution against these empirical treatments ; it would be more desirable to obtain an exact anatomical diagnosis in order to optimize treatment . few studies have compared the outcome of treatment for periarticular shoulder lesions with or without an accurate imaging technique ( 20 ) . a recent surgical series revealed that ra patients with both partial and full - thickness rotator cuff tears had significant improvements in overall pain and satisfaction after the repair ( 21 ) . however , only patients with a partial - thickness tear had improvement of active elevation . this result suggests that rotator cuff tendon repair performed early in its course may be more beneficial to obtain satisfactory result . there is a need for further trials investigating whether the us examination of the shoulder in ra patients offers a possibility of improving its treatment .
bacillus calmette - gurin ( bcg ) is an attenuated strain of mycobacterium bovis [ 1 , 2 ] . since bcg is usually considered to be avirulent , it is used for vaccination against tuberculosis in japan for infants . on the other hand , a previous report suggested that delayed granuloma formation could develop at the bcg vaccination site , though the granuloma - composing cells were still unknown [ 1 , 2 , 3 , 4 , 5 ] . in this report , we describe a case of lupus vulgaris ( lv ) arising from a bcg vaccination site 22 years after vaccination which was composed of m2-polarized macrophages . a 64-year - old japanese man visited our outpatient clinic with a 30-year history of pruritic erythema on the left arm . his condition had been treated in a private clinic with topical steroids , and he consulted our hospital for metastatic skin cancer . he had been given bcg vaccination into the left arm when 12 years old . on his initial visit , physical examination revealed erosive , asymptomatic nodules developing from a well - defined erythematous plaque on the left arm ( fig . cultures on 2% ogawa medium detected the mycobacterium tuberculosis complex , leading to identification of m. bovis bcg strain tokyo 172 . from the above finding one year after stopping isoniazid , there was no sign of relapsing nodules . since m. bovis bcg has been reported to induce m1 macrophages and , in contrast , m2-polarized macrophages have been reported to contribute to tissue remodeling , we employed immunohistochemical staining for cd68 ( fig . the granuloma - composing macrophages were mainly composed of cd68 + cells , cd163 + macrophages and cd206 + cells . periostin was prominent in the stroma of granulomas adjacent to cd163 + macrophages ( fig . 2f ) . the frequency of lv as one of the rare complications after bcg vaccination [ 2 , 3 , 4 ] is estimated to be only 5 per 1 million vaccinations [ 2 , 3 , 4 , 8 ] . lv is a chronic form of tuberculosis occurring in individuals with moderate to high immunity against tubercle bacilli . since lv induced by bcg vaccination is correlated with immunosuppression such as cellular immune defects and impaired il-12- and interferon--mediated immunity , bcg - induced lv might complicate skin cancer , including squamous cell carcinoma and basal cell carcinoma [ 1 , 10 ] . notably , these skin cancers contain tumor - associated macrophages in the lesional skin to maintain an immunosuppressive tumor microenvironment together with regulatory t cells [ 11 , 12 , 13 ] . in addition , von bubnoff et al . reported that infectious cutaneous granulomas , including conventional lv , possess granulomas composed of cd68 + macrophages that express indoleamine 2,3-dioxygenase , which degrades the tryptophan in the surrounding microenvironment to suppress t cell function . from the above reports , we hypothesized that bcg - induced lv might possess m2-polarized macrophages that contributed to the development of lv . to prove our hypothesis , we employed immunohistochemical staining for cd68 ( a common myeloid marker ) , inos ( m1 marker ) , cd163 and cd206 ( m2 markers ) , as well as periostin , which was previously reported to stimulate cd163 + macrophages to produce various functional factors such as chemokines and matrix metalloproteinases . as expected , the granuloma cells were mainly composed of cd68 + myeloid cells , cd163 + macrophages and cd206 + cells . in addition , periostin was prominent in the stroma of granulomas , suggesting that periostin might stimulate cd163 + macrophages to establish the granuloma by producing various chemokines . since this report presents only a single case , further analysis of the mechanisms underlying this phenomenon may provide fundamental insights into the biology of lv arising from a bcg vaccination site .
we obtained the full - length genome sequence for a / duck / nigeria/3724 - 2/2008 and the sequence of the hemagglutinin ( ha ) segment for a / duck / nigeria/3724 - 10/2008 ( 4 ) . sequences of the 8 gene segments of a / duck / nigeria/3724 - 2/2008 were submitted to the global initiative on sharing avian influenza data public database ( accession nos . the ha segment of the 2 isolates was identical , and the deduced amino acid sequence of the ha cleavage site was characteristic of hpai ( h5n1 ) ( pqgerrrkkr*glf ) . the highly pathogenic pathotype was confirmed by the result of the intravenous virus pathogenicity index test ( index 2.87 ) ( 3 ) . phylogenetic analysis of the 8 genes was conducted by using mega 4 ( 5 ) with the neighbor - joining method , and the ha and na tree topology was confirmed by using bayesian methods ( 6 ) ( figures 1 , 2 ) . phylogenetic analysis of the ha gene segment showed the viruses fall in clade 2.2 , according to the unified nomenclature system ( 7 ) . unexpectedly , the viruses were grouped separately from the viruses previously detected in nigeria and in other african countries . they clustered in the sublineage here designated iii , together with hpai ( h5n1 ) viruses isolated in 2007 in europe and middle east ( figure 1 ) . phylogenetic analysis of the na gene segment of a / duck / nigeria/3724 - 2/2008 supported these results ( figure 2 ) . phylogenetic tree constructed by bayesian analysis of the hemagglutinin gene segment of representative influenza viruses a ( h5n1 ) from africa , europe , and the middle east . taxon names of the nigerian viruses isolated during 20062007 are marked in blue , 2008 isolates in red . phylogenetic tree constructed by bayesian analysis of the neuraminidase gene segment of representative influenza viruses a ( h5n1 ) from africa , europe , and the middle east . taxon names of the nigerian viruses isolated during 20062007 are marked in blue , 2008 isolate in red . sequence analysis of the 8 gene segments of a / duck / nigeria/3724 - 2/2008 showed the highest similarity at the nucleotide level with the hpai ( h5n1 ) virus isolate a / cygnus olor / czech republic/10732/2007 ( 99.3% for ha , 99.8% for na , 99.7% for nonstructural protein , 99.4% for polymerase basic protein 1 [ pb1 ] , 99.7% for polymerase basic protein 2 [ pb2 ] , 99.8% for nucleoprotein [ np ] , 99.3% for polymerase acidic protein [ pa ] , and 100% for matrix [ ma ] protein ) and with the hpai ( h5n1 ) strains from romania collected in 2007 ( 99.3% , only ha gene segment is available ) . for the ha protein , only 3 amino acids differences were observed between the nigerian isolate and the strain a / cygnus olor / czech republic/10732/2007 . lower similarities ( ranging from 96.9% to 98% for the ha gene ) were shown with previous isolates from nigeria . no molecular changes were associated with increased affinity toward 2,6 linkage sialic acid substrates in the ha receptor - binding domain ( 8) or mutations related to resistance to na inhibitors and to adamantanes were observed in the ha , na , and m2 genes of the nigerian isolate . analysis of the amino acid sequences of the internal proteins of a / duck / nigeria/3724 - 2/2008 virus showed the amino acid lysine at position 627 of the pb2 gene known to be associated with increased virulence of hpai ( h5n1 ) virus in mice ( 9 ) and 1 amino acid mutation at position 33 ( v33i ) of the np gene , which is described as genetic signature of human influenza a virus ( 10 ) . the pb1-f2 protein had 1 mutation at position 66 ( n66s ) , previously observed only in the hong kong 1997 subtype h5n1 viruses and in the 1918 pandemic strain ( a / brevig mission/18 ) and is associated to high pathogenic phenotype in mice ( 11 ) . since the earliest known progenitor detected in china , a / goose / guandong/96 , numerous lineages of hpai ( h5n1 ) viruses have emerged ( 7 ) . introduction and spread of distinct h5n1 genetic lineages were described in several asian countries and in europe , such as germany , italy , and france ( 12,13 ) . surprisingly , nigeria is the only country in africa where hpai ( h5n1 ) belonging to distinct sublineages have been detected ( 4,12,14 ) . previous genetic characterization of hpai ( h5n1 ) viruses isolated during 2006 and 2007 indicated the cocirculation in nigeria of 3 distinct sublineages , here designated i , ii , and iv ( 4,14 ) . sublineages i and ii appeared to be widespread in this country during 2006 and 2007 ( 14 ) , and their extended cocirculation enabled reassortment events between these sublineages . the first reassortant virus was identified in june 2006 ( 12 ) , and in early 2007 , an additional reassortant virus was identified in 7 of 22 nigerian states where infection was found ( 4 ) . our results indicate a novel introduction in nigeria of a virus belonging to sublineage iii , a genotype not previously detected in the african continent . indeed , previous surveillance efforts ( passive and active ) since 2006 in nigeria and other african countries ( 4,12,14 ) never showed evidence of the circulation of a virus belonging to this sublineage . viruses belonging to sublineage iii have been detected in domestic and wild birds in 2007 in european , middle eastern , and asian countries such as germany , poland , romania , the czech republic , kuwait , saudi arabia , russia , and pakistan . the nigerian isolate a / duck / nigeria/3724 - 2/2008 resulted in a genome almost identical to an isolate from a mute swan living in the wild , namely , a / cygnus olor / czech republic/10732/2007 ( 15 ) . this finding , however , does not shed light on how the virus was introduced into nigeria because neither of the 2 main means of spread , through wild birds or the poultry trade , can be excluded . the evidence of a mutation in the pb1-f2 gene segment that increases the pathogenicity of the virus in mammalian hosts is of concern . this type of mutation has never been observed in hpai ( h5n1 ) viruses of clade 2.2 ; this finding supports the need for a continuous monitoring effort of influenza viruses a ( h5n1 ) viral genotypes and their evolution . our findings highlight the evolving epidemiology of hpai ( h5n1 ) viruses and the need for implementation and maintenance of sustainable surveillance programs in countries where infection has been found and in countries where it has not . the outcome of these efforts , however , can be maximized only through prompt reporting to international organizations and international collaboration that leads to timely molecular and antigenic comparisons of isolates .
the progressive development in the field of information and communication technology ( ict ) during the last decades has led to great advances also in the health sector ( e - health ) . there is a global , regional , and national awareness about the importance of e - health . the world health organization ( who ) millennium development goals ( mdgs ) gaps task force has encouraged the governments to increase the use of ict in the provision of health services in order to increase its efficiency and support the achievement of the mdgs . the who eastern mediterranean regional office took a strategic direction to emphasize the importance of using ict in health , leveraging e - health : use of ict in health in the eastern mediterranean region . at the national level , many countries ( including sudan ) include e - health in their national health plans . however there is a large variation between countries in their commitment and implementation of e - health strategies . the gezira family medicine project ( gfmp ) is a collaboration project between the faculty of medicine , university of gezira , and the ministry of health in gezira state of sudan . it aims to improve the quality of primary care health services , through training of family doctors and improving service delivery at this level . gfmp provides a two - year master 's program in family medicine since 2010 for the practicing doctors in both urban and rural areas . ict was implemented in three main areas : telemedicine , e - learning , and the electronic medical records ( emrs ) . telemedicine is defined as the use of medical information exchanged from one site to another via electronic communications to improve a patient 's clinical health status . in this paper the term is used to describe online interaction between specialist doctors and the candidates enrolled in gfmp through a videoconference - like meeting . telemedicine at the gfmp aims to break down the geographical barrier and to increase access to a high quality care at the specialist level to patients all over gezira state . although there are some articles evaluating telemedicine in developing countries , a literature review in the eastern mediterranean region showed that e - health has not yet been well studied . numerous telemedicine articles are found from developed countries , but in general there has been relatively scarce telemedicine research from developing countries . in this study it was selected on basis of the great educational opportunities it provides for the students and its enhancement of faculty effectiveness and efficiency [ 9 , 10 ] . use of electronic medical records ( emrs ) is expected to increase patients ' safety and is of high value in effective service provision . many emr programs are developed worldwide for both hospital and primary care levels and are sometimes used for specific diseases like hiv in africa or for follow - up of chronic diseases . this study evaluates the comprehensive experience of using ict both in education and in service provision at gfmp . it describes the physicians ' experience of e - learning as a training method and its role in facilitating the in - service model of training at the gfmp . administrative data was used to show the actual utilization of ict in education and practice while questionnaire - based data was used to assess candidates ' perception and satisfaction regarding the use of ict . gezira state lies in the central part of sudan and has a total population of 3.7 million ; about 80% are living in rural areas . health services are provided through over three hundred health centers which are served by medical doctors or medical assistants ( nurse ) ; the second line is rural hospitals or city hospitals . infectious diseases like malaria represent the major cause of morbidity and mortality in gezira ; however noncommunicable diseases ( ncds ) are emerging . a cross - sectional observational design was followed to collect administrative and questionnaire - based data . the study targeted the 207 candidates ( medical doctors ) of the first batch enrolled in the gfmp master program . the number of candidates declined gradually from 207 at the program start to reach 125 candidates at their graduation exam ; the main reason was migration to other rich countries . administrative data collection for the use of telemedicine has targeted all the 207 candidates ( from the program start ) , while questionnaire - based evaluation has targeted the 125 candidates at their graduation . the form included date of the consultation , age and sex of the patient , clinical symptoms , tentative diagnosis , management , and any referral to secondary care , besides the name of the consulting family doctor and consulted specialist doctor . data from gfmp annual reports for the period from april 2011 ( telemedicine start ) to december 2012 were used in this paper . data collected for emrs and e - learning was obtained from administrative data and exam results ' data . the candidates ' use of the ict tools was a part of their evaluation at the family medicine exams , which included the number of initiated and opened electronic patient files ( quantity ) , the comprehensiveness of the data in the files ( quality ) , the candidates participation in telemedicine activity ( number of consultations ) , and the candidate 's participation in the online e - learning activities . candidates ' own evaluation of the use and effect of the different ict elements , that is , telemedicine , emrs , and e - learning , was registered through an anonymous questionnaire filled by them at the end of their study period of the master 's program . we used a six grades ' scale : strongly agree ( 6 ) , somewhat agree ( 5 ) , agree ( 4 ) , disagree ( 3 ) , somewhat disagree ( 2 ) , and strongly disagree ( 1 ) . a total of 113 candidates responded to the ict self - evaluation questionnaire out of the total number of 125 graduating candidates , a response rate of 90.4% . at the start , all of the 207 trainees were provided with computer laptops with an in - built camera for telemedicine and training purposes ; they were also provided with free internet service ; all was paid by gezira state government . two telemedicine studios were established and equipped with computers , lcd screens , cameras , microphones , internet , and telephone lines . the software program oovoo was used to connect family doctors ( together with the patient ) at the health centers all over gezira state with the specialists at the gfmp headquarter in madani town ( capital of the state ) . they communicated by means of voice , picture , and chatting in a videoconference - like setting , allowing the family doctor to show the specialist some clinical signs on the patient such as skin manifestations or some investigations like ecg . a weekly scheduled program was set for specialist doctors in telemedicine activities , provided to the candidates so that they could communicate with the needed specialist at the scheduled times . before the start of the gfmp , there were few health centers in gezira state that were not using medical records at all , even as paper notes . the program copes with local needs and includes the icd10 classification of diseases . the same studios used for telemedicine were also used for educational activities . cisco - webex software was installed in the computers of the candidates and at the studios ; it is used to connect all candidates with the lecturer . candidates could see , hear , and interact with the lecturer who could share his desktop screen with the candidates to show them pictures , slide presentations , videos , or text documents . any trainee could also take the host role and present a tutorial or other activity to the other trainees and the lecturer . it was also possible to download the online activities later from the website of the gfmp ; some candidates preferred to attend the lectures on portable devices , especially when there were problems with internet connectivity . , armonk , ny , usa ) was used for data management and statistical analyses . the study was reviewed and approved by the ethical review committee at the ministry of health , gezira state , sudan . the study proposal was also approved by the regional committee for medical and health research ethics , western norway . privacy issues and patients ' file management related to the scientific evaluation were also approved by the norwegian data protection official for research . the telemedicine activity at the gfmp started on april 1 , 2011 , almost six months after the start of the program . a total of 3808 telemedicine consultations have been registered in the period from april 1 , 2011 , to december 31 , 2012 . the mean number of consultations per month was 181 , with a slight monthly increase during the first year , reaching its maximum of 299 consultations in march 2012 ; this was followed by a large decrease to a minimum of zero consultations in september 2012 ( due to internet disconnection ) , followed again by an increase reaching its maximum of 309 consultations in december 2012 . the majority of the consultations ( n = 2763 , 74% ) were held by female doctors ( mean 31 consultations per female doctor ) , compared with 8 per male doctor . almost one - third of the consultations were related to the discipline of internal medicine ( 32.6% ) followed by paediatrics ( 21.8% ) . male doctors used to have more consultations in obstetrics and gynaecology , surgery , and ent , while female doctors used to consult specialists in ophthalmology , dermatology , and internal medicine in a higher proportion than men ( figure 2 ) . the vast majority of telemedicine consultations were done by doctors working in madani locality ( 2234 consultations , mean 35 per doctor ) , followed by el - kamlin locality ( 469 consultations , mean 19 per doctor ) . least consultations were registered from east - gezira locality ( 55 consultations , mean 3 per doctor ) . findings from the candidates ' evaluation of the use of telemedicine are shown in table 1 . all respondents agreed to varying degrees on the high importance of telemedicine to their patients ' care . the majority ( 81% ) usually preferred taking telemedicine consultations with the patient being in the office . however , almost one - fifth of the candidates agreed ( in varying grades ) that patients might lose the confidence in their family doctors if telemedicine consultations were used . in general , males demonstrated more positive attitude , compared with females , regarding several aspects of telemedicine , although this was not statistically significant ( table 1 ) . a total of 165993 new patients ' emrs were created by the study subjects , 125 candidates , mean of 1328 files per doctor ( maximum 5470 , minimum 104 , and median 1178 ) . the mean number of files opened by male doctors was 1413 ( n : 49 male doctors ) , while the mean for female doctors was 1273 ( n : 76 female doctors ) . almost two - thirds of the respondents strongly agreed that emr is important for the care of their patients , while a third agreed or somewhat agreed . on the other hand a fifth strongly agreed , and more than a half agreed or somewhat agreed that patients are not happy when the family doctor was using a computer during consultation the majority of respondents stated that they register all or most of their patients in emrs . males reported a more positive attitude ( statistically not significant ) than females regarding the use of the emr ( table 1 ) . administrative data showed that 240 online lectures and 29 meetings were organized using the software program cisco - webex in the period from may 2011 to october 2012 . ( n : 90 ) , internal medicine 23% ( n : 55 ) , paediatrics 15% ( n : 37 ) , obstetrics and gynaecology 8% ( n : 19 ) , and surgery 8% ( n : 18 ) , and the rest was distributed between other medical disciplines . almost two - fifths of the respondents strongly agreed that online lecture was a good teaching method . one - half of the candidates either agreed or somewhat agreed , while 9% disagreed , somewhat disagreed , or strongly disagreed there was a large variation in the evaluation of the candidates regarding the easiness of combining work with the training activities ; 28.6% reported degrees of disagreement , while 71.4% reported degrees of agreement . the difference between males and females is more prominent in the e - learning component although it did not reach statistical significance level ( p = 0.072 and p = 0.070 ) ; thus males had a tendency of more positive attitude to the utilization of e - learning . a successful integrated utilization of ict at the gfmp in sudan is shown in this study . a high number of telemedicine consultations were achieved , with high satisfaction among the candidates . emrs were introduced in this area for the first time , and more than 165,000 patient files were opened in a period of two years , reflecting a great need for such innovative solutions in primary care settings in developing countries . using ict at the gfmp has also contributed to universal health coverage and partially reduced the problem of brain drain which is a recognized challenge in developing countries . gfmp recruited 207 doctors to work at primary health care facilities , where 84 health centers had never been served by a physician before . this finding is in agreement with that of a study from mali ( 2012 ) which reflected the positive significant influence of ict on the recruitment and retention of health care professionals . this successful use of telemedicine activity follows a global trend of positive experience in using telemedicine , which is also documented in developing countries [ 1921 ] . a survey from the who in 2014 revealed encouraging findings in many countries regarding e - health and innovation in women 's and children 's health . the monthly variation in the number of telemedicine consultations represents the expected challenges facing ict implementation , including technical problems , academic obligations ( exam periods ) , and sometimes economic constrains where the project was unable to afford internet fees . discipline based variation in telemedicine utilization was prominent ; this can be due to the spectrum of common diseases in the area . telemedicine activity was not used in emergency cases at the gfmp , in contrast to other experiences where telemedicine has been used only in emergency and disaster settings . the candidates were highly satisfied with telemedicine and found it as an effective pathway to communicate quickly and effectively with the physicians working in second - line care . the huge number of electronic records establishes a data pool that is suitable for research as well as for patients ' care . the variation in the number of registered patients between physicians could mainly be attributed to the size of population in the catchment area , in addition to the activity of each health center . the physicians ' high activity in using the emr system was influenced by the workplace based assessment ( wba ) method of evaluation in their family medicine master 's exam ; both the quantity ( number of files ) opened by the candidate and the quality ( comprehensiveness ) of the files were evaluated in the exam . a systematic review of the impact of wba on doctors ' education and performance showed positive performance changes . physician 's attitude towards the use of computer during consultation provided similar results to a study done in the united arab emirate ( uae ) , where concerns including effectiveness of patients ' communication were also highlighted . other studies assessing patients ' satisfaction with the use of computers during consultation revealed general satisfaction [ 2628 ] . e - learning was used at the gfmp in a blended way , including both face to face teaching and e - learning . a review article compared the use of blended e - learning methods with the traditional approaches in medical education in resource constrained countries . it revealed either better - promising results or no statistically significant differences between the two approaches in the majority of studies . a study from iran comparing the effect of lecture and blended teaching methods on students ' learning and satisfaction showed higher satisfaction among students using blended method . firstly , reduction of the number of enrolled candidates ( 207 to 125 ) within the 2-year training period , due to brain drain to rich countries . secondly , information on patients ' perception on the use of the emr and telemedicine utilization during consultation was obtained from the study subjects ( family physicians ) , instead of the patients themselves . this study collected physicians ' perceptions about patients ' feelings generally , not at an individual patient 's basis . finally , social desirability bias of self - administered questionnaires was reduced by blinding the name of the participants . in addition , administrative data reflects the real practice and could approve or disapprove the physicians ' perception . in this case the high use of ict tools was in harmony with the high satisfaction reported by the participants . gfmp 's experience in utilizing ict in a comprehensive way , including telemedicine , emrs , and e - learning , is rather unique in a developing low - resource country setting . results from this study show how ict implementation in primary care can participate in achieving important health care goals like universal coverage , accessibility , decreasing brain drainage , and increasing the training 's capacity in the health sector . although the project was politically and financially supported on a national level , the successful implementation was not without barriers and challenges , such as internet coverage and technical problems . the issue of sustainability deserves to be considered and further research is needed to explore the impact of using ict on health indicators in the project .
orthorexia nervosa , literally meaning proper appetite , is a pathological fixation with healthy food that has aptly been described as a disease disguised as a virtue.1 although not yet officially recognized as a psychiatric diagnosis , orthorexia is often associated with significant impairment , as what starts as an attempt to attain optimum health through attention to diet may lead to malnourishment , loss of relationships , and poor quality of life . relative to other styles of unhealthy eating , orthorexia has been largely neglected by the scientific community even though its behavioral pattern is frequently observed by eating disorder specialists.2 in this review , we describe what is known about the symptoms , epidemiology , and assessment of orthorexia , including a discussion of its diagnostic boundaries and neuropsychological profile . we also highlight what remains unknown about this problematic eating pattern and suggest multiple avenues for additional research . first coined by bratman and knight in 1997 , the term orthorexia nervosa describes individuals with an obsession for proper nutrition who pursue this obsession through a restrictive diet , a focus on food preparation , and ritualized patterns of eating . orthorexic individuals are typically concerned by the quality , as opposed to the quantity , of food in one s diet,3 spending considerable time scrutinizing the source ( eg , whether vegetables have been exposed to pesticides ; whether dairy products came from hormone - supplemented cows ) , processing ( eg , whether nutritional content was lost during cooking ; whether micro - nutrients , artificial flavoring , or preservatives were added ) , and packaging ( eg , whether food may contain plastic - derived carcinogenic compounds ; whether labels provide enough information to judge the quality of specific ingredients ) of foods that are then sold in the marketplace.4 the fixation on food quality a combination of the nutritional value of food as well its perceived purity is prompted by a desire to maximize one s own physical health and well - being , rather than religious beliefs or concerns for sustainable agriculture , environmental protection , or animal welfare . such preoccupation with health from food may elicit eating patterns that are especially complex ( eg , internalized rules governing which foods can be combined at one sitting or at certain times of day ) and/or require unusually long periods of time to execute ( eg , beliefs that maximal digestion of one food type occurs a certain amount of time after ingestion of another food type ) . outside of meals , extra time is spent researching and cataloging food , weighing and measuring food , and planning future meals , with additional , intrusive , food - related thoughts occurring outside of these circumscribed periods.1 diagnostic criteria , as suggested by moroze et al,5 are shown in table 1 . with regard to the consequences of this extreme style of eating , orthorexic individuals may experience nutritional deficiencies due to omission of entire food groups,6 and , although long - term empirical studies are lacking , there is anecdotal evidence that this kind of dietary extremism can lead to the same medical complications that one sees with severe anorexia : osteopenia , anemia , hyponatremia , metabolic acidosis , pancytopenia , testosterone deficiency , and bradycardia.1,5,7 psychologically , orthorexic individuals experience intense frustration when their food - related practices are disrupted or thwarted , disgust when food purity is seemingly compromised , and guilt and self - loathing when they commit food transgressions,8 all of which is superimposed on chronic worry about imperfection and nonoptimal health . indeed , dietary violations may prompt a desire for self - punishment , manifested by an even stricter diet , or purification via supposedly cleansing fasts.1 moreover , orthorexic individuals are at risk for social isolation , as they may believe that they can only maintain healthy eating while alone and in control of one s surroundings and may adopt a stance of moral superiority about their food habits such that they do not wish to interact with others who are unlike them.8 many of the features described above echo symptoms of anorexia nervosa and obsessive compulsive disorder ( ocd ) , conditions that are themselves highly comorbid and have functionally similar clinical presentations,9 prompting debate as to whether orthorexia is a unique disorder or a subset of anorexia or ocd ( figure 1 ) . orthorexia and anorexia share common traits of perfectionism , high trait anxiety , and a high need to exert control,10 in addition to the potential for significant weight loss.4 both orthorexic and anorexic individuals are achievement - oriented , valuing adherence to their diet as a marker of self - discipline and construing deviation from the diet as a failure of self - control . both have limited insight into their condition and often deny the functional impairments associated with their disorder.1 with regard to overlap with ocd , orthorexic individuals manifest certain obsessive compulsive tendencies : recurrent , intrusive thoughts about food and health at inappropriate times , inflated concern over contamination and impurity , and a strong need to arrange food and eat in a ritualized manner.1,11 similar to those with ocd , orthorexic individuals have limited time for other activities , as adherence to a strict eating style interferes with normal routines.4 yet , there are notable points of departure between orthorexia and these other conditions as well . the most significant difference between orthorexia and anorexia is the motivation for disordered eating . in anorexia , individuals are preoccupied with body image and fear of obesity , altering their eating patterns in order to lose weight . in orthorexia , individuals adopt eating habits given a desire to be healthy , natural , or pure,1,12 entertaining unrealistic , if not magical , beliefs about certain foods.13 anorexic individuals tend to hide their behaviors , whereas orthorexic individuals are more likely to flaunt their habits.1 with regard to ocd , the most significant difference is that the content of obsessions in orthorexia is perceived as ego - syntonic , rather than ego - dystonic.8 beyond these two disorders , orthorexia shares overlapping features with several other diagnostic categories , including obsessive compulsive personality disorder ( ocpd ) . within the ocpd syndrome , which itself belongs to the cluster of personality disorders characterized by fear and behavioral inhibition,14 notable similarities to orthorexia include perfectionism , rigid thinking , excessive devotion , hypermorality , and a preoccupation with details and perceived rules . while no studies to date have examined the rates of co - occurrence between ocpd and orthorexia , the comorbidity between ocpd and ocd and between ocpd and eating disorders has been extensively studied . data concerning the former are mixed , with some studies suggesting a low degree of association between ocpd and ocd15,16 and others indicating significant and specific associations.17,18 concerning the latter relationship , there is some evidence that ocpd , rather than ocd , has a close link with eating disorders,19 particularly to anorexia.20 other research has shown that the presence of ocpd traits positively predicts development of pathological eating habits.21,22 features of orthorexia may also bear resemblance to health - related anxiety seen in the somatoform disorders . although the 5th edition of the diagnostic and statistical manual of mental disorders ( dsm-5)23 introduced significant changes to the nomenclature and scope of the somatoform conditions relative to the dsm - iv - tr edition , the potential relevance of orthorexia to these conditions , namely somatic symptom disorder and illness anxiety disorder , is noteworthy . with the former , individuals experience one or more chronic somatic symptoms whether or not medically unexplainable about which they are excessively preoccupied or fearful , prompting frequent use of traditional and sometimes nontraditional health care services . with the latter , individuals experience heightened bodily sensations and are intensely anxious about the possibility of an undiagnosed illness , often devoting excessive time and energy to these health concerns . in each condition , the preoccupation with illness might engender a secondary preoccupation with food and diet as a route by which to combat real or perceived illness ; in this scenario , an individual would be most likely to turn toward compensatory dietary management upon dissatisfaction with the traditional medical establishment or upon specific advice from health care professionals to manage illness with diet . while there are no empirical studies to date that specifically describe orthorexia as an associated feature of these somatoform conditions , health anxiety is known to be positively correlated with food and diet preoccupation,24 and there is evidence that health anxiety prompts significant , problematic changes in eating patterns.25 lastly , although robust empirical data are lacking on this topic , there remains the possibility that orthorexia can signal more severe psychopathology in the form of a psychotic spectrum condition . to date , there is one case study of an adult woman whose orthorexic eating habits represented the prodromal phase of schizophrenia.26 while the comorbidity of schizophrenia and eating disorders is generally estimated to be low,27 the numerous case reports of anorexia preceding first episode psychosis have prompted theories that a ) the obsessional features of anorexia have the potential to devolve into more precise delusions over time and that b ) nutritional deficiency from food restriction may itself trigger psychosis . as orthorexia is a recently - documented construct , prospective analysis is needed to determine the extent to which orthorexia elevates the risk for subsequent development of schizophrenia , delusional disorder , and related conditions . at a theoretical level , the feature of orthorexia of greatest relevance to the psychosis spectrum is food - related magical thinking ( table 2 ) , erroneous beliefs that are based on intuitive laws of contagion ( ie , the notion that objects that have been in real or imagined contact continue to influence each other over time or space ) or similarity ( ie , the notion that superficial resemblances between objects or concepts are actually deeply meaningful).13,28 regardless of whether their origin is culturally or religiously accepted , magical beliefs about food are of medical concern when food exclusion and food refusal lead to severe nutritional deficiency.29 from a psychiatric perspective , elevated magical ideation , regardless of its content , is a common symptom of schizotypal personality disorder and a good predictor of future psychosis.30 data concerning the epidemiology of orthorexia , like that of any other condition , are shaped by the sensitivity and specificity of assessment instruments . the fact that there are no thoroughly vetted measures of orthorexia with clear psychometric properties makes it difficult to obtain trustworthy estimates of its prevalence . in their original treatise on orthorexia , bratman and knight1 proposed a simple 10-item dichotomous rating scale by which to assess orthorexia , but this measure has not received much traction in the literature . instead , researchers have relied primarily on a modification of this scale called the orto-1531 and , to a lesser degree , the orto-1110 and orto-11-hu32 to measure the prevalence of orthorexia in various populations.3,6,32 there is debate , however , as to the reliability and validity of these measures . the orto-15 is a 15-item measure that assesses beliefs about the perceived effects of eating healthy food ( eg , do you think that consuming healthy food may improve your appearance ? ) , attitudes governing food selection ( eg , are your eating choices conditioned by your worry about your health status ? ) , habits of food consumption ( eg , at present , are you alone when having meals ? ) , and the extent to which food concerns influence daily life ( eg , does the thought about food worry you for more than 3 hours a day?).31 responses are scored on a 4-point scale and totaled , with scores below 40 considered indicative of orthorexia and higher scores purportedly reflecting normal eating behavior . with regard to its psychometric properties , donini et al31 report sensitivity , specificity , and predictive validity values for the orto-15 using this threshold in an italian adult sample . however , the lack of established diagnostic criteria makes it difficult to gauge the appropriateness of any self - report measure , as epidemiological research is predicated on the existence of a gold standard approach for ascertaining true from false positives and true from false negatives . beyond this , the orto-15 has been criticized for potentially problematic internal consistency . in four different samples of american undergraduate students , reported cronbach s alpha coefficients have ranged from an unacceptable low of 0.1433 to respectable highs above 0.70.3436 while this one instance of poor overall internal consistency may represent an isolated methodological design flaw , it is also worth noting that low internal reliability may signal an orthogonal multifactorial latent structure . indeed , factor analytic work on the orto-15 has suggested both two-33,37 and three - factor31,38 solutions . however , in these studies , these factors did not collectively explain a large proportion of the variance observed across the orto-15 items . some researchers have eliminated items from the orto-15 in an effort to strengthen its reliability and validity . for example , when adapting the orto-15 for use in a hungarian population , varga et al32 eliminated four items from the measure to improve its consistency , resulting in the orto-11-hu . although more research is needed , the orto-11-hu appears to have good internal reliability ( cronbach s = 0.82 ) when used in a hungarian population . similarly , arusolu et al39 eliminated four items from the orto-15 for use in a turkish population , achieving an 11-item version with an internal validity coefficient of 0.62 . notably , the items eliminated from the orto-15 for the hungarian adaptation were different from the items eliminated for the turkish adaptation . while it is possible , as varga et al32 suggest , that cultural differences account for contradictory internal consistency values across samples , it is also possible that the orto-15 is simply not a reliable measure of orthorexia . another serious point of concern regarding the orto-15 is the fact that it does not account for the obsessive compulsive symptoms that people with orthorexia experience , such as intrusive food related thoughts , concerns with contamination and impurity , and the tendency to eat in a ritualized manner . this flaw prompted the researchers who developed the orto-15 to only label a study participant as orthorexic if the participant exhibited both ( as determined by orto-15 score ) and an altered mmpi.31 participants who met this latter criterion were men who scored less than 66 and women who scored less than 65 on scale 7 of the minnesota multiphasic personality inventory , which accounts for obsessive behavior.31 yet in various other studies,3,6,32,34 researchers have used the orto-15 as the sole measure of orthorexia , raising concerns about the accuracy of their results . based on the flaws in the orto-15 as well as the many differences across orthorexia studies in terms of methodology and sample characteristics , a clear picture of the prevalence of orthorexia has yet to emerge . existing estimates of orthorexia range from 6.9%4 to 57.6%12 in the general population , with rates as high as 81.8% in specific populations.3 furthermore , it is unclear whether orthorexia is more prevalent among women or men . some studies12,34 report that the rates of orthorexia are higher in women than men , whereas other studies report the reverse pattern.4,10 yet other studies report comparable rates across the sexes.6,33 similar contradictions exist regarding the prevalence of orthorexia based on age,4,10,12,32,33 education level,3,4,12,33 body mass index,3,4,10,32,33 smoking status,3,10,32,33 and alcohol consumption.3,32,33 additional epidemiology research is needed in conjunction with improvements in the psychometrics of orthorexia measures . psychometric problems aside , it may be the case that individuals who are focused on nutrition and health for one s career or leisure activities such as those involved in healthcare,6,10,11,32,40 the performing arts,3 and athletics41 may be at an elevated risk for developing orthorexia . given that these individuals are likely to be particularly sensitive to issues surrounding health and nutrition,6 may feel pressure to be role models for health,3 and might have tendencies toward perfectionism , it is important to continue to examine the prevalence of orthorexia within these particular populations . overall , the methodological issues concerning the existing scales have not gone unnoticed , and researchers have taken preliminary steps to develop a new measure , the eating habits questionnaire ( ehq ) , to identify individuals with behaviors , cognitions , and feelings that may indicate a problematic fixation on healthy eating.40 the ehq is a 21-item measure that contains three subscales that measure knowledge of healthy eating ( eg , i know more about healthy eating than do other people ) , problems associated with healthy eating ( eg , i spend more than 3 hours a day thinking about healthy food ) , and feelings associated with healthy eating ( eg , i feel control when i eat healthily ) ; initial analyses suggest good convergent and divergent validity in that the ehq subscales correlated strongly with measures of maladaptive eating behaviors and attitudes rather than with measures of personality , social desirability , and general psychopathology . preliminary evidence suggests that the ehq is reliable , with the three subscales showing strong internal consistency ( cronbach s = 0.82 , 0.90 , and 0.86 , respectively).40 while the psychometric properties appear promising , it should be noted that the ehq is not necessarily a comprehensive measure of orthorexia symptoms . although certain items do probe the obsessive nature of food - related cognitions , there is no assessment of compulsive behaviors that one might expect in the syndrome . to date , most of the research concerning orthorexia has focused on the emotional and physical sequelae of the condition rather than on the underlying brain behavior relationships . one study,34 however , used standardized clinical neuropsychological assessment to characterize the cognitive profile of orthorexia , targeting the cognitive domains known to be affected in anorexia and ocd , including attention , verbal long - term memory , visuospatial functioning , and executive functioning,4245 as candidate areas of inquiry . using a nonclinical sample of undergraduate students , highly orthorexic participants ( defined as those scoring < 40 on the orto-15 ) performed worse in domains of set - shifting , external attention , and working memory ( wm ) relative to nonorthorexic participants , even after controlling for scores on measures of anorexia and ocd . in effect , orthorexia was independently associated with key facets of executive dysfunction for which anorexia and ocd profiles already overlap . set - shifting involves flexible problem - solving and the ability to move freely from one situation or set of thoughts to another as needed . impoverished set - shifting , or cognitive rigidity , might readily explain the inflexible , rule - bound approach that orthorexic individuals take toward food selection , preparation , and consumption.34 indeed , an unfortunate positive feedback loop might develop such that one s exposure to varied , stimulating daily activities declines in order to fulfill time - intensive and complex food rules , prompting yet further decline in set - shifting skills from lack of applicative practice.34 cognitive inflexibility is also a hallmark feature of anorexia46 and ocd.47 external attention refers to the ability to focus on the external environment , including awareness of one s social impact on other people . as many orthorexic behaviors signal an extreme focus on the self , specifically on obtaining bodily health and/or purity , and given evidence that focusing attention inward is associated with impaired processing of external cues,48 it is not surprising for orthorexic individuals to have difficulty with external attention.34 reviews of the clinical literature suggest that individuals with psychological disorders generally exhibit excessive self - focused attention and that this pattern produces additional dysfunctional effects , such as intensification of emotional states , reduction in effortful coping , and impairment in task performance.49,50 for example , anorexic individuals seem to privilege inward perceptual , cognitive , and emotional information as opposed to external information51 and , furthermore , demonstrate impaired external sustained attention.52 similarly , individuals with ocd exhibit increased awareness of and monitoring of their thoughts53 as well as heightened self - preoccupation and rumination.54 recent neuroimaging data55 provide evidence of disrupted functional connectivity in ocd between large - scale brain networks supporting internal and external attention , potentially explaining the difficulty among individuals with ocd to disengage from internally - generated thoughts when performing tasks requiring external attention . similar neuroimaging studies are needed to determine if orthorexic individuals exhibit analogous patterns . as a construct , wm refers to the ability to hold information online for brief periods of time in the service of another task . as a finite and depletable set of resources , wm operations can be easily disrupted by attention to task - irrelevant stimuli , whether internal or external;56 it is possible , for example , that ongoing preoccupation with food- and health - related images or thoughts weakens wm in orthorexia,34 as similar findings have been reported in the eating disorders literature . evidence suggests that food - related thoughts reduce wm capacity in dieters,57 and dysfunction has been reported in anorexic patients particularly in the visuospatial sketch pad and central executive components of wm.58 with regard to ocd , there is meta - analytic evidence59 to implicate wm as the link between executive dysfunction and long - term memory impairment such that repetitive , intrusive thoughts interfere with episodic binding during wm . as wm is a multifaceted cognitive domain , future research on orthorexia should attempt to dissociate the executive ( eg , cognitive control ) from nonexecutive ( eg , storage ) elements in order to provide a more nuanced analysis of wm dysfunction and to help disambiguate the brain pathways that underlie the dysfunction . beyond this one exploratory neuropsychological investigation of orthorexia , there is no published research on the genetic , neuroanatomical , neurochemical , or psychophysiological correlates of the orthorexic syndrome . given the theoretical overlap with anorexia and ocd , we might look to the literature concerning the neuropathophysiology of these latter conditions to outline logical starting points for this kind of research . furthermore , additional mapping of the behavioral and cognitive endophenotypes in orthorexia with experimental neuropsychological methodologies will provide useful clues about proximal biological contributors , in essence providing a top - down deconstruction60 of outwardly complex behavior to simpler component processes . intermediate endophenotypes may provide better insight into underlying etiology than can symptom - level clinical categories61 which , given the perplexities surrounding the differential diagnosis of orthorexia , will be advantageous for advancing our understanding of orthorexia more quickly . in other words , we might be better served to shift our research focus away from achieving precise categorical boundaries among orthorexia and related conditions to , instead , continuing to characterize the dimensional endophenotypes that best explain the orthorexic phenomenon , recognizing that such dimensions will likely be transdiagnostic in nature . a deeper appreciation of these endophenotypes may generate ideas for novel approaches to both the prevention and treatment of orthorexia and its diagnostic cousins . to date , there are no studies of treatment effectiveness for orthorexia , although suggestions for best practices have been offered . the ideal intervention involves a multidisciplinary team that includes physicians , psychotherapists , and dieticians62,63 such that a combination of medication , cognitive - behavioral therapy , and psychoeducation8 can be applied with close monitoring in outpatient settings . in cases of significant weight loss and malnourishment , an inpatient setting with physicians experienced in refeeding syndrome5 would be indicated . with regard to psychotropic medication , serotonin reuptake inhibitors are reportedly helpful for orthorexia,8 which makes sense given evidence of their efficacy for both anorexia and ocd.64 others have successfully used antipsychotics such as olanzapine to decrease the obsessive nature of magical food - related thinking.5 it should be noted , however , that orthorexic individuals may be apt to reject pharmaceuticals as non - natural substances.8 when considering psychotherapy , interventions should be individualized based on the symptoms that are prominent for a given patient,39 recognizing that treatment goals should focus not only on what patients eat but also on how they shop for , prepare , and feel about the food they consume.63 exposure and response prevention , potentially in conjunction with habit reversal training,65 may be most successful for treating obsessive and compulsive aspects of orthorexia . cognitive restructuring is likely to be beneficial for dichotomous thinking , overgeneralization , catastrophization , and other cognitive distortions surrounding food , eating , and health66 as well as associated problematic traits such as perfectionism . various forms of relaxation training may assist with pre- and postprandial anxiety67 and other manifestations of health anxiety.68,69 moreover , behavior modification strategies may be useful to expand one s food repertoire , increase socialization during meals , and diversify leisure activities to include nonfood themes . lastly , psychoeducation about empirically - validated dietetic science may help disabuse orthorexic patients of false food beliefs.62 however , research indicates that nutrition and health education , while obviously needing to contain objective concepts about nutrients and physiology , should also recognize the deeply emotional aspects of food beliefs and food choices so as to incorporate affective approaches to patient counseling.28 asking severely orthorexic patients to abandon false food beliefs is really a request to discard a deeply held ideology ; as discussed by lindeman et al,13 ideologies , whether comprised of reality - grounded or magical beliefs , provide structure and order to one s life , reducing anxiety by providing a means to exert control over the environment . psychoeducation , to the extent that it challenges an entrenched belief system , should be undertaken with an appreciation of its potential for significant emotional upheaval in the patient . unchecked by any scientific regulatory process , the sharp rise in healthy lifestyle - related propaganda through book , magazine , and electronic formats , further bolstered by a rapid exchange of ideas through social media , means that the average individual is regularly bombarded by advice and admonitions about diet and health . despite the great potential for misinformation , those who utilize the internet , for example , to search for health - related information tend not to attend to the validity or recency of the source and often misjudge the trustworthiness of the information.70 for those already predisposed to health anxiety , research indicates that searching online for health information exacerbates this anxiety , a phenomenon dubbed cyberchondria.71 as orthorexia presents as a cluster of symptoms that is almost a parody of trends in popular culture toward healthy living , it is difficult to pinpoint when concern over the healthfulness and integrity of one s diet reaches pathological proportions.63 yet , in a recent survey of psychologists , psychiatrists , nurses , and social workers , two - thirds reported having observed patients in their practice presenting with clinically significant orthorexia ; importantly , two - thirds of clinicians also indicated that the syndrome deserves more scientific attention.2 with the acknowledgment that further research into orthorexia may serve to reify a culturally - constructed condition,72 the information reviewed in the preceding sections leaves us with more questions than firm answers ( table 3 ) . proper diagnostic recognition , as begun by moroze et al,5 is a precursory step toward the creation of gold standard assessment instruments needed for appropriate identification of orthorexic individuals,63 and with that will come advances in our understanding of etiology , treatment , and prevention .
the feedback [ table 1 ] from the relative who attended the squint surgery was obtained by a trained secretary . the feedback was taken in their native language , preferably on the first follow - up visit , in the opd ( same evening or second postoperative day ) or by a telephonic call at their convenient time , in their preferred language of communication . all the patients operated for squint in a six - month period were included . the questionnaire and the percentage distribution of the responses prior to the surgery , the parents were provided with a detailed explanation and printed brochure about the surgery , in their native language , by the surgeon . caregivers were then given an option to choose to witness the surgery themselves or allow one of their relatives to attend the surgery . relatives were informed that a medical doctor from the family or a relative with medical background would be a preferred choice . adult patients chose to allow or disallow an attendant in the operation theater during the surgery . the patient 's relative was called in the operation theater just before the surgery began . the relative was dressed in a manner exactly similar to the other paramedical personnel in the operation theater , ( but with different colored clothes ) . the relative was greeted and repeatedly assured of the smooth progress of the surgery and the general well being of the patient . the standard protocol was followed in dealing with complications that occurred during surgery . in case of anesthesia - related problems , where major resuscitation attempts were required , the relative was requested to wait outside of the operation theater for the time being , to be called immediately once the patient was stabilized . the relatives were escorted out by a nursing staff at the end of surgery or at anytime during the surgery if he / she was not comfortable . only the attendees aged between 20 and 60 years , who were medically and psychologically fit ( self reported ) , were allowed to attend the surgery . the item response analysis was performed and the responses of different groups were compared using the bartlett 's test for each variable followed by the box 's m test for all variables together . multivariate analysis was performed to ascertain the internal consistency of the questionnaire with cronbach 's alpha . we received the feedback from all the 44 patients relatives who had witnessed squint surgery . the mean age of the patients was 7.2 years 7.8 ( 1 42 years ) and that of the attendee was 36.1 years 8.5 ( 22 60 years ) . the average duration of a surgery ( recalled by the attendees ) was 28 minutes 12.4 ( 10 60 minutes ) . with an average of seven minutes per operated muscle , the duration of a surgery was seldom more than 45 minutes . the level of education of the attendees varied ; undergraduates ( 27% ) , graduates ( 14% ) , postgraduates ( 39% ) , and medical doctors ( 20% ) . the count and percentage distribution of responses [ table 1 ] from the attendees revealed no statistically significant differences in the responses for different education levels , relation ( parents / not parents [ uncle / aunt / grandparent / husband / family - friend ] ) , age of the attendees ( aged below / above 40 years ) , and the duration of the surgery ( 0 20 minutes , 20 40 minutes , and 40 60 minutes ) . an increased level of transparency and confidence was reported by the younger attendees ( < 40 years ) [ p = 0.06 ] and attendees of older children ( > 5 years ) [ p = 0.01 ] . six attendees advised to offer this practice to all the relatives and five attendees advised to offer this selectively . the increase in the anxiety level was mild in eight and severe in three . in six ( 14% ) the internal validity of the questionnaire was fair ( cronbach 's alpha = 0.6 ) . in this study , we found that the practice of the relatives attending the surgery adds transparency to healthcare delivery . it increases the families confidence in the treating surgeon and the healthcare facility and increases the awareness about squint surgery and operation theater practices . all these come at a cost of increase in perioperative anxiety and a sense of aversion , while watching the surgery . nevertheless , a large majority of the attendees recommended this practice to be offered to all , and nearly a third of the relatives advised it to be offered selectively to those who can understand the surgery and / or psychologically bear the impact of watching a relative being operated on . at present , we leave the decision at the discretion of the family members after appropriate counseling . out of a total of 50 surgeries performed during the study period , the relatives of six patients had refused to attend the surgery for the following reasons : ( 1 ) inability to comprehend the surgery , ( 2 ) inability to take the psychological impact , and / or ( 3 ) they believed the surgeon would do the best job if they were not present during the surgery . of the 44 who attended the surgery , one relative complained of claustrophobia and another felt very anxious and sick. the size of operation theater was 170 square feet . the advantages and disadvantages of the relatives attending the surgery could be many [ tables 2and 3 ] . they may increase the families receptiveness and comprehension about the instructions given by the surgeon on postoperative care and further treatment . if the patient needs more surgeries , the genuineness of the initial attempt at surgical correction , witnessed by the relative , avoids development of distrust in the surgeon . further studies are required to assess the benefits of this practice in improving the patient the advantages of relative attending the surgery the disadvantages of parents / relatives attending the surgery paice et al . surveyed 307 respondents , while there were concerns of the health professionals . in the present study we found that medical doctors were more conservative and skeptical about the practice of a relative in the operation theater than the non - medical attendees . future studies are required to know the perspectives of the health personnel about this practice . parental presence in the operation theater is not a novel idea . in obstetric set ups , interventional radiologists , cardiologists , cardiac surgeons , and orthopedic ( arthroscopic ) surgeons give digital records of the procedure to the patients and / or allow the relatives to attend the procedures . we believe , that the practice of the parental presence in the operation theater during the squint surgery of their ward may not be practiced universally in all the set ups , but it is worth considering in the operation theaters , where the staff is well trained , surgical load is not tremendous , and the surgeons do not have the responsibility to transfer the skills . focusing on parental satisfaction and building more trust in the parents by giving them an access to the operation theater / allowing them to watch the surgery in the viewing chamber can be a small , but significant step toward bringing in more transparency , accountability , confidence , awareness , and trust in the medical fraternity .
some unusual renal tumors like clear cell sarcoma kidney ( ccsk ) , rhabdoid tumor kidney ( rtk ) , congenital mesoblastic nephroma ( cmn ) , multilocular cystic nephroma ( mcn ) , teratoid wilms , and renal teratomas are found infrequently . they are usually diagnosed by tissue biopsy in the form of histopathological examination ( hpe ) and/or immunohistochemistry ( ihc ) . a few case series of uncommon renal tumors are reported in literature till now . we have undertaken a retrospective study of non - wilms renal tumors in our institution . each tumor has been evaluated individually in terms of its presentation , preoperative investigations , preoperative chemotherapy , intraoperative findings , postoperative recovery , histopathological findings , postoperative chemotherapy , final outcome , and follow - up protocol . the results are tabulated , evaluated , and compared with the other available concerned articles of uncommon renal tumors . this is a retrospective analysis of uncommon ( non - wilms ) renal tumors in children . the study comprised of 15 patients , out of which 11 were male and 4 were female . all patients were diagnosed clinically as a renal lump . practically , most of the cases were preoperatively taken as wilms tumor . all the patients were investigated in the form of complete hemogram , urine routine examination , chest x - ray , ultrasonography ( usg ) whole abdomen , and contrast enhanced computed tomography ( cect ) . magnetic resonance imaging , magnetic resonant urogram , and urine for venillylmandelic acid ( vma ) were done in selective cases . neo - adjuvant chemotherapies were given in two cases to make them amenable for complete surgical tumor resection . postoperative chemotherapy and radiotherapy were given according to the histopathological reports as we had no facility of ihc in our institution . the patients were followed up clinically in every 3 months , usg abdomen in every 6 months for first 2 years . then , every six monthly evaluation ( abdominal examination for any lump , blood pressure measurement , and serum urea / creatinine estimation ) in the follow - up clinic for another 3 years . another patient had developed skull metastasis in postoperative period , but he did not seek further treatment . clinical photograph showing flank abscess with renal mass , radiological picture showing large heterogeneous mass , indistinct margin , and areas of necrosis consistent with rhabdoid tumor of kidney we had treated four patients of ccsk . among them , one had presented with an advanced stage of the tumor with metastasis . moreover , we had to administer four cycles of neo - adjuvant chemotherapy in this case in the form of actinomycin - d , vincristine , and doxorubicin . histopathological reports showed the classic type of ccs in all four patients [ figure 2 ] . local irradiation was needed in one patient who had a large renal tumor and with bone metastasis . even with all measure , this patient had died after a period of 18 months . histopathological picture and computed tomography scan picture suggestive of clear cell sarcoma of kidney we had treated two patients of renal teratoma . the patient had received postoperative chemotherapy in the form of bleomycin , etoposide , and cisplatin ( bep ) . in 1 year follow - up , there was no recurrence . there was no recurrence and patient was doing well in 1 years follow - up . in our series a 4 years girl had presented with the right flank mass of 3 months duration with intermittent fever . usg abdomen had shown large , sharply demarcated , hyperechoic mass of 10 cm 5 cm 4 cm size located at the renal area . one patient was brought to us at the age of 1 day with antenatally detected renal mass . other two patients ( male ) had presented at the age of 3 and 8 months , respectively . after preoperative investigations ( usg , cect whole abdomen ) , we had performed nephrectomy in all three patients . histopathological reports had shown a classical variant of cmn in two cases [ figure 3 ] and a cellular variant of cmn in one case . we had given chemotherapy in a cellular variant of cmn in the form of vincristine , cyclophosphamide , and doxorubicin . this patient had developed psoas abscess on opposite side after 9 months which was treated accordingly . all three patients were doing well and there was no evidence of tumor recurrence or metastasis during the follow - up over 1 year . clinical photograph showing omphalocele with left renal area fullness , radiological picture showing homogenous renal mass with displaced small kidney , and gross specimen showing large renal mass with areas of necrosis and hemorrhage consistent with congenital mesoblastic nephroma of kidney two cases of cystic nephroma were encountered in our series . cect abdomen had suggested multilocular cystic tumor in kidney with sharply demarcated margin without wall thickening or any calcification or contrast enhancement . the term rhabdoid tumor was coined by haas in 1981 because of absence of muscle differentiation . usually , it presents in advanced stage and resistant to chemotherapy . diffuse hematogeneous and lymphatic spread occur in infancy . both international society of pediatric oncology ( siop ) and children 's oncology group / national wilms tumor study group ( nwtsg ) have reported a poor outcome for children with rtk . prognosis is also good in older children and lower stage of the disease . unlike wilms tumor important histologic features are open vesicular nuclei and scattered hyaline eosinophilic cytoplasmic inclusions of intermediate filament in a whorled pattern . another important diagnostic feature is integrase interactor 1 protein negativity found in ihc staining . in our series one patient had a history of flank abscess which was treated outside in the form of incision drainage and biopsy . it is classified separately from wilms tumor due to several distinctive features such as unilateral , unicentric in the medullary region of kidney with foci of necrosis and cyst formation , and presence of intracytoplasmic vesicles . ccsk is rare below 1 year of age , peak incidence 3 - 5 years and is more common in male ( male : female = 2:1 ) . various patterns of ccsk have been described such as classical , myxoid , sclerosing , cellular , epitheloid , palisading verocay body , spindle cell , storiform , and anaplastic . most common is classic type ( 90% ) where the tumor cell appears as monomorphic with cords or nests of 10 cells separated by fibrovascular septa . ccsk is managed by aggressive surgical approach followed by chemotherapy and radiotherapy as per nwtsg protocol . all patients were diagnosed clinically as renal lump and investigated in the form of blood hemogram , usg , cect abdomen , chest x - ray , and urinary vma . one of them had required neo - adjuvant chemotherapy . all the patients had radical nephrectomy and received postoperative chemotherapy with doxorubicin , vincristine , etoposide , and cyclophosphamide . one patient had lost to follow - up and two are doing well for last 2 years . it is an encapsulated tumor contains tissue or organ components resemble normal derivatives of more than one germ layer . tissues of teratoma are different from surrounding tissues contains hair , tooth , bone , brain , eyes , torso , hands , feet , limbs , etc . teratoma with malignant transformation may contain of somatic ( nongerm cell ) malignancy such as leukemia , carcinoma , or sarcoma . teratoma of mixed germ cell type is normally malignant and contains element like endodermal sinus tumor and choriocarcinoma . postoperative chemotherapy ( bep ) is needed in selective cases like malignant teratoma . during follow - up period apart from clinical examination and imaging , measurement of serum beta human chorionic gonadotropin and alpha - fetoprotein are utmost important both for diagnosis , monitoring successful treatment , and to detect relapse . wilms tumor is classically triphasic tumor . the combination of blastemal , stromal , and epithelial cell types is observed . other elements such as squamous , mucinous epithelium , smooth muscle , adipose tissue cartilage , osteoid , and neurogenic tissue are occasionally found . presence of more than 50% heterogeneous component is an essential criterion for diagnosis of teratoid wilms as proposed by fernandes et al . in 1988 . it is resistant to both chemotherapy and radiotherapy . in our series , we have treated one case of teratoid wilms. the patient had presented with the right - sided renal mass with intermittent fever . classical ( 24% ) looks like infantile myofibromatosis , cellular ( 66% ) looks like infantile fibrosarcoma , and mixed type ( 10% ) . cystic nephroma , also known as mcn , is a rare nongenetic lesion of unknown etiology . according to the who classification of the renal neoplasms , histologic feature include cyst lined by flat , cuboidal , or hobnail epithelium and septa variably lined by fibrous and/or ovarian - like stroma . cut surface revealed multiple cysts pushing renal pelvis , cysts were filled with serous fluid , and rim of normal renal tissue . we had encountered different types of uncommon renal tumors such as ccsk , rtk , cmn , etc . ccs is an aggressive and rapidly progressive renal tumor , but the final outcome has changed for better with improvised chemo- and radio - therapies . the cmn has very good prognosis as with cystic nephroma and teratoid wilms. another important fact is proper counseling of the parents . it reduces the psychological burden of parents and also ensures to bring the patients at postoperative follow - up clinic .
several studies assessing the adverse effects of sepsis on the heart have shown that myocardial dysfunction is a common , severe complication of sepsis , and the mechanisms responsible for development of myocardial dysfunction are complex . hemodynamic monitoring is important in the management of critically ill sepsis patients , because it can help assess hemodynamic variables , identify causes of hemodynamic instability and monitor response to therapy . however , the benefit of hemodynamic monitoring in the management of sepsis and septic shock remains unproven . the pulmonary artery catheter ( pac ) is an invasive device used largely in the intensive care unit ( icu ) for monitoring , assessment and management of hemodynamic variables in critically ill patients , including patients with sepsis . pac use varies between different icus and is influenced by several factors , including icu organization , physician preference , patient insurance , race and clinical characteristics , but overall the use of the pac in critical care is declining . the indication for pac use is matter of debate because , despite earlier promising results , several well - designed studies have failed to show a clear benefit with regard to mortality or other major outcomes [ 2 , 3 ] . the aim of this review is to summarize the current literature on the use of the pac in critically ill sepsis patients . we conducted a pubmed search using the combinations of the words swan - ganz catheter , pulmonary artery catheter and sepsis . all identified manuscripts , including reviews and case series , were considered for inclusion in this review . we also reviewed the bibliographies of all identified manuscripts in an attempt to find additional relevant publications . we limited the scope of our work to studies on humans , published in english in the last 20 years , but we also included studies published in other languages , if they had a meaningful abstract in english . two authors reviewed all identified manuscripts for relevance to this review , and articles deemed relevant were included . any disagreement regarding relevance of specific publications was resolved by consensus , after discussion between the authors . all clinical studies identified and used in this review are summarized in table 1 [ 4 - 20 ] . cco(pac ) : continuous cardiac output by pac ; icu : intensive care unit ; los : length of stay ; pac : pulmonary artery catheter ; pts : patients ; rct : randomized controlled trial . in 2014 , a publication by gopal et al compared cardiac output measurements derived from thermodilution using a pac vs. non - invasive cardiac output using the mostcare monitor in 22 consecutive sepsis patients , and noted that , compared to thermodilution , the non - invasive method had high error rate . similarly , a study by slagt published in 2013 compared cardiac output measurements using thermodilution with pac ( cotd ) vs. the flotrac / vigileotm ( cofv ) system by uncalibrated arterial pressure waveform analysis in 19 patients with septic shock . this study showed strong correlation between cofv and cotd values ( r = 0.53 , p < 0.001 ) but also showed that cofv underestimates cotd in septic shock with low systemic vascular resistance ( svr ) . a publication by trof in 2012 reported results of a prospective , randomized clinical trial ( rct ) assessing the hemodynamic management of critically ill patients with shock using transpulmonary thermodilution vs. pulmonary artery occlusion pressure . the study included 72 patients with septic shock and 48 patients with non - septic shock ( 120 patients in total ) and showed that important outcomes , including ventilator - free days , length of stay , organ failure and mortality were not significantly different between the two groups . patients in non - septic shock treated with pac - based algorithm had fewer mechanical ventilation days and shorter icu stay compared to the transpulmonary thermodilution algorithm , but there was no significant difference in patients with septic shock . a retrospective study from the netherlands published by bethlehem in 2012 evaluated fluid balance and the need for catecholamines before vs. after introduction of a pac - based protocol in patients with severe sepsis or septic shock admitted to a 22-bed mixed icu in a tertiary care hospital . in this study , patients treated with a pac - based protocol received norepineprine more frequently and at significantly higher maximum doses ( 0.12 ( 0.03 - 0.19 ) g / kg / min , n = 59 vs. 0.02 ( 0 - 0.17 ) g / kg / min , n = 39 , p = 0.000 ) and had significantly higher positive fluid balance ( 6.1 2.6 vs. 3.8 2.4 l , p < 0.001 ) on the first icu day , but had significantly lower cumulative fluid balance after 7 days ( 9.4 7.4 vs. 13 7.6 l , p = 0.001 ) compared with patients in the historical control group . the study concluded that introduction of a pac - based protocol was associated with greater need for vasopressors , higher early but lower overall need for iv fluids and significant reduction in ventilator and icu days . a review paper on myocardial dysfunction in severe sepsis published by jozwiak in 2011 suggested that echocardiography is the best method for diagnosis of sepsis - induced myocardial dysfunction , but mentioned invasive methods , such as transpulmonary thermodilution monitor and hemodynamic assessment via pulmonary artery catheterization as useful tools to alert clinicians about myocardial dysfunction and to monitor the response to inotropic therapy . a multicenter longitudinal study from hamilton , canada , published by koo et al in 2011 reviewed records of 1,921 patients who received pac within the first 2 icu days , in five different icus over a 5-year period ( 2002 - 2006 ) . multiple logistic regression was used to determine variables associated with pac use and whether these variables changed over time . this analysis showed that patient factors predicting the use of pac included severity of illness , as measured by the acute physiology and chronic health evaluation ii ( apache ii ) score ( odds ratio ( or ) : 1.05 ; confidence interval ( ci ) : 1.04 - 1.06 ; p < 0.0001 ) , elective surgery ( or : 2.82 ; ci : 2.29 - 3.48 ; p < 0.0001 ) , cardiogenic shock ( or : 5.31 ; ci : 3.35 - 8.42 ; p < 0.0001 ) , sepsis ( or : 2.83 ; ci : 1.94 - 4.13 ; p < 0.0001 ) , use of vasoactive medications ( or : 4.04 ; ci : 3.47 - 4.71 ; p < 0.0001 ) , mechanical ventilation ( or : 2.21 ; ci : 1.86 - 2.63 ; p < 0.0001 ) , and abdominal aortic aneurysm repair ( or : 10.91 ; ci : 8.24 - 14.45 ; p < 0.0001 ) . non - patient factors associated with pac use were icu preference and the base specialty of the attending physician ( p < 0.001 ) . overall , pac use decreased from 16.4% to 6.5% of patients over this 5-year period . an article published by frazier in 2008 reviewed the role , efficacy and complications of pac use over a decade , and suggested that published data do not support routine pac use . a small prospective cohort study published by spohr et al from the university of heidelberg , in germany in 2007 evaluated continuous cardiac output by pac vs. pulse - contour analysis using the picco system in 14 surgical icu patients with septic shock and showed very strong correlation between the two measurement methods ( r = 0.781 , p < 0.0001 ) . however , the study also assessed the relationships between the global end - diastolic volume ( gedv ) derived by picco vs. traditional pac - derived filling indicators , including central venous pressure , pulmonary artery occlusion pressure , and right ventricular end - diastolic volume ( rvedv ) , and did not show any significant correlation . the study concluded that the average bias in continuous cardiac output measurement by both a modified pac and pulse - contour analysis was small in patients with septic shock , but variability was large . another retrospective study published by siddiqui in 2005 reviewed charts of 10 icu patients with sepsis who had pac inserted for fluid management and hemodynamic instability at the university hospital in karachi , pakistan in 2004 . the authors could not identify any complications related to pac use , but eight of these 10 patients died , and the cause of death in these patients was severe sepsis . the fluid and catheter treatment trial ( factt ) designed by the ardsnet group evaluated treatment of patients with acute lung injury or ards , in a two by two factorial design , whereby patients were randomized to receive pac vs. central venous catheter , and were also randomized to conservative vs. liberal fluid strategy . mortality during the first 60 days was the primary outcome of this study , and results were published in two manuscripts in the new england journal of medicine in 2006 . a part of the study evaluated pac vs. central venous catheter and concluded that pac - guided therapy was associated with higher incidence of complications and no improvement in survival . similarly , the part of the study that evaluated conservative vs. liberal fluid administration did not show significant difference with regard to mortality , but showed that conservative fluid management improved lung function and resulted in shorter mechanical ventilation and icu stay . a meta - analysis published in jama in 2005 searched medline ( 1985 - 2005 ) , the cochrane controlled trials registry ( 1988 - 2005 ) , the national institutes of health clinicaltrials.gov database and the us food and drug administration ( fda ) website for articles evaluating the use of pac . studies included general surgery patients , icu patients and patients admitted with advanced heart failure or diagnosed with acute respiratory distress syndrome ( ards ) and/or sepsis . this meta - analysis concluded that , overall , pac use did not increase mortality or hospital length of stay , but did not confer any benefit . another review published by summerhill and baram in 2005 included several rcts evaluating the role of pac insertion in critically ill conditions including sepsis , and concluded that pac use did not confer any clear benefit and could even be detrimental . results from an rct conducted in 36 icus in france over a 2-year period ( 1999 - 2001 ) were published in 2003 and showed that management involving use of a pac did not affect morbidity or mortality in patients with ards , shock , or both . in addition , a case - control study ( nested within a prospective cohort study ) published by yu et al in 2003 , evaluated the use of the pac in 141 pairs of patients with severe sepsis in eight major academic medical centers in the usa . this study showed that mortality and total hospital charges were slightly , but not significantly lower in patients with pac . patients with pac had significantly increased risk of renal failure within 28 days after onset of sepsis ( or : 3.48 , 95% ci : 1.81 - 6.71 ) , but pac use was not associated with any other organ dysfunction . similarly , results from an rct on 201 patients ( of which 101 patients had sepsis ) published by rhodes et al in 2002 showed that patients randomized to have a pac received significantly more fluids in first 24 h and had significantly higher renal failure and thrombocytopenia , but there was no difference in mortality . with regard to pac - related risk of infection , a prospective , rct conducted by chen et al in taipei , taiwan , evaluated 258 critically ill patients who had pac insertion and showed that the risk of catheter colonization , and the risk of bacteremia were not significantly different between patients who had pac for 4 vs. 7 days . also , a review article on pac colonization and infection published by rello et al in 1997 showed that , compared to other types of catheters , sensitivity in diagnosing pulmonary artery colonization can be improved by evaluating both the tip and the intradermal segments of the catheter . in cases of an indwelling introducer presence , as pac efficacy and safety have been under scrutiny because of association with increased morbidity and mortality in observational studies , several researchers attempted to evaluate pac usefulness and necessity . in 1997 , the national heart , lung , and blood institute ( nhlbi ) and the us fda conducted the pulmonary artery catheterization and clinical outcomes workshop in alexandria , virginia to develop recommendations for improved pac utility and safety . the workshop concluded that medical staff needs education obtaining and interpreting pac data and this education effort should be led by professional societies . areas given high priority for clinical trials included refractory congestive heart failure , ards , severe sepsis and septic shock , and low - risk coronary artery bypass graft surgery . a manuscript published by sakka et al in 2000 presented data ( 51 cardiac output measurements in 12 patients with sepsis or septic shock ) from a prospective clinical trial conducted in jena , germany . the study compared four cardiac output ( co ) measurement techniques : pulmonary artery thermodilution ( co(pa ) ) , transpulmonary aortic thermodilution ( co(aorta ) ) , fick principle - derived ( co(fick ) ) , and continuous pulmonary artery cardiac output ( cco ) measurements , and showed high correlation between the four techniques : co(pa ) and co(aorta ) had the highest agreement ( r = 0.98 ) ; agreement between co(pa ) or co(aorta ) and cco was lower , but still very high ( r = 0.92 and r = 0.93 ) , and all three techniques had comparable correlation with co(fick ) ( r = 0.85 , r = 0.83 , and r = 0.83 , respectively ) . because co measurements can be obtained with similar accuracy non - invasively from co(aorta ) , the authors concluded that pac placement is not justified solely for measurement of co , unless cco measurement is needed . in 1998 , becker reviewed selected outcome studies conducted since 1987 and concluded that there were insufficient data from well - conducted prospective , randomized , studies to show a mortality or morbidity benefit from use of the pac . the author suggested that until stronger evidence becomes available , use of the pac should not be considered standard of care in critically ill patients . in 1997 , parker and peruzzi published a review on the use of the pac in patients with sepsis and septic shock , based on articles published in english between 1984 and 1996 , and concluded that pac use may be appropriate in patients with septic shock who do not respond to early resuscitative measures . the authors suggested that further research was needed to determine the role of the pac in patients with sepsis / septic shock . in 1996 , a prospective cohort study by connors et al evaluated the association of right heart catheterization within the first 24 h of icu stay with survival , length of icu stay and cost of care , based on data from 5,735 critically ill patients admitted between 1989 and 1994 in five teaching hospitals in cleveland , ohio . data analysis in this study showed association of right heart catheterization with increased resource utilization and higher mortality . in 1995 , schoenenberger et al compared clinical assessment vs. invasive measurements of hemodynamic parameters in 47 critically ill icu patients and assessed changes in therapy following pac insertion . in this study , invasive hemodynamic values obtained with insertion of a pac resulted in a major change in treatment in 21% of patients , thereby suggesting that the pac is a very useful tool for guiding therapy . in 1994 , a prospective study by jardin et al compared invasive ( right heart catheterization using pac ) vs. non - invasive assessment of hemodynamic parameters by measuring co ( thermodilution method ) , cardiac pressures ( right heart catheterization ) and left ventricular ( lv ) volumes ( two - dimensional echocardiography ) in 32 patients with septic shock . because of frequent discrepancies between invasive vs. non - invasive data , the study concluded that hemodynamic evaluation based on pac should be questioned due to possible co overestimation by the thermodilution method in sepsis . the pac was introduced in cardiology and critical care in the 1940s [ 29 - 31 ] , but the use of the pac came to critical practice after a landmark publication by swan et al in 1970 . although pac use enhances our understanding of cardiovascular pathophysiology and helps clinicians optimize hemodynamic management , use of the pac has been criticized due to risks associated with its use and absence of convincing evidence that pac use improves patient outcome [ 12 , 33 - 36 ] . the pac allows measurement of central venous pressure , right ventricular pressure and pulmonary artery pressure and mixed venous oxygen saturation , and calculation of several hemodynamic variables , including co , right ventricular ejection fraction and peripheral vascular resistance . tissue oxygenation can be assessed by monitoring mixed venous oxygen saturation ( svo2 ) after insertion of a fiberoptic pac , and pulmonary artery occlusion pressure can be determined after occlusion of the pulmonary artery using the catheter balloon . when placement of a pac is not feasible , insertion of a central venous catheter can provide information about tissue oxygen supply and demand by measuring mixed venous oxygen saturation ( scvo2 ) . traditional indications for pac insertion are left ventricular dysfunction , myocardial ischemia , valvular heart disease and assessment of patients receiving vasoactive therapy like sepsis patients . however , pac use has been associated with significant complications , including arrhythmias that usually resolve spontaneously , pneumothorax , thrombosis and hemorrhage , and case reports of pulmonary valve endocarditis have also been published [ 38 , 39 ] . when pac is placed in situ , infections are another issue which remains of clinical importance , also distal catheter migration and pulmonary artery rupture are rare but significant complications [ 40 - 42 ] . therefore , because pac use has been associated with significant complications and increased cost , without a clearly documented outcome benefit , there is an argument that the pac should not be used in sepsis patients , and this is why newer , less invasive techniques , such as echocardiography , doppler and pulse contour techniques have been developed with some success . pac insertion guided by bedside echocardiography is safe , but older data suggest that heavy colonization of the insertion site , percutaneous insertion in the internal jugular vein rather than subclavian vein , duration of catheterization longer than 3 days , and insertion without full barrier precautions significantly increase the risk of catheter - related infection [ 46 , 47 ] . pac insertion can also cause complications years later : a case report published in 2013 described a case where retained pac fragment was incidentally found lodged in the right heart of a patient 16 years after pac insertion , thereby highlighting the importance of vigilance during pac insertion . regarding the use of pac in sepsis , the consensus conference of 1997 concluded that use of the pac may be beneficial in patients with septic shock unresponsive to early resuscitative measures . in such cases , the american college of critical care medicine updated the recommendations for hemodynamic support in adult patients with sepsis , and proposed a level d recommendation for invasive hemodynamic monitoring in patients who do not respond to initial resuscitative efforts . in such cases , the guidelines recommend administration of fluids titrated to defined hemodynamic goals , and adequacy of cardiac filling pressures can be determined by the response of the co to increasing pulmonary artery occlusion pressure . in this consensus , most experts agreed that the maximum benefit can usually be achieved when pulmonary artery occlusion pressure is in the 12 - 15 mm hg range . our literature search shows that there is ongoing debate regarding the benefit from the pac use . observational studies suggest that use of the pac is not associated with improved outcome and may even increase morbidity and mortality . similarly , randomized controlled trials in sepsis patients and other critically ill patients failed to demonstrate a mortality benefit from use of the pac . pulmonary artery catheterization seems to be more accurate than clinical assessment alone in evaluating the cause of shock ( hypovolemic , cardiogenic or septic ) , and is also useful in evaluating the cause of pulmonary edema ( cardiogenic vs. non - cardiogenic ) . the pac may be useful in cases where hemodynamic intervention with fluids and dopamine is ineffective , and also in cases where there is need for precise evaluation of cardiac preload and optimization of oxygen transport . mixed venous oxygen content ( commonly measured as oxygen saturation ) is a highly relevant parameter in the monitoring of critically ill patients , but its measurement requires catheterization of the pulmonary artery . as cardiac dysfunction is a very common and severe complication of septic shock , the catheterization of the pulmonary artery is used to monitor the effects of inotropic therapy , to alert clinicians for cardiovascular changes and optimize therapy . however , a matter of debate for its use is the fact that although treatment corner stones for sepsis include adequate volume resuscitation and improvement of tissue oxygenation , specific hemodynamic endpoints remain controversial and direct measurements of tissue oxygenation are not possible . this would suggest a need for a consensus opinion on how pacs are actually used to obtain the different physiological variables which can influence patient management . pac use provides hemodynamic data that can assist decision - making in critically ill patients , and many clinicians use advanced hemodynamic monitoring and obtain invasive or non - invasive measures of co to guide therapy in critical illness . the pac - man study , which was published in 2005 , evaluated 1,014 critically ill patients randomly assigned to management with ( n = 519 ) vs. without ( n = 522 ) a pac , and showed no evidence or benefit or harm from use of the pac , but also showed that 80% of patients in the non - pac group underwent an alternative form of co monitoring . every procedure in medicine of course there are circumstances where use of the pac may be considered , such as in sepsis patients with significant pre - existing comorbidities or presence of severe ards , in sepsis patients with persistent deterioration and multiple organ failure , or in cases with diagnostic dilemmas , such as probable co - existing underlying pathologies . pulmonary artery catheterization has been in clinical use since 1970 , and has been a valuable tool for the assessment of cardiorespiratory performance in critically ill patients , but there has been criticism that pac use has encouraged physicians and intensivists to make decisions based on numerical targets rather than clinical signs , and incorrect interpretation of data has also been a concern . the best approach for use of the pac seems to be careful clinical management that takes into account data derived from advanced hemodynamic monitoring , invasive and/or non - invasive . as there is increasing use of non - invasive methods for the assessment and management of cardiovascular complications in sepsis , there is need for large prospective trials in order to define whether use of the pac offers benefits in patients with severe sepsis and septic shock . an interesting editorial published by pr vincent in critical care medicine in 2011 discussed the declining use of the pac in recent years , and classified the reasons for reduced pac use as bad and good . bad reasons include the publication of randomized controlled trials failing to prove a clear benefit , the availability of less invasive monitoring techniques , the use of scvo2 monitoring and the fashion that follows the trend , whereas good reasons include the widespread use of echocardiography , efforts to reduce healthcare expenses , and the tendency to avoid overuse of the pac in patients who will not clearly benefit . marik in the annals of intensive care in 2013 reported the obituary of the pulmonary artery catheter , we believe that the pac is still a very useful tool for a limited number of critically ill patients , and therefore its optimal use deserves further investigation . pulmonary artery catheterization has a significant role in the management of patients with sepsis and septic shock , not only as a diagnostic tool , but also as a means to monitor the hemodynamic response to therapy . although clinical management of hemodynamic instability in sepsis is facilitated by pulmonary artery catheterization , our literature review shows that pac use has not been associated with clear benefit with regard to outcome in sepsis , and use of the pac in the icu is declining all over the world . the pac remains a valuable educational tool for the assessment of sepsis patients , but because its efficacy and safety is under scrutiny , well - designed large prospective clinical studies are needed to better assess its role . dv did literature search and wrote the manuscript . vk assisted with literature search and edited manuscript . all authors have read and approved the final version of the manuscript submitted for publication .
neonatal diabetes mellitus ( ndm ) is a rare endocrinological disorder , which affects children in the first 6 months of life , with estimated incidence of 1/90,000 to 1/210,000 live births 1 , 2 . two forms of this condition have been identified , transient and permanent neonatal diabetes mellitus ( tndm and pndm ) . tndm is a genetically mediated disorder of insulin production that remits in the postnatal period and is commonly associated with intrauterine growth retardation , it accounts for 5060% of the cases of neonatal diabetes 3 . pndm , a less common form that results from abnormal pancreatic development , increased apoptosis , and necrosis with cellular dysfunction and causing lifelong insulin dependency 4 . patients develop inadequate insulin production necessitating exogenous insulin therapy , which if not well balanced results in several complications including diabetic ketoacidosis . we report the case of 7 weeks old boy with diabetic ketoacidosis that required 10 days of intensive care management . a 7weekold baby was referred to the emergency department ( ed ) of muhimbili national hospital ( mnh ) , dar es salaam because of presumed severe pneumonia and septicemia . he presented at the ed with history of fever and difficulty in breathing for 3 days , fever was of high grade with no report of convulsion . difficulty in breathing was noted concurrently with fever and was not accompanied by cough , however , it was noted to cause difficulty in breastfeeding . the child was reported to have received vaccination with dpthbhib , pcv13 rotarix and polio vaccine 4 days prior to onset of above mentioned symptoms . nothing remarkable was noted during prenatal period , the baby was delivered by spontaneous vaginal delivery with birth weight of 3.5 kg , cried immediately and was breastfed within 1 h of delivery . on presentation at ed the child weighed 5.5 kg , was unconscious responding to pain , febrile ( 38.1c ) pulse rate was 170 beats / min , respiratory rate was 49 breaths / min , extremities were warm , and some pallor was noted with no jaundice . cardiovascular examination revealed normal heart sounds with no murmur , respiratory examination revealed vesicular breath sounds with no added sounds , and abdominal examination revealed normal findings . capillary random blood glucose at admission showed high blood glucose ( > 33 mmol / l ) . venous blood gas analysis revealed ph of 6.8 , pco2 8 mmhg , po2 67 mmhg , sodium 154 mmol / l , potassium 3.2 mmol / l , and hco3 1.4 mmol / l . dipstick urinalysis showed glucose 3 + , ketone 2 + , nitrate+ , protein negative , and bilirubin+ . the final ed diagnoses were neonatal diabetes mellitus with diabetic ketoacidosis , septicemia , and severe malaria . the child was catheterized , given ceftriaxone 600 mg iv stat , artesunate 12 mg iv stat , and normal saline 100 ml for 1 h , then 50 ml hourly for 2 h ( table 1 ) . soluble insulin 1.0 unit stat was given followed by soluble insulin infusion at o.5 u / h infusion ( table 1 ) . fluid and insulin administration and monitoring of random blood glucose venous blood gas ( vbg ) and/or arterial blood gases ( abg ) were monitored every two hours ( table 2 ) , and 4 h after starting treatment , abg showed ph 6.8 , pco2 12.8 mmhg , po2 67.8 mmhg , sodium 159 mmol / l , potassium 3.4 mmol / l , and hco3 2.3 mmol / l . eight hours later , vbg was ph 7.0 , pco2 24.5 mmhg , sodium 166 mmol / l , potassium 3.4 mmol / l , and hco3 5.9 mmol / l . blood gas monitoring at ed after 13 h in ed , the patient was admitted to acute pediatric care unit ( apcu ) and was noted to be lethargic with respiratory rate of 72/min , lower chest wall indrawing , pulse rate of 144/min , and tender hepatomegaly . full blood count revealed wbc of 17.9 k / l , neutrophil 10 k / l ( 56.8% ) , monocytes 1.8 k / l , hb 8.7 g / dl , mcv 85.6 fl , mch 28.8 pg , and platelet 502 thyroidstimulating hormone was 2.3 iu / ml ( 1.79.1 ) and free thyroxin was 1.2 ng / dl ( 0.92.6 ) all within normal range . glycated hemoglobin was elevated at 7.7% , and screening for hiv , hbv , hcv , toxoplasmosis , and rubella were performed as part of providerinitiated testing and counseling for hiv and to exclude other viral infections , these were all negative . in the ward , the patient was given ceftriaxone 500 mg ( daily for 10 days ) , artesunate 12 mg at 12 h and 24 h after initial injection at ed and thereafter daily for 3 days , and 500 ml of normal saline for 24 h. in the ward , soluble insulin 1 iu ( calculated as 0.1 u / kg every 1 h ) was given subcutaneously every 2 h for 24 h , as there were no facilities for continuous insulin infusion pump . the baby regained consciousness after 12 h of admission in the apcu , was afebrile and able to breast feed . insulin therapy was changed to 2 iu of soluble insulin before breakfast , before lunch , and subsequently changed to 2 iu of glargine ( lantus ) insulin before dinner for 24 h. two days later , the baby was kept on glargine insulin 2 iu daily . the patient was given daily single lantus insulin injection after 24 h of apcu stay and his capillary random blood glucose was ranging between 3.1 and 10.2 mmol / l . forty eight hours of stay in apcu full blood picture showed wbc 18.3 k / ul , neutrophils 7.56 k / ul , monocytes 4.55 k / ul , and hb of 6.6 g / dl consistent with severe anemia . serum creatinine was 28.6 the baby was given 60 ml of packed red blood cells in view of rapid decline of hemoglobin level . the baby was discharged from apcu to general pediatric ward after 10 days , and was then discharged home after 3 days in the ward , with wellcontrolled blood glucose ranging from 4.8 to 6.8 mmol / l . blood specimens were sent to university of exeter , united kingdom and genetic testing was performed and sequence analysis of the abcc8 , kcnj11 , and ins genes did not detect a pathogenic mutation , we are currently awaiting further genetic analysis for potential mutations . the patient is still being followed monthly in our pediatric diabetic clinic and has been doing generally well , however , he has been presenting with hypoglycemic episodes and we have advised his parents to monitor his blood glucose regularly . neonatal diabetes mellitus is a rare metabolic disorder diagnosed within the first 6 months of life and presents with low birth weight , dehydration , hyperglycemia , or diabetic ketoacidosis 5 . previous studies reported no clearcut clinical features that may predict whether a neonate with diabetes without any abnormal morphology will present with permanent or transient diabetes mellitus 3 . our patient presented at the age of 7 weeks with hyperglycemia and features consistent with severe malaria and neonatal sepsis 6 . neonatal severe infection may present with hyperglycemia resulting from stress and a raise in epinephrine and cortisol , decreased insulin release and impaired glucose utilization 7 . therefore , hyperglycemia with ketoacidosis may easily be missed if it is solely attributed to infections . our patient had severe malaria as depicted by positive rapid diagnostic test , however , blood culture test had no growth after 72 h , the clinical picture presented highlights the mimicry between dka and severe infections . bappal et al . 8 in study conducted among patients with ndm in oman reported fever , lethargy and poor feeding , polyuria , diarrhea and dehydration , and tachypnea to be the most common presenting symptoms . capillary random blood glucose is an important bedside test in evaluating neonates suspected to have sepsis that may commonly present with hypoglycemia , but may also present with hyperglycemia 9 . recommended treatment of patients with ndm according to international society for pediatric and adolescent diabetes ( ispad ) is insulin , sulfonylurea is an useful alternative treatment for patients with kcnj11 and abcc8 gene mutations for which it has been reported to have good response 10 . our patient had diabetic ketoacidosis characterized by hyperglycemia , glycosuria , ketonuria , and metabolic acidosis and was managed with intravenous fluids and soluble insulin . intravenous soluble insulin infusion which was used in our patient has been reported to provide satisfactory blood glucose level particularly in the initial management of patients with ndm with hyperglycemia 11 . erratic blood glucose levels have been described with intravenous insulin infusion therapy 12 , 13 . establishing the chronic insulin therapy is usually a challenge for both health care providers and parents , once the patient is discharged . this was noted in our patient , therefore intensive glucose monitoring at home is important in management of ndm as hypoglycemic attacks are usually accompanied with psychological issues to parents 14 . the most commonly identified genetic mutations with ndm involve zac , hymai , kcnj11 , abcc8 , and ins genes . none of the later three gene mutations ( abcc8 , kcnj11 , and ins ) which were sequenced for in our patient were identified . this genetic finding has a bearing to the management of our child as both patients with tndm and pndm with activating mutations of kcnj11 and abcc8 may be amenable to treatment with sulphonylureas , which stimulate endogenous insulin secretion 7 , 10 , 14 , 15 , 16 . therefore , our patient continues to be managed with daily longacting subcutaneous insulin injections . longterm outcome of ndm patients is variable and may be influenced by the form of ndm . 17 described 13 patients who had transient ndm who attained remission and recurred later with median duration in remission of 13 years . this being the case , it is difficult to predict the longterm outcome of our patient although the overall prognosis is influenced by glycaemic control 7 , 16 . in conclusion , diabetic ketoacidosis in neonate is a rare , but lifethreatening complication of ndm that requires a high degree of suspicion especially in neonates with coexistent infection .
a 17-month - old boy weighing 14 kg was diagnosed with a fracture of the right lateral humeral condyle and scheduled for open reduction and internal fixation with a kwire . he had suffered from an upper respiratory infection for the previous 3 weeks and drug - induced hepatitis developed as a result of his medication . the preoperative serum alanine aminotransferase ( alt ) and serum aspartate aminotransferase ( ast ) levels were 177 and 76 other laboratory exams were normal , except for mild anemia ( hb 8.8 g / dl ) . a pediatrician recommended delaying the surgery for about 4 weeks , but early intervention is needed for fractures of the lateral condyle of the humerus in pediatric patients . we decided to proceed with the surgery under an interscalene brachial plexus block without supplementary general anesthesia . after intravenous access was secured in the left forearm , 20 g of fentanyl and 50 mg of thiopental sodium were administered . under mask - assisted ventilation , the patient was placed in the supine position with the neck rotated slightly to the left . the brachial plexus was identified using the mturbo ultrasound system ( sonosite , bothell , wa , usa ) with a 13 - 6 mhz 25-mm high - frequency linear array transducer ( slax ; sonosite ) . a transverse scan was performed at the level of the interscalene groove with the long axis of the probe parallel to the clavicle . then , the transducer was moved slightly in the caudal direction until the brachial plexus roots were identified between the anterior and middle scalene muscles . after the transducer position was confirmed , 1% mepivacaine was applied in a skin wheal and a 25-mm , 24-guage insulated needle ( stim - a2250 , b. braun medical , bethlehem , pa ) was advanced using the inplane technique . once the needle reached the brachial plexus , the nerve stimulator ( maxistim ; life - tech , stafford , tx ) was turned on , starting from 1.5 ma and decreasing to 0.5 ma to elicit contraction of the deltoid and biceps muscles . after confirming needle placement , 1.5 ml of 0.5% ropivacaine successful blockade was determined by the absence of a withdrawal response and hemodynamic changes in response to surgical stimuli , such as the skin incision . after block placement , surgery was performed uneventfully ; the duration of surgery was about 20 min . no additional sedative or analgesic was administered and the patient 's vital signs were stable during surgery . postoperatively , a chest x - ray showed no elevation of the right diaphragm and the alt and ast were 108 and 62 he had excellent postoperative pain relief for 2 days after surgery and was discharged on the third day with no evidence of neurologic sequelae . three days after discharge , he visited the orthopedic clinic for follow - up assessment and was still free of any neurological deficit . although the potential for nerve injury exists , regional anesthesia in pediatric patients is usually performed under deep sedation or general anesthesia . the use of ultrasound in peripheral nerve blockade can reduce the risk of such complications by providing more accurate localization of the target nerve and other ' dangerous ' structures , such as blood vessels , the peritoneum , and pleura . presently , the use of ultrasound has become common when performing peripheral nerve blockade in pediatric regional anesthesia . moreover , ultrasound has allowed more anesthesiologists to perform nerve blocks with high success rates in pediatric patients . the greatest potential limitation to this technique is likely the availability of equipment and the need for well - trained operators . regional anesthesia in children has several benefits in addition to the simple avoidance of general anesthesia , including decreased perioperative opioid use and stress responses . moreover , the better analgesia offered by regional anesthesia also shortens recovery time and improves the outcome [ 5 - 7 ] . in our patient , moreover , he still had a symptomatic upper respiratory infection , with rhinorrhea , a sore throat , and intermittent cough at the time of surgery , constituting another problem for performing general anesthesia . surgery for the fixation of lateral humeral condyle fractures can be performed readily under a supraclavicular brachial plexus block . although single - dose blocks can be performed safely with normal doses of local anesthetics , even in patients with severe hepatic dysfunction , a relatively larger dose of local anesthetic is needed for a supraclavicular brachial plexus block compared with an interscalene block , even under ultrasound guidance . berde suggested safe dosing guidelines for the use of bupivacaine in pediatric patients , but no data are available on the safety of peripheral nerve block with a large amount of a modern , less toxic local anesthetic in children , such as ropivacaine or levobupivacaine . second , a supraclavicular brachial plexus block has the potential risk of pneumothorax , which can be reduced by using an ultrasound - guided technique . however , the risk of pneumothorax is greater in infants and small children because the apex of the lung is situated in a more rostral position and complete avoidance of this complication is difficult , even using an ultrasound - guided technique . the major concern when performing an interscalene brachial plexus block is hemidiaphragmatic paralysis . in adults , the incidence of this complication is 100% and it does not usually cause respiratory insufficiency this can be reduced by using an ultrasound - guided technique . however , there is no report on the incidence and risk of this complication in children . although no objective assessment of hemidiaphragmatic paralysis , such as an ultrasound exam or spirometry , was performed , the postoperative chest x - ray did not show hemidiaphragmatic elevation in our patient . in conclusion , we successfully and safely performed an ultrasound - guided interscalene brachial plexus block in a small child in whom general anesthesia was not feasible , without complications .
hydrocephalus occurs if the production of cerebrospinal fluid ( csf ) exceeds its resorption , and this leads to elevated intracranial pressure . it often requires surgical treatments such as repetitive lumbar punctures or a ventriculoperitoneal ( vp ) shunt to reduce the intracranial pressure and avoid compression of the periventricular white matter and cerebral arteries . however , infection is a major complication after shunt insertion , with the infection rates ranging from as little as 1% to as much as 25%1 ) . most infections in shunt systems originate from bacterial contamination introduced at the time of surgery and most manifest by 3 to 4 weeks postoperatively28 ) . clinically , the csf parameters ( white blood cell and red blood cell counts , the glucose level and the protein levels ) are frequently used to aid in diagnosing shunt infection in patients with unreliable csf cultures19 ) . however , the utility of the csf parameters for patients with a vp shunt is known to be limited due to the poor diagnostic sensitivity and specificity19 ) . moreover , abnormal csf parameters also imply that an infection process may already be underway . thus , novel and precise csf biological markers are needed to predict shunt - associated infection . a number of biochemical products are exchanged with the central nervous system ( cns ) through the csf , which is the main component of the cns 's extracellular fluid . csf may reflect the pathophysiology of various neurological disorders occurring in the cns as well as healthy conditions because csf plays a critical role for physiological control in the brain to maintain a stable cns condition3,20 ) . various neuropeptides , neurotransmitters , proteins , enzymes and metabolic by - products have been assayed in the csf of patients with psychiatric , neurochemical , dementing , neuroinflammatory and traumatic disorders3 ) . among them , transforming growth factor ( tgf)-5,11 ) and vascular endothelial growth factor ( vegf)11 ) are increased in the csf of patients with posthemorrhagic hydrocephalus , whereas tau18 ) and tumor necrosis factor ( tnf)-30 ) are increased the csf of patients with normal pressure hydrocephalus ( nph ) . however , the diagnositic utility of these biomarkers in patients with hydrocephalus as a infection indicator after shunt placement is currently unknown . thus , the aim of this study is to determine the association between the csf biomarkers and inflammation , and the predictive value of these csf biomarkers for the subsequent development of shunt associated infection . we obtained csf from seventy - six patients with hydrocephalus during their vp shunt operations from 2008 to 2009 . of the seventy - six patients , a total seven patients suffered from subsequent shunt infection . twenty - two patients including these seven patients who presented with subsequent shunt infection were enrolled for this study . all the participants signed a consent form with regards to the aims of the study , and this study was approved by the university hospital ethics committee . inph was confirmed with radiologic studies and by the hydrocephalus induced - signs and symptoms such as gait disturbance , cognitive dysfunction and urinary incontinence , and the response after external lumbar drainage . sah - induced hydrocephalus was defined as clinical and radiologically diagnosed hydrocephalus that required treatment , and the hydrocephalus was demonstrable at least two weeks after sah as either the progression of acute hydrocephalus or the development of chronic hydrocephalus de novo . post - traumatic or -spontaneous intracerebral hemorrhage hydrocephalus was also defined as clinical and radiologically diagnosed hydrocephalus that developed during the next few weeks after resolution of the hemorrhage and the hydrocephalus required treatment . the subsequent development of shunt infection was confirmed by the clinical findings such as fever and/or meningeal irritation signs , laboratory studies that included the hematological and csf parameters ( the white blood cell and red blood cell counts , the glucose level and the protein levels ) and csf culture from the shunt devices . antibiotics were started according to the results of csf culture and all the shunt devices were removed when shunt infection was confirmed . all the samples were taken through intraventricular catheterization during a vp shunt operation for treating the patients with hydrocephalus . approximately 10 ml csf was collected from a proximal catheter inserted into the ventricles before connecting the proximal catheter and the shunt valve . csf analysis and culture were then performed in a routine fashion on these collected csf samples . the csf samples were centrifuged at 800 g for 10 minutes to sediment both the hematogenous cells and other cells contaminating the sample , and the supernatant was aliquoted and stored at -80 until analysis . we detected and analyzed the specific biomarkers in the csf by way of enzyme - linked immunosorbent assay ( elisa ) . the biomarkers were tgf- and tnf- for inflammation , vegf for angiogenesis and tau protein for neurodegeneration . the vegf , tgf-1 and tnf- concentrations were determined using a commercially available sandwich elisa ( bender med - systems gmbh , vienna , austria ) , and the total tau concentration was determined using a commercially available sandwich elisa ( invitrogen , ca , usa ) according to the manufacturer 's instructions . the sensitivity of the assay was 7.9 pg / ml for vegf , 9.0 pg / ml for tgf-1 , 1.65 pg / ml for tnf- and 12.0 pg / ml for total tau . the intra - assay coefficient of variation was 6.2% ( mean : 571 pg / ml , n=8 ) for vegf ; the interassay coefficient of variation was 5.1% ( mean : 14346 pg / ml , n=8 ) for tgf-1 ; the interassay coefficient of variation was 6.0% ( mean : 295 pg / ml , n=7 ) for tnf- : the interassay coefficient of variation was 4.4% ( mean : 578 pg / ml , n=3 ) for total tau . all the elisa 96-well microtiter plates were analyzed using a microplate photometer with the maximum absorbance at 470 nm . the twenty - two patients were divided into 3 groups : sah - induced hydrocephalus ( n=9 ) , inph ( n=6 ) and hydrocephalus with a subsequent shunt infection ( n=7 ) . the significance of differences of each biomarker level among the sah - induced hydrocephalus , inph and shunt infection groups was established by the kruskal - wallis test with asymptotic sig . ( p ) values , as the distribution of the values was non - gaussian . the significance of differences of the vegf level between the sah - induced hydrocephalus and inph groups , the sah - induced hydrocephalus and shunt infection groups and the inph and shunt infection groups was established by the mann - whitney u test with two - sided p values , as the distribution of the values was non - gaussian . the statistical analyses were processed by the use of statistical software spss 12.0 for windows . inph was confirmed with radiologic studies and by the hydrocephalus induced - signs and symptoms such as gait disturbance , cognitive dysfunction and urinary incontinence , and the response after external lumbar drainage . sah - induced hydrocephalus was defined as clinical and radiologically diagnosed hydrocephalus that required treatment , and the hydrocephalus was demonstrable at least two weeks after sah as either the progression of acute hydrocephalus or the development of chronic hydrocephalus de novo . post - traumatic or -spontaneous intracerebral hemorrhage hydrocephalus was also defined as clinical and radiologically diagnosed hydrocephalus that developed during the next few weeks after resolution of the hemorrhage and the hydrocephalus required treatment . the subsequent development of shunt infection was confirmed by the clinical findings such as fever and/or meningeal irritation signs , laboratory studies that included the hematological and csf parameters ( the white blood cell and red blood cell counts , the glucose level and the protein levels ) and csf culture from the shunt devices . antibiotics were started according to the results of csf culture and all the shunt devices were removed when shunt infection was confirmed . all the samples were taken through intraventricular catheterization during a vp shunt operation for treating the patients with hydrocephalus . approximately 10 ml csf was collected from a proximal catheter inserted into the ventricles before connecting the proximal catheter and the shunt valve . csf analysis and culture were then performed in a routine fashion on these collected csf samples . the csf samples were centrifuged at 800 g for 10 minutes to sediment both the hematogenous cells and other cells contaminating the sample , and the supernatant was aliquoted and stored at -80 until analysis . we detected and analyzed the specific biomarkers in the csf by way of enzyme - linked immunosorbent assay ( elisa ) . the biomarkers were tgf- and tnf- for inflammation , vegf for angiogenesis and tau protein for neurodegeneration . the vegf , tgf-1 and tnf- concentrations were determined using a commercially available sandwich elisa ( bender med - systems gmbh , vienna , austria ) , and the total tau concentration was determined using a commercially available sandwich elisa ( invitrogen , ca , usa ) according to the manufacturer 's instructions . the sensitivity of the assay was 7.9 pg / ml for vegf , 9.0 pg / ml for tgf-1 , 1.65 pg / ml for tnf- and 12.0 pg / ml for total tau . the intra - assay coefficient of variation was 6.2% ( mean : 571 pg / ml , n=8 ) for vegf ; the interassay coefficient of variation was 5.1% ( mean : 14346 pg / ml , n=8 ) for tgf-1 ; the interassay coefficient of variation was 6.0% ( mean : 295 pg / ml , n=7 ) for tnf- : the interassay coefficient of variation was 4.4% ( mean : 578 pg / ml , n=3 ) for total tau . all the elisa 96-well microtiter plates were analyzed using a microplate photometer with the maximum absorbance at 470 nm . the twenty - two patients were divided into 3 groups : sah - induced hydrocephalus ( n=9 ) , inph ( n=6 ) and hydrocephalus with a subsequent shunt infection ( n=7 ) . the significance of differences of each biomarker level among the sah - induced hydrocephalus , inph and shunt infection groups was established by the kruskal - wallis test with asymptotic sig . ( p ) values , as the distribution of the values was non - gaussian . the significance of differences of the vegf level between the sah - induced hydrocephalus and inph groups , the sah - induced hydrocephalus and shunt infection groups and the inph and shunt infection groups was established by the mann - whitney u test with two - sided p values , as the distribution of the values was non - gaussian . the statistical analyses were processed by the use of statistical software spss 12.0 for windows . of the enrolled twenty - two patients , one patient suffered from congenital hydrocephalus , two had post - traumatic cerebral hemorrhage hydrocephalus , two patients had hydrocephalus after moyamoya - induced hemorrhage , seven were inph and ten were sah - induced chronic hydrocephalus . the mean symptom duration of inph was 18.7 months ( range : 5 months to 3 years ) . the mean duration from sah to vp shunt and from other intracerebral hemorrhages to vp shunt was 84.2 days ( range : 26 to 138 days ) and 122.5 days ( range : 84 to 180 days ) , respectively . the patient with congenital hydrocephalus underwent shunt reoperation due to shunt failure with a non - infectious cause ( table 1 ) . of the seventy - six patients who underwent vp shunt , a total seven patients suffered from shunt infection and they all were enrolled for this study . of them , one patient there were 2 patients with post - traumatic cerebral hemorrhage hydrocephalus and post - moyamoya - induced hemorrhage hydrocephalus , respectively ( table 1 ) . the mean duration from the shunt operation to shunt infection was 46 days ( range : 20 to 68 days ) . a routine csf analysis and culture during vp shunt showed that there was no sign of infection at the moment that the shunt operation was performed . the mean red and white blood cell count of the csf ( sd ) was 10532733 ( range : 0 - 7250)/l and 1.93.3 ( range : 0 - 9)/l , respectively . the mean protein and glucose level of the csf ( sd ) was 4938 ( range : 13 - 125 ) and 6310 ( range : 50 - 81 ) mg / dl , respectively . there was no growth of pathogenic organisms on the culture study with these csf samples , even though at the time of the subsequent development of shunt infection , some bacteria grew in the csf samples from the shunt devices . the main pathogenic organisms were staphylococcus aureus ( 3 patients ) and staphylococcus epidermidis ( 2 patients ) . one patient had a staphylococcus hominis infection and one patient had a mixed infection - bacteroides fragilis and serratia fonticola ( table 2 ) . table 1 summarized the characteristics of the enrolled patients with hydrocephalus and table 2 demonstrated the results of csf analysis and culture before and after shunt infection in the infection group . there was no difference in the red and white blood cell counts and the protein and glucose levels among the csf samples ( data was not shown ) . the mean vegf concentration ( sd ) in the csf of the sah - induced hydrocephalus , inph and shunt infection groups was 236138 ( median : 201 ) , 23780 ( median : 224 ) and 627391 ( median : 525 ) pg / ml , respectively . the mean total tau concentration ( sd ) in the csf of the sah - induced hydrocephalus , inph and shunt infection groups was 12471983 ( median : 352 ) , 195151 ( median : 158 ) and 326182 ( median : 282 ) pg / ml , respectively . the mean tnf- concentration ( sd ) in the csf of the sah - induced hydrocephalus , inph and shunt infection groups was 11235 ( median : 121 ) , 14141 ( median : 139 ) and 15238 ( median : 144 ) pg / ml , respectively . the mean tgf-1 concentration ( sd ) in the csf of the sah - induced hydrocephalus , inph and shunt infection groups was 991439 ( median : 895 ) , 918498 ( median : 763 ) and 24072210 ( median : 949 ) pg / ml , respectively . we statistically analyzed the csf vegf between the sah - induced hydrocephalus and infection groups and between the inph and infection groups by the mann - whitney u test . there was a significant difference between the sah - induced hydrocephalus and infection groups , and between the inph and infection groups , respectively ( p<0.01 ) , whereas there was no significant difference between the sah - induced hydrocephalsus and inph groups . of the enrolled twenty - two patients , one patient suffered from congenital hydrocephalus , two had post - traumatic cerebral hemorrhage hydrocephalus , two patients had hydrocephalus after moyamoya - induced hemorrhage , seven were inph and ten were sah - induced chronic hydrocephalus . the mean symptom duration of inph was 18.7 months ( range : 5 months to 3 years ) . the mean duration from sah to vp shunt and from other intracerebral hemorrhages to vp shunt was 84.2 days ( range : 26 to 138 days ) and 122.5 days ( range : 84 to 180 days ) , respectively . the patient with congenital hydrocephalus underwent shunt reoperation due to shunt failure with a non - infectious cause ( table 1 ) . of the seventy - six patients who underwent vp shunt , a total seven patients suffered from shunt infection and they all were enrolled for this study . of them , one patient there were 2 patients with post - traumatic cerebral hemorrhage hydrocephalus and post - moyamoya - induced hemorrhage hydrocephalus , respectively ( table 1 ) . the mean duration from the shunt operation to shunt infection was 46 days ( range : 20 to 68 days ) . a routine csf analysis and culture during vp shunt showed that there was no sign of infection at the moment that the shunt operation was performed . the mean red and white blood cell count of the csf ( sd ) was 10532733 ( range : 0 - 7250)/l and 1.93.3 ( range : 0 - 9)/l , respectively . the mean protein and glucose level of the csf ( sd ) was 4938 ( range : 13 - 125 ) and 6310 ( range : 50 - 81 ) mg / dl , respectively . there was no growth of pathogenic organisms on the culture study with these csf samples , even though at the time of the subsequent development of shunt infection , some bacteria grew in the csf samples from the shunt devices . the main pathogenic organisms were staphylococcus aureus ( 3 patients ) and staphylococcus epidermidis ( 2 patients ) . one patient had a staphylococcus hominis infection and one patient had a mixed infection - bacteroides fragilis and serratia fonticola ( table 2 ) . table 1 summarized the characteristics of the enrolled patients with hydrocephalus and table 2 demonstrated the results of csf analysis and culture before and after shunt infection in the infection group . there was no difference in the red and white blood cell counts and the protein and glucose levels among the csf samples ( data was not shown ) . the mean vegf concentration ( sd ) in the csf of the sah - induced hydrocephalus , inph and shunt infection groups was 236138 ( median : 201 ) , 23780 ( median : 224 ) and 627391 ( median : 525 ) pg / ml , respectively . the mean total tau concentration ( sd ) in the csf of the sah - induced hydrocephalus , inph and shunt infection groups was 12471983 ( median : 352 ) , 195151 ( median : 158 ) and 326182 ( median : 282 ) pg / ml , respectively . the mean tnf- concentration ( sd ) in the csf of the sah - induced hydrocephalus , inph and shunt infection groups was 11235 ( median : 121 ) , 14141 ( median : 139 ) and 15238 ( median : 144 ) pg / ml , respectively . the mean tgf-1 concentration ( sd ) in the csf of the sah - induced hydrocephalus , inph and shunt infection groups was 991439 ( median : 895 ) , 918498 ( median : 763 ) and 24072210 ( median : 949 ) pg / ml , respectively . we statistically analyzed the csf vegf between the sah - induced hydrocephalus and infection groups and between the inph and infection groups by the mann - whitney u test . there was a significant difference between the sah - induced hydrocephalus and infection groups , and between the inph and infection groups , respectively ( p<0.01 ) , whereas there was no significant difference between the sah - induced hydrocephalsus and inph groups . the present study demonstrated that only vegf in the csf of the patient group with the subsequent development of shunt infection after vp shunt was significantly increased compared to that of the patient groups with sah - induced chronic hydrocephalus and inph without infections . there was no significant difference of the concentration of other biomarkers such as total tau , tnf- and tgf-1 among the three groups . of interest , analysis of vegf showed that there was a significant difference between the sah - induced hydrocephalus and infection groups , and between the inph and infection groups ( p<0.01 ) , whereas there was no significant difference between the sah - induced hydrocephalus and inph groups . although koehne et al.15 ) reported that the vegf concentration of the non - hydrocephalic csf controls was less than 1 pg / ml , the normal ranges of the above biomarkers in the csf are unclear . in our study , the increased vegf in the infection group should be considered to be relative ( compared to that of the sah - induced hydrocephalus and inph groups ) because we did not compare the biomarkers of the study groups with the csf biomarkers of healthy people . previous studies have reported that vegf is increased in the csf of patients with posthemorrhagic hydrocephalus11 ) or chronic obstructive hydrocephalus34 ) . chronic hydrocephalus probably increases the intracranial pressure , and increased intracranial pressure may decrease the cerebral blood flow and induce chronic tissue hypoxia . finally , such conditions may induce vegf secretion from the chroid plexus or migration of vegf from the surrounding brain tissue11,34 ) . the choroid plexus , which is involved in csf production and it secretes numerous growth factors4,29 ) , normally has high levels of vegf21 ) . in the csf , the vegf levels may reflect choroid plexus - secreted ligand or migration of vegf from the surrounding brain tissue and this plays an active role in brain tissue angiogenesis34 ) . on the contrary , the origin of tau is probably damaged or degenerative neuronal cells in the subependymal region of the dilated cerebral ventricles18 ) , and tnf- may result from the activated microglial or inflammatory cells in the brain during the development of chronic hydrocephalus30 ) . tgf-1 is expressed from endothelial , hematopoietic and connective tissue cells in response to tissue injury for wound healing or fibrosis13 ) , whereas following hemorrhage , it is released from astrocytes17 ) and platelets5,11 ) into the csf . it is unclear why the patients suffering from hydrocephalus with increased vegf in the csf more often developed shunt infection . it increases peripheral oxygen delivery by promoting angiogenesis , and it is involved in endothelial cell migration , proliferation and differentiation , as well as proteolysis of the extracellular matrix2,14 ) . enhanced levels of vegf were found in animal brains after hypoxic insults22,24,25 ) and in human patients after acute ischemic stroke12 ) . under normal conditions , there is only a diffuse expression of vegf in the brain , with the exception of some specialized cells such as those of the epithelium in the choroid plexus22 ) . in contrast , under local or systemic hypoxia , the neurons , astrocytes and microglial cells all show an enhanced vegf expression10,24,27 ) . additionally , vegf is also expressed in response to inflammatory stimuli from preformed granules that are present in neutrophils and platelets , and this is independent of hypoxia15 ) . vegf has been shown to be elevated in the csf of children and adults with bacterial meningitis.33 ) koehne et al.16 ) reported that the vegf concentrations were significantly elevated in the hydrocephalus csf samples regardless of the causes compared with those vegf concentrations in routine diganostic lumbar punctures for unrelated reasons . interestingly , they observed higher vegf concentrations in the csf samples that grew staphylococcus epidermidis compared to the vegf concentrations in those csf samples of any other hydrocephalic patients , although the small number of samples precluded demonstarting a statistically significant association between the vegf concentrations and bacterial infection . koehne et al.15 ) assumed that a high vegf level in the csf may reflect a sequel of inflammation . we also routinely performed a csf analysis and culture from the intraventricular catheterization during shunt operations . interestingly , only the csf vegf levels of the patients with a subsequent shunt infection were significantly higher than those csf vegf levels of the non - infection groups , whereas the other biomarkers and the csf parameters such as the red and white blood cell counts and the protein and glucose levels in the infection group were not different from those of the non - infection groups and any bacteria did not grow in all the csf samples . generally , most infections in shunt systems originate from bacterial contamination introduced at the time of surgery and most manifest by 3 to 4 weeks postoperatively.28 ) on the contrary , the mean duration from the shunt operation to the shunt infection was 46 days in our study . we have used an antibiotic - coated shunt system for vp shunt operation since 2008 . we think that this system probably delays the implantation of organisms into the csf space . thus , our results suggest that increased csf vegf probably provides a good condition for bacteria , which are introduced at the time of surgery , to grow in the brain , rather than being a a sequel of subclinical bacterial infection before vp shunt . vegf has been shown to play a major role in angiogenesis and increasing vascular permeability.23 ) vegf - mediated neovascularization may enhance the oxygen supply . besides , vegf that is produced intrathecally may contribute to disruption of the blood - brain barrier ( bbb)9,32 ) . thus , the bacteria introduced at the monent of vp shunt surgery may easily break into the brain tissue and vascular channels through the disrupted bbb and the increased vascular networks probably provide nutrients and oxygen to the bacteria . taken together , these circumstances induced by increased vegf may make the external bacteria adhere to the brain tissue and shunt devices and grow better . by contrast , the csf parameters and culture results are probably not predictive factors for shunt associated infection , but rather , they are markers for a present infection only . this study has some limitations . as mentioned above , because we did not obtain the csf biomarkers of nonhydrocephalic controls , we could not compare the csf biomarkers between normal controls and the hydrocephalus patients . moreover , there is still no reference values of the biochemicals in the csf of healthy subjects , and we do not know the age - matched reference values for the evaluation of these biomarkers among the study groups . however , because the aim of this study is to compare csf biomarkers between the subsequent shunt infection and non - infection groups with hydrocephalus , we did not consider a normal control group and age - related variables . another limitation is the small number of patients in each group even though this is a pilot study . of the seventy - six patients who underwent vp shunt during the study period , a total seven patients suffered from shunt infection and they all were enrolled for this study because the number of shunt - related infection was very few . finally , we obtained csf samples only one time during ventricular catheterization for a shunt operation . it has been demonstrated that the levels of certain markers in the csf might fluctuate over time , so a sampling at one time point might be of limited use7 ) . moreover , the effect of the gravity may influence the concentration of the some biomarkers in the samples ( lumbar versus ventricle)8 ) . thus , in future studies , the corrleation of the csf vegf levels between lumbar and ventricular csf samples should be confirmed . further , repeated ventricular punctures should be limited due to ethical issues and technical problems if the monitoring of csf vegf is necessary for making decision when a vp shunt operation is performed . our data suggests that the levels of vegf in the csf , which is taken during a shunt operation , could be relevant to the subsequent development of shunt infection . in future , a comparison study among a healthy group and a hydrocephalic group might be needed to determine the normal reference values of the csf biomarkers . prospective studies are also needed to determine the longitudinal profile of the csf biomarkers , and especially the vegf levels , from the occurrence of hydrocephalus until a vp shunt operation and to test whether csf vegf can be used to predict a shunt infection . more refined assay techniques and further understanding of the pathophysiology of shunt infection will probably lead to tests of the csf composition that are indeed useful for the clinical management of hydrocephalic patients .
regulation of nuclear protein transportation through nuclear pore complexes ( npcs ) is an essential function in eukaryotic cells . most macromolecules larger than 4060 kda are transported actively through the npc mediated by transport factors such as members of importin- superfamily ( fabre and hurt 1994 ; davis 1995 ; macara 2001 ; weis 2002 ) . importin13 ( imp13 , lgl2 , kap13 , or ipo13 ) , a member of the importin- superfamily , is a nucleus cytoplasm bidirectional transporter that plays roles in cell differentiation , embryonic development , and physiologic functions of several organs , including lung , brain , and heart ( zhang et al . 2000 ; su et al . 2002 ; tao et al . 2004 ; tao et al . 2006 imp13 has been documented to be involved in nuclear import or export of several nuclear proteins which include eif1a , mago - y14 and ubc9 ( mingot et al . 2001 ) , pax6 ( ploski et al . 2004 ) , nf - yb / nf - yc dimer ( kahle et al . 2005 ) , the gulcocorticoid receptor ( gr ) ( tao et al . 2006 ) , myopodin ( liang et al . 2008 ) , and arx ( shoubridge et al . 2007 ; lin et al . 2009 ) . for example , pax6 is a master control gene for eye morphogenesis ( gehring 1996 ) and arx is necessary for the development of forebrain ( lin et al . imp13 is exclusively expressed in the basal cells of human limbal epithelia and regulates differentiation and proliferation of corneal epithelial progenitor cells ( wang et al . importin proteins show regulated expression patterns in cells and tissues at both rna and protein levels , indicating that nuclear import of the cargo proteins depends on the presence of different amounts of importins ( jans et al . because of the intrinsic selectivity importin proteins display for different cargoes , their differential expression patterns during development and differentiation are suggested to be a potential regulatory mechanism ( yamaguchi et al . 2006 ; terry et al . 2007 ; okada et al . 2008 ; yasuhara et al . 2009 ; whiley et al . 2012 ; yasuda et al . several lines of evidence show regulated importin expression during embryonic development ( kamei et al . however , neither expression nor subcellular localization of imp13 in brain development has been closely examined . in this study , we generated a rabbit anti - imp13 antibody to analyze both expression and localization of endogenous imp13 in embryonic mouse brain tissues . our results revealed that both expression and subcellular localization of endogenous imp13 are dynamically changed in some tissues of embryonic mouse brains , suggesting a significance of spatial temporal regulation of imp13 in mouse brain development . to express gst - tagged imp13 protein , cells of escherichia coli bl21 carrying pgex-4t-2-imp13 ( tao et al . 2004 ) were grown overnight on lb - amp plates and were used to inoculate 1 l of prewarmed lb containing 100 g / ml ampicillin . the cell cultures were incubated at 37c with vigorous shaking . at an optical density of 0.7 at 600 nm , cells were lysed and gst - tagged imp13 proteins were purified using glutathione sepharose 4b beads . for antibody production , new zealand white rabbits were immunized subcutaneously using 0.5 mg gst - tagged imp13 proteins per kilogram body weight after emulsified to freund s complete adjuvant . two weeks after primary injection , booster injections were made using 0.5 mg fusion protein per kilogram body weight with freund s incomplete adjuvant . twelve days after monthly booster injections , anti - sera were collected from an artery in the ear . finally , the purified rabbit anti - imp13 antibody was prepared after absorbing gst antibody with gst beads . all animal experimental procedures were conducted in accordance with the guide for the care and use of laboratory animals , provided by the xiamen university laboratory animal center , xiamen , china . c57/bl-6 mouse embryos at different developmental stages were collected ( three mice per group ) for real - time rt pcr , western blot , and immunohistochemical analysis . brains of e11.5 , e13.5 , e15.5 , and e17.5 were carefully dissected out from the skulls and placed into ice - cold phosphate - buffered saline ( pbs ) ; for p0 and adult mice , after a deep anesthesia , the animals were perfused with cold 4% paraformaldehyde transcardially using a peristaltic perfusion connected with an 18-gauge needle through the left ventricle and by clamping the descending aorta . then , after perfusion , the animals were decapitated , the skulls were taken off , and the brains were carefully removed . for immunostaining , all samples were dehydrated and embedded in paraffin and cut into 4-m - thick sections with a diamond knife with an ultra - microtome ( leica rm2255 , nussloch , germany ) . total rnas were isolated with rnafast 1000 ( feijie , china ) and all primers and probes were ordered from applied biosystems ( foster , ca , usa ) . the sequence of the primers and probes used for taqman rt pcr amplification are as follows : a forward primer ( 5-acagccccaaaatggttaaggtt-3 ) , a reverse primer ( 5-ccaacactt cgagaggtcctt-3 ) , and the taqman mgb probe ( fam 5-ccaacacttcgagaggtcctt-3 nfq ) were used for amplifying a 61-bp fragment of the hprt1 cdna as internal control . a forward primer ( 5-ggctccaaaattgtgctgact-3 ) , a reverse primer ( 5-gcatcatgctgagag ctagtga-3 ) , and a taqman mgb probe ( fam 5-ccagcgccacgcacag-3 nfq ) were used to amplify a 64-bp fragment of ipo13 cdna . analysis of real - time rt pcr was carried out in a total volume of 20 l . the thermal cycle conditions were as follows : 1 2 min 50c , 1 10 min 95c , followed by 40 cycles of reaction at 95c for 15 s and combined annealing / extension step at 60c for 1 min . expression of ipo13 was normalized to hprt using the 2 method as described ( tichopad et al . 2005 ) . tissues were pulverized with a mortar and pestle on ice and homogenized in the lysis buffer ( 50 mm hepes naoh , ph 7.5 , 100 mm nacl , 0.5% np-40 , 2.5 mm edta , 10% glycerol , 1 mm dtt , 1 mm pmsf , and 1% proteinase inhibitor cocktail ) . protein concentrations in the supernatants were measured with a spectrophotometer ( bio - rad smartspec 3000 , el cajon , ca , usa ) . protein extracts ( 60 g per sample ) were denatured by boiling in 2 loading buffer ( 0.25 m tris hcl , 20% glycerol , 4% sds , 0.005% bromoethanol blue , and 5% -mercaptoethanol ) for 5 min , separated by 10% sds page , and transferred to a pvdf membrane . the membrane was placed in blocking solution ( 5% non - fat dry milk in tbst ) for 1 h at room temperature and then incubated overnight at 4c with either the rabbit anti - imp13 polyclonal antibody at 1:1,000 dilution or a mouse anti - tubulin monoclonal antibody at 1:1,000 dilution ( # mab5564 , chemicon , temecula , ca , usa ) . the membrane was rinsed three times , for a total of 30 min in tbst , followed by incubation with horseradish peroxidase - conjugated anti - rabbit or anti - mouse igg antibodies . the membrane was rinsed three times again for 30 min total in tbst and developed with ecl plus western blotting detection reagents ( ge healthcare , piscataway , new jersey , usa ) . immunohistochemical analysis was performed using the rabbit anti - imp13 polyclonal antibody , a rabbit anti - imp9 polyclonal antibody ( # ab52605 ; abcam , uk ) , and a rabbit anti - imp1 polyclonal antibody ( # ab2811 ; abcam ) . four - micrometer - thick serial sections were mounted on glass slides coated by 3-aminopropyltriethoxysilane , and the slides were dried overnight at 37c followed by incubating for 30 min at 64c . the sections were deparaffinized in two changes of xylene and rehydrated in a series of descending concentrations of ethanol . antigen retrieval was performed by microwave heating the slides in 10 mm citrate buffer for 20 min . the sections were then incubated with primary antibodies at 4c overnight . after washing with pbs solution three times for 5 min , the sections were incubated with horseradish peroxidase - conjugated anti mouse / rabbit immunoglobulin g ( secondary antibodies ) for 30 min at room temperature . the immune complex was visualized by incubation with diaminobenzidine ( dab kit ; maixin biological , fuzhou , china ) for 5 min . the sections were then lightly counterstained with hematoxylin , dehydrated , and mounted . for negative controls , the tris - buffered saline ( tbs ) solution was used instead of the primary antibody . gst - tagged full - length imp13 protein was expressed and partially purified in bacterial cells ( fig . 1a , lanes 2 , 3 , and 4 ) . because the rabbits were immunized against a gst - tagged imp13 , their serum should contain antibodies against imp13 and antibodies against the gst tag as well ( fig . 1b , lanes 1 and 2 ) . by incubation of the serum with gst immobilized glutathione sepharose 4b beads , the anti - gst antibodies in the serum were removed and the treated serum does not recognize the gst tag but is able to detect imp13 ( fig . therefore , we generated an anti - imp13 antibody which was used in the present study.figure 1.preparation of a rabbit anti - imp13 antibody . ( b ) western blot analysis for the retained gst antibody in the anti - sera . gst - tagged imp13 and gst proteins were separated by 10% sds page and proteins were transferred to a nitrocellulose membrane . lanes 14 blots were probed with anti - serum prepared primary antibody ( 1:2,000 ) , followed by goat - anti rabbit igg / hrp secondary antibody . and retained gst antibody was detected in the anti - serum before treatment ( lanes 1 and 2 ) . no gst antibody was detected in the anti - sera after treatment with gst beads ( lanes 3 and 4 ) . lanes 56 blots were probed with anti - gst primary antibody ( 1:1,000 ) as a control . ( b ) western blot analysis for the retained gst antibody in the anti - sera . gst - tagged imp13 and gst proteins were separated by 10% sds page and proteins were transferred to a nitrocellulose membrane . lanes 14 blots were probed with anti - serum prepared primary antibody ( 1:2,000 ) , followed by goat - anti rabbit igg / hrp secondary antibody . and retained gst antibody was detected in the anti - serum before treatment ( lanes 1 and 2 ) . no gst antibody was detected in the anti - sera after treatment with gst beads ( lanes 3 and 4 ) . lanes 56 blots were probed with anti - gst primary antibody ( 1:1,000 ) as a control . the expression of imp13 has been suggested to be regulated in multiple fetal tissues ( quan et al . 2008 ) . since imp13 transports several transcription factors which are essential in brain development ( ploski et al . 2004 ; lin et al . 2009 ) , it is of interest to examine the expression of imp13 in mouse brain development . to this end , we carried out two parallel experiments . first , we applied the real - time rt pcr analysis to quantify its mrna levels of ipo13 from fetal brain tissues of mice . total rnas were isolated from the brain at e13.5 , e15.5 , and e17.5 embryos as well as at p0 and of adult mice . the level of ipo13 mrna was normalized to hprt internal control and presented in fig . interestingly , ipo13 expression level in fetal brain tissues was found to be the highest at e13.5 and then gradually decreased . by contrast , the expression of ipo13 from adult mouse brain tissues was shown to be the lowest level among the time point examined . meanwhile , western blot analyses further confirmed the temporal - specific expression pattern of imp13 ( fig . a expressions of ipo13 in the brains at the indicated stages were analyzed with real - time rt pcr analyses . b expressions of imp13 protein in mouse fetal brain at the indicated stages were analyzed with western blot analyses . relative quantification real - time rt pcr analyses were normalized to hprt loading controls . error bars represent the standard error of the mean ( sem ) ; western blot analyses were normalized against tubulin loading controls . a expressions of ipo13 in the brains at the indicated stages were analyzed with real - time rt pcr analyses . b expressions of imp13 protein in mouse fetal brain at the indicated stages were analyzed with western blot analyses . relative quantification real - time rt pcr analyses were normalized to hprt loading controls . error bars represent the standard error of the mean ( sem ) ; western blot analyses were normalized against tubulin loading controls . in order to localize imp13 in developing brains distribution of endogenous imp9 and imp1 , two other members of the importin- super family , was used as control . in the tissue of telencephalon , endogenous imp13 was mainly localized in the cytoplasm of at e11.5 ( fig . 3a ) . at e13.5 , imp13 is in both the cytoplasm and nucleus ( fig . by contrast , at later stages from e15.5 to p0 , imp13 is mainly in the nucleus and only a weak staining of imp13 can be observed in the cytoplasm ( fig . endogenous imp9 resides mainly in the cytoplasm of telencephalon in all stages ( fig . , however , imp13 was found to be in both the cytoplasm and the nucleus from the early to late stage ( fig . 5q , r ) , which was similar to that of imp9 ( fig . this may suggest the existence of different neural progenitor cells in the hippocampus area ( hildrestrand et al . v).figure 3.cellular localization of imp13 ( a e ) , imp9 ( f j ) , and imp1 ( k o ) in fetal and nascent brain . o , immunohistochemical staining of sagittal sections ( e11.5e15.5 ) or coronal section ( e17.5 and p0 ) of the brains at the indicated stages was employed to assess cellular localization of imp13 , imp9 , or imp1 . t h&e staining of sagittal sections ( e11.5e15.5 ) or coronal section ( e17.5 and p0 ) of whole mouse embryos or brains at the indicated stages . red arrows indicate fetal and nascent mouse telencephalon ( p , q ) or cerebral cortex ( r t ) . a , f , k : e11.5 ; b , g , l : e13.5 ; c , h , m : e15.5 ; d , i , n : e17.5 ; e , j , o : p0 ( original magnification 400 ) . the inset is the high magnification view ( original magnification 1,000).figure 4.cellular localization of imp13 ( a c ) , imp9 ( d f ) , and imp1 ( g i ) in fetal mouse cerebellar primordium or cerebellum at differential stages . red arrows indicate fetal mouse cerebellar primordium ( j , k ) or cerebellum ( l ) . a , d , g : e11.5 ; b , e , h : e13.5 ; c , f , i : e15.5 ( original magnification 400 ) . the inset is the high magnification view ( original magnification 1,000).figure 5.cellular localization of imp13 ( a , b , i , j , q , r ) , imp9 ( c , d , k , l , s , t ) , and imp1 ( e , f , m , n , u , v ) in fetal mouse and neonatal ( p0 ) mouse s striatum , external capsule , and hippocampus at differential stages . black arrows indicate nuclear localizations and white arrows indicate cytosol localizations ; imp9 and imp1 are expressed lowly in the striatum ( c , d , e , f ) and external capsule ( k , l , m , n ) . red arrows indicate fetal mouse ( e17.5 ) and neonatal ( p0 ) mouse s striatum ( g , h ) , external capsule ( o , p ) , and hippocampus ( w , x ) . a , c , e , i , k , m , q , s , u : e17.5 ; b , d , f , j , l , n , p , t , v : p0 ( original magnification 400 ) . cellular localization of imp13 ( a e ) , imp9 ( f j ) , and imp1 ( k o ) in fetal and nascent brain . o , immunohistochemical staining of sagittal sections ( e11.5e15.5 ) or coronal section ( e17.5 and p0 ) of the brains at the indicated stages was employed to assess cellular localization of imp13 , imp9 , or imp1 . t h&e staining of sagittal sections ( e11.5e15.5 ) or coronal section ( e17.5 and p0 ) of whole mouse embryos or brains at the indicated stages . red arrows indicate fetal and nascent mouse telencephalon ( p , q ) or cerebral cortex ( r t ) . a , f , k : e11.5 ; b , g , l : e13.5 ; c , h , m : e15.5 ; d , i , n : e17.5 ; e , j , o : p0 ( original magnification 400 ) . cellular localization of imp13 ( a c ) , imp9 ( d f ) , and imp1 ( g i ) in fetal mouse cerebellar primordium or cerebellum at differential stages . red arrows indicate fetal mouse cerebellar primordium ( j , k ) or cerebellum ( l ) . a , d , g : e11.5 ; b , e , h : e13.5 ; c , f , i : e15.5 ( original magnification 400 ) . the inset is the high magnification view ( original magnification 1,000 ) . cellular localization of imp13 ( a , b , i , j , q , r ) , imp9 ( c , d , k , l , s , t ) , and imp1 ( e , f , m , n , u , v ) in fetal mouse and neonatal ( p0 ) mouse s striatum , external capsule , and hippocampus at differential stages . black arrows indicate nuclear localizations and white arrows indicate cytosol localizations ; imp9 and imp1 are expressed lowly in the striatum ( c , d , e , f ) and external capsule ( k , l , m , n ) . red arrows indicate fetal mouse ( e17.5 ) and neonatal ( p0 ) mouse s striatum ( g , h ) , external capsule ( o , p ) , and hippocampus ( w , x ) . a , c , e , i , k , m , q , s , u : e17.5 ; b , d , f , j , l , n , p , t , v : p0 ( original magnification 400 ) . in this work , an antibody against full - length imp13 was generated and the expression and subcellular distribution of endogenous imp13 during the development of embryonic mouse brain were systematically examined . both the expression and the subcellular distribution of imp13 in fetal brain are found to be regulated : at early developmental stages , its expression level is higher than that at later stages . imp13 is mainly in the cytoplasm of telencephalon at early developmental stages , but it is concentrated in the nucleus of telencephalon when mice were born . since imp13 is one of importin- superfamily which plays crucial roles in nucleocytoplasmic transport , our results suggest that its function is probably regulated spatial temporally in brain development . the nucleocytoplasmic transport has been suggested to be highly regulated at different levels such as cargo , importin-s , and npcs ( major et al . even subtle changes of them may result in significant impact on biological processes and dramatic influences on cell signaling . imp13-mediated nuclear import of transcription factors in response to regulatory signaling governs organogenesis during embryonic development . we have reported previously that the imp13 primarily is localized in the nucleus in fetal lung and that imp13 enters the nucleus much more rapidly at e18 than at e21 ( tao et al . total nuclear recovery of imp13 was significantly different at these two time points . in this study , different subcellular distribution patterns of imp13 are found during the development of fetal brain comparing with imp1 and imp9 , which may indicate its distinct roles in this process . it is also possible that nuclear localization of imp13 may reflect selective nuclear retention to reduce its nucleocytoplasmic transport activities at late brain development . regulated synthesis of specific importin proteins has been shown to mediate cell fate outcomes in embryonic stem cell systems ( perez - terzic et al . 2a , b ) , suggesting that there might be a heavier nucleocytoplasmic transport of cargoes by imp13 when mouse neurogenesis starts ( hartfuss et al . imp13 is one of two members in importin- superfamily which can transport cargoes in and out of the nucleus ( mingot et al . it is possible that imp13 mainly functions in importing transcription factors such as pax6 or arx at early developmental stages but functions mainly in exporting cargoes such as eif1a at late developmental stages in this case . mechanisms in cells to regulate the functional transition of imp13 from import to export or vice versa could be related to unknown factors in brain development . in summary , subcellular localization of endogenous imp13 is shown for the first time to be regulated throughout fetal brain development , suggesting a potential for neural cell - specific nucleocytoplasmic transport mechanisms to govern brain development .
complete esophageal obstruction ( ceo ) is an uncommon phenomenon characterized by lumen obliteration that can arise from both benign and malignant etiologies . the former , being more frequent , is commonly the result of chemoradiation therapy of head and neck and lung cancers . however , incidence is dose - dependent with occurrence stated to be between 0.8 % to 5 % in those who have over 60 gy exposure 1 . the underlying pathophysiology is likely progressive chronic inflammatory changes with subsequent fibrosis and collagen deposition from radiation or toxic exposures . a connective tissue membrane obliterating the esophageal lumen frequently is encountered as a result of this process . longer - segment completely obstructing fibrotic strictures also can occur , making endoscopic lumen restoration challenging . blind antegrade endoscopic puncture or dilation is usually not performed due to risk of injury to surrounding critical structures in the neck and chest . hernandez et al 2 demonstrated that blind antegrade dilation can in fact lead to higher rates of complications such as perforations and fistula formation in complex strictures . treatment options have been technically challenging with some including radical surgical procedures such as esophagectomy with colonic interposition , gastric transposition or platysma myocutaneous flap repair , all of which have substantial morbidity and mortality 3 . consequently , minimally invasive approaches using endoscopy to restore luminal patency have been the mainstay in recent years . in a sentinel paper tucker 4 described management of complex esophageal strictures with a retrograde dilation approach through a mature gastrostomy site . van twisk et al 5 described a similar approach in which a flexible endoscope was inserted retrograde via a gastrostomy site for ceo . currently , various other endoscopic methods are available for lumen restoration in ceo , including a combined antegrade - retrograde endoscopic dilation or rendezvous procedure 6 . this approach became more commonly employed after a case series published by bueno and colleagues 7 . the main limitation to this strategy is that it is restricted to esophageal obstructions typically less than 3 cm in length . however , we recently described a novel approach ( poetre : per - oral endoscopic tunneling for restoration of the esophagus ) using endoscopic submucosal tunneling with combined antegrade - retrograde endoscopic dilation for longer segments of obstructed esophagus 8 . to date , results in more than 180 patients have been described in various published case series using different techniques and devices demonstrating excellent clinical symptom resolution with low rates of adverse events . in this article , we present our experience with endoscopic management of complete esophageal obstruction . in addition , we highlight emerging techniques , outcomes and adverse events related to this minimally invasive modality . this study was approved by the university of florida institutional review board ( irb ) . our electronic endoscopy database was queried from january 2009 through june 2014 for patients who were referred for antegrade and retrograde endoscopy for ceo . general anesthesia was used per anesthesiologist recommendations and prophylactic antibiotics were typically not given unless a submucosal tunneling technique was undertaken the primary aim of the study was to assess the efficacy and safety of combined antegrade - retrograde endoscopic dilation for ceo in patients undergoing the procedure at our institution . the secondary aim was to review and highlight emerging techniques , outcomes , and adverse events ( aes ) after endoscopic treatment of ceo . efficacy was defined by : ( 1 ) technical success of endoscopic therapy ; and ( 2 ) clinical success as determined by improvement in dysphagia score . technical success : procedural technical success was defined as the ability to successfully perform simultaneous antegrade and retrograde endoscopy with dilation and restoration of esophageal continuity . 0 = no dysphagia ; 1 = dysphagia to solids ; 2 = dysphagia to semisolids ; 3 = dysphagia to liquids ; 4 = patient unable to swallow saliva ( complete dysphagia / aphagia ) was used to quantify dysphagia prior to and after endoscopic treatment 9 . adverse events : endoscopic aes were assessed based on criteria previously established by the american society of gastrointestinal endoscopy ( asge ) 10 . the procedure was begun by using an antegrade endoscope to demonstrate a ceo at or distal to the esophageal inlet ( fig.1 ) . a retrograde endoscope was then inserted through a mature gastrostomy site and guided up the esophagus . the proximity of the two endoscopes was confirmed by use of multiplanar fluoroscopy ( fig . 2 ) and transillumination from the endoscope ( fig . 3 ) . in cases where the distance between the two endoscopes was measured to be less than 3 cm , a 19-gauge endoscopic ultrasound needle ( eus - n ) was used to puncture and traverse the obstruction under multiplanar fluoroscopy and simultaneous antegrade and retrograde endoscopic guidance . this allowed guide wire access to the distal esophagus , which permitted the tract to be balloon dilated . when antegrade passage of the guidewire was not successful , the guide wire was advanced through the retrograde endoscope and probed with antegrade endoscopic guidance under fluoroscopy . the guidewire was seen to exit into the pharynx on antegrade views where the wire was then grasped with a snare through the antegrade endoscope . transillumination from the antegrade endoscope in cases in which simultaneous antegrade and retrograde endoscopes were visualized to be separated by a distance longer than 3 cm , per - oral endoscopic tunneling ( poetre ) 8 was done for restoration of the esophagus . a submucosal bleb was created with injection of saline - indigo carmine and submucosal tunneling ( fig . 4 ) , which allowed the submucosal space to be entered with the anterograde endoscope . submucosal tunneling then proceeded caudally and was achieved with repeat injections and dissection with a t - type hybrid knife ( erbe ) . when close proximity of the two endoscopes was seen under fluoroscopy along with indentation from the approaching endoscope , the retrograde endoscope ( fig . 5 ) was advanced into the proximal esophagus , thereby creating a neo - esophageal lumen and restoring esophageal continuity . a guidewire was passed through the retrograde endoscope , caught by a snare from the anterograde endoscope and pulled through the oral cavity . finally , fully covered stents were deployed over the guidewire , which spanned the entire submucosal tunnel . the stents were removed in 4 to 6 weeks and serial endoscopic dilations were performed as needed to maintain esophageal patency ( fig . 6 a and fig retrograde endoscope visible on antegrade views after reconnecting the esophagus . fully covered stent across neo - esophageal lumen . technical success : procedural technical success was defined as the ability to successfully perform simultaneous antegrade and retrograde endoscopy with dilation and restoration of esophageal continuity . 0 = no dysphagia ; 1 = dysphagia to solids ; 2 = dysphagia to semisolids ; 3 = dysphagia to liquids ; 4 = patient unable to swallow saliva ( complete dysphagia / aphagia ) was used to quantify dysphagia prior to and after endoscopic treatment 9 . adverse events : endoscopic aes were assessed based on criteria previously established by the american society of gastrointestinal endoscopy ( asge ) 10 . the procedure was begun by using an antegrade endoscope to demonstrate a ceo at or distal to the esophageal inlet ( fig.1 ) . a retrograde endoscope was then inserted through a mature gastrostomy site and guided up the esophagus . the proximity of the two endoscopes was confirmed by use of multiplanar fluoroscopy ( fig . 2 ) and transillumination from the endoscope ( fig . 3 ) . in cases where the distance between the two endoscopes was measured to be less than 3 cm , a 19-gauge endoscopic ultrasound needle ( eus - n ) was used to puncture and traverse the obstruction under multiplanar fluoroscopy and simultaneous antegrade and retrograde endoscopic guidance . this allowed guide wire access to the distal esophagus , which permitted the tract to be balloon dilated . when antegrade passage of the guidewire was not successful , the guide wire was advanced through the retrograde endoscope and probed with antegrade endoscopic guidance under fluoroscopy . the guidewire was seen to exit into the pharynx on antegrade views where the wire was then grasped with a snare through the antegrade endoscope . transillumination from the antegrade endoscope in cases in which simultaneous antegrade and retrograde endoscopes were visualized to be separated by a distance longer than 3 cm , per - oral endoscopic tunneling ( poetre ) 8 was done for restoration of the esophagus . a submucosal bleb was created with injection of saline - indigo carmine and submucosal tunneling ( fig . 4 ) , which allowed the submucosal space to be entered with the anterograde endoscope . submucosal tunneling then proceeded caudally and was achieved with repeat injections and dissection with a t - type hybrid knife ( erbe ) . when close proximity of the two endoscopes was seen under fluoroscopy along with indentation from the approaching endoscope , the retrograde endoscope ( fig . 5 ) was advanced into the proximal esophagus , thereby creating a neo - esophageal lumen and restoring esophageal continuity . a guidewire was passed through the retrograde endoscope , caught by a snare from the anterograde endoscope and pulled through the oral cavity . finally , fully covered stents were deployed over the guidewire , which spanned the entire submucosal tunnel . the stents were removed in 4 to 6 weeks and serial endoscopic dilations were performed as needed to maintain esophageal patency ( fig . 6 a and fig retrograde endoscope visible on antegrade views after reconnecting the esophagus . fully covered stent across neo - esophageal lumen . a total of 6 patients ( 67 % male , 33 % female , mean age 71.6 years [ range 63 80 ] ) with ceo were treated with flexible endoscopic therapy . three patients had laryngeal cancer , 2 had pharyngeal cancer and 1 patient had a previous history of lung cancer . all of the patients had a history of chemoradiation therapy for their malignancy and also had g - tube placement prior to referral to our center . four patients underwent technically successful rendezvous procedures , with the average size of obstruction being 3 cm . two patients , whose obstructions measured 4 cm and 5 cm , respectively , underwent technically successful poetre . one endoscopic treatment session was performed per patient and all patients noted improvement in their dysphagia symptoms after therapy . the mean pre - procedure dysphagia score was 4 and fell to 1.33 ( range 0 all patients required repeat dilations to remain luminal patency ( mean 6.8 dilations [ range 4 15 ] ) . there were no aes and mean follow - up time was 17.3 months ( range 3 currently , 14 case series / analyses 5 7 11 12 13 14 15 16 17 18 19 20 21 22 ( table 2 ) consisting of 184 patients who underwent endoscopic treatment for ceo have been published . radiation - induced strictures were thought to be the etiology in the majority ( 94.6 % ) of the cases ( table 3 ) . technical success was seen in 174/184 ( 95 % ) , of which 172/184 ( 93 % ) were rendezvous procedures . among the cases that were termed unsuccessful 12 16 17 , longer length of the obstruction nk , needle knife ; gw , guidewire ; bd , balloon dilation ; bf , blunt forceps ; cf , cup forceps ; eus - n , endoscopic ultrasound needle ; sn , sclerotherapy needle ; card , combined anterograde and retrograde dilation ; poetre , peroral endoscopic tunneling for restoration of the esophagus ; ga , general anesthesia ; mac , monitored anesthesia care ; cs , conscious sedation ; ae , adverse events ; f / u , follow up ; na , not available in terms of outcomes , considerable heterogeneity exists in defining clinical success given the subjective nature of reported results and retrospective analysis . in studies where dysphagia scores were used , or interpretable from the collected data , the average pretreatment and posttreatment dysphagia score was 4 and 2.26 , respectively . where clinical success was reported , 113/139 ( 81 % ) patients showed symptomatic improvement . however , given the lack of standardization , there remain differences in how complications are reported and designated . of the 184 reported patients who underwent endoscopic therapy for ceo , 36 ( 19.5 % ) were reported to have an ae ( table 4 ) , the most common being micro - perforation , which occurred in 36 % ( 13/36 ) of the cases . most of these aes were documented by various radiographic studies and the patients had inconsequential clinical outcomes and were treated conservatively without antibiotics . the next most common ae was malfunction of the g - tube which included loss of g - tube site , tract and subsequent leak following the procedure . all of these aes were likely to have occurred due to manipulation of the g - tube site during the procedure and were easily and successfully revised . patient mortality was infrequent , occurring in only one case , reportedly 19 23 due to a venous air embolism . with recent advances in flexible endoscopy , several methods have been described for treating ceo , including antegrade , retrograde , and combined antegrade - retrograde endoscopic dilation with technical variations . in this article , we describe our experience along with other reported techniques and outcomes . as such , to date , good outcomes have been described in 190 patients , including those in our series . because of the retrospective nature of the cases reported , some heterogeneity exists in preoperative and intraoperative techniques and postoperative care of these patients . these tests help to identify the presence , level , and extent of the esophageal obstruction as factors such as location and length have been shown to be predictors of technical success 17 . in the largest single - center study of ceo reported , goguen et al demonstrated that failure was most likely in cases involving larger obstructions and stenosis located in the region of the larynx or pharynx . in addition , if patients were to be considered for retrograde or combined antegrade - retrograde endoscopic dilation therapy , a mature gastrostomy tract would be preferred , as manipulation of immature tracts in individuals who are malnourished or immunocompromised reportedly leads to higher rates of peritonitis 24 . one advantage of flexible endoscopic therapy for ceo is the ability to perform the procedure without general anesthesia , thus allowing patients who are not optimal candidates for endotracheal intubation to undergo both moderate sedation ( conscious sedation / cs ) or deep sedation / monitored anesthesia care ( mac ) . these modes of anesthesia have been reported to be safe except when submucosal tunneling was performed 12 15 16 22 and general anesthesia was used . nevertheless , general anesthesia is still the most frequently reported form that has been used ( table 2 ) . several methods described for endoscopic lumen restoration in ceo have been shown to be both effective and safe including antegrade , retrograde , combined antegrade - retrograde endoscopic dilation and the most recently described submucosal tunneling techniques . single endoscopic antegrade dilations are however , difficult to achieve due to a frequently encountered fibrous membrane or longer segment of complete obstruction obliterating the view of the esophageal lumen . any attempt at puncture for traversing the obstruction may lead to perforation or inadvertent injury to surrounding critical structures in the neck and chest . nonetheless a novel approach was recently described using a eus - guided puncture 25 . in this technique , the echoendoscope is placed on the proximal end of the obstruction . visualization of the distal end of the ceo was obtained through eus images . in conjunction with fluoroscopy , an eus needle was used to puncture the obstruction , guidewire was passed through the needle , and subsequent dilations were performed to restore luminal patency . this technique is particularly useful in patients without a preexisting gastrostomy tract . a retrograde approach to esophageal dilation , in which a swallowed string was used as a guide for bougie dilation , first was described in 1924 4 . since then , technical approaches to this method for ceo have typically described introduction through a gastrostomy tube site of a thin - diameter endoscope . this was followed by intubation of the esophagus with the endoscope and advancement of a guidewire to traverse the obstruction and feed it into the oral cavity . in which the guidewire could not be passed , successive retrograde balloon dilations have been described 15 . combined antegrade - retrograde endoscopic dilation for ceo utilizes a collaborative approach between two endoscopists to meet at both the superior and inferior edges of the obstruction . earlier reports described the procedure using a rigid esophagoscope via the mouth and a flexible endoscope via the g - tube tract . both tactile and transilluminating impressions seen by the opposing endoscope allow for precise and safe passage of the guidewire through the obstruction . in addition , multiplanar fluoroscopic guidance helps determine the length of the obstruction and alignment of the dual endoscope . good success also has been documented with the needle knife 13 22 , biopsy forceps 19 , cup forceps 17 , eus - n 13 18 and balloon dilators 15 19 . once luminal patency is achieved , a guidewire is usually passed through the mouth or g - tube site followed by balloon dilation over the wire . a nasogastric tube can be inserted to ensure access to the stricture for the next dilation within 24 is then removed and further serial dilations resumed , as needed , over subsequent few weeks . in the past , to maintain luminal patency over the following few months , some investigators have passed a loop of string through the nostril , which traverses the neo - esophagus , exits the g - tube tract , and is taped to the patient s abdomen . that , however , is cumbersome and associated with some patient discomfort because the string through the nose is present for a few months . as an alternative , when technically feasible , we have used a fully covered esophageal stent to maintain luminal patency after creation of the neo - esophagus . a limitation of the standard dual endoscope antegrade and retrograde endoscopy procedure that has been well documented has been its poor procedural success in obstructions longer than 3 cm 12 16 22 . the crux of this issue lies in the feasibility of having two endoscopes approach each other and align in close proximity , as determined by multiplanar fluoroscopy and visible transillumination . until recently , when patients were determined not to be candidates for endoscopic lumen restoration based on longer lengths of obstructed esophagus , they were referred for surgery , which often is not feasible in individuals with multiple comorbidities and a prior history of surgery and irradiation to this area . however , we have recently circumvented this problem by describing a unique approach , poetre , which borrows from an application used during peroral endoscopic myotomy ( poem ) . poetre and similar techniques have been described in the literature in limited case reports 8 26 27 with good success . with poetre , a neo - esophagus can be created through submucosal tunneling into obstructions previously felt to be too long for standard rendezvous procedures . typically , patients undergoing procedures other than poetre were discharged or admitted for overnight observation with slow progression of their diet . repeat endoscopic dilation within 24 to 48 hours was performed to ensure there was no restenosis . post - procedural imaging or antibiotics were usually not necessary in the absence of symptoms . after poetre , peri - procedural antibiotics were given at our center for at least 5 days . patients were typically started on a liquid diet the following day and discharged within 48 to 72 hours . nearly all of the procedures described for ceo have had a good technical success rate and clinical outcome . however , a limitation of such studies is the uncontrolled nature of how cases were described . for instance , one objective measure that can be used is reporting a dysphagia score 8 19 . such a score provides an objective measurement of outcome and is routinely used at our center and in this study as well . clinical success was typically displayed in most reports , with a cumulative rate of 78 % ( range 0 % -100 % ) . this wide range of outcomes can be explained by the lack of homogenous patient populations , subjective reporting , and diversity in intra - procedural technical approaches . furthermore , it is important to note that influences on clinical success are not inherently dependent on restoring luminal patency . previously sustained damage of muscles and nerves involved in deglutition from radiation are a likely explanation for lack of symptomatic improvement despite successful reconnection of the obstructed esophagus 28 . indeed , studies have shown that establishment of esophageal continuity is not the only requirement for regaining the swallowing function ; it is likely a multifactorial process . to that end , more recent studies have aimed to determine predictors of functional outcome versus just technical success 22 . at our institution , as at other centers that have previously published series , we did not encounter any procedural aes . however , as mentioned earlier , accurate reporting of aes is likely best achieved in prospective studies using objective predetermined criteria as suggested by the asge 10 . combined antegrade and retrograde endoscopic therapy appears to be a safe and efficacious minimally invasive option for treatment of ceo . various endoscopic techniques and novel accessories have been used via this route to reconnect the obstructed esophagus , including our recent description of poetre using submucosal tunneling .
bone marrow transplantation ( bmt ) from an hla - matched related donor is the treatment of choice for children and young adults with severe aplastic anemia ( saa ) . patients without an appropriate sibling donor usually receive immuno - suppressive therapy , and those who fail it , undergo bmt from an hla - matched unrelated donor . umbilical cord blood transplantation ( ucbt ) has become an alternative option in various diseases since the first transplantation to treat a patient with fanconi anemia was successful in 1988 ( 1 ) . however , unrelated donor ucbt has not yet been recommended for saa patients due to the high risk of graft failure and complications ( 2 ) . here we report the case of a girl who successfully underwent two - unit ucbt after engraftment failure with a single unit . a 3-yr - old girl , whose blood type was a+ , was admitted to our hospital for easy bruisibility . her initial peripheral blood cell count showed 3.2810/l white blood cell ( wbc ) with 2% neutrophils , 96% lymphocytes , 1% monocyte and 1% eosinophil , 7.0 g / dl hemoglobin with 19.2% hematocrit , 0.8% reticulocyte and 510/l platelet . a bone marrow study revealed hypocellular marrow ( 10% to 20% cellularity ) with a marked decrease of normal hematopoietic cells . as the patient had no siblings , she underwent immunosuppressive therapy with anti - lymphocyte globulin and cyclosporine a for six months without response . then she received oxymetholone and prednisolone for three years with intermittent transfusions of more than 30 units of packed red blood cell ( rbc ) and 30 units of plateletpheresis . however , oxymetholone was stopped because she developed a hepatic adenoma . at seven years of age , a single - unit ucbt from an ab+ male donor was performed with 5/6 hla - matched unit , which contained 2.0610/kg nucleated cells with 0.6410/kg cd34 cells ( table 1 ) . the conditioning regimen was composed of fludarabine ( 180 mg / m ) , busulfan ( 6.4 mg / kg ) , anti - thymocyte globulin ( 10 mg / kg ) and total lymphoid irradiation ( 2 gy ) . graft - versus - host disease ( gvhd ) prophylaxis was done with cyclosporine a and methylprednisolone . two units of cord blood were infused after conditioning with fludarabine ( 180 mg / m ) , busulfan ( 6.4 mg / kg ) and total body irradiation ( 4 gy ) . other supportive care was performed according to the guidelines for stem cell transplantation at our center ( 3 , 4 ) . the engraftment was achieved with 6/6 hla - matched unit containing 2.2710/kg nucleated cells and 0.5710/kg cd34 cells . but the other 5/6 hla - matched unit containing 2.2110/kg nucleated cells with 1.1510/kg cd34 cells disappeared ( table 1 ) . the engrafted unit came from an a+ male donor , while the other was from a b+ male . the number of days required to reach an absolute neutrophil count more than 0.510/l and 1.010/l was 18 days and 22 days , respectively . spontaneous platelet recovery to more than 2010/l and 5010/l required 112 and 123 days , respectively . complete donor chimerism was confirmed through the analysis of short tandem repeat regions and fluorescence in situ hybridization ( fish ) of xy chromosome ( table 2 ) . hepatic adenoma has been routinely followed up with abdomen sonography and -fetoprotein without interval change . up to two years and seven months after the two - unit ucbt , complete donor chimerism has been maintained with a normal blood cell count . since the first successful ucbt to treat a patient with fanconi anemia in 1988 ( 1 ) , ucbt has become an alternative option to treat a number of malignant or nonmalignant hematologic diseases . wagner et al . ( 5 ) demonstrate the importance of graft cd34 cell dose in determining the outcome after unrelated donor ucbt . to augment infused cell dose , ex vivo expansion of hematopoietic stem cells and transplantation of multiple umbilical cord blood units has been attempted . in some studies , two - unit ucbt is proposed to have better engraftment potential and to offer a better chance of survival than single unit ucbt ( 4 , 6 ) . recently , there was a report of a successful second transplantation with two unrelated cord blood units for early graft failure after first hematopoietic stem cell transplantation ( 7 ) . the mechanisms of these additional advantages of two - unit ucbt are not fully understood . increase of the cell dose could be a contributing factor , and graft - versus - graft reaction between two units also could be another factor . in previous reports on two - unit ucbt , results showed the dominancy of one unit in most of the cases . the mechanism of determining the dominancy is not known yet , but the number of cd3 cells and degree of hla mismatch has been reported as related factors ( 4 , 6 ) . in our case , the patient underwent a successful two - unit ucbt after engraftment failure with a single - unit ucbt . with this promising result , two - unit ucbt could be an alternative treatment option in saa patients without an hla - matched donor . also , further investigation about the mechanism of engraftment in two - unit ucbt may extend the field of stem cell transplantation .
ocular symptoms in behet s disease ( bd ) begin mostly before 30 years of age according to international surveys , and bd activity may decrease with age . anti - tnf antibody has recently demonstrated strong effects against recurrent uveitis in bd , but the efficacy and safety of anti - tnf therapy in elderly patients remain unclear . we report herein the case of an elderly patient with long - standing uveitis due to bd who was successfully treated with two types of anti - tnf therapy . an 81-year - old japanese man presented with a 33-year history of ocular inflammation due to bd . as immunosuppressive agents , such as cyclosporine a , were difficult to use because he had undergone removal of the left kidney due to cancer , he was treated with colchicine . after colchicine had been changed to infliximab , ocular inflammation was fairly well controlled , but ocular attacks still occurred once or twice a year . as soon as intestinal hemorrhage related to bd occurred , infliximab was switched to adalimumab . this represents the first report of the application of two types of anti - tnf therapy for ocular attacks in an elderly bd patient . in addition to infliximab , adalimumab appears to offer an alternative therapy for refractory , long - standing bd - related uveitis in elderly patients . behet s disease ( bd ) is a systemic inflammatory disease characterized by recurrent ocular inflammation , oral and mucosal ulcers and skin lesions , and other manifestations in multiple organ systems . colchicine , cyclosporine , corticosteroids , azathioprine , and other immunosuppressive agents are used to treat attacks of ocular inflammation in bd.1 ocular inflammatory attacks in bd have been reported to begin before 30 years of age according to international surveys.2 one reason may be that bd activity decreases with patient age , and little information is available regarding the treatment of elderly bd patients . as recent treatments for bd , infliximab , a chimeric human murine monoclonal tnf antibody , however , infliximab requires intravenous infusion , and infusion reactions represent a known adverse effect . adalimumab is another tnf blocker , representing a fully human monoclonal anti - tnf antibody that can be self - administered subcutaneously . while adalimumab is currently used for ankylosing spondylitis , crohn s disease , juvenile idiopathic arthritis , plaque psoriasis , psoriatic arthritis , rheumatoid arthritis , and ulcerative colitis , this agent has not been used for ocular inflammation as an approved drug . reports have established adalimumab as an efficacious and safe treatment in patients with crohn s disease , rheumatoid arthritis , and psoriasis.35 however , whether these anti - tnf therapies are effective and safe for elderly bd patients with ocular inflammation remains unclear . we report herein the case of an elderly patient with a 33-year history of bd in whom disease control with standard treatments was proving difficult , but ocular inflammation was completely suppressed after switching to infliximab and adalimumab . the patient provided written informed consent for the publication of their data and accompanying images . an 81-year - old japanese man was diagnosed with bd in 1981 on the basis of recurrent oral and genital ulcers , erythema nodosum , and uveitis , meeting the classification criteria for bd established by the japanese ministry of health and welfare.6 he lost eyesight in his left eye in 1992 , due to recurrent uveitis . he was referred to our hospital in 2007 with recurrent attacks of inflammation affecting the right eye . he had been treated with betamethasone eyedrops , but had never been treated with colchicine or cyclosporine a before the first visit to our hospital . as for initial ophthalmic presentation at our hospital , visual acuity in the right eye was at the level of recognizing hand motion , and keratic precipitate , anterior chamber cells ( + + ) , flare ( + + ) , and grade 3 vitreous haze were identified . the patient was initially treated with colchicine and betamethasone eyedrops , but attacks of ocular inflammation persisted , occurring six times in 8 months ( equivalent to nine times / year ) . immunosuppressive agents , such as cyclosporine a , were difficult to use because he had undergone removal of the left kidney due to cancer in 1998 . in may 2008 , administration of infliximab was started at a dose of 5 mg / kg , followed by a regular treatment schedule ( initially in weeks 2 and 6 , then every 8 weeks ) . this treatment reduced the frequency of ocular inflammatory attacks to seven times in 60 months ( 1.4 times / year ) . right visual acuity improved to 1.0 . however , the patient experienced exanthema after the ninth infusion of infliximab in may 2009 ( 54 weeks after starting infliximab treatment ) . that episode was considered to represent an infusion reaction to infliximab , so 5 mg of d - chlorpheniramine maleate and 20 mg of epinastine hydrochloride were administered before each infusion of infliximab thereafter . the frequency of ocular attacks increased from december 2011 ( 3 years and 7 months after starting infliximab treatment ) , and oral ulcers and abdominal pain occurred in the same period . after 4 years and 8 months , intestinal lesions with bleeding were identified , and infliximab was judged inadequate to control intestinal lesions . adalimumab was thus considered as an alternative treatment , and started as a substitute for infliximab . adalimumab was administered at a dose of 80 mg the first time , with 40 mg administered every 2 weeks thereafter . after switching to adalimumab , uveitis was well controlled , right visual acuity remained at 1.0 , and ocular inflammatory attacks did not occur during 2 years of follow - up ( figure 1 ) . vitreous haze in the right eye had disappeared with the use of infliximab , and did not reappear after switching to adalimumab . fluorescein angiography examination showed leakage from retinal vessels at the first examination , but this leakage was dramatically improved by infliximab , and the improvement was maintained on adalimumab ( figure 2 ) . research into the application of anti - tnf to certain diseases , such as rheumatoid arthritis and bowel disease , has reported that elderly patients receiving anti - tnf show slightly dampened responses compared with younger patients , although once an initial response is achieved , long - term outcomes are similar . in terms of the risk of anti - tnf , elderly patients receiving anti - tnf present with an increased risk of adverse events , such as serious and opportunistic infections , compared with younger patients . such risk varies according to the type of adverse event when elderly patients receive other treatments . comorbidities , such as cardiovascular disease , are an important element to consider in elderly patients.7,8 in elderly bd patients , the efficacy and safety of anti - tnf have remained unclear because of the lack of published data . one reason for this lack may involve a proposed self - limiting mechanism of ocular attacks with increasing age in bd , and anti - tnf agents have thus remained largely unnecessary for elderly bd patients . we encountered a rare case of bd in which the patient continued suffering from frequent ocular uveitis attacks even in older age , and administration of anti - tnf therapy proved useful . in the present case , changing from colchicine to infliximab was obviously successful , because the frequency of ocular attacks fell from nine times a year to once or twice a year . after starting infliximab , visual acuity gradually improved . infliximab had achieved good control of the uveitis , but the frequency of ocular attacks increased after 3 years and 7 months ( in december 2011 ) . treatment with infliximab can result in immunogenicity and the formation of human antichimeric antibodies ( hacas ) , which act as antibodies to infliximab . the appearance of hacas has been found in more than half of patients who have received infliximab.9 the formation of hacas was the most likely reason for the increase in ocular attacks in this case . infliximab was used for 4 years and 8 months , and the course suggests the development of hacas , resulting in inflammation of the intestinal tract . changing to another anti - tnf agent proved effective , and was considered a good alternative . from a pharmacokinetic perspective , subcutaneous administration of adalimumab leads to more uniform serum concentrations at a steady state , whereas intravenous administration of infliximab leads to higher peak and lower trough levels . however , the effectiveness and safety outcomes are reportedly comparable between intravenous and subcutaneous administration of anti - tnf agents.10 in this case , after a switch from infliximab to adalimumab , ocular and intestinal symptoms were not encountered for more than 2 years , and no adverse effects have been seen . adalimumab was obviously able to prevent long - standing recurrent ocular inflammation in this elderly patient . investigations into noninfectious uveitis have shown the mean time to discontinuation of infliximab secondary following development of rash was 39.8 weeks , and the mean time to elevated liver function test results was 54 weeks . differences in these durations by age have not been clarified.11 the patient developed exanthema after the ninth infusion of infliximab ( 54 weeks after starting infliximab ) , which was considered to represent an infusion reaction to infliximab and occurred after a longer - than - average duration . with the switch to adalimumab , no adverse effects , eg , infusion reactions , were encountered . as adalimumab represents a fully human monoclonal anti - tnf antibody , whereas infliximab is a chimeric human murine monoclonal antibody , the risk of infusion reactions may be reduced with adalimumab . data concerning the efficacy of adalimumab for bd - related uveitis in elderly patients are limited , although several reports have shown that adalimumab therapy for refractory noninfectious uveitis is useful for patients of susceptible ages,1216 and outcomes in terms of safety appear superior to those of infliximab.12 accumulation of long - term follow - up data from elderly patients with active bd is needed to evaluate the length of remission that can be achieved , but adalimumab appears to offer a feasible alternative treatment for bd - related uveitis in elderly patients . this case , with marked suppression of ocular inflammation using adalimumab without side effects in an elderly patient with long - standing bd , may provide good information for ophthalmologists .
although the hippocampus has not typically been identified as part of the neuronal circuit for language and aphasia , recent evidence suggests that the hippocampus is closely related to naming , word priming , and anomic aphasia . we present herein a case that presented with limbic encephalitis ( le ) , bilateral symmetric , discrete lesions within the hippocampus , as well as transient phonemic paraphasia , a combination that has not been reported previously . a 59-year old , previously healthy , right - handed woman developed high fever ( 39c ) and vomiting . five days later , she became somnolent and began to have generalized convulsions that brought her to our hospital . on the day of admission to our hospital , she was status epilepticus and in a deep coma . the cerebrospinal fluid ( csf ) examination carried out on the first day from admission showed an increased cell count ( 40/mm , mononuclear : polymorphonuclear = 35:5 , no malignant cells ) , increased total protein of 84 mg / dl , and normal glucose levels . the brain magnetic resonance imaging ( mri ) from the first day showed no apparent lesions ; and no contrast enhancement by gadolinium injection was seen . electroencephalogram ( eeg ) showed high amplitude slow delta waves ( 23hz ) diffusely . at that time , herpetic encephalitis was first suspected and the patient was started on intravenous 1500 mg / day acicrovir . on the 3rd day after admission she returned to normal consciousness . she had no muscle weakness or sensory disturbances , while she had mildly increased deep tendon reflexes in the lower extremities and a positive babinski sign bilaterally . in addition , we asked the patient to recall 10 small episodes ( by our observations [ antegrade , recent memory ] or by interviewed histories taken from the families [ retrograde ] ) , in order to quantify amnesia . as a result , she was revealed to have extreme retrograde ( unable to tell 100% of life histories that happened in the past 30 years ) and anterograde memory impairment ( unable to tell 100% of events that had happened in the last three minutes ) . on the 6th day after admission , the csf examination revealed a cell count of 41/mm ( all mononuclear cells ) and total protein of 23 mg / dl . at that time , antibodies against herpes simplex , herpes zoster viruses in the csf and the serum were negative . antibodies for anti - neuronal nuclear antibody ( anna)-1 ( anti - hu ) , anna-2 ( anti - ri ) , anna-3 , anti - glial nuclear antibody-1 , purkinje cell cytoplasmic antibody ( pca)-1 ( anti - yo ) , pca-2 , pca - tr , amphiphysin , collapsin response mediator protein-5 , neuronal voltage - gated k channel , striated muscle , muscle acetylcholine ( ach ) receptor , neuronal ganglionic ach receptor , p / q - type and n - type voltage - gated ca channel , and glutamate receptor 2 and 2 subunits were all negative . a whole - body ct scan including the ovary revealed no malignancy . she had repeated attacks of fear , hallucination ( both lasting hours ) , and short - duration seizures ( lasting minutes ) , but meanwhile she remained almost normal and was started on 5 mg intramuscular haloperidol , 300 mg / day oral phenytoin , and 90 mg / day phenobarbital . cognitive test results were as follows : mini - mental state examination ( msme ) score 16/30 ; wechsler memory scale revised version ( wmsr ) general score under 50 , verbal score 56 , visual score under 50 , attention score not performed ; frontal assessment battery ( fab ) score 14/18 . on the 18 day after admission , brain mri results revealed bilateral , symmetrical high signal lesions localized at the body to the infundibulum of the hippocampus , which slightly extended to the parahippocampal gyrus and the amygdala on diffusion - weighted images and fluid attenuated inversion recovery ( flair ) images . therefore , non - herpetic , autoimmune limbic encephalitis ( le ) became the tentative diagnosis . the patient was then started on 3 courses of 1,000 mg / day intravenous methylprednisolone for three days . after these treatments , her hallucination and seizures disappeared gradually , and she became able to eat meals , although her memory disturbances persisted . on the 31 t day after admission , eeg showed 6hz theta waves in the frontal lobe bilaterally , and no spikes were observed . on the 39 day , brain mri still revealed bilateral , symmetrical high signal lesions at the body to the infundibulum of the hippocampus , which slightly extended to the parahippocampal gyrus and the amygdala only by flair images ( figure 1 ) . on the 41 day , she began to show signs of transient fluent , phonemic paraphasia ; e.g. , omotai ( heavy ) > amatai , saba ( mackerel ) > sabako , jinja ( shrine ) > chinja , nebusoku ( sleepless ) > nobusoku , tsukatte morau ( let someone to use it ) > takette morau , passport > kasport . this phenomenon lasted for half a day and then disappeared , but was repeatedly observed by the co - medical staff for a week . we were not able to perform a detailed aphasia battery during a period of a week because of non - availability of a clinical psychologist . on the 44 day , eeg showed small sharp waves in the frontal , temporal , and parietal lobes bilaterally . after that , no seizures or phonemic paraphasia were observed , and her memory impairment was gradually ameliorated . on the 65 day , eeg showed a small amount of 6 hz theta waves , but no sharp waves were seen . we performed single - photon emission computed tomography ( spect ) scans one month and three months after admission , both of which showed normal findings ( on the 10 day , motion artifacts alone ) . six months after admission , she was discharged from hospital . at that time , she had moderate retrograde ( unable to tell 80% of life histories that happened in the past 20 years ) and anterograde memory ( unable to tell 10% of events that happened in the recent 60 minutes ) impairment . the cognitive test results were as follows : msme score 23/30 ; wmsr general score 66 , verbal score 70 , visual score 70 , attention score 82 ; fab score 17/18 . flair images of mri revealed amelioration of the bilateral high signal foci at the hippocampus , parahippocampal gyrus and the amygdala . figure 1brain magnetic resonance imaging of the patient . bilateral , symmetrical high signal lesions localized in the body to the infundibulum of the hippocampus , which slightly extended to the parahippocampal gyrus and the amygdala on fluid attenuated inversion recovery ( flair ) images . brain magnetic resonance imaging of the patient . bilateral , symmetrical high signal lesions localized in the body to the infundibulum of the hippocampus , which slightly extended to the parahippocampal gyrus and the amygdala on fluid attenuated inversion recovery ( flair ) images . the diagnosis of le in this case was based on : clinical features of acute onset of high fever , disturbance of consciousness , and epilepsy ; and after recovery of consciousness , severe memory impairment , fear , and hallucination ; the csf finding of pleocytosis and increased protein content ; bilateral symmetrical lesions in the hippocampus by an mri scan . our patient was unique in that she developed , during a course of le , transient phonemic paraphasia . the paraphasias appeared to be very transient , lasting for approximately half a day , observed for one week . the hippocampus has not typically been identified as part of the language and aphasia circuit . however , recent evidence suggests that the hippocampus is closely related to naming , word priming , and anomic aphasia . among these , urbach et al . have described the results of the wada test , in which sodium amytal and spect tracer tc- hexamethylpropyleneamine oxime ( hmpao ) were injected into the posterior cerebral artery , with 4 of the 14 injected subjects revealing transient ( lasting 13 min . ) paralyzed brain areas as shown by hmpao were the parahippocampal gyrus , the hippocampus , and the occipital lobe . similarly , jernigan et al . performed mri volumetry in normal volunteers and found that the hippocampal volume contributed independently to increased naming latency and decreased word priming by a speech test . these findings might be a reflection of anatomical evidence that the hippocampus has fiber connections with the wernicke 's area . another factor related to the transient phonemic paraphasia in our patient was the focal epilepsy . this is because our patient had seizures twice at the end of a one - week episode of phonemic paraphasia . eeg in our patient at the times of transient paraphasia also showed small sharp waves in the frontal , temporal , and parietal lobes bilaterally . although partial status epilepticus can present with multiple , discrete mri lesions in the brain , mri lesions in our patient were localized at the body to the infundibulum of the hippocampus . previously , aphasic status epilepticus has been recognized in complex partial seizures ( temporal lobe epilepsy ) . dong et al . reported 4 aphasic patients in whom this condition lasted from two days to three months . in those patients , mri findings were normal ; but focal slow waves by an electroencephalography and focal hypermetabolism by f - fluo - rodeoxyglucose ( fdg)- positron emission tomography ( pet ) were shown in the temporal lobe . taken these findings into account , the transient phonemic paraphasia noted in our patient may have been a result of primary damage in the hippocampus and its fiber connection to the wernicke 's area or secondary partial status epilepticus that might have originated in the hippocampus and the temporal lateral cortex . in conclusion , we have reported a 59-year old woman with limbic encephalitis of possible autoimmune etiology and bilateral symmetric , discrete lesions in the hippocampus based on an mri scan . the transient phonemic paraphasia noted in our patient may have been a result of primary damage in the hippocampus and its fiber connection to the wernicke 's area or secondary partial status epilepticus that might have originated in the hippocampus and the temporal lateral cortex .
national health and wellness survey ( nhws ; n = 75,000 ) , an annual , cross - sectional study of the u.s . adult ( aged 18 years ) population . a stratified random sample ( with strata by gender , age , and ethnicity ) was implemented to ensure that the demographic composition of the sample was aligned to that of the corresponding adult population as measured by the u.s . the sample for analyses included respondents who self - reported a diagnosis of t2 dm . once they self - reported having t2 dm , additional indicators were further examined to confirm type of diabetes , including age at diagnosis , time since diagnosis and start of insulin , type of oral medication use , and body mass index ( bmi ) . other national studies , such as national health and nutrition evaluation survey ( nhanes ) , use a similar approach to confirm type of diabetes . the current nhws sample used in this analysis participants were categorized into mental well - being categories using the mcs from the medical outcomes study 36-item short form survey instrument version 2 ( sf-36v2 ) . this is achieved by transforming the raw scores for the items to a mean of 50 and a standard deviation ( sd ) of 10 . the mcs scores were categorized on the basis of the mean and sd of the general population and distribution of the mcs score within the analytic sample . final categories were as follows : good mental well - being ( above the population mean ; mcs 50 ) , poor mental well - being ( 1 sd below the population mean ; 40 mcs < 50 ) , and very poor mental well - being ( > 1 sd below the population mean ; mcs < 40 ) . consideration was given to defining the cutoff between poor and very poor mental well - being using a score of 35 , which is a more traditional cutoff indicative of depression . however , a cutoff of 40 was a more conservative approach and yielded a more even distribution across categories . sensitivity analyses were subsequently conducted using the more liberal cut - off of 35 and did not demonstrate substantial change in the results . in addition , the defined mental well - being categories were further supported by their statistical association with other mental health indicators ( eg , depression diagnosis or generalized anxiety disorder diagnosis ) . those with very poor mental well - being reported more depression and anxiety diagnoses and prescription history than those with poor or good mental well - being . those with poor mental well - being reported more depression and anxiety diagnoses and prescription history than those with good mental well - being ( see table 1 in appendix , supplemental digital content 1 ) . the following demographic variables were examined for differences between mental well - being categories : age , gender , race / ethnicity , education , and household income . the following health characteristics were also examined : bmi , smoking status , and comorbidity burden , measured via the charlson comorbidity index ( cci ) . in addition , diabetes - related characteristics were examined : history of hypoglycemia , diabetes - related complications , years since diagnosis , and current treatment . resource use : health care resource was measured for all respondents in the analytic sample for the past 6 months and included number of health care provider ( hcp ) visits , number of emergency room ( er ) visits , and number of hospitalizations . labor force participation and work productivity loss : labor force participation ( employed full time , employed part - time , or self - employed ) was examined via a single item . work productivity loss and activity impairment were measured using the work productivity and activity impairment - general health questionnaire ( wpai - gh ) . the wpai measures the percentage work loss due to absenteeism ( time missed from work ) , presenteeism ( lost productivity while at work ) , and overall work impairment ( absenteeism and presenteeism ) for those respondents currently in the labor force . it also measures the percentage of activity impairment for all respondents in the analytic sample . demographics , health characteristics , and outcomes differences were examined for the three mental well - being groups . for continuous variables , means and sds were reported and one - way analysis of variances ( anovas ) were used to determine statistical significance . for categorical variables , frequencies and percentages were reported and chi - square tests were used to determine statistical significance . following initial comparisons , generalized linear models ( glms ) were used , which test whether the adjusted ( accounting for covariates ) relative counts of the outcomes differ among well - being groups . all analyses were carried out using spss version 20 ( spss inc . , chicago , il ) . national health and wellness survey ( nhws ; n = 75,000 ) , an annual , cross - sectional study of the u.s . adult ( aged 18 years ) population . a stratified random sample ( with strata by gender , age , and ethnicity ) was implemented to ensure that the demographic composition of the sample was aligned to that of the corresponding adult population as measured by the u.s . the sample for analyses included respondents who self - reported a diagnosis of t2 dm . once they self - reported having t2 dm , additional indicators were further examined to confirm type of diabetes , including age at diagnosis , time since diagnosis and start of insulin , type of oral medication use , and body mass index ( bmi ) . other national studies , such as national health and nutrition evaluation survey ( nhanes ) , use a similar approach to confirm type of diabetes . the current nhws sample used in this analysis national health and wellness survey ( nhws ; n = 75,000 ) , an annual , cross - sectional study of the u.s . adult ( aged 18 years ) population . a stratified random sample ( with strata by gender , age , and ethnicity ) was implemented to ensure that the demographic composition of the sample was aligned to that of the corresponding adult population as measured by the u.s . the sample for analyses included respondents who self - reported a diagnosis of t2 dm . once they self - reported having t2 dm , additional indicators were further examined to confirm type of diabetes , including age at diagnosis , time since diagnosis and start of insulin , type of oral medication use , and body mass index ( bmi ) . other national studies , such as national health and nutrition evaluation survey ( nhanes ) , use a similar approach to confirm type of diabetes . participants were categorized into mental well - being categories using the mcs from the medical outcomes study 36-item short form survey instrument version 2 ( sf-36v2 ) . this is achieved by transforming the raw scores for the items to a mean of 50 and a standard deviation ( sd ) of 10 . the mcs scores were categorized on the basis of the mean and sd of the general population and distribution of the mcs score within the analytic sample . final categories were as follows : good mental well - being ( above the population mean ; mcs 50 ) , poor mental well - being ( 1 sd below the population mean ; 40 mcs < 50 ) , and very poor mental well - being ( > 1 sd below the population mean ; mcs < 40 ) . consideration was given to defining the cutoff between poor and very poor mental well - being using a score of 35 , which is a more traditional cutoff indicative of depression . however , a cutoff of 40 was a more conservative approach and yielded a more even distribution across categories . sensitivity analyses were subsequently conducted using the more liberal cut - off of 35 and did not demonstrate substantial change in the results . in addition , the defined mental well - being categories were further supported by their statistical association with other mental health indicators ( eg , depression diagnosis or generalized anxiety disorder diagnosis ) . those with very poor mental well - being reported more depression and anxiety diagnoses and prescription history than those with poor or good mental well - being . those with poor mental well - being reported more depression and anxiety diagnoses and prescription history than those with good mental well - being ( see table 1 in appendix , supplemental digital content 1 ) . the following demographic variables were examined for differences between mental well - being categories : age , gender , race / ethnicity , education , and household income . the following health characteristics were also examined : bmi , smoking status , and comorbidity burden , measured via the charlson comorbidity index ( cci ) . in addition , diabetes - related characteristics were examined : history of hypoglycemia , diabetes - related complications , years since diagnosis , and current treatment . resource use : health care resource was measured for all respondents in the analytic sample for the past 6 months and included number of health care provider ( hcp ) visits , number of emergency room ( er ) visits , and number of hospitalizations . labor force participation and work productivity loss : labor force participation ( employed full time , employed part - time , or self - employed ) was examined via a single item . work productivity loss and activity impairment were measured using the work productivity and activity impairment - general health questionnaire ( wpai - gh ) . the wpai measures the percentage work loss due to absenteeism ( time missed from work ) , presenteeism ( lost productivity while at work ) , and overall work impairment ( absenteeism and presenteeism ) for those respondents currently in the labor force . it also measures the percentage of activity impairment for all respondents in the analytic sample . participants were categorized into mental well - being categories using the mcs from the medical outcomes study 36-item short form survey instrument version 2 ( sf-36v2 ) . this is achieved by transforming the raw scores for the items to a mean of 50 and a standard deviation ( sd ) of 10 . the mcs scores were categorized on the basis of the mean and sd of the general population and distribution of the mcs score within the analytic sample . final categories were as follows : good mental well - being ( above the population mean ; mcs 50 ) , poor mental well - being ( 1 sd below the population mean ; 40 mcs < 50 ) , and very poor mental well - being ( > 1 sd below the population mean ; mcs < 40 ) . consideration was given to defining the cutoff between poor and very poor mental well - being using a score of 35 , which is a more traditional cutoff indicative of depression . however , a cutoff of 40 was a more conservative approach and yielded a more even distribution across categories . sensitivity analyses were subsequently conducted using the more liberal cut - off of 35 and did not demonstrate substantial change in the results . in addition , the defined mental well - being categories were further supported by their statistical association with other mental health indicators ( eg , depression diagnosis or generalized anxiety disorder diagnosis ) . those with very poor mental well - being reported more depression and anxiety diagnoses and prescription history than those with poor or good mental well - being . those with poor mental well - being reported more depression and anxiety diagnoses and prescription history than those with good mental well - being ( see table 1 in appendix , supplemental digital content 1 ) . the following demographic variables were examined for differences between mental well - being categories : age , gender , race / ethnicity , education , and household income . the following health characteristics were also examined : bmi , smoking status , and comorbidity burden , measured via the charlson comorbidity index ( cci ) . in addition , diabetes - related characteristics were examined : history of hypoglycemia , diabetes - related complications , years since diagnosis , and current treatment . resource use : health care resource was measured for all respondents in the analytic sample for the past 6 months and included number of health care provider ( hcp ) visits , number of emergency room ( er ) visits , and number of hospitalizations . labor force participation and work productivity loss : labor force participation ( employed full time , employed part - time , or self - employed ) was examined via a single item . work productivity loss and activity impairment were measured using the work productivity and activity impairment - general health questionnaire ( wpai - gh ) . the wpai measures the percentage work loss due to absenteeism ( time missed from work ) , presenteeism ( lost productivity while at work ) , and overall work impairment ( absenteeism and presenteeism ) for those respondents currently in the labor force . it also measures the percentage of activity impairment for all respondents in the analytic sample . demographics , health characteristics , and outcomes differences were examined for the three mental well - being groups . for continuous variables , means and sds were reported and one - way analysis of variances ( anovas ) were used to determine statistical significance . for categorical variables , frequencies and percentages were reported and chi - square tests were used to determine statistical significance . following initial comparisons , generalized linear models ( glms ) were used , which test whether the adjusted ( accounting for covariates ) relative counts of the outcomes differ among well - being groups . all analyses were carried out using spss version 20 ( spss inc . , chicago , il ) . the analytic sample consisted of 7852 respondents diagnosed with t2 dm . of these , 22% ( n = 1701 ) experienced very poor mental well - being , 23% ( n = 1781 ) poor mental well - being , and 56% ( n = 4370 ) good mental well - being . patients with very poor and poor mental well - being were more likely to be younger , female , hispanic or other ethnicity , less educated , and had lower household income than those with good mental well - being . in addition , those with very poor mental well - being were more likely to be younger , hispanic or other ethnicity , less educated , and had lower income than those with poor mental well - being ( see table 1 ) . generally patients with very poor mental well - being had unhealthier health characteristics and more comorbidity burden than those with poor mental well - being and good mental well - being . those with poor mental well - being had unhealthier health characteristics and more comorbidity burden than those with good mental well - being . specifically , patients with very poor mental well - being were more likely to be morbidly obese , more likely to smoke , and had higher cci scores than those with poor mental well - being and good mental well - being . in addition , those with poor mental well - being were more likely to be morbidly obese , current smokers , and had higher comorbidity burden than those with good mental well - being ( see table 1 ) . a similar relationship was observed for diabetes - related complications and treatment . patients with very poor mental well - being were more likely to experience diabetes - related complications and to be treated with a combination of insulin and noninsulins than those with poor or good mental well - being . among patients with very poor or poor mental well - being , there was a greater likelihood of experiencing hypoglycemia and diabetes - related complications as well as to be treated with a combination of insulin and noninsulin(s ) than among those with good mental well - being ( see table 1 ) . overall , patients with very poor mental well - being reported greater health care resource use than those with poor and good mental well - being as indicated by a greater number of doctor visits , er visits , and hospitalizations in the past 6 months . also , those with poor mental well - being reported higher resource use than those with good mental well - being ( see table 2 ) . these results held after controlling for covariates for resource use ( covariates included age , gender , ethnicity , income , education , smoking status , bmi , cci , years since diagnosis , diabetes - related complications , hypoglycemia status , and current treatment . ) those with very poor mental well - being reported more resource use than those with good well - being and more hcp and er visits than those with poor mental well - being . those with poor mental well - being reported more resource use than those with good mental well - being ( see table 3 ; individual regression tables located in appendix : doctor visits see tables 6a and 6b , er visits see tables 7a and 7b , and hospitalizations see tables 8a and 8b , supplemental digital content 1 ) . for the whole sample , activity impairment was measured . those with very poor and poor mental well - being had higher activity impairment than those with good mental well - being . those with poor mental well - being had greater activity impairment than those with good mental well - being ( see table 2 ) . presenteeism , absenteeism , and overall work impairment were asked only of those participating in the labor force . overall , approximately one - third of patients with t2 dm were participating in the labor force . patients with very poor mental well - being were less likely to participate in the labor force than those with poor mental well - being and good mental well - being . in addition , those with poor mental well - being were more likely to participate in the work force than those with good mental well - being ( see table 2 ) . those with very poor mental well - being had higher presenteeism , absenteeism , and overall work impairment than those with poor and good mental well - being . likewise , those with poor mental well - being had higher presenteeism , absenteeism , and overall work impairment than those with good mental well - being . controlling for potential confounders , the findings were consistent with the unadjusted comparisons ( covariates included age , gender , ethnicity , income , education , smoking status , bmi , cci , years since diagnosis , diabetes related complications , hypoglycemia status , and current treatment . ) those with very poor mental well - being reported more work and activity impairment than those with poor and good mental well - being . similarly , those with poor mental well - being reported more activity and work impairment than those with good mental well - being ( see table 3 ; individual regression tables located in appendix : absenteeism see tables 2a and 2b , presenteeism- see tables 3a and 3b , overall work impairment see tables 4a and 4b , and activity impairment see tables 5a and 5b , supplemental digital content 1 ) . the analytic sample consisted of 7852 respondents diagnosed with t2 dm . of these , 22% ( n = 1701 ) experienced very poor mental well - being , 23% ( n = 1781 ) poor mental well - being , and 56% ( n = 4370 ) good mental well - being . patients with very poor and poor mental well - being were more likely to be younger , female , hispanic or other ethnicity , less educated , and had lower household income than those with good mental well - being . in addition , those with very poor mental well - being were more likely to be younger , hispanic or other ethnicity , less educated , and had lower income than those with poor mental well - being ( see table 1 ) . generally patients with very poor mental well - being had unhealthier health characteristics and more comorbidity burden than those with poor mental well - being and good mental well - being . those with poor mental well - being had unhealthier health characteristics and more comorbidity burden than those with good mental well - being . specifically , patients with very poor mental well - being were more likely to be morbidly obese , more likely to smoke , and had higher cci scores than those with poor mental well - being and good mental well - being . in addition , those with poor mental well - being were more likely to be morbidly obese , current smokers , and had higher comorbidity burden than those with good mental well - being ( see table 1 ) . a similar relationship was observed for diabetes - related complications and treatment . patients with very poor mental well - being were more likely to experience diabetes - related complications and to be treated with a combination of insulin and noninsulins than those with poor or good mental well - being . among patients with very poor or poor mental well - being , there was a greater likelihood of experiencing hypoglycemia and diabetes - related complications as well as to be treated with a combination of insulin and noninsulin(s ) than among those with good mental well - being ( see table 1 ) . overall , patients with very poor mental well - being reported greater health care resource use than those with poor and good mental well - being as indicated by a greater number of doctor visits , er visits , and hospitalizations in the past 6 months . also , those with poor mental well - being reported higher resource use than those with good mental well - being ( see table 2 ) . these results held after controlling for covariates for resource use ( covariates included age , gender , ethnicity , income , education , smoking status , bmi , cci , years since diagnosis , diabetes - related complications , hypoglycemia status , and current treatment . ) those with very poor mental well - being reported more resource use than those with good well - being and more hcp and er visits than those with poor mental well - being . those with poor mental well - being reported more resource use than those with good mental well - being ( see table 3 ; individual regression tables located in appendix : doctor visits see tables 6a and 6b , er visits see tables 7a and 7b , and hospitalizations see tables 8a and 8b , supplemental digital content 1 ) . for the whole sample , activity impairment was measured . those with very poor and poor mental well - being had higher activity impairment than those with good mental well - being . those with poor mental well - being had greater activity impairment than those with good mental well - being ( see table 2 ) . presenteeism , absenteeism , and overall work impairment were asked only of those participating in the labor force . overall , approximately one - third of patients with t2 dm were participating in the labor force . patients with very poor mental well - being were less likely to participate in the labor force than those with poor mental well - being and good mental well - being . in addition , those with poor mental well - being were more likely to participate in the work force than those with good mental well - being ( see table 2 ) . those with very poor mental well - being had higher presenteeism , absenteeism , and overall work impairment than those with poor and good mental well - being . likewise , those with poor mental well - being had higher presenteeism , absenteeism , and overall work impairment than those with good mental well - being . controlling for potential confounders , the findings were consistent with the unadjusted comparisons ( covariates included age , gender , ethnicity , income , education , smoking status , bmi , cci , years since diagnosis , diabetes related complications , hypoglycemia status , and current treatment . ) those with very poor mental well - being reported more work and activity impairment than those with poor and good mental well - being . similarly , those with poor mental well - being reported more activity and work impairment than those with good mental well - being ( see table 3 ; individual regression tables located in appendix : absenteeism see tables 2a and 2b , presenteeism- see tables 3a and 3b , overall work impairment see tables 4a and 4b , and activity impairment see tables 5a and 5b , supplemental digital content 1 ) . patients with t2 dm and very poor or poor mental well - being were more likely to be younger , female , nonwhite , less educated , and have lower income than patients with t2 dm and good mental well - being . the demographic groups associated with poor and very poor mental well - being tend to be consistent with previous literature . the pattern is a little bit less clear when it comes to ethnicity and well - being , as it is difficult to disentangle the relationship between socioeconomic status and ethnicity . previous research has found a strong relationship between ethnicity / socioeconomic status and health disparities that can often be attributed to differences in health behaviors , cultural factors , and access to treatment . in addition , a previous study looked at overall nhws data and results showed that whites had higher mental well - being , measured by mcs scores , than ethnic minority groups , which is consistent with the results from the current study . however , once demographic factors such as income were controlled for in the previous study , the differences between ethnic groups and well - being were not as clear . given certain groups are at a greater risk for poor and very poor mental well - being , it is important to note as they may benefit from intervention . the burden of poor and very poor mental well - being among patients with t2 dm was demonstrated for all examined outcome variables . even after adjusting for differences in social , health , and disease status , patients with poor and very poor mental well - being reported a greater number of health care practitioner visits , emergency room visits , and hospitalizations than patients with good mental well - being . patients with very poor mental well - being also experienced the lowest work force participation . interestingly , those with poor mental well - being experienced higher work force participation than those with good mental well - being . those with good mental well - being were older , on average , than those with poor and very poor mental well - being . older individuals have a higher likelihood of being retired from the workforce regardless of mental well - being status . in addition , those with poor mental well - being had lower educational levels and lower annual household incomes than those with good mental well - being . those with poor mental well - being may have to work to survive financially , necessitating greater workforce participation . those with very poor mental well - being have the lowest annual household income levels and the lowest levels of workforce participation . regardless of financial need , those with very poor mental well - being may simply be unable to work or may be eligible for disability benefits to survive financially . those with poor and very poor mental well - being who participated in the labor force experienced greater work productivity loss including greater absenteeism and presenteeism than those with good mental well - being . displaying the greatest burden , patients with very poor mental well - being , who participated in the workforce , experienced even greater health care resource use and more pronounced work productivity loss than patients with poor mental well - being . the study corroborates previous research by demonstrating that mental health has a substantial impact on health care resource use and work productivity among t2 dm patients . although we would expect this pattern to be consistent among those with t2 dm , given the substantial burden already associated with t2 dm , having poor and very poor mental well - being could exacerbate the negative effects . in particular , prior studies showed that patients with t2 dm and depression had greater outpatient costs as well as a greater probability of having primary care , specialty care , inpatient care , emergency room visitation , and hospitalizations than patients with t2 dm and no depression . prior studies also showed that patients with t2 dm and depression had greater odds of functional disability , and were more likely to miss at least 7 workdays in a given year , compared with patients with t2 dm but no depression . it is important to note that 40.5% of those with poor and 30.9% of those with very poor mental well - being were actively participating in the labor force . it is very possible that the negative impact that mental well - being had on workplace performance may extend beyond what has been measured in this study . for instance , we are not capturing details about the circumstances of those not currently in the labor force . as t2 dm is a major driver of health care and indirect costs , these findings suggest that poor and very poor mental well - being among patients with t2 dm is a major economic burden . the greater use of health care resources found in patients with poor and very poor mental well - being indicates greater direct costs for patients and payers , including self - insured employers . costs $ 18,012 . those with poor mental well - being had 0.70 hospitalizations ( unadjusted ) annually that equates to $ 12,608 in annual hospitalization costs , that is , an increase of approximately $ 8286 in annual costs attributable to hospitalizations per patient with very poor mental well - being compared with a patient with good mental well - being and an additional $ 3962 compared with a patient with poor mental well - being . considering that nearly half of patients with t2 dm can be categorized as experiencing either very poor or poor mental well - being , direct health care costs for resource utilization are substantial . to put the burden of lost work productivity in perspective , the median individual weekly salary in the u.s . is $ 768 , which amounts to $ 39,936 annually assuming 52 work - weeks a year . given those with very poor mental well - being report roughly 10.7% absenteeism ( unadjusted ) , the amount attributable to lost wages due to missing work is $ 4273 annually . those with very poor mental well - being have $ 3227 greater annual costs attributable to absenteeism than those with good mental well - being and $ 2144 greater absenteeism costs than those with poor mental well - being . indirect costs associated with the greater presenteeism associated with very poor and poor mental well - being will add to the economic burden on employers . notably , the current study finds that , while patients with t2 dm who were classified as having poor mental health ( mcs of 40 to 50 ) may not necessarily meet criteria for diagnoses of depression , anxiety , or other psychiatric conditions , they have significantly greater health care resource use and experience significantly more work impairment than those with good mental well - being . as patients who were classified as having poor mental well - being represented nearly a quarter of the sample , the findings suggest previous estimates , which focused on patients with very poor mental health status ( via diagnoses of psychiatric conditions ) may have underestimated the total impact of mental health impairment in patients with t2 dm . prior findings suggesting that poor mental health , and particularly diabetes - related distress , is negatively associated with self - care , treatment adherence , and glycemic control , further highlighting the importance of the current findings . clinicians should take care to address the mental well - being of patients in addition to the physical aspects of t2 dm in order to prevent patients from developing poor or very poor mental well - being . this is particularly notable , as prior research suggests that there is discordance between patients and their physicians , with patients rating mental health symptoms as a higher treatment priority than their physicians . the current study benefited from using a large sample representative of the internet - using u.s . because the study employed an internet sampling methodology , older and ill patients not able to complete online surveys may have been undersampled . this may have led to the current study 's sample being younger and healthier than would be the case if the sampling could have included these patients , which may have biased the study to underestimate the prevalence of very poor and poor mental well - being among patients with t2 dm and the impact of mental well - being on health care and work productivity costs . because of the cross - sectional nature of the study , a causal relationship between mental well - being and outcomes could not be established . although poorer mental well - being may lead to greater resource use and work productivity loss , greater resource use and work productivity loss may exacerbate poor mental well - being . all measures were self - reported and patients may have misclassified their disease status or treatment status , potentially causing measurement error . lastly , we were not able to assess diabetes - related distress in this study , as the data were not available in the national health and wellness survey . future research should focus on the relationship between diabetes - related distress , mental health conditions including depression and anxiety , and overall mental well - being . future research should consider the relationship of overall mental well - being with health care resource use and work productivity in the general population , as well as in populations with other chronic health conditions . the current study found that patients with t2 dm and poor or very poor mental well - being experience greater health care resource use and work productivity impairment than patients with t2 dm and good mental well - being . the consequences of such impairment for those with poor or very poor mental well - being have real - world implications for associated costs to employers and health plans . in contrast with prior research , the current study highlights that patients who are not necessarily clinically diagnosed with a mental health condition , but have poor mental well - being , may experience impairment , indicating prior research may have underestimated the total impact of diabetes - related mental health impairments . clinicians should pay special attention to populations at a greater risk for poor and very poor mental well - being such as low income , women , and non - whites . it is important that clinicians take care in developing individualized treatment strategies tailored to mental health status and focus on those with poor and very poor mental well - being , as both groups may have different needs and require different interventions . the current study benefited from using a large sample representative of the internet - using u.s . population . because the study employed an internet sampling methodology , older and ill patients not able to complete online surveys may have been undersampled . this may have led to the current study 's sample being younger and healthier than would be the case if the sampling could have included these patients , which may have biased the study to underestimate the prevalence of very poor and poor mental well - being among patients with t2 dm and the impact of mental well - being on health care and work productivity costs . because of the cross - sectional nature of the study , a causal relationship between mental well - being and outcomes could not be established . although poorer mental well - being may lead to greater resource use and work productivity loss , greater resource use and work productivity loss may exacerbate poor mental well - being . all measures were self - reported and patients may have misclassified their disease status or treatment status , potentially causing measurement error . lastly , we were not able to assess diabetes - related distress in this study , as the data were not available in the national health and wellness survey . future research should focus on the relationship between diabetes - related distress , mental health conditions including depression and anxiety , and overall mental well - being . future research should consider the relationship of overall mental well - being with health care resource use and work productivity in the general population , as well as in populations with other chronic health conditions . the current study found that patients with t2 dm and poor or very poor mental well - being experience greater health care resource use and work productivity impairment than patients with t2 dm and good mental well - being . the consequences of such impairment for those with poor or very poor mental well - being have real - world implications for associated costs to employers and health plans . in contrast with prior research , the current study highlights that patients who are not necessarily clinically diagnosed with a mental health condition , but have poor mental well - being , may experience impairment , indicating prior research may have underestimated the total impact of diabetes - related mental health impairments . clinicians should pay special attention to populations at a greater risk for poor and very poor mental well - being such as low income , women , and non - whites . it is important that clinicians take care in developing individualized treatment strategies tailored to mental health status and focus on those with poor and very poor mental well - being , as both groups may have different needs and require different interventions .
according to barker 's theory , certain risk exposures few months before pregnancy , during pregnancy , and in early childhood might have a role in the occurrence of some disorders in adulthood . it is , therefore , essential to monitor the medical status of neonates , particularly those at certain risks , to keep them healthy and to avoid adverse consequences later in the life . some studies showed that for preventing irreversible consequences in high risk infants , they need to be specifically looked after by a team of experts with various skills [ 212 ] . the definition of high risk infants and the approaches suggested for the follow - up of high risk children are discussed in detail elsewhere . implementation of any follow - up program for high risk infants would largely depend on existing facilities , family circumstances , and infant status . a follow - up program for high risk infants was initiated in alzahra maternity hospital in tabriz city of iran in 2013 . the main objective of the program was to create a pilot model for possible implementation of follow - up care for high risk infants across the country . the aim of the current paper is to give a brief report of this program . the city is one of the three major cities in iran located in the northwest of iran , a cold climate zone , with a total population of 1,398,060 in 2012 and an average annual population growth rate of 0.8 percent . high risk infant was mainly defined based on the birth weight ( less than 1500 grams ) and gestational age ( less than 32 weeks ) . if an infant did not , however , have those criteria , other medical conditions ( i.e. , major surgery in the neonatal period , seizures or fits , and serious illnesses such as meningitis or congenital malformation ) were considered for risk assessment at birth / soon after . full details of the high risk conditions can be found elsewhere [ 20 , 21 ] . the first group comprising 509 infants ( 282 boys and 227 girls ) received services in alzahra maternity hospital implemented by the follow - up program . this included a full package for family / mothers to train them to look after high risk infant and periodic clinical evaluation by fully equipped / trained medical staff at two and four weeks after birth and then two , three , four , five , and six months later again . at those time points , the pediatric nurse of the program called the family ( mainly mother ) to bring the child for clinical follow - up . at this regular medical program , every infant was assessed for cardiac problems , lung diseases , gastroesophageal reflux , anemia and nutritional assessment ( mainly based on weight , height , and head circumference ) , immunization ( according to the country regular plan ) , hypothyroidism , osteopenia , nephrocalcinosis , renal tabular acidosis , developmental dislocation of hip ( ddh ) , intraventricular hemorrhage , neurodevelopmental assessment ( using ages and stages questionnaire at the second , fourth , and sixth months ) , retinopathy , auditory assessment , a comprehensive psychological assessment and mental health ( including autism , etc . ) , sleep disorders ( using a standardized questionnaire ) , oral health assessment , and anthropometric indices ( including weight , height , and head circumference ) . bronchopulmonary dysplasia ( bpd ) is routinely fully managed during the hospital stay for every high risk infant . after discharge , a detailed follow - up program is organized beginning from the fourth year onward . the second group including 131 infants ( 63 boys and 68 girls ) in taleqani maternity hospital received routine services after birth with no specific / regular follow - up or any specific nurse for this . they were medically assessed at the same time points and at the same hospital to compare them with the status of high risk infants in the first group . infants diagnosed , as high risk infants , in two maternity centers ( alzahra , as pilot , and taleqani , as control hospitals ) entered the follow - up program . these hospitals routinely provide obstetric and gynecological services in the study population under the tabriz university of medical sciences . they are located in two different places in the city covering the population in two various zones in the city . confounding factors were considered in both groups for the purpose of data analysis . those factors included gender and risk status ( based on birth weight and gestational age ) . we also assessed the attitude and practice of staff and families towards the program using a questionnaire and interview and filling a check list while they are doing the job . the study obtained ethics approval from the committee of ethics in tabriz university of medical sciences . were asked whether or not they are willing to participate in the study and were told that they are free to leave for any reason at any time . of those high risk infants eligible for follow - up care in alzahra hospital , 33 percent ( 95% confidence intervals : 28.037.9 ) refused , even after they were called for three times , to enter the follow - up program where 84 percent ( 95% confidence intervals : 76.691.5 ) of control families with high risk infants did not participate in the hospital for follow - up services . in both groups , those refusing families either preferred to get follow - up services from private doctors and clinics or never got follow - up care at all over the study period . we compared the improvement of clinical and anthropometric indices in alzahra and taleqani hospital to assess the effectiveness of this program . some anthropometric indices showed a significant improvement in the intervention hospital compared to control group over the follow - up period . these included the following : head circumference at first and second months ; weight in the first , fourth , fifth , and sixth months ; and height in sixth month only ( table 1 ) . there was an overall improvement for the mean of head circumference , height , and weight between second week and sixth month ( follow - up period ) in alzahra hospital compared to control hospital . table 2 presents the proportion of high risk infants admitted to the outpatient clinics in both hospitals for assessment for various medical conditions and reasons . clinical evaluation of infants in two hospitals broadly showed an increase in the screening for many of medical conditions . for instance , 21.6 percent of gastroesophageal reflux cases ( 95% confidence intervals : 18.025.2 ) were found and then medically managed in alzahra hospital where the same figure was 7.6 percent ( 95% confidence intervals : 3.112.2 ) in control hospital . in contrast , in some instances there was a better screening in control hospital : 14.5 percent of cardiac problems ( 95% confidence intervals : 8.520.6 ) were diagnosed in control hospital while it was 2.2 percent only in the first group ( 95% confidence intervals : 0.813.4 ) . in this paper , we briefly reported a follow - up care program for high risk infants in tabriz city of iran . we showed that the program was seemingly effective in finding and managing some of the medical conditions in neonates over the six - month follow - up . similar findings were reported before from various countries [ 2228 ] . however , for implementing the program at regional or national levels , some technical , logistic , and financial aspects should be considered including the following : before the program begins , it is essential to appoint a neonatologist ( where unavailable , a general pediatrician ) and a trained pediatric nurse / midwife as the focal points for the program in every hospital qualified for starting the follow - up care program for high risk infants . the program nurse / midwife willcoordinate the follow - up care with family;provide the family with full package of the follow - up care ( i.e. , time table for clinical visits and instruction for various conditions and situations);organize the timetable of clinical visits at regular basis;arrange instruction and training sessions for family;enter the relevant data in the program online software;prepare regular reports of the follow - up program.access to some paramedical services has to be organized / arranged for those infants needing these services after discharge . some of those services include occupational therapy , physiotherapy , speech therapy , clinical nutrition services , and psychology and psychotherapy facilities . some families may also need financial aids to access those services.a major attention should be made for recall and follow - up of those high risk infants living in the villages far from the program hospital . the program nurse / midwife may also need to be in close contact with the local family doctor to organize the regular follow - up visit for those infants.one of our main limitations in the implementation of this follow - up program was improper infrastructure and insufficient capacity of online data handling in the country . if a program is to be implemented across the country , the online communication of the data between states , hospitals , and main office in the ministry of health has to be set up / administered properly . before the program begins , it is essential to appoint a neonatologist ( where unavailable , a general pediatrician ) and a trained pediatric nurse / midwife as the focal points for the program in every hospital qualified for starting the follow - up care program for high risk infants . the program nurse / midwife will coordinate the follow - up care with family;provide the family with full package of the follow - up care ( i.e. , time table for clinical visits and instruction for various conditions and situations);organize the timetable of clinical visits at regular basis;arrange instruction and training sessions for family;enter the relevant data in the program online software;prepare regular reports of the follow - up program . coordinate the follow - up care with family ; provide the family with full package of the follow - up care ( i.e. , time table for clinical visits and instruction for various conditions and situations ) ; organize the timetable of clinical visits at regular basis ; arrange instruction and training sessions for family ; enter the relevant data in the program online software ; prepare regular reports of the follow - up program . access to some paramedical services has to be organized / arranged for those infants needing these services after discharge . some of those services include occupational therapy , physiotherapy , speech therapy , clinical nutrition services , and psychology and psychotherapy facilities . a major attention should be made for recall and follow - up of those high risk infants living in the villages far from the program hospital . the program nurse / midwife may also need to be in close contact with the local family doctor to organize the regular follow - up visit for those infants . as a conclusion , a follow - up care program for a minimum of six months after discharge from maternity hospitals may help to avoid adverse and life threatening consequences in high risk infants .
members of this genus growing at temperatures between 35 and 75 c are widespread throughout the world and can be recovered from various natural environments with temperatures ranging from 80 c to that of glacier ice ( such as hot springs , petroleum reservoirs , compost , marine hydrothermal vents , soils , lake and ocean sediments , and arctic waters ) . a recent revision of this genus based on analysis of the 16s rrna gene sequences resulted in a considerable decrease in the number of geobacillus species . apart from the 16s rrna gene , sequence similarity analyses of the recn , gyrb , and the strain 1017 (= vkm b-3132 ) was isolated from a production water sample of the dagang high - temperature heavy oil reservoir ( hebei province , china ) ( 38404.7 n , 1172238.0 e ) , . strain 1017 is an aerobic endospore - forming bacterium , motile during the early exponential growth phase , and able to grow within the temperature range from 38 to 68 c with an optimum at 60 c . the strain utilizes fatty acids , sugars , amino acids , aromatic compounds , and n - alkanes of crude oil . the 16s rrna gene sequence of strain 1017 has 99.5% similarity with the respective gene of geobacillus kaustophilus r-35646 ( fn428694 ) . analysis of the gyrb and pare genes of the new strain 1017 revealed 96.0% and 97% similarity to the relevant genes of g. kaustophilus nbrc 102445 , ( nz_bbjv01000018 , bbjv01000017 ) , which made it possible to suggest this strain as a new geobacillus species . analysis of the genome of strain 1017 was carried out in order to specify its taxonomic position and to elucidate the genotypic diversity within the genus geobacillus . genomic dna was isolated from the biomass using the dneasy blood & tissue kit ( qiagen , germany ) according to the manufacturer 's instructions . 1017 genomic dna was sequenced with a roche genome sequencer ( gs flx ) , using the titanium xl + protocol for a shotgun genome library . about 356 mb of raw sequences with an average read length of 5394 nucleotides were produced providing approximately 100-fold genome coverage . the reads were de novo assembled into contigs using newbler assembler version 2.9 ( 454 life sciences , branford , ct ) . 1017 consists of 146 contigs longer than 500 bp , with a total length of 3,562,450 bp . the n50 contig size of the genome is 52,882 bp and the g + c content of 51.74% . gene search and annotation were performed for all contigs longer than 500 bp using the rast server . the genome was predicted to contain 3896 protein - coding sequences , 86 trnas and 24 coded rrnas ( 5s , 16s , and 23s ) . most of the annotated genes determined amino acids and derivatives synthesis ( 435 ) , carbohydrate metabolism ( 409 ) , cofactors , vitamins , prosthetic groups and pigment formations ( 296 ) , protein metabolism ( 244 ) , and rna metabolism ( 149 ) ( fig . 1 ) . the 16s rrna , gyrb and pare gene sequences revealed in the genome had 100% , 100% and 99.9% similarity , respectively , with those determined earlier for the strain 1017 . the results of phenotypic studies characterizing the strain as an aerobic spore - forming bacterium utilizing a wide range of organic substrates were confirmed by detection of respective genes . despite utilization of 10,11 and 1319,22 n - alkanes by strain 1017 , neither alkb nor lada genes were found in the draft genome . a range of protein - coding sequences involved in the pathways for the oxidation of aromatic compounds was detected in the genome of the strain . further studies of the genes involved in biodegradation of alkanes and aromatic compounds from crude oil by aerobic thermophilic bacteria are necessary . overall , in silico results confirmed that the strain 1017 was a member of the genus geobacillus , though further characterization work is required to determine its species . whole genome shotgun project has been deposited at ddbj / ena / genbank under the accession mqmg00000000 . the authors declare that there is no conflict of interests on the work published in this paper .
pityriasis rubra pilaris ( prp ) is a rare chronic inflammatory keratosis , clinically characterized by gradually developing to reddish or orange extending plaques and keratotic follicular papules . five types of prp were classified by griffith , and there are refractory cases ( particularly in type ii ) in contrast with spontaneous cures for several years as described in the literature . at the onset in infancy , we frequently hesitate to use these medications , which are etretinate , systemic corticosteroid , and biologics recommended by previous studies . an administration of high - dosage vitamin a was described in the previous textbook of dermatology ; however , it did not describe in detail the lower limits and the period . herein , we present an infantile case of prp which was hard to classify , successfully controlled with a minimal dose of systemic vitamin a in the long term . a 12-year - old male patient ( weight 40 kg ) first presented to our hospital because of the presence of reddish asymptomatic keratosis plaques with no medications in january 2008 . the patient was not taking any medications to date ( including s - retinoids , albumin , etc . ) . the plaques had appeared on the palms and plantar aspects of the feet 6 years previously . erythematous plaques and keratotic follicular papules emerged and rapidly expanded to cover the head , trunk , and extremities over the past year ( fig . histopathologically , a biopsy specimen obtained from a reddish plaque on the patient 's back showed hyperkeratosis , acanthosis , and elongation of rete ridges in the epidermis . alternating vertical and horizontal parakeratosis in the epidermis ( checkerboard appearance ) with follicular keratinization was also observed ( fig . although topical betamethasone butyrate propionate , maxacalcitol , and oral loratadine at 10 mg / day were introduced in february 2008 , the skin lesions rapidly expanded and merged into larger plaques within 2 months , eventually covering the whole trunk ( fig . although we recommended oral etretinate according to the literature at first , his family disagreed with our suggestion . one month later , we recommended to take low - dose vitamin a and started vitamin a in oil ( chocolaa ) at 10,000 units twice a day in addition to the above - mentioned agents . before and 14 days after beginning the therapy , both vitamin a levels of peripheral blood were within the normal range , and no liver or renal dysfunction were seen . approximately 2 months after starting the vitamin a , the reddish eruptions on the whole body , including those on the palms and plantar aspects of the feet , had essentially disappeared ( fig . therefore , we discontinued the vitamin a in oil , but the eruptions on the trunk gradually relapsed 2 weeks after discontinuation . since then , we have regularly followed up the patient and have prescribed the agent during rash exacerbations . most pediatric cases of prp classified as type iii by griffith generally undergo spontaneous cure between 1 and 3 years . although the present case was a suspected type iii with no family history and a juvenile onset , the 6-year history of rash on the palms and plantar aspects of the feet may have been associated with prp ; therefore , we finally could not establish a precise classification . although the possibility of spontaneous healing was not denied in the present case , we stopped the administration of vitamin a after the change in the patient 's eruption ; the rashes were worsening and expanding again in short time . soon after re - administration of the same dose , the rashes immediately improved , indicating that the amount of the vitamin a was effective for the dosing period . administration of large amounts of vitamin a for treatment of prp has been described in previous literature and textbooks [ 2 , 3 ] , but the effective amount and period of vitamin a has not been specifically described . specifically , the previous dosage was 1,000,000 units per day for 14 days and 200,000 units per day for 35 days . therefore , re - administration of the same dose was performed , and immediate efficacy was again obtained . in the present case , we made a decision to administer 10,000 units twice a day based on the recommendations for over - the - counter drug vitamin a in japan , which define the safe amount as 5,000 units per day continuously . the amount in the present case was the minimum effective dosage of vitamin a in the previous literature . these results suggested that the clinical efficacy may not be due to a supplementary effect of vitamin a , but to a pharmacological action because serum vitamin a was within the normal limits during the therapy . hereafter , as more cases become accumulated , we would expect to clarify the effective minimum dosage , optimal dosing period , and adverse effects of vitamin a therapy for pediatric prp patients .
individual identification is an important and challenging task in forensic investigation , which was based on scientific principles . tsuchihashi and suzuki established that the arrangement of lines on the red part of the human lip is individual and unique . the grooves were named as sulci labiorum and corresponding lip prints as figura linearum labiorum rubrorum by them . in 1981 , cottone reported cheiloscopy as a special technique for the purpose of individual identification . a lip print is different in every living individual and does not change with time therefore it can be used as a tool in forensic investigations . a lip print may be revealed as a stratified surface trace with visible elements of lines , namely the furrows and if the lines are not clear , only the shape of lips is printed . it has been confirmed that these furrows recover after undergoing alterations like trauma , inflammation , and diseases like herpes . lip print on drinking glass or cigarette butt found at crime scenes may link to a suspect . the one of the most emerging methods of human identification , which originates from the criminal and forensic practice , is human lips recognition . fischer in 1902 was the first anthropologist to describe the furrows on the red part of human lips . however , it was in 1932 that edmond locard , one of the criminologists recommended the use of lip prints in personnel identification and criminalization . it is a method of identification of a person based on the characteristic arrangement of lines appearing on the red part of the lips . cheiloscopy in its present stage of development has surpassed the limits of a method and has become a means of criminalistics identification . lipstick smears can lead to indirect proof of a relationship or contact between a victim and a suspect or a suspect and a crime scene . those latent or invisible lip prints can be detected using aluminum powder and magnet powder as mentioned by sharma et al . the lipstick - cellophane tape method was used in lifting lip print was described first by bindal et al . the use of lipstick is not inevitable as latent prints are available at all crime scenes because of the presence of minor salivary glands and sebaceous glands . santos in 1967 classified lip grooves into four types ( straight line , curved line , angled line , and sine shaped line ) . suzuki and tsuchihashi in 1970 devised a new classification of lip grooves as : type i a clear cut groove running vertically across the liptype i partial length groove of type itype ii a branched groovetype iii type i a clear cut groove running vertically across the lip type i partial length groove of type i type ii a branched groove type iii an intersected groove type iv a reticular pattern type v undetermined . the intercommissural distance ( icd ) in relaxed state is measured between the corners of the mouth . it corresponds to the width of maxillary anterior teeth and can be used as a guide for the selection of maxillary dental prosthesis . icd could be utilized in forensic odontology for the identification of a person , if he / she was a denture wearer . the inter labial gap during relaxed state , can be used to assess the lip competency . the lip competency records in human beings could be matched with past facial profile photographs or lateral cephalogram records for identification in mass disaster . thus a dental surgeon has to actively play his role in personal identification and criminal investigation , as his evidence would be very much useful in law and justice . this study will investigate the correlation of lip print pattern to gender , abo blood groups , and icd in sriganganagar , rajasthan . the study was conducted on 208 randomly selected students of surendera dental college and research institute , sriganganagar , rajasthan , out of which 123 were females and 85 were males , aged between 18 and 25 years from october 2012 to march2013 . all the subjects were briefed about the purpose of the study and a written informed consent was obtained . the subjects undergoing orthodontic treatment , presence of congenital lip abnormalities , inflammation or trauma of lips , hypersensitivity to lipsticks were excluded from the study . red flamed lip stick , lip brush , cellophane tape ( 45 mm width ) , white a4 bond paper , electronic digital calipers , magnifying glass ( 10 cm diameter ) , anti - a sera , anti - b sera , and anti - rh sera for abo blood group testing . the lips of the subjects were cleaned and a red lipstick was applied evenly with a single stroke using lip brush over the vermillion border and the subjects were asked to rub both the lips to spread the applied lipstick uniformly . after 2 minutes , the glued portion of the cellophane tape was placed over the lipstick . the lip prints were taken in the normal rest position by dabbing in the center first and then pressing it comfortably toward the corners of the lips . the cellophane strip was then stuck to the white bond paper for a permanent record . the lip prints were then analyzed following tsuchihashi classification using a magnifying glass by two forensic experts independently [ figure 1 ] . each lip was divided into six areas starting from right upper area to right lower area ( a1a6 ) . the type of lip print was assessed in all the six areas and the type , which was repeated the maximum number of times , was considered as described by rajendran and sivapathasundram . the short upper lip and proclined upper anterior teeth with interlabial gap in relaxed position was noted clinically to record the competency of lips . the icd ( in cm ) for each subject was recorded at rest position using electronic digital calipers . type i - vertical groove across the lip , type i-partial length groove , type ii - branched groove , type iii - intersected groove , type iv - reticular pattern , type v - undetermined the blood group of the subjects were identified by placing a drop of blood on the slide and treated with anti - a , anti - b , and then on anti - rh sera . positive agglutination of the blood on treating with anti - a is considered as blood group a , positive reaction with anti - b is considered as blood group b , if no agglutination is produced then the blood group is o and if agglutination is seen with both antisera then blood group ab is considered . similarly positive agglutination reaction with rh antigen is considered rh+ or otherwise rh. the results were analyzed using spss 20.0(microsoft corporation inc . , chicago , il , usa ) statistical software . red flamed lip stick , lip brush , cellophane tape ( 45 mm width ) , white a4 bond paper , electronic digital calipers , magnifying glass ( 10 cm diameter ) , anti - a sera , anti - b sera , and anti - rh sera for abo blood group testing . the lips of the subjects were cleaned and a red lipstick was applied evenly with a single stroke using lip brush over the vermillion border and the subjects were asked to rub both the lips to spread the applied lipstick uniformly . after 2 minutes , the glued portion of the cellophane tape was placed over the lipstick . the lip prints were taken in the normal rest position by dabbing in the center first and then pressing it comfortably toward the corners of the lips . the cellophane strip was then stuck to the white bond paper for a permanent record . the lip prints were then analyzed following tsuchihashi classification using a magnifying glass by two forensic experts independently [ figure 1 ] . each lip was divided into six areas starting from right upper area to right lower area ( a1a6 ) . the type of lip print was assessed in all the six areas and the type , which was repeated the maximum number of times , was considered as described by rajendran and sivapathasundram . the short upper lip and proclined upper anterior teeth with interlabial gap in relaxed position was noted clinically to record the competency of lips . the icd ( in cm ) for each subject was recorded at rest position using electronic digital calipers . type i - vertical groove across the lip , type i-partial length groove , type ii - branched groove , type iii - intersected groove , type iv - reticular pattern , type v - undetermined the blood group of the subjects were identified by placing a drop of blood on the slide and treated with anti - a , anti - b , and then on anti - rh sera . positive agglutination of the blood on treating with anti - a is considered as blood group a , positive reaction with anti - b is considered as blood group b , if no agglutination is produced then the blood group is o and if agglutination is seen with both antisera then blood group ab is considered . similarly positive agglutination reaction with rh antigen is considered rh+ or otherwise rh. the results were analyzed using spss 20.0(microsoft corporation inc . , chicago , il , usa ) statistical software . b positive , followed by 29.8% of o positive , about 14.4% of a positive , 2.8%b negative , and ab negative , a negative being 0.9% , respectively [ table 1 ] . gender distribution of blood groups and lip print patterns the results of the two observers were analyzed for lip patterns by wilcoxon signed - rank test showing insignificant inter - observer bias [ figure 2 ] . frequency of lip print pattern by two observers the general distribution of lip prints in the given population was in the order of branched type ( 47.6% ) followed by intersecting ( 23.1% ) , vertical , partial length groove , reticular , and undetermined type [ table 1 ] . frequency of type i , type i , typeii and type iii lip prints was more among the b+ group . distribution of type iv lip prints was equal among a+ and o+ while type v showed increased expression among individuals with a+ blood group [ table 2 ] . distribution of lip prints with blood groups the correlation was calculated between lip prints and blood groups and also lip prints with gender , both were found insignificant [ table 3 ] . correlation of lip prints with gender and blood groups out of the total 208 , 198 ( 95.2% ) subjects were having competent lips while 10 ( 4.8% ) were having incompetent lips . the type ii lip pattern was more common in competent lips while type ii and type iii was more among incompetent lips . the mean icd of the sample was 4.96 cm , which was more in males ( 5.17 cm ) than females ( 4.83 cm ) . the mean icd is noted highest among type ii lip pattern subjects [ table 4 ] . the present study was conducted among 208 randomly selected subjects among which 57.5% were female and 42.5% were male . the lip pattern of the sample was studied independently by two forensic experts in six areas , that is , a1-a6 , to find out any inter observer bias which was found insignificant by statistical analysis . the results showed that type ii was the dominant pattern in male and female population . this was followed by type iii pattern in both gender ( 22.4% in males and 45.5% in females ) . the results were in accordance with previous studies by sivapathasundram et al . , and manipady . augustine et al . , stated that the minimum number of type v patterns should be seen in tsuchihashi classification , as in the present study where no type v pattern was seen in female population , while only two male subjects showed the same pattern . the results revealed no significant correlation between distribution of lip print patterns and abo blood group ( p = 0.71 ) . there is no statistically observed difference between males and females in individual lip print types ( p = 0.629 ) as was seen in study conducted by neo et al . the mean icd was found largest among branched lip pattern ( type ii ) subjects while overall mean icd was more among males than females as reported by temitope et al . the competent lips were noted in 95% of the study population while incompetency of lips was seen only in 5% . the type ii lip pattern subjects showed maximum competent lips while incompetent lips were equally seen among type ii and type iii lip print pattern subjects . the study confirmed the distinctiveness of cheiloscopy but disproves any statistical correlation of lip print pattern with gender , abo blood groups , or icd .
traumatic distraction injuries to the craniocervical junction are typically treated with occipitocervical fusion procedures.1 2 3 high failure rates of nonoperative management have been reported.4 the existing literature includes few reports of craniocervical injuries treated successfully with prolonged immobilization.5 6 however , in most cases , significant follow - up of the patients and functional outcomes are not reported . we report the successful management of a unique two - level craniocervical distraction injury in a 27 year - old man who was treated with prolonged halo immobilization . to our knowledge , the successful nonoperative management of a two - level craniocervical dissociation injury has not been reported in the literature . a pubmed and medline search was conducted involving the nonoperative management of craniocervical distraction injury . this article reviews the existing literature and also reports the case of a 27-year - old man who was involved in a motorcycle accident and sustained multiple systemic injuries and ligamentous distraction injuries to both occipitocervical joints and both c1c2 joints . the patient 's traumatic brain injury and bilateral pulmonary contusions precluded safe operation of the two - level craniocervical distraction injury . a pubmed and medline search revealed only three limited reports involving the nonoperative management of patients with craniocervical distraction injury . nonoperative management was associated with poor outcomes in the majority of the few reported patients . posttreatment computed tomography ( ct ) scan and ultimate follow - up flexion extension and traction radiographs demonstrated stable occipitocervical and c1c2 joints bilaterally . the patient reported minimal neck pain and an excellent functional outcome with a neck disability index score of 2 points at 41 months postoperatively . a 27-year - old man was riding a motorcycle at a high rate of speed , lost control , and collided with a large tree . the helmet he was wearing sustained significant damage . per the report , he was ambulating at the scene and moving all four extremities . the patient was transferred to a level 1 trauma center where he was diagnosed with a large intraventricular hemorrhage with both frontal and temporal lobe brain contusions . the initial lateral cervical spine image was suspicious for both widening of the occipitocervical and c1c2 joints ( fig . the patient was noted to be moving all four extremities spontaneously with normal muscle tone and strength . initial lateral cervical spine image is suspicious for both widening of the occipitocervical and c1c2 joints . the ct scan of the cervical spine revealed evidence of two - level bilateral craniocervical distraction injuries with diastasis of the occipitocervical and c1c2 joints bilaterally ( fig . 2a , b ) . magnetic resonance imaging ( mri ) of the cervical spine demonstrated severe edema and distraction injuries to both the occipitocervical and c1c2 bilateral joints ( fig . ( a , b ) computed tomography scan of the cervical spine showing two - level bilateral craniocervical distraction injuries with diastasis of the occipitocervical and c1c2 joints bilaterally . ( a , b ) magnetic resonance imaging of the cervical spine demonstrated severe edema and distraction injuries to both the occipitocervical and c1c2 bilateral joints . the patient was deemed too medically unstable to undergo operative stabilization of his complex craniocervical distraction injuries . on postinjury day 2 in the intensive care unit , a halo vest immobilization device was placed . the initial halo radiographs demonstrated continued widening of both the occipitocervical and c1c2 joints ( fig . the recommendations from the intensive care team were to not proceed with complex cervical surgery due the patient 's poor pulmonary and cerebral status . initial halo lateral radiograph demonstrated continued widening of both the occipitocervical and c1c2 joints . in the months following the injury , the patient demonstrated improved pulmonary and cerebral function . at 8 weeks postinjury , the decision was made to continue halo immobilization as the primary method of spinal injury treatment . spine clinic outpatient follow - up radiographs documented neutral alignment of the craniocervical junction . at 6 months postinjury , a ct scan showed maintained neutral alignment and reduction of the diastasis in all four involved joints ( fig . flexion extension and traction radiographs showed normal cervical motion with maintained stability ( fig . he reported very minimal activity - related neck pain . at the time of ultimate follow - up , his neck disability index score was 2 , indicating excellent functional outcome , and he reported an analog pain score of 0 . ( a , b ) six - month follow - up computed tomography scan after halo removal showing neutral alignment and reduction of the diastasis in all four involved joints . ( a , b ) flexion extension radiographs at 41-month follow - up showing normal cervical range of motion with maintained craniocervical stability . ( c ) craniocervical traction lateral radiograph showing maintained stability and alignment of the upper cervical spine and occipitocervical junction . distraction injuries to the craniocervical junction are the result of very high - energy trauma with powerful distractive forces . these injuries have high reported rates of fatality and severe neurologic dysfunction.7 8 it has been estimated that traumatic atlanto - occipital injury may account for up to 20% of fatal high - speed blunt trauma accidents.4 the most frequently injured ligaments in occipitocervical distraction injuries are the tectorial membrane and the alar ligaments , which are the most important stabilizing ligaments of the craniocervical junction.2 3 various reports conclude that early injury recognition and prompt stabilization are the most important factors toward successful craniocervical injury management.9 10 11 the patient in our case report most likely sustained an incomplete rupture or stretching of the main stabilizers of the occipitocervical junction including the alar ligaments , ligamentum transversum atlantis , ligamentum flavum , tectorial membrane , and joint capsules . the diagnosis of aod is often missed on spine plain radiographs and is difficult to detect on the initial lateral image in our patient ( fig . early additional imaging of the craniovertebral junction with either ct or mri is recommended in patients suspected of having craniocervical injury . gire et al have demonstrated improved accuracy in occipitocervical injury diagnosis using the combination of ct and mri imaging to confirm occipitocervical joint abnormalities.12 pang et al performed a ct scan - based anatomical evaluation of the occipitocervical joints and determined a nonpathologic normal mean occipitocervical joint interval of 1.28 mm . the authors found no cases of normal oc joint distance greater than 2.5 mm.13 the two separate levels of injury occurring at both occipitocervical and c1c2 joint levels are confirmed in our patient by the presence of significant abnormalities on both ct and mri and distraction distance greater than 4 mm in both sets of joints ( figs . 2 , 3 ) . unfortunately , the clear identification of occipitocervical ligament rupture versus ligament stretching remains difficult on static mri and ct . reis et al reported the largest series of traumatic craniocervical dissociation survivors , which included 48 consecutive adult patients.14 craniocervical dissociation was identified on initial cervical spine imaging in 26 patients ( 84% ) . twenty - three patients ( 74.2% ) were diagnosed within 24 hours of presentation , 4 ( 22.6% ) were diagnosed between 24 and 48 hours , and 1 ( 3.2% ) experienced a delay of greater than 48 hours . operative stabilization of the craniocervical junction is the most common treatment described in the literature.1 15 16 prior to performing fusion surgery , it is important for the surgeon to determine the prognosis of the patients who sustain traumatic craniocervical injury as many of these injuries are associated with other multisystem severe injuries that may preclude survival . chaput et al suggested that aod is a potentially survivable injury.17 the authors suggested that a significant neurologic injury , a high degree of initial distraction , and more severe associated injuries would decrease the likelihood of survival . they evaluated 14 patients and attempted to describe the occipitocervical injury pattern in a statistically meaningful way . patient mortality was associated with the presence of a complete neurologic deficit ( p = 0.0047 ) , a high basion - dens interval ( > 16 mm , p = 0.015 ) , and a high injury severity score ( p = 0.0373 ) . there is a plethora of literature describing the successful operative management of craniocervical injuries.1 2 4 good outcomes have been reported in numerous studies with a comprehensive plan that consists of accurate and timely diagnosis and stabilization of the craniocervical junction.5 14 15 what remains unclear with respect to craniocervical distraction injuries is the distinction between the patients who should be managed with or without stabilization surgery . bellabarba et al proposed a three - stage classification system for craniocervical junction injuries.1 the authors indicated that stage 1 injuries , which are often mild injuries to only one of the occipitocervical joints , may be managed nonoperatively . they postulated that in some craniocervical injuries , sufficient ligamentous integrity may be present to maintain craniocervical stability . it was suggested that these lower - grade craniocervical injuries will have less than 2 mm of joint distraction on manual distraction testing using lateral fluoroscopy . although this mild form of craniocervical injury was described , the successful nonoperative management of stage 1 injury was not demonstrated by the authors . the patient in our case report exceeds the distraction criteria as described by bellabarba et al for mild craniocervical distraction injury as the static initial ct and mri images demonstrate greater than 2 mm distraction of both occipitocervical and c1c2 joints . although this study demonstrates that advanced imaging is beneficial in making the diagnosis of craniocervical distraction injuries , the classification system proposed may not account for differentiating complete ligament rupture and stretching of the ligaments alone , which may be difficult due to the limitations of static imaging in the acute injury setting . the existing literature lacks significant discussion of successful nonoperative management of injuries to the craniocervical junction . the indications for nonoperative management remain unclear , and the functional outcomes of nonoperative treatment have not been adequately described . the patient we report was initially indicated for occipitocervical fusion surgery and underwent nonoperative management due to other systemic injuries that precluded surgery . govender et al reported four patients who had sustained a traumatic dislocation of the atlanto - occipital joint.5 the diagnosis was initially missed in two patients . only one of the patients , who was neurologically intact , was treated nonoperatively with a halo body jacket . the nonoperatively treated patient had a rotatory - type subluxation injury of the occipitocervical joint . in another small series , ghatan et al described three children , age 1 to 32 months , who presented with craniocervical junction injuries.6 variable neurologic findings were observed at presentation ( ranging from cranial nerve deficits to severe quadriparesis ) . all three children were treated with prolonged immobilization and recovered with minimal to no neurologic deficit . although children younger than 3 years of age represent a distinct subpopulation of patients at particular risk for high cervical and craniovertebral injuries , there are very few descriptions of survivors of severe craniocervical trauma among the very young , and scarce data exists regarding management after initial emergency stabilization . a recent systematic review by theodore et al identified 13 patients initially treated with external immobilization alone : 4 worsened transiently and 3 were unstable after 6 to 22 weeks of immobilization,4 and 7 of the 13 patients either deteriorated neurologically or failed to achieve craniocervical stability . only 5 patients with aod described in the literature were successfully treated with external immobilization alone ( 1 type i , 2 type ii , 2 other type dislocations ) . the authors suggested that because 7 of 12 ( 58% ) patients managed with external immobilization either deteriorated neurologically or failed to achieve craniocervical stability without surgical internal fixation and fusion , the treatment of aod with external immobilization alone should be considered with extreme caution . in this literature meta - analysis , the failure to treat aod with surgery resulted in worsening in 7 of 13 patients ( 54% ) with most patients deteriorating neurologically . although the use of external immobilization for aod was often associated with late instability , several patients achieved stability without operative management . the authors also suggested that the use of both ct and mri for differentiation of partial and complete ligament tears from stretch injuries may be useful in identifying a subgroup of patients in whom craniocervical stability might be achieved with external immobilization alone . bellabarba et al , in a retrospective evaluation of institutional databases , reviewed medical records and original images obtained in 17 consecutive surviving patients with craniocervical distraction injury.1 the diagnosis of craniocervical distraction injury was frequently delayed , and the delay was associated with an increased likelihood of neurologic deterioration . the authors concluded that early diagnosis and spinal stabilization protected against worsening spinal cord injury . it is apparent from the existing craniocervical literature that operative management of these highly unstable injuries leads to improved patient outcomes . although we report a patient with a unique two - level distraction injury who was successfully managed with prolonged halo immobilization , the indications and role of nonoperative treatment still remain undefined . it is very likely that our reported patient sustained incomplete rupture of the main occipitocervical stabilizing structures and thus successful treatment was achieved with nonoperative management of the injury . long - term follow - up of both surgically and halo - managed patients will improve our understanding of the ideal treatment for this unusual and potentially lethal injury . the literature remains unclear as to which craniocervical injuries may be managed successfully with nonoperative measures and further study is needed . only three limited reports have been published to date describing the nonoperative management of patients with craniocervical distraction injury , and most patients had poor outcomes . in addition , although advanced imaging with mri and ct has been shown to be helpful in diagnosing these injuries , the reliability of these diagnostic modalities to identify the severity of the ligamentous injury may be misleading in the acute setting . we describe successful nonoperative management of a unique two - level craniocervical ligamentous distraction injury using a halo device in a 27-year - old man who had multiple systemic injuries that precluded safe operative management . so why publish a case , which defies all published odds ? evidence - based spine - care journal ( ebsj ) has selected this single - patient case report for the very reason that it contradicts the current conventional wisdom that patients with craniocervical dissociation past pediatric age are preferably treated with open reduction and internal fixation with arthrodesis of the injury zone . the case as described involves a polytraumatized patient with severe head injury and chest trauma in addition to an unstable appearing ligamentous craniocervical junction injury with a vertical atlanto - occipital and a vertical atlanto - axial disruption . although we are not given details of the head injury ( location of the bleed , presence or absence of displaced skull fracture , intracranial pressure , burr holes , and craniectomy sites ) and the chest injury ( rib and or sternal fractures , acute respiratory distress syndrome , hemato- or pneumothorax ) , none of these injuries make for a particularly good argument in favor of halo vest immobilization and recumbent immobilization - based treatment . although the authors emphasize that their patient was not cleared for any spine surgery , one could make the counterargument how the patient could be cleared for prolonged recumbent immobilization treatment in light of this serious injury constellation ? from a biomechanical standpoint , this treatment choice is also less than desirable as well because a halo vest serves more of a distraction function along the craniocervical junction and is not suitable to exert a compression function in this region.1 this injury as shown is clearly a distractive injury and as such not really amenable to halo vest reduction . so how did the authors succeed in getting this distractive , purely ligamentous injury of the craniocervical junction to heal so well without apparent instability or subluxation and without visible heterotopic bone formation ? the exact reasons were unclear to the reviewers at ebsj - global spine journal ( gsj ) but several factors were offered : perhaps the severity of the head trauma immobilized the patient effectively for the critical first weeks to allow for healing . having the patient 's head slightly elevated in the intensive care unit bed might have reduced the head back down onto the neck , allowing the halo vest to do what it is designed to do by preventing translation in the sagittal plane . the head trauma may have induced osseous heterotopic bone formation ( which we do not see on the provided final radiographs and ct scan ) or excessive scar formation that provided such reassuring stability . perhaps the ligamentous injury was indeed just a severe sprain and not a complete disruption , a circumstance that a surgeon - conducted traction test such as promoted by the harborview group would have revealed.2 an incomplete craniocervical ligament injury may have left several key ligaments . an important anchoring structure and part of the cruciform ligament complex at the center of the craniocervical junction.3 perhaps other key ligaments such as the tectorial membrane , the atlanto - occipital facet capsules , and the often overlooked but mechanically relevant transverse occipital ligament were also structurally intact to allow for sufficient mechanical healing of the craniocervical osteoligamentous complex?4 no doubt the patient was fortunate to have recovered so well from this serious injury constellation with what appears to be a very favorable result , but how we could predict such a favorable healing result in the first place remains somewhat unpredictable . what conclusions can we draw from a single case report , which defies the vast majority of published reports on this subject ? of course , this single case report should not call into question the advancements of the past two decades in terms of diagnosis and emergent as well as surgical treatment for survivors of traumatically disrupted craniocervical junctions . as presented in the preceding article , these published outcomes collectively are impressive and have provided a clear improvement over the past . perhaps this article by kaplan et al can inspire us to reflect on how we remain quite unrefined in our attempts at identifying and properly grading ligamentous injuries of the spine despite mri and increasingly accurate cts . finally , this article can also remind us that conventional wisdom is a powerful force one most often desirable in its benefits , but also a force that can lead to dogma where plurality of approaches and some variances still can and perhaps should play an important role . in the right circumstances , and if done well , nonoperative care , as in this example , can still play an important part in spine trauma care . sadly , in everyday practices nonoperative spine trauma care has become increasingly obsolete for more serious injuries because it is more arduous and difficult to apply compared with surgery , it may have more uncertain outcomes , and it is commonly more cost - intensive due to longer inpatient stays . nonoperative care in most well - developed countries is rapidly becoming a lost art as newer resident generations are well trained in surgical details but for instance have never applied a halo vest .
as reported in the previous issue of critical care , vincent and colleagues investigated the possible increased risk of patients with insulin - treated diabetes for morbidity and mortality in the intensive care unit ( icu ) . literature is conflicting at this point , with studies showing increased risk , decreased risk , or neutral risk . in their analyses , vincent and colleagues included 3,147 patients originally recruited for the sepsis occurrence in acutely ill patients ( soap ) study , including 226 ( 7.2% ) patients with a prior diagnosis of insulin - treated diabetes . no significant differences in icu or 28-day hospital mortality were observed between the groups , even though patients with insulin - treated diabetes were sicker at baseline , as reflected by higher simplified acute physiology score ( saps ii ) and sequential organ failure assessment ( sofa ) score . from a cox proportional hazards analysis correcting for differences in patient characteristics , it appeared that patients with insulin - treated diabetes were more likely to develop renal failure , but diabetes was not an independent predictor of icu or 28-day mortality ( hazard ratio 0.78 , confidence interval 0.58 to 1.07 , p = 0.12 ) . the latter mortality rates were not discussed , probably due to low numbers in the diabetes group at 60 days . the diabetes population in the study of vincent and colleagues this definition does not classify between type 1 and type 2 diabetes , and from the large type 2 diabetes population , only the insulin - treated proportion , around 25% of all type 2 diabetes patients , is captured . how this affects the conclusions is unknown . also , the authors did not have the opportunity to collect data with respect to glucose regulation or insulin therapy , and this might have contributed to observed group differences . very recent descriptions of two large mixed icu populations and , more specifically , sepsis patients also found no differences in mortality , and perhaps even less mortality , in diabetes compared with non - diabetes patients , despite larger morbidity in the former group . larger morbidity and development of complications in diabetes can be explained by the often pre - existing organ dysfunction and pathophysiological alterations in the disease . this raises the intriguing question of how patients with diabetes manage to survive in the icu despite an increased risk for a variety of complications such as bloodstream infections and renal failure , which are , at least in the non - diabetic population , independently associated with mortality . remarkably , there seems to be a lower incidence of acute lung injury in patients with diabetes . there is evidence that hyperglycemia caused by critical illness is not associated with mortality in patients with diabetes , but on the other hand , patients with diabetes do not seem to benefit from intensive insulin therapy during their icu stay . this suggests that acute hyperglycemia in critical illness and hyperglycemia due to chronic diabetes are two distinct pathophysiological entities . perhaps this is a call for an active search for preexisting diabetes since this is often undiagnosed at the time of an event leading to hospital admission . various mechanisms are proposed to explain the similar outcomes of patients with diabetes and those without it . insulin may protect through anti - inflammatory effects given that in the intensive insulin therapy era , many patients without diabetes are receiving insulin . also , a higher body mass index may have a protective effect against icu mortality and may also protect people with type 2 diabetes . oxidative stress , arising from inflammation and hyperglycemia , is known to cause endothelial damage through several mechanisms and is associated with poor outcome in the critically ill . it is possible that because diabetes patients are already adapted to oxidative stress due to previous chronic exposure to hyperglycemia , the critical illness - induced oxidative stress is more harmful to non - diabetic patients because they have not yet activated cellular adaptation mechanisms . whatever the mechanism is , this elegant study by vincent and colleagues contributes to the evidence that diabetes itself is not a risk factor for mortality in the icu . moreover , the likely higher complication and morbidity rates of patients with diabetes and different responses to hyperglycemia suggest the need for the implementation of different treatment algorithms for both groups .
missing values are endemic across health and social studies.1 ) missing data reduce statistical power and representativeness of the sample and might cause misinterpretation of the results by introducing bias.2 ) socioeconomic status ( ses ) variables such as education , income , marital status , and occupation are often unanswered in the large public data sets . in most cases , the missingness in ses variables is related to certain characteristics of the individuals surveyed.3 ) however , this issue rarely receives specific focus as a shortcoming of studies , and has rarely been the focus of specific discussion within academic print . the korea national health and nutrition examination survey ( knhanes ) provides a rich source of data for studying the relationships between health and ses for primary care physicians . in this report , ses variables ( i.e. , education , household income , marital status , and occupation ) within the korean journal of family medicine ( kjfm ) original articles using the knhanes data were reviewed . rates of missing ses variables from the 4th knhanes were estimated , when used independently or used in combination with other ses variables . finally , other ses characteristics related to the omissions of household income and occupation were assessed . this study was composed of two main parts . the first part included a detailed hand search to select kjfm articles from 2007 to 2011 which used knhanes as their primary source of data . the methods and results sections of each relevant article were carefully reviewed , and the ses variables used in the univariate and multivariate analysis were checked . in the second part of the study , rates of missing ses variables ( i.e. , education , household income , marital status , and occupation ) from the health interview survey ( his ) of the 4th knhanes were estimated including that for all men and women aged more than 19 years old . the his consisted of four components : the household core , the sample adult core , the sample adolescent core , and the sample child core . the household core component included the household income and marital status of individuals , and the sample adult core component included their educational and occupational classification . detailed descriptions of the plan and operation of the survey have been described on the knhanes website ( http://knhanes.cdc.go.kr/ ) . educational levels were categorized according to less than elementary school graduate , middle school graduate , high school graduate , and college graduate . in order to calculate the household income level , the mean monthly household income was divided by the root of the number of household members , and was classified into quartiles . marital status of the individuals ( married and living with a partner , divorced or separated , widowed , or unmarried ) was also included . occupational classification used the knhanes system of classification , which is a modified version of the korean standard classification of occupation , 6th revision ( 2007 ) supplemented by an indicator reflecting unemployment status . 10 ( stata co. , college station , tx , usa ) to incorporate sampling weight . chi - square tests were used to assess the relationship between the missingness of household income data and occupation classification and other ses variables . of the reviewed literature , one article in 2007 , three articles in 2008 , four articles in 2009 , three articles in 2010 , and five articles in 2011 used the knhanes data as their primary data source , totaling 16 articles ( 5.4% ) among 296 original articles during the same period . eleven articles presented ses data to describe the participants ' characteristics with univariate analysis , and 9 articles used them as covariates in multivariate analysis . the most frequently used ses variables in the multivariate analysis were education ( 9 articles ) , household income ( 8 articles ) , marital status ( 3 articles ) , and occupation ( 4 articles ) . none of these 11 articles took into account the omissions within the analysis ( data not shown ) . the estimated rates of missing data on education , household income , marital status , and occupation were 0.3 ( standard error , se , 0.05 ) , 2.7 ( 0.2 ) , 0.5 ( 0.1 ) , and 9.4 ( 0.9 ) , respectively . when all four variables were used simultaneously , the rate increased to 11.8 ( 0.9 ) ( table 1 ) . table 2 presented ses characteristics according to the missingness of household income and occupation data . respondents with missing household income tended to be older ( p < 0.001 ) , less educated ( p < 0.001 ) , and more likely to be unemployed ( p < 0.001 ) , and widowed ( p < 0.001 ) . the rates of missing data for the categories of household income and occupation within knhanes were not low , i.e. , 2.7% and 9.4% , respectively , and the missingness was not randomly dispersed throughout the data . however , no articles in kjfm clarified the process by which missing values or attrition reduce the sample size , nor did they explicate how these problems introduce potential bias to their findings . traditional approaches to working with missing values are case deletion , pair wise deletion , mean substitution , or the inclusion of indicator variables . kjfm articles using ses variable from knhanes used the case deletion method , presumably as it is the default in standard statistical packages . use of the case deletion method using knhanes ses data could result in the loss of up to 12% of the data , and this figure will increase when researchers use multiple components of knhanes together . therefore , these approaches can result in serious biases in a positive or a negative direction , increasing type ii errors.4,5 ) this study showed that low educational achievement , unemployment state , and lower household income were all associated with omission in ses data . similar results have been reported in oversea studies . a postpartum survey in california3 ) and in the national health interview survey6 ) showed that respondents with missing income information were , in general , more likely to be socioeconomically disadvantaged . missing values can not be avoided , and naturally , the best solution is to minimize missing values at the point of collection . however , this may not be possible in most of cases . hence , researchers should , first and foremost , carefully examine the profiles of respondents with missing information prior to analysis.3 ) secondly , researchers should keep in mind the possible bias which can be introduced by missing values . finally , modern alternative techniques for working with missing values , such as single or multiple imputation , or full information maximum likelihood approaches should be introduced to the analysis.7 )
mass spectrometric analysis of proteome samples from eukaryotic cell lines , tissues or biological fluids is still hampered by the vast complexity of samples and concentration differences of proteins within making comparisons of proteomics and transcriptomics data difficult . online and off - line two - dimensional ( 2d ) or multidimensional separation to reduce sample complexity is therefore still of high importance . the most widely used methods involve two subsequent steps , an off - line fractionation step followed by ( low ph ) reversed phase liquid chromatography ( rp - lc ) directly coupled to mass spectrometry . ideally , the separation in the two - dimensions is highly complementary and uses different mechanisms , that is , they separate according to different properties of the analyte such as size , charge and hydrophobicity . many approaches have shown decent orthogonality such as hydrophilic interaction liquid chromatography ( hilic ) , electrostatic repulsion hydrophilic interaction chromatography ( erlic ) , strong cation exchange ( scx ) , isoelectric focusing ( such as offgel ) , scx - weak - anion exchange ( wax ) 3d and high - ph rp . particularly , high ph rp chromatography has shown great potential as it is highly resolving and partly orthogonal to low ph rp . however , this setup requires the samples to be dried down after the first dimension resulting in sample loss , unless another , third dimension such as sax is added , which increases the number of fractions and thus instrument time and reduces robustness of the system . furthermore , the high ph of the first rp dimension is corroding most of the silica - based stationary phase , leading to reproducibility issues and short column lifetime . while high - ph rp can never achieve full orthogonality to low - ph rp as they both separate according to hydrophobicity , ion exchange chromatography such as scx or strong anion exchange ( sax ) chromatography at least theoretically can . but while scx has been widely used , sax has been not widely considered for proteomic analysis . this is surprising as it was observed that the majority of tryptic peptides cluster between pi of 3 and 5 , partly because many post - translational modifications such as phosphorylation , pyro - glutamination or acetylation decrease the pi . this suggests that the majority of the tryptic peptides in a total cell digest are likely acidic , thus negatively charged and should be well separable by sax . some groups reported studies involving sax fractionation , mostly for phospho - proteomics and glycomics . on the proteome level , an online mixed mode reversed phase anion exchange ( mm , rp - ax ) , a sax - scx mixed bed ion exchange chromatography , a sax microreactor or a sax stage - tip approach were successfully used ; however , the use of sax for large - scale proteome analyses is still underdeveloped . here , we present a sax column with a hyperbranched architecture , quaternary ammonium ion functionality and an ultralow hydrophobicity . while the column was originally designed for the separation of small organic and haloacetic acids , we show its remarkable separation power for proteome research . this column exhibits high reproducibility , high capacity , robustness and very high orthogonality when coupled to low ph rp , allowing the identification of more than 9000 proteins from a raw264.7 macrophage cell lysate on an orbitrap velos pro mass spectrometer within only one week of instrument time . we show that both hydrophilicity and the ion exchange properties of the column are important for the high orthogonality of this approach , which we term hydrophilic strong anion exchange ( hsax ) chromatography . the standard proteins mixture consisted in bovine thyroglobulin , bovine serum albumin , chicken ovalbumin , bovine beta - casein , cytochrome c from horse heart , lysozyme from chicken eggs . all proteins were purchased from sigma aldrich ( st . louis , mo ) . ( walkerburn , scotland ) , while those for online system were purchased from merck kgaa ( darmstadt , germany ) . the mouse macrophage cell line raw264.7 was obtained from atcc and grown in dmem , 10% heat - inactivated fetal bovine serum ( fbs , sigma ) , 2 mm l - glutamine , 5000 u / ml penicillin and 5000 g / ml streptomycin ( invitrogen ) . raw 264.7 cells were harvested , washed with ice - cold pbs and lysed in 8 m urea/50 mm tris - hcl ( ph 8.0)/10 mm dtt plus a phosphatase inhibitor cocktail containing 1.15 mm sodium molybdate , 1 mm sodium orthovanadate , 4 mm sodium tartrate dehydrate , 5 mm glycerophosphate ( all sigma aldrich ) and 1 mm sodium fluoride ( analar normapur , west sussex , uk ) ; finally , 1 l of benzonase ( merck ) was added and the lysate passed through a 26.5 g needle . the solution was left to reduce for 60 min at 30 c under shaking . afterward , 15 mm iodoacetamide ( iaa ) was added and the sample was left to alkylate for 40 min at room temperature ( rt ) in the dark . the iaa was then deactivated with 20 mm dtt for 40 min at rt and at this point the protein concentration was assessed by rc / dc protein assay according to the manufacturer s instructions ( biorad ) . prior to digestion , the protein mixture was diluted 8 times with 50 mm tris - hcl ph 8.0 to 1 m urea . trypsin tpck ( worthington ) was methylated as described previously , added to the protein mixture ( 1:100 , trypsin : sample ) and the digestion was performed at rt overnight . another 1:100 was added the day after for 3 h followed by addition of 1% tfa to stop trypsin activity . finally , the sample was desalted by seppack oasis solid phase extraction cartridges ( waters ) , dried down and stored at 80 c . the same procedure was applied to the standard protein mixture ( 6-mix ) . an off - line thermo hplc ultimate 3000 system equipped with the wps-3000t(b ) fc autosampler , the dgp-3600bm pump system including the srd-3600 system for solvent autodegasser , the vwd-3400rs uv / vis photometer and the tcc-3000sd thermo - controlled column compartment were used . in this work , we compared three different strong anion exchange ( sax ) columns : the as24 , the as11-hc and the as15 ( ionpac series , thermo - fisher scientific ) that were chosen according to their chemical / physical characteristics . the as24 ( 2 250 mm , 2000 pore size ) is a low bleed column primarily designed for the separation of environmental ions as well as for ion chromatography separation coupled with mass spectrometry . as24 is a high capacity ( 140 eq ) analytical column and it is compatible with ph 014 eluents and samples ( table 1 ) . it consists in a supermacroporous resin with alkanol quaternary ammonium ions as functional groups , which are ultralow hydrophobic . it uses hyperbranched chemistry with extremely hydrophilic architecture whereas as11-hc and as15 used aromatic monomers and are thus significantly more hydrophobic . finally , the as25 is very similar to as24 but it is the most hydrophilic member of the product family ( ionpac as25 , 2 250 mm , 2000 , 87.5 eq of capacity ) but has a lower capacity . it was tested to confirm that the hydrophilic architecture of as24 improves the orthogonal separation of tryptic peptides . to compare the results of sax / rp with ( high ph ) rp/ ( low ph ) rp , two reversed - phase columns were tested off - line in the first dimension , which differ in matrix composition . in this work , acclaim 120 c18 ( a conventional rp , 3 m , 120 , 2.1 150 mm , thermo - fisher scientific ) and acclaim rslc polar advantage ii -pa2- ( a polar - embedded rp , 2.2 m , 120 , 2.1 100 mm , thermo - fisher scientific ) columns were used to separate tryptic digested proteins from raw264.7 cell lysate . while both c18 columns are based on ultrapure silica , acclaim pa2 has the advantage to have specially designed amide - embedded ligands . those features make the column compatible with 100% aqueous environments over a wide range of ph ( 1.510 ) , exhibiting high polarity for selectivity complementary to conventional rp columns . the acclaim pa2 column provided higher efficiencies than the acclaim 120 c18 column ( supporting information , figure s1 ) and therefore it was chosen for the comparison with the as24 . for the off - line 2d lc , a highly resolving c18 column was used ( gemini - c18 , 3 m , 110 , 3 250 mm , phenomenex ) . this column uses ultrapure spherical silica particles and can operate at wide ph range ( 112 ) increasing method development flexibility . peptide separation on the off - line 1d separation system employing strong anion exchange was achieved with a flow rate of 0.25 ml / min ( solvent a : 20 mm tris - hcl ph 8.0 ; solvent b : 20 mm tris - hcl ph 8.0 , 1 m nacl ) . a gradient ( slope 7 for 6-mix , 8 for raw264.7 cells ) spanning 0100% mobile phase b over 35 min was used . in case of high ph rp , separation was based on an acetonitrile ( acn ) gradient ( solvent a : 20 mm nh4oh / h2o , ph 10.0 ; solvent b : 20 mm nh4oh / acn , ph 10.0 ) at the same flow rate ( 0.250 ml / min , 080% b in 35 min ) . when the acclaim 120 was tested , the acn gradient was set at 580% b for 35 min . the off - line 2d was commonly performed at ph 2.5 ( solvent a : 0.1% tfa / h2o ; solvent b : 0.08% tfa / acn ) at a flow rate of 0.4 ml / min and a multistep gradient of 35 min : 515% b in 5 min , following by 30 min up to 90% b. all chromatograms were recorded by a uv detector at 214 nm . off - line 1d - fractions ( either sax without further handling or high ph rp , after drying down and resuspension in 0.1% tfa ) from the raw264.7 cell lysate were run online on an orbitrap velos pro ( thermo - fisher scientific ) . all nanoflow chromatography was performed on an ultimate 3000 nano lc system ( thermo - fisher scientific ) , using an acclaim pepmap 100 ( 75 m i d 500 mm , 3 m c18 ) in conjunction with an acclaim c18 pepmap trapping column ( 100 m i d 20 mm , 5 m c18 ) ( thermo - fisher scientific ) . linear gradient elution was performed using buffer a ( 0.1% formic acid ) and buffer b ( 0.08% formic acid , 80% acn ) starting from 5% buffer b to 35% over 277 min at a flow rate of 300 nl / min . a coated silica tip ( new objective , woburn , ma ) was used for electrospraying the sample into the mass spectrometer , at an ion spray voltage of 1.45 kv . ms analysis was operated in data dependent mode , such that the top 20 most abundant precursors in each ms scan were subjected to ms / ms ( cid in the linear trap , normalized collision energy = 35% , precursor isolation width = 2 da , intensity threshold for precursor selection = 2000 ) . as global parameters , precursor ions between m / z 4002000 were selected , at resolution of 60000 collected in profile mode . dynamic exclusion was enabled with a repeat count of 1 and exclusion duration set to 60 s. the lock mass feature was enabled for m / z = 445.120025 ( [ si(ch3)2o]6 ) as the internal calibrant ion . the data analysis of all ms / ms proteomics data sets was performed through the trans - proteomic pipeline ( tpp ) as previously described . briefly , mass spectrometry raw output files were first converted to mzxml by readw and afterward searched through the x!tandem ( cyclone 2011.12.01 ) search engine with k - score plug - in . data was searched against a randomized forward and reverse ipi mouse database ( version 3.87 ) and x!tandem parameters included cysteine carbamylation as fixed modifications , methionine oxidation and asparagine / glutamine deamidation were set as variable modifications . cyclization of glutamine / glutamic acid at the n - termini ( pyroglutamate ) was automatically searched , since tandem automatically checks for formation of pyroglutamic acid , that is , the loss of water ( e ) or ammonia ( q ) , respectively , when a peptide starts with e or q. this modification is considered to be an n - terminal modification only , so it does not affect any potential modifications specified for q , e or c. search parameters specified a precursor mass tolerance of 25 ppm ( required by tpp , typical mass accuracy was < 2 ppm ) , a ms / ms tolerance at 0.4 da and full trypsin specificity allowing for up to 2 missed cleavages . peptideprophet was then used to validate the search engine results and to assign accurate probabilities to peptide results were filtered at a calculated 1% fdr on the peptide level and then protein level . data were imported into r ( v2.11.0 ) , an open source platform for statistical analysis ( http://www.r-project.org ) and graphs were plotted using the ggplot2 library . for identification via andromeda , raw - files were loaded into maxquant 1.3.0.5 and searched against the same ipi mouse database ( version 3.87 ) . variable and fixed modifications were the same as above ; precursor mass accuracy was set to 6 ppm , ms / ms tolerance to 0.4 da and trypsin specificity allowing for up to 2 missed cleavages . false - discovery rate was set to 0.05 for peptides and 0.01 for proteins . from a range of 12 high - capacity hydroxide - selective anion - exchange columns ( ionpac series , thermo - fisher scientific ) which were initially developed for the separation of small organic and haloacetic acids and inorganic anions , we tested three members ( as24 , as11-hc and as15 ) for the use in off - line fractionation in a proteomics setting . these columns all contain the same functionality of alkanol quaternary ammonium ions , but differ in backbone hydrophobicity , with as24 exhibiting ultralow hydrophobicity , as11-hc medium hydrophobicity and as15 high hydrophobicity . in initial experiments we injected 180 g of a tryptic digest of six proteins fractions were automatically collected and reinjected onto a c18 rp column using an ultimate 3000 hplc ( thermo - fisher scientific ) and data acquired on a uv detector . with the use of chromeleon software ( v6.8 ) , 2d retention maps were created by which the evaluation of the peptide distribution over the two dimensions was possible . retention maps showed a highly orthogonal separation by as24as shown by the wide distribution over the two - dimensional space some separation by as11-hc and almost full retention of peptides on as15 even when eluted with 1 m nacl ( figure 1a ) . as the functionality in all three materials is identical , the difference of separation efficiency must depend on their differences in hydrophobicity . indeed , addition of at least 25% acn to the mobile phase allowed elution of tryptic peptides from as15 and improved elution from as11-hc ( figure 1b ) , showing that high hydrophobicity of the chemical backbones of these columns hampers the use for separation of peptides . furthermore , the most hydrophilic member of the ion exchange materials in this line ( as25 ) performs similarly well as as24 ( supporting information , figure s2 ) which led us to conclude that both the hydrophilicity in conjunction with the ion exchange functionality are important for the high orthogonality of this type of chromatography that we termed hydrophilic strong anion exchange ( hsax ) chromatography . ( a ) 2d retention maps of peptides of a 6-protein mix digest show that elution with up to 1 m nacl in absence of organic solvent leads to high orthogonality for as24 ( ultralow hydrophobicity ) , but part and full retention of peptides by as11-hc ( medium hydrophobicity ) and as15 ( high hydrophobicity ) , respectively . ( b ) addition of 25% acetonitrile ( acn ) into the elution buffer enhances elution from as11-hc and as15 . ( c ) three replicate injections on as24 over the course of 48 h show high reproducibility . ( d ) increasing amounts of protein digest loaded on as24 show good linear behavior without peak broadening . as the functional groups are primarily quaternary amines , changes of ph have no to little effect on column chemistry , but will change the available negative charge on peptides . when the mobile phase was adjusted to ph 3 , a major breakthrough was observed in 2d retention maps , which was absent at ph 8 . furthermore , acidic ph in sample solution , while keeping the mobile phase at ph 8 , or changing the mobile phase to ph 10 reduced retention of peptides or had no beneficial effect ( supporting information , figure s3 ) . we therefore performed all following experiments in 20 mm tris - hcl , at ph 8 . this has actually the benefit that tryptic digestion of the cell lysate can be performed at 20 mm tris - hcl , ph 8 and directly injected on the column , avoiding solid phase extraction or lyophilization and , therefore , minimizing sample loss . now that running conditions were optimized , we calculated the column efficiency of the as24 on a digested peptide mixture from bsa ( supporting information , figure s4 ) and we analyzed the run - to - run reproducibility and linearity which is required for quantitative proteomics experiments , using replicate injections of digested 6-mix samples over a period of 48 h ( figure 1c ) and injections of increasing material ( figure 1d ) . in both cases , as24 showed very high reproducibility ( supporting information , figure s5 ) and good linearity ( supporting information , figure s6 ) . after optimized parameters were established , the method was applied to a very complex mixture , a total cell lysate of the mouse macrophage cell line raw264.7 . tryptic peptides of 200 g of cell lysate were separated on the as24 column in a 35 min gradient from 0 to 1 m nacl ( 34 fractions ) which were automatically collected and injected onto a gemini c18 column ( phenomenex ) . 2d retention maps show a very high orthogonality of separation between the two chromatographic dimensions ( figure 2a ) , displayed by the elution of peptides over the entire 2d map . separation of total cell lysate digests by hsax and a high ph / low ph reversed phase approach show differences in orthogonality . tryptic raw264.7 macrophage cell lysate digests were separated on an as24 sax column ( a ) or an acclaim pa2 rp column at ph 10 ( b ) . thirty - four fractions of both first dimensions were separated in the second dimension by reversed phase chromatography at ph 3 . furthermore , we separated the same cell lysate digest on two different columns using high ph ( ph 10)/ low ph ( ph 3 ) rp / rp chromatography ( supporting information , figure s1 ) which has shown good orthogonality in the past and is currently seen as the gold standard in two - dimensional separation due to its high resolution . we then optimized elution parameters and chose the acclaim pa2 ( thermo - fisher scientific ) as it performed best , likely due to its higher polarity than the conventional c18 ( acclaim 120 , thermo - fisher scientific ) . then we compared its orthogonality to the as24 ion exchange column using 2d peptide maps using identical run time and numbers of fractions ( figure 2b ) . 2d retention maps show that the hsax / rp approach performs considerably better than the rp / rp approach , as a much greater area in the 2d maps is covered with peaks , while peptides in the rp / rp approach are scattered around the diagonal . this provides further evidence that high ph rp / low ph rp can not be fully orthogonal , as both dimensions separate according to hydrophobicity . recent approaches to concatenate early and late fractions of high ph rp to increase orthogonality have improved results ; however , concatenation involves user interference and might provide problems in quantitative proteomics experiments when the same peptides are then present in non - neighboring fractions as quantitative proteomics software such as maxquant requires peptides to be in neighboring fractions for accurate quantitation . in order to test both hsax and high ph rp approaches for their performance in a proteomics experiment , we injected aliquots ( 36% , corresponding to 300400 ng of protein digest ; 1 10 base peak chromatogram ) of each of the 34 fractions of the raw264.7 cell lysate separated by hsax or high ph rp onto an orbitrap velos pro mass spectrometer , using 300 min gradients on a 75 m 50 cm pepmap c18 column ( thermo - fisher scientific ) , corresponding to one week of instrument time each . online separation of hsax and high ph rp fractions showed a similar degree of orthogonality comparable to the offline 2d chromatography ( supporting information , figure s7a and b ) . ms / ms spectra were searched against the mouse ipi database v3.87 using x!tandem . results were filtered at peptide- and proteinprophet estimated 1% fdr . while we identified with the rp / rp approach 99110 peptides and 8627 proteins ( 1% fdr ) , the hsax approach resulted in identification of 126318 unique peptides and 9469 proteins , representing 28% and 10% more identifications respectively ( table 2 and supporting information , table s1 ) , while keeping the average sequence coverage equal ( 31% respectively 32% ) ( supporting information , figure s8 ) . combining both approaches , we identified 159847 peptides and 9871 proteins showing that we could increase the number of peptides and proteins identified by only 20% and 4% respectively compared to hsax alone ( table 2 ) . in addition , we analyzed the data using the andromeda search engine included in maxquant which identified overall 68% less proteins and peptides in each experiment , but confirmed the superiority of our sax approach ( table 2 and supporting information , table s1 ) . this data compares well to two recent publications in which about similar number of proteins were identified from a mammalian cell line using 3 different proteases and 2 weeks of instrument time or in which samples were analyzed repeatedly with inclusion lists . unique proteins ( fdr 1% ) according to proteinprophet ( x!tandem ) and maxquant ( andromeda ) . unique nonstripped peptides ( fdr 1% ) according to peptideprophet ( x!tandem ) and maxquant ( andromeda ) . number differing from figure 4a due to fdr recalculation on combined pep.xml ( peptideprophet ) . the high orthogonality of the hsax approach is not only shown by the broad distribution in the 2d peptide maps , but also exemplified by the fact that we identified more than 3000 proteins in 16 out of 34 fractions , while the rp / rp approach achieved this for only 6 fractions ( figure 3a ) . data also indicated that we could have saved instrument time by combining the last 5 fractions , which could have reduced run time by almost another day . the hsax approach also showed a considerably higher number of proteins ( 7292 vs 6315 in rp / rp , + 15% ) that were identified with 3 and more peptides which considerably improves identification and quantitation in proteomics experiments . comparison of protein and peptide identifications from off - line separation by either hsax / rp or rp / rp and lc ms experiments . ( a ) the high orthogonality of the hsax approach is exemplified by the identification of more than 3000 proteins in 16 out of 34 fractions , outperforming rp / rp approach ( 6 out of 34 fractions ) . ( b ) moreover , the hsax was comparable to the rp / rp approach in separating peptides in a single fraction ( 69% of rp peptides were present in one fraction compared to 55% for the hsax approach ) , which is beneficial for quantitative proteomics experiments . as quantitative proteomics performs best when peptides are only present in one fraction , we tested how many peptides were only identified in a single fraction . here , the rp / rp approach expectedly outperformed the hsax approach , showing a higher resolution as 69% of peptides were present in one fraction compared to 55% for the hsax approach ( figure 3b ) . only 18.5% ( hsax ) and 11.6% ( rp ) of all peptides respectively were identified in 3 or more fractions . in addition , separate experiments with dimethyl - labeled proteome samples indicated that deuterated samples do not change retention time in hsax chromatography as they can do in rp experiments ( data not shown ) , which can potentially separate light and heavy forms of isotopically labeled peptides into neighboring fractions complicating peptide quantitation . interestingly , the two techniques seem to favor certain subsets of peptides as only 58679 peptides ( 46% for hsax and 60% for rp ) are shared among the two approaches ( figure 4a ) . to further identify the characteristics of these subsets , we analyzed which amino acids were over - represented in the data sets unique to each approach ( supporting information , figure s9 ) and identified peptides with a higher number of acidic residues to be the major contributor to the difference ( figure 4b ) . furthermore , the peptides identified by the hsax approach matched much better to an in silico digest of all proteins of the mouse ipi database ( figure 4b ) , suggesting that the hsax approach allows for the identification of more representative peptides of the total proteome than the rp / rp approach . hsax / rp and rp / rp lead to the identification of different peptide subsets . ( a ) both hsax and rp approaches lead to the identification of different subsets of peptides with only about half the peptides identified in the two approaches ( please note : number of combined peptides higher than in table 2 due to fdr recalculation ) ( proportional venn diagram has been produced using bioinforx ) . ( b ) in - depth analysis of the amino acid distribution in the subset of unique peptides revealed that hsax favored more acidic peptides than rp , a trend that is more representative to the in - silico tryptic digestion of the whole ipi database . ( c ) moreover , both hsax and rp approaches showed similar peptide charge state distribution over the whole gradient , favoring doubly and triply charged peptide ions . finally , we tested how separation via hsax affected the charge - state distribution of peptide ions in mass spectrometry over the gradient . unlike scx , peptides fractionated by sax should not show a charge - distribution as the negative charges by which the peptides were separated in the first dimension at ph 8 do not affect electrospray ionization ( esi ) after separation at ph 3 in the second dimension , where basic residues are critical . evaluation of peptide charge states showed that peptides separated by both hsax and rp / rp showed a relatively even charge state distribution over the whole gradient ( figure 4c ) . this is of great advantage as the identification of doubly and triply charged peptide ions is highly favored in esi ms / ms compared to singly and highly charged ions which populate , for example , early and late fractions of scx experiments . in this work we demonstrate that hydrophilic strong anion exchange chromatography provides a robust and reproducible separation of complex protein digest samples for proteomics analysis . its very high orthogonality proved to be superior to an optimized high ph rp / low ph rp approach and enabled us to identify > 9,000 proteins from raw264.7 mouse macrophage cell lysate in just one week of mass spectrometry instrument time which will allow a better comparison of proteomics and transcriptomics data . in the future , we will test the applicability of the hsax material for online 2d lc - ms and the separation of complex mammalian proteomes for quantitative proteomics as well as phosphopeptide analysis .
the markhor ( capra falconeri ) is an endangered wild goat in a continuous decline ; the global population is < 2,500 mature animals ( 5 ) . in tajikistan , < 350 animals may survive in fragmented subpopulations in the remote hazratishoh and darvaz mountain ranges along the afghanistan border ( 6 ) . they live sedentarily over relatively small home ranges , moving < 5 km per day ( 7 ) . throughout its range , the markhor has to forage in close proximity to domestic goats ( 8) and is therefore prone to infections of contagious agents transmitted by these animals . during september 17october 18 , 2010 , eleven markhors that displayed labored breathing and 64 markhors that had recently died were found in 5 localities ( table ) in the district of shuroabad , khatlon province , usually in close proximity to water sources ( figure 1 , panel a ) . all but 4 carcasses were too scavenged for thorough examination in the field , and 1 dying adult female was sent on september 20 to the republican veterinary laboratory in dushanbe for necropsy . the most relevant necropsy findings noted in the field were the following : an abundant serous to mucopurulent nasal discharge ; and , internally , severe pneumonia associated with a variable level of pleural fluid . the female markhor examined in dushanbe showed gray areas of consolidations in the apical and cardiac lobes of the right lung and yellow pleural fluid ( figure 1 , panel b ) . the cut surface of the affected lobes revealed a fine granular texture , and mucopurulent exudate could be expressed from the bronchi . regarding indications of ccpp , although gross lesions were limited to the thoracic cavity , fibrinous pleurisy ( 9 ) was not observed . the histopathologic findings were consistent with proliferative interstitial pneumonia associated with multifocal suppurations ( figure 1 , panel c ) . findings included diffuse thickening of the interlobular septa , alveolar epithelialization , and polymorphonuclear leukocytes in alveolar and bronchiolar spaces ( figure 1 , panel d ) . also , disseminated and abundant neutrophil infiltration of alveolar spaces was found that , when ruptured , created multifocal nodules . the left lung was congested . 13 adult males , 6 adult females , 4 juveniles ( < 1 year of age ) . a ) adult male markhor found dead with signs of pneumonia and no indications of emaciation . b ) disseminated gray areas of consolidation in the cardiac lobe of the right lung with mucopurulent exudate in bronchi . c ) diffuse proliferative interstitial pneumonia associated with a lesion of suppuration ( hematoxylin and eosin stain ; original magnification 40 ) . d ) interstitial pneumonia showing fibrotic thickening of alveolar walls and epithelialization of pneumocytes ( hematoxylin and eosin stain ; original magnification 250 ) . no bacteria were isolated from pleural fluid that was obtained aseptically and inoculated onto 5% sheep blood agar . however , when a healthy 5-month - old domestic goat ( c. hircus ) was inoculated intratracheally with 5 ml of this pleural fluid , pneumonia developed within 8 days . to evaluate the possibility that the outbreak might have been caused by m. capricolum subsp . capripneumoniae , which was first identified in tajikistan in 2009 ( 10 ) , samples were sent to centre de coopration international en recherche agronomique pour le developpement , montpellier , france , a reference laboratory for ccpp for the world organisation for animal health . pleural fluid from the markhor was centrifuged at low speed ( 500 g for 10 min ) to eliminate inflammatory cells , and dna was extracted from the supernatant with the dneasy blood and tissue kit ( qiagen , courtaboeuf , france ) , according to the manufacturer s instructions . capripneumoniae , provided negative results , whereas a partial 16s rrna gene sequence could be amplified and sequenced ( 12 ) . blast analysis ( http://blast.ncbi.nlm.nih.gov/blast.cgi ) showed that the sequence corresponded to that of a mycoplasma from the m. mycoides cluster . markhor pleural fluid and lung tissue from the domestic goat were then injected into modified hayflick broth ( 1 ) and onto agar plates and incubated at 37c in 5% co2 . typical mycoplasma colonies appeared on solid medium after 12 days . a clone from the markhor culture , named 10074 ( 1.4 ) , was used for pcr amplification and sequencing of fusa , glpq , gyrb , lepa , and rpob partial gene sequences as described ( 1 ) . : hq882179 ( glpq ) , hq882180 ( gyrb ) , hq882181 ( lepa ) , hq882178 ( rpob ) . the 5 protein - coding sequences were then concatenated and incorporated in the m. mycoides cluster phylogenetic tree ( figure 2 ) . the strain clustered with m. capricolum subsp . the isolate from the inoculated domestic goat was undistinguishable from 10074 ( 1.4 ) by sequencing of the 5 housekeeping genes . phylogenetic tree of the mycoplasma mycoides cluster , including the isolate from markhor ( capra falconeri ) 10074 ( 1.4 ) in tajikistan , 2010 , together with available m. capricolum subsp . capricolum strains , as well as type strains corresponding to other species or subspecies from this cluster and m. putrefaciens , used as outgroup . the tree , derived from distance analysis of 5 concatenated protein - coding sequences ( fusa , glpq , gyrb , lepa , rpob ) , was constructed by using the neighbor - joining algorithm . bootstrap percentage values were calculated from 500 resamplings , and values > 90% are indicated . note that the branch corresponding to the outgroup has been shortened , as indicated by 2 parallel bars . the pattern of inflammation in the right lung in the necropsied markhor was consistent with m. capricolum subsp . capricolum respiratory infection in domestic goats ( 2 ) , and the presence of m. capricolum subsp . capricolum in pleural fluid , the lack of findings indicative of alternative etiologic agents , and the reproduction of the disease in the domestic goat with isolation of m. capricolum subsp . although because of difficult field conditions , only 1 markhor could be thoroughly investigated , these findings support the hypothesis that m. capricolum subsp . capricolum , a newly recorded pathogen in free - ranging wild ruminants , may be responsible for the pneumonia epizootic observed in endangered markhors . this outbreak claimed 20% of the population remaining in tajikistan , and more markhor deaths might have remained undetected . the source of mycoplasma infection in markhors is unknown , but domestic goats , which have contact with markhors , particularly in the summer , might have been responsible for the emergence of m. capricolum subsp . a disease resembling ccpp affected domestic goats and , to a lesser extent , sheep in shuroabad district ( < 40 km from the area where the dead markhors were found ) with a case - fatality rate of 20%30% ( 13 ) . however , the origin of this outbreak could not be investigated . although the clinicopathologic features of the disease in the markhors resembled ccpp , m. capricolum subsp . in fact , several mycoplasmas have been associated with respiratory diseases in ruminants , including m. capricolum subsp . further testing should evaluate the presence of sick animals or asymptomatic carriers of m. capricolum subsp . environmental and nutritional stressors may exacerbate the susceptibility of ruminants to mycoplasma infections ( 2,15 ) . the disease appeared at the end of summer , when markhors are forced by livestock and guard dogs to retreat to suboptimal habitats with poor forage ( 8) . it was also the end of the dry season , when markhors may have contact with livestock at the few remaining water sources . findings from this study support the conclusion that the markhor is vulnerable to m. capricolum subsp . capricolum . in the generalized context of increasing encroachment of livestock into wild habitats , markhors and other wild caprines this case emphasizes the need for continuous disease surveillance in domestic animals that have contact with valuable wildlife resources .
all of the subjects underwent a comprehensive ophthalmologic examination , which included best - corrected visual acuity ( bcva ) ; slit - lamp biomicroscopy ; refraction measurement using auto refraction , calculation of the spherical equivalence ( se ) based on the spherical diopter ( d ) plus one - half of the cylindrical dioptric power ; dilated fundus examination ; and measurement of iop using a noncontact tonometer . the subjects ' heart rate and blood pressure were also recorded at the time of oct imaging . the mean arterial pressure ( map ) was calculated as the diastolic blood pressure plus one - third of the difference between the diastolic blood pressure and the systolic blood pressure . the ocular perfusion pressure ( opp ) subjects were included in the study if their bcva was 16/20 or better and se was between + 1 and 3 d. subjects with any of the following were excluded : history of ocular surgery or trauma ; bcva less than 16/20 ; iop greater than 21 mm hg ; family history of glaucoma in a first - degree relative ; signs of myopic degeneration or a pathologic form of myopia ; other ophthalmic diseases ; or the presence of any systemic disease that might affect blood flow , such as diabetes mellitus , hypertension , and migraine . the study was approved by the institutional review board of the eye and ent hospital of fudan university ( shanghai , china ) , and conformed to the tenets of the declaration of helsinki . optical coherence tomography angiography scans were obtained using a spectral - domain ( sd ) system ( rtvue - xr avanti ; optovue , fremont , ca , usa ) . this system has an a - scan rate of 70 khz with a light source centered at a wavelength of 840 nm and a bandwidth of 45 nm . optic disc ( 4.5 4.5 mm ) and macular ( 6 6 mm ) oct angiography scans were acquired by two repeated b - scans at 304 raster positions , and each b - scan consisted of 304 a - scans . two volumetric raster scans were taken consecutively , with one in the horizontal priority ( x - fast ) and one in the vertical priority ( y - fast ) . motion artifacts were removed by three - dimensional ( 3d ) orthogonal registration and by merging the pair of scans . en face retinal angiograms were created by projecting the flow signal internal to the retinal pigment epithelium . all of these procedures were achieved using the rtvue - xr avanti software . in this study , the vessel area density was measured for two retinal regions : the peripapillary and parafoveal areas ( fig . the peripapillary region was defined as a 700-m wide elliptical annulus extending outward from the optic disc boundary ( fig . the parafoveal region was defined as an annulus with an outer diameter of 3 mm and an inner diameter of 1 mm ( fig . the capillary - free zone ( cfz ) was outlined and measured in images taken at a magnification of 4 , as previously described , using imagej software ( http://imagej.nih.gov/ij/ ; provided in the public domain by the national institutes of health , bethesda , md , usa ; fig . en face oct angiograms of ( a ) the peripapillary region ; ( b ) fovea and parafoveal regions ; and ( c ) cfz . the retinal thickness at the macula and rnfl thickness at the peripapillary was also measured in all subjects . the rnfl thickness was obtained along a 3.45-mm diameter circle centered on the optic disc using the same rtvue - xr avanti system used to measure retinal perfusion . retinal nerve fiber layer thickness was automatically calculated using the built - in software as the mean thicknesses of the whole circle . the retinal thickness of the macular area was measured using the spectralis sd - oct ( heidelberg engineering , vista , ca , usa ) with a posterior pole volume scan with 97 raster lines . each line comprised 30 averaged scans , covering an area of 30 25. the foveal region refers to a circular region with a diameter of 1 mm centered on the fovea . full retinal thickness was measured from the internal limiting membrane ( ilm ) to the outer boundary of the retinal pigment epithelium ( rpe ; supplementary fig . the inner retinal thickness was measured from the ilm to the outer boundary of the inner nuclear layer ( inl ; supplementary fig . the spectralis software automatically calculates the full retinal thickness and the thicknesses of each retinal layer ( 11 different layers ) . the inner retinal thicknesses of the foveal and parafoveal regions were calculated by summing the rnfl , ganglion cell layer ( gcl ) , inner plexiform layer ( ipl ) , and inl thicknesses . pearson 's correlation test and linear mixed - models were used to determine the relationships of iop , se , opp , heart rate , age , and retinal thickness ( rnfl and inner / full retinal thicknesses of the fovea / parafovea ) with the vessel area density of the relevant regions . linear mixed - models were used to estimate the changes in vessel area density , and cfz as dependent variables , for each 1 sd change in retinal thickness as the independent variable . the analyses were adjusted for iop , se , opp , heart rate , and age . all of the subjects underwent a comprehensive ophthalmologic examination , which included best - corrected visual acuity ( bcva ) ; slit - lamp biomicroscopy ; refraction measurement using auto refraction , calculation of the spherical equivalence ( se ) based on the spherical diopter ( d ) plus one - half of the cylindrical dioptric power ; dilated fundus examination ; and measurement of iop using a noncontact tonometer . the subjects ' heart rate and blood pressure were also recorded at the time of oct imaging . the mean arterial pressure ( map ) was calculated as the diastolic blood pressure plus one - third of the difference between the diastolic blood pressure and the systolic blood pressure . the ocular perfusion pressure ( opp ) subjects were included in the study if their bcva was 16/20 or better and se was between + 1 and 3 d. subjects with any of the following were excluded : history of ocular surgery or trauma ; bcva less than 16/20 ; iop greater than 21 mm hg ; family history of glaucoma in a first - degree relative ; signs of myopic degeneration or a pathologic form of myopia ; other ophthalmic diseases ; or the presence of any systemic disease that might affect blood flow , such as diabetes mellitus , hypertension , and migraine . the study was approved by the institutional review board of the eye and ent hospital of fudan university ( shanghai , china ) , and conformed to the tenets of the declaration of helsinki . optical coherence tomography angiography scans were obtained using a spectral - domain ( sd ) system ( rtvue - xr avanti ; optovue , fremont , ca , usa ) . this system has an a - scan rate of 70 khz with a light source centered at a wavelength of 840 nm and a bandwidth of 45 nm . optic disc ( 4.5 4.5 mm ) and macular ( 6 6 mm ) oct angiography scans were acquired by two repeated b - scans at 304 raster positions , and each b - scan consisted of 304 a - scans . two volumetric raster scans were taken consecutively , with one in the horizontal priority ( x - fast ) and one in the vertical priority ( y - fast ) . motion artifacts were removed by three - dimensional ( 3d ) orthogonal registration and by merging the pair of scans . en face retinal angiograms were created by projecting the flow signal internal to the retinal pigment epithelium . all of these procedures were achieved using the rtvue - xr avanti software . in this study , the vessel area density was measured for two retinal regions : the peripapillary and parafoveal areas ( fig . the peripapillary region was defined as a 700-m wide elliptical annulus extending outward from the optic disc boundary ( fig . the parafoveal region was defined as an annulus with an outer diameter of 3 mm and an inner diameter of 1 mm ( fig . the vessel area density was calculated as previously described . the capillary - free zone ( cfz ) was outlined and measured in images taken at a magnification of 4 , as previously described , using imagej software ( http://imagej.nih.gov/ij/ ; provided in the public domain by the national institutes of health , bethesda , md , usa ; fig . en face oct angiograms of ( a ) the peripapillary region ; ( b ) fovea and parafoveal regions ; and ( c ) cfz . the retinal thickness at the macula and rnfl thickness at the peripapillary was also measured in all subjects . the rnfl thickness was obtained along a 3.45-mm diameter circle centered on the optic disc using the same rtvue - xr avanti system used to measure retinal perfusion . retinal nerve fiber layer thickness was automatically calculated using the built - in software as the mean thicknesses of the whole circle . the retinal thickness of the macular area was measured using the spectralis sd - oct ( heidelberg engineering , vista , ca , usa ) with a posterior pole volume scan with 97 raster lines . each line comprised 30 averaged scans , covering an area of 30 25. the foveal region refers to a circular region with a diameter of 1 mm centered on the fovea . full retinal thickness was measured from the internal limiting membrane ( ilm ) to the outer boundary of the retinal pigment epithelium ( rpe ; supplementary fig . the inner retinal thickness was measured from the ilm to the outer boundary of the inner nuclear layer ( inl ; supplementary fig . the spectralis software automatically calculates the full retinal thickness and the thicknesses of each retinal layer ( 11 different layers ) . the inner retinal thicknesses of the foveal and parafoveal regions were calculated by summing the rnfl , ganglion cell layer ( gcl ) , inner plexiform layer ( ipl ) , and inl thicknesses . pearson 's correlation test and linear mixed - models were used to determine the relationships of iop , se , opp , heart rate , age , and retinal thickness ( rnfl and inner / full retinal thicknesses of the fovea / parafovea ) with the vessel area density of the relevant regions . linear mixed - models were used to estimate the changes in vessel area density , and cfz as dependent variables , for each 1 sd change in retinal thickness as the independent variable . the analyses were adjusted for iop , se , opp , heart rate , and age . a total of 121 eyes in 64 healthy chinese subjects were included in this study . the subjects ( table 1 ) included 28 males ( 53 eyes ) and 36 females ( 68 eyes ) . the mean age was 38 13 years ( range , 2062 years ) . the mean iop was 14.4 2.5 mm hg ( range , 921 mm hg ) , and the mean se was 0.7 1 d ( range , 3 to 1 d ) . the vessel area density of the parafoveal and peripapillary regions are listed in table 1 . clinical characteristics of the study population and optic coherence tomography measurements of retinal thickness / perfusion in the parafoveal region , vessel area density was significantly and positively correlated with the inner retinal thickness ( p < 0.05 , fig . this correlation remained statistically significant after adjusting for other factors , including age , se , hr , opp , and iop in the linear mixed - models ( p < 0.05 ; table 2 ) , and the vessel area density was weakly correlated with se ( p = 0.031 , table 2 ) . by contrast , the vessel area density was not significantly correlated with the thickness of the full retina in the parafoveal region ( p > 0.05 , supplementary table s1 ) . the linear mixed - models revealed that each 1 sd decrease in the inner retinal thickness was associated with a 1.3% decrease in vessel area density in the parafoveal region . ( a ) the vessel area density was positivity correlated with inner retinal thickness in the parafoveal region . ( b , c ) the cfz area was negatively correlated with the inner retinal thickness and the full retinal thickness in the fovea . ( d ) the peripapillary vessel area density was positivity correlated with the rnfl thickness . relationship between retinal perfusion and the inner retinal thickness in the parafoveal region the cfz area was negatively correlated with the inner thickness and the full thickness of the fovea ( both p < 0.001 , figs . 2b , 2c ) , and these correlations remained significant in the linear mixed - models ( both p < 0.001 , tables 3 and 4 ) . the cfz area was positively correlated with age ( p < 0.05 , table 4 ) , but not with the other variables ( tables 3 and 4 ) . each 1 sd decrease in the inner thickness and full thickness of the retina was associated with an increase in the cfz area of 146% and 128% , respectively . relationships between the capillary - free zone area and the inner retinal thickness in the fovea relationship between the capillary - free zone area and the full retinal thickness in the fovea the vessel area density of the parapapillary region was positively correlated with the rnfl thickness ( p < 0.001 , fig . 2d ) . these correlations remained statistically significant after the analysis was adjusted for other variables , including age , se , hr , opp , and iop in linear mixed - models ( p < 0.001 , table 5 ) . vessel area density was not correlated with any of the other variables ( all p > 0.05 , table 4 ) . each 1 sd decrease in rnfl was associated with a 1.6% decrease in the vessel area density . in this study , we used oct to examine whether retinal perfusion was correlated with the retinal thickness of the peripapillary and macular regions in a group of healthy chinese subjects . of note , we found that the blood supply from the central retinal artery system was closely correlated with the thickness of the inner neural retina . recently , oct angiography was shown to be an effective , noninvasive tool for monitoring blood flow in small retinal vessels . amplitude - decorrelation angiography is an amplitude - based oct angiography algorithm , which is based on variations in the reflectance amplitude . decorrelation of the oct signal amplitude between b - scans taken at the same nominal position could be caused by several sources : ( 1 ) regional blood flow , ( 2 ) bulk tissue motion or scanner position error , and ( 3 ) background noise . a signal corresponding to the true blood flow can be detected by suppressing decorrelation caused by ( 2 ) and ( 3 ) . the split - spectrum technique greatly reduces the scan time and improves the signal - to - noise ratio of flow detection , and makes it possible to obtain high - quality angiograms using a commercial oct system . in our study , this approach is convenient for both clinical research and practice , especially for examining retinal diseases characterized by vascular pathologies . however , the oct angiogram provided the macular perfusion of a 5 5 area and , although this system also determined the retinal thickness in the same dimension , it defined the inner retinal thickness as the thickness of retinal tissue from the ilm to the outer boundary of the ipl . notably , chan et al . reported that , in the posterior pole , the deepest capillaries were found in the deepest part of the inl . therefore , we used another sd - oct system ( spectralis ) , which could measure the thicknesses of 11 different layers of retina , and the retinal thickness between the ilm and the outer boundary of the inl could be calculated . unfortunately , the spectralis defines the perifovea as an annulus with an outer diameter of 6 mm and an inner diameter of 3 mm , whereas the oct angiogram defines the perifovea as smaller annulus with an outer diameter of 5 mm and inner diameter of 3 mm . , we found a strong correlation between the inner thickness and the perfusion of the retina . the close correlation between peripapillary blood flow and rnfl thickness observed in our study is consistent with the results reported by tham et al . and we then studied the correlation between retinal perfusion and inner retinal thickness in the macular region in detail . our finding that retinal perfusion was correlated with the inner retinal thickness but not with the full retinal thickness is consistent with the understanding that oxygen and nutrition demands of the inner retina are met by the central retinal artery system , while those of the outer retina are met by the choroidal vascular system . failed to find a correlation between blood flow velocity in retinal vessels and retinal thickness . by contrast , landa et al . reported that retinal volume was strongly correlated with the blood flow velocity in retinal vessels . the different parameters and techniques used in those studies could explain the differences in their results . however , the vessel area density is actually the mean value of a specific region ; accordingly , we used the mean thickness of that region , rather than the volume , which was not determined as the mean . it is possible that an increase in the retinal thickness might lead to an increase in oxygen and nutrient demands , and hence increase retinal perfusion . but , conversely , an increase in vessel volume might also translate into an increase in retinal thickness . the analyses showed that each 1 sd decrease in the inner retinal thickness was associated with a 1.3% to 1.6% decrease in the vessel area density . cheung et al . reported that each 1 sd decrease in the rnfl thickness was associated with a decrease in the arteriole and venule diameters by 0.62 pixels ( p < 0.01 ) and 0.99 pixels ( p < 0.01 ) , respectively . in that study , the mean arteriole and venule diameters were approximately 27 to 30 pixels and 38 to 41 pixels , respectively . therefore , the reductions in diameters were approximately 2.1% to 2.6% , similar to our results . reported marked variability in blood flow in the optic nerve head ( largest / smallest : 3.5 ) among individuals . this variability was greater than the variability in rnfl thickness ( largest / smallest : 2.22.3 ) in another study . , we found much smaller variability in perfusion parameters ( 1.21.5 ) , consistent with the small variability in retinal thickness ( 1.22.3 ; supplementary table s2 ) . the earlier studies measured blood flow in large vessels surrounding the disc . by contrast , we measured blood flow in the large vessels and in the small blood vessels , including capillaries . retinal tissue is directly supplied by small capillaries , and this might explain the consistent variability in our study . this finding agrees with those of the studies by chui et al . and tick et al . these findings are also consistent with the concept that the inner retina is supplied by the central retinal vasculature . but , the cfz area was also significantly and negatively correlated with the full retinal thickness of the fovea . although the reason for this is not fully clear , the strong correlation between the inner retinal thickness and the full retinal thickness of the fovea ( r = 0.815 , p < 0.001 ) might explain this finding . a strong correlation between the inner retinal thickness and the full retinal thickness was also found in the parafoveal ( r = 0.792 , p < 0.001 ) region , where perfusion was not correlated with full retinal thickness . recently reported that macular ischemia is often associated with photoreceptor damage in patients with diabetes . these findings suggest that future studies might be required to improve our understanding of the retinal perfusion at the fovea . a correlation between macular perfusion and age , which was observed in our prior study , was not apparent in the present study , possibly because many of the subjects ( 18/64 ) were younger than 25-years old . when we limited the analysis to subjects aged older than 35 years , we observed significant correlations between macular perfusion and age , and between macular perfusion and inner retinal thickness ( supplementary table s3 ) . reported a negative correlation between age and blood flow velocity in venules in subjects aged over 40 years , while kimura et al . found no correlation between blood flow and age in subjects aged less than 42 years therefore , the reduction in macular perfusion might be more prominent in older subjects , particularly those aged more than 35 to 40 years . although we examined correlations between retinal perfusion and retinal structure in this study , we did not assess the possible correlations with visual function , such as retinal sensitivity determined using a microperimeter . future studies on this aspect or development of oct angiogram might further improve our knowledge of retinal perfusion . in conclusion , we observed strong correlations between the perfusion parameters obtained by oct angiography and the inner retinal thicknesses in the macular and parapapillary regions . the techniques used here might be helpful in future studies of retinal diseases associated with vascular disorders .
atypical prostatic hyperplasia ( aph ) is a pseudoneoplastic lesion that can mimic prostate adenocarcinoma because of its architectural and cytological features . in this prostatic disease , there is an imbalance between prostate cell growth and apoptosis . the occurrence rate of aph is not known and its associations with benign prostatic hypertrophy ( bph ) and latent carcinoma of the prostate ( lpc ) have not been completely clarified . the fact that aph arises always in prostates with concomitant bph and exhibits several cancer - like features places aph as an intermediate lesion between bph and the subset of well - differentiated cancers in a hypothetical pathway between bph and lpc . the role of inflammation in prostate diseases is suggested by the presence of inflammatory cells within the bph . inflammation is usually a self - limited event , with initial proinflammatory cytokines , growth factor release , and angiogenesis followed by an anti - inflammatory cytokine - mediated resolution . there is an interest in the potential health benefits of allium vegetables , mainly onion ( allium cepa ) and garlic ( a. sativum ) . intake of allium vegetables may be inversely related to cancer at various sites , including prostate [ 7 , 8 ] . allium vegetables seem to have antiproliferative action on human cancers and to prevent diseases associated with aging . onions contain high levels of nonnutrient antioxidant compounds , flavonoids , and the alk(en)yl cysteine sulfoxides ( acsos ) , which have protective effects against different degenerative pathologies such as cardiovascular disease , cancer , and other dysfunctions based on oxidative stress . the uses of bulb in food and manufacture introduce tons of its scales ( red dried onion scales , ros ) as a waste product . recently , these scales have attracted the attention of many researchers to maximize the benefits of this waste material . ros contain large amounts of flavonoids , mainly ferulic , gallic , kaempferol , quercetin , quercetin dimer , quercetin trimer , and quercetin glycosides . these flavonoids are responsible for the reported antioxidant activity of ros which is comparable to that of -tocopherol [ 12 , 13 ] . they are also reported to have hepatoprotective effect , immune enhancement potential , anti - infectious , antistress and anticancer properties . most of the studies were done using an onion bulb per se , bulb extracts , or bulb juice without studying the protective effect of ro scales , the richest part of the onion with quercetin . the aim of this study was to investigate the protective effect of the ros extract on enlarged rat prostate and the histopathological changes related to inflammation , proliferation , and/or apoptosis in aph induced experimentally in rats . solvents of hplc grade used for hplc analysis , in addition to analytical grade solvents for extraction and thin layer chromatography ( tlc ) , were purchased from sigma - aldrich ( st . louis , mo , usa ) . antibodies against clusterin , phospho - smad2 , and -actin were obtained from santa cruz biotechnology ( santa cruz , ca ; anticlusterin for western blot analysis ) ; upstate biotechnology ( lake placid , ny ; anticlusterin for immunohistochemistry ( ihc ) ) ; and cell signaling technology inc . ( danvers , ma ) . antibodies against tgf-1 ligands were purchased from dakocytomation ( carpinteria , ca ) . testosterone was obtained from sigma - aldrich and dakocytomation ( carpinteria , ca ) , while saw palmetto was obtained from futurebiotics ( ny , usa ) . the red onion bulbs ( allium cepa l. , giza red cultivar ) were collected from a single field cultivated in sohag city , sohag governorate , egypt . it was cultivated in mid - november and collected in the beginning of may , 2010 . the fully grown bulbs were peeled and the ros were stored at 25c in a dark place till extraction . the plant sample was identified by a staff member of the horticulture department , faculty of agriculture , cairo university . ros powder ( 1250 g ) was extracted with 80% ethanol ( 3 5 liters ) by using ultra - turrax t50 homogenizer ( janke and kunkel , ika - labortechnik , staufen , germany ) at a temperature not exceeding 25c . the extract was concentrated by evaporation under reduced pressure , lyophilized to give 240 g of reddish semisolid residue , and protected from light at 4c to use later . preliminary phytochemical tests to identify the main chemical constituents were carried out according to the methods of trease and evans . chromatographic tlc profile of the methanolic extract was performed using thin layer chromatography ( solvent system : ethyl acetate - formic acid - glacial acetic acid - water , 100 : 11 : 11 : 26 ) as per fingerprinting using a chromatographic condition reported by wagner and bladt against common reference flavonoids available in the pharmacognosy department , faculty of pharmacy , cairo university . total phenolics were determined as mg gallic acid equivalent per gram dry extract ( mg gae / g de ) employing the folin - ciocalteu method described by singleton and rossi . aluminum chloride colorimetric assay described by hertog was applied for determination of total flavonoids content as mg quercetin equivalent per gram of dry extract ( mg qe / g de ) with a slight modification . the free radical scavenging activity of the extracts , based on the scavenging activity of the stable 1,1-diphenyl-2-picrylhydrazyl ( dpph ) free radical , was determined by the method described by braca et al . . the capability of the extracts to scavenge the dpph radical was calculated using the following equation : % inhibition = ( acontrol atest ) 100/acontrol . quercetin ( q ) and quercetin-4--o - d - glucoside ( qg ) were used as standard marker compounds . qg was separated from the ros extract and identified using a procedure reported by abou zid and elsherbeiny . hplc analysis was performed on agilent hp1200 series hplc system equipped with a g1322a quaternary pump and degasser , a g1314a variable wavelength uv detector , and 250 4.0 mm ( particle size 5 m ) ods column ( lichrospher 100 , merck , darmstadt , germany ) . chromatographic separation was achieved by applying a linear gradient system using mobile phase a ( 5% formic acid in water v / v ) and mobile phase b ( methanol ) . a linear gradient elution was performed using 50% mobile phase b for 10 min , rising to 80% b over 10 min , then to 100% b over 11 min , and back to 50% b. the flow rate was maintained at 1.0 ml / min and uv was monitored at 360 nm . adolescent male wistar rats , aged 5060 days , were obtained from the animal facility of king fahd research center , king abdulaziz university , jeddah , saudi arabia . they were used in the study according to the guidelines of the biochemical and research ethics committee at king abdulaziz university , in accordance with the nih guidelines . animals were housed in a well - ventilated , temperature - controlled room at 22 3c with a 12 h light - dark cycle . they were provided with standard rat chow pellets obtained from grain silos and flour mills organization f-1005 , jeddah , saudi arabia , and tap water ad libitum . all experimental procedures were performed between 810 a.m. and care was taken to avoid stressful conditions . the remaining stump was pushed back through the inguinal canal into the abdominal cavity , and the scrotal sac was closed by sutures . after castration , the rats were maintained under standard laboratory conditions for 7 days in order to allow a definite involution of the prostatic gland . aph was induced as previously described by engelstein et al . in castrated rats using citral and testosterone . rats were subcutaneously injected with testosterone propionate in corn oil ( 0.5 mg/0.1 ml / rat ) each day for 30 days . citral , 1 m diluted in 70% ethanol , was smeared on a different shaved area of skin , each time , on the back at a final dose of 185 mg / kg every 4 days for 30 days . control group rats were smeared with the solvent ( ethanol ) alone at the shaved skin . considering the pungent lime fragrance of citral , the control groups were kept in a separate location from the citral - treated animals to avoid possible false results as citral has some influence via the olfactory tract . seven days after castration , the animals were randomly divided into six groups ( n = 7 ) . group i served as a control ( shamed operation ) group and received both corn oil ( 0.1 ml / rat ) and 1% cmc - na ( 0.3 ml/100 g body weight ) daily during the period of the experiment . group ii served as negative control and received cmc - na 1% as previously mentioned . group iii served as positive control and received saw palmetto ( 100 mg / kg ) suspended in 1% cmc - na . groups from iv vi were treated with ros at doses of 75 , 150 , or 300 mg / kg / day , respectively , by oral gavage . all the ros extracts were suspended in 1% cmc - na and were given to rats once daily by oral gavage along with testosterone injection and citral smearing for 30 days as described before . after euthanization , ventral prostate of each rat in each group was removed from the body , 24 h after the last administration , and weighed . the half of the tissues were frozen in liquid nitrogen and stored at 75c until use . the remaining tissues were fixed immediately in 0.1 m phosphate - buffered 10% formalin ( ph 7.4 ) for 48 h and then embedded in paraffin and were used for histological studies . serial 4 m thick sections from each tissue specimen were prepared and mounted on poly - l - lysine coated glass slides . these were used for detection of il-6 , il-8 , tnf- , igf-1 , clusterin , and tgf-1 receptors in the prostatic tissue by immunohistochemistry . a part of the ventral lobes was separated and fixed overnight in stieve 's solution . thereafter , the tissue was thoroughly rinsed with water and immersed overnight in ethanol 70% . then , it was dehydrated , embedded in paraffin , and 5 mm thick sections were cut and stained by harris ' hematoxylin eosin , according to the standard procedures of lillie . a score - chart protocol ( histoscore ) developed by scolnik et al the examination , description , and scoring of the slides were performed in a blinded manner . the scoring system was presented in arbitrary units to make a better evaluation . in a second step , the cumulative score in each group was correlated to the final histological diagnosis in order to establish a score range for normal and hyperplasia . an additional histological inflammatory score described by de nunzio et al . score 0 : no inflammation , score 1 : scattered inflammatory cell infiltrate without nodules , score 2 : no confluent lymphoid , and score 3 : large inflammatory areas with confluence . hematoxylin and eosin staining was performed to observe histopathology . for analysis of il-6 and tgf-1 expression , sections from the paraffin embedded tissue blocks were mounted on charged glass slides and baked at 60c for 1 h in the oven , then mounted on the ventana staining machine , dewaxed by ez prep ( xylene substitute ) , and rehydrated . the tissue sections were heated in ventana buffer cc1 ( ph 6 ) to facilitate antigen retrieval and treated with h2o2 to eliminate endogenous peroxidase . this was followed by incubation for 60 min at room temperature with primary antibodies il-6 and tgf-1 . the dilutions used were il-6 ( dilution 1 : 50 ) and tgf-1 ( dilution of 1 : 25 ) . subsequently , the sections were incubated with biotinylated secondary antibody using the avidin - biotin complex method . the negative controls comprised serial sections that were stained using equivalent concentrations of nonimmune mouse igg in place of the primary antibodies . expression of tgf-1 and il-6 was evaluated according to a semiquantitative scale : 0 , no detectable staining at all ; 1 , less than 10% of the cells stained positive ; 2 , 1050% positive cells ; and 3 , more than 50% of cells positive . staining intensity was scored as 0 ( no detectable stain ) , 1 ( weak staining detected at intermediate to high power ) , 2 ( moderate detected at low to intermediate power ) , to 3 ( strong detected at low power ) . total rna was extracted from the snap - frozen tissue samples using total rna isolation kit ( macherey - nagel ) according to the manufacturer 's instructions . the rt reaction contained 1 g rna , 10 mm tris - hcl ( ph 8.3 ) , 50 mm kcl , 1.5 mm mgcl2 , 2.5 mm dithiothreitol , 500 mol / liter each of datp , dctp , dgtp , and dttp ( bioline ) , 40 u rnasin ( bioline ) , 25 g / ml oligo dt_pd(t)1218 ( bioline ) , and 100umoloney murine leukemia virus reverse transcriptase ( bioline ) . the reaction mixture was incubated at 42c for 60 min and then heated to 80c for 5 min . the resultant cdna was used for pcr . for quantitative real - time rt - pcr , we prepared appropriate dilutions of each single - strand cdna followed by normalizing of the cdna content using -actin as a quantitative control . quantitative pcr amplification was performed with a 25 l final volume consisting of 1 l rt reaction mixture , 3 mm mgcl2 , 10 pmol of each sense and antisense primer , and 12.5 l ( roche diagnostics ) . pcr conditions were as follows : initial denaturation at 95c for 10 min and 35 cycles of denaturation at 94c for 1 min , annealing at 55c for 1 min , and elongation at 72c for 2 sec with a final elongation at 72c for 10 min . samples were migrated in 1% agarose gel using electrophoresis , uv visualized , and images were analyzed using total lab120 ( nonlinear dynamic ltd ) . clusterin , tgf-1 , igf-1 , il-6 , il-8 , and tnf- expression in the test samples were normalized to the corresponding -actin level and were reported as the relative band intensity to the -actin gene expression . sequences of oligonucleotides used as primers for -actin , il-6 , il-8 , tnf , tgf-1 , igf-1 , and clusterin are summarized in table 1 . data were expressed as mean se and were analyzed by analysis of variance ( anova ) followed by tukey - kramer multiple comparisons test . inflammation scores and their significance were calculated by chi - square test with yate 's corrections . screening of the methanolic onion extract indicated mainly the presence of sterols and/or terpenoids , polyphenolic compounds such as flavonoids , tannins , and the absence of alkaloids and saponins . assay of total phenolic content of methanolic extract was determined to be 12.9 mg gae / g de . assay of total flavonoid content was determined to be 119 mg qe / g de . the antioxidant is expressed as inhibition percentage corresponding to a reduction of the absorbance of dpph of 50% ( ic50 ) . ascorbic acid , a commonly used reference antioxidant , elicited 96.21% inhibition at 1 mm / ml . onion extract was able to reduce the stable radical dpph to the yellow colored diphenylpicrylhydrazine . thus , it exhibited observable scavenging activity in a dose - related manner with ic50 values of 368 g / ml . figures 1 and 2 showed hplc and tlc profile of ros extract against q and qg as marker compounds . the hplc profile of ros methanolic extract displayed two major peaks at tr 5.68 and 11.01 at 360 nm identified as quercetin and quercetin-4--o - d - glucoside through spiking with standard quercetin and the isolated quercetin-4--o - d - glucoside . the amount of quercetin in ros extract was found to be 60.1 mg / gm of dry extract using standard quercetin ( 1.5 mg / ml ) . in aph - induced rats , bw has increased significantly at the end of the experiment compared to the starting weight . moreover , both apw and rpw were increased significantly compared to the normal control rats . all treatments with saw palmetto or ros failed to improve the bw at the end of the experiment compared to the starting weight . however , saw palmetto induced small but insignificant reduction in apw and rpw compared to control rats . however , ros also induced significant and dose - related reductions in both apw and rpw compared to control rats with aph ( table 2 ) . induction of aph in rats significantly increased the tissue levels of il-6 , il-8 , and tnf-. saw palmetto treatment significantly decreased the il-6 ( 20.3% ) , il-8 ( 48.1% ) , and tnf- ( 39.4% ) . ros induced significant reductions in il-6 , il-8 , and tnf- , which were greater than that produced by saw palmetto ( figure 3 ) . these reductions were dose dependant regarding il-6 ( 54.7% , 59% , and 65.6% ) , il-8 ( 93% , 95.3% , and 97.9% ) , and tnf- ( 50.8% , 65.1% , and 91.3% ) . induction of aph is accompanied with a significant increase of the clusterin and igf-1 expression in the ventral lobe of rat prostate , while the tgf-r1 expression was significantly decreased . saw palmetto treated rats with aph showed significant increase in clusterin and tgf-r1 expression , an effect which was accompanied with the decrease in igf-1 expression . all the treatment groups with ros extract showed a significant increase in clusterin , while the expression of igf-1 was significantly decreased in a dose - dependent fashion . on the other hand , tgf-r1 expression was not significantly changed compared to the aph group ( figure 4 ) . ventral prostates from the normal group showed normal histology with average histoscore corresponding to 24.3 1.2 ( figure 5(a ) ) . ventral prostates from the aph - induced rats showed increase in the number of acini ( hyperplasia ) with irregular distribution . all prostatic acini were lined by tall columnar cells with epithelial pilling and nuclear stratification seen among six of seven prostatic sections in the group . the interstitial stroma was scant and showed edema with congested blood vessels and mixed acute and chronic perivascular inflammatory cells . chronic inflammatory cells seen were lymphocytes which were distinguished by their darkly stained ink - dot nucleus and thin rim basophilic cytoplasm . these findings were associated with a significant increase in the histoscore corresponding to 41.1 1.8 . the ventral prostate in the saw palmetto group showed diminution regarding the scale of pathological changes and histoscore corresponding to 32.2 2.1 ( figure 5(e ) ) . however , hyperplastic changes such as acini lined by tall columnar cells with epithelial pilling and nuclear stratification were seen among all rats in the group . prostatic sections from two rats in this group also showed 1 - 2 mitotic figures . histological changes in the ventral lobe of aph - induced rats treated with ros extract ( 75 mg / kg ) showed irregular and enormous dilatation of prostatic acini with intraluminal secretions among five of six rats in the group . dilated acini showed epithelial changes in the form of flattening or low cuboidal transformation ( figure 6(a ) ) . acini seen at the peripheral part of the section were still hyperplastic being lined by tall columnar cells showing nuclear stratification ( figure 6(b ) ) . mixed acute and chronic inflammatory cells were seen among four of six rats in the group along with clustering of stromal mast cells . karyorrhectic debris was seen within the gland lumina among four of six rats in the group . sections examined from ventral prostates of aph - induced rats treated with ros extract ( 150 mg / kg ) showed prostatic acini lined by tall columnar epithelium exhibiting nuclear stratification in all five rats . small foci of mixed acute and chronic inflammatory cells were seen among three of five rats in the group . intraluminal sloughing of karyorrhectic debris was also seen among three of five rats ( figures 6(c ) and 6(d ) ) . histological changes in ventral prostates of rats , with aph treated with ros extract ( 300 mg / kg ) showed prostatic acini lined by tall columnar epithelium exhibiting nuclear stratification in all six rats . scattered mixed acute and chronic inflammatory cells in the stroma along with intraluminal sloughing of karyorrhectic debris were seen in three of six rats ( figure 6(e ) ) . normal control rats showed no expression of both immunohistochemical markers with positive internal controls ( figures 7(a ) and 7(b ) ) . tgfbr-1 expression corresponded to score 3 with strong intensity in the secretory epithelial cells of acini with foci of strong expression among basal cells also in the prostatic sections from aph - induced rats . il-6 expression corresponded to score 1 and showed weak intensity in the secretory epithelial cells only . no expression was observed in basal or stromal cells ( figures 7(c ) and 7(d ) ) . prostatic sections from saw palmetto treated aph - induced rats revealed tgfbr-1 expression corresponding to score 3 exhibiting strong intensity in the secretory epithelial cells of acini with foci of strong expression also in the basal cells . il-6 was variable between score 2 - 3 with a staining intensity between moderate to strong . no expression was observed in the basal or stromal cells ( figures 8(a ) and 8(b ) ) . prostatic sections from ro scale revealed il-6 expression corresponding to score 1 with weak intensity . the immunohistochemical profile expressed by the prostatic tissue showed no notable doze related variation ( figures 8(c ) and 8(d ) ) . it was reported that aph usually arises with concomitant bph and exhibits several cancer - like features , which makes aph an intermediate lesion between bph and the subset of well - differentiated prostate cancers . in the present study , aph - induced rats revealed prostatic enlargement which was evidenced by an increase in the apw and rpw of the ventral prostate lobe as well as acinar hyperplasia that may be attributed to the influence of androgen on prostate growth . the development of hyperplasia was associated with enhanced proliferation and suppressed apoptosis of prostatic cells [ 25 , 33 ] . citral , used in the current study , was reported to have an estrogenic - like effect , as it binds to estrogen receptors that are located in prostatic epithelial cells of both human and rat . type 2 estrogen - binding sites in rat ventral prostate could be responsible for this proliferative effect . moreover , the present study revealed an increase in the igf-1 and a decrease in the tgf-1 which may cause the prostate enlargement in aph group . tgf-1 is known to suppress tissue proliferation and induce cell apoptosis . circulating testosterone acts locally in the prostate via the production of growth factors such as igf and tgf families that act in a manner which influences prostate cell growth , survival , or apoptosis . fruits and vegetables have health benefits and are good sources of antioxidants ; therefore a lot of recent literature has focused on nutritional and herbal medicine for prostatic hyperplasia [ 3840 ] . in the present study , administration of ros extract induced significant and dose - related reduction in both the absolute and relative weight of prostate in the aph - induced rats , an effect that was greater than that induced by saw palmetto . these effects may be due to the fact that ros are rich in flavonols which represent 60% of the total active constituents . these mainly are kaempferol , quercetin , quercetin dimer , quercetin trimer , and other quercetin glycoside . flavonols were found to be responsible for the antioxidant , hepatoprotective , anticancer , antimicrobial , antistress , and other biological activities [ 12 , 13 ] . among the major constituents of the ros extract , 16% are quercetin , which was found to be mainly responsible for the protective effects against different degenerative pathological diseases [ 11 , 14 ] . it was reported that administration of quercetin along with finasteride resulted in reduction in prostate weight in rats , through a cell cycle - related pathway that may function independently of androgens . moreover , the ros extract has ameliorated the histopathological changes , significantly modulated the expression of the proinflammatory cytokines , and decreased the inflammatory scores in a dose - dependent manner . in the current study , ros significantly decreased il-6 , il-8 , and tnf- in the ventral lobe of prostatic tissues of rats with aph . these findings are in accordance with results that are reported by jung et al . . in the context of chronic inflammation and expression of proinflammatory cytokines , il-6 is one of the major physiologic mediators of acute phase reaction that influence immune responses and inflammatory reactions . il-6 is also secreted by both normal and prostatic epithelial cells and acts as a growth factor for normal prostatic epithelial cells . tnf- , a proinflammatory cytokine , may induce inflammation by induction of cox-2 , superoxide radical , and hydrogen peroxide in both human and rat mesangial cells . tgf- , an inflammatory cytokine , has been shown to regulate stromal proliferation and differentiation in bph , and it is a key factor in the androgen control of prostatic growth . recently , descazeaud et al . investigated the tgf- receptor ii protein ( tgfbrii ) expression in bph patients . the ros extract contains large amounts of antioxidant flavonoids , mainly , ferulic , gallic , kaempferol , and quercetin or their glycosides [ 12 , 13 ] . found that hepatic expressions of tnf- and il-6 in diabetic rats were suppressed by quercetin . these results are in agreement with previous reports , in which quercetin was found to have antioxidative and anti - inflammatory activities . moreover , quercetin can affect the prostate cancer biology by inhibiting arachidonic acid metabolism through the blocking of phospholipase a2 and 5 as well as 12-lipooxygenase enzymes and inhibiting androgen receptor mutations . quercetin has also demonstrated the ability to interrupt the spread of prostate cancer ( metastases ) and to promote cell death . it was able to decrease the activity of specific enzymes known to be involved in tumor invasion and metastases . furthermore , quercetin was found to have antiproliferative activity in vitro against several cancer cells and arrested cell cycle progression either at the g1/s phase or at the g2/m transitional boundary . quercetin is also a possible option to relieve symptoms for men who have prostate problems , and it has been identified as being beneficial in cases of prostatitis . the ros extract significantly reduced the absolute and relative weight of ventral lobe prostate of rats with aph compared with the negative control rats . this effect may be partially due to that ros extract may have antiproliferative and apoptotic action on the ventral lobe of prostatic tissues . the ros extract significantly decreased the expression of igf-1 and increased clusterin expression . the prostate enlargement and the increased net weight of the ventral lobe in case of aph may be partly due to the increased igf-1 and decreased tgf-1 expression . this modulation in expression of these cytokines may play a crucial role in prostate cell proliferation and apoptosis . igf-1 , a mitogenic factor , interacts with igf-1 receptor stimulating cell proliferation and inducing proliferative prostatic diseases . moreover , senthilkumar et al . suggested that quercetin can decrease the survival of androgen - independent prostate cancer cells by changing the expression of igf-1 signaling and inducing apoptosis in cancer patients . the antiproliferative effect of quercetin is probably mediated by interaction with the type ii estrogen binding sites . quercetin also inhibits cell invasion and induces apoptosis through a pathway involving heat shock proteins . the ability of ro extract to decrease the prostate weight in rats with aph may also be due to that it has some active constituents with a specific ability to inhibit phosphodiesterase subtype 5a ( pde-5a ) . these findings are in agreement with that which was reported by lines and ono who found that the improvement in sexual function might be due to quercetin 1 . chronic administration of no donor drugs and pde5-inhibitors may also induce antiproliferative and/or apoptotic effects in the prostate . in conclusion , the results of the present study showed that the methanolic extract of ros have the ability to decrease the prostate weight in aph - induced rats . this effect may be due to the anti - inflammatory and immunomodulatory effects of the extract . all of these effects are dose - dependent and may not only be related to the antioxidant activities of the flavonoids or their glycosides but also due to its phenolic content in ros .
the honey bee insect belongs to the order hymenoptera of the family apidae of the genus : apis , subordinated by the western honey bee apis mellifera jemenatica ruttner that has spread out all around the earth . it is in several geographical areas and spaced eras , and such isolation has resulted in a large number of strains of this type , including the yemeni bee strain ( domestic honey bees ) apis mellifera jemenatica , which is the prevalent strain in the arabian peninsula , both in yemen and oman as well as in saudi arabia , and it also has spread to some parts of africa . honey bees , like other living organisms , are exposed continuously to a wide range of biological and non - biological pressures , such as environmental factors , which may interact with each other and affect the health or survival of the insects ( 1 , 2 ) . many industrial substances are used to fight insect pests in agricultural areas , but the indiscriminate use of these substances affects non - targeted insects , such as bees ( 3 ) . many insecticides are used routinely to protect crops against insects to prevent economic losses ( 4 ) . the literature pointed out that the harmful impact of deadly doses of different pesticides shows on the behavior of the insect during its return flight , and they affect the insects sense of orientation and foraging efficacy ( 5 ) . in spite of that , many scientific references have referred to the disappearance of honey bees in the 1880s , 1920s , and 1960s , and a description of what looked like a phenomenon of bee colonies colony collapse disorder ( ccd ) , the diagnosis of the causes of bee disappearance include disease , such as paralysis , viruses , and nosemea ( 6 ) , and environmental factors , such as global warming and monoculture ( 7 ) , and pesticides , whether to combat the mites inside the bee hives or field pesticides ( 8) , but there s no way to be sure of whether the factors causing the sudden death in those years are the same of those leading to this problem now concerning the sudden death of bees . maybe the most different stupendous and the most important event is the synchronization of this phenomenon all over the world ( 9 ) or the so - called phenomenon of honey bee depopulation syndrome ( hbds ) ( 10 ) . there is no single reason for their disappearance , but many scientists have implicated the poor sanitary environment for the bees inside or outside the hives as being one of the most important causes for the loss of bees ( 11 , 12 ) . the hives hygiene is influenced with many factors , including hygienic management , innate immunity , viral illnesses , and their pesticide sensitivity , nutrition , adult age , and temperature ( 11 , 12 ) . those stressful factors weaken the immune system of the bees just as it does with other social insects , and they may lead to disabling its social system , making them more susceptible to diseases . several statistics have revealed high levels of pollution of honey bees combs with pesticide residues , and this study was conducted to test the direct and indirect potential impacts , the length of life of adult honeybee workers . honeybee workers were bred in the brood combs containing high levels of known pesticide residues , in addition to a control group of non - treated brood combs . it was observed in honey bees brought up in high levels of pesticides , especially in the early ages of 48 days , delays in growth , and it also a decrease in the life of the adult honey bee workers was observed , at the rate of four days in bees exposed to such residues , as pesticide residues are transmitted from the combs containing high percentage of pesticide residues to the non - treated combs after cycles of ongoing broods , giving the effects of how fast is the transmission of the residues through honey bees wax , which supports the need to replace honey bee combs . the chemical analysis after conducting the experiment explained the migration of pesticide residues from the treated combs to the non - treated combs in advance . this study is the first of its kind to determine the less than deadly effects of the exposure of the foraging bee combs to pesticides . these effects include larva delayed growth , and full insect delayed hatching , and low longevity of the adult , and this may probably impose indirect effects on communities , such as early transformations in hive phases , and the activity of the foraging honeybee worker insects , in addition to lengthening the time of growth that could lead to the growth of the devastating parasite of varroa mites . it is necessary to study the impact of the delayed growth of the honey bee population on the activity and fertility of this parasite ( 13 ) . in 1994 , beekeepers in france issued a report containing worrisome signs , i.e. , many honey bees did not return to their hives ; rather , they gathered in small groups nearby to each hive close to the ground or moving in a disturbed manner in front of the hives , and the foraging honey bee workers showed abnormal manifestations in behavior , where such signs were accompanied by losses in the winter season ( 14 ) . in a study conducted by karise et al . ( 15 ) , it was found that kaolin is an inert material and has a wide range of applications ; such as an insecticide , and as a substance may be added to fill iological pesticide compounds , thus , bumble bee workers are exposed to pesticides in the field and therefore are subjected to side effect risks of those pesticides . the study s results showed that treatment with pure kaolin only increases water loss in the ice layer , and reduces its resistance for survival , but when mixing kaolin with real fungi , would lead to a negative impact on the longevity of the bees . due to the lack of ongoing research in the kingdom of saudi arabia in serious study of the impact of insecticides on the life of honeybee insects , it necessitated the conduct of a biological study to determine the extent of the insecticides effects under study , i.e. , deltamethrin , malathion , and abamectin , on the longevity of the honey bee insect ( foraging worker ) at different concentrations when used orally . the field research was conducted in the apiary of hada al sham research station , which is a model station for agricultural research in the king abdulaziz university ( saudi arabia ) . the honeybees used in the study were yemeni bee race ( local)-apis mellifera jemenatica - which have been subjected to research . it is one of the yellow bee strains spread in many parts of the arabian peninsula , distinctive of its adaptation under environmental conditions prevailing in saudi arabia , and its disease resistance ( 16 ) . individuals used in the study were the foraging honeybee workers , which are individuals working outside the hive in collecting nectar and pollen , but are characterized with being fed on the nectar or honey in larger amounts ( carbohydrates nutrition ) . foraging honeybee workers were chosen to conduct the study according to oldroyd and nanork ( 17 ) and khoury et al . ( 18 ) , where two methods were combined for the design of wooden cages for breeding , taking into account that the one face of the wooden box is covered with metal wire mesh , while the opposite face would be of glass , based on what was mentioned by kakmand et al . ( 19 ) , and for holding cage measurements , were ( 40 30 30 cm ) . the cage was provided , on the top side , with two plastic medical syringes ( 50 ml ) , one of which with water , and the other syringe with sugar solution of ( 1:1 ) that is ( 50% ) ( as a source of carbohydrates nutrition ) . ( 50% w / v ) based on what was conducted by bortolotti et al . ( 21 ) , and pohorecka ( 22 ) , laced with insecticide solution under test . the cage was also provided with a small plastic pot of 3 cm in diameter , and 1 cm in height , put in the cage bottom to provide natural protein nutrition , ( pollen ) mixed with sugar in equal parts ; where 50 grams of pollen and 50 grams of powdered sugar as well as a little water were added to get a paste , and then 10 grams of the such paste are put in the plastic pot , covered with a transparent perforated plastic sheet to allow feeding of bees and protection of the paste from drying out and preventing the adhesion of such food particles bees during feeding , where food is changed every three days hatjina et al . the adverse effects caused by three types of insecticides , representing the most prevalent groups , available in abundance in the saudi market , used in pest control , were studied , namely : deltamethrin ; a compound of pyrethroid group , malathion , from the organophosphates pesticide group , and abamectin pesticide , from the avermectin group . the use of deltamethrin pesticide in the following concentrations : 1.00 , 2.50 , 5.00 , and 10.00 ppm , while with the malathion pesticide , the following concentrations were used : 1.250 , 3.125 , 6.25 , and 12.5 ppm . in case of the abamectin pesticide , the following concentrations were used : 0.025 , 0.1 , 0.5 , and 1.00 ppm . the research experiences were divided into four groups , namely : 1 ) a non - exposed control group , 2 ) an exposed group to deltamethrin , with different concentrations , 3 ) an exposed group to malathion , with different concentrations , and 4 ) an exposed group to abamectin , with different concentrations . the forager honey bee workers were selected for the study , as they are individuals working outside the hive in the collection of nectar and pollen , where they have been fed orally , where they were provided with water and natural protein nutrition , and sugar solution laced with insecticide in the required concentration . after initial tests , the appropriate concentrations of each pesticide were selected , as the insecticides used in the study ( deltamethrin , malathion and abamectin ) were prepared in four different concentrations . the deltamethrin pesticide was used in the following concentrations : 10 , 5 , 2.5 , and 1 ppm , while the malathion pesticide was used in the following concentrations : 12.5 , 6.25 , 3.125 , and 1.25 ppm , while abamectin pesticide has been used in the following concentrations : 1.00 ppm , 0.5 ppm , 0.1 ppm and 0.025 ppm , while the control group was not treated with any kind of pesticides , and were fed naturally , with water , natural protein nutrition as well as sugar solution , free of any additives , were used . the samples were followed up , as a bee would be considered dead when it remains motionless for 10 seconds of the observation period , after moving it gently by a fine brush ( 24 ) . the longevity of the foraging honeybee worker , staying alive after its exposure , was calculated by daily follow - up and comparing to the control group . all results were subjected to various statistical analyses by ibm - spss software , version 22 . the field research was conducted in the apiary of hada al sham research station , which is a model station for agricultural research in the king abdulaziz university ( saudi arabia ) . the honeybees used in the study were yemeni bee race ( local)-apis mellifera jemenatica - which have been subjected to research . it is one of the yellow bee strains spread in many parts of the arabian peninsula , distinctive of its adaptation under environmental conditions prevailing in saudi arabia , and its disease resistance ( 16 ) . individuals used in the study were the foraging honeybee workers , which are individuals working outside the hive in collecting nectar and pollen , but are characterized with being fed on the nectar or honey in larger amounts ( carbohydrates nutrition ) . foraging honeybee workers were chosen to conduct the study according to oldroyd and nanork ( 17 ) and khoury et al . ( 18 ) , where two methods were combined for the design of wooden cages for breeding , taking into account that the one face of the wooden box is covered with metal wire mesh , while the opposite face would be of glass , based on what was mentioned by kakmand et al . ( 19 ) , and for holding cage measurements , were ( 40 30 30 cm ) . the cage was provided , on the top side , with two plastic medical syringes ( 50 ml ) , one of which with water , and the other syringe with sugar solution of ( 1:1 ) that is ( 50% ) ( as a source of carbohydrates nutrition ) . ( 50% w / v ) based on what was conducted by bortolotti et al . ( 21 ) , and pohorecka ( 22 ) , laced with insecticide solution under test . the cage was also provided with a small plastic pot of 3 cm in diameter , and 1 cm in height , put in the cage bottom to provide natural protein nutrition , ( pollen ) mixed with sugar in equal parts ; where 50 grams of pollen and 50 grams of powdered sugar as well as a little water were added to get a paste , and then 10 grams of the such paste are put in the plastic pot , covered with a transparent perforated plastic sheet to allow feeding of bees and protection of the paste from drying out and preventing the adhesion of such food particles bees during feeding , where food is changed every three days hatjina et al . the adverse effects caused by three types of insecticides , representing the most prevalent groups , available in abundance in the saudi market , used in pest control , were studied , namely : deltamethrin ; a compound of pyrethroid group , malathion , from the organophosphates pesticide group , and abamectin pesticide , from the avermectin group . the use of deltamethrin pesticide in the following concentrations : 1.00 , 2.50 , 5.00 , and 10.00 ppm , while with the malathion pesticide , the following concentrations were used : 1.250 , 3.125 , 6.25 , and 12.5 ppm . in case of the abamectin pesticide , the following concentrations were used : 0.025 , 0.1 , 0.5 , and 1.00 ppm . the research experiences were divided into four groups , namely : 1 ) a non - exposed control group , 2 ) an exposed group to deltamethrin , with different concentrations , 3 ) an exposed group to malathion , with different concentrations , and 4 ) an exposed group to abamectin , with different concentrations . the forager honey bee workers were selected for the study , as they are individuals working outside the hive in the collection of nectar and pollen , where they have been fed orally , where they were provided with water and natural protein nutrition , and sugar solution laced with insecticide in the required concentration . after initial tests , the appropriate concentrations of each pesticide were selected , as the insecticides used in the study ( deltamethrin , malathion and abamectin ) were prepared in four different concentrations . the deltamethrin pesticide was used in the following concentrations : 10 , 5 , 2.5 , and 1 ppm , while the malathion pesticide was used in the following concentrations : 12.5 , 6.25 , 3.125 , and 1.25 ppm , while abamectin pesticide has been used in the following concentrations : 1.00 ppm , 0.5 ppm , 0.1 ppm and 0.025 ppm , while the control group was not treated with any kind of pesticides , and were fed naturally , with water , natural protein nutrition as well as sugar solution , free of any additives , were used . the samples were followed up , as a bee would be considered dead when it remains motionless for 10 seconds of the observation period , after moving it gently by a fine brush ( 24 ) . the longevity of the foraging honeybee worker , staying alive after its exposure , was calculated by daily follow - up and comparing to the control group . all results were subjected to various statistical analyses by ibm - spss software , version 22 . the results showed the effect of using different concentrations of pesticides on honeybee foraging workers apis mellifera jemenatica throughout the life of these workers , where they were fed on sugary solution laced with insecticide of different concentrations under laboratory conditions . it was found through the results obtained in the present study ( table 1 ) that when using deltamethrin insecticide in the following concentrations : 10 , 5 , 2.5 , and 1 ppm , the average longevities for the workers were 2.5 , 11 , 14.5 , and 15.5 days , respectively . in the case of the malathion insecticide , the concentrations used in the study were 12.5 , 6.25 , 3.125 , and 1.25 ppm , and the average longevity for the workers were 3.5 , 4 , 4 and 6.5 days , respectively . as for the abamectin insecticide at the concentrations tested namely ; 1 , 0.5 , 0.1 , and 0.025 ppm , the average longevities for the workers were 2 , 3 , 3.5 , and 5 days , respectively . whereas the foraging honeybee workers that were not subjected to any kind of exposure ( control group ) the average period of evolution and life of the workers was 18 days . our observations showed that the longevity of foraging honeybee workers exposed to tested insecticides were as follows : the average longevity occurred when we used abamectin insecticide at a concentration of 1 ppm ( higher concentration ) , to two days , thus took a shorter time than the other tested individuals , followed by individuals fed on food laced with deltamethrin insecticide at concentration 10 ppm ( higher concentration ) , amounting to 2.5 days . as for abamectin insecticide at a concentration 0.5 ppm , longevity reached three days , where it was close to those exposed to the same insecticide at concentration 0.1 ppm and was also equal to the individuals fed on the malathion insecticide at a concentration of 12.5 ppm ( higher concentration ) . while at concentrations3.125 and 6.250 ppm , reached up to 4 days . whereas the average longevity of honeybee workers exposed to the abamectin insecticide at concentration of 0.025 ppm ( the least concentration ) , reached 5 days , which is approximately the length of the life of the honeybee workers fed on food laced with the malathion insecticide at the concentration 1.25 ppm ( the least concentration ) where the length of the lives of the bee workers treated therewith reached 6.5 days , and the period of evolution and the life increased of the bee workers fed with food laced with deltamethrin insecticide at following concentrations 5 , 2.5 , and 1 ppm ( the least concentration ) until it reached up to 11 , 14.5 , and 15.5 days respectively , which is the longest period in regards of the effect of insecticide on longevity . the results also showed that the longest life was reached by the insects was 15.5 days on the use of deltamethrin insecticide at concentration 1 ppm ( the least concentration ) , while the least life time was 2 days on the use of abamectin insecticide at concentration 1.00 ppm . while the longevity of foraging honeybee workers fed on natural diet ( control ) under lab conditions reached 18 days . the differences between the longevity of honeybee workers fed on food laced with solutions at concentrations of various insecticides tested when statistically analyzed were apparent . whereas the malathion insecticide , at a lower concentration , coefficient of variation in longevity was 32.6% , which is the highest value of variation recorded . abamectin insecticide had the highest impact on longevity , even when using the least concentration thereof , followed by malathion insecticide , while the deltamethrin insecticide was of least effect ; where the bee workers stayed alive for a longer time compared to other individuals tested in the current study . hence , it is clear that the type and concentration of the insecticide the bee workers received had a significant impact on the evolution period and longevity and survival of the foraging bee workers . when the effect of different concentrations of insecticides under study , on average longevity of the foraging bee workers apis mellifera after exposure to these insecticides were put in order , it was found to be abemectin , malathion , and deltamethrin , respectively . among the negative effects of the use of insecticides , their impact on non - target organisms , such as useful insects , was defined as the main cause for the disappearance of pollinators of agricultural fields , especially in single - crop farming areas ( 2527 ) . the risk of insecticides is not limited to toxicity , but it also has indirect harm to the insect , such as low efficiency and short life . , ( 28 ) in that all classes and ages of honeybees are sensitive to pesticides . the results of the current study showed that the longest life of honeybee workers exposed to pesticides was when using deltamethrin insecticide at the least concentration of 1 ppm , where it reached 15.5 days , compared to other individuals tested in the current study . the foraging honeybee workers fed on a natural diet ( control ) under laboratory conditions , remained for a period of longevity 18 days . wu et al . ( 13 ) found that the honeybee workers that have been bred in the combs containing insecticide residues at high levels live to average age of 4 days less than those not exposed , and this is consistent with the results of the current study , whereas vosscher et al . ( 29 ) found that the average longevity of honeybee workers after entering foraging stage was less than 8 days . while the malathion insecticide has medium impact on the longevity among the insecticides used therein ; as the average longevity of a honeybee worker when using higher concentration of 12.5 ppm and the least concentration of 1.25 ppm , between 3.5 and 6.5 days , respectively . ( 30 ) and mackenzie ( 31 ) suggested , that topical treatment for members of honeybee workers with under lethal concentrations of insecticides diazinon or malathion have resulted in decreases in the length of life . the results of the study also showed that the lowest length of life was when using abamectin insecticide at the highest concentration ; where it showed an impact on longevity even when using the lowest concentrations thereof , as it was two days at the concentration of 1 ppm ( the highest concentration ) , which is the lowest period of life . ( 33 ) pointed out that low doses of insecticides used , have proven its impact on longevity and foraging in adult honeybees . the exposure to below lethal concentrations of the carbaryl insecticide of ( family : carbamate ) have negative effects on honeybee longevity and activities of foraging . studies indicated that the getting acquainted with the different effects of pesticides on pollinators is a source of particular concern in agricultural systems ( 8 , 3437 ) . the low longevity of adult honeybee workers in foraging stage can lead to the younger honeybee workers to begin earlier in search for food , and in the long run , this behavior can affect the internal system of the activities of the hive , including the care of the brood , food processing and storage , care paid to the queen , and effectiveness of hygienic behavior and foraging , which , in turn , leads to a breach in the balance of this colony , which was pointed out by thompson et al . it can be said that the type and concentration of the insecticide , the bee workers have fed on , has a significant impact on the evolution and survival of the foraging bee workers . when putting into order the effect of different concentrations of pesticides under study , on average longevity of foraging honeybee workers , apis mellifera after exposure to these pesticides , were found to be as follows : abamectin , malathion , and deltamethrin . when referring to the results of the toxic effects and toxin residues of some insecticides on foraging honeybee worker , it was found that the rate of death of the bee workers exposed to deltamethrin insecticide was higher and average residues inside its body were less . whereas in malathion insecticide , the rate of death of the bee workers exposed was less , while the average pesticide residues in their bodies were higher , after 24 hours of exposure ( 39 ) . also , when referring to the results of detection of pesticide residues in foraging honeybee workers using gas chromatographic analyses , it was found that the average residue of malathion insecticide was more than the deltamethrin insecticide residue inside the body of honeybee samples that were exposed to different concentrations ( 40 ) ; and this explains why the length of the life of foraging honeybee workers exposed to the deltamethrin insecticide , where it may be the absence of the concentrations of residues of the deltamethrin insecticide in the body of the insect that gave it a greater chance of survival for longer periods , but samples of honey bees exposed to the malathion residues of this pesticide led to decreased longevity . the life of a honeybee worker and its longevity depend upon the health and safety of all of the members of the beehive , so it is necessary , when the application of insecticides to the continuity of life , to take into account , the gravity of the entire society depends on his life in this layer of the bee community .
it is one of the most common gynecological disorders in the reproductive age women and its prevalence in the general population varies between 0.7 and 44% . endometriosis is usually found in the pelvis and especially the ovaries , uterosacral ligaments , and round ligaments . on the other hand , it is observed in extrapelvic sites . the most common implantation sites are bladder , gastrointestinal tract , lungs , and on the skin especially after obstetric surgical interventions . the main cause of surgical scar endometriosis is obstetric and gynecologic operations ( such as in the perineum following vaginal delivery with episiotomy and in abdominal surgery scar areas following hysterectomy and cesarean section ) . its clinical diagnosis is difficult and confused with abscess , hematoma , suture granuloma , desmoid tumor , sarcoma , and metastatic malignancy . but most accepted theory is direct implantation of the endometrial tissue in scars during the surgical procedure . the knowledge of the clinical background of the disease is essential for diagnosis of scar endometriosis . the definite treatment of extrapelvic endometriosis is by surgery and the diagnosis can be made by histopathological examination of the material . the retrospective evaluation and treatment of scar endometriosis cases with obstetric causes that were prediagnosed with clinical imaging methods and verified histopathologically have been presented in this study . nineteen patients who presented to our clinic with symptoms of pain and swelling in the obstetric surgical scar area between january 2008 and may 2013 were evaluated . physical findings at presentation , age , previous obstetric operative time , duration of symptoms , localization of lesions , the size of the mass , treatment method , and histopathological results of the patients were registered ( table 1 ) . the postsurgical diagnosis was performed using histopathological analysis , in which the criterion was the presence of endometrial glands and/or stromal cells in the connective tissue that was analyzed . this research project was approved by the research ethics committee of adiyaman university school of medicine . the time of last obstetric surgical intervention : it is defined as the time between diagnosis and last obstetric surgical intervention . a total of 19 patients who had presented to our clinic with symptoms of swelling and pain in 13 caesarean section and 6 episiotomy scars between january 2008 and may 2013 were evaluated ( figure 1 ) . all patients received a preliminary diagnosis of obstetric incision scar endometriosis preoperatively due to their history and examination characteristics . the mean age was 29.1 5.4 , with range from 21 to 40 years , and the mean number of pregnancies was 2.3 0.5 , with range from 1 to 6 pregnancies . all of patients were described as abdominal surgery ( cesarean section ) and vaginal surgery ( episiotomy ) . thirteen ( 68.4% ) patients were cesarean section , and six ( 31.6% ) patients were vaginal delivery with episiotomy . the time between diagnosis and last obstetric surgical intervention was 45.4 32.5 months , with range from 12 to 108 months in evaluation of all patients . this period was 16.8 13.8 months , with range from 0,5 to 48 months for cesarean section patients and 56.0 36.1 months , with range from 12 to 108 months for vaginal delivery with episiotomy patients . the mean duration of the symptoms , defined as the time between symptoms and the first visit , was 19.7 15.1 months , with range from 0,5 to 48 months in evaluation of all patients . this result was 26 17.1 ( 0,548 ) months in vaginal delivery with episiotomy patients and was 16.8 13.8 ( 0,548 ) months in cesarean section patients . the mean asymptomatic period , defined as the time interval between surgical intervention and onset of symptoms , was 23.2 20.7 months . tumoral tissue was surgically excised with a 1 cm surgical margin of safety in all patients . a fascial defect that developed in two patients after surgical excision was repaired with prolene suture material by us . the final diagnosis was reported as endometriosis on histopathological examination ( figure 2 ) . the mean follow - up period after surgery was 24 ( 635 ) months and no recurrence was observed . none of patients received the additional treatment modalities because of endometriosis like symptoms were not described in the gynecologic history of patients . a total 43934 births with 14252 cesarean sections and 29682 normal births took place at our clinic in the specified period . the incidence of obstetric scar location endometriosis was 0.09% for cesarean section and 0.04% for vaginal delivery in our clinic . as a result , cesarean section is one of the most important risk factors for obstetric scar endometriosis in our data ( or : 4,51 , cl : 1,7211,87 ) . this result may be according to surgical method and amount of endometriotic tissue in scar area . endometriosis is defined as finding endometrial gland and stroma outside the uterus . although this placement is usually in the pelvis , it may be outside the pelvis and in tissues such as the lung , ureter , brain , and obstetric scars [ 47 ] . . however , direct mechanical implantation of endometrial tissue seems to be the most appropriate theory for the explanation of the scar endometriosis . development of scar endometriosis requires implantation of the cells in the relevant area following abdominal or vaginal procedures , protection from the immune response , and hormonal stimulus for cell growth . on the other hand , it is difficult to determine the precise incidence of obstetric scar endometriosis due to the wide range of obstetric scar locations , follow - up durations , and the clinical presentation . while the incidence of endometriosis was as high as 10% among women of reproductive age , the incidence of abdominal wall endometriosis after cesarean section was 0.031.7% and the incidence of episiotomy region endometriosis after normal birth was 0.060.7% in studies with a limited number of cases [ 4 , 9 ] . these types of lesions can be observed as skin lesions after procedures such as laparoscopy and amniocentesis . an important issue besides the symptoms caused by the lesions themselves such as swelling and pain is malignant transformation of scar endometriosis . functional complications ( such as defecation and sexual problems ) according to endometriosis surgery are commonly observed in extensive surgery . the possibility of malignant transformation of the lesion should be considered in cases that recur after surgery . this rare but important condition should be considered in all patients and monitored carefully during patient follow - up . history and physical examination are important in detecting scar endometriosis and the most common findings are swelling , pain , and rarely bleeding in the lesion area . similar results can be caused by many disorders such as hematoma , neuroma , hernia , granuloma , and neoplasia , which should also be considered in the differential diagnosis . scar endometriosis was considered as the preliminary diagnosis in all our cases after obtaining the medical history and was confirmed histologically . menstruation - related pain and swelling in the anamnesis should be considered to be pathognomonic for scar endometriosis . although the basis for preliminary diagnosis is the medical history and physical examination , imaging methods such as ultrasound , mri , ct , and fine - needle aspiration biopsy are helpful in the diagnosis . . however , implantation of cells in other tissues and organ perforation in hernia cases are major complications in case of probable malignancy . local excision of the mass provides an opportunity for both diagnosis and treatment , limiting the importance of fine - needle aspiration biopsy . surgical removal of the lesion is necessary for the diagnosis and treatment and the complete excision of the lesion together with approximately 1 cm of healthy tissue is important to prevent local recurrence . after the excision , the repair of defect with synthetic mesh is necessary in patients with an extensive facial defect . anal sphincter invasion in episiotomy scar endometriosis is a rare condition requiring primary sphincter repair . in this situation the closure of the visceral and parietal peritoneum during cesarean section and the use of high doses of progesterone during the first 6 months after hysterectomy are the main suggestions [ 13 , 14 ] . on the other hand , washing the incision area with saline after cesarean section can reduce the risk of developing endometriosis by reducing cell burden . the patients who were evaluated in our study had presented to our clinic with pain and a mass in the cesarean or episiotomy scar region . surgical excision was performed for all lesions with approximately 1 cm of disease - free tissue margin . defective areas were primarily sutured , and the tissue defect in 2 patients was repaired with polypropylene mesh . all material received after surgery was examined and the histopathological diagnosis of endometriosis was confirmed . our findings indicate that a 1 cm safety margin is adequate during tumor excisions . however , it should be noted that the surgical technique and the safety margin might vary according to the location of the lesion [ 15 , 16 ] . the data found in our presented study conforms to the results of many studies in the literature . scar endometriosis has now become even more important due to the increased number of obstetric surgical interventions . however , the high rate of diagnosis with a simple physical examination and medical history is an important advantage . prevention of other tissues by endometrial tissue as much as possible during obstetric interventions can be recommended for the prevention of scar endometriosis . excision of lesions with a margin of safety is important , and we suggest that this margin can be 1 cm . prospective studies with a large number of patients are needed for progress on the prevention of scar endometriosis .
dentigerous cyst is a type of odontogenic cysts and has a rate between 20% and 24% in all the jaw cysts . these cysts form between the enamel epithelium and the enamel of the crown of the affected tooth , and the fluid accumulation occurs in the related area . dentigerous cyst always includes the crown of an unerupted or impacted tooth , and it is commonly observed in the mandibular third molar region . these cyst often show no symptoms , and they are generally detected by a radiographic examination to find the reason for the delayed eruption . in the radiographic examination , dentigerous cyst lesion has a well - defined sclerotic border , and a well- demarcated unilocular radiolucency which is surrounding the crown of an unerupted tooth is observed . the ages of twenties or thirties are the most common periods when the ages of the dentigerous cyst cases are considered whereas these cysts are rare in the first decade . different options were advised for the treatment of these cysts such as the elimination of the damage on the affected permanent tooth , enucleation of all pathological tissues with the removal of the involved tooth , or marsupialization . in these options , the removal of the cystic lesion and the extraction of the unerupted tooth is the main treatment to prevent the recurrence of the cystic lesion . the aim of this report is to present a case of dentigerous cyst with an unerupted mandibular left first premolar and its surgical treatment in a child patient . a 5-year - old female child patient referred to the department of pedodontics because of a painless swelling in the right side of the mandible for the last 6 months . on general examination , the patient was apparently healthy without any significant past medical history and routine hematological tests were within the normal limits . intraoral examination revealed a hard swelling which caused bulging of the cortical bone in the primary mandibular right first molar region . the primary mandibular right first molar tooth was nonvital , and the crown had been eradicated by a carious lesion . the adjacent mucosa was apparently normal , and there were not any signs of inflammation . panoramic radiograph [ figure 1 ] was taken for radiological examination , and it revealed the presence of a unilocular radiolucent cystic lesion with sclerotic border associated with the mandibular right first premolar crown . the crown of the mandibular right first premolar was lying horizontally and coronally displaced . additionally , the radiolucent cystic lesion extended to the lower border of the mandible . after the clinical and radiological examination , a provisional diagnosis of the dentigerous cyst was made . panoramic radiograph showing the radiolucent area with the displacement of underlying premolar surgical enucleation of the cyst was chosen as the treatment of choice . the primary mandibular right first molar tooth was extracted before the disclosing of the cyst cavity by opening a flap . after the flap opening process , the cyst cavity was identified [ figure 2 ] , and the contents of the cyst were removed with the unerupted premolar tooth [ figure 3 ] . histopathological view showed nonkeratinizing stratified squamous epithelium and confirmed the diagnosis of dentigerous cyst [ figure 4 ] . after 18 months , there was not any recurrence in the operation region [ figure 5 ] . intraoperative view of the cyst cavity view of the unerupted tooth crown and cystic contents photomicrograph of the lesion showing the cystic lesion lined by nonkeratinized epithelium ( h and e 100 ) postoperative panoramic radiograph ( 18 months later ) dentigerous cysts most commonly occur in the in the ages of twenties or thirties . however , the frequency in children is relatively low , and 49% of these cysts occur in the first 10 years after birth . in the present case , the cyst was associated with the mandibular first permanent premolar tooth crown in a 5-year - old child . two types of dentigerous cysts are reported in the literature : developmental and inflammatory types . the developmental type of these cysts is the most common type , which surrounds the crown of an unerupted tooth by the fluid accumulation between the layers of the enamel organ . rarely , the dentigerous cyst develops as a result of periapical inflammation from a nonvital primary tooth . the spread of periapical inflammation may affect the germ of the permanent tooth and may induce the formation of the cyst . therefore , the inflammatory dentigerous cyst is usually associated with the roots of a nonvital primary tooth . according to these definitions , the presence of overlying nonvital necrotic primary mandibular first molar tooth increases the possibility of being an inflammatory type of the dentigerous cyst in the present case . odontogenic keratocyst , unicystic ameloblastoma , central giant cell granuloma , and a large radicular cyst must be considered in the differential diagnosis of a dentigerous cyst . radiograph alone can not differentiate the above - mentioned lesions , so a histopathological examination should be performed . additionally , the epithelial cells lining the lumen of the dentigerous cyst possess an unusual ability to undergo metaplastic transition . untreated dentigerous cysts rarely develop into an odontogenic tumor or a malignancy like squamous cell carcinoma . therefore , the early diagnosis and treatment of a dentigerous cyst lesion creates an importance for the prevention of the occurrence of more destructive lesions . the factors such as the size and location of the cystic lesion can change the treatment option . the available options for the treatment of these lesions in children include total enucleation of the cyst with primary closure or marsupialization . marsupialization of the cyst is the treatment of choice which gives a chance to the unerupted tooth to erupt in large cysts ; however , this technique creates notable disadvantages . to illustrate , the two - stage surgical procedure may result an intolerable procedure for a child and lifting behind a pathological tissue . enucleation with primary closure was the treatment choice in our case as the cyst was small , and the displacement of the unerupted permanent tooth was severe . although dentigerous cyst lesions are rare in the first decade of life , they can form in young children . for this reason , the true treatment choice with the early clinical diagnosis of these lesions may increase the rate of success . a long - term follow - up is important for the diagnosis of the recurrence as well .
in this issue of critical care , carlier and colleagues describe pharmacokinetic / pharmacodynamic ( pk / pd ) target attainment in critically ill patients receiving meropenem or piperacillin / tazobactam as extended infusions . these investigators found that 48% of patients did not achieve the desired pk / pd target ( 100% time that the free antibiotic fraction exceeds the minimum inhibitory concentration ( mic ) ) , of which almost 80% had a measured creatinine clearance ( crcl ) > 130 ml / minute . more worrisome was the observation that 37% of patients with crcl > 130 ml / minute did not achieve the minimum pk / pd target ( 50% time that the free antibiotic fraction exceeds the mic ) . these investigators concluded that patients not attaining pk / pd targets may be at risk for treatment failure without upward antibiotic dose titration . the findings from this study suggest that we should add inadequate antibiotic dosing to the list of antibiotic treatment characteristics that can adversely impact the outcomes of infected critically ill patients . this is an important issue when one considers that antibiotic use is often viewed as a variable expense in the hospital setting that can be manipulated to achieve cost savings . such an attitude is flawed with the understanding that the most cost - effective approach to treating serious infections is the approach that is most likely to achieve rapid clinical success . the most recent surviving sepsis campaign guidelines recommend that broad - spectrum antibiotics be administered within the first hour of recognition of septic shock , with one or more agents that have activity against the likely causative pathogens , and that the duration of therapy typically be between 7 and 10 days . these recommendations are based on studies demonstrating that the timing of appropriate antibiotic therapy , defined as an antimicrobial regimen demonstrating in vitro activity against the isolated organism(s ) responsible for the infection , is critical in determining the outcomes of such patients [ 3 - 5 ] . however , even if an appropriate initial therapy with an active antibiotic regimen is administered , patient outcomes may not be optimized due to inadequate drug concentration delivery to the site of infection . this is important for both concentration - dependent antibiotics as well as for antibiotics whose efficacy is based on the achieved dosing interval time that the antibiotic concentration is above the mic of the pathogen . moreover , many prescribers of antimicrobial therapy in the hospitalized patient are unaware that drug delivery targets are not met given that therapeutic drug monitoring is not routinely performed for most antibiotic classes . recent randomized trials of inadequately dosed antibiotics ( ceftobiprole and tigecycline ) for patients with nosocomial pneumonia have demonstrated greater treatment failures and mortality for the inadequately dosed antibiotics compared to more optimally dosed comparators [ 6 - 8 ] . the usual rationale for selecting such doses for investigational antibiotics is to minimize any drug - related toxicity . this is highlighted by the current dosing of tigecycline that is half of the originally considered dosing due to greater rates of nausea and vomiting at the higher doses ( the higher doses being more likely to achieve desired drug concentration pk / pd targets ) . additionally , the results from two meta - analyses and a recent clinical trial found that the use of prolonged infusions of betalactam antibiotics achieved similar clinical results compared to similar or higher dosed intermittent infusion antibiotic therapy [ 9 - 11 ] . however , in one of the metaanalyses , a trend towards benefit among patients receiving intermittent infusion antibiotics possibly explained by the use of higher antibiotic doses was observed . for fair balance it should be noted that another recent meta - analysis showed that prolonged or continuous infusion of pipercillin - tazobactam or carbapenems was associated with lower mortality , although these results were primarily from nonrandomized studies . the influence of crcl on outcomes among patients with severe infections also seems to be an important determinant of clinical outcome , in large part by influencing antibiotic elimination and achieved drug concentration targets at the infection site . the use of prolonged antibiotic infusions has been proposed as a strategy to achieve appropriate targeted antibiotic blood concentrations in patients with augmented renal clearance . the potential detrimental influence of augmented crcl on the outcomes of critically ill patients with infections has been demonstrated in several randomized trials . kollef and colleagues found that patients with crcl 150 ml / minute had greater clinical cure rates for vap with 10 days of imipenem compared to 7 days of meropenem despite administering meropenem as a prolonged infusion . in a trial of nosocomial pneumonia , ceftobiprole dosed at 500 mg every 8 hours was clinically inferior and associated with greater mortality compared to ceftazidime dosed at 2 grams every 8 hours plus linezolid dosed at 600 mg every 12 hours . in this trial , increased crcl was found to be associated with a greater risk of mortality , suggesting that under - dosing of antibiotics may be most detrimental in patients with normal or augmented crcl . this may also explain the hesitation among intensivists to use the currently approved dosing regimen of ceftaroline ( 600 mg every 12 hours ) in critically ill patients as it has not been rigorously evaluated in that population . carbapenem antibiotics and beta - lactams represent the most common antibiotics currently prescribed in critically ill patients . however , there is no routine therapeutic drug monitoring available for these agents as exists for aminoglycosides and vancomycin . this creates uncertainty for many clinicians prescribing antibiotics , especially when patient - specific conditions such as renal function , volume status , and hemodynamics are changing . therefore , intensivists must carefully consider how antibiotics are delivered in terms of dose , interval of administration , and duration of infusion in order to optimize pk / pd target attainment . the duration of therapy must also be carefully considered in that longer durations of treatment for optimal success may be necessary for difficult to treat pathogens such as pseudomonas or acinetobacter species . a recent example of new methods for achieving such targets is the use of advanced aerosol delivery systems that hold the promise of exceeding therapeutic targets in the lung with antibiotics such as colistin , aminoglycosides , and fosfomycin that can not be accomplished with parenteral administration . carlier and colleagues must be commended for their study highlighting the relationship between elevated crcl and inability to attain pk / pd targets for prescribed antibiotics despite the use of prolonged infusions . this is an important finding given the increasing use of prolonged antibiotic infusions and suggests that clinicians should carefully evaluate the presence of elevated crcl when making decisions regarding antibiotic dosing . from a practical standpoint , the use of an antibiotic loading dose along with the prolonged antibiotic infusion should be considered in patients with elevated crcl to allow for more rapid attainment of the desired antibiotic concentration at the infection site . moreover , maximal recommended doses of antibiotics should be prescribed in critically ill patients , especially in the presence of elevated crcl , as suggested by arnold and colleagues regardless of whether or not prolonged infusions are employed ( for example , cefepime 2 grams every 8 hours , pipercillintazobactam 4.5 grams every 6 hours , meropenem 1 gram every 8 hours ) . future studies are needed that address the issue of antibiotic dosing optimization in the presence or absence of elevated crcl . such studies also need to carefully consider the influence of confounding factors , such as the mic of the targeted pathogens and the patient 's drug volume of distribution , that can also influence the optimization of antibiotic dosing . crcl : creatinine clearance ; mic : minimum inhibitory concentration ; pk / pd : pharmacokinetic / pharmacodynamic .
malignant neoplasm of lymphoid cell is lymphomas which is divided into 2 groups : hodgkin and non - hodgkin . primarily hodgkin 's lymphoma is lymph nodes 's disease , which has been known with the presence of two nuclear cells called reed - sternberg cells and lymphoid stroma composed of many non - neoplastic cells . non - hodgkin 's lymphomas are a group of prevalent neoplasms that originate primarily from lymph nodes , but also extranodeal non - hodgkin 's lymphomas are found that constitute 20 - 40% of non - hodgkin 's lymphomas in usa and approximately half of those in asian countries . the majority of head and neck maxillofacial lymphomas arise in lymphoid tissue , especially the cervical group of lymph nodes and waldeyer 's ring , followed by the vestibule and gingiva , mandible , palatal soft tissue , maxilla , and tongue . non - hodgkin lymphoma generally originates from the two groups b and t lymphocytes 85% of non - hodgkin lymphoma derived from b lymphocytes but t - cell origin tumors are less common . anaplastic large - cell lymphoma ( alcl ) is a subgroup of non - hodgkin malignant lymphoma ( ml ) , originated from t or nk cells that initially described by stein et al . in 1985 . the lesion is characterized by proliferation of anaplastic large lymphoid cells with abundant cytoplasm that strongly express cd30 antigen . primary alcl in the oral cavity is extremely rare , with only 10 other cases known to have been reported . we report a male patient with oral involvement ( posterior of the hard palate ) as the first sign of systemic alcl . we also discuss the clinicopathologic and immunohistochemical profiles compared with those in previously reported cases . a 32-year - old man was referred to the department of oral surgery , dental school of isfahan in 2010 . patient 's chief complaint was swelling and scarring of the posterior hard palate about three weeks before visiting and after the extraction of maxillary left second and third molars . on physical examination , the patient had scar with raised edges and a yellow - white membrane in posterior of the hard palate [ figure 1 ] . the patient declared a history of lymphoma from 1.5 years ago in the neck lymph nodes which diagnosis was anaplastic larg cell lymphoma , that had been receiving chemotherapy . clinical view of the lesion severe alveolar ridge resorption with irregular border were found in left maxilla by an x - ray examination [ figure 2 ] . panoramic view of patient the clinical signs and symptoms of patient raised probability of diagnosis of ulcers caused by chemotherapy and tumor 's metastasis . after that , incisional biopsy was done and was sent to oral and maxillofacial pathology department after embedding in 10% formalin fixative . microscopically , the proliferation of large and bizarre form neoplastic cells with hyperchromatic and angular nuclei , and numerous bizarre tumor giant cells with atypical mitotic figures which had been located between necrotic tissue and degenerated minor salivary glands as seperated foci was seen . surface of this lesion had been covered with the fibrinoleukocyter membrane [ figure 3 ] . histopathological view : proliferation of large and bizzare form neoplastic cells ( h and e , staining 100 ( a ) , 400 ( b ) ) the histologic findings suggested an alcl , and differential diagnoses included metastasis of lymphoma , poorly differentiated carcinoma and malignant melanoma . the antibodies used to determine the definitive diagnosis were included : lca , ck , cd20 , cd30 and cd3 . the following results were obtained [ figure 4 ] : immunohistochemical staining : cytokeratin ( a ) , leukocyte common antigen ( b ) , cd30 ( c ) , cd3 ( d ) based on the immunohistochemical findings , the lesion was diagnosed as an metastatic alcl . the patient was transfered to omid 's hospital of isfahan . despite consecutive follow - up , unfortunately the patient did nt corporate about presenting treatment plan and refused from referring to oral pathology department . non - hodgkin 's lymphomas are a group of lymphoid neoplasms with a wide range of behavior ( some are indolent , some are very aggressive and if untreated can be fatal ) . head and neck area , especially waldeyer 's ring is second common site of non - hodgkin 's lymphoma . in 1985 stein et al . described a series of 45 diffuse large - cell lymphoma strongly expressing the ki-1 antigen ( cd30 ) and exhibiting prominent sinusoidal invasion , most of which had previously been diagnosed as malignant histiocytosis or anaplastic carcinoma . as hodgkin 's disease ( hd ) is also characterized by strong expression of cd30 , a common origin of these two entities was initially proposed . however any relationship between these two entities was then disproved in several different studies . in 1988 , , were included as a new clinicopathological entity in the revised kiel classification under the denomination of large cell anaplastic lymphoma . the alcls are further subdivided into 3 categories according to clinical criteria and immunohistochemistry : ( 1 ) primary systemic anaplastic lymphoma kinase ( alk ) positive alcl ; ( 2 ) primary systemic anaplastic lymphoma kinase ( alk ) negative alcl ; and ( 3 ) primary cutaneous alcl . the alk expression is predominantly caused by a t(2;5 ) translocation genetic abnormality , in which the nucleophosmin ( npm ) gene at 5q35 is translocated with the alk gene at 2p23 , resulting in the formation of p80npm / alk fusing protein . the alk(+ ) alcls usually occur in the first decades of life and are more prevalent in males . they response to chemotherapy and have a good prognosis , whereas the alk ( _ ) alcls occur in elderly individuals ( most common in 6 decade and male predominance ) and have a comparably poor prognosis . common involved extranodal sites include skin ( 21% ) , bone ( 17% ) , soft tissues ( 17% ) , lung ( 11% ) , and liver ( 8% ) , and involvement of the gut and central nerve system is rare . involvement of bone marrow in alcl can be varied from 10 to 40% and depends on a methods of immunohistochemical and morphological study . in addition , in about 50% of extranodal systemic alcl , 2 or more sites are involved . several oral alcl cases have been reported , although some were the b - cell phenotype that now are classified as an anaplastic type of diffuse large b - cell lymphoma , we found only 9 cases of oral alcl reported in the english - language literature ; the mean age of the patients was 54.6 years old ( range 12 to 77 years ) that in comparison with our patient ( 32 years ) were considerably higher and the gender distribution was equal . most reported cases have been occurred in the gingiva and in addition of our patient only one case of oral alcl have been reported in the hard palate . all of the reported patients with oral alcl complained from swelling occasionally combined with ulceration and pain as a first symptom , which made it difficult to distinguish from other oral inflammatory disorders . alcl typically shows a broad spectrum of morphologic features , ranging from small - cell neoplasms to cases with very large and anaplastic cells predominance but almost all the cases , share a common feature , which is the presence of a variable number of so called hallmark cells. these are large cells with abundant cytoplasm and eccentric lobulated horse shoe or kidney shaped nuclei ; an intense eosinophilic region corresponding to the golgi apparatus is seen near the nucleus , and this region is often surrounded by the nucleus itself . the size of the hallmark cells is usually large , but in small - cell variant cases , smaller elements with the same morphologic features can be present . along with these highly characteristic and almost diagnostic hallmark cells , neoplastic elements with different morphology are usually seen . in some cases nuclei multinucleated cells may be present , but cells resembling typical reed - sternberg cells are uncommon . moreover , in alcl nucleoli are smaller than in hd diagnostic cells . in our case , we observed the proliferation of large and bizarre form neoplastic cells with hyperchrome and angular nuclei associated , with numerous bizarre tumor giant cells and atypical mitotic figures which had been located between necrotic tissue and degenerated minor salivary glands as seperated foci . the histologic appearance of an alcl can sometimes be problematic and so confuse with that of a poorly differentiated carcinoma , amelanotic melanoma , or hodgkin 's disease . various immunohistochemical markers have been studied in this neoplasm , including positive staining for cd3 in 57% , cd30 in 100% , and lca in 75% of all cases . in this case , reactivity of tumor cells for lca , cd3 , cd30 , and to a lesser degree cd20 was observed . alcl should be differentiated from other cd30 positive lesions such as malignant melanoma , hodgkin 's lymphoma , anaplastic large b - cell lymphoma . for example , tumor cells in melanoma are positive for s-100 and hmb45 unlike alcl . although alcl is an aggressive tumor , it is responsive well to single or combined chemotraphy with 77% having 5 year survival rate .
the majority of the studies of the neuropathology of mci , especially degenerative / amnestic mci , suggest that in most instances mci is associated with a less fervent manifestation of the neuropathologies that are generally associated with dementia . unselected mci samples derived from memory clinic or general geriatric populations evidence a variety of neuropathologic lesions such as those associated with diffuse lewy body disease , cerebrovascular disease , ischemic changes and hippocampal sclerosis , argtrophilic grain disease , parkinson 's disease , and , of course , ad ( eg , refs 37 - 40 ) . nearly invariably , the extent of these lesions is considerably less than those observed in persons with frank dementia . in general , relative to persons with intact cognition , the frequency of ad - associated neuropathology in persons with mci , especially those with amnestic mci , is significantly greater than other neuropathologic lesions associated with dementia . alzheimer 's disease is characterized by extracellular neuritic plaques ( np ) and intracellular neurofibrillary tangles ( nft ) . as mentioned previously , the extent , distribution , and density of these lesions are used by most diagnostic and staging strategies for ad . most studies of mci have shown that the density and distribution of these hallmark lesions and their less mature lesion variants ( eg , np - diffuse plaques , cored plaques ; nft - pre - nft hyperphosphorylated or conforma tionally altered tau ) is significantly increased in the brains of persons with mci . early studies by morris et al showed that persons with cdr scores of 0.5 , ie , questionable dementia / mci , evidenced statistically significant increases in the density of plaques , especially diffuse plaques , in the temporal cortex . the density of plaques increased with increasing dementia severity and the proportion of plaques shifted from diffuse to more mature variants ( eg , cored and neuritic ) . our studies of neuritic plaques showed a similar pattern where persons with cdr=0.5 evidenced significantly greater number of nps in the neocortex than age - matched cognitively intact controls , but fewer nps than persons with frank dementia ( ie , cdr>1 ) . similar changes were noted recently in a study where the definition of mci was restricted to those persons with amnestic mci as defined by petersen et al . in that study the numbers of neocortical diffuse plaques were not significantly elevated in mci , but the numbers of nps were significantly higher than those in persons with intact cognition . since the pathogenic constituent of nps is the a peptide , it is not surprising that a levels in the brains of persons with mci are also significantly elevated . just as diffuse plaques may represent premature nps , oligomeric forms of a may precede the diffuse aggregates and represent an even earlier neurotoxic form of a. the question of the association of oligomeric forms of a in mci is an area of active current investigation by many laboratories ( see below ) . as mentioned previously , these observations ol plaque involvement in mci are consistent with neuroimaging/ pet studies of mci using pib . however , the precise distribution of nfts within neocortical and medial temporal lobe structures and the phosphorylation or conformational state of the tau protein constituent of nfts may be critical factors . several studies have found that the density of nfts in the hippocampus and the parahippocampal gyrus as well as the amygdala increase significantly in persons with mci ( eg , refs 39,49 ) . most studies find that the nft involvement in neocortical regions is associated with more advanced cognitive impairment , supporting the staged development of nft pathology as a function of ad progression . the development of early nft pathology and its progression is further supported by cellular studies . stereological analyses have shown that , at least in the neocortex , mci or early adassociated nfts develop first in degeneration - susceptible large neurons of layers iii and v of the frontal cortex , implicating long- track association circuits of the brain . multivariate analyses of nfts with an emphasis on early conformational changes of tau in the frontal cortex support these observations . on the other hand , other studies ( eg , refs 44,63 ) have noted an age - dependent increase in nfts , like those cited above , but they have found nft association with cognitive function relatively late in the course ol disease . a possible explanation of these apparently discrepant results may lie in the way that nfts develop . just as nps are thought to evolve ( from diffuse to cored to neuritic ) , nfts develop gradually through changes in protein structure . nfts are comprised of paired - helical filaments that are aggregates of the microtubule - associated protein tau that have undergone abnormal conformation and phosphorylation . several studies suggest that even when an association between mci and histopathological indices of nfts is not identified , changes in the phosphorylation or conformation state of tau are associated with mci ( eg refs 42,73 ) . in addition , recent studies suggest that the neurofilament protein tau within the ad - vulnerable cholinergic neurons of the nucleus basalis of meynert ( nbm ) and noradrenergic neurons within the brainstem locus ceruleus become conformationally altered or hyperphosphorylated in mci . although nps and nfts are hallmark and diagnostic lesions for ad , their net effect on cognitive function maybe expressed through cell death and/or loss of synapses . only a few studies have examined neuronal or synaptic loss in mci directly , eg , refs 76 - 80 . several of these studies used stereological techniques and found significant loss of neurons in the frontal cortex , the entorhinal cortex and the ca1 field of the hippocampus . an interesting feature of one of these studies was that the neuronal loss exceeded the number of nft - bearing neurons . this observation could suggest that in addition to nfts , other factors influence neuronal loss in mci and ad ; but it can also be argued that the greater neuronal loss reflects the death and elimination of nft - bearing neurons , and the survival of other nft - bearing neurons that have not yet been eliminated from the neuronal pool . on the other hand , other studies have noted that detectable cell loss does not occur in the brains of persons with mci , but is evident in the brain of more cognitive ! ) ' impaired early ad persons . credence lor this hypothesis can be derived by the observation that in at least one of the studies reporting mci - associated cell loss , the subjects included in the mci group evidenced sufficient np and nft lesions to meet diagnostic criteria for ad . this observation raises the possibility that persons classified as mci in this study were in a more advanced stage of cognitive impairment than those assessed in some of the other studies ( eg , ref 79 ) . clearly , the number of studies that have investigated the question of neuronal loss in mci , and the number of cases of mci samples in each of these studies is too small to justify firm conclusions . however , the cited studies all suggest that neuronal loss is a feature of cognitive compromise that can be observed early in the dementing process , even if absent at the ver ) ' earliest stages of impairment . that more subtle cellular changes occur also in mci is supported by recent studies that suggest that , while some neurons are lost in mci , others , especially those in the cerebral cortex , hippocampus , and nbm , undergo hypertrophy of their nuclear volumes . it has been hypothesized that these cellular changes may reflect a compensatory state that forestalls cell death in mci . although the numbers ol studies are still very limited , there is growing emphasis on exposing the neurobiological mechanisms responsible for cell death in mci . the toxicity of a and a oligomers mentioned above is one example , as is the susceptibility of some neurons to oxidative stress and the expression and response to neurotrophic factors . one recently emergent concept that is consistent with neuronal loss in mci and ad is the abnormal re - execution of cell division / cycle programs in neurons and the abnormal expression of cell - cycle related genes and proteins . unquestionably , these divergent mechanisms may not be mutually exclusive and many other cellular processes are likely to play important roles in mci - associated cell loss . these and other similar studies underscore the clear imperative for future research to more fully describe the mechanistic processes that contribute to neuronal death . early studies ( eg , ref 74 ) , that have since been replicated multiple times , showed that the cholinergic neurons of the nbm were especially vulnerable to degeneration in ad . this finding was highly consistent with even earlier observations that the activities of cholinergic enzymes are significantly reduced in ad . several studies ( eg , refs 95,96 ) indicated that although the cholinergic deficits in ad were profound , they became manifest only in the late stages of cognitive impairment . more recent reports have suggested that mci is associated with more subtle cholinergic abnormalities that may be indicative of compensatory changes . these detailed studies of mci found that the activities of cholinergic marker enzymes rose in multiple cortical regions and in the hippocampus of persons with mci , but then returned to levels comparable to that of nondemented individuals in early ad and early dementia cases before decreasing to below normal in advanced ad . that the mci - associated changes in the activities of cholinergic marker enzymes are likely related to changes in nbm neurons has been shown by elegant gene expression profiling studies of individually dissected neurons . this study showed that the composition of neurotrophin / cholinotrophic response elements in individual cholinergic neurons of the nucleus basalis ol meynert is significantly altered in mci . a parsimonious corollary to neuronal loss however , proliferation of synapses compensatory to neuronal loss could also occur , as could reductions in synaptic numbers , proteins and function in the absence of neuronal loss . early pioneering studies , ( eg , refs 99 - 101 ) , suggested that synapse loss was a strong correlate of cognitive compromise in ad , but these studies did not address the question of synapse loss in mci directly . unbiased stereological studies have shown that there is indeed significant synaptic loss associated with mci in the dentate gyrus and the ca1 field ol the hippocampus and that the magnitude of synaptic loss increases with increasing cognitive impairmant . many neurobiological mechanisms can be involved in this mci - associated loss of synapses , including toxicity of a oligomers . more biochemical studies have suggested that the changes in synaptic function may occur non - uniformly in different parts of the brain and that different synapse - associated proteins , including markers of dendritic spine plasticity ( drebrin ) , may be differentiallyaffected in mci . until recently , most studies of the neurobiological substrates of dementia and ad have focused on persons in the 65 to 85 years of age range or have not specifically differentiated between different age groups within the elderly population . however , us census bureau data and projections show that the number of americans over the age of 85 ( 4.4 million in 2001 ) will rise significantly by 2010 to 5.8 million and will quadruple to 19.3 million by 2050 ( http://www.census.gov/population/www/ projections / natdet - d1a.html ) . of these 19.3 million , 8 million are predicted to develop dementia , with the prevalence of dementia increasing from 13% in 77- to-84 year - olds to 48% in persons 95 years old and older . similarly , the incidence of dementia increases from 1% at age 65 to 21% to 47% at ages 85 and older . only recently have studies begun to distinguish between young - old , often defined as those younger than 85 or 90 , and oldest - old individuals ( persons over the age of 85 or 90 ) . that understanding the neurobiological substrates of dementia and mci in this age group is important is highlighted by a recent study suggesting that even after controlling for physical disorders , 5-year mortality in persons 95 years and older is significantly higher in demented individuals than in those who are cognitively intact ( 96% vs 73% , respectively ) . in fact , dementia was a stronger predictor of mortality in this population than cardiovascular disease , cancer or male sex . the importance of this distinction has become even more apparent from recent evidence suggesting that the neuropathological substrates of dementia may be different in these two broad age categories . accumulating evidence suggests that nonagenarians and centenarians display different patterns of cortical vulnerability to the neurodegenerative process compared with younger elderly , and it is not known whether correlations between clinical severity and neuropathological stages remain valid in this age group . several investigations have noted that oldest - old participants who die with dementia frequently do not have the high amounts of the hallmark np and nft neuropathological lesions generally associated with dementia and/or ad ( but see ref 43 ) . one of these studies directly compared the density of neocortical and hippocampal nps and nfts in the brains ol young - old individuals with cdr scores of 0.5 , to similarly impaired oldest - old persons . as expected from the foregoing , a relatively high number of nps and nfts were associated with cdr 0.5 in young - old individuals , but the density of nps and nfts was not significantly higher in the brains of cdr 0.5 oldest - old persons . the failure of nft - based neuropathological staging to distinguish between persons without cognitive impairment and those with mci has also been reported in nonagenarians . interestingly , the association of synaptic abnormalities and dementia appear to be relatively constant between young - old and oldest - old persons with frank dementia raising the possibility that the association of synaptic proteins with mci noted in young old persons ( see above ) will also be true of oldest - old persons with mci . even when evidence of mci associated neuropathology is found in the oldestold , the neuroanatomical distribution of the lesions appears to vary from that of young - old persons . one quantitative study that investigated the distribution of nps and nfts within the different fields of the hippocampus in mild ad cases found modest associations of nfts in the ca2 field of the hippocampus in the oldest - old , whereas nfts in the ca1 field , which is more closely associated with dementia in younger persons , appeared to be relatively spared . given the clinical relevance of mci and its importance and implications for the development of treatment approaches for dementia in the elderly , it is disappointing that direct postmortem and neurobiological studies of mci are insufficient for firm conclusions . many of the existing studies are marred by small sample sizes , insufficient clinical characterization , and experimental and practical constraints on consideration of crucial variables such as age , symptom duration , and sex . despite these limitations , the available data suggests that similar to the continuum of cognitive impairment , the ad - associated neurobiology and neuropathology of mci are typified by prediagnostic mild changes that are qualitatively similar to those associated with the pathophysiology of ad dementia . neuropathological , anatomical , and neurobiological studies of mci in the oldest - old are even more sparse than age - indiscriminate studies or studies in young - old persons .
the portability of a handheld dynamometer ( hhd ) is excellent , and its clinical application for measurements is simple . the relative intra - class and inter - class reliabilities of an hhd are 0.840.991 and 0.840.942 , respectively . conventionally , the sensor unit of an hhd is fixed during the measurement of muscle strength . although hhds are usually fixed by examiners using their hands , there are fixed limits for the strength values than can be accurately measured3 , 4 . considering this , a previous study reported 30 kgf as the fixed limit of shoulder horizontal adductor muscle strength measurements using an hhd fixed with the examiner s hand ( hand - fixed hhd ; hfhhd)10 . although the hfhhd method has measurement limits , it is simple . therefore , measurements made by the same examiner in accordance with the fixed limits of the sensor are considered clinically reliable . reported that in the measurement of lower limb muscle strength , the inter - class reliability was higher when using a belt - fixed hhd ( bfhhd ) than when using the conventional hfhhd method , even for muscle strength values less than the fixed limits of measurements6 . however , there have been no previous studies on the absolute reliability in measurements upper limb muscle strength . this study examined shoulder joint horizontal adduction muscle strength measured using an hfhhd and bfhhd . the purpose of this study was to examine the absolute reliability of measurements in the all subjects group as well as a group with less than a fixed limit of muscle strength . a total of 33 healthy college students ( 20 males and 13 females ; age , 2122 years ; height , 168.4 7.6 cm ; body weight , 62.4 9.6 kg ) were recruited in this study . the examiner , a 21-year - old college student ( male ; height , 174 cm ; body weight , 63 kg ) , received sufficient training on measurement techniques before the experiment . measurements of the strength of the shoulder joint horizontal adductor muscles were made using an hhd . a tas f-1 hhd ( anima corp . , tokyo , japan ) was used . the shoulder joint was abducted to 90 , with 0 internal rotation and 0 external rotation , and the elbow joint was flexed to 90. the elbow on the measurement side was positioned on the edge of the examination table . the subject was positioned such that the shoulder joint position was aligned with the bedpost . for the bfhhd measurements , a belt was inserted between the bedpost and the floor to fix the hhd . the sensor was placed on a thin rubber pad on the distal upper arm . the examiner controlled his hand in such a way that he did not move the sensor of the hhd and suppressed compensatory movements by placing his other hand on the anterior aspect of the opposite shoulder joint . subjects were asked to perform isometric contractions in a manner similar to the make test . maximum contractions were attained within 3 s and were maintained for 5 s. the maximum values of the horizontal adduction muscle strength of the shoulder joint were recorded . measurements were made on the same day at intervals of 30 s. repetitions of hfhhd and bfhhd measurements were made at intervals of 1 week . an assistant recorded the measured values , and the examiner was blinded to these values . for obtaining representative values from the results obtained , the differences in the values were measured , along with an analysis of absolute reliability in hfhhd and bfhhd measurements for both all subjects and the < 30 kgf group . because the fixed limit of the hfhhd for shoulder horizontal adduction muscle strength measurements was 30 kgf10 , we examined subjects with < 30 kgf measurement values as a single group . baa was performed using statistical software ( r2.8.1 ) between the 1st and 2nd measurements as well as between the maximum value obtained during the 1st and 2nd measurements and the 3rd measurement . a probability ( p ) value of < 0.05 was considered statistically significant . the study protocol was approved by the ethics committee of ryotokuji university ( approval number : 2528 ) and was in accordance with the declaration of helsinki . the mean and standard deviation of the measurements of the shoulder joint horizontal adduction muscle strength are shown in table 1table 1.subject characteristics and shoulder joint horizontal adduction muscle strengthall subjects<30 kgf group>30 kgf grouphfhhdbfhhdhfhhdbfhhdhfhhdbfhhdnumber of subjects ( male , female)33 ( 20,13)13 ( 1,12)20 ( 19,1)age ( years)21.8 8.421.5 0.521.9 0.3height ( cm)168.4 0.4161.2 4.3173.0 5.4body weight ( kg)62.4 9.653.8 3.768.0 3.71st ( kgf)21.0 6.232.0 15.214.8 3.716.7 4.925.0 3.741.9 10.62nd ( kgf)21.6 6.831.0 13.114.3 3.917.8 4.726.4 2.839.6 8.73rd ( kgf)20.6 6.830.3 12.313.9 4.217.9 5.424.9 4.138.4 7.8the maximum value obtained during the 1st and 2nd ( kgf)22.3 6.833.6 14.515.0 3.718.9 4.727.0 3.043.1 9.8meansd . hfhhd : conventional method of an examiner manipulating the hhd by hand ( hand - fixed hhd ) . the results of baa and the standard error of measurement ( sem ) are shown in table 2table 2.bland-altman analysis of shoulder joint horizontal adduction muscle strength measurementsfixed biasproportional biassem(kgf)loamdc95(kgf)95% cibiasslope of the regression linebias<30 kgf group ( n=13)hfhhd ( the 1st and 2nd measurements)0.22 to 1.08n - ex0.055 n - ex0.8 0.6 to 1.42.1 hfhhd ( the maximum obtained during the 1st and 2nd measurements and the 3rd measurrment ) 0.30 to 1.76 exist0.143 n - ex0.9 0.1 to 2.1 2.3 bfhhd ( the 1st and 2nd measurements)3.47 to 1.38n - ex0.051 n - ex2.8 4.7 to 2.67.8 bfhhd ( the maximum obtained during the 1st and 2nd measurements and the 3rd measurement)0.10 to 2.08n - ex0.142n - ex1.30.7 to 2.63.5bfhhd and hfhhd ( the maximum obtained during the 1st and 2nd measurements ) 1.83 to 6.10exist0.293 n - ex2.50.7 to 7.26.9all subjects ( n=33)bfhhd ( the 1st and the 2nd measurements)0.82 to 2.99n - ex0.158exist3.76.0 to 8.010.2bfhhd ( the maximum obtained during the 1st and 2nd measurements and the 3rd measurement)1.62 to 4.87exist0.167exist3.22.9 to 9.49.0hfhhd : conventional method of an examiner manipulating the hhd by hand ( hand - fixed hhd ) ; bfhhd : hhd fixed with a belt ( belt - fixed hhd ) . * presence of bias : exist , present ; n - ex : not present . 95% ci : 95% confidence interval ; sem : standard error of measurement ; loa : limits of agreement ; mdc95 : minimal detectable change in the 95% confidence interval .. the < 30 kgf hfhhd group had no systematic bias between the 1st and 2nd measurements , and the sem was 0.8 kgf . a fixed bias was observed between the maximum value obtained during the 1st and 2nd measurements and the 3rd measurement . the 3rd measurement was smaller than the maximum value obtained during the 1st and 2nd measurements . the < 30 kgf bfhhd group had no systematic bias between the 1st and 2nd measurements , and the sem was 2.8 kgf . in addition , no systematic bias between the maximum value obtained during the 1st and 2nd measurements and the 3rd measurement was observed , and the sem was 1.3 kgf . in the < 30 kgf group , a fixed bias existed between the maximum value obtained during 1st and 2nd measurements with the hfhhd and bfhhd . in addition , the values measured using the bfhhd were greater than those measured using the hfhhd . hfhhd : conventional method of an examiner manipulating the hhd by hand ( hand - fixed hhd ) . bfhhd : hhd fixed with a belt ( belt - fixed hhd ) hfhhd : conventional method of an examiner manipulating the hhd by hand ( hand - fixed hhd ) ; bfhhd : hhd fixed with a belt ( belt - fixed hhd ) . * presence of bias : exist , present ; n - ex : not present . 95% ci : 95% confidence interval ; sem : standard error of measurement ; loa : limits of agreement ; mdc95 : minimal detectable change in the 95% confidence interval . in the all subjects group , moreover , proportional and fixed biases between the maximum value obtained during the 1st and 2nd measurements and the 3rd measurement were observed . the 3rd measurement was smaller than the maximum value obtained during the 1st and 2nd measurements . in the present study , by using 30 kgf as the fixed limit for measurement of the shoulder joint horizontal adduction muscle strength by hfhhd in accordance with previous research , we verified the absolute reliability of the test - retest method in measurements less than the fixed limit . in addition , we investigated the absolute reliability between the hfhhd and bfhhd for measurements less than the fixed limit . flansbjer et al.12 reported good sensitivity of a test in the analysis of reliability of the gait performance criteria , and the sem of measurement values was reported to be 10% or less . therefore , in this study , no systematic bias for absolute reliability was observed ; an sem of < 10% was regarded to be the bias allowed for clinical settings . the hfhhd results in the < 30 kgf group had no systematic bias , and the sem was < 10% of the means of the 1st and 2nd measurements . in addition , the 3rd measurement was less than the maximum value from the 1st and 2nd measurements . therefore , in the < 30 kgf hfhhd group , a single measurement was considered to be reliable in the clinical setting . the bfhhd results in the < 30 kgf group had no systematic bias , and the sem was < 10% of the mean of the 1st and 2nd measurements . in addition , the 3rd measurement value was less than the maximum of the 1st and 2nd measurement values . therefore , the maximum value of two measurements in the < 30 kgf bfhhd group was considered to be reliable . although 30 kgf is within the manipulative fixed limit , a fixed bias was observed between the maximum value obtained during the 1st and 2nd measurements using the hfhhd and bfhhd , and bfhhd values were higher than hfhhd values . the magnitude of the bias was estimated to be 0.737.19 from the limits of agreement . consequently , caution should be exercised when comparing measurements made using an hfhhd and bfhhd because of the different measurement methods . in all subjects , a proportional bias between the 1st and 2nd measurements was observed , and the sem was > 10% of the mean . fixed bias and proportional bias were observed between the maximum value obtained during 1st and 2nd measurements and the 3rd measurement . the 3rd measurement was smaller than the maximum value obtained during the 1st and 2nd measurements . therefore , the adopted value was considered to be the maximum value of two measurements . according to the results of the present study , for measurement of the shoulder joint horizontal adduction muscle strength using an hfhhd , however , hfhhd values may not accurately represent actual strength , because they are smaller than bfhhd values ; thus , the measurement method should be considered in the comparison of the measured values . for a bfhhd , the adopted values were considered to be the maximum value of two measurements . in the present study , intra - class reliability was observed ; however , we were not able to ensure face validity . therefore , future research must consider inter - class reliability and the reliability of measurements in elderly subjects and those with diseases .
chylous ascites is considered a relatively rare postoperative complication , but it can not be disregarded because van der gaag et al . 1 reported that the incidence after pancreaticoduodenectomy was 9% , and malik et al . 2 reported that it was 6.7% . for treatment , there are conservative and surgical treatments . however , no reliable treatment method has been established , and treatment is difficult in many cases . therapeutic lipiodol contrast imaging has recently been attracting attention , but it is necessary to puncture a lymph duct to perform lymphangiography and sclerotherapy . generally , a lymph duct is punctured with a 30g butterfly needle [ 3 , 4 ] , but lymph ducts are very thin and fragile , and cannulation may perforate the duct or its fixation is difficult . we encountered a patient with chylous ascites after surgery for pancreatic cancer in whom a lymph duct was secured under a microscope and punctured with a catheter for the neonatal central vein . lymphangiography and lipiodol injection could be stably applied , and a favorable outcome was achieved . he was diagnosed with pancreatic body cancer and underwent total pancreatectomy at the department of surgery . after surgery , ascites accumulation persisted , but the general condition was stable . thus , the patient was discharged 2 months after surgery . however , abdominal distension gradually aggravated , and marked ascites was observed on ct ( fig . 1 ) . in addition to fasting , highcalorie infusion management , and several applications of abdominocentesis , internal medical treatment , such as octreotide and etilefrine administration , were performed , but the condition was not improved . the patient was referred to our department 9 months after surgery to perform a therapeutic lipiodol contrast imaging . we performed a new technique of lymph duct puncture to perform lipiodol contrast imaging and sclerotherapy . the patient was a 65yearold man who was diagnosed with chylous ascites caused by chyle leakage after total pancreatectomy for pancreatic cancer . indocyanine green ( icg , daiichi sankyo company , tokyo , japan ) was intracutaneously injected into the right dorsum pedis , and the lymph duct distribution was observed using an infrared camera ( photo dynamic eye ( pde ) , hamamatsu photonics , japan ) . after applying local anesthesia with 1% xylocaine epinephrine , a 12mm incision was made in the right lower leg using a scalpel ( fig . 2 ) . a lymph duct was identified and secured under a microscope ( fig . 3 ) . a 3/4 circumference incision was made in the lymph duct , and 80 nylon thread was applied to the upper end as an auxiliary thread ( fig . 4 ) . a 28g singlelumen catheter for the neonatal central vein ( argyle pi catheter kit , 0.42mm diameter 20 cm , covidien ltd . firstly , the guidewire was inserted into the lymph duct , the skin was punctured with a 23g needle on the distal side of the incision , and the outer catheter was subcutaneously passed through and advanced into the lymph duct using the guidewire ( fig . 4 ) . the outer catheter was fixed to the lymph duct by ligation with 80 nylon thread at three sites , and the guidewire was removed ( fig . urografin ( 60% , bayer yakuhin , ltd . , japan ) was injected , and cannulation into the lymph duct was confirmed on radiography ( fig . the skin was sutured with 50 nylon , and surgery was completed . after returning to the ward , 12 ml of lipiodol ( guerbet japan , japan ) was injected at a rate of 6 ml / h through the catheter . after intracutaneous indocyanine green injection , the lymph duct distribution was confirmed using an infrared camera and an incision above the duct was designed . the subcutaneous region was exposed under a microscope , and a lymph duct was identified and secured . a 3/4 circumference incision was made in the lymph duct , and 80 nylon thread ( blue arrow ) was applied to the upper end as an auxiliary thread to open the duct . the guidewire in the 28g catheter for the neonatal central vein ( red arrow ) was inserted , followed by insertion of the outer catheter . the outer catheter was fixed to the lymph duct by ligation with 80 nylon thread at three sites , which made the duct resistant to the pressure of drug injection . the lymph duct is not obstructed by slightly strong ligation because the guidewire is contained in the catheter . the skin was then punctured with a 23g needle on the distal side of the incision , and the outer catheter was subcutaneously passed through . lipiodol was noted around the aorta , confirming that it had reached the cistern of chyle ( fig . recovery was favorable , and the patient was discharged 1 month after our surgery . one year has passed since the surgery , but recurrence has not been admitted ( fig . lipiodol was noted around the aorta , confirming that it had reached the cistern of chyle . postoperative chyle leakage due to lymph duct damage is a relatively rare complication . for treatment , there are conservative and surgical treatments . for conservative treatment , a lowfat diet , fasting and nutrition management by central venous alimentation are basic 5 . as ulibarri et al . 6 reported the efficacy of somatostatin administration for the treatment of chyle leakage in 1992 , the usefulness of a somatostatin derivative , octreotide , for intractable chylous ascites has been reported 7 . in 1999 , guillem et al . reported that the combination of octreotide and etilefrine with sympathetic nerve 1 action improved lymphorrhea 8 . on the other hand , surgical treatment includes lowinvasive drainage , a peritoneovenous shunt 9 , and highinvasive lymph duct ligation and clipping by laparotomy . however , no reliable treatment method has been established , and treatment is difficult in many cases . therapeutic lipiodol contrast imaging for postoperative chyle leakage has recently been attracting attention 10 . in the present patient , all conservative treatments were applied , but remission could not be achieved , and surgical lymphangiography and lipiodol embolization were selected . the mechanism of healing lymphorrhea by lipiodol has not been clarified , but the promotion of granulation by lipiodolinduced embolization and inflammation of the lymph duct damage site are considered 11 . it is necessary to puncture a lymph duct to perform lymphangiography and sclerotherapy . in previous lymphangiography , isosulfan blue or indigo carmine was subcutaneously injected into the region between the toes , the dorsum of the foot was incised , a stained lymph duct was identified , and the lymph duct was cannulated with a 30g puncture needle for lymphangiography 3 , 4 . this method requires the cannulation technique and damages the lymph duct , or the puncture needle detaches while injecting contrast medium , being unreliable . thus , we designed a new method which secures a lymph duct under a microscope using a catheter for the neonatal central vein and ensures cannulation into the lymph duct and stable injection of a drug . first , it was performed under a microscope so that handling of a thin lymph duct was easy compared with that under direct vision . second , using icg and a pde camera to confirm the distribution of lymph duct , it is possible to incise the center of the lower leg instead of the dorsum of the foot , thus securing thicker lymph duct . third , a 3/4 circumference incision was made in the lymph duct , and 80 nylon thread was applied to the upper end as an auxiliary thread . this is an important point because the lymph duct likely to escape or be smashed can be retained using this thread , and the application of cannulation becomes easy . passing the guidewire through the incised lymph duct makes the subsequent advancement of the catheter easy . fifth , the outer catheter was fixed to the lymph duct by ligation with 80 nylon thread at three sites , which made the duct resistant to the pressure of drug injection . lymphorrhea from the punctured site may occur , but it did not occur in this patient . this new method is advantageous in that the previous complex procedures of lymph duct puncture and drug injection can be easily and stably applied . lymphangiography and sclerotherapy can be easily applied by cannulation with a catheter for the neonatal central vein to the lymph duct under a microscope . tk , kh , and sm : managed the patient 's case , contributed to the literature search , and wrote the manuscript . tk , kh , sm , ki , and kt : made substantial contributions to the concept and design of this surgical method . te : also managed the patient . se , fn , io , mi , th , mt , and mi : aggregated the data and helped draft the discussion of the manuscript .

with the obvious increasing prevalence and mortality rate , cancer has become one of the primary causes of morbidity and mortality . the underlying mechanisms of the tumorigenesis are obscure because of the involvement of multiple risk factors containing complicated gene - gene and gene - environment interactions . many studies have demonstrated that the occurrence of cancers may be related to inflammation , and that cytokines are associated with individual susceptibility to cancers . it is located on chromosome 16 ( 16p11 ) and comprises 2 subunits - epstein - barr virus - induced gene 3 ( ebi3 ) and p28 , which is a recently discovered il-12p35-related polypeptide . it was described as a pro - inflammatory cytokine that enhances t helper ( th ) 1 responses , cytotoxic t lymphocytes ( ctls ) maturation , natural killer ( nk ) cells stimulation , and secretion of interferon- ( ifn- ) . research shows that il-27 can impair tumor progression by cd8 + t cells with promoted ctl reaction , regardless of tumor immunogenicity . additionally , il-12 inhibits neoangiogenesis in tumors by stimulation of ifn--inducible protein-10 ( ip-10 ) . in view of the association of il-27 polymorphisms and susceptibility to cancer , some previous case - control studies were conducted among chinese population [ 813 ] . however , the conclusions were inconsistent and inconclusive . in 2014 , hu et al . conducted a meta - analysis of 6 case - control studies and concluded that il-27 rs153109 polymorphism was associated with cancer susceptibility in chinese , a result consistent with another meta - analysis of 8 case - control studies by xu et al . that il-27 - 964a / g ( rs153109 ) polymorphism might enhance cancer susceptibility . using more recent studies , we conducted an updated meta - analysis to obtain a more precise evaluation of the relevance of il-27 polymorphisms ( rs153109 , rs17855750 , and rs181206 ) and cancer susceptibility . we conducted a comprehensive literature search in pubmed , web of science , google scholar , cnki ( chinese national knowledge infrastructure ) , and wanfang databases to find all eligible case - control studies up to june 11 , 2015 on the association between polymorphisms of il-27 ( rs153109 , rs17855750 and rs181206 ) and cancer susceptibility by applying the searching terms : ( interleukin-27 or il-27 ) and ( mutation or polymorphism or variant ) and ( cancer or malignancy or carcinoma or tumour or neoplasm ) without language restriction . in addition , we checked the reference lists of all the eligible publications or the relevant reviews for additional studies . the studies enrolled in the current meta - analysis had to satisfy the following criteria : ( a ) studies that assessed the relevance between the polymorphisms in il-27 and cancer susceptibility ; ( b ) studies designed as case - control ; ( c ) we can obtain specific genotype frequency of all the cases and controls or they can be obtained from the available data . we excluded studies which were : ( a ) case - only studies , reviews , comments , and case reports ; ( b ) studies without the raw statistics of the polymorphisms of il-27 ; ( c ) publications that were repetitive ; ( d ) studies focused on animals . the following details were recorded from each study by 3 investigators ( meng zhang , xiuxiu tan , and junjie huang ) : the name of the first author , year published , ethnicity of the case - control studies , source of controls , genotyping method , the number of cases and controls , and the p value of the hwe in control groups . we assessed the association between il-27 polymorphisms and cancer susceptibility by or and 95% ci . a total of 5 different ors were calculated : allele contrast model ( b vs. a ) , dominant model ( bb+ab vs. aa ) , recessive model ( bb vs. ab+aa ) , heterozygote comparison ( ab vs. aa ) , and homozygote comparison ( bb vs. ab ) ( aa , homozygotes for the common allele ; ab , heterozygotes ; bb , homozygotes for the rare allele ) . we conducted a -test - based q statistic test to evaluate the heterogeneity within the case - control studies . if the q test ( p>0.1 ) suggested homogeneity across studies , we selected the fixed - effects model ; otherwise , the random - effects model was used . in addition , we further quantified the heterogeneity effect by i test ( i<25% : no heterogeneity ; i=2550% : moderate heterogeneity ; i=5075% : high heterogeneity , i>75% : extreme high heterogeneity ) . if any cancer type totals no more than 2 studies , we included it into the other cancers group . sensitivity analyses were used to calculate the stability of the results by removing a single case - control study from the enrolled pooled data to detect the influence of that data set on the pooled ors . finally , we used begg s funnel plot and egger s regression test to evaluate the potential publication bias [ 20 , 21 ] . we used stata 12.0 ( stata corporation , college station , texas ) to conduct all statistical analyses . we conducted a comprehensive literature search in pubmed , web of science , google scholar , cnki ( chinese national knowledge infrastructure ) , and wanfang databases to find all eligible case - control studies up to june 11 , 2015 on the association between polymorphisms of il-27 ( rs153109 , rs17855750 and rs181206 ) and cancer susceptibility by applying the searching terms : ( interleukin-27 or il-27 ) and ( mutation or polymorphism or variant ) and ( cancer or malignancy or carcinoma or tumour or neoplasm ) without language restriction . in addition , we checked the reference lists of all the eligible publications or the relevant reviews for additional studies . the studies enrolled in the current meta - analysis had to satisfy the following criteria : ( a ) studies that assessed the relevance between the polymorphisms in il-27 and cancer susceptibility ; ( b ) studies designed as case - control ; ( c ) we can obtain specific genotype frequency of all the cases and controls or they can be obtained from the available data . we excluded studies which were : ( a ) case - only studies , reviews , comments , and case reports ; ( b ) studies without the raw statistics of the polymorphisms of il-27 ; ( c ) publications that were repetitive ; ( d ) studies focused on animals . the following details were recorded from each study by 3 investigators ( meng zhang , xiuxiu tan , and junjie huang ) : the name of the first author , year published , ethnicity of the case - control studies , source of controls , genotyping method , the number of cases and controls , and the p value of the hwe in control groups . we assessed the association between il-27 polymorphisms and cancer susceptibility by or and 95% ci . a total of 5 different ors were calculated : allele contrast model ( b vs. a ) , dominant model ( bb+ab vs. aa ) , recessive model ( bb vs. ab+aa ) , heterozygote comparison ( ab vs. aa ) , and homozygote comparison ( bb vs. ab ) ( aa , homozygotes for the common allele ; ab , heterozygotes ; bb , homozygotes for the rare allele ) . we conducted a -test - based q statistic test to evaluate the heterogeneity within the case - control studies . if the q test ( p>0.1 ) suggested homogeneity across studies , we selected the fixed - effects model ; otherwise , the random - effects model was used . in addition , we further quantified the heterogeneity effect by i test ( i<25% : no heterogeneity ; i=2550% : moderate heterogeneity ; i=5075% : high heterogeneity , i>75% : extreme high heterogeneity ) . if any cancer type totals no more than 2 studies , we included it into the other cancers group . sensitivity analyses were used to calculate the stability of the results by removing a single case - control study from the enrolled pooled data to detect the influence of that data set on the pooled ors . finally , we used begg s funnel plot and egger s regression test to evaluate the potential publication bias [ 20 , 21 ] . we used stata 12.0 ( stata corporation , college station , texas ) to conduct all statistical analyses . as presented in figure 1 , after a systematic literature search in the databases , 46 potential relevant studies on the association between il-27 polymorphisms and cancer were identified . nevertheless , of them , 34 were unqualified in that some were based on case - only design , some were not polymorphism studies and the others were not concerning the susceptibility of cancer . in the end , a total of 12 publications with 27 independent case - control studies comprising of 7,570 cases and 9,839 controls were concerning the associations of il-27 polymorphisms and cancer susceptibility . the genotype distributions of the three polymorphisms and the genotyping method of the enrolled studies were retrieved scrupulously , and the controls were selected from non - cancer populations . the results of the meta - analysis for the association of il-27 polymorphisms ( rs17855750 , rs181206 and rs153109 ) with susceptibility to cancer are presented in table 2 . obvious heterogeneity was identified in il-27 rs17855750 polymorphism ( gg vs. tt : pheterogeneity=0.036 , i=61.2% and gg vs. gt+tt : pheterogeneity=0.046 , i=58.7% ) and rs153109 polymorphism under all 5 genetic models ( g vs. a : pheterogeneity=0.003 , i=35.5% ; gg vs. aa : pheterogeneity=0.038 , i=20.4% ; ga vs. aa : pheterogeneity=0.047 , i=18.8% ; gg+ga vs. aa : pheterogeneity=0.006 , i=32.6% ; gg vs. ga+aa : pheterogeneity=0.038 , i=4.9% ) ( table 2 ) . therefore , we chose the random - effects model to generate wider cis in these genetic models . the present work identified that rs17855750 polymorphism of il-27 was significantly associated with cancer susceptibility ( g vs. t : or=1.177 , 95%ci=1.3041.341 , pheterogeneity=0.156 , figure 2a ; gg+gt vs. tt : or=1.156 , 95%ci=1.0051.329 , pheterogeneity=0.410 , figure 2b ) , particularly for bladder cancer ( gg vs. tt : or=14.600 , 95%ci=1.653128.994 , pheterogeneity=0.647 ; gg vs. gt+tt : or=14.480 , 95%ci=1.640127.836 , pheterogeneity=0.658 ) . nevertheless , no association was identified between il-27 rs153109 and rs181206 polymorphisms and cancer susceptibility . when a stratification analysis was performed by cancer type , we identified an increased susceptibility of bladder cancer in rs153109 polymorphism ( ga vs. aa : or=1.413 , 95%ci=1.0801.848 , pheterogeneity=0.725 ) . moreover , in the stratification analysis by genotyping method , we identified an increased susceptibility for pcr - rflp group in rs17855750 polymorphism ( g vs. t : or=1.194 , 95%ci=1.0281.387 , pheterogeneity=0.074 ; gg+gt vs. tt : or=1.185 , 95%ci=1.0081.392 , pheterogeneity=0.232 ) , whereas a decreased susceptibility was identified in rs153109 polymorphism ( gg vs. aa : or=0.943 , 95%ci=0.8901.000 , pheterogeneity=0.094 ) ( table 2 ) . we performed sensitivity analysis by omitting each study sequentially , suggesting that the results for the overall population were statistically robust and reliable ( figure 3a3c ) . egger s test and begg s funnel plot were performed to examine the publication bias risk in our research . no publication bias was identified ( rs153109 : g vs. a : p=0.300 for begg s test , p=0.112 for egger s test , figure 4a ; rs181206 : c vs. t : p=0.133 for begg s test , p=0.252 for egger s test ; figure 4b ; rs17855750 : g vs. t : p=0.283 for begg s test , p=0.322 for egger s test ; figure 4c ) . as presented in figure 1 , after a systematic literature search in the databases , 46 potential relevant studies on the association between il-27 polymorphisms and cancer were identified . nevertheless , of them , 34 were unqualified in that some were based on case - only design , some were not polymorphism studies and the others were not concerning the susceptibility of cancer . in the end , a total of 12 publications with 27 independent case - control studies comprising of 7,570 cases and 9,839 controls were concerning the associations of il-27 polymorphisms and cancer susceptibility . the genotype distributions of the three polymorphisms and the genotyping method of the enrolled studies were retrieved scrupulously , and the controls were selected from non - cancer populations . the results of the meta - analysis for the association of il-27 polymorphisms ( rs17855750 , rs181206 and rs153109 ) with susceptibility to cancer are presented in table 2 . obvious heterogeneity was identified in il-27 rs17855750 polymorphism ( gg vs. tt : pheterogeneity=0.036 , i=61.2% and gg vs. gt+tt : pheterogeneity=0.046 , i=58.7% ) and rs153109 polymorphism under all 5 genetic models ( g vs. a : pheterogeneity=0.003 , i=35.5% ; gg vs. aa : pheterogeneity=0.038 , i=20.4% ; ga vs. aa : pheterogeneity=0.047 , i=18.8% ; gg+ga vs. aa : pheterogeneity=0.006 , i=32.6% ; gg vs. ga+aa : pheterogeneity=0.038 , i=4.9% ) ( table 2 ) . therefore , we chose the random - effects model to generate wider cis in these genetic models . the present work identified that rs17855750 polymorphism of il-27 was significantly associated with cancer susceptibility ( g vs. t : or=1.177 , 95%ci=1.3041.341 , pheterogeneity=0.156 , figure 2a ; gg+gt vs. tt : or=1.156 , 95%ci=1.0051.329 , pheterogeneity=0.410 , figure 2b ) , particularly for bladder cancer ( gg vs. tt : or=14.600 , 95%ci=1.653128.994 , pheterogeneity=0.647 ; gg vs. gt+tt : or=14.480 , 95%ci=1.640127.836 , pheterogeneity=0.658 ) . nevertheless , no association was identified between il-27 rs153109 and rs181206 polymorphisms and cancer susceptibility . when a stratification analysis was performed by cancer type , we identified an increased susceptibility of bladder cancer in rs153109 polymorphism ( ga vs. aa : or=1.413 , 95%ci=1.0801.848 , pheterogeneity=0.725 ) . moreover , in the stratification analysis by genotyping method , we identified an increased susceptibility for pcr - rflp group in rs17855750 polymorphism ( g vs. t : or=1.194 , 95%ci=1.0281.387 , pheterogeneity=0.074 ; gg+gt vs. tt : or=1.185 , 95%ci=1.0081.392 , pheterogeneity=0.232 ) , whereas a decreased susceptibility was identified in rs153109 polymorphism ( gg vs. aa : or=0.943 , 95%ci=0.8901.000 , pheterogeneity=0.094 ) ( table 2 ) . we performed sensitivity analysis by omitting each study sequentially , suggesting that the results for the overall population were statistically robust and reliable ( figure 3a3c ) . egger s test and begg s funnel plot were performed to examine the publication bias risk in our research . no publication bias was identified ( rs153109 : g vs. a : p=0.300 for begg s test , p=0.112 for egger s test , figure 4a ; rs181206 : c vs. t : p=0.133 for begg s test , p=0.252 for egger s test ; figure 4b ; rs17855750 : g vs. t : p=0.283 for begg s test , p=0.322 for egger s test ; figure 4c ) . interleukin-27 is a newly discovered member of the il-12 family , which is regarded as a mediator of naive t cell proliferation , and an inducer of ifn - g secretion , specifically in synergy with il-12 . investigated the antitumor ability of il-27 against a murine tumour model and observed that il-27 could induce tumour - specific antitumor activity . the relationship between il-27 polymorphisms and cancer susceptibility had been investigated in recently published case - control studies , but conflicting results were reported . meta - analysis is regarded as a crucial method to accurately define the influence of specific genetic polymorphisms on cancer susceptibility . after searching the databases , 2 meta - analyses were found focussing on the relevance of the il-27 polymorphisms and cancer susceptibility . in 2014 , hu et al . conducted a meta - analysis and concluded that il-27 rs153109 polymorphism was associated with cancer susceptibility in chinese , whereas the rs17855750 and rs181206 polymorphisms were not . the results were consistent with another meta - analysis conducted by xu et al . , which reported that il-27 rs153109 polymorphism might enhance cancer susceptibility . first , the number of eligible published studies used was limited to a total of 6 , with 1684 patients and 1837 controls . second , there were 8 case - control studies , including 2044 cancer cases and 2197 controls focussing only on a single il-27 polymorphism . therefore , we performed the current meta - analysis to comprehensively elucidate the effects of il-27 polymorphisms ( rs153109 , rs17855750 and rs181206 ) in a total of 12 publications , including 27 case - control studies comprising 7570 patients and 9839 controls . interestingly , the results were inconsistent with previous studies . except for il-27 rs17855750 polymorphism , there was no evident relationship between the il-27 rs153109 and rs17855750 polymorphisms and cancer susceptibility . in addition , when we performed a stratification analysis by cancer type , an increased susceptibility to bladder cancer in rs153109 polymorphism was identified . stratifications may be introduced by the combination of genetic studies on various cancers in the meta - analysis . the results of il-27 polymorphisms on cancer susceptibility might be affected by several complicated factors , such as age , sex , ethnicity , source of controls , and matching criteria when we lack the original data . additionally , only papers published in a limited number of databases were searched , and some studies might have been missed ; therefore , the eligible case - control samples included into the current meta - analysis were insufficient . thirdly , all the studies were conducted in chinese , and no research in whites or africans was identified . this meta - analysis illustrated that il-27 rs17855750 polymorphism enhanced cancer susceptibility in a chinese population , and an increased susceptibility of bladder cancer was identified in rs153109 polymorphism when a stratification analysis was performed by cancer type . further well - planned studies on these variants are warranted to discover the mechanisms of il-27 polymorphisms in the tumorigenesis of these cancers .
the concept of preimplantation genetic screening ( pgs ) for chromosomal abnormalities to improve clinical outcomes in patients undergoing in vitro fertilization ( ivf ) is based on the observation that aneuploidy represents the leading genetic cause of miscarriage and is likely the most prevalent genetic abnormality in human embryos . in addition , conventional embryo selection methodologies , namely using morphological and developmental criteria , are not sufficient to identify which embryos are chromosomally normal . despite sound principles for the use of pgs , clinical outcomes from fish based pgs , one of the key limitations of fish based preimplantation aneuploidy screening is the inability to simultaneously evaluate all 24 chromosomes found in human cells ( chromosome 122 , x and y ) . the development of technologies for single cell whole genome amplification [ 59 ] has now led to a number of methodologies for comprehensive screening of all 24 chromosomes in preimplantation embryos and polar bodies . these ccs technologies include metaphase comparative genomic hybridization ( mcgh ) [ 1012 ] , array ( a)cgh [ 5 , 6 , 13 , 14 ] , and single nucleotide polymorphism ( snp ) arrays [ 1519 ] . more recently , a quantitative real time ( q)pcr approach was developed that does not require whole genome amplification . despite similar applications ( i.e. 24 chromosome aneuploidy screening ) these various methods of ccs possess unique capabilities and limitations ( table 1).table 1comparison of methods for preimplantation ccsreported characteristicccs methodmcghshort mcghacghsnp arrayqpcraccuracynr100% nr94 -99% 97% consistency between pb and oocyte76 -88% [ 82 , 83]nr94% nrnrminimum turn - around time72 h24 h12 h 24 h 4 h stages of biopsy eligible for fresh etoocyteoocyte , cleavageoocyte , cleavageoocyte , cleavageoocyte , cleavage , blastocystnumber of probesnana232 k262370 knrreported minimum detectable imbalance10 mb 100 mb 2.5 mb 1.7 mb nrdirect monogenic disease screening---+nruniparental disomy screening---+nrcontamination screening---+nrorigin of aneuploidy screening---+nraccuracy predictions based on reported analysis of cell linesmcgh , short mcgh , and acgh have been reported with parallel but indirect monogeneic disease screeningnot all snp array methods have validated origin of aneuploidy predictionsnr not reported , na not applicable comparison of methods for preimplantation ccs accuracy predictions based on reported analysis of cell lines mcgh , short mcgh , and acgh have been reported with parallel but indirect monogeneic disease screening not all snp array methods have validated origin of aneuploidy predictions nr not reported , na not applicable one important consideration is the amount of time required to complete the analysis . while rapid conventional mcgh methods have been developed [ 2123 ] , the most widely used methods are nt suitable for cleavage stage biopsy and fresh embryo transfer . however , mcgh results are typically available in time for a fresh embryo transfer when applied to polar body biopsy [ 12 , 24 ] . currently , most groups utilize acgh instead of mcgh in clinical trials and commercial activities as acgh allows for greater throughput , higher resolution and more rapid analyses . snp arrays can also be used on blastomeres in time for fresh embryo transfer [ 16 , 25 ] and additional time savings are possible through the use of qpcr methods from which results are available within 4 h of the biopsy allowing fresh blastocyst transfer after trophectoderm biopsy [ 20 , 26 ] . although acgh and snp array technology both involve an array of dna based probes , these methods are not equivalent . for example , among the commonly used arrays for pgs , the bluegnome ( cambridge , uk ) bacterial artificial chromosome ( bac ) arrays possess approximately 2,000 to 5,000 dna probes across 24 chromosomes , the affymetirx ( santa clara , ca ) nspi snp array possesses approximately 262,000 probes [ 15 , 28 ] , and illumina ( san diego , ca ) arrays used typically possess approximately 300,000 to 370,000 probes [ 1618 ] . although the number of probes included on each of these arrays does not necessarily correlate with the level of accuracy , it does influence the level of genomic resolution provided by each method . furthermore , bac array and snp array probe numbers may not be directly compared since relative performance of probes on each array type can impact resolution . while it is clear that whole chromosome aneuploidy represents the most common and clinically relevant genetic abnormality in human embryos , many groups have developed ccs technologies capable of identifying smaller deletions and duplications . this capability is particularly important for patients carrying a balanced translocation since clinically significant imbalances of smaller segments of the chromosomes ( segmental aneusomy ) involved are often produced during meiosis . a number of ccs methods have been applied to evaluating embryos from translocation carrier patients including mcgh with a resolution of 1020 mb and 25100 mb , acgh with a resolution of 2.8 mb and 2.5 mb , and snp arrays with a resolution of 2.4 mb and 5 mb . despite these reported abilities to detect small imbalances , the ability to predict de novo deletions and duplications in embryos from patients without a known translocation has typically not been claimed . however , a method combining acgh and snp array technologies suggested the ability to detect a 1.7 mb deletion in single cells and to predict de novo deletions and amplifications in human embryos . estimates of the prevalence of such imbalances in human embryos by this methodology are high given their rarity in clinically recognized pregnancies [ 36 , 37 ] and may need to be confirmed by alternative methodologies . another key difference between array based platforms is the way in which copy number is assigned for each chromosome . for example , acgh involves differential labeling and mixing of biopsy dna with control dna prior to hybridization and interpretation of ratios of red and green ( two - color ) fluorescence upon completion . in contrast , affymetrix snp arrays involve hybridization of only biopsy dna ( single color ) followed by computational comparison of signal intensities to those obtained on separate control dna hybridized arrays ( in silico controls ) . the snp single color array approach has the distinct advantage of evaluating the test sample against a large number of control samples ( not just 1 ) . this could help avoid inconsistencies from control sample specific natural variations in the human genome . however , acgh platforms are typically designed with probes that avoid regions of the genome with polymorphic copy number variations . the acgh two - color approach has the advantage of paired comparison to a control sample produced during the same timeframe and with the same lot of reagents used for the test sample . this could help control for fluctuations in laboratory components used in the process over time . while cgh methodologies provide an assessment of chromosomal copy number , snp arrays and qpcr can also provide genotypic information which can be used for the assessment / diagnosis of multiple other clinical factors . these include single gene disorders , uniparental disomy ( upd ) , loss of heterozygosity ( loh ) , dna fingerprinting and determination of the parental and cell division origins of aneuploidy . although simultaneous aneuploidy ( using mcgh [ 24 , 40 , 41 ] and snp arrays [ 18 , 42 ] ) and single gene ( using conventional pcr ) analysis has been reported , snp array based haplotype methodologies provide the ability to avoid the time and expense of preparing pcr based family specific informative markers of the mutation but may be limited when additional family members are not available to define haplotype phases . a recent study illustrated the use of snp arrays to predict inheritance of monogenic disease through haplotype based analysis and has applied the methodology clinically . another group presented a similar application of snp arrays with results confirmed from antenatal analysis of 3 pregnancies . a number of groups using snp arrays have used the technology to predict the parental and cell division origins of embryonic aneuploidy . one recent publication indicated an accuracy of 100% for predicting the parental origin of monosomy ( 26/26 male embryo x chromosomes identified as maternal ) , and 50% for trisomy . ( 2008 ) not only modeled monosomy by evaluating the x chromosome from male embryos , but also used embryos with trisomies known to originate from maternal meiosis ( as a result of having evaluated the polar bodies from the same oocyte that the embryo was derived from ) and demonstrated 100% accuracy for identifying both monosomy and trisomy parental origin of aneuploidy from snp array data alone . other groups have described results of predicting the parental origin of aneuploidy but have yet to report levels of accuracy from controls [ 16 , 46 ] . furthermore , some methods have been applied to distinguish meiotic from mitotic aneuploidy by investigating the patterns of crossover and haplotype inheritance [ 16 , 47 ] . validation of these methods in single cells also remains to be presented but could represent an important advancement towards improving our understanding of the origin and etiology of preimplantation aneuploidy . further research into the accuracy of predicting the cell division origins of aneuploidy in human embryos by snp array technology are of particular clinical importance since they have been proposed to serve as a means to justify the transfer of embryos with aneuploid results . although uniparental isodisomy may represent an extremely rare event , the possibility of detection has been validated using snp array technology through loss of heterozygosity ( loh ) analysis . loh analysis can also be useful in confirming the presence of a monosomy identified through copy number based analyses . in contrast , the ability to identify uniparental heterodisomy has yet to be validated but is theoretically possible given the ability to predict the parental origin of aneuploidy . finally , dna fingerprinting from snp array data provides an opportunity to prevent misdiagnosis from contamination and also to identify and track which embryo implanted after multiple embryo transfer . the later of these fingerprinting applications provides a unique opportunity to perform very well controlled paired analyses of putative markers of , or the impact of interventions on the reproductive potential of sibling embryos . despite the numerous differences between platforms of ccs , still , comparative data may be critical to a better understanding of the limitations and capabilities of various ccs methodologies and to providing patients with the best possible care for example , mcgh and snp arrays , and qpcr and snp arrays have indicated similar levels of performance . in contrast , a comparative study between acgh and snp arrays indicated acgh methodology to have a significant decrease in diagnostic accuracy compared to snp arrays . however , a recent study found that other platforms for acgh ( bluegnome ) and snp arrays ( illumina ) were highly concordant . additional comparative studies , not just across platforms but also across laboratories , remain critical to identifying the most accurate methodologies of ccs . with the development of new methods for aneuploidy screening such as ccs , studies of the putative limitations of fish based methods have begun to emerge . one of these studies involved a novel prospective randomized blinded analysis of multiple single blastomeres from the same cleavage stage embryos using either fish or snp array based ccs ( fig . 1 ) . randomization of blastomeres from the same embryo to analysis by either of the two methods provided a unique opportunity to distinguish between the contribution of mosaicism ( biological error ) or technical error by assessing the rate of discordance observed by each method . that is , the rate of discordance within each embryo should be similar for each method used since mosaicism should be equally distributed ( randomly ) to the two methods . however , fish predicted 100% mosaicism while snp arrays found only 31% mosaicism ( fig . this is particularly significant since the snp array data included more chromosomes per cell , and more cells per embryo ( as a result of significantly higher reliability of diagnosis ) , both of which would increase the chances of finding mosaicism in the snp array group.fig . 1a prospective randomized blinded study designed to compare the level of reliability and consistency of 2 methods of aneuploidy screening . arrested cleavage stage embryos can be dispersed into individual blastomeres and then randomly assigned to analysis by either of 2 methods of analysis ( i.e. fish and snp microarray ) . by including more than one embryo in the randomization , the embryo of origin of each blastomere can also remain blinded , thereby avoiding the potential bias from knowing that 2 blastomeres originated from the same embryo . results can demonstrate which method provided the most reliable and consistent diagnosis . adapted from treff et al . , and used with permission from oxford university press a prospective randomized blinded study designed to compare the level of reliability and consistency of 2 methods of aneuploidy screening . arrested cleavage stage embryos can be dispersed into individual blastomeres and then randomly assigned to analysis by either of 2 methods of analysis ( i.e. fish and snp microarray ) . by including more than one embryo in the randomization , the embryo of origin of each blastomere can also remain blinded , thereby avoiding the potential bias from knowing that 2 blastomeres originated from the same embryo . results can demonstrate which method provided the most reliable and consistent diagnosis . adapted from treff et al . , and used with permission from oxford university press a second study comparing fish and ccs analysis of the same embryos involved careful evaluation of the putative mechanisms of self correction , which represents the primary explanation for discordance between cleavage stage fish and reanalysis of the resulting blastocysts . for example , one proposed mechanism of correction is trisomy / monosomy rescue through extrusion or duplication of a trisomic or monosomic chromosome , respectively . this phenomenon can be expected to lead to uniparental disomy ( upd ) in a certain percentage of blastocysts . unlike previous studies that have used fish to reanalyze blastocysts , originally diagnosed as abnormal on day 3 , snp array based analysis provides an opportunity to investigate the possibility of self correction resulting in upd . ( 2010 ) indicated that trisomy / monosomy rescue is not the major mechanism for self correction as 0% of the corrected chromosomes ( multiple ccs studies have now demonstrated that preferential segregation does not occur [ 49 , 56 , 57 ] . however , a potential limitation of interpretation from blastocyst reanalysis by ccs methodologies is the inability to detect the presence of mosaicism within a multi - cell biopsy . northrop et al . ( 2010 ) specifically validated the ability to detect a level of mosaicism of 40% within a 5-cell sample and therefore provided more weight to evidence for a lack of preferential segregation . while it is still possible that complete extrusion or apoptosis of aneuploid cells may result in correction of abnormalities in the embryo upon blastulation , no evidence currently exists to support such a phenomenon . one of the major implications of these comparative studies is that the mitotic origin of embryonic aneuploidy may have been overestimated . indeed , studies of products of conception have found that maternal meiosis is the predominant origin of aneuploidy , and not mitosis as some methods of pgs have predicted . while traditional cytogenetic analysis ( g - banding ) may underestimate the levels of mosaicism in products of conception , recent molecular cytogenetic studies have shown that actual levels of mosaicism may only be higher by a marginal percentage [ 36 , 37 ] . in fact , methods which predict high levels of mosaicism in embryos may need to be re - evaluated as illustrated in fig . 1 in order to distinguish between biological phenomena and technical inconsistency . this design could also represent an important component to preclinical validation of embryonic ccs methodologies . still , the phenomenon of mosaicism can not be completely disregarded given observations from other studies involving ccs analysis of multiple cells from the same embryo [ 11 , 59 ] . given the inconsistency and poor negative predictive value of cleavage stage fish , new technologies such as ccs should be more carefully evaluated . moreover , fish based re - analysis of ccs evaluated embryos may not represent a good approach to validate new ccs methods since fish has been shown to be an inconsistent methodology itself . alternatively , randomized blinded analysis of single cells from cell lines with known abnormalities could be performed and used to evaluate the accuracy of aneuploidy predictions ( fig . 2 ) . another interesting study design for evaluating the accuracy of a ccs methodology was recently performed by the european society of human reproduction and embryology ( eshre ) task force on pgs . in this blinded pilot study , polar body ccs results were obtained using acgh and compared to the results of the corresponding oocytes for consistency , which was found to be 94% ( 130/138).fig . 2a prospective randomized blinded study designed to determine the accuracy of a single cell ccs methodology . cell lines with previously well characterized chromosomal abnormalities can be obtained from a number of commercial suppliers such as the corriel cell repository ( camden , nj ) . lines with consistent abnormalities observed in multiple evaluations by the supplier may provide the most consistent single cells in terms of possessing the expected karyotype . single cells can be obtained , placed in pcr tubes , and randomized and blinded for analysis by ccs . once ccs predictions are made , the origin of each cell can be unblinded to evaluate the consistency with the expected karyotype and the accuracy of the ccs methodology can be determined a prospective randomized blinded study designed to determine the accuracy of a single cell ccs methodology . cell lines with previously well characterized chromosomal abnormalities can be obtained from a number of commercial suppliers such as the corriel cell repository ( camden , nj ) . lines with consistent abnormalities observed in multiple evaluations by the supplier may provide the most consistent single cells in terms of possessing the expected karyotype . single cells can be obtained , placed in pcr tubes , and randomized and blinded for analysis by ccs . once ccs predictions are made , the origin of each cell can be unblinded to evaluate the consistency with the expected karyotype and the accuracy of the ccs methodology can be determined as previously alluded to , accumulating evidence indicates that fish based aneuploidy screening at the cleavage stage of embryogenesis is not only inconsistent but also poorly predictive of aneuploidy in the blastocyst . reanalysis of blastocysts indicate that nearly 60% of embryos discarded due to an abnormal cleavage stage fish diagnosis were in fact euploid for all 24 chromosomes in all 4 evaluated sections . a similar observation was recently made from reanalysis of blastocysts originally given a parental support based ccs abnormal cleavage stage diagnosis . parental support based ccs reanalysis results indicated that 43% of the blastocysts ( 26/61 ) were euploid despite an aneuploid diagnosis at the cleavage stage . it is unclear whether these discrepancies were due to biological variation or technical issues with parental support . these observations highlight the critical need for a second preclinical validation study ; to determine the negative predictive value of ccs for embryonic reproductive potential . such a study could indicate whether the ccs method is capable of accurately determining the chromosomal status of embryos so that there is high confidence that embryos being discarded are truly abnormal ( fig . oocytes or embryos would be biopsied and selected for transfer using conventional morphological and developmental criteria without information from ccs . the ccs results of each biopsy would be produced only after embryo transfer had taken place . specific outcomes of each individual oocyte or embryo would be confirmed by dna fingerprinting and the implantation and delivery from oocytes or embryos that would have been diagnosed as aneuploid by ccs could be determined . however , since some ccs methods do nt provide polymorphism information ( i.e. mcgh and acgh ) , additional molecular tests would be required in order to track embryo specific outcomes . this approach should be possible even for those groups using cgh methodologies given previous reports of double factor pgd [ 40 , 41 ] . in the situation where polar body biopsy is performed , an alternative method of embryo tracking from polar body polymorphisms could be employed . while a randomized controlled trial is necessary to evaluate the efficacy of a particular ccs method it would fail to determine the negative predictive value of the method since samples predicted to possess aneuploidy would not be transferred . this is particularly troublesome for patients when all their embryos or oocytes are predicted to be aneuploid . without the knowledge that the negative predictive value of a method is meaningful , one will never know if implementation of the method prevented such a patient from missing out on the opportunity of having a healthy child . a prospective blinded non - selection clinical trial is therefore a critical consideration when establishing the safety of ccs methodologies.fig . 3a prospective blinded non - selection study designed to determine the negative predictive value of a ccs methodology for the reproductive potential of the oocyte or embryo . biopsies of either polar bodies from the oocyte , a blastomere from the cleavage stage embryo , or trophectoderm from the blastocyst can be performed . the best embryos can be selected for transfer based on conventional criteria and without the use of ccs results . dna from the conceptus can be obtained and evaluated against the dna from the original biopsies in order to determine which oocytes or embryos produced the newborns . the percentage of oocytes or embryos predicted to have possessed aneuploidy by the ccs methodology and that produced euploid newborns can be calculated . this value subtracted from 100% gives the negative predictive value and whether the ccs methodology can be used to safely discard an embryo a prospective blinded non - selection study designed to determine the negative predictive value of a ccs methodology for the reproductive potential of the oocyte or embryo . biopsies of either polar bodies from the oocyte , a blastomere from the cleavage stage embryo , or trophectoderm from the blastocyst can be performed . the best embryos can be selected for transfer based on conventional criteria and without the use of ccs results . dna from the conceptus can be obtained and evaluated against the dna from the original biopsies in order to determine which oocytes or embryos produced the newborns . the percentage of oocytes or embryos predicted to have possessed aneuploidy by the ccs methodology and that produced euploid newborns can be calculated . this value subtracted from 100% gives the negative predictive value and whether the ccs methodology can be used to safely discard an embryo although a randomized controlled trial represents what most consider the pinnacle of clinical validation of efficacy , case control studies currently represent the primary source of evidence of clinical validity for most ccs methodologies [ 12 , 6468 ] . while it is certainly encouraging to see improvements from such analyses , it should be noted that many cleavage stage fish case control studies illustrated significant clinical improvements [ 6973 ] but ultimately failed in all randomized controlled trials performed to date . as a result of the higher standard of evidence that randomization provides , many ccs methodologies have now initiated the process of conducting randomized controlled trials ( table 2 ) . the results presented for one these ccs methods has indicated a significant increase in clinical pregnancy and embryo implantation rates .table 2randomized controlled trials of ccscolorado center for reproductive medicineeshre task force on pgsgenera center for reproductive medicinegene security networkreproductive medicine associates of new jerseyreprogeneticssourcem . geraedtsisrctn37972669nct01194531nct01219283nct01332643technologysnp arrayacghacghsnp arrayqpcracghstage of biopsyblastocystoocytecleavagecleavageblastocystblastocysttransfer typefrozenfresh or frozenfreshfreshfreshfrozenmajor criteria for inclusion>37 and/or 2 repeated ivf failures3640 , < 2 failed ivf cycles3643 , <3 consecutive miscarriages , 2 failed ivf cycles3542 , <3 consecutive miscarriages , 1 failed ivf cycle2143 , day 3 fsh < 15u / l , 1 failed ivf cycle3542 , < 3 failed ivf cycles , day 3 fsh < 11u / lestimated sample size100600200440500120estimated completionjanuary 2012may 2013january 2011september 2011july 2012april 2012resultsnot reportednot reportednot reportednot reportedscott et al.not reportedpersonal communicationwww.controlled-trials.comwww.clinicaltrials.gov randomized controlled trials of ccs personal communication www.controlled-trials.com www.clinicaltrials.gov while numerous considerations for the efficacy of using a specific stage of biopsy for pgs exist , one of the most important may be the impact that the procedure has on the reproductive potential of the embryo . although some studies have focused on comparing outcomes in patients who had all of their oocytes / embryos biopsied to outcomes in patients who had none of their oocytes / embryos biopsied , this may not represent the best controlled study design . this is particularly true since the patients having embryos or oocytes biopsied were typically subject to pgs while the other patients were not . instead , randomization of the 2 best oocytes / embryos so that one is biopsied ( case ) and the other is not ( control ) and subsequent paired analysis of outcomes within each 2 embryo transfer ( using dna fingerprinting ) could represent a better controlled study of the impact of biopsy . interestingly , preliminary results using this paired study design indicate that embryo biopsy at the cleavage stage , but not the blastocyst stage , significantly reduces the implantation potential of the embryo . similar studies of the impact of polar body biopsy have yet to be conducted but should be helpful in characterizing the safety and optimum stage of biopsy for ccs . while validated methods of ccs may improve clinical outcomes for patients with infertility , they may also represent an exciting tool to help identify additional markers , beyond aneuploidy screening , that provide predictive information about the long term viability of embryos and oocytes . since it is clear that not all embryos , identified as euploid by ccs , ultimately result in the delivery of a newborn , there are likely additional markers of reproductive potential that may enhance the precision of embryo selection . once validated methods of ccs have been established , research efforts can be directed at characterizing molecular and biochemical signatures of embryos that are morphologically and chromosomally normal . one of the first studies to employ this design involved determining cumulus cells gene expression signatures predictive of which morphologically and chromosomally normal embryos possess reproductive potential . this is different from simply evaluating whether cumulus cells can be used as an alternative to direct oocyte or embryo ccs aneuploidy screening or whether cumulus cells can be used to select competent oocytes or embryos without simultaneous aneuploidy screening . the unique aneuploidy controlled study design could apply to evaluating additional types of molecular signatures including , for example , the embryonic metabolome or proteome [ 79 , 80 ] . despite the failure of cleavage stage fish based aneuploidy screening , the introduction of new ccs technologies holds great promise for achieving the expected improvements in clinical outcomes for patients suffering from infertility . a critical mass of class i evidence still needs to be generated for each ccs methodology before scientists and clinicians adopt it for routine clinical testing . randomized controlled trials of efficacy as well as non - selection studies of the negative predictive value of embryonic reproductive potential should provide the data needed to accept or reject the validity of a given ccs methodology . while recent success of blastocyst trophectoderm ccs with qpcr and fresh embryo transfer is encouraging , results from additional ongoing randomized trials of ccs are eagerly anticipated and should help shape the future of chromosome screening in the ivf setting .
in denmark , women planning to conceive are advised to take a daily supplement of 400 g folic acid ( fa ) until the 12th week of gestation to reduce the risk of neural tube defects ( ntds).1 starting fa supplementation before conception is an important component of effective prevention of ntds , since the neural tube closes at gestational week 6 , only a few weeks after the pregnancy may be recognized.2 fa is primarily taken as single supplements or as a component of multivitamins ( mvs ) and other vitamin preparations made for pregnancy planners or pregnant women . despite campaigns promoting the fa recommendation in denmark in 1999 and 2001 , women in the preconceptional period appear to have neither adequate dietary intake of folate nor adequate supplementation from fa tablets or mv supplements . according to the national survey of dietary habits from 2003 to 2008 , only 510% of danish women of fertile age have a sufficient intake of dietary folate.3 the most recent data on periconceptional use of fa supplements in denmark are from the danish national birth cohort ( dnbc ) . between 2000 and 2002 , the proportion of fa compliers among dnbc participants who planned their pregnancy increased from 14% to only 22% , and thus remained low even after the campaigns.4,5 several retrospective studies of pregnant women in other countries also reported poor compliance , with 12% of women in the uk,6 17% in norway,7 2330% in australia8,9 and 44% in the us10 reporting fa supplement use in the preconception period . in addition , a prospective cohort study reported that only 6% of the women who became pregnant within 3 months of being interviewed in a general woman s survey in the uk followed the fa recommendation.11 in previous studies , young age , low education and income , smoking , overweight , and parity were reported to be predictors of noncompliance.58,10 to date , no study has examined other health - related predictors of compliance during the preconceptional period , and we lack recent estimates of compliance with the fa recommendation reported from pregnancy planners during the preconceptional period . in the current study , we estimated the prevalence of fa and mv supplement use and identified sociodemographic , lifestyle , reproductive , and medical predictors of such use among danish pregnancy planners . the present study was a cross - sectional analysis of baseline data from an internet - based prospective cohort study of danish pregnancy planners snart - gravid ( soon pregnant).the study design has been described in detail elsewhere.12,13 briefly , the study was initiated in june 2007 . participants were enrolled via the study website , and data were collected by email and self - administered questionnaires . recruitment was achieved by a pop - up advertisement placed on a well - known health - related website ( http://www.netdoktor.dk ) and two press releases . before enrolment , potential participants entering the study website were required to read a consent form and fill in a screening questionnaire in order to confirm eligibility . further , participants were required to provide a valid email address and their personal civil registry ( cpr ) number , which is a unique ten - digit personal identification number allowing linkage to a number of nationwide registries . eligible women were invited to complete a baseline questionnaire and bimonthly follow - up questionnaires for 12 months or until conception occurred , after which active follow - up ended . participants were initially randomized to receive either a short- or a long - form baseline questionnaire . completion rates and missing data were similar for both questionnaire versions.13 eligible women were danish residents aged 1840 years , living in a stable relationship with a male partner , not using birth control , not receiving any type of fertility treatment , and attempting to conceive for no more than 12 months . from june 1 , 2007 to august 3 , 2011 of these , one woman did not provide a valid cpr number in the screener , one woman was excluded because she was already pregnant ( 14 weeks ) , and 533 women were excluded because they had been attempting to conceive for more than 12 months . in total , 5383 eligible women enrolled in the study during the 4-year study period . data on preconceptional use of fa and mv supplements and sociodemographic , lifestyle , reproductive , and medical variables were assessed at baseline . in the baseline questionnaire , women were asked do you take vitamins on a regular basis daily or almost every day ? , how long have you been taking vitamins on a regular basis less than one year , 15 years , more than 5 years , or do nt know ? , and which of the following vitamins or minerals do you take on a regular basis mvs , vitamin a , beta - carotene , vitamin b , vitamin c , vitamin d , vitamin e , fa , calcium , magnesium , selenium , or other ? participants who reported multivitamin or wrote the name of an mv product were defined similarly , participants who reported folic acid or wrote folate were defined users were defined as women who used either fa supplements , mv supplements , or both . women who used single - vitamin or mineral supplements other than fa and women who did not take any dietary supplements were defined nonusers . a total of 197 ( 3.7% ) women did not answer the initial vitamin question and were also defined as nonusers . participants reported weight , height , physical activity , and smoking history in the baseline questionnaire , allowing the calculation of body mass index ( bmi ) , total metabolic equivalents ( mets ) , and pack - years of smoking . bmi was calculated by dividing weight ( kg ) with height squared ( m ) . mets were estimated by summing the mets from moderate and vigorous physical activity ( hours per week multiplied by 3.5 and hours per week multiplied by 7.0 , respectively).14 data on smoking were categorized as pack - years of ever - smoking where 1 pack - year was defined as smoking 20 cigarettes per day in 1 year . to assess sociodemographic predictors of compliance among pregnancy planners , we examined the association between preconceptional fa or mv supplement use and the following variables : age ( categorized as < 25 , 2529 , 3034 , and 35 years ) , schooling ( primary and lower secondary school , high school , and other ) , vocational training ( none , short [ <3 years ] , medium [ 34 years ] , and long [ > 4 years ] ) and total monthly household income ( < 12,500 , 12,50024,999 , 25,00039,999 , 40,00064,999 , and 65,000 dkk / month ) . we also examined lifestyle factors that could indicate intense efforts to conceive , such as intercourse frequency ( categorized as < 1 , 13 , and 4 times per week ) and months attempting pregnancy at study entrance ( 01 , 24 , 56 , and 712 months ) . furthermore , compliance with other health recommendations , such as attending the national screening program for cervical cancer ( pap smear ) during the last 3 years ( none vs one or more ) , smoking history ( never smoked , < 5 , 59 , and 10 pack - years ) , current alcohol intake ( none , 13 , 47 , 814 , and 15 drinks / week ) , bmi ( < 18.5 , 18.524.9 , 2529.9 , 3034.9 , and 35 kg / m ) , and engagement in physical activity ( < 10 , 1019 , 2039 , and 40 mets / week ) , were also of interest . finally , we studied the associations with previous spontaneous abortion ( yes vs no ) , parity ( nulliparous vs parous ) , and medical conditions that may increase health awareness in relation to pregnancy , which included hypertension ( yes vs no ) , diabetes ( yes vs no ) , thyroid disease ( yes vs no ) , pelvic inflammatory disease ( yes vs no ) , and infection with chlamydia ( yes vs no ) . we estimated the prevalence proportion ( pp ) of fa or mv users in each level of study predictors . multivariate binomial regression was used to obtain prevalence proportion differences ( ppds ) with 95% confidence intervals ( cis ) for each predictor level in relation to the reference group . the multivariate analyses for the pp and ppd for each study predictor were adjusted for all other covariates . stata statistical software ( version 11.2 ; college station , texas ) was used for all analyses . missing values ranged between 0.1% ( schooling ) and 8.7% ( total monthly household income ) . because 1540 ( 28.6% ) participants were initially randomized to receive the short - form baseline questionnaire , they did not receive the questions about hypertension , diabetes , thyroid disease , and pelvic inflammatory disease . the present study was a cross - sectional analysis of baseline data from an internet - based prospective cohort study of danish pregnancy planners snart - gravid ( soon pregnant).the study design has been described in detail elsewhere.12,13 briefly , the study was initiated in june 2007 . participants were enrolled via the study website , and data were collected by email and self - administered questionnaires . recruitment was achieved by a pop - up advertisement placed on a well - known health - related website ( http://www.netdoktor.dk ) and two press releases . before enrolment , potential participants entering the study website were required to read a consent form and fill in a screening questionnaire in order to confirm eligibility . further , participants were required to provide a valid email address and their personal civil registry ( cpr ) number , which is a unique ten - digit personal identification number allowing linkage to a number of nationwide registries . eligible women were invited to complete a baseline questionnaire and bimonthly follow - up questionnaires for 12 months or until conception occurred , after which active follow - up ended . participants were initially randomized to receive either a short- or a long - form baseline questionnaire . eligible women were danish residents aged 1840 years , living in a stable relationship with a male partner , not using birth control , not receiving any type of fertility treatment , and attempting to conceive for no more than 12 months . from june 1 , 2007 to august 3 , 2011 of these , one woman did not provide a valid cpr number in the screener , one woman was excluded because she was already pregnant ( 14 weeks ) , and 533 women were excluded because they had been attempting to conceive for more than 12 months . in total , 5383 eligible women enrolled in the study during the 4-year study period . data on preconceptional use of fa and mv supplements and sociodemographic , lifestyle , reproductive , and medical variables were assessed at baseline . in the baseline questionnaire , women were asked do you take vitamins on a regular basis daily or almost every day ? , how long have you been taking vitamins on a regular basis less than one year , 15 years , more than 5 years , or do nt know ? , and which of the following vitamins or minerals do you take on a regular basis mvs , vitamin a , beta - carotene , vitamin b , vitamin c , vitamin d , vitamin e , fa , calcium , magnesium , selenium , or other ? participants who reported multivitamin or wrote the name of an mv product were defined similarly , participants who reported folic acid or wrote folate were defined users were defined as women who used either fa supplements , mv supplements , or both . women who used single - vitamin or mineral supplements other than fa and women who did not take any dietary supplements were defined nonusers . a total of 197 ( 3.7% ) women did not answer the initial vitamin question and were also defined as nonusers . participants reported weight , height , physical activity , and smoking history in the baseline questionnaire , allowing the calculation of body mass index ( bmi ) , total metabolic equivalents ( mets ) , and pack - years of smoking . bmi was calculated by dividing weight ( kg ) with height squared ( m ) . mets were estimated by summing the mets from moderate and vigorous physical activity ( hours per week multiplied by 3.5 and hours per week multiplied by 7.0 , respectively).14 data on smoking were categorized as pack - years of ever - smoking where 1 pack - year was defined as smoking 20 cigarettes per day in 1 year . to assess sociodemographic predictors of compliance among pregnancy planners , we examined the association between preconceptional fa or mv supplement use and the following variables : age ( categorized as < 25 , 2529 , 3034 , and 35 years ) , schooling ( primary and lower secondary school , high school , and other ) , vocational training ( none , short [ <3 years ] , medium [ 34 years ] , and long [ > 4 years ] ) and total monthly household income ( < 12,500 , 12,50024,999 , 25,00039,999 , 40,00064,999 , and 65,000 dkk / month ) . we also examined lifestyle factors that could indicate intense efforts to conceive , such as intercourse frequency ( categorized as < 1 , 13 , and 4 times per week ) and months attempting pregnancy at study entrance ( 01 , 24 , 56 , and 712 months ) . furthermore , compliance with other health recommendations , such as attending the national screening program for cervical cancer ( pap smear ) during the last 3 years ( none vs one or more ) , smoking history ( never smoked , < 5 , 59 , and 10 pack - years ) , current alcohol intake ( none , 13 , 47 , 814 , and 15 drinks / week ) , bmi ( < 18.5 , 18.524.9 , 2529.9 , 3034.9 , and 35 kg / m ) , and engagement in physical activity ( < 10 , 1019 , 2039 , and 40 mets / week ) , were also of interest . finally , we studied the associations with previous spontaneous abortion ( yes vs no ) , parity ( nulliparous vs parous ) , and medical conditions that may increase health awareness in relation to pregnancy , which included hypertension ( yes vs no ) , diabetes ( yes vs no ) , thyroid disease ( yes vs no ) , pelvic inflammatory disease ( yes vs no ) , and infection with chlamydia ( yes vs no ) . we estimated the prevalence proportion ( pp ) of fa or mv users in each level of study predictors . multivariate binomial regression was used to obtain prevalence proportion differences ( ppds ) with 95% confidence intervals ( cis ) for each predictor level in relation to the reference group . the multivariate analyses for the pp and ppd for each study predictor were adjusted for all other covariates . stata statistical software ( version 11.2 ; college station , texas ) was used for all analyses . missing values ranged between 0.1% ( schooling ) and 8.7% ( total monthly household income ) . because 1540 ( 28.6% ) participants were initially randomized to receive the short - form baseline questionnaire , they did not receive the questions about hypertension , diabetes , thyroid disease , and pelvic inflammatory disease . overall , 412 ( 7.7% ) women used fa supplements exclusively , 1100 ( 20.4% ) used mv supplements exclusively , and 1831 ( 34.0% ) used both , yielding 62.1% users . a total of 82 ( 1.5% ) used single vitamins or minerals other than fa , and 1958 ( 36.4% ) did not use any dietary supplements , yielding 2040 ( 37.9% ) nonusers of fa or mv supplements ( table 1 ) . among users , after mutual adjustment for covariates , higher age was associated with increased prevalence of fa or mv use ( table 2 ) . our data also indicate that women who finished high school were more likely to use fa or mvs compared with women with less schooling . similarly , compared with women with a long vocational training ( > 4 years ) , ppds for having no vocational training and a short ( <3 years ) vocational training were 5.7% and 7.1% , respectively , and compared with total monthly household of 65,000 dkk / month , ppd for < 12,500 dkk / month was 8.7% . while intercourse frequency 1 times / week was associated with an increased prevalence of fa or mv use , there was no clear association between months attempting to conceive at study entrance and fa or mv use . furthermore , women who had pap smears once or more during the last 3 years were more likely to use fa or mv supplements compared with women who did not have pap smears ( ppd was 9.7% for none versus one or more ) . kg / m ) were associated with a decreased prevalence of fa or mv use . compared with women who never smoked , ppd for 10 pack - years of smoking was 11.3% . compared with no alcohol intake ppd for 15 drinks / week was 18.4% . compared with normal weight ( bmi = 18.524.9 kg / m ) , ppds of fa or mv use for bmis of 3034.9 and 35 kg / m were 5.1% and 7.1% , respectively . furthermore , women who engaged in physical activity were more likely to use fa or mvs than sedentary women ( < 10 mets / week ) . among women who had a previous spontaneous abortion , the ppd of fa or mv use was 7.7% higher than women who did not report having a previous abortion . finally , there was no clear association between being diagnosed with either hypertension , diabetes , thyroid disease , pelvic inflammatory disease , or infections with chlamydia and preconceptional fa or mv supplement use . our data indicate that 62% of the 5383 pregnancy planners in this study adhere to the danish fa recommendation . by interpreting users as compliers , we may overestimate the proportion of compliers following the fa recommendation . the questionnaire provided information on whether the women took an fa or mv supplement or not , but there was no information on the exact dose of fa ingested or the brand name of the fa or mv product . in addition , mv supplements have no standard definitions,1720 it can not be assumed that all mvs contained fa . however , most mvs on the danish market contain 400 g fa , especially those made for use during pregnancy . the prevalence among pregnancy planners in our study is higher than the prevalence of preconception fa ( 12%44%)510 and mv use ( 11%)8 reported by pregnant women in previous studies . however , these studies collected data during the second and third trimesters , which may decrease the recall of fa and mv use during the preconceptional period . in addition , the studies were relatively small , with 588 women attending an antenatal clinic in melbourne in gestational weeks 3638,8 1541 women attending an antenatal ultrasound screening in gestational weeks 1719 in oslo,7 and 327 pregnant women calling the california teratogen information service in gestational week 13 in the us.10 consequently , prevalence estimates reported in these studies may have been imprecise . the definition of compliance with the fa recommendation differs among studies . in the study by forster et al,8 29% took prepregnancy fa supplements , but only 23% reported taking fa for at least 4 weeks before pregnancy . in the study by braekke and staff,7 17% of this proportion may be more comparable with our findings , since some users in our study may have been in gestational weeks 04 at baseline . women with unplanned pregnancies are less likely to use fa supplements before pregnancy . in the studies by forster et al8 and goldberg et al,10 the prevalence of unplanned pregnancy was 19% and 36% , respectively . these studies estimated fa use among all pregnancies ( planned and unplanned ) , making their results difficult to compare with ours . in the study by braekke and staff,7 there was no information about unplanned pregnancies or contributions of fa from mv supplements , both increasing the possibility of underestimation of the proportions of fa users in this study . in denmark , the largest and most recent study of lifestyle factors in relation to compliance with the fa recommendation was conducted among 18,294 pregnant women ( gestational weeks 1012 ) enrolled in the dnbc during 20002002.5 in this study , fa supplements were derived from single fa tablets , mv tablets , and vitamins made for pregnant or lactating women . compliance was defined as taking 320 g fa per day , from 4 weeks before the date of the last menstrual period until gestation week 6 . a total of 76% of the pregnancies were planned , and the overall proportion of women who complied with the recommendation was only 16% among planners . during the 10-year time period to the present study , there may have been an increase in the awareness as well as more available information about prepregnant recommendations , which may partly explain the observed increase in the prevalence of compliers with the fa recommendation found in this study . in contrast to the dnbc , our data on supplement use and potential predictors were reported during the preconceptional period , and information was recorded prospectively , which increases the validity of the study . on the other hand , snart - gravid study participants may be more health - conscious than the general population of pregnancy planners , possibly overestimating the prevalence of fa or mv use . even so , it is unlikely that an overestimation of supplement use would meaningfully distort the associations between predictors and fa or mv use . in addition , differences in sociodemographic factors among snart - gravid study participants compared with the general population may also contribute to an overestimation of fa or mv use . our study agrees with previous studies that found that maternal age,5,7,10 education,5,6,10 income,6,8 smoking,5,8 and bmi10 were associated with preconception fa use . although a history of childbirth may increase awareness of preconceptional fa use , previous studies found that a previous childbirth either decreased the likelihood of fa use in subsequent pregnancies or was not related to fa use.5,7,8 we found only little association between parity and fa use in our study . the positive associations between previous spontaneous abortion and intercourse frequency and fa or mv use found in our study have not been reported previously . these findings may indicate a relation between a high desire to conceive and increased knowledge about the preconceptional fa guidelines . while lifestyle recommendations during pregnancy are widely available , less advice is available for women trying to conceive . in addition to the fa recommendation , danish women planning a pregnancy are advised to avoid alcohol altogether.1 a total of 32% reported no alcohol intake in our study , which was slightly more than the 12% reported from the dnbc previously.21 in addition , we found the lowest proportion of fa or mv users among women with the highest alcohol intake . together with the concern that excessive alcohol intake impedes the normal bioavailability and metabolism of folate,22 these results underscore the need to target women at high risk of not following the fa recommendation , as well as those not following other preconceptional guidelines . being diagnosed with a chronic disease has previously been associated with increased dietary supplement use in general.23 pregnancy planners with a chronic illness might be more prone to use fa or mvs because of increased health awareness , but we found little association between a diagnosis of hypertension , diabetes , thyroid disease , pelvic inflammatory disease or infections with chlamydia and preconceptional use of fa or mvs . our data indicate that 62% of the 5383 pregnancy planners in this study adhere to the danish fa recommendation . by interpreting users as compliers , we may overestimate the proportion of compliers following the fa recommendation . the questionnaire provided information on whether the women took an fa or mv supplement or not , but there was no information on the exact dose of fa ingested or the brand name of the fa or mv product . in addition , mv supplements have no standard definitions,1720 it can not be assumed that all mvs contained fa . however , most mvs on the danish market contain 400 g fa , especially those made for use during pregnancy . the prevalence among pregnancy planners in our study is higher than the prevalence of preconception fa ( 12%44%)510 and mv use ( 11%)8 reported by pregnant women in previous studies . however , these studies collected data during the second and third trimesters , which may decrease the recall of fa and mv use during the preconceptional period . in addition , the studies were relatively small , with 588 women attending an antenatal clinic in melbourne in gestational weeks 3638,8 1541 women attending an antenatal ultrasound screening in gestational weeks 1719 in oslo,7 and 327 pregnant women calling the california teratogen information service in gestational week 13 in the us.10 consequently , prevalence estimates reported in these studies may have been imprecise . the definition of compliance with the fa recommendation differs among studies . in the study by forster et al,8 29% took prepregnancy fa supplements , but only 23% reported taking fa for at least 4 weeks before pregnancy . in the study by braekke and staff,7 17% of this proportion may be more comparable with our findings , since some users in our study may have been in gestational weeks 04 at baseline . women with unplanned pregnancies are less likely to use fa supplements before pregnancy . in the studies by forster et al8 and goldberg et al,10 the prevalence of unplanned pregnancy was 19% and 36% , respectively . these studies estimated fa use among all pregnancies ( planned and unplanned ) , making their results difficult to compare with ours . in the study by braekke and staff,7 there was no information about unplanned pregnancies or contributions of fa from mv supplements , both increasing the possibility of underestimation of the proportions of fa users in this study . in denmark , the largest and most recent study of lifestyle factors in relation to compliance with the fa recommendation was conducted among 18,294 pregnant women ( gestational weeks 1012 ) enrolled in the dnbc during 20002002.5 in this study , fa supplements were derived from single fa tablets , mv tablets , and vitamins made for pregnant or lactating women . compliance was defined as taking 320 g fa per day , from 4 weeks before the date of the last menstrual period until gestation week 6 . a total of 76% of the pregnancies were planned , and the overall proportion of women who complied with the recommendation was only 16% among planners . during the 10-year time period to the present study , there may have been an increase in the awareness as well as more available information about prepregnant recommendations , which may partly explain the observed increase in the prevalence of compliers with the fa recommendation found in this study . in contrast to the dnbc , our data on supplement use and potential predictors were reported during the preconceptional period , and information was recorded prospectively , which increases the validity of the study . on the other hand , snart - gravid study participants may be more health - conscious than the general population of pregnancy planners , possibly overestimating the prevalence of fa or mv use . even so , it is unlikely that an overestimation of supplement use would meaningfully distort the associations between predictors and fa or mv use . in addition , differences in sociodemographic factors among snart - gravid study participants compared with the general population may also contribute to an overestimation of fa or mv use . our study agrees with previous studies that found that maternal age,5,7,10 education,5,6,10 income,6,8 smoking,5,8 and bmi10 were associated with preconception fa use . although a history of childbirth may increase awareness of preconceptional fa use , previous studies found that a previous childbirth either decreased the likelihood of fa use in subsequent pregnancies or was not related to fa use.5,7,8 we found only little association between parity and fa use in our study . the positive associations between previous spontaneous abortion and intercourse frequency and fa or mv use found in our study have not been reported previously . these findings may indicate a relation between a high desire to conceive and increased knowledge about the preconceptional fa guidelines . while lifestyle recommendations during pregnancy are widely available , less advice is available for women trying to conceive . in addition to the fa recommendation , danish women planning a pregnancy are advised to avoid alcohol altogether.1 a total of 32% reported no alcohol intake in our study , which was slightly more than the 12% reported from the dnbc previously.21 in addition , we found the lowest proportion of fa or mv users among women with the highest alcohol intake . together with the concern that excessive alcohol intake impedes the normal bioavailability and metabolism of folate,22 these results underscore the need to target women at high risk of not following the fa recommendation , as well as those not following other preconceptional guidelines . being diagnosed with a chronic disease has previously been associated with increased dietary supplement use in general.23 pregnancy planners with a chronic illness might be more prone to use fa or mvs because of increased health awareness , but we found little association between a diagnosis of hypertension , diabetes , thyroid disease , pelvic inflammatory disease or infections with chlamydia and preconceptional use of fa or mvs . our findings indicate that more than one - third of the pregnancy planners in this study do not follow the preconceptional fa recommendation . we found that pregnancy planners with other risky behaviors , such as smoking and alcohol use , obesity , and being physically inactive , are less likely to comply with the fa recommendation or use mvs .
villous adenomas are common lesions of the gastrointestinal tract but they are rarely located in the urinary tract including the bladder . . they should be accepted as important lesions because the malignancy potential of them is still not known [ 1 , 2 ] . here a 43-year - old male patient was admitted to our hospital with the complaint of non - coagulated hematuria and pain . a polypoid lesion 14 mm 10 mm in diameter located on the left lateral wall of the bladder was detected in ultrasonography . transurethral resection was performed by the urology department and material was sent to the pathology department for histopathological evaluation . the sections prepared with hematoxylin and eosin showed that the lesion was composed of villous structures lined by intestinal epithelium with mild dysplastic changes in some nuclei and abundant mucinous substance , which were remarkable microscopically ( fig . the lesion was stained diffusely positive with carcinoembryonic antigen ( cea ) , focal positive with cytokeratin 20 ( ck-20 ) , cytokeratin 7 ( ck-7 ) and negative with epithelial membrane antigen ( ema ) . the diagnosis was villous adenoma of urinary bladder with these clinical and histopathological findings . a conclusion about the possibility of having a malignancy potential in these lesions was also included in the pathology report and close follow - up of the patient was suggested to the clinic . villous structures lined by intestinal epithelium with mild dysplastic changes in some nuclei ( he , magnification 100 ) although villous adenomas are commonly seen in the gastrointestinal tract , they are rare in the urinary tract including the urinary bladder the patients generally complain about hematuria , irritative symptoms and rarely mucusuria [ 15 ] . they develop from the partitioning of the cloaca by the urorectal septum [ 1 , 3 ] . it is postulated that remnants of cloaca may exist in the bladder and they can cause a glandular epithelial neoplasm . there is also a suggestion that these neoplasms originate from injured stem cells of urothelium which result in glandular metaplasia . chronic irritation such as infection , chemical injury or presence of calculi may result in intestinal metaplasia of epithelium [ 2 , 4 , 6 ] . they both consist of villous structures lined by columnar epithelial cells with some goblet type mucin producing cells . villous adenomas of the urinary tract also have similar immunohistochemical properties with their colonic counterpart . they stain positive with carcinoembryonic antigen ( cea ) and cytokeratin 20 ( ck-20 ) , but generally negative with epithelial membrane antigen ( ema ) . cytokeratin 7 ( ck-7 ) is positive in approximately 50% of urinary tract lesions in contrast to intestinal ones . consistently with the literature , our sections stained strongly and diffusely positive with cea ( fig . 2 ) , focal positive with ck-20 and ck-7 , and negative with ema . neutral acid and sialomucins secreted by adenomas can be shown with periodic acid - schiff and alcian blue stains as well . carcinoembryonic antigen ( cea ) was stained positive ( cea , magnification 100 ) the epitope for mabdas1 which was firstly identified on normal colonic epithelium was used in one study , and found positive in 8 of 10 cases . this epitope was also positive in neoplastic epithelium of the colon , but negative in normal , inflamed and neoplastic urothelium . cystitis glandularis , in situ and well - differentiated adenocarcinoma should be considered for differential diagnosis . there are no well - formed villous structures which were characteristic for villous adenomas in cystitis glandularis . dysplastic appearance in pseudo - stratified epithelium with enlarged , crowded and hyperchromatic nuclei is remarkable in a well - differentiated adenocarcinoma . sometimes invaginations of adenomatous epithelium into the stroma can cause difficulties for differential diagnosis from invasive neoplasm [ 3 , 5 ] . the coexistence of villous adenoma with in situ or invasive adenocarcinoma , squamous cell carcinoma , and urothelial carcinoma was shown in some studies [ 3 , 4 ] . on the other hand , there is no clear evidence about progression to carcinoma , in spite of its colonic counterpart . since it is a rare lesion , there are no exact data about follow - up and recurrence . it was reported that no evidence about recurrence was found in patients with pure villous adenoma in some studies [ 3 , 4 ] . however , it is uncertain whether an untreated lesion may progress to invasive neoplasm [ 1 , 4 ] . generally complete surgical resection is accepted as curative and prognosis is excellent in patients with isolated villous adenoma . but recurrence or distant metastasis may be seen in patients with coexistent malignancy , and more aggressive treatment can be indicated [ 3 , 4 ] . in conclusion , villous adenomas are important lesions because of coexistence with malignant neoplasms and uncertain malignant potential . so the clinician and the pathologist should be aware of this situation , and any urinary tract lesion diagnosed as villous adenoma of the urinary tract must be thoroughly sampled .
primary neuroendocrine cancer of the bladder is a rare histological occurrence , constituting 0.48 - 1% of all bladder cancers . the 5-year survival rate is around 8% and the prognosis is extremely unfavorable . due to the morphology of the tumor , treatments based on small cell lung cancer , we treated a case in which chemotherapy was performed with cisplatin ( cddp ) and etoposide ( vp-16 ) for neuroendocrine cancer that occurred in the bladder ; here , we report the results . our patient was a 67-year - old male with a major complaint of macroscopic hematuria . his previous history included a traumatic brain hemorrhage at the age of 60 years and stomach cancer at the age of 64 years . he had no family history in particular . in february 2009 , the patient noticed blood in his urine and visited our department . an mri and bone scintigraphy revealed metastasis to both external iliac lymph nodes , resulting in a diagnosis of clinical stage t3bn2m0 . in march 2009 , the patient was hospitalized for the purpose of undergoing a transurethral resection of the bladder tumor ( tur - bt ) . hematological values : rbc 361/l , wbc 7,600/l , hb 11.7 g / dl , plt 18.8 10/l . biochemistry : alb 4.5 g / dl , tp 7.0 g / dl , t - bil 0.5 mg / dl , ast 16 iu / l , alt 12 iu / l , alp 263 iu / l , ldh 178 iu / l , bun 16 mg / dl , cre 0.84 mg / dl , na 139 meq / l , k 4.7 meq / l , cl 102 meq / l , crp 0.07 g / dl . urinary analysis : ph 5.5 , rbc > 51/hpf , wbc 11 - 20/hpf , protein ( 2 + ) , glucose ( - ) . simple pelvic mri revealed a high basic tumorous lesion with low signals for t1wi , high signals for t2wi , and a diameter of 4 cm on the right bladder wall , and invasion outside the wall was observed . in the external iliac artery regions on both sides , enlarged lymph nodes with a diameter of 1.5 cm no obvious distal metastasis was detected by bone scintigraphy and thoracic pelvic ct . in march 2009 , a tur - bt was immediately performed for the purpose of obtaining a pathological diagnosis . in the histopathological findings , there were a number of large and small solid alveoli of atypical cells accompanied by infiltrative growth into the interstitium . the atypical cells had a high n / c ratio and rough chromatin , and the neoplastic alveoli also suggested differentiation into the neuroendocrine system ( fig . when immunohistological staining was performed , the tumor cells were partially positive for cd56 and chromogranin a and negative for synaptophysin ( fig . the nse upon admission was 260 ng / ml . a positron emission tomography - computed tomography ( pet - ct ) performed before chemotherapy revealed metastasis to the liver , bones , and lymph nodes ( fig . 2 ) . based on the protocol for small cell lung cancer , chemotherapy with cisplatin ( cddp ) and etoposide ( vp-16 ) was performed along with pe therapy ( p : 80 mg / body , e : 100 mg / body ) . the nse after completing the first course declined to 9.1 ng / ml and ct also revealed tumor shrinkage ( fig . 3 ) . however , before implementing the second course , the patient 's systemic condition deteriorated , and in august 2009 , the patient expired due to multiple systemic metastases . in february 2009 , the patient noticed blood in his urine and visited our department . an mri and bone scintigraphy revealed metastasis to both external iliac lymph nodes , resulting in a diagnosis of clinical stage t3bn2m0 . in march 2009 , the patient was hospitalized for the purpose of undergoing a transurethral resection of the bladder tumor ( tur - bt ) . hematological values : rbc 361/l , wbc 7,600/l , hb 11.7 g / dl , plt 18.8 10/l . biochemistry : alb 4.5 g / dl , tp 7.0 g / dl , t - bil 0.5 mg / dl , ast 16 iu / l , alt 12 iu / l , alp 263 iu / l , ldh 178 iu / l , bun 16 mg / dl , cre 0.84 mg / dl , na 139 meq / l , k 4.7 meq / l , cl 102 meq / l , crp 0.07 g / dl . urinary analysis : ph 5.5 , rbc > 51/hpf , wbc 11 - 20/hpf , protein ( 2 + ) , glucose ( - ) . simple pelvic mri revealed a high basic tumorous lesion with low signals for t1wi , high signals for t2wi , and a diameter of 4 cm on the right bladder wall , and invasion outside the wall was observed . in the external iliac artery regions on both sides , enlarged lymph nodes with a diameter of 1.5 cm in march 2009 , a tur - bt was immediately performed for the purpose of obtaining a pathological diagnosis . in the histopathological findings , there were a number of large and small solid alveoli of atypical cells accompanied by infiltrative growth into the interstitium . the atypical cells had a high n / c ratio and rough chromatin , and the neoplastic alveoli also suggested differentiation into the neuroendocrine system ( fig . when immunohistological staining was performed , the tumor cells were partially positive for cd56 and chromogranin a and negative for synaptophysin ( fig . based on the morphology and the results of immunohistological staining , the patient was diagnosed with neuroendocrine cancer . in june 2009 , the patient was hospitalized for the purpose of undergoing additional treatment . the nse upon admission was 260 ng / ml . a positron emission tomography - computed tomography ( pet - ct ) performed before chemotherapy revealed metastasis to the liver , bones , and lymph nodes ( fig . 2 ) . based on the protocol for small cell lung cancer , chemotherapy with cisplatin ( cddp ) and etoposide ( vp-16 ) was performed along with pe therapy ( p : 80 mg / body , e : 100 mg / body ) . the nse after completing the first course declined to 9.1 ng / ml and ct also revealed tumor shrinkage ( fig . 3 ) . however , before implementing the second course , the patient 's systemic condition deteriorated , and in august 2009 , the patient expired due to multiple systemic metastases . since first being reported by cramer et al . in 1981 , neuroendocrine bladder cancer has often been reported as primary small cell cancer of the bladder . histologically , it is believed that this condition exhibits a similar histological appearance as small cell lung cancer , where the tumor cells are small , the nuclei are rich in chromatin and are circular or spindle - shaped , and tumor cells with scarce cytoplasm solidly proliferate . for immunostaining , cd56 , synaptophysin , and chromogranin a are used . in this study , cd56 and chromogranin the case in this study involved a high - grade neuroendocrine cancer according to the world health organization classification , and using the classifications of lung cancer , many parts had morphologies equivalent to those of small cell cancer , while some parts exhibited morphologies of large cell cancer . blomjous et al . have reported that primary neuroendocrine cancer of the bladder constitutes approximately 0.48% of all bladder tumors in autopsy cases . at the time of diagnosis , primary neuroendocrine cancer of the bladder is detected as an advanced cancer occurring in t3 and t4 in 70% and 16.3% of cases , respectively . in addition , the 5-year survival rate has been reported to be 8.1 - 19% , and the prognosis is extremely unfavorable . in our present case , too , the cancer progressed rapidly and resulted in death 6 months after diagnosis . regarding treatment , multimodality therapy combining surgical therapy and chemotherapy / radiation therapy is often implemented ; however , this is not yet an established therapy . based on cases of small cell lung cancer , chemotherapy is mainly performed with pe therapy using a combination of cisplatin ( cddp ) and etoposide ( vp-16 ) , and there are reports in which the prognosis was improved . in this study , we also performed pe therapy based on small cell lung cancer and observed a decrease in the nse value and a shrinkage of the tumor on ct images . as primary neuroendocrine cancer of the bladder progresses rapidly , we believe that it is important to select multimodality therapy via early detection .
intensive care unit ( icu ) admission in chronic obstructive pulmonary disease ( copd ) patients is generally due to infections by bacterial or viral agents , but fungal agent may occur in immunocompromised states . among fungal agents candida is the most common species , of which a new fluconazole resistant strain of candida named candida ciferrii has been found to be frequently associated with systemic mycosis in immunocompromised hosts . here , we report a rare case of pneumonia due to fluconazole sensitive candida ciferrii in a patient of copd exacerbation with underlying diabetes . a 55-year - old , female , bidi smoker , suffering from moderate copd ( gold guidelines ) for 2 years , presented to the emergency room with progressive increase in dyspnea and cough with copious mucopurulent expectoration for 15 days and 10 days respectively . before her exacerbation , her symptoms were well controlled with tiotropium and a fixed dose combination of formoterol and budesonide . on general examination , she was tachypneic ( respiratory rate 30/min ) ; had cyanosis and used her accessory muscles of respiration . respiratory system examination revealed diminished vesicular breath sound with prolonged expiration on left lower zone ; bilateral polyphonic rhonchi all over the chest and coarse biphasic crackles over bilateral lung bases more on the right side . her peripheral oxygen saturation was 74% in room air during the admission and improved to 88 - 92% with oxygen through face mask at a flow of 8 l / min . her arterial blood gas showed ph 7.43 , pao2 70 mmhg , paco2 36 mmhg , pao2/fio2 234 , suggestive of acute lung injury . she was a known diabetic for 15 years and had needed insulin for the control of diabetes for the past 6 months . on admission blood culture ; sputum for gram stain , ziehl - neelsen ( z - n ) stain and pyogenic culture with sensitivity were asked for . she received piperacillin - tazobactum ( 4.5 g ) 6 hourly and azithromycin ( 500 mg ) once daily , along with nebulization by salbutamol + ipratropium , injectable deriphylline and intravenous fluids . her chest x - ray showed bilateral lower zone heterogeneous opacity , more on left side with clear costophrenic angles on lateral chest x - ray suggestive of bilateral pneumonia [ figure 1a ] . total leukocyte count was 11,700/mm with neutrophil 67% , lymphocytes 28% , eosinophils 2% , basophil 1% and monocytes 2% . serum urea was 34 mg% , creatinine 0.7 mg% , sodium 138 meq / l , potassium 3.5 meq / l . since , her condition did not improve after 2 days a computed tomographic scan of thorax was requested for further evaluation , which revealed left lower lobe collapse with consolidation along with patchy pulmonary infiltrations in the right middle and lower lobe [ figure 1b ] . fiber - optic bronchoscopy was carried out to know the cause of collapse , which showed patchy whitish lesion in the lateral wall of trachea just above the carina with a mucous plug occluding the lumen of the left main bronchus and purulent discharge from right main bronchus [ figure 2 ] . bronchoalveolar lavage fluid ( bal ) was taken from those segments with clearing of that mucous plug and bal fluid was sent for cytological examination , gram staining , fungal staining , z - n staining , malignant cells , mycobacterial culture , and fungal culture . fungal staining of bal and mucosal biopsy specimen showed yeast forms suggestive of candida species [ figure 3 ] . intravenous liposomal amphotericin b ( 150 mg daily ) was initiated and changed to oral fluconazole ( 150 mg daily ) after 4 days , when drug sensitivity revealed that the strain was fluconazole sensitive [ table 1 ] . after 4 days , she showed remarkable recovery and maintained oxygen saturation on room air . chest x - ray on follow - up after 6 weeks showed marked improvement [ figure 4 ] . chest x - ray ( a ) showing bilateral lower zone heterogeneous opacity , more on left side with clear costophrenic angles on lateral x - ray suggestive of bilateral pneumonia and computed tomographic scan of thorax ( b ) showing left lower lobe collapse with consolidation along with patchy pulmonary infiltrations in right middle and lower lobes fibre - optic bronchoscopy showing mucous plug occluding the lumen of the left main bronchus and pus coming out from right main bronchus fungal staining of bronchoalveolar lavage fluid and mucosal biopsy specimen showing yeast forms suggestive of candida species sensitivity pattern of candida ciferrii to antimicrobial agents chest x - ray showing marked improvement and clearance of alveolar opacities after 6 weeks of antifungal therapy copd exacerbation is an acute event characterized by worsening of patient symptoms that is beyond normal day to day variations and leads to change of medications . the most common cause of copd exacerbations appears to be respiratory tract infections mainly bacterial or viral . candida spp . constituted to normal flora of the human skin , oropharynx , lower gastrointestinal tract , and genitourinary system . the incidence of deep candida infections resistant to common antifungal agents has increased in recent years especially among immunocompromised patients such as diabetes mellitus , prolonged high dose glucocorticoid ( gc ) use , transplant recipients , and human immunodeficiency virus infected patients . candida is a part of the normal flora in the oropharynx and gastrointestinal tract , so growth of candida from upper respiratory samples is frequently disregarded as a contaminant . can be isolated from bronchial washings , tracheal aspirates , and bal samples of patients , but accompanying lung parenchymal invasion is infrequent ; hence , demonstration of candida spp . from lower respiratory tract along with parenchymal invasion conclusively proves candidal pneumonia . candida ciferrii is a newer strain of candida , which has been rarely reported as a cause of human infection . most of the reported cases by candida ciferrii include malignant otitis externa and onychomycosis . in the literature there was only one reported case of lung involvement by candida ciferrii in the form of spotted pulmonary infiltrations , which was resistance to fluconazole . the candida ciferrii strain in our case was sensitive to fluconazole with minimum inhibitory concentration 1 g / ml and it implies the need for anti - microbial susceptibility testing before starting therapy . to the best of our knowledge this is the first case report of recovery of fluconazole sensitive candida ciferrii in a copd patient admitted with pneumonia in an icu .
tumorigenesis is a multistep process beginning with the transformation of a single cell by the accumulation of at least six distinct characteristics . these include infinite lifespan , resistance to antigrowth signals , resistance to apoptosis , autocrine production of growth signals , sustained angiogenesis , and tissue invasion . most environmental carcinogens induce transformation by causing mutations in the dna that alter the activity of protooncogenes or tumor suppressors . these mutations are formed when residual , unrepaired dna damage stalls progression of the replication fork during s phase . stalled replication forks are most frequently resolved using error - free mechanisms that include homologous recombination or use of the homologous nascent strand as a template . nevertheless , replication may proceed using the damaged strand as a template in an error - prone process known as translesion dna synthesis ( tls ) . tls is defined as the incorporation of a nucleotide across from dna damage followed by extension of the potentially mispaired primer - template , and can be error - free or error - prone . cellular commitment to error - free , recombinatorial damage avoidance or error - prone tls is modulated by the molecular switch pcna ( figure 1 ) . cells presumably risk mutations caused by tls to relieve replication fork blockage at dna adducts and to avoid the potential formation of extremely cytotoxic double strand breaks ( dsb ) . although it accounts for less than 10% of all bypass synthesis events in yeast , the frequency of potentially mutagenic tls may be as high as 50% in higher eukaryotes [ 35 ] . the propensity and mutagenic potential of tls explain why it is etiologic in most environmentally - induced cancers and has been the focus of numerous investigations over the past decade . polymerase ( pol ) , pol , pol , and rev1 in the y - family and pol in the b - family [ 7 , 8 ] are responsible for most tls in mammalian cells . these proteins have active sites that are larger and more open than those of the high - fidelity replicative dna polymerases ( pol , , and ) , allowing accommodation of and synthesis past dna templates with large , helix - distorting lesions . this unique ability to synthesize dna opposite bulky adducts helps cells avoid double strand breaks associated with replication fork stalling , but can also lead to mutagenesis by incorrect base addition . it is important to note that polymerases in the y - family are expressed in all three kingdoms of life , indicating a critical and evolutionarily conserved role for these proteins . the obviously conflicting roles of these enzymes in both preventing and promoting genetic instability are reflected in the tight cellular control of the tls pathway ( figure 1 ) . although extensive in vitro studies have given us a better understanding of their role in the cell , much less is known about the function of tls polymerases in living animals . limited epidemiological studies have been conducted to associate single nucleotide polymorphisms ( snps ) with cancer risk in humans . knockout mice have been generated for each gene , and carcinogenesis studies are published or underway . importantly , studies in mice and humans have shown that tls polymerases , particularly pol , are involved in immunoglobulin gene hypermutation . readers are directed to reviews by reynaud et al . and diaz et al . for an exploration of this function of tls polymerases this review will focus on the rapidly progressing connection of tls and cancer research in knockout mice and human populations . rev1 was discovered in budding yeast by the lawrence group in 1989 as a component of the pol complex . the catalytic activity of rev1 is limited to insertion of dcmp across from a template dg . the human homolog was cloned in 1999 and has the same template - dependent dcmp transferase catalytic activity on an undamaged template or an abasic site . one locus used in eukaryotic cells to measure mutation frequency is hprt , a gene involved in the purine salvage pathway . in this forward mutation assay , cells with loss - of - function mutations in hprt are resistant to the drug 6-thioguanine ( tg ) . rev1 is required for carcinogen - induced hprt mutagenesis in human cells [ 2022 ] , but the catalytic activity appears to be dispensable for the induction of uv - induced mutations [ 23 , 24 ] , indicating that this protein probably plays a structural rather than catalytic role in uv mutagenesis . cells from mice with a targeted deletion of the brca1 c - terminal ( brct ) homology domain of rev1 ( rev1 ) have a reduced uv - induced mutation frequency at the hprt locus . however , the animals have a paradoxically decreased latency of squamous cell carcinoma ( scc ) formation and only marginally reduced p53 mutagenesis in the skin after uv exposure . despite rev1 cells showing a moderate increase in chromatid breaks and exchanges after uv in vitro , comparative genomic hybriziation of uv - induced scc and normal skin dna reveals no increase in the frequency of gross genomic alterations in rev1 scc . if point mutations and chromosomal rearrangements are near normal levels in brct - deleted rev1 mice , what is the reason for accelerated scc development ? acute uv exposure of these rev1-mutant mice induces enhanced atr signaling , senescence , and apoptosis in the skin . however , long - term low - dose uv exposure causes a mitogenic response , as evidenced by epidermal hyperplasia , decreased apoptosis , and increased proliferation of cpd - containing keratinocytes . based on literature reports of the etiological role of il-6 in carcinogenesis and elevated il-6 levels in the skin after a single subtoxic uv dose , the authors conclude that error - prone tls of uv - induced dna damage is responsible for suppressing the proinflammatory , tumor - promoting effects of uv in the skin . however , more direct immunological studies are needed to confirm that rev1 suppresses uv - induced inflammation and tumor suppression . benzo[a]pyrenediolepoxide ( bpde ) is the primary carcinogenic metabolite of b[a]p and causes point mutations in a rev1-dependent manner [ 22 , 27 ] . bpde - induced hprt mutations are dramatically decreased in primary mouse fibroblasts after ribozyme - mediated rev1-knockdown . when a plasmid expressing this ribozyme is delivered to the lungs of a / j mice by aerosol nebulization this targeted gene therapy causes a ~%40 reduction in the lung tumor multiplicity after b[a]p treatment . in addition , only 73% of ribozyme - treated mice develop lung adenomas after b[a]p , compared with 100% penetrance in control animals . although no human disorder involving rev1 deficiency is known , there are 16 snps in humans that result in nonsynonymous amino acid changes . the f257s snp , which lies outside of all known functional domains of the protein , has been associated with an increased risk of squamous cell carcinoma of the lung in patients who have ever smoked cigarettes . the same f257s snp was associated with decreased risk of cervical cancer , and n373s within the catalytic domain was associated with increased risk of cervical cancer . both effects were specific for squamous cell carcinoma and not relevant for adenocarcinoma of the cervix . although the functional consequences of these polymorphisms are unknown , these studies support a role for rev1 in the formation of multiple internal cancers . the study of translesion synthesis in mammals began in 1999 with the discovery of the molecular defect that results in xeroderma pigmentosum ( xp ) variant syndrome . patients in complementation groups a through g are deficient in nucleotide excision repair ( ner ) , the major pathway for removal of helix - distorting lesions , including those induced by uv . however , the xp variant subset of patients has normal ner activity [ 33 , 34 ] , yet displays the skin cancer - prone phenotype of ner - deficient patients . intensive investigations indicate that after uv - irradiation cells from these patients have difficulty exiting s - phase that is exacerbated by caffeine [ 35 , 36 ] . , two groups independently discovered that xp variant patients carry autosomal recessive mutations in polh , the human gene coding for pol , and that the enzyme can catalyze error - free dna synthesis across from a template tt cyclobutane pyrimidine dimer ( cpd ) [ 3840 ] . the dramatic increase in skin cancer risk of xp variant patients uv principally induces photoaddition products between intrastrand adjacent pyrimidines , the most frequent of which are tt cpd . data indicate that helicase activity may continue in spite of the blocked replication complex , resulting in single - stranded dna that is rapidly coated with replication protein a ( rpa ) . this appears to attract the ubiquitin ligase rad18 , which has binding sites for the ubiquitin conjugase rad6 , pol , and rpa . since pol has a ubiquitin binding domain , pol is now thought to be preferentially attracted to the stalled fork because it is chaperoned directly by rad18 and binds to the ubiquitylated pcna ( figure 1 ) . data indicate that pol then incorporates aa across from tt cpd in the template . in the absence of pol , another translesion polymerase , which is potentially error - prone when bypassing these common uv - induced lesions , accesses the damaged template ( reviewed in [ 42 , 43 ] ) . generation of pol -knockout mice shows that the highly homologous mouse pol protein functions similarly in uv - induced mutagenesis and carcinogenesis . pol -deficient mice develop squamous cell carcinoma with 100% penetrance at a uv fluence that does not cause any tumors in wild - type littermates . in addition , approximately one - third of heterozygous mice develop cancer after uv exposure . this raises the possibility that humans carrying heterozygous mutations in the polh gene may have an increased risk of developing skin cancer there is evidence that xp variant patients develop internal cancers faster than pol -proficient individuals [ 45 , 46 ] , raising the possibility that pol -deficiency is involved in the formation of multiple human cancers caused by dna damaging agents other than uv . six snps in polh have been found to date that result in nonsynonymous amino acid substitutions , but their functional significance is unknown . there is a single study evaluating the effects on cancer risk of polh polymorphisms . flanagan and colleagues found no significant changes in coding - region snps of polh among 40 basal cell carcinoma and squamous cell carcinoma patients in a fair - skinned irish population . it is clear that larger epidemiological studies of polh status are needed to evaluate the effects of polh polymorphisms . dna polymerase ( pol ) was discovered in 1999 as a novel homolog of pol in mammals and is encoded by the human poli gene . in vitro studies with purified enzyme indicate error - prone tls function on almost all substrates examined , perhaps due to the still controversial ability of pol to incorporate incoming nucleotides using hoogsteen base pairing [ 49 , 50 ] . exhaustive characterization of the error - prone replication properties of pol has lent credibility to the hypothesis that poli is a candidate gene for the pulmonary adenoma resistance 2 ( par2 ) locus in mice [ 5153 ] . the par2 locus was identified in 1996 by chromosomal linkage mapping between balb / cj and a / j mouse strains and plays a major role in the relative resistance of balb mice versus the a / j strain to developing urethane - induced lung adenomas . wang et al . identified ten amino acid - substitution polymorphisms between a / j and balb mice that produce changes in substrate recognition of pol ; while the enzyme from both strains is functional , the isoform expressed in balb mice may be more accurate on certain undamaged templates . it has been hypothesized that this activity is due to the augmentation of base excision repair ( ber ) by pol , because the enzyme has 5deoxyribose phosphate ( drp ) lyase activity and can partially reconstitute the ber - deficiency of pol -null cells in vitro . it is possible that after urethane - induced dna damage , which produces 1 , n - ethenoadenine adducts that are primarily repaired by ber , pol acts in the gap - filling step of lesion repair . if the isoform of pol expressed in a / j mice is more likely to add the incorrect g opposite a template t in the gap - filling step of ber , as was found in vitro , this could explain the increased incidence of lung adenomas in a / j mice . in support of this hypothesis , nearly all urethane - induced adenomas in mice have a caacga transition in codon 61 of kras2 . in addition , 129-derived mouse strains that carry a snp in codon 27 of poli resulting in a severely truncated protein display extreme sensitivity to urethane - induced lung adenomas . in the absence of pol , it has been hypothesized that another dna polymerase , such as pol , inserts the incorrect base during gap filling in the repair of urethane - induced dna damage . however , normal mouse pol displays extremely error - prone properties during synthesis opposite all four undamaged template bases in vitro , making it unlikely to prevent mutations during ber in mice that are pol -competent . further studies must be completed to determine the tumor suppression mechanism of pol in mouse lung carcinogenesis . a growing body of evidence suggests that pol is involved in error - prone tls of uv - induced dna damage in vivo . the heightened uv mutagenesis of pol -null ( xp variant ) human cells has been attributed to tls by pol . loss of the functional poli gene in dermal cells results in a dramatically reduced uv - induced mutation frequency at the hprt locus in both wild - type and pol -deficient mice ( figure 2 ) . remarkably , however , the decreased uv - induced mutagenesis observed due to loss of the error - prone pol from pol -deficient mice is associated with increased cancer risk after uv exposure ( figure 3 ) . this result was confirmed and extended by ohkumo and colleagues who showed that poli mice are more likely to develop aggressive mesenchymal tumors after uv than poli - proficient siblings . these apparently contradictory findings speak to the fact that cancer etiology is more complex than the point mutations scored by the hprt assay , and that one can not use cell biology alone to accurately predict cancer risk in a tls model . indeed , they suggest a tumor suppressor role for pol that could be separate from its role as a tls polymerase prone to induce single base - substitution mutations . it is also possible that pol is error - free when bypassing a minor uv adduct , or that it is involved in error - free ber of the minimal oxidative damage induced by uvb used in these studies , but more detailed experiments must be performed to evaluate these possibilities . the role of pol in the induction of cancer induced by other carcinogens has not been systematically studied to date . . found that pol -deficient 129 mice are resistant to -irradiation - induced thymic lymphoma but sensitive to methylating agent - induced thymic lymphoma . -irradiation induces dna strand breaks and oxidative damage , and pol is known to protect cells from oxidative stress . it is therefore possible that increased cell death after -irradiation protects poli 129 mice from lymphomagenesis . however , pol does not affect the sensitivity of pol -null cells to methylating agents , so the sensitivity of 129 mice to thymic lymphoma induced in this way is still unexplained . there is no known human disorder involving deficiency for pol . however , pol is overexpressed in some lung cancer cell lines as well as in primary human gliomas . the t706a snp was found to increase the risk of adenocarcinoma and squamous cell carcinoma of the lung in persons < 61 years of age . however , this association was not confirmed by another independent study and failed to show significance in a meta - analysis . another snp in human poli , f532s , is associated with prostate cancer patients whose tumors display tmprss2-erg fusion with a highly significant odds ratio of 4.6 . the protooncogenic transcription factor erg was identified as the most frequently overexpressed gene in human prostate cancers , and fusion with the androgen - responsive serine protease tmprss2 by chromosomal rearrangement was found in > 90% of erg - overexpressing cases . threonine 706 and serine 532 , the two residues altered by these snps in pol , are located in the noncanonical ubiquitin - binding motifs ubm2 and ubm1 , respectively . these two polymorphisms could therefore affect binding of pol to ubiquitylated pcna , which is required for its recruitment to stalled replication forks following dna damage . in the case of prostate cancer , the f532s variant of pol may promote chromosomal instability by causing replication fork stalling and double - strand break ( dsb ) formation . dsb formed in this way could promote cellular transformation by causing chromosomal rearrangements that place the protooncogene erg under control of the androgen - responsive promoter elements of tmprss2 and lead to erg - overexpression as is found in many prostate cancers . evidence supports the suppression of skin and lung cancers by pol in humans and mice , and new studies suggest that other cancers could be affected by this protein , making it a promising candidate for future investigation . the fourth member of the y - family is dna polymerase . pol performs faithful tls of bpde - induced dna damage in vitro by inserting dc opposite a template bpde - adducted g [ 7375 ] . pol is required for recovery from a novel bpde - induced intra - s phase checkpoint , and the protein relocalizes to stalled replication forks after bpde - induced dna damage [ 76 , 77 ] . polk mouse embryonic fibroblasts ( mefs ) show persistent s - phase arrest after bpde exposure , which results in increased dsb formation at stalled replication forks and increased toxicity in cells without functional pol . avkin and colleagues measured tls efficiency and fidelity in polk mefs using a shuttle vector technique . tls efficiency on a plasmid containing a site - specific bpde - n - dg adduct is reduced nearly threefold in polk mefs , and mutagenic tls is increased from 29% to 50% in knockout cells , supporting a role for pol in the efficient and error - free bypass of bpde dna damage . sirna - mediated polk - knockdown also reduces the efficiency of tls past bpde - n - dg in human u2os cells . this body of evidence suggests that pol could have an important role in cancers caused by bulky chemical carcinogens like bpde . polk mefs have reduced levels of ner of uv damage , including reduced repair synthesis and removal of 6 - 4 photoproducts after uv . both of these phenotypes are largely corrected by expressing wild - type pol , but not a catalytically inactive mutant . pol carries out ner repair synthesis and is recruited to sites of ner through its interaction with xrcc1 and ubiquitylated pcna . these remarkable studies highlight the ability of tls polymerases to function in multiple cellular pathways and the likelihood that polk plays an important role in preventing dna damage - induced carcinogenesis . while polk - knockout mice have been generated [ 82 , 83 ] and show increased spontaneous mutagenesis in kidney , liver , and lung , no cancer studies have yet been reported using these models . pol is overexpressed in ~70% of nonsmall cell lung cancers ( nsclc ) examined , and this overexpression correlates with mutation status of tp53 which is itself an indicator of poor prognosis . in addition , polk promoter activity is increased in tp53 cells , and p53 protein suppresses polk promoter activity in vitro . these reports suggest that pol overexpression in nsclc could be secondary to loss of functional p53 , but the correlation between these two events must be investigated to rule out an etiological role for pol in lung cancer . multivariate analysis indicates that pol overexpression is an independent prognostic factor for the assessment of glioma patient outcomes ( figure 4 ) . although the potential role of pol in the etiology of brain tumors is unclear , pol is clearly a candidate for investigation of cancer risk and chemoprevention of multiple tumor types . the human homolog of yeast dna polymerase is required for mutagenesis by uv , bpde , and other carcinogens [ 7 , 88 ] . pol belongs to the b - family of dna polymerases and contains a large catalytic subunit encoded by the rev3 gene in humans along with the much smaller regulatory protein rev7 . early investigations in saccharomyces cerevisiae showed that rev3 mutant strains have reduced rates of spontaneous mutation , indicating that pol is involved in the mutagenic processing of spontaneous and uv - induced mutations . studies in mammalian cells indicate that pol has a role in both repair of double strand breaks and base substitution mutagenesis , the latter likely involving extension of mispaired primer termini after initial tls by another polymerase [ 91 , 92 ] . pol is the only tls polymerase required for development , and complete rev3-knockout results in mitotic catastrophe and lethality at mouse embryonic day 10.5 [ 9395 ] . however , conditional rev3-knockout mice have been generated and are viable and fertile . while rev3-deficiency alone is insufficient to promote cancer formation , conditional rev3 knockout accelerates the spontaneous formation of lymphoma in trp53 mice . in humans , rev3 gene expression is reduced by twofold in 40 of 74 ( 54% ) colon carcinomas compared to matched normal tissue . however , normal expression is found in much smaller sample sets of gastric , colon , lung , and renal cancers , and the gene is not mutated in primary tumors or cell lines from breast and colon cancers . the expression levels of rev3 in human cancers , particularly colon carcinoma , must be revisited using larger sample sizes to draw firm conclusions about the correlation of gene expression and cancer progression . no studies are published investigating the 25 nonsynonymous snps in human rev3 , but the possibility exists that functional changes in human pol could alter the risk of cancer formation . the importance of translesion dna synthesis in preventing human cancer is well understood from the example of xp variant , in which patients lacking the y - family dna polymerase are prone to develop uv - induced skin cancers due to an extremely hypermutable phenotype . however , we understand very little about how the other polymerases involved in tls affect human health and cancer risk . recently developed mouse models have so far provided conflicting results ; ribozyme - mediated knockdown of total rev1 and removal of the brct domain both result in reduced mutagenesis by bpde or uv , respectively . as expected , when rev1 mrna is knocked down using the same ribozyme delivered to the lungs of mice , multiplicity of b[a]p - induced lung adenomas decreases . in contrast , rev1 brct - null mice develop uv - induced squamous cell carcinomas faster than wild - type controls . in a similarly paradoxical finding , mice lacking both pol and pol have decreased uv - induced mutations in their dermal fibroblasts and accelerated development of squamous cell carcinoma after uv treatment compared to pol -proficient animals . while it is understood that the mutations induced by these polymerases are etiological in many environmentally - induced cancers , it is clear from these studies that simply blocking tls is not sufficient to reduce cancer risk , and in fact may cause an acceleration of carcinogenesis . more detailed studies are needed using existing mouse models to determine the effects of tls polymerase activity on cancer development after diverse carcinogen exposures . in addition , molecular epidemiological studies must be conducted to evaluate the functional consequences of the many nonsynonymous snps in tls polymerase genes , some of which have already been associated with cancer risk or protection . after a decade of intense research , there are still critical gaps in our understanding of the role of tls in human health and cancer risk .

every subject was studied on 2 separate days in random order with 24 week intervals . on both days , breakfast ( 51 g carbohydrate ; 4.8 g fat ; 5.8 g protein ) was given at 10:00 a.m. on the snack day only , a snack ( 30 g soya beans ; 75 g yogurt ) was given 2 h before the breakfast . the details of metabolic testing , hormone , and metabolites assays were as previously described ( 3,8 ) . paired student t test was performed by spss ( version 17.0 ; spss , chicago ) . every subject was studied on 2 separate days in random order with 24 week intervals . on both days , breakfast ( 51 g carbohydrate ; 4.8 g fat ; 5.8 g protein ) was given at 10:00 a.m. on the snack day only , a snack ( 30 g soya beans ; 75 g yogurt ) was given 2 h before the breakfast . the details of metabolic testing , hormone , and metabolites assays were as previously described ( 3,8 ) . paired student t test was performed by spss ( version 17.0 ; spss , chicago ) . at baseline , 2 h before breakfast , fasting plasma glucose was similar on the 2 study days ( 6.6 0.3 and 6.6 0.4 mmol / l ) . the snack induced a small peak in plasma glucose at 60 min ( 7.3 0.4 mmol / l ) . the concentrations of plasma glucose immediately before breakfast ( t = 0 min ) did not differ significantly between the 2 days ( 6.6 0.3 vs. 6.4 0.3 mmol / l , p = 0.45 ) ( fig . metabolic changes between the 2 study days in 10 subjects with type 2 diabetes . a : plasma glucose concentrations . c and d : change in ffa and insulin concentrations , respectively . * p < 0.05 ; * * p < 0.02 ; * * * p < 0.01 ; , snack day ; , control day . following breakfast , min / l for snack and control day , respectively ( p = 0.013 ) ( fig . the 2-h postprandial plasma glucose concentration was significantly lower on the snack day compared with the control day ( 9.8 0.3 vs. 10.8 0.4 mmol / l , p = 0.001 ) . the fasting plasma free fatty acid ( ffa ) concentrations on both study days were similar ( 0.57 0.05 and 0.57 0.04 mmol / l , p = 0.9 ) . after ingestion of the snack , plasma ffa concentration declined , falling to 70% of the fasting levels just before breakfast ( 0.41 0.04 mmol / l ) . after breakfast , plasma ffa levels in both groups were suppressed ( 0.16 0.02 vs. 0.14 0.02 ffa concentration before breakfast was positively correlated with the postprandial iauc for plasma glucose ( r = 0.50 , p = 0.013 ) . fasting mean serum insulin levels were similar on the 2 study days ( 13.4 2.4 and 13.2 2.7 mu / l ) . on the snack day , insulin concentration rose promptly after ingestion of the snack to 26.5 4.0 1d ) . following breakfast , insulin levels increased similarly on both days ( 58.5 7.9 vs. 51.2 7.6 the mean insulin - to - c peptide ratios from the area under the curves ( t = 05 h ) were similar on both days ( 13.6 3.2 vs. 16 . 9 1.4 mu / nmol , p = 0.36 ) implying similar hepatic insulin extraction . fasting glucose oxidation rates were not significantly different on the 2 study days ( 0.55 0.18 vs. 0.77 0.25 mg / kg min , p = 0.37 ) . on the snack day , glucose oxidation rate increased to 1.38 0.24 mg / kg min at 90 min after breakfast compared with 1.09 0.25 mg / kg min on the control day ( p = 0.11 ) . fasting lipid oxidation rates were similar ( 0.7 0.1 vs. 0.63 0.12 mg / kg min ) and 90 min after breakfast decreased to 0.39 0.09 vs. 0.51 0.09 mg / kg min , respectively ( p = 0.09 ) . at baseline , 2 h before breakfast , fasting plasma glucose was similar on the 2 study days ( 6.6 0.3 and 6.6 0.4 mmol / l ) . the snack induced a small peak in plasma glucose at 60 min ( 7.3 0.4 mmol / l ) . the concentrations of plasma glucose immediately before breakfast ( t = 0 min ) did not differ significantly between the 2 days ( 6.6 0.3 vs. 6.4 0.3 mmol / l , p = 0.45 ) ( fig . metabolic changes between the 2 study days in 10 subjects with type 2 diabetes . a : plasma glucose concentrations . c and d : change in ffa and insulin concentrations , respectively . * p < 0.05 ; * * p < 0.02 ; * * * p < 0.01 ; , snack day ; , control day . following breakfast , min / l for snack and control day , respectively ( p = 0.013 ) ( fig . the 2-h postprandial plasma glucose concentration was significantly lower on the snack day compared with the control day ( 9.8 0.3 vs. 10.8 0.4 mmol / l , p = 0.001 ) . the fasting plasma free fatty acid ( ffa ) concentrations on both study days were similar ( 0.57 0.05 and 0.57 0.04 mmol / l , p = 0.9 ) . after ingestion of the snack , plasma ffa concentration declined , falling to 70% of the fasting levels just before breakfast ( 0.41 0.04 mmol / l ) . after breakfast , plasma ffa levels in both groups were suppressed ( 0.16 0.02 vs. 0.14 0.02 mmol / l for snack and control days , respectively ) ( fig . ffa concentration before breakfast was positively correlated with the postprandial iauc for plasma glucose ( r = 0.50 , p = 0.013 ) . fasting mean serum insulin levels were similar on the 2 study days ( 13.4 2.4 and 13.2 2.7 1d ) . following breakfast , insulin levels increased similarly on both days ( 58.5 7.9 vs. 51.2 7.6 the mean insulin - to - c peptide ratios from the area under the curves ( t = 05 h ) were similar on both days ( 13.6 3.2 vs. 16 . 9 1.4 mu / nmol , p = 0.36 ) implying similar hepatic insulin extraction . fasting glucose oxidation rates were not significantly different on the 2 study days ( 0.55 0.18 vs. 0.77 0.25 mg / kg min , p = 0.37 ) . on the snack day , glucose oxidation rate increased to 1.38 0.24 mg / kg min at 90 min after breakfast compared with 1.09 0.25 mg / kg min on the control day ( p = 0.11 ) . fasting lipid oxidation rates were similar ( 0.7 0.1 vs. 0.63 0.12 mg / kg min ) and 90 min after breakfast decreased to 0.39 0.09 vs. 0.51 0.09 mg / kg min , respectively ( p = 0.09 ) . this study demonstrated for the first time that the provision of a practical , high - protein , low - carbohydrate snack prior to breakfast reduced by 40% the postprandial plasma glucose increment in people with type 2 diabetes . these findings confirm a potent expression of the second - meal effect in people with type 2 diabetes similar to that resulting from intravenous arginine infusion ( 3 ) . the importance of the present observation is that a more practical means of improving glucose tolerance could potentially be of therapeutic benefit in people with type 2 diabetes . the mechanism underlying the second - meal effect has been shown to be due to suppression of plasma ffa , allowing greater storage of glucose as muscle glycogen ( 2 ) . we previously demonstrated a strong negative correlation between the decrease of preprandial plasma ffa levels and the postmeal glucose increment . in the present study , a significant positive correlation was found between prebreakfast plasma ffa and the rise in postprandial plasma glucose concentration . this observation is analogous to the acute effect of the antilipolytic nicotinic acid analog acipimox ( 9 ) . it will be important to optimize both the composition of the snack and the interval before breakfast to maximize the benefit of this approach . in everyday life , the gap between snack and breakfast would have to be accommodated , for instance , by delaying breakfast until mid - morning . although the snack induced a small increase in plasma glucose , it was minimal and unlikely to contribute to the hyperglycemic burden . the sample size was dictated by prior power calculation ( 80% power with 10 subjects ) . we have demonstrated that a high - protein , low - carbohydrate snack before breakfast attenuates postbreakfast hyperglycemia , and further studies must determine whether long - term use is associated with improvement in a1c .
progress in diabetes care over the last decade , such as the routine use of recombinant insulins , continuous subcutaneous insulin infusions , and continuous glucose monitoring , has improved and lengthened the lives of millions of patients . as patients live longer they are more likely to develop impaired awareness of hypoglycemia . adrenergic responses to hypoglycemia in patients with long - standing diabetes are often severely blunted and nonspecific neuroglycopenic symptoms tend to predominate . as a result , frequent , unanticipated hypoglycemic episodes continue to plague patients . and , although it is well documented that tight glycemic control helps delay or prevent end - organ complications such as retinopathy and nephropathy , it is also clear that the chief barrier to excellent glycemic control is the constant fear of dangerous hypoglycemia . ideal control , without glycemic excursions or risk of hypoglycemia , can only be achieved with physiologic -cell replacement , such as in the form of pancreas transplantation or islet transplantation . one of the major limitations to clinical islet or vascularized pancreas transplantation , however , is the inadequate supply of human cadaver donors . with over 30,000 patients diagnosed with type 1 diabetes each year in the united states and only about 8000 human cadaver donors , therefore , a reliable and clinically applicable method to replace lost cells in patients with diabetes is desperately needed . potential strategies for -cell replacement can generally be categorized as ex vivo strategies involving the generation of cells in vitro and their subsequent transplantation , or in vivo regeneration - type approaches . in the former , it is envisioned that cells would be isolated , derived , or grown from other sources and subsequently transplanted either as cells alone or encapsulated cells or cells together with matrices as part of a tissue construct into the diabetic recipient . examples of this type of strategy might include the differentiation of human pluripotent stem cells through stereotypical developmental stages into pancreatic and endocrine progenitor cells and ultimately into glucose - responsive insulin - secreting cells followed by transplantation . alternatively , cells could be grown from other cell types isolated directly from patients such as blood cells , acinar cells , ductal cells , or liver cells , etc . advantages of the ex vivo strategy is that cells can be characterized , quantified , and safety tested prior to transplantation . one approach to achieve this goal that has been explored recently is to reprogram other somatic or parenchymal cells into becoming cells by overexpressing multiple key pancreatic transcription factors . although this has been achieved in mice in vivo , it may also be worthwhile to explore ex vivo conversion of other pancreatic cell types to cells , such as targeting putative facultative progenitor cells to induce their conversion into cells . regardless of which strategy is pursued , it is generally accepted that in order to be effective in human patients it will be necessary to consider control of alloimmunity and/or autoimmunity in conjunction with replacing lost cells . the next sections review in more detail three - aforementioned promising strategies toward -cell replacement or restoration that are currently in preclinical studies : derivation of insulin - producing cells from pluripotent stem cells , reprogramming non- cells into cells , and methods of promoting endogenous regeneration . the quest for alternative sources of cells has catalyzed an effervescence of studies aimed at translating known molecular pathways of pancreas organogenesis into protocols of stem cell differentiation in vitro . the prospect of turning human stem cells , either embryonic ( es ) or induced pluripotent ( ips ) , into enough cells to treat many patients first derives merit from the renewal potential of stem cells , whose populations can be amplified to clinically significant levels and can serve as transplantation material . second , stem cell pluripotency implies that , under the action of the appropriate inductive networks of growth factors , these cells may give rise to any cell type , including fully functional pancreatic endocrine lineages with therapeutic potential in insulin - dependent diabetes . third , the recent advances in reprogramming human somatic cells to become ips cells [ 13 ] potentially allow the in vitro derivation of an autologous therapeutic cell population . significant progress has been achieved over the last decade in our ability to identify definitive endoderm and pancreatic lineages in stem cell cultures and to directly induce the differentiation of these cell types from human pluripotent stem cells by sequentially recapitulating the major stages in pancreas development . however , the remaining challenge is to match the phenotypic profile of expressed markers and transcription factors with functional qualities such as glucose responsiveness and physiologic insulin secretion in vitro , and , more importantly , in vivo . early reports of generating human pancreatic endoderm , capable of differentiating in vivo into more mature islet cell types secreting c - peptide , insulin , glucagon , or somatostatin in response to glucose stimulation [ 47 ] have been followed by recent failed attempts to generate clinically relevant levels of human endocrine hormone secretion [ 8 , 9 ] , casting a shadow of doubt over the reproducibility and efficiency of current protocols of -like cell differentiation from human pluripotent stem cells . the past 3 years have brought to light several analogous , yet surprisingly diverse , pancreatic lineage differentiation protocols for human pluripotent stem cells focused on deepening the exploration and applicability of signaling pathways from embryonic pancreas development ( summarized in table 1 and recently reviewed in ) . special interest in recent reports has been dedicated to the role of retinoic acid in converting definitive endoderm into pancreatic duodenal homeobox-1 ( pdx1)-positive precursors [ 11 , 12 ] , which were substantially increased in number in the presence of antagonists to bone morphogenetic protein ( bmp ) and hedgehog , epidermal growth factor ( egf ) , and low - density culture . additional interest has been focused on fibroblast growth factors ( fgfs ) in the fine modulation of endoderm differentiation fates . a positive effect of fgf2 in conjunction with bmp4 and activin a on endoderm differentiation was recently reported by several groups [ 14 , 1518 ] . xu et al . [ 17 , 18 ] also identified the role of combined fgf2/transforming growth factor- ( tgf-)/activin a / bmp4 signaling in endoderm differentiation and fgf2 signaling during later stage patterning of the gut tube , leading to efficient pancreatic precursor specification and a highly enriched pdx1-positive population capable of further differentiating into some c - peptide - positive cells . other recent reports confirm that during the patterning stage optimal levels of fgf2 and fgf4 correlate with improved foregut specification to pancreatic lineage while inhibiting hepatocyte differentiation , however with more modest outcomes . whereas many protocols use fgf10 during pancreatic precursor differentiation , a recent report validated on multiple human embryonic stem ( es ) cell lines associated fgf10 and bmp signaling with hepatocyte differentiation , and showed that inhibiting these factors strongly increases pancreatic pdx1-positive precursor differentiation achieving 50% to 80% enrichment . the alternative use of fgf7 in foregut endoderm differentiation from definitive endoderm [ 12 , 17 ] could thus prove to be a solution to circumvent fgf10-driven hepatic lineage specification . although several recent human stem cell differentiation protocols demonstrated robust endoderm differentiation and enriched pdx1-positive cell populations , endocrine specification was much more restricted and only a fraction of cells in these studies express insulin or c - peptide . very few studies were able to report physiologic levels of glucose - responsive endocrine hormone secretion , and even fewer were able to show efficient control of hyperglycemia after transplantation into diabetic mice [ 6 , 8 , 20 ] . table 1overview of the most recent studies on pluripotent stem cell differentiation to endoderm and pancreatic lineage cellsreferencesourceend pointkey factorsfunctionaltransplantation in animal modelsdefinitive endodermborowiak et al . es57% to 62% sox17+ide1 , ide2 , screeningn / acells integrate into developing gut tubewang et al . es , ips73% sox17 + , 39% primitive gut endodermcd49e , cd141 , cd238 sortingn / acells differentiate to endodermal progenyforegut endodermchen et al . es50% to 80% pdx1+noggin , ra ; inhibition of fgf10 , bmpn / an / aendocrine specificationmaehr et al . producing cellst1d cell donorsin vitro , glucose - responsive c - peptide releasen / amao et al . esimmature insulin - producing cellsplga scaffolds transplantationin vitro and in vivo low insulin releasein diabetic mice , decreased fasting blood glucosezhang et al . es , ips25% mature - like insulin- and c - peptide - producing cellsegf , ra , noggin , fgf7 in vitro , glucose - responsive c - peptide releasen / amatveyenko et al . [ 8]es0.8% insulin- and c - peptide producing cellsnovocell protocol reproducibilityin vivo low insulin and c - peptide release50% of implants develop into islet - like structurescai et al . es72% pdx1 + ; endo- and exocrine precursorslow cell density , ran / an / anostro et al . [ 14]es , ipsup to 25% c - peptide+ , immature endocrinetgf- inhibition ; wntn / an / arezania et al . esimmature and mature - like glucagon - producing cellsalk inhibitors screeningin vitro and in vivo glucagon releasein normoglycemic and diabetic mice , decreased glucagon secretionthatava et al . ipsimmature and mature - like endocrine cellsilv , glp-1,in vitro c - peptide releasen / axu et al . es , ipsup to 10% c - peptide producing cellsactivin , bmp , fgf2 in vitro c - peptide releasen / abmp bone morphogenetic protein ; egf epidermal growth factor ; es embryonic stem cells ; fgf fibroblast growth factor ; glp-1 glucagon - like peptide-1 ; ilv indolactam v ; ips induced pluripotent stem cells ; n / a study not available ; pdx1 pancreatic duodenal homeobox-1 ; plga polylactic - co - glycolic acid ; ra retinoic acid ; tgf- transforming growth factor- ; t1d type 1 diabetes overview of the most recent studies on pluripotent stem cell differentiation to endoderm and pancreatic lineage cells bmp bone morphogenetic protein ; egf epidermal growth factor ; es embryonic stem cells ; fgf fibroblast growth factor ; glp-1 glucagon - like peptide-1 ; ilv indolactam v ; ips induced pluripotent stem cells ; n / a study not available ; pdx1 pancreatic duodenal homeobox-1 ; plga polylactic - co - glycolic acid ; ra retinoic acid ; tgf- transforming growth factor- ; t1d type 1 diabetes a second approach to protocol optimization is based on high - throughput screening for active small molecules and agonists that mimic protein - based signaling pathways during embryonic development . treatment with histone deacetylase inhibitors such as ide1 and ide2 resulted in 57% to 62% sox17-positive definitive endoderm differentiation , which was reportedly almost as efficient as activin a. high - content chemical screening identified indolactam v s ability to efficiently induce up to 46% pdx1-positive pancreatic progenitors from definitive endoderm cultures , which prompted inclusion of this compound in other differentiation protocols . screening for compounds that are active in later stages identified two kinase inhibitors alk - i i and alk - i ii , which guided the differentiation of pancreatic progenitors to functionally mature endocrine glucose - responsive cells . notably , some of these compound screening reports have been validated in vivo by following the differentiated cell progeny after transplantation . despite the multitude of differentiation protocols currently described in the literature , current limitations in the ability to generate fully functional cells from human pluripotent stem cells in vitro call for the need to refine the existing protocols , by fine - tuning discrete or reciprocal regulatory mechanisms involved in creating appropriate temporal and spatial differentiation microenvironments in culture . in support of this requirement , elegant studies on mouse development recently showed that the timing and duration of growth factor inductive networks , such as mesodermal bmp and tgf- signaling , are controlled over very short time frames , in the range of hours , to insure correct cell type specification in the foregut endoderm . moreover , spatial intra - endodermal cell interactions were shown to be critical for the induction of pancreatic cells versus non - endocrine pancreas or intestine from adjacent endoderm areas . furthermore , we know little about the molecular events regulating islet formation and -cell functional maturation , which typically occurs in the late gestational and early postnatal period . therefore , we anticipate that future pluripotent stem cell differentiation studies will increase in complexity and that the aim will shift from replicating limited arrays of gene expression profiles of intermediate progeny , to generating fully functional glucose - responsive pancreatic endocrine cells capable of reliably restoring euglycemia in experimental diabetes models . the loss of cells observed in type 1 diabetes mellitus has stimulated great interest in the body s endogenous capacity to regenerate new cells . cells have been shown in numerous studies to replicate after birth in response to pancreatic injury or disease , as well as under certain physiologic conditions such as pregnancy . there is also some evidence to suggest that adult stem cells or other progenitors may give rise to new cells in the postnatal and adult pancreas ( i.e. , neogenesis ) , but this possibility remains controversial , as different laboratories have published conflicting results . here , we review recent studies , primarily in rodent models , aimed at elucidating the mechanisms and capacity for -cell regeneration , including evidence for and against adult neogenesis . early support for neogenesis arose from immunohistochemical observations , such as the presence of budding insulin - positive cells in the pancreatic duct epithelium following partial pancreatectomy [ 26 , 27 ] . however , using a pulse - chase system to label the progeny of pre - existing cells , dor et al . provided evidence that all or nearly all new cells in the adult pancreas including those generated after pancreatectomy are derived by replication of pre - existing cells . although this finding generated skepticism over the existence of neogenesis , the lineage - tracing approach that was used labeled only cell derived cells , and did not have 100% efficiency , making it impossible to completely rule out the possibility that some cells arose from other cell types . in a subsequent study , nir et al . used a transgenic mouse model to conditionally and selectively induce -cell death via doxycycline - dependent expression of diphtheria toxin . in addition to conferring cell - type specificity , this strategy also provided exquisite temporal control over both the onset and the duration of -cell ablation , and eliminates some confounding experimental variables associated with pancreatectomy , such as inflammatory responses . using this approach in combination with their lineage tracing system , nir et al . confirmed that most or all regeneration following loss of cells in mice occurs via replication . moreover , they found that commonly used immunosuppressants inhibited endogenous regeneration rates by about 80% , suggesting that alternative immunosuppressive strategies may improve outcomes for patients undergoing pancreas or islet transplantation by permitting more active endogenous replenishment mechanisms . whereas these studies focused on the pancreatectomy model , other important studies were evaluating the mechanisms responsible for rodent regeneration after pancreatic duct ligation . in 2008 , inada et al . used a cell - lineage tracing approach to determine whether ductal progenitors can give rise to cells after duct ligation in the adult pancreas . the authors of this study developed a transgenic mouse line in which the progeny of carbonic anhydrase ii - positive ductal cells expressed -galactosidase ( -gal ) . following ductal ligation , in which islets distal to the ligation site are destroyed while proximal islets are spared , about 40% of cells in the distal islets and about 12% in the nonligated islets expressed -gal , versus about 5% of cells expressing ( endogenous ) -gal in wild - type animals . together , these results suggest that carbonic anhydrase ii - positive ductal cells can give rise to cells following injury in the adult pancreas . the potential for neogenesis in the adult pancreas after duct ligation is also supported by results from xu et al . , who mapped the fate of pancreas - specific progenitor cells expressing the transcription factor neurogenin 3 ( ngn3 ) in adult mice following ductal ligation . the authors demonstrated that ngn3-positive progenitors can differentiate into cells in vitro , albeit an embryonic pancreas environment . despite the results of these carefully conducted studies that support the potential for adult neogenesis , the possibility that pancreatic progenitors give rise to cells in the adult pancreas remains highly contentious . . seems to run counter to the result demonstrated by xu et al . using ngn3-gfp mice , lee et al . showed that ngn3 is not reactivated after pancreatectomy demonstrating that ngn3 , whose expression is transiently required during pancreas development , is not required for regeneration following pancreatectomy even though substantial pancreas regrowth occurred . using a sequential pulse of dna analogues , which incorporate into dividing cells , also seem to support the concept that new murine cells arise by replication , rather than from tissue - specific progenitor cells , during normal turnover , after pancreatectomy , or other stimuli . their results in the pancreas were strengthened by the opposite finding in the intestine and hair follicle , tissues in which endogenous progenitors are well characterized . using in vivo lineage tracing strategies , investigators indelibly labeled progenitor cells expressing hepatocyte nuclear factor 1 ( hnf1 ) , muc1 , or sox9 and asked whether these cells , which give rise to cells during normal development , can give rise to cells after pancreatic injury in the adult mouse . collectively , these studies suggest that regardless of cell type , differing mechanisms exist for the origin of cells during embryogenesis versus adult life . for example , in a study published in 2009 , solar et al . traced the fate of pancreatic progenitor cells expressing the early pancreatic transcription factor hnf1. the authors found that in the embryonic mouse , hnf1-positive progenitor cells primarily give rise to ductal cells , but can also assume an acinar or endocrine fate ( including cells ) if labeled early in development . in the adult , however , hnf1-positive cells assumed a strictly ductal fate , even after ductal ligation or alloxan - induced -cell ablation , followed by treatment with the neogenesis - promoting factors egf and gastrin . kopinke and murtaugh followed the fate of cells expressing the exocrine pancreatic marker , muc1 , and found that these cells can give rise to endocrine cell types during embryogenesis but not after birth . similarly , kopp et al . followed the fate of cells expressing sox9 , which are found at the interface of small ducts and acini and had previously been shown to be capable of assuming an endocrine fate when injected into fetal pancreatic explants . the authors found that sox9-positive cells were multipotent before birth , giving rise to all types of pancreatic cells . however , in the adult , sox9 cells failed to generate endocrine cells under basal conditions or after ductal ligation , although ligation did lead to the presence of ngn3 expression in sox9-positive cells . a study from thorel et al . the authors induced diphtheria toxin - mediated apoptosis selectively in cells using a transgenic mouse system similar to the one used by nir et al . however , in this study expression of the toxin resulted in almost total ablation ( > 99% ) of cells . under these conditions , regeneration of insulin - secreting cells occurred not via -cell replication but primarily through transdifferentiation of pre - existing cells . interestingly , the resulting insulin - positive cells were also glucagon - positive , indicating that they retained at least some fundamental aspects of -cell identity . although the physiologic characteristics of these hybrid cells remain unexplored , they may prove useful in harnessing the endogenous regenerative capacity of the pancreas to achieve therapeutic outcomes . as this survey of recent studies illustrates , the cellular origins of new cells in the adult pancreas remain highly contentious . when comparing the results of these studies , it is important to consider how each study differs from the others . for example , different experimental models of pancreatic injury produce different percentages of -cell ablation , may trigger apoptotic or necrotic cell death , and may or may not be accompanied by inflammatory responses . furthermore , each study was specifically designed to test whether cells can arise from a particular cell type of interest . the key methods and findings of each of these studies table 2some recent murine models studying mechanisms of endogenous -cell regeneration in the adult pancreasreferenceablation methodcell type tracedsupports adult neogenesis?dor et al . [ 38]dtx ablation of cells ( > 99%) cellsyeskopinke and murtaugh muc1 + progenitor and adult ductal and acinar cellsnokopp et al . ductal ligationsox9 + progenitor and ductal cells including duct / centroacinar cellsnongn3 + cells became cells in an embryonic pancreas environmentdtx diphtheria toxin ; hnf1 hepatocyte nuclear factor 1 ; ngn3 neurogenin 3 some recent murine models studying mechanisms of endogenous -cell regeneration in the adult pancreas ngn3 + cells became cells in an embryonic pancreas environment dtx diphtheria toxin ; hnf1 hepatocyte nuclear factor 1 ; ngn3 neurogenin 3 finally , it must be noted that most of what is known about -cell regeneration , including all of the studies described above , comes from rodent models . because of the inherent difficulty of studying in human subjects , little is known about turnover of cells over the human life span . in a recent study , perl et al . showed that -cell turnover primarily occurs in the first three decades of human life . the authors analyzed iododeoxyuridine / bromodeoxyuridine expression in pancreas tissue from 10 deceased patients who had previously received thymidine analogues as part of a cancer - related clinical trial . cells co - labeled with analogues and insulin were only observed in patients younger than 30 years old . the authors further confirmed this finding using a recently developed dna carbon - dating technique on tissue from three cadaver donors . thus , although these findings are based on a relatively small sample sizes , it would appear that the capacity for -cell generation is extremely limited in the adult human pancreas . however , the replicative power of cells may be revealed during conditions such as pregnancy or autoimmune disease . the relatively low -cell proliferation rate under basal conditions and significantly higher replication rate under provocative conditions indicates that -cell mass is tightly regulated , yet there is substantial potential for expansion of existing cells . methods for de- and transdifferentiation of mature cell types , or now more commonly called cellular reprogramming , are likely to contribute to the future of regenerative medicine because they could facilitate restoration of cellular functions lost in disease states . in the case of diabetes , a primary focus has been on reprogramming different cell types to become glucose - responsive , insulin - secreting -like cells . there has been long - standing interest in the possibility of transforming hepatocytes into cells . liver and pancreas tissues share a common endodermal origin and hepatocytes , like cells , express glucose transporter 2 ( glut-2 ) and glucokinase , two key proteins involved in stimulus secretion coupling in the cell . however , it is well known that hepatocytes lack several important components of insulin secretion , such as enzymes that convert proinsulin to insulin . in one study , adenovirus - mediated gene transfer of the transcription factor pdx1 into mice was used to reprogram 60% of hepatocytes . the authors detected increased quantities of insulin and proinsulin in the liver and were able to show decreased blood - glucose levels in animals with diabetes induced by streptozotocin . subsequently , another study from wang et al . tried to use adeno - associated virus ( aav ) instead of adenovirus to reprogram liver cells . interestingly , the authors of this study found that aav - mediated transfer of -cell markers pdx1 or ngn3 alone failed to reduce symptoms of diabetes , but when it was coadministered with an irrelevant adenoviral vector the treatment corrected hyperglycemia and weight loss , increased blood insulin levels , and improved glucose tolerance in diabetic mice . the authors suggested that the immune response against adenovirus is required for reprogramming of hepatocytes into a -like cell fate . several other transcription factors important for -cell differentiation have also been introduced into the liver . for example , kaneto et al . showed that adenovirus transfection of mafa , pdx1 , and neurod induced production of insulin from hepatocytes and helped control blood - glucose levels in diabetic animals . the reprogrammed cells secreted c - peptide and expressed glut-2 as well as several important transcription factors present in mature cells , such as nkx2.2 , nkx6.1 , and pax4 . the cells also expressed the neuroendocrine vesicular markers scg-2 and sgne1 , as well as prohormone convertase 2 . after these cells were transplanted into streptozotocin - induced diabetic mice , the animals exhibited decreased blood - glucose levels compared with animals that received non - transformed human liver cells . although these results are promising , it remains unclear whether the cells maintain the -like phenotype for a long period of time , especially if transplanted into the liver where they could conceivably revert to a hepatocyte identity . [ 47 ] converted exocrine cells of immune - deficient mice into insulin - secreting cells though viral - mediated gene transfer of the transcription factors ngn3 , mafa , and pdx1 . this transformation partly reduced the elevated blood - glucose concentration observed following ablation of pre - existing cells with streptozotocin , but failed to fully normalize glycemia . the lack of full rescue may have been due to insufficient numbers of new insulin - secreting cells , or to a lack of organized islet structures that could respond properly to glucose stimuli . nonetheless , the transformation of cells already present in the adult pancreas to assume a -like function is an important and promising advance . in another important study illustrating cellular reprogramming to cells , collombat et al . used a cre / lox transgenic mouse system to selectively drive ectopic expression of pax4 in cells that expressed either pdx1 ( pancreatic progenitor cells ) , pax6 ( endocrine progenitor cells ) , or glucagon ( cells ) in postnatal adult mice . expression of pax4 in each of these cell types increased the number of insulin - positive cells present in the pancreas at the expense of other endocrine cell types . pax4 expression also restored normoglycemia in younger ( 4 weeks old ) mice following ablation of cells with streptozotocin , and 41% of these animals lived for 2 months . however , older ( > 4 weeks old ) animals died spontaneously and showed signs of hyperglycemia , in spite of also having increased insulin - positive cell counts . furthermore , all older animals expressing ectopic pax4 died following treatment with streptozotocin , indicating an age - restricted effect . it is unclear whether insulin - positive cells generated by ectopic pax4 expression are nonfunctional in the older animals , or whether these animals have become insensitive to insulin . nonetheless , this study provides important evidence that cells may be a useful progenitor population from which insulin - producing cells could be derived . future investigations may be directed toward achieving direct cellular reprogramming without introduction of exogenous genes and/or by specifically altering chromatin states . although considerable progress has been made in reprogramming cells toward a -like state , there remains no proven method for generating a continual source of glucose - responsive , insulin - secreting cells with long - term stability suitable for the treatment of diabetes . future challenges will include not only establishing such a source , but also making it safe for the treatment of human patients . nevertheless , the possibility of acquiring cells from a patient s own body , transforming them into a stable line of glucose - responsive , insulin - secreting -like cells , and surgically reintroducing them would likely revolutionize the treatment of diabetes . to fulfill their therapeutic potential , alternative sources of cells must meet a challenging set of requirements , such as functional maturation to clinically relevant numbers of endocrine cells , and persistent engraftment and survival , but also must satisfy safety concerns related to tumorigenicity , genetic stability , adventitious pathogens , containment , host tissue toxicity , and dosage . to begin with , solid evidence that human pancreatic precursors can mature functionally in vitro or in vivo and cure experimental diabetes in animal models is absolutely necessary , yet is currently still missing . in addition to differentiating into functional endocrine cells for the duration of experimental assays , ideally pancreatic precursors must also be capable of engrafting and surviving in vivo for extended periods of time . to this end , innovative solutions , such as controlling the size of precursor clusters by covalent microcontact printing of laminin on cell culture substrates , show promise to allow the efficient production of human uniform - size islet - like structures with optimized nutrient and oxygen access after engraftment in vivo . an additional challenge to the in vivo survival of pancreatic precursors in human patients is the susceptibility of cells to inflammation - induced cell death and the presence of autoimmune and alloimmune responses that may compromise an otherwise functional transplant . in this respect , the breakthrough of generating ips cells from human tissue [ 1 , 2 ] and differentiating them to pancreatic cell types [ 12 , 14 , 18 , 23 , 50 , 51 ] that potentially may be transplanted back to the patient from whom the ips cells were derived for -cell replacement holds a significant therapeutic promise for circumventing allogeneic immune responses that es - derived precursors might otherwise elicit . a proof of concept of using ips cell progeny in curing diabetes has been recently reported in a mouse system . derived ips cells from murine skin fibroblasts and differentiated them into insulin - secreting -like cells in vitro that responded to glucose stimulation under physiologic or pathologic conditions . these insulin - secreting -like cells were transplanted via intraportal vein injection into the livers of two different mice lines modeling type 1 and type 2 diabetes . although cells engrafted and subsequently corrected hyperglycemia in both models , the insulin - deficient model that was used was not an autoimmune model . in fact , studies testing the efficacy of syngeneic ips cells in autoimmune diabetes models in vivo or alternatively testing the susceptibility of type 1 diabetic human ips cells to autoimmune destruction in vitro have yet to be reported . nonetheless , whether ips cell - derived cells would be destroyed upon transplantation into subjects with type 1 diabetes is an important clinical issue as some past human experiments might predict . in these cases , pancreatic grafts from a nondiabetic twin pathologic evaluation of these pancreas transplants , which failed early post - transplant , exhibited classic insulitis and patients reverted to hyperglycemia , whereas nonpancreatic grafts would normally be accepted between these twin siblings . a similar pancreas transplant that was subsequently performed with low - dose immunosuppression succeeded long term . based on these data , the possibility exists that destruction of any autologous -cell population , be it derived from ips cells in vitro , induced by reprogramming , or by endogenous regeneration , when placed in an autoimmune environment , may occur and will thus need to be formally tested . with the rapid advance of preclinical research on new sources of cells for cell - replacement therapies , for instance , one of the principal unique aspects of using es or ips cells as alternative sources of cells is the need to thwart the teratogenic potential that transplantation of nonpurified stem cell derived populations might hold . moreover , recent studies on numerous human ips cell lines reprogrammed using a variety of methods showed that ips cells may harbor protein - coding point mutations , which could have arisen in the original donor tissue or resulted from reprogramming [ 55 , 56 ] as well as an assortment of epigenetic mark abnormalities , all adding to a possible increase in their tumorigenic potential . one prospective solution to these challenges is the sorting of target precursors from heterogeneous populations based on surface molecules associated with differentiation . newly described cd141 and cd238 surface markers allowed for higher efficiency of human definitive endoderm generation by cell enrichment and similarly , selection of cd326- ( i.e. , epithelial cell adhesion molecule ) or cd24 -expressing cells resulted in higher yields of pancreatic endoderm cells , while significantly diminishing the teratogenic / tumorigenic cell numbers allowing for safer transplantation [ 58 , 59 ] . as an alternative , bioengineering innovations such as encapsulation devices that permit molecular diffusion while preventing precursor cell escape or immune cell penetration are currently being considered . a new level of translational complexity is introduced by reprogramming protocols . in addition to future efficacy and scalability tests that would need to be done in humans , safety concerns arise related to various gene delivery systems . even though a cellular reprogramming clinical trial would likely be approached with caution , such an approach holds significant potential to materialize into relevant therapies while nongenetic means of reprogramming are actively being investigated . altogether , there is significant evidence in recent literature surveys that innovative resources and sophisticated new methodologies are actively being applied to address many of the challenges that translational integration of alternative -cells sources currently face . society s ability to ultimately confront the dramatic increase in diabetes prevalence worldwide and the limitations of existing therapeutic options will largely depend on the aggressiveness to which research pursues developing alternative sources of cells . whether new cells are derived from human pluripotent stem cells in vitro and transplanted , or generated in vivo by either reprogramming adult cells or regenerating precursors , these therapies offer tremendous advantage over islet or pancreas transplantation by virtue of their renewal potential , ample supply , syngeneic source , ability to be quality control tested , and capacity for cell number control through homeostatic regulation . with these beneficial attributes comes the need to control the outcome of their differentiation to achieve the desired functional endocrine maturity in addition to finding ways to overcome autoimmunity . collaborative multidisciplinary research bringing together the fields of autoimmunity , tolerance , encapsulation , biomaterials , stem cells , and developmental biology will undoubtedly furnish future therapeutic opportunities .
dna damage tolerance enables a cell to resolve replication problems such as damage - induced fork stalling ( lawrence , 1994 ; lehmann , 2002 ; ulrich , 2005 ) . replicative bypass of dna lesions occurs via translesion synthesis ( tls ) by specialized damage - tolerant dna polymerases or by an error - free damage avoidance pathway that makes use of the information of the newly synthesized sister chromatid ( lawrence , 1994 ) . both pathways are activated by posttranslational modification of the replicative sliding clamp , proliferating cell nuclear antigen ( pcna ) ( hoege et al . , 2002 ; kannouche et al . , 2004 ; stelter and ulrich , 2003 ; watanabe et al . , 2004 ) . in response to dna damage , monoubiquitylation of pcna at a conserved lysine , k164 , activates the damage - tolerant polymerases for tls , whereas polyubiquitylation is required for error - free damage avoidance . independent of dna damage , budding yeast pcna is also modified during s phase by the ubiquitin - like protein sumo ( papouli et al . , 2005 pcna monoubiquitylation involves the ubiquitin - conjugating enzyme ( e2 ) rad6 and its cognate ubiquitin ligase ( e3 ) , rad18 . a second e2-e3 pair , although it promotes resistance to genotoxic agents , tls is a potentially mutagenic process that endangers the cell 's genomic stability . at the same time , failure to reactivate stalled replication forks may lead to genome instability by inducing dna double - strand breaks ( dsbs ) and gross chromosomal aberrations ( branzei and foiani , 2005 ) . stringent control over dna damage bypass is therefore essential , but the upstream signals that activate pcna modification in vivo are not well defined . one of the important regulatory mechanisms responsible for the sensing of dna damage and replication stress is the replication - dependent s phase checkpoint , a surveillance system that inhibits the firing of late - replication origins , prevents cell - cycle progression to mitosis , and is important for the stabilization of stalled replication forks ( branzei and foiani , 2005 ; nyberg et al . , 2002 ) . the atr - atrip kinase complex and the pcna - like 9 - 1 - 1 checkpoint clamp , responsible for initiating the checkpoint signaling cascade during s phase , are activated by replication fork stalling . their recruitment to stretches of single - stranded ( ss)dna is mediated by interactions of atrip and the 9 - 1 - 1-specific clamp loader with the ssdna - binding rpa complex ( zou and elledge , 2003 ; zou et al . , our analysis of the mechanisms that control the activity of the rad6 pathway in budding yeast now reveals striking parallels to the replication checkpoint response : although the two systems operate independently , they are activated in a similar fashion by stalled replication intermediates that involve an accumulation of ssdna . we show that yeast and human rad18 , like atrip and the 9 - 1 - 1 clamp loader , directly interact with the rpa complex . in vivo , the abundance of rad18 on dna mirrors that of rpa even in the absence of its physiological target , pcna , and depletion of rpa prevents damage - induced pcna ubiquitylation in s phase . in vitro in order to characterize the conditions required for pcna ubiquitylation in s. cerevisiae , we examined possible contributions of the dna damage checkpoint and cell - cycle regulation . we found that , in budding yeast , as in x. laevis egg extracts and in s. pombe ( chang et al . , 2006 ; frampton et al . , 2006 ) , ubiquitin - dependent dna damage tolerance and checkpoint signaling operate independently ( see figure s1 available online ) . given the importance of ubiquitylated pcna for replicative lesion bypass in fact , consistent with our previous findings ( papouli et al . , 2005 ) and with the situation in mammalian cells ( kannouche et al . , 2004 ) , arrest in s phase with hydroxyurea ( hu ) , which causes replication fork stalling by nucleotide depletion without directly damaging dna , is sufficient to trigger pcna modification ( figure 1a ) . in contrast , ubiquitylated pcna was not detected in g1- or g2-arrested cells even after treatment with dna - damaging agents . this indicates that , even in asynchronous populations , all detectable pcna ubiquitylation arises from s phase cells . the absence of ubiquitylated pcna outside of s phase could be due to the lack of replication forks . alternatively , the physiological state of the cell , defined by the activities of cyclin - dependent kinases , could control pcna modification . in order to directly examine the need for dna replication , we made use of a temperature - sensitive mutant of an essential kinase gene responsible for dna replication initiation , cdc7 ( figure 2 ) ( hartwell , 1973 ) . at the permissive temperature , cdc7 cells undergo regular cycles of dna replication and cell division , whereas upon release from g1 arrest at the restrictive temperature , the mutant enters the cell cycle without initiating dna replication ( figure 2b ) . degradation of the cdk inhibitor sic1 at the beginning of s phase and later on the accumulation of the mitotic cyclin clb2 proceeds normally in cdc7 cells ( figure 2c ) , indicating that the physiological state under these conditions resembles a passage through the cell cycle . following the scheme outlined in figure 2a , we asked whether dna damage would trigger pcna modification in the mutant . we found that wt cells underwent pcna ubiquitylation normally at 24c and 37c , but in cdc7 the modification was visible only at the permissive temperature ( figure 2d ) . in order to exclude the possibility that the kinase activity of cdc7 itself was needed for the modification , we examined a strain in which the requirement for cdc7 is bypassed by a mutation in mcm5 , encoding a subunit of the replicative helicase ( hardy et al . , 1997 ) . in the context of this allele , bob1 , deletion of cdc7 did not abolish pcna ubiquitylation , implying that the cdc7 kinase itself is dispensable for modification of the clamp ( figure 2e ) . this suggests that pcna needs to be engaged in replication for efficient ubiquitylation in vivo . in addition to uv radiation and methyl methane sulfonate ( mms ) , which induce ubiquitylation in all species examined so far , agents that cause bulky adducts such as 4-nitroquinoline oxide ( nqo ) and also the oxidizing agent hydrogen peroxide ( h2o2 ) were found to be active ( figure 3a ) . as observed in s. pombe ( frampton et al . , 2006 ) , pcna was also ubiquitylated after treatment with ionizing radiation ( ir ) ( figure 3a ) , despite our previous finding that pcna ubiquitylation site mutants are not particularly sensitive to ir , and dsbs induced by an endonuclease do not cause pcna modification ( chen et al . , 2005 ) . moreover , mammalian cells do not ubiquitylate pcna after ir treatment ( kannouche et al . , a possible explanation for the ir - induced modification of s. cerevisiae and s. pombe pcna may therefore be base damage associated with the high doses of radiation used in the yeast system rather than dsbs per se . to further explore this hypothesis , we analyzed the response to chemicals that cause dsbs by different mechanisms . bleomycin , which acts independently of the cell - cycle phase , did not trigger pcna modification ( figure 3a ) , although it affected viability ( figure 3b ) . camptothecin ( cpt ) , a topoisomerase i inhibitor , induces covalent adducts of the enzyme to dna , which are converted to dsbs in s phase through collisions with replication forks ( liu et al . , 2000 ) . despite its s phase - specific action , cpt treatment did not result in pcna ubiquitylation ( figure 3a ) . in order to exclude the possibility that the drug had simply no effect at the concentrations used in this experiment , we examined pcna modifications in a rad52 mutant , which is highly sensitive to cpt ( figure 3c ) . again , we did not observe pcna ubiquitylation in response to cpt in rad52 , whereas its reaction to mms was comparable to that of wt cells ( figure 3d ) . likewise , cpt induces pcna modifications very modestly in s. pombe when compared to hu or uv ( frampton et al . , 2006 ) , and the drug is also a poor inducer of the replication checkpoint in budding yeast ( redon et al . , 2003 ) ( figure 3e ) . replication fork stalling by treatment with hu or adduct - forming agents like mms results in an inhibition of dna polymerases and an accumulation of ssdna due to the continuing movement of the replicative helicase ( branzei and foiani , 2005 ) . in contrast , collision of the replication machinery with cpt - induced topoisomerase adducts and dsb formation is expected to affect the entire replicon and should therefore not initially involve an accumulation of ssdna . in support of this model , radioactive labeling of nondenatured total dna by random priming was significantly enhanced after mms or hu , but not after cpt treatment ( figure 3f ) . this even applied to the checkpoint - defective rad53 mutant , which is known to accumulate ssdna in response to replication stress ( sogo et al . , 2002 ) . in rad52 cells , the difference was less pronounced , but we can not rule out a replication - independent effect of the mutation for example , on formation or resection of dsbs that would have no consequences for pcna modification . given that the ubiquitin ligases , rad18 and rad5 , are ssdna - binding proteins , they might directly recognize a blocked fork by associating with the stretches of ssdna adjacent to the stalled polymerase - pcna complex . if these enzymes are limiting factors in transmitting the signal for modification , changes in their abundance should affect the extent of modification . we therefore analyzed the consequences of overexpressing rad18 , encoding the e3 responsible for pcna monoubiquitylation . figure 1b shows that overexpression of rad18 caused significantly increased levels of ubiquitylated pcna . in asynchronous populations , rad18 overexpression resulted in constitutive modification of pcna even in undamaged cells , suggesting that fork stalling was no longer required . likewise , the modification was no longer restricted to s phase , as ubiquitylated pcna now appeared in g1- and g2-arrested cells . outside of s phase , taken together , elevated levels of rad18 afforded pcna ubiquitylation whenever the clamp was detectable in association with chromatin ( figure s2 ) , strongly suggesting that the modification takes place on dna . consistent with this notion , loading of pcna onto dna was shown to be required for efficient modification in vitro ( garg and burgers , 2005 ) . our findings suggest that pcna ubiquitylation is induced by the recruitment of rad18 to regions of ssdna exposed by the uncoupling of helicase movement from dna synthesis , analogous to the way in which stalled forks are believed to activate the replication checkpoint ( branzei and foiani , 2005 ) . considering that the factor responsible for recruitment of the atr kinase complex and the 9 - 1 - 1 clamp loader is not naked ssdna but rather ssdna coated by the ssdna - binding rpa complex ( zou and elledge , 2003 ; zou et al . , 2003 ) the rfa1-t11 mutant ( k45e ) , defective in homologous recombination and recruitment of checkpoint factors ( umezu et al . , 1998 ; zou and elledge , 2003 ; zou et al . , 2003 ) , was competent in damage - induced pcna ubiquitylation ( figure 4a ) . likewise , a temperature - sensitive mutant , rfa1-t33 ( s373p ) , which is unable to mediate dna replication at the restrictive temperature ( umezu et al . , 1998 ) , ubiquitylated pcna normally . however , even at the restrictive temperature , the mutant protein was found in association with dna ( figure 4b ) , which leaves the possibility that it was still able to promote the recruitment or activation of rad18 . a panel of rfa2 and rfa3 mutants defective in various aspects of dna replication and repair ( maniar et al . , 1997 ) had relatively minor effects on pcna ubiquitylation ( figure s3 ) . we therefore examined the consequences of depleting rfa1 by means of a heat - inducible degradation signal ( dohmen et al . , 1994 ) . following the procedure outlined in figure 4c , we induced degradation of the rfa1 protein in g1-arrested cells . the rfa1-td mutant engaged in dna replication ( figure 4d ) with less than 5% of the rfa1 protein remaining , but in contrast , s phase - associated sumoylation of pcna , which likewise depends on dna replication ( our unpublished results ) , was not impaired ( figure 4e ) , implying that the lack of ubiquitylation is not due to a general failure to modify pcna . in addition , comparable amounts of pcna were chromatin - associated in wt and rfa1-td ( figure 4f ) , suggesting that replication forks remain largely intact when rfa1 levels are seriously reduced . these findings indicate that rpa is required for damage - dependent ubiquitylation of pcna during s phase , independent of its function in dna replication , recombination , and the recruitment of checkpoint factors . we asked whether rpa contributes directly to the recruitment of the ubiquitylation machinery to stalled replication intermediates by examining possible interactions between rad18 , rad5 , and the rpa subunits . in the two - hybrid system , we observed an interaction of rad18 , but not of rad5 , with the subunits rfa1 and rfa2 in addition to mutual interactions among the three rpa subunits ( figure 5a ) . in order to exclude indirect effects , we examined the interaction of recombinant yeast rad6-rad18 complex ( figure 5b ) with rpa immobilized on sepharose beads . purified rad18 was retained on the beads in the presence of a nuclease , indicating that the interaction was direct and not mediated by dna or other cellular factors ( figure 5c ) . analysis of truncations and mutations of rad18 in the two - hybrid system revealed that an n - terminal portion of rad18 , including the ring domain , is sufficient for interaction , whereas the central zinc finger and a dna - binding sap domain ( notenboom et al . , 2007 ) are irrelevant ( figure 5d ) . within rfa1 , we mapped the interaction site to the central region spanning amino acids 167452 ( figure 5e ) , which comprises the primary ssdna - binding motifs of rpa . this interaction , as well as the association between rad18 and rfa2 , was confirmed in vitro using recombinant constructs rfa1(182421 ) , rfa2 , and rad18 ( figure 5f ) . thus , both subunits , rfa1 and rfa2 , contribute independently to the interaction with the e3 . coimmunoprecipitations from strains bearing epitope - tagged rad18 and rfa1 in their native contexts confirmed the association of rad18 with rpa in vivo ( figure 5 g ) . the interaction did not vary measurably between damaged and undamaged cells ( data not shown ) . considering the conservation of pcna modification in eukaryotes upon transfection with an expression construct for flag - tagged human rad18 , isolation of hrad18 indeed resulted in copurification of endogenous hrpa both from the cytoplasmic and the chromatin - associated fraction ( figure 5h ) . addition of nuclease did not abolish the interactions in yeast or mammalian extracts ( data not shown ) , indicating that they are primarily mediated by protein - protein contacts . these observations raised the question of whether rad18 is recruited to ssdna by means of its interaction with rpa . chromatin immunoprecipitations ( chips ) from yeast cells bearing a rad18 allele provided evidence for association of rad18 with chromatin in vivo . in hu - treated cells , rad18 , like rpa and pcna ( papouli et al . , 2005 ) , was detectable at replication forks in the vicinity of a replication origin ( figure 6a ) . in order to exclude the possibility that the presence of rad18 at this site was merely due to its interaction with pcna , we analyzed the chromatin association of rad18 at stretches of ssdna that result from the resection of a dsb induced by the ho endonuclease ( lee et al . , 1998 ) . in this context , rpa initially associates with sequences adjacent to the break but is displaced by the recombinogenic rad51 filament in a rad52-dependent manner ( wang and haber , 2004 ) ( figure 6b ) . although pcna is easily detectable at replication forks by chip ( papouli et al . , 2005 ) , the protein was absent from the dsb ( figure 6c ) . we had previously failed to observe significant rad18 association by chip using multiplex pcr ( chen et al . , 2005 ) ; however , with a more sensitive real - time pcr method , we were able to detect a 2-fold enrichment after induction of the ho endonuclease ( figure 6d ) . this small but reproducible signal is likely to be significant , as it was abolished in an mre11 mutant , in which ssdna forms more slowly ( lee et al . , importantly , inhibition of rad51 filament formation by deletion of rad52 resulted in strongly enhanced association of rad18 ( figure 6d ) , consistent with elevated rpa levels on the ssdna in this mutant ( wang and haber , 2004 ) ( figure 6b ) . thus , the amount of rad18 on ssdna correlates with that of rpa even where pcna is not present . to gain insight into how rpa might associate with rad18 on ssdna , we examined the effect of rpa on the dna binding of rad18 to an immobilized 75 nt oligonucleotide in vitro . at 250 mm sodium chloride , binding of rad18 by itself was undetectable , but increasing levels of rpa afforded a robust and rpa - specific enrichment of the e3 in the bound material , indicating that rpa recruits rad18 to ssdna ( figure 7a ) . surprisingly , under low - salt conditions , rad18 alone associated with the oligonucleotide , and rpa now caused a reduction in the amount of bound rad18 ( figure 7b ) . however , comparable quantities of the bacterial ssdna - binding protein , ssb , competed much more effectively with rad18 than rpa , indicating that , even at low ionic strength , rpa and the e3 can occupy a common stretch of dna . in order to assess in a simplified system whether rpa can simultaneously interact with ssdna and rad18 , we examined the interaction of the e3 with rfa1(182421 ) in the presence of short oligonucleotides with no measurable affinity for rad18 ( data not shown ) and varying affinities for rfa1 ( fanning et al . , 2006 ) ( figure s5 ) . we found that ssdna prebound to rfa1 enhanced retention of rad18 , suggesting that rfa1 in its dna - bound conformation interacts with rad18 better than free in solution ( figure 7c ) . an interaction of rpa with rad18 not involving dna binding of rad18 itself thus appears possible . yet , the rad18 sap domain , responsible for dna binding of the human protein ( notenboom et al . , 2007 ) , was previously shown to be involved in the assembly of the e3 at replication foci ( nakajima et al . , inactivation of this domain in yeast rad18 abolished its function in vivo , as judged by pcna modification and dna damage sensitivity ( figures 7c and 7d ) , despite the ability of the mutants to autoubiquitylate in vitro ( data not shown ) . hence , dna binding by rad18 itself also appears to be important for its activity toward pcna . rpa has been implicated in virtually all eukaryotic dna transactions ( fanning et al . , 2006 ; zou et al . , its stabilizing effect on ssdna is essential for replication , recombination , and nucleotide excision repair , but the complex engages in dna metabolism even more directly by means of protein - protein interactions , for example with dna polymerase /primase or the recombination protein rad52 . during s phase , rpa - coated ssdna signals replication stress by recruiting the pcna - like 9 - 1 - 1 clamp and the atr / atrip checkpoint kinase complex to sites where polymerase stalling has resulted in exposure of extended stretches of ssdna ( zou and elledge , 2003 ; zou et al . , 2003 ) . our findings now point to an even more general role of rpa in dealing with replication problems that appears to be conserved from yeast to mammals . loss of pcna ubiquitylation upon depletion of rfa1 implicates rpa in the activation of the rad6 pathway , suggesting that the complex is responsible not only for the sensing of damaged dna and the stabilization of stalled forks but also for initiating the steps necessary to overcome the damage that caused the arrest . our results indicate that the requirements of rpa for replication and recombination are genetically and physically separable from its role in dna damage bypass . identification of rpa - covered ssdna as an upstream signal for the rad6 pathway explains a large body of circumstantial evidence defining the conditions that induce pcna ubiquitylation . although experiments with synchronized cells suggest that dna damage causes pcna ubiquitylation primarily during s phase , the cell - cycle stage itself is irrelevant for the modification : on one hand , a replication initiation defect abolishes pcna ubiquitylation under conditions that physiologically resemble s phase . on the other hand , the reaction can be triggered in g1 by stalled replication intermediates resulting from the processing of dna interstrand crosslinks ( sarkar et al . , 2006 ) . hence , stalled replication intermediates appear to be both necessary and sufficient for activation of pcna ubiquitylation . a need for ssdna at the sites of stalled replication intermediates is implied by our inability to detect pcna modification in response to dsb - inducing agents that do not cause base damage . even cpt , which induces strand breaks in a replication - dependent manner and stalls replication forks , did not result in pcna ubiquitylation , consistent with our finding that this drug does not cause accumulation of ssdna . by similar reasoning , uncoupling between polymerase and helicase has been suggested to activate damage bypass in x. laevis egg extracts ( chang et al . , 2006 ) . elevated levels of rad18 can overcome the requirement for fork stalling and promote ubiquitylation of pcna whenever the clamp is associated with dna ( figure 1b ) . this suggests that the e3 is rate limiting for the reaction , and higher concentrations will drive ubiquitylation at shorter or more transient stretches of ssdna during undisturbed replication . constitutive modification of pcna , as observed in s. pombe and in x. laevis egg extracts ( frampton et al . , 2006 ; leach and michael , 2005 ) , might therefore be caused by a higher expression level or a lower activation threshold of rad18 in these systems . a higher incidence of spontaneous fork stalling or intrinsic damage might have the same effect . finally , a placement of rpa - covered ssdna upstream of pcna ubiquitylation explains the similarities between the signals for modification of the clamp and those that elicit the replication - dependent s phase checkpoint ( branzei and foiani , 2005 ) . given that the domains required for the recruitment of the checkpoint factors and for interaction with rad18 are distinct , the two pathways damage sensing and damage bypass appear to originate independently from a common structure . intriguingly , a reduction in pcna ubiquitylation has been reported in mammalian cells upon sirna - mediated downregulation of atr ( bi et al . , 2006 ) . hence , while damage tolerance is clearly independent of checkpoint function in s. cerevisiae ( figure s1 ) , s. pombe , and x. laevis ( chang et al . , 2006 ; frampton et al . , 2006 ) , an indirect contribution of the kinase in the mammalian system remains possible . rpa is well known for a complicated dna - binding behavior that involves several distinct binding modes and varies considerably with ionic strength ( fanning et al . , 2006 ) . interactions with other cellular factors may involve either one or multiple of its subunits , and these interactions often induce conformational changes of rpa . recruitment of other proteins by rpa can involve cooperative binding but also a trading of places whereby a replication or repair factor would replace the rpa domains in a stepwise manner ( fanning et al . , 2006 ) . our in vitro experiments reveal that both protein - protein and protein - dna interactions are likely to contribute to the recruitment of rad18 to ssdna . in particular , we found that the affinity of rad18 for ssdna and rpa strongly depends on ionic strength . while modulation of the reaction buffer imposes rather artificial conditions on the rpa - rad18-ssdna interaction , our experiments have nevertheless revealed two patterns that might explain in principle how the two proteins can interact on dna : at low ionic strength , rad18 exhibits detectable affinity for ssdna by itself but does not engage in cooperative interactions with rpa . in physiological salt conditions , however , rpa is clearly necessary for recruitment of rad18 to ssdna , and interaction of rad18 with the dna - binding domain of rfa1 is enhanced when the latter is bound to ssdna ( figure 7 ) . whether the association in vivo relies solely on protein - protein interactions or whether rpa and rad18 bind cooperatively to the dna needs to be determined . a change between the two interaction modes during recruitment of rad18 would explain the requirement of both rpa and the rad18 sap domain for pcna ubiquitylation . however , the sap domain may also have other functions in addition to dna binding . the physical interactions between rpa and rad18 , detectable in yeast and mammalian cells , suggest that rpa recruits rad18 to ssdna by direct association . in the context of a stalled replication fork , for example , interaction of the e3 with its target , pcna , might affect its dna - binding properties . alternatively , rad18 might undergo a conformational change upon dna binding that would in turn modulate its interactions with pcna , rpa , or rad5 . notably , c - terminal truncations of rad18 excluding the dna - binding sap domain consistently exhibit stronger interaction signals than the full - length protein in two - hybrid assays ( figure 5d ) ( ulrich and jentsch , 2000 ) , possibly indicating an inhibitory function of the c - terminal domain that might be relieved by dna binding . further biochemical studies and isolation of selectively interaction - deficient mutants of both rad18 and rpa will be necessary to define the molecular mechanism by which rpa targets rad18 to its sites of action . however , the presence of rad18 at ssdna in vivo correlates with that of rpa even in the absence of its ubiquitylation target , pcna . association of the e3 with ho - induced dsbs might therefore suggest additional , pcna - independent functions . consistent with this notion , yeast rad18 , but not ubiquitylation - deficient pcna mutants , are highly sensitive to ir ( chen et al . 2001 ) , and the phenotypes of vertebrate rad18 cells have implicated the e3 in the repair of dna - strand breaks and recombination ( shiomi et al . , 2007 ; szuts et al . , however , the relevant ubiquitylation targets as well as possible contributions of the rpa complex to these alternative functions remain to be identified . standard procedures were followed for the cultivation of yeast . mutants in rad18 , rad53 , and rad52 as well as pol30 and rad18 have been described previously ( stelter and ulrich , 2003 ; ulrich and jentsch , 2000 ) , and other epitope - marked alleles were created in the same background . the cdc7 allele was transferred into pol30 by cloning of the open reading frame with flanking regions into a ura3 plasmid , integration into the cdc7 locus , selection for loss of the marker , and screening for temperature - sensitive growth . mutants bob1 , bob1 cdc7 , and an isogenic wt ( hardy et al . , 1997 ) were modified by introduction of pol30 . chip experiments at ho - induced dsbs were performed in the background of jkm179 ( lee et al . , 1998 ) . the rfa1-t11 strain was generated in pol30 by direct replacement of the wt allele with a ura3-marked construct . experiments involving rfa1-t33 were performed in the s288c background by introduction of pol30 into isogenic rfa1 and rfa1-t33 strains ( umezu et al . , 1998 ) . the rfa1-td strain carries the degron allele ( dohmen et al . , 1994 ) under control of a dual tetracycline - repressible promoter system ( belli et al . , wt carry an integrative plasmid expressing ubr1 under control of the gal1 promoter and the pol30 allele in addition to endogenous pol30 . for complementation of rad18 with wt , sap ( amino acids 279312 ) , or sap ( g299a , r301a , m304a ) , we used integrative vectors carrying the respective alleles under control of the rad18 promoter . strains with a bar1 deletion were used for experiments involving g1 synchronization , except for those used in figure 4 . rabbit polyclonal antibodies were obtained from s. brill ( rfa1 ) , j. diffley ( sic1 , rad53 , orc6 ) , or s. west ( hrpa ) ; purchased from santa cruz biotechnology ( clb2 , myc , ha ) or abcam ( hrad18 ) ; or generated for our lab ( pcna , rad18 ) ; monoclonals were from molecular probes ( pgk ) , sigma ( flag ) , cell signaling technology ( ubiquitin , p4d1 ) or cancer research uk ( myc , 9e10 ; ha , 12ca5 ) . strains bearing the pol30 allele were subjected to the desired treatment and processed for isolation of pcna by ni - nta pull - downs under denaturing conditions followed by detection of pcna and ubiquitin as described previously ( hoege et al . , 2002 ; stelter and ulrich , 2003 ) . responses to dna damage were analyzed by treatment with hu , mms , nqo , bleo , cpt , or h2o2 in liquid ypd medium for 90 min . for uv irradiation , exponentially growing cultures were plated onto solid ypd medium , irradiated at 254 nm ( uv stratalinker 2400 , stratagene ) , resuspended in fresh medium , and incubated for 40 min prior to analysis . cell - cycle arrests in g1 , s , and g2 were achieved by treatment with factor ( 10 ng / ml ) , hu ( 100 mm ) , or nocodazole ( 15 g / ml ) , respectively , and monitored by propidium iodide staining and flow cytometry . cells were pregrown in raffinose medium at 25c and blocked in g1 with 5 g / ml factor for 3 hr . after exchange into galactose medium with 100 g / ml doxycyclin and factor and incubation for 1 hr , the temperature was raised to 37c , and incubation was continued for 2 hr . after returning the cultures to 25c and addition of more factor ( 2 g / ml ) , cells were incubated for another 2 hr before being released into s phase by washing in galactose / doxycyclin medium . control cultures were blocked in g1 and kept in raffinose medium at 25c for 3 hr before release in raffinose medium . sensitivities to bleo , cpt , nqo , and mms were analyzed by spot assays on ypd plates containing the indicated concentrations of damaging agents as described previously ( stelter and ulrich , 2003 ) . phosphorylation of rad53 was followed by preparation of total cell extracts under denaturing conditions and western blotting . protein - protein interactions were monitored in the reporter strain pj69 - 4a as described previously ( ulrich and jentsch , 2000 ) by using constructs based on fusions to the gal4 activation and dna - binding domains . constructs for full - length rad18 and rad5 have been described ( ulrich and jentsch , 2000 ) . the rfa1 , rfa2 , and rfa3 open reading frames were amplified by pcr from genomic dna . total cell extracts were prepared from yeast strains expressing rfa1 and/or rad18 by lysis with zirconium / silica beads in 50 mm tris - hcl ( ph 7.5 ) , 250 mm kcl , 20% glycerol , 1% np40 , 2 mm dtt , and protease inhibitors . immunoprecipitations were performed from 6 10 cells ( 4 mg total protein ) by incubation with 35 g antibody for 2 hr , addition of 20 l protein g agarose ( roche ) , and further incubation for 1 hr followed by washing five times with lysis buffer and once with the same buffer containing no detergent . t cells were transiently transfected with a construct encoding flag - tagged human rad18 ( mulder et al . , 2002 ) . after 3 days , cell extracts were prepared from one 90 mm plate per immunoprecipitation in 50 mm tris - hcl ( ph 7.5 ) , 25 mm nacl , 1.05 mm sucrose , 3 mm mgcl2 , 1 mm egta , 0.5% np40 , and protease inhibitors . soluble material was recovered by centrifugation at 2000 rpm for 5 min . the pellet was washed twice with lysis buffer and extracted with 50 mm tris - hcl ( ph 7.5 ) , 125 mm nacl , 1 mm edta , 0.5% np40 , and protease inhibitors for 30 min on ice to yield the detergent - insoluble chromatin fraction . both extracts were centrifuged at 13,000 rpm for 15 min , and the lysates were precleared with protein g agarose for 1 hr . immunoprecipitations were performed with 20 l anti - flag agarose ( sigma ) for 3 hr . the beads were washed four times with 50 mm tris - hcl ( ph 7.5 ) , 200 mm nacl , 1% np40 , and protease inhibitors and twice with the same buffer without np40 . chip assays at replication forks were performed as described previously ( papouli et al . , 2005 ) . a full description of the assay conditions for chip at ho - induced dsbs ( chen et al . , fractionation of total cell extracts prepared by spheroplast lysis into soluble and chromatin - bound fractions was achieved by centrifugation through a sucrose cushion essentially as described ( liang and stillman , 1997 ) . after the desired treatment of exponential cultures , genomic dna was isolated from 5 10 cells with the dneasy blood & tissue kit ( qiagen ) according to the manufacturer 's instructions . klenow enzyme ( 0.5 u ) with 0.5 l hexanucleotide mix ( roche ) , 7.5 ci p - dctp , and 5 mm each of cold datp , dgtp , and dttp were used in 5 l random - primed labeling reactions on 100 ng of nondenatured dna for 16 hr at room temperature ( rt ) . aliquots of 2 l spotted in duplicate on nitrocellulose were quantified by phosphorimaging . a correction factor for the exact amount of input dna was determined by real - time pcr quantification of the template with primers specific for the pac2 gene ( 5-aataacgaattgagctatgacaccaa-3 and 5-agcttactcatatcgatttcatacgactt-3 ) . yeast rpa was purified from e. coli as described ( sibenaller et al . , 1998 ) . the expression constructs for rfa1(181422 ) and rfa2 were generated in pgex-4t-3 ( ge healthcare ) ; the proteins were produced in e. coli and purified by affinity chromatography on glutathione sepharose . expression constructs for yeast rad18 and untagged rad6 were generated in the vector pfastbac ( invitrogen ) . the proteins were produced in sf9 insect cells and purified as a complex from cytoplasmic extracts on ni - nta agarose . interaction of rad18 with rpa in the absence of dna was examined by covalent coupling of yeast rpa to activated ch sepharose 4b ( at 2.5 g / ml ) and monitoring retention of rad18 in 50 mm tris - hcl ( ph 7.5 ) , 100 mm nacl , 5 mm mgcl2 , 0.05% triton x-100 , and 2.5 u benzonase ( novagen ) . beads ( 20 l ) were incubated with 2 pmol rad18 for 2 hr at 4c and washed five times with the same buffer containing 250 mm nacl . interaction of rad18 with rfa1(182421 ) or rfa2 was assayed by immobilizing 0.5 nmol fusion protein on glutathione sepharose for 30 min at 4c , followed by a brief wash in a buffer containing 50 mm tris - hcl ( ph 7.5 ) , 50 mm nacl , 1 mm edta , and 0.05% triton x-100 . rad18 ( 10 pmol ) was added in the same buffer containing 100 g / ml bsa and incubated for 60 min at 4c . beads were washed five times in buffer without bsa , and bound material was eluted as above and analyzed by western blotting and coomassie blue staining . where indicated , gst or rfa1(182421 ) was incubated with a 1 or 5 molar excess of oligo - dt ( 10 , 16 , or 35 nt ) for 45 min before binding to the beads . binding of rad18 to rpa - covered ssdna was examined by immobilizing a 75 nt , 5-biotinylated oligonucleotide of mixed sequence on streptavidin agarose ( pierce ) in phosphate - buffered saline ( pbs ) with 1 mm edta for 1 hr at rt . after washing three times in pbs with 1 mm edta and three times in binding buffer ( 25 mm hepes - naoh [ ph 7.5 ] , 15 mm kcl , 1 mm edta , 0.05% triton x-100 , 0.5 mm dtt , 100 g / ml bsa , supplemented with 150 or 250 mm nacl for high - salt conditions ) , 15 l beads per reaction ( 5 pmol of the oligonucleotide ) were incubated with increasing amounts of purified yeast rpa or bacterial ssb ( 2.4 , 8 , and 24 pmol ) for 30 min at 4c . incubation was continued for 1 hr at 4c , and the beads were washed three times with high - salt binding buffer and twice with the same buffer containing no bsa . bound material was eluted as above and detected by western blotting . for rpa blots , equal fractions of input and bound material were loaded . for rad18 blots , 1% of the input and 35% of the bound material were loaded .
dapagliflozin , a member of sodium - glucose cotransporter-2 ( sglt2 ) inhibitors family , exhibits glucose - lowering effect in patients with t2 dm [ 1 , 2 ] . treatment with dapagliflozin has been shown to improve glycemic control and reduce body weight and systolic blood pressure ( sbp ) [ 38 ] without increase in hypoglycemia . studies verified that the dapagliflozin is well tolerated and associated with sustained reductions in hba1c , sbp , and body weight over 24 years in patients with t2 dm [ 9 , 10 ] . in older patients with longstanding t2 dm , dapagliflozin is also well tolerated and achieved improvement of glycemic control without an increase of hypoglycemic episodes . however , the clinical efficacy and tolerability need full elucidation in older patients with comorbidity . we recently observed that dapagliflozin may confer reduced atrial natriuretic peptide levels and improved glycemic control in patients with newly diagnosed t2 dm , which may benefit the cardiovascular system . dapagliflozin , reduced by hyperglycemia , body weight , and sbp , effectively addressed three cerebrovascular disease ( cvd ) risk factors in older patients with poorly controlled t2 dm and cvd [ 6 , 11 ] . microvascular and macrovascular complications are mainly [ 14 , 15 ] or partially [ 15 , 16 ] dependent on hyperglycemia . the acute glucose fluctuations during postprandial periods play an important role in oxidative stress . specifically , the rapid rise in postprandial blood glucose concentration induces an overproduction of peroxynitrite and nitrotyrosine [ 17 , 18 ] , which had more specific triggering effect on oxidative stress . moreover , study demonstrated that hyperglycemia may induce severe alterations in ionic channels conduction properties . these channels are involved in the control of ryr2 channels , and ryr2 channels may predispose the patient to ventricular arrhythmias and sudden death . so we hypothesize that dapagliflozin which benefits the cardiovascular system might partially depend on the improvement of blood variations , leading to the smoothed oxidative stress in patients with t2 dm . in this study we performed 2-time 3-day continuous glucose monitoring ( cgm ) and measured plasma 8-iso prostaglandin f2 ( 8-iso pgf2 ) levels at baseline and at the endpoint of dapagliflozin therapy to observe the changes of glycemic variations and oxidative stress levels in patients with newly diagnosed t2 dm compared with those treated with placebo control . this was a randomized , double - blind , placebo - controlled , phage 3 trial . the study was performed in the department of endocrinology , nanjing first hospital , nanjing medical university , between july 2010 and march 2012 . after the baseline parameters were assessed , patients receiving 8 weeks of lifestyle management counseling , those who continued to experience inadequate glycemic control , as defined by hba1c levels of 7.510.5% , were recruited . the interactive voice response system ( bristol - myers squibb research and development , lawrenceville , nj ) will assign subjects to randomly receive one of the following blinded treatment regimens in a 1 : 1 : 1 ratio : dapagliflozin 5 mg , qd ; dapagliflozin 10 mg , qd ; dapagliflozin 5 mg/10 mg matching placebo , qd ( distributed by bristol - myers squibb , lawrenceville , nj ) , for 24 weeks , and , after 4 weeks of treatment , patients lacking glycemic control ( fasting blood glucose > 11.1 mmol / l ) were eligible to receive another antihyperglycemic drug , such as metformin , based on their particular symptoms . scheduled visits will occur at weeks 1 and 24 . the following exclusion criteria are applied : ( 1 ) history of diabetes insipidus ; ( 2 ) severe uncontrolled hypertension ( systolic blood pressure 180 mmhg and/or diastolic blood pressure 110 mmhg ) and use of any renin - angiotensin system blocker ; ( 3 ) replacement or chronic systemic corticosteroid treatment ; ( 4 ) history or current diagnosis of significant comorbid diseases , such as cardiovascular , hepatic , and renal diseases ; ( 5 ) and/or positive test for islet cell autoantibodies ( such as glutamic acid decarboxylase autoantibodies , islet cell autoantibodies , or insulinoma - like antigen 2 ) , indicating the possibility of type 1 diabetes mellitus . before and after 24-week dapagliflozin treatment , all patients were subjected to 2-time 3-day retrospective cgm ( medtronic incorporated , northridge , usa ) in hospital by the specialist nurse at baseline and at the endpoint . briefly , the cgm sensor was subcutaneously embedded at day 0 around 16:00 - 17:00 pm . subjects were instructed to keep the sensor fixed and waterproof , if cgm was going well . the study nurse inputted at least 4 calibration readings every day . at day 4 , around 16:00 - 17:00 pm , subjects had the sensor removed , and the cgm data were saved by the investigator , as described previously [ 2022 ] . all subjects were instructed to maintain a similar level of physical activity and received meals consisting of the same nutritional value and equivalent carbohydrate intake during the study . the 24-hour mean blood glucose ( mbg ) , the standard deviation of the mbg , the mean amplitude of glycemic excursions ( mage ) , the incremental area under curve ( auc ) of blood glucose above 10.0 mmol / l , the auc above fasting plasma glucose ( fpg ) concentration , and the hourly mbg were recorded and calculated , as described previously [ 21 , 22 ] . the plasma 8-iso prostaglandin f2 ( 8-iso pgf2 ) level was measured at the baseline and the completion of the study using an enzyme immunoassay method , as we previously described ( cayman chemical co. , ann arbor , mi ) [ 22 , 23 ] . the study was approved by the appropriate independent ethics committees and regulatory authorities and was conducted in accordance with the declaration of helsinki and international conference on harmonisation good clinical practice guidelines . after the purpose and procedures of the study were fully explained , all subjects provided informed consent before enrolling in the study . shapiro - wilk test was used to assess the distribution of data . normally distributed and continuous variables are presented as mean standard deviation ( sd ) . the mixed anova model ( 2 2 ) test was used to compare differences within group . a total of 28 newly diagnosed t2 dm patients met inclusion criteria ( 18 in dapagliflozin group and 10 in placebo group ) and were admitted to the study . as we reported , the demographic and baseline characteristics of study subjects were similar between placebo and dapagliflozin groups . there were no differences in the 24-hour mbg , the sdmbg , the mage , and the incremental auc ( hyperglycemia , hypoglycemia , and above fpg ) and the hourly glucose blood concentrations ( figure 1(a ) ) within the two groups at baseline . subjects in placebo group exhibited insignificant decreases in 24-hour mbg , the sdbg , the mage , and the incremental auc of hyperglycemia after 24-week study compared with baseline , which might partially depend on the placebo effect . cgm data showed that , as expected , all patients had significant improvement of 24-hour mbg ( 9.12 1.77 versus 7.50 1.49 , p < 0.05 ) , sdbg ( 2.43 1.09 versus 1.51 0.42 , p < 0.05 ) , mage ( 5.85 3.02 versus 3.48 0.98 , p < 0.05 ) , the incremental auc of hyperglycemia ( 0.69 1.15 versus 0.14 0.28 , p < 0.05 ) , and the auc above fpg ( 1.68 0.50 versus 1.01 0.65 , p < 0.05 ) after 24-week dapagliflozin treatment compared with baseline ( table 1 ) . analysis comparing the two groups revealed that patients treated with dapagliflozin therapy experienced improvement of mage ( 3.48 0.98 versus placebo group 5.37 2.16 , p = 0.010 ) . consistent with the improvement of blood glycemic excursions , a significantly decreased 24-hour mbg was exhibited in patients with dapagliflozin therapy ( 7.50 1.49 versus 9.46 1.16 mmol / l , p = 0.026 ) compared to that of control group . mmol / l or fpg ) in patients treated with dapagliflozin compared to that of placebo group ( 0.14 0.28 versus 0.44 0.47 and 1.01 0.65 versus 1.12 0.80 ) . the average blood glucose concentrations per hour in patients in dapagliflozin group were lower than that in control group , especially from 2400 to 0200 ( 7.12 2.13 , 6.34 1.04 , and 6.17 1.01 versus 9.47 2.32 , 8.29 2.51 , and 8.36 2.64 , p < 0.05 , resp . ) and 1300 to 1800 o'clock ( 8.40 2.53 , 8.31 2.25 , 8.10 1.81 , 8.06 2.11 , 7.85 1.96 , and 7.57 1.65 versus 9.64 2.85 , 10.55 2.58 , 10.61 2.45 , 10.29 1.98 , 9.80 0.89 , and 9.55 1.37 , p < 0.05 , resp . ) ( figure 1(b ) ) . to determine the effect of dapagliflozin therapy on oxidative stress in patients with newly diagnosed t2 dm , we measured plasma 8-pgf2 level , a well - recognized biomarker of oxidative stress . plasma 8-pgf2 level was significantly decreased in the dapagliflozin group from 9.85 4.91 to 7.36 3.32 pg / ml ( p = 0.022 ) . furthermore , plasma 8-pgf2 level in dapagliflozin group was significantly lower than that of control group after 24-week treatment ( 7.36 3.32 versus 10.59 5.08 pg / ml , p = 0.034 ) ( figure 2 ) . safety and tolerance . with regard to hypoglycemia , the incremental auc less than 3.9 mmol / l was almost the same within groups after 24-week therapy ( 0.02 0.06 versus 0.00 0.00 , p = 0.420 ) . one patient suffered moderate urinary tract infection during dapagliflozin therapy at 7 weeks , the results of the present study showed that patients treated with dapagliflozin experienced improvement of blood glycemic excursions , lowered 24-hour mbg , and insignificant reduction in auc of > 10 mmol / l and auc above fpg . studies showed that the dapagliflozin is well tolerated in patients with t2 dm over 24 years [ 9 , 10 ] . in our study , 18 patients who received dapagliflozin therapy were well tolerated for 24 weeks . the increased risks of urinary tract infection and genital infection are the main dapagliflozin therapy side effects , and we did not observe any serious adverse event ( sae ) , with the exception of one patient who had moderate urinary tract infection during the dapagliflozin therapy period . as expected , our cgm data showed that patients treated with dapagliflozin were exhibiting decreased mage and lower 24-hour mbg , without increase in hypoglycemic episodes , compared with placebo group . the results agreed with previous studies , which demonstrated that patients treatment with dapagliflozin had benefits of improved glycemic control [ 38 ] , with no increase in hypoglycemia . sglt-2 inhibitors lower the maximum thresholds of glucose reabsorption , thus exhibiting the glucose - lowering effect in patients with t2 dm [ 1 , 2 ] . interestingly , our cgm data revealed that patients in dapagliflozin treated group had significantly reduced 24-hour mbg , especially during periods from 2400 to 0200 and 1300 to 1800 , and insignificantly decreased auc above fpg . the lower blood plasma glucose concentrations might implicate the decrease in glucose reabsorption facing hyperglycemia challenge . dapagliflozin reduced hyperglycemia , body weight , and sbp and effectively addressed three cvd risk factors in older patients with poorly controlled t2 dm and cvd [ 6 , 11 ] . however , we observed that dapagliflozin may benefit the cardiovascular system through the reduced atrial natriuretic peptide levels . acute glucose fluctuations during postprandial periods , other than chronic hyperglycemia , played a more important role in oxidative stress in patients with t2 dm . a rapid rise in postprandial blood glucose concentration induces an overproduction of peroxynitrite and nitrotyrosine [ 17 , 18 , 25 ] . notwithstanding , continued effort has been made to suppress postprandial hyperglycemia in patients with t2 dm . microvascular and macrovascular complications are mainly [ 14 , 15 ] or partially [ 15 , 16 ] dependent on hyperglycemia . the rapid rise in postprandial blood glucose concentrations induces an overproduction of peroxynitrite and nitrotyrosine [ 17 , 18 ] . studies have shown that postprandial glucose ( ppg ) is an independent risk factor for cardiovascular disease . by reducing postprandial excursions , also , chronic hyperglycemia has been demonstrated to be a risk factor for developing cvd [ 29 , 30 ] . most importantly , patients with uncontrolled blood glucose concentrations might have the modified response of cardiac resynchronization therapy ( crt ) at clinical and epigenetic levels [ 31 , 32 ] . optimal glycemic control , by upregulation and differentiation of endothelial progenitor cells , may improve the myocardial salvage and affect the entity of myocardium damage extension . studies also demonstrated that diabetic patients with atherosclerotic plaques showed an altered and augmented inflammation and apoptosis response . in addition , after a mean follow - up of 6.5 years , newly diagnosed t2 dm patients with an increase in morning blood pressure surge had a risk of microalbuminuria , which might be induced by the fluctuation of glycemia . in this study , we observed that patients with t2 dm had significant improvement of blood glycemic variations after being treated with dapagliflozin for 24 weeks . moreover , our data also showed that the oxidative stress level was significantly decreased after dapagliflozin therapy for 24 weeks . the current study indicates that there might have been a correlation between the reduction of the glycemic variability and the reduction of oxidative stress after the dapagliflozin therapy . the smoothed glycemic variations might improve the prognosis of patients with cerebrovascular disease , because glycemic fluctuations might lead to the development of atrial arrhythmias as atrial fibrillation ( af ) , which might be induced by the alterations in sympathetic tone regulation . indeed , af occurred frequently in young t2 dm patients and were associated with a high risk to present future cerebrovascular and silent episodes . in particular , the study population was relatively small , and the observation time was relatively short . in addition , more markers for oxidative stress should be employed , such as nitrotyrosine , a well - recognized biomarker to test the oxidative stress alterations and to predict clinical outcomes . in conclusion , this study shows the ability of dapagliflozin to improve glycemic variations and associate with reduction of oxidative stress in patients with t2 dm , which may benefit the cardiovascular system .
septic acute kidney injury ( aki ) is associated with poor outcome compared to septic patients without aki , hence sepsis is regarded as the most common trigger of aki in seriously ill patients . sepsis leads to aki in ~50% of all critically ill patients.1 there are various other studies that reported that 40%75% cases of aki were associated with sepsis.24 these patients generally had poor prognosis when compared to septic patients without aki.57 the unacceptably high mortality rates are associated with septic aki and this is explained by an incomplete understanding of the pathophysiology and delay in diagnosis , in spite of using serum creatinine and fractional excretion of sodium . furthermore , serum creatinine level may take up to 2 days to rise after kidney injury . therefore , early detection of septic aki is of great importance to enable adequate treatment in these patients and improve their outcomes . early diagnosis of aki remains difficult because it relies on imperfect parameters , such as serum creatinine , while the introduction of new serum and urinary biomarkers could hypothetically allow earlier diagnosis and better prognostication.8,9 at present , neutrophil gelatinase - associated lipocalin ( ngal ) has been the most frequently investigated biomarker for early diagnosis of aki.10 in humans , three different forms of ngal can be found , namely , a 25 kda monomer , a 45 kda dimer , and a 135 kda heterodimer , covalently conjugated with gelatinase.1113 yet , no commercially available immunoassays are able to make a clear discrimination between the monomer , mainly released from tubular epithelial cells , and the dimer , originating from neutrophils.12 studies reported that there was a rise in the biomarker level , without a rise in serum creatinine or a decrease in urinary output , which resulted in the speculation of the existence of a new entity called subclinical aki.14,15 the aim of this study was to examine the urinary ngal ( ungal ) in septic patients with and without aki . this was a prospective cohort study carried out in the department of medicine , nephrology unit at king george medical university , lucknow , up , india , over a period of 1 year from august 2014 to july 2015 . the reporting of this study follows the strengthening the reporting of observational studies in epidemiology guideline.16 after informed written consent and approval from the institutional ethic committee , patients were enrolled in the study . during this period , 18,665 patients were admitted in indoor wards , out of which 170 patients with septicemia fulfilling the inclusion criteria were enrolled in the study . total subjects were divided into two groups , 88 subjects of septicemia with aki ( group i ) and 67 subjects of septicemia without aki ( group ii ) . fifteen patients dropped out of the study , so are excluded from the analysis ( figure 1 ) . we included patients in the range of 1865 years who had sepsis according to the survival sepsis campaign 201217 ; and patients with end - stage kidney disease ( defined as estimated glomerular filtration rate 15 ml / min / m ) , chronic dialysis therapy , confirmed and/or suspected acute glomerulonephritis , acute interstitial nephritis , renal vasculitis or postrenal chronic kidney disease , and those who had just undergone renal transplantation or were recipients of prior kidney transplant were excluded . aki was defined and classified according to akin criteria.18 worsening aki was defined as an increase in rifle category ( from risk to injury , risk to failure , or injury to failure ) in the 48 hours after enrollment or renal replacement therapy ( rrt ) initiation , as previously defined.19 baseline serum creatinine was defined as the lowest creatinine value in the last 6 months before aki or , for those without this measurement , the lowest value achieved during hospitalization in the absence of dialysis.20 day 0 was defined as the calendar day of admission and thus its length varied depending on the time of presentation . sepsis syndrome was defined according to the consensus guidelines.21 organ dysfunction / failure was assessed by the sequential organ failure assessment ( sofa ) score , illness severity score ( apache ii ) . oliguria was defined as a urine output < 400 ml/24 h. vasopressor therapy was defined as the use of any vasopressor or inotropic drugs ( dopamine , dobutamine , or noradrenaline ) after hospitalization . shock was defined as a mean arterial pressure < 60 mmhg and/or a need for vasoactive support plus a blood lactate 4 mmol / l.22 clinical and laboratory data were collected on standardized data collection forms . baseline ungal was defined as the estimated value of ungal , 12 hours from admission . peak value of ungal was defined as the maximum value of ungal during the hospital stay , before the development of renal failure . all subjects were admitted to the hospital and monitored daily for biochemical parameters , the length of hospital stay , the need for rrt , and the presence of sepsis . five milliliters of venous blood sample was collected once daily for up to 35 days . the blood was centrifuged at 5,000 rpm for 10 minutes at room temperature ; serum was separated for routine hematology ; biochemistry , urinalysis , and urine protein measurements were performed as per study protocols . an automated blood - cell analyzer ( bc-5380 , mindray , guangdong , people s republic of china ) was used for routine hematology testing , and an automated clinical biochemistry analyzer ( cobas c 311 roche - hitachi , japan ) was used for blood urea nitrogen , creatinine , uric acid , serum lipids , electrolytes , and albumin . a clean , morning midstream urine sample ( 5 ml ) was collected in a sterile test tube and centrifuged at 5,000 rpm for 15 minutes . the supernatant was transferred to an eppendorf tube and stored at 80c until assayed for urine ngal . urine was analyzed for ngal at 12 , 24 , and 48 hours after enrollment . urine ngal was measured using the biovendor human lipocalin-2/ngal elisa , which is a sandwich enzyme immunoassay for the quantitative measurement of human ngal as per producer protocol . the primary outcome variable was aki occurring during the hospital stay , and the secondary outcomes were aki stage iii . continuous variables were expressed as mean standard deviation and compared using one - way analysis of variance followed by tukey s post hoc tests . receiver operator curve analysis has been done for ngal and for identifying the optimal ngal cutoff values for predicting aki . all the analysis has been done using spss 20.0 ( ibm corporation , armonk , ny , usa ) and medcalc software . five milliliters of venous blood sample was collected once daily for up to 35 days . the blood was centrifuged at 5,000 rpm for 10 minutes at room temperature ; serum was separated for routine hematology ; biochemistry , urinalysis , and urine protein measurements were performed as per study protocols . an automated blood - cell analyzer ( bc-5380 , mindray , guangdong , people s republic of china ) was used for routine hematology testing , and an automated clinical biochemistry analyzer ( cobas c 311 roche - hitachi , japan ) was used for blood urea nitrogen , creatinine , uric acid , serum lipids , electrolytes , and albumin . a clean , morning midstream urine sample ( 5 ml ) was collected in a sterile test tube and centrifuged at 5,000 rpm for 15 minutes . the supernatant was transferred to an eppendorf tube and stored at 80c until assayed for urine ngal . urine was analyzed for ngal at 12 , 24 , and 48 hours after enrollment . urine ngal was measured using the biovendor human lipocalin-2/ngal elisa , which is a sandwich enzyme immunoassay for the quantitative measurement of human ngal as per producer protocol . the primary outcome variable was aki occurring during the hospital stay , and the secondary outcomes were aki stage iii . continuous variables were expressed as mean standard deviation and compared using one - way analysis of variance followed by tukey s post hoc tests . correlations between various kidney function parameters have been calculated using pearson correlation coefficient . receiver operator curve analysis has been done for ngal and for identifying the optimal ngal cutoff values for predicting aki . all the analysis has been done using spss 20.0 ( ibm corporation , armonk , ny , usa ) and medcalc software . a total of 155 patients were enrolled in the study out of which 88 ( 56.8% ) were septic aki patients that included 35 females and 53 males . they were admitted to the hospital ~35 days after the acute onset of clinical symptoms . in septic non - aki group 67 ( 43.2% ) were study subjects , out of which 39 were male and 28 were female . the baseline information of patients and laboratory test results was compared between the two groups , septic aki group vs septic non - aki group . we found significantly higher apache ii score and sequential organ failure assessment score in the septic aki group as compared to septic non - aki ( 26.846.4 vs 18.68.4 , p<0.001 ) and ( 10.62.8 vs 6.82.4 , p<0.001 ) , and decreased urine output was also more in the septic aki group as compared to the septic non - aki group ( 844.32672.98 vs 1,012.69367.46 , p=0.06 ) , respectively . the level of ungal was high in the septic aki group as compared to the septic non - aki group ( 261.0647.91 vs 53.8027.76 ) ( table 1 ) . the early increasing ungal reached its peak after 48 hours of development of aki followed by consistently increased in the levels of blood urea and serum creatinine in patients developing septic aki and reaching their maximum value within 7 days . in these patients , the ungal correlated positively with the blood urea ( r=0.27 , p<0.01 ) , serum creatinine ( r=0.44 , p<0.001 ) , and the length of hospital stay ( r=0.46 , p<0.001 ) ( figures 24 ) . among septic non - aki , 57 ( 85.07% ) patients were at risk , seven ( 10.45% ) patients as injury , and only three ( 4.48% ) as failure at baseline . after 48 hours , 43 ( 64.17% ) were in the risk category , 21 ( 31.34% ) patients in injury , and three ( 4.4% ) patients were considered as failure . only 14 ( 20.9% ) there was no significant change in the akin criteria within the septic non - aki group after 48 hours , and no significant difference was observed between the two groups ( p<0.001 ) . but in the septic aki group , five ( 5.68% ) patients were at risk , 46 ( 51.13% ) patients in injury , and 37 ( 42.04% ) patients in failure category as per the akin criteria at baseline . after 48 hours , eight ( 9% ) were in the risk category , 36 ( 40.9% ) patients in injury category , and 44 ( 50% ) patients were considered as failure . there was a significant change in aki stages within septic aki after 48 hours ( p<0.001 ) ( table 2 ) . in the septic non - aki group , difference in mean change of ungal between 12-hour and 24-hour values was 02.070.80 ng / ml and difference between 24-hour and 48-hour values was 26.1315.12 ng / ml . in the septic aki group , difference in mean change of ungal between 12-hour and 24-hour values was 80.007.00 ng / ml , and difference between 24-hour and 48-hour values was 128.1322.46 ng / ml . within group analysis , difference was statistically highly significant ( p<0.0001 ) in septic aki but not in septic non - aki group ( p<0.01 ) . on evaluating between group analysis , we found highly significant difference in septic aki at 12 and 48 hours as compared to septic non - aki ( p<0.0001 ) ( table 3 ) . the 12-hour value and peak ( 48 hours ) ungal were significantly higher in patients with septic aki than those with septic non - aki ( table 1 ) . the accuracy for the prediction of septic aki , as quantified by the area under the receiver - operating characteristic curve ( au - roc ) , was significantly higher with the peak ungal than that with the 12-hour ungal . au - roc for the peak ungal : 0.82 ( 95% ci , 0.750.88 ) vs au - roc for the baseline ungal : 0.81(95% ci : 0.730.89 ) ( figure 5 ) . at 12 hours , the cutoff value of 34.32 ng / ml had a sensitivity and specificity of 86.36 and 80.60 , respectively and an area under curve of 0.81 ( 95% ci : 0.730.89 ) for predicting the aki . at peak or at 48 hours , the cutoff value of 199.99 ng / ml had a sensitivity and specificity of 90.0 and 64.66 , respectively and an area under curve of 0.82 ( 95% ci , 0.750.88 ) for predicting aki ( table 4 ; figure 5 ) . the early increasing ungal reached its peak after 48 hours of development of aki followed by consistently increased in the levels of blood urea and serum creatinine in patients developing septic aki and reaching their maximum value within 7 days . in these patients , the ungal correlated positively with the blood urea ( r=0.27 , p<0.01 ) , serum creatinine ( r=0.44 , p<0.001 ) , and the length of hospital stay ( r=0.46 , p<0.001 ) ( figures 24 ) . among septic non - aki , 57 ( 85.07% ) patients were at risk , seven ( 10.45% ) patients as injury , and only three ( 4.48% ) as failure at baseline . after 48 hours , 43 ( 64.17% ) were in the risk category , 21 ( 31.34% ) patients in injury , and three ( 4.4% ) patients were considered as failure . only 14 ( 20.9% ) there was no significant change in the akin criteria within the septic non - aki group after 48 hours , and no significant difference was observed between the two groups ( p<0.001 ) . but in the septic aki group , five ( 5.68% ) patients were at risk , 46 ( 51.13% ) patients in injury , and 37 ( 42.04% ) patients in failure category as per the akin criteria at baseline . after 48 hours , eight ( 9% ) were in the risk category , 36 ( 40.9% ) patients in injury category , and 44 ( 50% ) patients were considered as failure . there was a significant change in aki stages within septic aki after 48 hours ( p<0.001 ) ( table 2 ) . in the septic non - aki group , difference in mean change of ungal between 12-hour and 24-hour values was 02.070.80 ng / ml and difference between 24-hour and 48-hour values was 26.1315.12 ng / ml . in the septic aki group , difference in mean change of ungal between 12-hour and 24-hour values was 80.007.00 ng / ml , and difference between 24-hour and 48-hour values was 128.1322.46 ng / ml . within group analysis , difference was statistically highly significant ( p<0.0001 ) in septic aki but not in septic non - aki group ( p<0.01 ) . on evaluating between group analysis , we found highly significant difference in septic aki at 12 and 48 hours as compared to septic non - aki ( p<0.0001 ) ( table 3 ) . the 12-hour value and peak ( 48 hours ) ungal were significantly higher in patients with septic aki than those with septic non - aki ( table 1 ) . the accuracy for the prediction of septic aki , as quantified by the area under the receiver - operating characteristic curve ( au - roc ) , was significantly higher with the peak ungal than that with the 12-hour ungal . au - roc for the peak ungal : 0.82 ( 95% ci , 0.750.88 ) vs au - roc for the baseline ungal : 0.81(95% ci : 0.730.89 ) ( figure 5 ) . at 12 hours , the cutoff value of 34.32 ng / ml had a sensitivity and specificity of 86.36 and 80.60 , respectively and an area under curve of 0.81 ( 95% ci : 0.730.89 ) for predicting the aki . at peak or at 48 hours , the cutoff value of 199.99 ng / ml had a sensitivity and specificity of 90.0 and 64.66 , respectively and an area under curve of 0.82 ( 95% ci , 0.750.88 ) for predicting aki ( table 4 ; figure 5 ) . in our study , clinical courses of patients with sepsis were prospectively followed throughout hospitalization . this result emphasizes the importance of early detection of septic aki , especially in emergency departments and intensive care units ( icus ) . during the course of sepsis , the patients gradually progress from mild - to - severe stages of aki . in these patients , the peak ungal positively correlated with the levels of blood urea , serum creatinine , and the length of hospital stay , reflecting the severity of renal dysfunction . approximately 90% of the patients in the study of sepsis had increased ungal , but this value was markedly increased in septic aki group . these patients also had a higher level of blood urea , serum creatinine , and increased progression of aki . ungal was also measured in one study of sepsis in which 63 ( 42% ) patients out of 151 patients had increased ungal.23 haase - fielitz et al24 studied adult cardiac surgery patients and they reported that predictive value of plasma ngal increases with increasing grade of aki . similarly , a recent study in a cohort of 45 patients of septicemia , showed that ungal was a good diagnostic marker for aki , but this did not indicate about the severity of aki or disease progression , when it was evaluated , after a rise in serum creatinine.25,26 in our study , ten patients ( 11.4% ) did not progress beyond the akin stage ii , indicating that some patients in this group probably had functional renal failure ( transient aki or pre - renal azotemia ) without any significant renal tubular injury . the incidence of transient aki was similar to the study done by hoste et al27 ( 18% ) . in such situations , serum creatinine may be elevated due to decreased glomerular filtration rate , but without elevation in ungal due to the absence of significant tubular injury.28 the diagnostic accuracy of septic aki was highest with the peak ungal at 48 hours , as compared to the baseline or 12-hour ungal ( figure 5 ) . although there is no such huge difference between the two values , the specificity of baseline or 12-hour ungal was high at a lower cutoff value . in order to diagnose aki before rise in serum creatinine , baseline or 12-hour ungal our study result showed that baseline ungal was highly specific for the diagnosis of aki with an au - roc of 0.81 . a study done by constantin et al29 in the adult population observed that plasma ngal at icu admission is an early biomarker of aki with sensitivity of 85% and specificity of 97% with an auc equivalent of 0.956 ( 0.8640.992 ) . our results are quite similar to the study done by nickolas et al28 who reported excellent prediction of aki by ungal ( auc of roc = 0.95 ) with high sensitivity ( 0.90 ) and specificity ( 0.99 ) of a single measure of ungal done during emergency . increased concentration of ngal has been found in patients with acute infection as well as in bronchoalveolar lavage fluids with lung disease . therefore , it is not surprising that the authors found increasing levels of ungal in septic patients without aki.30 our study result was also supported by wheeler et al31 who reported increasing levels of serum ngal in critically ill children with systemic inflammatory response syndrome ( sirs ) vs septic shock , even in the absence of aki . so in our study , we preferred to measure ngal in urine and in septic non - aki patients also . martens - son et al13 also supported our study that plasma ngal was raised in patients with sirs , severe sepsis , and septic shock and should be used with caution as a marker of aki in icu patients with septic shock . we also suggested that ungal is more useful in predicting aki , as the levels are not elevated in septic patients without aki.32 in our study at 12 hours ungal was significantly higher in those who developed aki after admission than those who never developed aki , indicating that ungal is indeed an early marker of aki . hence , despite limitation in a clinical setting ungal can still be a useful early prognostic marker of aki . though the peak level of ungal was reached at 48 hours , even at 12 hours after the development of septicemia ungal had good diagnostic value ; at 12 hours its sensitivity was 86.36% and specificity was 80.60% for prediction of aki . though the peak value at 48 hours , at the cutoff 199.99 ng / ml had high sensitivity of 90% , specificity was less than at 12-hour value . thus , we can say it is good to measure ungal even at 12 hours for prediction of aki . variability in the prediction of aki by ungal could be attributed to the type , timing , and nature of renal injury . it is very common to see critically ill patients being admitted to tertiary referral centers late in the course of their illness in india , when aki has already been established at the time of admission . the high cost of icu carries a major deterrent for self - paying patients , resulting in delayed admission to icu . thus , we can say that early detection of septic aki helps in early interventions , early antibiotic initiation , fluid resuscitation , and restriction of nephrotoxic antibiotics and intravenous contrast dye use . the level of ungal may make it possible to explain the prognosis of septic aki and the need for rrt on the basis of daily measurements . first , this study was relatively small and prospective in nature , our findings may be prone to type ii errors , and therefore , these markers require validation in independent cohorts . second , the early abnormalities , such as hypoalbuminemia , elevated hematocrit , and elevated aspartate and alanine aminotransferase indicating the presence of liver impairment were also noted in the sepsis , but we have not included these in the analysis . the increased urinary ngal is a significant early and consistent laboratory abnormality in septic aki . it could be having a potential value in risk stratification of patients for the timely initiation of rrt . its utility is markedly limited where referral is late or when aki has already been established at the time of admission .
necrotizing fasciitis / fournier s gangrene is a rare , life - threatening soft tissue infection that can rapidly progress to systemic toxicity if not treated promptly . its aetiology is poorly understood , and it can often be triggered by a very minor inciting event , such as an insect bite or minor trauma . early detection combined with aggressive surgical debridement , multidisciplinary team input and good reconstructive techniques are key factors for survival and good outcomes . a 48-year - old male , with a background of chronic pancreatitis and alcohol dependency , presented with septic shock . he had a cellulitic , oedematous and mottled discoloration of his genitalia and perineum , concerning for fournier s gangrene . he was transferred from a peripheral institution to a tertiary centre for intensive care unit ( icu ) and multidisciplinary surgical support . he had a radical debridement by urology , plastic and general surgery on - call services . at the time of surgery , it was noted that there was copious amounts of pus tracing out of his left inguinal canal . further examination revealed a large left - sided retroperitoneal collection and two large drains were placed ( fig . 1 ) . the peritoneal cavity was then examined and no intra - peritoneal collection was noted . figure 1:post - extensive debridement of the anterior abdominal wall , scrotum and penile skin with a large penrose drain placed retroperitoneally on the left side . post - extensive debridement of the anterior abdominal wall , scrotum and penile skin with a large penrose drain placed retroperitoneally on the left side . computed tomography scan of his abdomen / pelvis demonstrated acute - on - chronic pancreatitis , with focal necrosis at the head of the pancreas . fluid tracking from pancreas into the retroperitoneum and down to the perineum was visualized , with subcutaneous emphysema in left flank ( fig . he returned to theatre for further debridement of non - viable soft tissues , and medial thigh pouches were created for his testes . figure 2:coronal section of computed tomography scan showing acute - on - chronic pancreatitis ( calcifications visible ) with surgical emphysema in lower left abdominal wall planes . coronal section of computed tomography scan showing acute - on - chronic pancreatitis ( calcifications visible ) with surgical emphysema in lower left abdominal wall planes . subsequently , he had a 3-week course of intravenous therapy and then switched to oral antibiotics for a further 3 weeks . the acute pancreatitis ( imrie score 4 ) was managed conservatively , with nasogastric feeding . the patient was found to have diabetes mellitus ( type 2 ) and commenced oral treatment . after multiple debridements and vac changes , the abdomino / perineal skin defect was ready for resurfacing with a split - skin grafting ( fig . this was 100% taken by day-7 post - operatively and he was discharged well for convalescence ( fig . 4 ) . follow - up review in out - patients at 2 months demonstrated an excellent recovery . figure 3:post - multiple vac dressing changes , just prior to split - skin grafting ( testes in medial thigh pouches ) . figure 4:day-7 post split - skin grafting with 100% uptake and excellent healing of donor site ( left thigh ) . post - multiple vac dressing changes , just prior to split - skin grafting ( testes in medial thigh pouches ) . day-7 post split - skin grafting with 100% uptake and excellent healing of donor site ( left thigh ) . necrotizing fasciitis ( nf ) is a rare , potentially life - threatening soft tissue infection . its incidence is low , with an estimated 500 cases per year in the uk . reported mortality varies ( 025% ) , but is closely related to existing co - morbidities including diabetes , underlying neoplasms , chronic vascular disease , renal impairment or alcohol abuse [ 2 , 3 ] . the most common source is polymicrobial ( as in this case ) , with group a streptococcus being the most common organism cultured . diagnosing nf and its initiating cause can be elusive , due to the non - specific symptoms in the early stages . early detection or classically , the cause is a minor inciting event ( trauma , graze and burn ) . however , rarer causes have been reported , including secondary to intra - abdominal infectious process such as acute diverticulitis [ 5 , 6 ] . to date , there has been only one other case of nf secondary to acute pancreatitis published in the literature . we suspect that the pancreatic necrosis resulted in the development of a retroperitoneal abscess , which tracked into the perineum , triggering the nf . despite the cause , rapid , accurate diagnosis , with early aggressive debridement , in addition , good intensive care and microbial treatment are key adjuncts . typically , extensive surgical debridement results in significant disfigurement . furthermore , with fournier s gangrene substantial debridement of the perineum is required , and this can have future fertility implications . the formation of neo pouches in the medial thigh ( as in this case ) is an excellent method to recreate the environment of the scrotum , and preserve the testes function . despite this not only it is an excellent temporary wound closure device but it also helps with managing wound exudate , prior to definitive surgical management . it has also been shown to increase fibroblast migration , resulting in improved granulation tissue formation , lowering bacterial counts and can aid in graft uptake success . this case emphasizes the importance of good clinical suspicion for any patient presenting with fournier s gangrene and its subsequent management . in addition , it specifically highlights an usual cause of nf , and serves to raise awareness of acute pancreatitis as a potential initiating source .
in the last few years , a new class of highly conserved ~21-mer non - coding rnas , micrornas ( mirnas ) , has emerged as an important player in post - transcriptional gene expression control in different physiological and pathological conditions : metabolism , proliferation , cell death , differentiation and development , viral infection , and cancer [ 13 ] . they specifically bind the 3-untranslated regions ( 3-utr ) of target mrnas , promoting either mrna degradation or translation arrest [ 46 ] . each mirna may control the activity of many genes , and almost 30% of the genome could be regulated in such a way , which renders these small molecules as important as the transcription factors [ 7 , 8 ] . owing to their extreme importance as regulators , the isolation and the precise quantification of these tiny molecules are therefore fundamental . as purity and integrity are essential requirements not only for total rna but also for these small species , rna extraction protocols must also account for the maximizing of their recovery . , it is well established that the traditional glass - fiber total rna extraction protocol may be inefficient at recovering small rnas . in addition , the common spectrophotometric determination of total rna is not adequate to quantify low molecular weight ( lmw ) species selectively . we and other authors found previously that the recovery of lmw rna species is significantly affected by the specific purification process [ 3 , 9 ] . our results showed that different extraction strategies lead to significantly different recovery of lmw species including mirnas . we also demonstrated that using the same amount of total rna ( from different tissues ) , different amounts of mirnas may be obtained . moreover , the amount of lmw rna species does not perfectly parallel that of mirnas : even with the same extraction protocol , the concentration of mirnas may differ significantly among various tissues . nevertheless , this may also be because of a different global expression of mirna by different tissues . all of these considerations are extremely important when one compares the relative expression of many mirnas in different tissues . commonly , some small non - coding rnas ( i.e. , u6 , snoz30 , and others ) are used as normalization controls to compare mirnas expression in different tissues . the choice of a proper control should be conditioned to its real endogenous behavior , that is , it should have a constant and equal expression in all tissues . if the amount of that control small non - coding rna is different , a relative quantification is not feasible . in this latter case , only the comparison between various mirnas and the control gene in the same specimen ( tissue ) is methodologically acceptable . therefore , a method allowing a reliable estimation of the goodness of an endogenous control is highly desirable . in order to address all of these issues we used a lab - on - a - chip technology to characterize the lmw rna fractions obtained with different rna extraction protocols and evaluated mirnas recovery with specific quantitative real - time pcr ( qrt - pcr ) . in this paper we report and discuss the methods that allowed us to analyze the efficiency of extraction protocols , to study the small ( but significant ) differences between various preparations and to obtain a correct comparison of some mirna expression profiles in various tissues . total rna was extracted using three different methods : an acid phenol / guanidine isothiocyanate solution ( trizol reagent , invitrogen ) , a glass - fiber filtration protocol ( mirvana mirna isolation kit , ambion ) that provides also a procedure to isolate and enrich low molecular weight ( lmw ) rnas from higher molecular weight ( hmw ) rnas , and another common glass - fiber purification protocol ( rneasy mini kit , qiagen ) . three different cell lines ( hela , cos-1 and a lymphoblastoid cell line ( lcl ) obtained following an already reported method ) were cultured using standard procedures , trypsinized ( if necessary ) , and pelleted by centrifugation . approximately 10 cells for each extraction were resuspended in the appropriate lysis solution contained in the rna extraction kit and treated according to manufacturer 's instructions . the integrity of rna samples was checked by gel electrophoresis ( agarose 1% ) stained with ethidium bromide . gel images were acquired and analyzed with the quantity one ( software ver.2.0 , biorad ) . two micrograms of each rna samples were resolved into a 15% polyacrylamide tbe - urea gel and the image acquired . a second polyacrylamide gel , performed with the same experimental conditions , was used for rna bands extraction . the visible bands were separately excised using a modified crush - and - soak method . briefly , each band was gently disrupted with a pin and incubated in a soaking solution ( 0.5 m ammonium acetate , 2 mm edta , 0.1% sds ) for 3 hours at 37c . the mixture was centrifuged at 14000 g for 5 minutes , and the supernatant was collected in a new tube . the solution was centrifuged at 12000 g for 10 minutes through a ym-50 spin column , washed with water ( 3 300 l ) , and centrifuged at 12000 g for 5 minutes . purified fractions were collected in new tubes by inverting the columns and spinning at 1000 g for 3 minutes . the instrument uses fluorescence detection , monitoring the emission between 670 nm and 700 nm . electropherograms were analyzed using the agilent 2100 expert b.02.06 software that includes data collection , presentation , and interpretation functions . for the small rnas recovery efficiency evaluation of different extraction procedures , hsa - mir-21 and small nucleolar z30 ( snoz30 ) were assayed by real - time pcr ( taqman , applied biosystems ) , according to manufacturer 's instructions . for the analysis of mirna expression in different tissues , three mirnas ( hsa - mir-26a , hsa - mir-26b , and hsa - mir-134 ) and two controls ( u6 and snoz30 ) were arbitrarily chosen as model mirnas . a panel of five tissues ( brain , skeletal muscle , heart , liver , and uterus ) was chosen for evaluation , and the corresponding total rna ( clontech , bd biosciences ) was analyzed with agilent 2100 bioanalyzer . briefly , from five to ten nanograms of each rna samples were retrotranscribed to cdna using the high - capacity cdna archive kit ( applied biosystems ) with specific primers . the principle of taqman microrna assays is a specific stem - loop reverse transcription ( rt ) primer . the short length of mature mirnas ( ~22 nt ) prohibits conventional design of a random - primed rt step followed by a specific real - time assay . in the former case , the resulting rt amplicon is a suitable template for standard real - time pcr with taqman assays . reactions were performed incubating samples for 30 minutes at 16c , 30 minutes at 42c , 5 minutes at 85c , and finally cooled on ice . pcr products were assayed with specific probes using the taqman universal pcr master mix , no amperase ung ( applied biosystems ) following the manufacturer 's protocol . pcr reactions were performed incubating samples for 10 minutes at 95c , then for 15 seconds at 95c and 60 seconds at 60c for 45 cycles by means of abi prism 7900ht sequence detection system . . the early electropherogram region ( from 23 to 29 seconds ) , obtained from lcl rna sample extracted with trizol reagent , was exported in ascii format with the agilent 2100 expert b.02.06 and imported in peakfit v.4.12 . the fitting procedure was iterated until a constant r value ( r = 0.998693 ) was obtained . rna samples extracted from hela , cos-1 , and lcl were run on agarose gel to visualize the differences between various extraction methods . cos-1 rna samples , extracted with trizol reagent and mirvana kit , clearly showed the high molecular weight ( hmw ) 28s and 18s rrna bands , while lmw rnas are visualized as faint , smeary bands ( figure 1 , lanes 1 and 2 , resp . ) . cos-1 extracted with rneasy kit displayed only the hmw rna bands ( 28s and 18s ) ( figure 1 , lane 3 ) , while the enriched lmw fraction obtained with mirvana kit is clearly displayed in the lowest part of the gel ( figure 1 , lane 4 ) . the same samples were also checked with agilent 2100 bioanalyzer which is one of the most versatile microfluidics - based platforms for the analysis of dna , rna , proteins and cells . in all electropherograms the 28s and 18s rnas are represented on the right side ( figure 2 ) , and the smaller species ( lmw rnas ) are present at a very low concentration and distinguishable on the left side of the profile ( see the magnification of the lmw rnas region in figure 2 ) . in the electropherogram , all samples present a similar hmw profile region , but the major differences are recognizable in the lmw region . while total rna recovery is quite good , and similar for the three protocols ( > 1.2 g/l ) , the lmw fractions are substantially different ( table 1 ) . in particular , trizol reagent allowed the highest lmw rna recovery ( 22%34% of total rna ) , while rneasy mini kit the lowest ( 2.5%3% ) . mirvana mirna isolation kit gives good yields for lmw rna species ( 16%19% ) even before the enrichment step . while lmw rna species extracted with trizol and mirvana have comparable profiles ( figure 2 ) ; rneasy kit retains only one rna peak in comparable concentrations to the others ( peak a in the magnification of figure 2 ) . therefore , the lab - on - a - chip analysis is a useful tool to quantify precisely the amount of lmw rnas of samples extracted with different protocols . total rnas from lcl extracted with trizol reagent , and rneasy kit and enriched with mirvana kit were loaded on a polyacrylamide gel ( figure 3(a ) ) to analyze the differences between various extraction protocols . all the rna bands were cut out from the gel , and the rna was extracted as described . each species coming from excised bands was run on bioanalyzer , and the corresponding electropherograms ( figure 3(b ) ) were superimposed on the large and unresolved lmw rna profile ( black line ) . this allowed us to localize unambiguously and identify precisely each rna species previously identified on polyacrylamide gel . the electropherogram profile in the lmw rnas region is made of several peaks ( figure 3(b ) ) , the greatest part belonging to the 5.8s rrna ( red line ) , the 5s rrna ( green line ) , and the trnas fractions ( blue line ) . in order to obtain the principal number of peaks under the curve , peakfit software was used for the deconvolution of the lmw rna region . seven peaks underlying the lmw rna profile were obtained with a good fit ( r = 0.998693 ) . the upper part of figure 3(c ) reports raw data ( ) together with the fitted curve ( solid line ) and the calculated baseline , while the lower part of figure 3(c ) shows the component peak functions . calculated peak - peaking ( expressed in bp ) is also reported ( figure 3(c ) ) . three of the calculated peaks centered at 145 bp ( 26.89 seconds ) , 131 bp ( 26.33 seconds ) , and 104 bp ( 25.24 seconds ) are located in the correspondence of 5.8s , 5s , and trna peaks , respectively . another less intense peak is located at 114 bp ( 25.83 seconds ) and may be described as a further trna peak . other peaks found at 171 bp ( 27.78 seconds ) , 89 bp ( 24.84 seconds ) and 65 bp ( 24.31 seconds ) might belong to other lmw rna species , such as smaller trnas , pre - mirnas , and small nuclear or nucleolar rnas . these small peaks are difficult to extract from polyacrylamide gel owing to their low abundance , and therefore it was not possible to run them on the chip . therefore , determination of small rna species by bioanalyzer ( table 1 ) and by polyacrylamide gel electrophoresis ( figure 3(a ) ) showed that the lmw rna samples significantly differ from each other . this could reasonably pertain also to the mirnas fraction . in order to quantify mirnas extracted with different protocols and to study the correlation between lmw rnas and mirnas , we carried out a taqman quantitative assay for two representative small rnas : a control non - coding rna ( snoz30 ) and a mirna ( hsa - mir-21 ) . a target - specific stem - loop adapter technology was employed to obtain the corresponding cdna . we started the rt reaction with 10 ng of total rna from each sample and quantified the absolute expression level of each mirnas through the analysis of cycle threshold ( ct ) values . ct is the pcr cycle at which the sample reaches the level of detection above the background . lcl rna samples extracted with different protocols showed different ct values for snoz30 ( figure 4(a ) ) and for mir-21 . a similar behavior was also obtained by using hela and cos-1 cell lines with both probes ( data not shown ) . then , we repeated the rt reaction using 10 ng of lmw rna calculated from the bioanalyzer electropherogram . as expected , using the same lmw rna amount similar ct values both for mir-21 and snoz30 between the various samples were obtained ( figure 4(b ) ) . this demonstrates that the amount of mir-21 and snoz30 correlates only to the lmw rna fraction and not to total rna amount . in fact , figure 4(a ) clearly shows that using the same amount of total rna different ct values may be obtained . ct differences ( ct ) between total rna and lmw rna ct values for each extraction protocol and for each cell line are very similar both for hsa - mir-21 and snoz30 ( table 2 ) . this demonstrates that ct differences parallel the amount of input rna that is ultimately linked to the amount extracted by various protocols . table 2 reports also the calculated lmw rna concentration ( expressed in % ) calculated from ct values applying the formula 2 . mirna concentrations calculated from real - time assays are , as expected , in perfect agreement with lmw rnas concentrations evaluated with the lab - on - a - chip technology . here then , we asked if different tissues might also express different amounts of lmw and mirnas and if it might be possible to quantify them individually with lab - on - a - chip technology . for this reason we selected five commercial rna samples from different tissues extracted with the same protocol ( according to manufacturer information ) . total rnas from brain , skeletal muscle , heart , liver , and uterus were run on rna 6000 nano kit to quantify the total and the lmw rna fractions . total rna concentrations were quite homogeneous and resulted : brain ( 1159 ng/l ) > heart ( 1106 ng/l ) > uterus ( 1080 ng/l ) > liver ( 963 ng/l ) > skeletal muscle ( 890 ng/l ) . these values are in good agreement with the nominal manufacturer 's concentration of 1000 ng/l . for all samples the concentration of lmw rna fraction was quite homogeneous and varied in the order : liver ( 43 ng/l ) > brain ( 29 ng/l ) > heart ( 26 ng/l ) > uterus ( 25 ng/l ) > skeletal muscle ( 23 ng/l ) . electropherograms of lmw rnas of different tissues are displayed in figure 5(a ) . calculating the percentage of lmw rnas with respect to the whole total rna amount we found the following : liver ( 4.4% ) > skeletal muscle ( 2.6% ) > brain ( 2.5% ) > heart ( 2.3% ) > uterus ( 2.3% ) . given that the extraction protocol employed by the manufacturer was the same for all samples , we could hypothesize that the only observed difference for liver might depend on the different global expression of small rnas in this tissue . to evaluate if the difference in lmw rna amount may also pertain to the mirna fraction , we ran the total rna samples on agilent small rna kit , specifically designed for the evaluation of mirnas . figure 5(b ) shows a magnification of the electropherogram profile obtained by running total rna samples from different tissues . the displayed region ( from 35 to 45 seconds ) is specific to the mirna region ( as indicated by the manufacturer ) . mirna concentrations were liver ( 700 pg/l ) > brain ( 510 pg/l ) > uterus ( 404 pg/l ) > heart ( 226 pg/l ) > skeletal muscle ( 71 pg/l ) . the mirna concentration , expressed in percentage , respect to lmw rnas resulted brain ( 1.7% ) > liver ( 1.6% ) = uterus ( 1.6% ) > heart ( 0.9% ) > skeletal muscle ( 0.3% ) . from this lab - on - a - chip quantification it was possible to conclude that the mirnas amount does not parallel that of lmw rnas in the same tissue . moreover , the variation is greater than that displayed by lmw rnas among different tissues . again , assuming that the extraction efficiency is the same for all samples , the observed differences are only due to the different global expression of mirnas in these tissues . the small rna kit , specifically designed for the identification and quantification of mirna species , allowed us to know the exact amount of mirnas present in the samples used for retrotranscription ( rt ) reactions . this information is useful , since the ct values obtained from real - time assays are directly proportional to the amount of mirnas . in fact , the ct differences observed for the same mirna in different tissues may be due essentially ( 1 ) to a real difference between different samples and/or ( 2 ) to a different sample dilution that generates a shift in ct absolute values . to eliminate the dilution problem , that occurs when absolute quantification is performed , a relative quantification with respect to an endogenous control in fact , the endogenous control must have a constant expression in all samples , and hence it may be used to normalize the expression of the other mirnas . for a methodologically correct comparison , however , one must be confident that the control ( i.e. , nuclear and/or nucleolar small rnas ) really does have a constant expression in considered samples . the lab - on - a - chip technology that we used is able to give an estimate of this variation and let the researcher choose the right endogenous control ( the one that does not significantly vary ) from an adequate selection . therefore , this validation ensures that the mirna expression comparison among considered samples is methodologically correct . the expression of three mirnas ( hsa - mir-26a , hsa - mir-26b , and hsa - mir-134 ) and two small rnas ( u6 and snoz30 ) from the same five tissues analyzed before , was assayed with real - time pcr . according to the manufacturer 's suggestion , we started the rt reactions with 5 ng of total rna . these values reflect the absolute concentrations of these mirnas in various samples . since most studies aim to discover differences in expression levels of mirnas and not absolute levels of expression , the use of an endogenous control is needed . in order to assess if the differences in ct values of the controls we used ( u6 and snoz30 ) are because of a different starting concentration or a real differential expression , we corrected the obtained values by taking into account the concentration of mirnas previously obtained with the lab - on - a - chip technology . hence , we considered that for double the concentration a correction of one ct value should be applied . this preliminary correction eliminated the intrinsic variability owing to different sample concentrations and allowed us to estimate the reliability of the selected endogenous controls . we observed slight variation for ct values of u6 ( average ct = 33.5 0.8 ) while snoz30 displayed a higher variability ( average ct = 34.1 1.1 ) even after the applied correction . certainly , the lower the ct difference is , the more reliable are the results . to facilitate this , more lab - on - a - chip quantifications and real time assays are needed . therefore , we concluded that u6 is a more reliable endogenous control than snoz30 for mirna expression profile comparison in the analyzed tissues . figure 7 shows the expression values of hsa - mir-26a , hsa - mir-26b and hsa - mir-134 compared with the expression values of some tissue - specific mirnas ( mir-1 for heart and muscle , mir-122a for liver , mir-124a for brain ) . one of the most difficult problems with mirnas experimental studies concerns the efficiency of their quantitative and qualitative recovery after total rna extraction from cells or tissues . in some cases , traditional total rna extraction protocols are not efficient methods for extracting both high molecular weight ( hmw ) and low molecular weight ( lmw ) rnas . moreover , conventional quantification methods ( i.e. , spectrophotometric measurements ) giving an overall quantification of total rna concentration are therefore inadequate for these small rna species . northern blotting is the only current viable technique to visualize and evaluate small rna molecules , particularly mirnas . however , their low abundance sometimes prevents the use of such techniques . on the other hand , the lab - on - a - chip technology we employed is an alternative and valuable tool for the precise quantification of small rnas and mirnas present in total rna samples . in this work , to characterize in detail all the lmw rna species visible in the bioanalyzer electropherogram ( 5.8s , 5s , trnas , etc . ) , we ran rna samples on polyacrylamide gels to clearly separate each of the predominant species present in the small rna region ( figure 3(a ) ) . then , we monitored the eluted fractions by means of a lab - on - a - chip technology that is , at present , the only technique that allows for the comparison of small rna profiles and the exact quantification of these species ( figure 3(b ) ) . several other species were present under the peak of lmw rnas , even if it was not possible to distinguish each of them . for these reasons , we applied a mathematical algorithm ( the fourier transform ) for the deconvolution of the profile coming from the bioanalyzer into different gaussian peaks . after the fitting procedure , we obtained a mathematical model comprising seven peaks that define the overall profile ( figure 3(c ) ) . these peaks range from a minimum of 65 bp to a maximum of 171 bp , which is well in agreement with the results obtained with agilent automatic peak - peaking that relies on the comparison of rna species with an rna ladder included in the running buffer . interestingly , after this procedure was performed some other non - assigned bands remained undetermined . the small rna kit , specifically designed for the analysis of mirna species , was used to study these unidentified species in more detail . we initially compared the three commonest rna extraction protocols , the classic acid phenol / guanidine isothiocyanate solution , and two glass fiber filtration protocols to examine and quantify the recovery of hmw and lmw rna species . the acid phenol / guanidine isothiocyanate solution ( table 1 ) maximized not only the recovery of hmw rna fractions but also the lmw rnas ( from 22% to 36% ) , as previously observed . then , we assessed by real - time pcr how significantly affected the recovery of mirna species was as a function of the total rna extraction protocol used . the expression levels of a mirna ( hsa - mir-21 ) and a small nucleolar rna ( snoz30 ) were evaluated by real - time pcr specific assays . real - time quantification results ( table 2 ) demonstrated that the amount of mirnas correlates better with the amount of lmw rnas than with total rna . another aspect that we critically analyzed concerned the correlation between lmw rna species and mirnas . in fact , we proved that even with the same extraction protocol the concentration of mirnas may differ considerably between various preparations ( i.e. , extraction from different tissues ) . as a potential application of our results , we applied our findings to the comparison of some mirna expression in different tissues . we assessed the expression of hsa - mir-26a , hsa - mir-26b , and has - mir-134 as model mirnas and two small rnas ( u6 and snoz30 ) as controls . the expression profile comparison is correct only if we assume that the endogenous control ( u6 or others ) has a constant and equal expression in all the considered tissues . the lab - on - a - chip technology we used allowed precise quantification of input mirnas , ultimately leading to a fine correction of real - time pcr ct data for eventual variations . therefore , we obtained a reliable and correct estimate of the relative quantities of mirnas present in various tissues . surprisingly , the expression of mir-26a was the highest of all the mirnas in all the tissues considered ( fold change > 10 with respect to u6 ) . although our data are in good agreement with those reported in literature ( figure 7 ) , the high expression values found for mir-26a will deserve future investigations . however , the expression values of mir-26a reported in literature are also very high ( and higher than those of mir-26b ) and above the values of those tissue - specific mirnas considered as highly expressed ( i.e. , mir-1 for muscle , mir-124a for brain , and mir-122a for liver ) ( see figure 7 ) . in conclusion , all the methods we used in this paper allowed us to study accurately the efficiency of extraction protocols , analyze the small ( but significant ) differences between various preparations , and suggest a methodologically correct method for the comparison of mirna expression profiles in various tissues .
the recent development of engineered humanized monoclonal antibodies has increased their therapeutic efficacy and decreased their toxicity , expanding their potential for the treatment of cancer . tumors of epithelial origin , among which we have head and neck cancers , are one of the leading causes of death worldwide . this is a humanized monoclonal antibody ( mab ) expressed in ns0 cells and obtained at the center of molecular immunology by genetic engineering techniques [ 2 , 3 ] by the fusion of the hypervariable regions ( cdr ) of murine origin with the variable region frameworks and the constant regions of the heavy and light chains of human origin and back mutation of critical residues . this antibody recognizes the epidermal growth factor receptor ( egfr ) that is overexpressed in epithelial tumors and is associated with malignant transformation process [ 4 , 5 ] . nimotuzumab , being a human igg class 1 ( higg1 ) molecule , is composed of two identical heavy chains ( hc ~ 50 kda ) and two identical light chains ( lc ~ 25 kda ) . this glycoprotein presents one n - glycosylation site in each heavy chain mainly comprising nonsialylated biantennary fucosylated structures [ 2 , 7 ] . the presence of oligosaccharides is critical for the structure , stability , and biological function of the antibody . nimotuzumab has been extensively and rigorously characterized as requested for all recombinant proteins intended for use in human therapy [ 2 , 9 ] . in vitro and in vivo studies have demonstrated potent antitumor activity and antiangiogenic and proapoptotic so this antibody plays an important role as a therapeutic agent [ 10 , 11 ] as demonstrated by the results of the several clinical studies in which this molecule has been evaluated . as for any therapeutic product , a tight control the quantification from cells supernatant is required for the control of the purification of this recombinant protein . for this reason the implementation of a selective method , capable of determining the amount of igg in cells supernatant , is necessary . several methods can be used for the specific quantification of antibodies on complex samples ( like culture supernatant ) . ideally , the method should be fast and simple and provide high throughput . it should also provide an adequate level of specificity and sensitivity due to the presence of impurities and its low concentration . elisa is a method that fulfills all these criteria but can be labor intensive and can be more affected by matrix components than interfering with the antigen - antibody reaction . hplc represents an alternative method in those cases . for antibody quantitation , reverse phase and affinity based methods ( using protein but for companies handling several different antibodies , it might be difficult to find a common procedure suitable for all of them . this problem is overcome by the use of affinity columns , as long as all the products belong to a suitable igg isotype . in this sense the determination by affinity chromatography using protein g by hplc is an attractive method because it has very high affinity and specificity for the human igg antibodies . on the other hand , this technique has several advantages over other conventional methods because it provides a high capacity and selectivity and allows the removal of specific contaminants from biological samples . regulatory agencies require that this technique , like all those used for the monitoring of therapeutic biotechnology products , must be validated to confirm that the analytical method used for a specific test is suitable for the proposed use , ensuring its reliability . the validation of a specific method must be carried out using laboratory experiments where the samples or standards used are similar to the samples routinely analyzed . the parameters studied during validation of an analytical method must be defined in advance as described in the international conference on harmonization ( ich ) . this study is vital if one considers that the use of a nonvalidated technique for the control of some critical parameter may risk the patient 's life due to the use of products that do not have sufficient safety and/or efficacy . the drug product of nimotuzumab used for the standard preparations was contained in a formulation buffer composed by phosphate buffer , sodium chloride , and polysorbate 80 , ph 6.57.5 . the culture medium of the supernatant was pfhm - ii ( protein - free additives ) pluronic c , antifoaming , ns0 cell line components , and nimotuzumab . the calibration curve was prepared using a reference material of nimotuzumab ( mrt ) ( havana , cuba ) diluted in mobile phase a ( 2 , 4 , 6 , 8 , and 10 g ) . in all cases the area of the elution peak was determined and plotted against the igg concentration of the standards to construct the calibration curve ( linear regression ) . the result of the supernatant samples was obtained by interpolation of the area of the elution peak into the calibration curve . the affinity chromatography was performed in a high performance liquid chromatography ( hplc ) ( shimadzu , japan ) system consisting of a quaternary pump , a solvent degasser , a column oven , and a variable - wavelength uv detector . operation parameters were fixed and controlled through a personal computer using lc solution software version 1.25sp1 . a poros g/20 of 100 mm 4.6 mm ( applied biosystems , california ) column was employed using three mobile phases ( a : 0.05 m phosphate buffer , 0.02% sodium azide , ph 7.5 for equilibration of the column ; b : 0.25 m glycine , ph 2.5 for product elution ; c : 0.25 m glycine , ph 6.1 ) for washing of impurities before product elution . the flow rate of the mobile phase was 2 ml / min and the column temperature was 25c . the final profile is obtained after subtraction of the profile of a blank to assist in the integration of the baseline . the mobile phases b and c were modified varying the molarity values to 0.05 m , 0.1 m , 0.25 m , and 0.5 m and the tailing factor of the elution peak from each chromatogram was calculated . to determine the robustness of the analytical method 7 factors were evaluated ( ph of mobile phases a and b ; molarity of mobile phases a , b , and c ; column batch ; oven temperature ) using a plackett - burman factorial experimental design . the variable used for statistical treatment of the data was the igg concentration from nimotuzumab reference material , and the effect of each factor on the response was calculated as defined by van der hayden et al . acceptance criteria are as follows : the effects of the analyze factors should not be more than the margin of error determined by the method . the interference of the matrix was evaluated from a run using formulation buffer , cell culture supernatant from nontransfected ns0 cells ( sn ns0 ) , and mobile phase a as independent samples . besides , the parallelism of the standard curves prepared in mobile phase a ( mpa ) was tested with respect to curves prepared in culture media : culture medium pfhm ii ( cm pfhmii ) and culture medium pfcho ( cm pfcho ) . the parallelism test was performed using a regression analysis comparing the slopes and intercept between calibration curves . acceptance criteria are as follows : there should be no signals on the profiles from samples not containing the analyte during the elution time of the product . repeatability and intermediate precision studies were assessed from the analysis of four different batches of cell culture supernatants ( sn ) during two experimental days using two different equipments . the statistical analysis was performed by analysis of variance ( anova ) [ 26 , 27 ] and the % rsd of repeatability and intermediate precision was determined from the standard deviation of the method and the analyzed factors ( day / equipment ) . acceptance criteria are as follows : the % rsd for the repeatability and intermediate precision analysis should not be more than 2% and 3% , respectively . the linearity of the method was evaluatedinjecting different amounts of igg ( 2 , 4 , 6 , 8 , and 10 g ) . a curve was plotted between the area of the elution peak versus the applied igg mass . acceptance criteria are as follows : the determination coefficient should not be less than 0.98 , and the slope should be different from zero . the igg concentration of different batches of drug product and reference material of nimotuzumab ( mr ) was determined by hplc - protein g and do280 nm ( used as a reference method ) . the ratio between the concentrations for both test methods ( igg concentration hplc / igg concentration do280 nm ) was calculated . in addition different concentrations of reference material of nimotuzumab were evaluated in duplicate , comparing the observed and theoretical values . the detection and quantification limit of the test method was calculated from the standard deviation and the slope of the calibration curve used in the linearity study as described in ich guidelines . acceptance criteria are as follows : the loq should not be more than 2 g . the range was established from the results obtained during precision studies , linearity and accuracy . the original method used 0.05 m glycine , ph 6.1 and 0.05 m glycine , ph 2.5 as mobile phases for washing , and elution , respectively . in these conditions the peak had a broad shape with a long tail . by increasing the molarity of the above - mentioned solutions to 0.25 and 0.5 m , it was possible to reduce the tailing factor below 2.0 , as recommended by usp [ 28 , 29 ] ( see table 1 and figure 1 ) . the use of 0.25 m glycine solutions allowed a better analysis of the chromatograms since peak start and end points are easier to assign . the final chromatographic conditions are those described in section 2.4 . table 2 shows the plackett - burman factorial experimental design and the igg concentration from nimotuzumab reference material used for the evaluation of the robustness study . the evaluation of the significance of the effects obtained by each parameter on the igg concentration is shown in figure 2 . the effects represent differences in the result of igg concentration obtained for upper and lower values of each factor . subsequently the margin of error ( me ) and simultaneous margin of error ( sme ) were calculated . these margins represent the limit where the effects begin to be considered as significant . figure 2 shows that all the effects caused by the factors studied are below the me and sme limits , so the igg concentration determined is not significantly affected by any of these factors . although it does not constitute a significant factor because it does not exceed the limit , a tight control must be established over the levels of variation for this parameter compared to the rest . this study demonstrates the robustness of this analytical procedure as a measure of its capacity to remain unaffected by small but deliberate variations in method parameters and provides an indication of its reliability during normal usage [ 20 , 25 ] . since nimotuzumab is obtained from transfected ns0 cells and fermented in protein - free medium , in the process another source of antibodies does not exist that may interfere with the response of the method . the chromatograms of figure 3 show the absence of ghost peaks in the formulation buffer . this is expected because in the buffer there should not be substances generating signals , and also in the absence of analyte the peaks must not be detected . this similar behavior was expected between the mobile phase a and the formulation buffer because in both cases the composition is similar . the formulation buffer has other components ( sodium chloride and polysorbate 80 ) which must not emit signal on the test . these results support the use of the mobile phase a into preparation of calibration curve . additionally , a similar behavior was observed between the sn ns0 and mobile phase a ( figure 4 ) . this result is again expected because this supernatant was obtained from a nontransfected ns0 cell line and therefore did not produce the antibody , confirming then that other host cell related proteins do not interfere with the results . the parallelism test was performed using a regression analysis comparing the slopes and intercepts between the calibration curves prepared in different matrixes . in all cases , the parallelism was demonstrated between the calibration curves and obtained high correlation coefficient values ( table 3 ) . the statistical analysis demonstrated that the slopes were significantly different from 0 ( p < 0.05 ) ; thus there is a correlation between the peak area and the igg mass . furthermore significant differences were not observed between the slopes and intercepts of the calibration curves prepared in culture medium , with respect to the calibration curve prepared in mobile phase a ( p > 0.05 ) which is indicative not only of parallelism but also of coincidence between them . therefore the specificity study reveals that there are no interference contributions from the components of the different culture medium used , which justifies the feasibility of using this method for the analysis of samples in cm pfcho or cm pfhmii culture medium . all of the above demonstrates the specificity of the method to unequivocally evaluate the analyte . in the repeatability study the % rsd was less than 1% , demonstrating the repeatability of the method between independent determinations using the same operating conditions in a small time interval [ 26 , 30 ] . the factors day and equipment did not contribute significantly to the overall variability of the results in our working conditions . therefore intermediate precision results are similar to those of repeatability , complying the acceptance criteria ( % rsd less than 3% ) . it can be concluded that the method for quantification of igg by protein g is precise . the linearity study was performed plotting the area of the elution peak versus the applied igg mass ( figure 5 ) . the determination coefficient ( r ) was greater than 0.98 , which ensures that a high correlation exists between the variables peak area and applied antibody mass . moreover , the statistical regression analysis showed a p < 0.05 ( p = 0.000 ) for the slope being significantly different from 0 and the stadigraph lack of fit showed a p > 0.05 ( p = 0.628 ) , demonstrating the linearity of the method from its ability to obtain results directly proportional to the concentration of analyte in the sample within the given range . the study of accuracy allows expressing the closeness of a value that is accepted as standard or an accepted reference value and the value obtained . the relationship between the concentrations for both test methods ( igg concentration hplc / igg concentration do280 nm ) was calculated ( figure 6 ) . the results varied within 10% for all batches evaluated , complying the acceptance criteria established ( 20% ) in this validation . table 4 shows the comparison of the observed values with respect to the theoretical ones . a very high percent of recovery was obtained demonstrating the method accuracy in the range of 210 g . the detection and quantitation limit yielded similar results ( 1.1 g ) because the slope of the calibration curve causes that the differences between the corresponding values of igg mass are negligible . the above - mentioned mass corresponds to a product concentration of 0.022 mg / ml . according to the results obtained during precision , linearity , and accuracy studies , the range of validity of the test is established between 2 and 10 g of antibody applied to the column . the method developed for the quantification of igg for affinity chromatography using protein g is robust , specific , precise , linear , and accurate . therefore this method can be used for the analysis of culture supernatant and drug product and could be widely used for the routine analysis and quality control because is an attractive , simple selective assay .
psychotic disorders and schizophrenia are disabling conditions characterized by positive symptoms , negative symptoms , and cognitive impairments . most individuals with schizophrenia have a poor long - term outcome resulting in personal suffering and psychosocial disabilities including impaired interpersonal and vocational skills . these drugs have been shown to be effective during the acute phase and for preventing relapse ( kennedy et al 2000 ; quraishi and david 2000 ) ; kisling ( 1994 ) argued that if patients complied fully with their medication , relapse rates would fall to about 15% ( almost 50% of patients relapse within a year of achieving remission ) . noncompliance is common throughout medicine , but some aspects of schizophrenia may make it particularly difficult for patients to accept their treatment . although antipsychotic medication decreases symptoms , other issues may temper these beneficial effects , resulting in poor compliance and high rates of relapse . these issues include the side effects of antipsychotic drugs ( such as weight gain , parkinsonism ) , and poor functional recovery following psychotic episodes . the rate of noncompliance is difficult to assessed , but has been estimated at 25%41% ( jeste et al 2003 ) . hogarty and colleagues ( 1997 ) demonstrated that the relapse rate increases from 40% to 65% after one year and to 80% after two years if medication is discontinued . however , if psychosocial treatment is given in addition to maintenance drug treatment , the relapse rate may be up to 50% lower than that for drug treatment and standard care . factors associated with noncompliance include poor insight , negative attitude to medication , a history of noncompliance , substance abuse , short duration of illness and a poor therapeutic alliance ( jeste et al 2003 ) . individuals suffering from psychosis tend to have impaired social functioning ( erickson et al 1989 ; grant et al 2001 ) , quality of life ( priebe et al 2000 ; addington et al 2003a ; addington 2003b ) , cognitive and occupational functioning , even if they display clinical recovery ( penn et al 2005 ) . these rate - limiting factors should be considered as therapeutic targets for improving psychosocial outcome and increasing the readiness of people with schizophrenia to undergo rehabilitation . baseline attitudes to treatment and motivational and training variables also affect remediation ( ( fiszdom et al 2005 ) . several programs dealing with these aspects have been developed and the term of compliance therapy is sometimes used ( kemp et al 1996 , 1998 ) . compliance therapy includes cognitive behavioural therapy , psychoeducation and remediation , with the aim of providing information about the illness and side effects , and improving cognitive and psychosocial functioning . the articles were selected from the medline and pubmed databases , using the following terms : ( 1 ) remediation , ( 2 ) rehabilitation , ( 3 ) psychosis , ( 4 ) antipsychotics , and ( 5 ) psychosocial treatment . relapse rates have been shown to be up to five times higher in noncompliant than in compliant subjects , resulting in significantly higher costs for these patients and for society ( robinson et al 1999 ) . several studies have investigated the possible relationship between compliance and type of antipsychotic medication ( kane et al 1985 ; lacro et al 2002 ) . some have suggested that the use of atypical antipsychotic drugs may be associated with fewer side effects , better compliance and a lower rate of relapse . the newer antipsychotic drugs efficiently attenuate the symptoms of schizophrenia without causing dysphoria and motor side effects . this higher tolerability and efficacy may lead to more positive attitudes to drug treatment in schizophrenic patients taking second - generation antipsychotic drugs than in patients taking first - generation antipsychotic drugs ( day et al 2005 ) . marder and colleagues ( 1996 ) showed in their review that periodic visits for blood monitoring , which are obligatory for patients on clozapine , improved the therapeutic alliance , making it easier for the clinician to monitor compliance . the question of the relationship between adverse effects and compliance with medication is highly complex . some studies have reported a significant relationship between various adverse effects and noncompliance , whereas others do not . according to kampman and colleagues ( 2002 ) , patients predictions concerning their compliance extra - pyramidal effects are most frequently considered anticholinergic and other adverse effects are also linked to compliance . according to freudenreich and colleagues ( 2004 ) , extra - pyramidal symptoms are not the primary factor determining attitudes to treatments . these authors studied the relationship between drug attitude inventory ( dai scale ) score and psychopathology , insight , extra - pyramidal symptoms , level of functioning and type of antipsychotic drug in 81 schizophrenic outpatients . their results suggest that patients who recognize adverse effects of therapeutic drugs may actually have a more positive attitude . it has also been suggested that personal characteristics such as attitude to health and illness , may be critical in determining attitudes to medication ( jeste et al 2003 ) . these factors might reduce the importance of medication - related side effects in determining treatment compliance . indeed , it has been shown that distress due to side effects is not necessarily linked to noncompliance in outpatients with schizophrenia ( weiden et al 1991 ) . in addition , no significant difference in compliance was found between depot , first- and second - generation antipsychotics ( rittmannsberger et al 2004 ) . schizophrenic subjects do not perceive side effects and symptoms as independent ( carrrick et al 2004 ) . in a review of the literature concerning side effects and compliance , lacro and colleagues ( 2002 ) reported that subjective response to medication affects both compliance and the risk of relapse . these results were confirmed by rettenbacher and colleagues ( 2004 ) , in both inpatients and outpatients . these authors demonstrated a positive correlation between compliance and the patients impression that the drug had a positive effect on the illness . they therefore stressed the need to include patients and their relatives in the treatment decision process , to increase treatment compliance . perkins and colleagues ( 1990 ) proposed a model in which compliance with treatment is determined by the patients assessment of the perceived benefits of treatment and the risks of illness versus the costs of treatment , including adverse effects . patients who believe that the risks of treatment outweigh patients who recognize the therapeutic effects of their medication may therefore have a more positive attitude to treatment . thus , side effects do not seem to be the main predictor of compliance : attention should therefore be paid to the patients subjective feelings about treatment , including the recognition of positive and negative therapeutic effects in particular . pharmacological treatments are the first - line treatment for schizophrenia , but adjuvant treatments are also required to achieve functional recovery or to prevent relapse because antipsychotic drugs may not be sufficiently effective and noncompliance is a common problem ( ratakonda et al 1997 ) . psychotic disorders and schizophrenia should therefore be treated with a combination of drugs , psychological treatment and the rehabilitation of cognitive disorders and social skills . several approaches have been developed including supportive therapy , integrated psychological treatment and social skills training . interest in psychoeducation and remediation has recently increased ( spaulding et al 1999 ; wikes et al 1999 ; penads et al 2002 ; addington et al 2004 ; byerly et al 2005 ) . educational interventions aim to provide patients with information about their illness and medication , with a view to increasing their understanding and promoting compliance . penads and colleagues ( 2002 ) showed that clinically orientated cognitive rehabilitation treatments seem to improve not only cognitive functioning and other functional aspects related to the illness . they compared 24 schizophrenia patients with cognitive impairment and 10 schizophrenia patients without cognitive impairment on integrated psychological treatment . some studies have reported a positive correlation between executive functions , as evaluated with the wisconsin card sorting test and social competence ( spaulding et al 1999 ) , or between verbal memory performance and psychosocial skill acquisition ( spaulding et al 1999 ; wikes et al 1999 ) . in 1996 , marder and colleagues randomly assigned eighty patients with schizophrenia to two groups , receiving either social skills training or supportive group therapy . significant main effects were identified , showing that social skills training was significantly more effective than supportive group therapy and significant interactions between psychosocial treatment and drug treatment were identified . however , the improvements observed were modest and confined to certain subgroups of patients . mcpherson and colleagues ( 1996 ) compared one educational session with three educational sessions . they found that both regimes improved the patients knowledge about their medication but that three sessions of education gave significantly better results than one educational session during follow - up . four studies by addington and colleagues ( 2001 , 2003a , 2003b , 2004 ) examined the results of the calgary early psychosis program ( offering a wide range of psychosocial interventions targeting the family , drug therapy , social skills ) in patients with nonaffective first - episode psychosis ( examining social functioning and quality of life over the course of one year ) . however , only one of these studies reported a better quality of life and social functioning in patients receiving such interventions ( addington et al 2003b ) . one study reported a decrease in the use hallucinogens , cannabis and alcohol in heavy users ( addington et al 2001 ) and another reported improvements in depression ( addington et al 2003a ) . computer - assisted cognitive enhancement therapy has been shown to modify cognitive style and social cognition in 121 schizophrenia patients ( hogarty et al 2004 ) . the observed relapse rate was low in this study ( 10% after two years ) , and was significantly lower in the subgroup of patients with an iq of 80 or higher . finally , byerly and colleagues ( 2005 ) examined the effect of a cognitive and psycho - educational approach in an open trial including 30 subjects with schizophrenia and schizoaffective disorders . symptoms , insight , and attitude to medication did not change significantly during the study . most studies have demonstrated that cognitive deficits and related behavior are improved in patients suffering from schizophrenia , provided with sufficient rehabilitation ( spaulding et al 1999 ; wikes et al 1999 ; penads et al 2002 ; addington et al 2004 ) . recommendations for a specific psychosocial intervention in schizophrenia are probably best made on the basis of patient characteristics : intelligence , duration of illness , and phase of illness ( hogarty et al 2004 ) . a meta - analysis of randomised controlled trials of social skills training and cognitive remediation provided no clear evidence of any benefits of social skills training on the global adjustment of relapse rate , social functioning , quality of life or treatment compliance ( pilling et al 2002 ) . most studies on cbt in schizophrenia have assessed the efficacy of this approach and its effects on the symptoms of schizophrenia ( see turkington et al 2006 ) . however , few studies have tested whether cbt is more beneficial than treatment as usual ( tau ) in terms of relapse and rehospitalization rates . some studies have shown cbt to be of benefit in the treatment of positive ( tarrier et al 1998 ) and negative schizophrenia symptoms ( sensky et al 2000 ) . a prospective , multicentre , randomised controlled trial , with rater blinding and an 18-month follow - up period was conducted by tarrier and colleagues ( 1998 ) . in this study , cbt was found to be significantly more effective than tau for attenuating symptoms and reducing relapse and rehospitalization rates . other studies have also reported cbt to be significantly more effective than tau in psychotic subjects suffering from an acute episode ( lewis et al 2002 ; tarrier et al 2004 ; startup et al 2004 ) or chronic illness ( turkington et al 2002 ; durham et al 2003 ; rector et al 2003 ; trower et al 2004 ) . similar improvements were also observed when the patients insight was assessed ( rathod et al 2005 ; valmaggia et al 2005 ) . the patients insight into compliance and its implications were significantly better in cbt group than in the tau group , but this difference was not maintained at follow - up ( rathod et al 2005 ; valmaggia et al 2005 ) . functional cbt ( fcbt ) has recently been developed as a novel approach for the treatment of psychotic symptoms . this technique was developed to extend the effects of cbt beyond symptom reduction , focusing on symptom interventions , working on functional goals . the therapeutic alliance and the patients motivation are thought to be improved by linking interventions to life goals . in a pilot study , carter and colleagues ( 2005 ) compared fcbt with psychoeducation ( pe ) in 30 outpatients with schizophrenia . both treatments consisted of weekly one - hour individual sessions for a total of 16 weeks . fcbt was significantly correlated with greater attenuation of positive symptoms and improvements in functioning ( 60% for fcbt versus 31% for pe ) . the cbt group had significantly lower rehospitalization rates and higher levels of compliance with medication , persisting for more than two years . finally , zimmermann and colleagues ( 2005 ) performed a meta - analysis on the efficacy of cbt in schizophrenia . this meta - analysis supported the general conclusion that cbt is a promising approach for the adjuvant treatment of positive symptoms in schizophrenia . moreover , the therapeutic effects of cbt persist during follow - up , suggesting that cbt has long - term effects . similar conclusions were drawn by butler and colleagues ( 2006 ) in a review of meta - analyses . a large effect on the decrease in psychotic symptoms has been found and long - term follow - up has shown the maintenance of gains and even an increase in their magnitude . however , both authors highlighted a number of variables that have not been specifically examined such as therapeutic alliance and neuropsychological deficits . personal therapy has a pervasive effect on social adjustment , which continues to improve three years of after discharge ( hogarty et al 1997b ) . however , personal therapy increases the rate of psychotic relapse for independent patients living away from their families ( hogarty et al 1997a ) . the intervention of the family has also been identified as important for preventing relapse and readmission ( pilling et al 2002 ) . according to kemp and colleagues ( 1996 , 1998 ) , three dimensions define insight : acknowledgment of the psychiatric disease , ability to recognize psychiatric symptoms , and compliance with treatment . the lack of insight , or unawareness of illness in people with schizophrenia has been recognized as a medical condition : anosognosia . a dutch study has indicated that 80% of schizophrenic patients are aware of their diagnosis ( van meer et al 1997 ) . only 20% of these subjects sought this information from their psychiatrist , the others received this information from their doctor without asking for it . in a french study , more than 60% of patients declared that they knew the name of their illness and were able to talk about schizophrenic or psychotic disorders ( ferreri et al 2000 ) . wirshing and colleagues ( 2002 ) showed that only 10% of people suffering from schizophrenia were able to understand this from their first interview with the psychiatrist . a second explanation from the doctor was required in 53% of the cases . this study showed that the level of comprehension is correlated with the conceptual disorganization item of the bprs scale . several specialists regard the question of insight as a major factor , enabling schizophrenia patients to take an active role in managing their symptoms and problems . previous studies focusing on insight or self - awareness in schizophrenia have suggested that this cognitive dimension may have nosological value ( rittmannsberger et al 2004 ) . the results obtained suggest that severe self - awareness deficits are a prevalent feature of schizophrenia ( smith et al 2004 ) . the lack of insight of schizophrenia patients is an important clinical issue . in a reference study of about 35 male forensic patients suffering from chronic schizophrenia , only 51% believed that they were suffering from a mental disorder ( goodman et al 2005 ) . in this study , a similar proportion reported awareness of a need for medication and correctly attributed symptoms to illness . this study also showed that poorer insight was correlated with a higher frequency of violent events . amador and colleagues ( 1994 ) suggested that the lack of insight has two components : unawareness of illness and incorrect attributions of the causes of illness . insight into illness and greater recognition of symptoms , severity of illness and functioning are predictors of a more favorable outcome in schizophrenia . symptom awareness deficits are common in schizophrenia and have been associated with poor treatment compliance ( davis et al 2004 ) . several studies have reported that individuals with severe negative symptoms tend to have the poorest insight ( amador et al 1994 ; collins et al 1997 ; schwartz et al 1998 ; carroll et al 1999 ) . in all these studies , impaired insight was considered to be an important factor contributing to poor treatment response and outcome in schizophrenia . droulout and colleagues ( 2003 ) studied the relationships between insight and compliance with medication in subjects with psychosis . they demonstrated that compliance with medication is associated with the level of insight , independently of the patients other demographic and clinical characteristics . this association between low - level insight and poor compliance with medication has been confirmed in several studies . the question of the quality of life of individuals suffering from schizophrenia remains a little - studied issue . awad and colleagues ( 2004 ) developed a conceptual model , suggesting that the major determinants of quality of life in schizophrenia are symptom severity , level of psychosocial functioning , and the presence of medication side effects . this model also suggests that quality of life may be influenced by the individual s subjective response to neuroleptic medication . some previous reports have suggested that insight has a major impact on quality of life scores ( atkinson et al 1997 ) . the evaluation of quality of life made by individuals with schizophrenia may be influenced by the presence of psychotic symptoms and by adaptation to the adverse social circumstances that they frequently experience . in several epidemiological studies , schizophrenic patients with poor insight , particularly those who displayed a lack of awareness of the consequences of the illness , were found to be more socially isolated and to have poorer psychosocial functioning ( amador et al 1994 ) . according to browne and colleagues ( 2005 ) , there is no significant relationship between quality of life and the level of insight . these authors reported a direct link between the development of treatment strategies to alleviate neuroleptic - induced dysphoria and the benefits of rehabilitation programmes for improving quality of life . in everyday life , the question of quality of life is associated with the problem of comorbidity . for example , nicotine problems are very frequently diagnosed by psychiatrists in people suffering from schizophrenia ( montoya et al 2005 ) . patients with such nicotine problems display poorer treatment compliance than their counterparts without such problems ( hudson et al 2004 ) . in a sample of 1843 patients followed by psychiatrist , this study suggests that psychiatric patients who smoke have more clinical and psychosocial stressors and more severe psychiatric problems than those who do not smoke ( montoya et al 2005 ) . little is known about the extent to which patients suffering from schizophrenia are preoccupied by their health and how often they request assistance to give up smoking . in many studies , the therapeutic alliance has been associated with compliance ( fenton et al 1997 ; kampman et al 1999 ; lacro et al 2002 ; day et al 2005 ) . more and more studies are now examining the subjective reasons for which patients are willing or reluctant to take medication . according to loffler et al ( 2003 ) , the quality of relationships with clinicians during acute admissions appears to be a major determinant of patients attitudes to treatment and compliance with medication . they assessed attitudes to treatment and self - reported compliance with medication in 28 inpatients and showed that a poor relationship with the prescriber , a feeling of being coerced during admission and a low level of insight were predictive of a negative attitude to treatment . similarly , two other studies have shown that feelings of coercion were associated with a tendency to reject psychiatric services ( rogers et al 1993 ; lidz et al 2000 ) . in a study of compliance in outpatients , rittmannsberger et al ( 2004 ) found that regular visits to a psychiatrist were correlated with good compliance . according to these authors , not visiting a psychiatrist could be seen as just another aspect of noncompliance . they also suggested that visiting a psychiatrist may protect against noncompliance . according to davis et al ( 2004 ) these authors showed in a sample of 24 patients with schizophrenia spectrum disorders , that poorer performance in verbal memory tests was significantly related to client reporting of a strong alliance , whereas better performance in visual spatial reasoning tests was significantly related to therapist reporting of a strong alliance . published studies on compliance have highlighted the importance of assessing the factors influencing compliance at an early stage of the disease process . side effects of medication and the patient s awareness of their illness are major issues in the treatment of psychotic disorders because of the high rate of relapse . the use of atypical antipsychotic drugs , in addition to reducing schizophrenic symptoms , may also be associated with fewer side effects . the higher tolerability and efficacy of these drugs may lead to more positive attitudes to drug treatment in schizophrenic patients taking second - generation antipsychotic drugs . psychosocial interventions , cognitive remediation and psychotherapy have all been proposed as adjuvant treatments for increasing compliance , but the most robust results have been achieved with cognitive behavioral therapy . thus , reducing the side effects of the antipsychotic medication associated with psychological interventions seems to be a major challenge in efforts to improve compliance .
recently , the use of water soluble fluorescent conjugated polymers ( cps ) as either chemical or biological sensing elements has received wide interest [ 15 ] . cps contain a large number of absorbing and delocalized molecular units , and the transfer of excitation energy along the whole backbone of the cp to the energy / electron acceptor results in an amplification of fluorescence signals . therefore , cps have been successfully employed in the detection of various substances including dna , rna , protein , metal ions , and even ph and temperature [ 69 ] . aptamer , a kind of one single - stranded dna or rna sequences , can be synthesized with the systematic evolution of ligands by the exponential enrichment ( selex ) procedure [ 10 , 11 ] . the unique properties of aptamer is that it can bind with a variety of targets ranging from small molecules , proteins , and even to cells at very high affinity . unlike elisa , immunobead assay , and western blotting , some unspecific second , their binding affinities and specificities can be manipulated easily and improved by rational design or by techniques of molecular evolution . therefore , aptamer is widely utilized as recognition molecular for detecting a variety of targets ranging from small molecules , proteins , and even cells [ 1217 ] . in this paper , we propose utilizing water - soluble fluorescent polythiophene derivative and aptamer for detecting l - arm . on one hand , thiophene polymer can be easily prepared through oxidation of the corresponding monomers ; on the other hand , thiophene polymer can detect , transduce , and possibly amplify chemical , biological , and physical changes into measurable optical or electrical signals with very high sensitivity [ 1821 ] . the stock solution of pt ( 2 10 m , per repeat unit ) was dissolved in pure water and used by appropriate dilution , all the oligonucleotides ( aptamer , a1 , a2 , a3 , and a4 , listed in table 1 . of the four aptamers , a3 was an unrelated one that was designed for control experiment ) solutions were prepared in 10 mm tris - hcl ( ph 7.4 , containing 0.01 m nacl ) buffer solution . for fluorescence assay , in 5 ml eppendorf tube , a 20 l of pt solution was added to 4 ml tris - hcl aqueous buffer solution , followed by the addition of 10 l aptamer ( a1a4 ) and l - arm , respectively . the final concentration of pt was 1.0 10 m , l - arm was 1.0 10 m , and aptamer was 3.3 10 m. the mixtures were incubated in water at 45c for reaction and detection . the concentration of dna was determined by measuring the absorbance at 260 nm in a 3 ml quartz cuvette . tris(hydroxymethyl)aminomethane ( tris ) was purchased from a chemical company . unless other specified , the rest reagents were analytical grade and used without further purification . fluorescence measurements were acquired in 3-ml quartz using a luminescence spectrometer equipped with a temperature - controlled cuvette holder and a circulating bath . as shown in figure 1 , at room temperature , mainly due to the electrostatic attraction between positively charged pt and negatively charged aptamer , the fluorescence of pt in each solution was weak , even in the presence of l - arm ( figure 2 ) . when the solution was heated to 45c , the fluorescence of pt was recovered to a certain extent . as shown in figure 3 , the fluorescence intensity of pt in the solution containing the hairpin conformation aptamer a1 , pt , and l - arm was the highest , followed by a2 and a3 , and the fluorescence of solution containing the linear conformation aptamer a4 showed no pronounced change . therefore , a1 was chosen as the best candidate for the detection of l - arm . besides the different fluorescence intensity , an evident red shift was also observed . unlike detection of mismatched or perfectly matched ssdna in the published literature , in which the maximum emission is restored to be at 520 nm , in this experiment , the maximum emission of pt was located at 560 nm . only under a certain temperature , pt , l - arm and a1 could constitute a stable complex , and the fluorescence of the system recovered to maximum level . as shown in figure 4 , with the increase of temperature , the fluorescence intensity of the system enhanced gradually , especially in the range of 45c50c , and the fluorescence intensity reached the maximum . however , when the temperature rose higher , the fluorescence intensity of the system decreased a little . one possible reason was that the structure of the system might be destroyed under the higher temperature . ph of the buffer system was another factor which could have potential impact on the intensity of fluorescence . in order to investigate the influence on recovery efficiency , a different ph value of the buffer solution was prepared for the experiment . figure 5 indicated that the neutral ph was helpful for the recovery of the fluorescence . in the following experiments , the buffer of ph 7.4 was used for the detection . under room temperature , even with the addition of l - arm to the solution consisting of a1 and polymer , the fluorescence of the system could not be recovered . only under a certain circumstance , for example , after heating , a1 , polymer , and l - arm developed a loop formation ( figure 6 ) , and the bases matched with each other to form a hydrophobic region and a closer structure , and the fluorescence of the system could be recovered . moreover , l - arm played a vital role for stabilizing the structure via hydrogen bond with the right aptamer . the aptamer with loop , or other aptamer without loop , even under the previously mentioned conditions , could not form a more stable structure , and thus the fluorescence of the system would not recover completely . since the addition of l - arm could make the fluorescence recovery , it was hoped that the aptamer and polymer composite could quantitatively reflect the amount of l - arm added . as shown in figures 7 and 8 , by monitoring the fluorescence intensity at 514 nm , a good linear relationship was obtained in the range from 1.0 10 m to 1.0 10 m. the limit of detection at an s / n ratio of 3 was 4.7 nm . in order to verify the specific detection of the aptamer to l - arm , three controlled experiments with addition of k , arginine , and bsa ( bovine serum albumin ) single - stranded dna with g - rich sequences was able to fold into secondary structures quadruplex via intramolecular hydrogen - bonding interactions in the presence of k . when the potassium ion specifically bound to the g - quadruplex dna , the fluorescence of the system was recovered to the high point by using cationic polyfluorene . in this experiment , arginine , an amino , whose structure was very similar to that of l - arm and bsa , a commonly used protein in the lab , was also chosen for deciding the binding specificity . in these cases ( seen in figure 9 ) , the addition of k , arginine , and bsa could not render the fluorescence recover , and only in the presence of l - arm , the fluorescence of the system could recover to the maximum , which indicated that the polymer and aptamer system could offer a specific approach for detection of l - arm . the concentrations of polymer , l - arm , a1 , k , arg , and bsa were 1.0 10 m , 1.0 10 m , 3.3 10 m , 1.0 10 m , 1.0 10 m , and 1.0 10 m , respectively . tris - hcl was 0.01 m and contained 0.1 m nacl , ph 7.4 . in summary , we have developed an exceptionally simple , rapid , and specific method for detection of l - arm without any complicated protocols or laborious modification . when aptamer , a special oligonucleotide , quenched the fluorescence of the polymer , the addition of l - arm could make the fluorescence recover under a certain condition . the quenching and recovery mechanisms are ascribed to the electrostatic interactions and energy transfer between polymer and aptamer . moreover , the recovered emission intensity is proportion to the concentration of l - arm , whereas a new homogeneous assay measurement for l - arm is established with a lod as low as 4.7 nm . since other substances did not have the obvious influence on the fluorescence of the system , the method could be applied for specific detection of l - arm .
attempts to minimize this include minimal tumor manipulation prior to ligation of the venous drainage . laparoscopy has become a standard option for the management of adrenal tumors . in cases of pheochromocytomas , most surgeons prefer to use the transperitoneal approach , with the belief that it affords a better view and easier approach to the vessels . we performed adrenalectomies for pheochromocytomas in 12 patients by using the retroperitoneal laparoscopic approach and present the first study comparing this approach with retroperitoneal open surgery . beginning january 1996 , 12 retroperitoneoscopic adrenalectomies were performed for functioning pheochromocytomas in 10 patients at our center . 7 open adrenalectomies by the extrapleural - extraperitoneal flank approach were performed for pheochromocytoma in 6 patients . the choice of procedure depended on the surgeon because 2 surgeons at our center do not practice laparoscopy . patients in the 2 groups were comparable in terms of age , sex , side of tumor , and size of tumor . all patients underwent either a preoperative computed tomography ( ct ) or magnetic resonance imaging ( mri ) scan for tumor localization . hypertension was controlled with a combination of alpha- and beta - adrenergic blockade prior to surgery . three 10-mm ports were used in all cases with some requiring an additional 5-mm port to aid dissection . a combination of digital dissection and hydrostatic balloon distension was used for the creation of the retroperitoneal space , more cranially than is done for a nephrectomy . on occasions on the left side , the renal hilum was directly approached to expose the renal vein . the adrenal vein was identified on its cranial surface and ligated before further manipulation of the gland . on the right side , the inferior vena cava was identified and traced up to the gland that was dissected primarily before ligating the short adrenal vein as it enters the vena cava . all specimens were retrieved intact by extending the primary port . during the same period , 7 open surgical adrenalectomies for pheochromocytomas were performed in 6 patients with 1 bilateral surgery . all procedures were performed with the patient in the lateral decubitus position . a flank incision was used and the dissection kept in the retroperitoneum , outside the pleural cavity . a retrospective analysis was performed of the various intra- and postoperative data , and the 2 procedures were compared using the wilcoxon rank sum test for statistical significance . retroperitoneoscopic adrenalectomy was successfully performed in 11 cases with 1 conversion to open surgery ( 8.33% ) . in 2 cases , one patient undergoing retroperitoneoscopic adrenalectomy on the right gland developed a retroperitoneal collection and hemothorax that required intercostal drainage for 3 days . two patients undergoing open surgery developed severe chest infection with one requiring ventilator support for 4 days . two patients in the open surgery group also developed wound infection in the postoperative period . in the retroperitoneoscopy group , 1 conversion to open surgery was required due to nonprogress of the dissection . all patients undergoing retroperitoneoscopy were started on oral fluids the same evening and ambulated the next morning . all parameters assessed , ie , operative time , blood loss , hospital stay , and analgesia requirements , were lower in the retroperitoneoscopy group . laparoscopy has become an established modality of treatment for a large number of urologic conditions . between the 2 techniques of laparoscopy retroperitoneoscopy does not require colonic mobilization or bowel handling and thus minimizes the chances of bowel injury and ileus . suzuki et al5 had to abort their randomization into transperitoneal and retroperitoneal approaches for adrenalectomy in favor of the retroperitoneal approach because of a strong preference by the patients and referring physicians . adrenalectomy is considered one of the more advanced laparoscopic procedures , requiring greater experience and technical skills . among the various adrenal tumors amenable to laparoscopic excision , pheochromocytomas pose a specific challenge due to the associated hemodynamic effects of tumor manipulation and the need for early control of the draining veins . gill found only 5 series consisting of 61 patients reporting exclusively on laparoscopic adrenalectomy for pheochromocytoma . while most reports of retroperitoneoscopy for pheochromocytoma have been limited to occasional cases , soulie et al 's experience of 9 cases is the first series reported . we have compared our experience of 12 retroperitoneoscopic procedures with 7 cases performed by open surgery , using the same retroperitoneal approach . one of the basic tenets of surgery for pheochromocytoma is the early control of adrenal veins to prevent release of catecholamines into the circulation during tumor manipulation . retroperitoneoscopy is ideally suited for this approach because it allows direct access to the renal hilum and the adrenal vein , particularly on the left side , without approaching the adrenal gland itself . even during open surgery , nagesser et al found the retroperitoneal approach superior to the transabdominal one for tumors considered otherwise suitable for laparoscopy . although directly approaching the vein may not be feasible on the right - sided gland , the tumor manipulation necessary to lift the gland and reach the vein from behind it is lower than that in open surgery . the magnification provided by the telescope makes the identification easier and subsequent dissection can be carried out without fear of hypertensive crises . unlike a nephrectomy , concerns regarding availability of space for dissection during retroperitoneoscopy are also lower for adrenalectomy because the adrenal is a smaller gland . fernandez - cruz et al have shown that the amount of catecholamines secreted during laparoscopic adrenalectomy is lower than that during open surgery and suggest that tumor manipulation is lower during laparoscopy . sprung et al confirm that the hemodynamic changes that occur during laparoscopy for pheochromocytomas are similar to those occurring during open surgery . janetschek , in a recent review of the role of laparoscopy for adrenalectomy , confirms that laparoscopy does not increase the risks specific to pheochromocytoma surgery . our mean operative time is similar to that reported for retroperitoneoscopic adrenalectomies for pheochromocytoma by soulie et al and lower than that reported for the transperitoneal approach . the operative time also compares favorably with that reported for retroperitoneoscopic adrenalectomy for tumors other than pheochromocytomas . although this may be the result of increasing experience and intact specimen removal without spending time on morcellation , it may also be due to the direct access afforded by retroperitoneoscopy without the need for reflecting the colon in a transperitoneal approach . our mean blood loss , hospital stay , and analgesia requirements are similar to those reported in the literature ( table 2 ) . retroperitoneoscopy allows direct access to the adrenal glands without the risks associated with a peritoneal transgression such as bowel injury . however , this does not mean that no risk to the abdominal viscera exists , because pancreatic injuries with left - sided adrenalectomies are possible . uni = unilateral , bi = bilateral . comparing the data with that for open surgery , lower blood loss , shorter hospital stay , and lower injectable analgesia requirements have been noted . this is consistent with the established advantages of laparoscopy . on the other hand , extensive dissection in the subdiaphragmatic region during open surgery this is often associated with significant postoperative pulmonary complications similar to those seen in 2 of our cases . direct visualization during laparoscopy precluded extensive retraction and allows better respiratory movements in the postoperative period . the patient developed a hemothorax following an adrenalectomy for a large right - sided tumor . though diaphragmatic injury is not a common occurrence on the right side , this probably resulted from use of an electrocautery during the dissection . the collection was suspected in the early postoperative period , and an intercostal drain was placed for 3 days . we agree with soulie et al that such injuries can be minimized with the use of a bipolar electrocautery for dissection . our complication rate of 8.3% , both major and minor , is lower than that reported by suzuki for laparoscopic adrenalectomy . our conversion rate of 8.3% is similar to their 6.7% though our series is much smaller . among the major issues related to the use of laparoscopy gill has also reported a lower overall cost of laparoscopy compared with that of open surgery . we also do not use any vascular staples and rely instead on titanium clips , which are far less expensive . though we have not carried out a cost audit of these cases , none of our patients has refused surgery due to the costs involved . this is despite the fact that our hospital requires patients to buy disposables not routinely used . it is not associated with any additional morbidity , is less time consuming , and allows earlier patient mobilization and discharge . while retroperitoneoscopy is being widely accepted as a good option for other adrenal tumors , it should also be actively considered for pheochromocytomas . retroperitoneoscopy is , however , a difficult technique to learn and should be performed only by experienced laparoscopic surgeons .
spirituality is associated with mental health , managing substance abuse , marital functioning , parenting , and coping . it has been suggested that spirituality also leads to finding purpose and meaning in life . this article focuses on the karma yoga described in bhagavad gita and its meaning in relation with positive psychology . the gita teaches the doctrine of uttermost detachment . it is a sanskrit text written in bhisma parva of mahabharata epic , comprising 745 verses . philosophical concepts of gita 's are ishvara ( the supreme controller ) , jiva ( living beings / the soul ) , prakrti ( matter ) , karma ( action ) and kala ( time ) . bhagavad gita proposed that true enlightenment comes from growing beyond identification with the temporal ego and self . according to krishna , the root of all suffering and discord is the agitation of the mind caused by a selfish desire . the only way to douse the flame of desire is by simultaneously stilling the mind through self - discipline and engaging oneself in a higher form of activity . the gita formulate theories of the three paths ( bhakti , gyan and karma yoga ) without creating any conflict . in the current article , the following lines are taken from the book karma yoga , written by vivekananda . the word karma is derived from the sanskrit word kri meaning to do ; all actions are karma . the cause of all the miseries we have in the world is that men foolishly think pleasure to be the ideal to strive for . our karma determines what we deserve and what we can assimilate . with regard to karma - yoga , the gita says that it is doing work with cleverness and as a science ; by knowing how to work , one can obtain the greatest results . some people want to get fame , and they work for fame , money , power , etc . we read in the bhagavad gita again and again that we must all work incessantly . the gita teaches us about detachment from the result of work . if working like slaves results in selfishness and attachment , working as master of our own mind gives rise to the bliss of non - attachment . positive psychology is concerned with the enhancement of happiness and well - being , involving the scientific study of the role of personal strengths and positive social systems in the promotion of optimal well - being . understanding and facilitating happiness and subjective well - being is the central objective of positive psychology . identifying factors that contribute to happiness is not a simple matter . both psychological and subjective well - being increase with age , education , emotional stability , extraversion and conscientiousness . a distinction may be made between extrinsic and intrinsic motivation . with extrinsic motivation , we do things because the outcomes of these activities will bring about situations that we like or which allow us to avoid unpleasant emotions . with intrinsic motivation , we do things because we like the activities themselves . we develop intrinsic motivation to do activities that are : moderately challenging ; that we feel we can do well ; and that give us satisfaction . flow experiences occur when we become engaged in controllable but challenging tasks or activities that require considerable skill and which are intrinsically motivating.[1214 ] to experience a flow , a deep level of concentration on the task is essential . the action of the person who acts without desire should be much better than that of the person who acts with desire . the latter is attracted to the fruit , and a part , much or little , of his time and attention will , of course , be spent on thought and dreams of the fruit . vinova bhave , krishna said that only work come in your jurisdiction and not the result ( karmanyevadhikaraste ma phaleshu kadachana ) . it is the positive psychology by which we learn to be happy . by focusing on only work we can give 100% of our concentration . work is worship - the statement is perfect in its meaning when we do not think that which work is great and which is not . flow of work as explained in positive psychology can be only understood by understanding karma yoga when we become indulged in the given work . it is intrinsic motivation secondary to the pleasure we gain by just doing work , which is higher state of concentration . although , meaning of salvation does not matter , but it matters if we get a taste of flow in work . stress is defined as a condition in which there is a marked discrepancy between the demands made on an organism and the organism 's capability to respond . it is found to be one of the important factors in causation of various psychiatric disorders like acute stress disorder , affective disorder , and various psychosomatic disorders like irritable bowel syndrome.[1821 ] work stress , in particular , is found to be associated with depressive episode and one of the most common diseases causing mortality and morbidity in the community - cardiovascular disease . recent review focused the mind body medicine , which included the role of mediation as a management practice of the illnesses having the biopsychosocial model . management of stress may be a possible alternative to improve one 's lifestyle and reducing mortality and morbidity in community . recent trend is changing to the improvement of normal life to make it more fulfilling . this was the basis of origin of positive psychology , which is a branch of psychology that studies the strengths and virtues that enable individuals and communities to thrive . stress , the major factor predisposing depression and cardiovascular diseases can be reduced just by overcoming anxiety related to our daily hazels . cutting down the worry ( past ) and result expectation ( future ) may be one of the positive factors to reduce anxiety . at the same time , good future planning ( living in present ) boosts up our spirits to perform good work up to the mark . karma yoga may be a therapeutic method to reduce anxiety and apprehension to reduce morbidity associated with psychiatric and medical illnesses relating to it . it means leave the past and future and live in present teaching of gita . the essence of the paper is to focus on karma yoga to improve ourselves as well as our work in daily activities to reach highest level . by taking this path , we may be able free from stress as well as be able to help others to come out of their sufferings in life .
especially , by modifying the surface properties of mechanical roughness , osteogenesis ability of the implant is enhanced . not only topography but also chemistry of the tio2 surfaces affect cellular attachment , proliferation , osteoblastic activity , differentiation , and formation of mineralized nodules on the surface . therefore , a range of chemical modifications of titanium surfaces , such as fluoride treatment , anodic oxidation , naoh treatment , heat treatment , and ion implantation have received attention . some studies1,2,3,4 demonstrated that divalent cations , such as magnesium ( mg ) and calcium ( ca ) ions play a momentous role in osteogenesis and bone remodeling . mg ions in oxide layer migrate toward the amorphous immature bone layer , whereas p and ca ions in the body fluid migrate toward the o2 layer of the implant.1,2 magnesium ions play an essential role in the binding interaction between ligand proteins and cell surface receptors such as the integrin superfamily ; vitronectin , fibronectin , fibrinogen , and some cell - cell adhesion receptors.2,3 it is necessary to understand the osteoblast and osteoclast responses on the titanium implant surface , which involves attachment , proliferation and differentiation , in order to understand the initial influence of the divalent cations . in this report , magnesium ions were implanted into the titanium surface by micro arc oxidation ( mao ) using a vacuum arc source filter . this study examined the initial cellular response of osteoblasts and osteoclasts to the titanium surfaces that had been implanted with or without mg ions using mao . mechanical polishing was applied , and 40 specimens were grounded utilizing no . 800 silicon carbide sand paper to imitate machined surface on commercially made pure titanium plates 10 mm in diameter and 3 mms thick ( shinheung co. , seoul , korea ) . all the specimens were cleaned in detergent solution using ultrasonics and dried in an oven at 50 for 24 hours . magnesium ions were implanted onto half of the specimens to induce bioactivity using the mao method . the implantation field had an electric energy of 60 - 500 v. in this energy field , a micro arc was induced on the titanium disc and subsequently a magnesium titanate oxide was formed . the mg ions showed acceleration within the electric field located between the sheath and substrates . the electric energy in the implantation field was 15 kev and retention dose was 5.0 10 ions / cm . all the specimens were enveloped and then sterilized with 30 kgy -radiation using a co source at the utr gama - pi facility located at greenpia in yeoju , korea ( fig . 1 ) . using a scanning electron microscopy ( sem , jsm-5800 ; jeol , tokyo , japan ) , the structure and surface morphology of the specimens were analyzed . and for the evaluation of hydrophilic properties of the titanium surface , surface contact angles were measured using the sessile drop method and a video contact angle instrument ( phoenix 150 , seo , suwon , korea)(fig . the choice of culture medium was dulbecco 's modified eagle medium ( dmem , gibco , rockville , md , usa ) containing 10% fetal bovine serum ( fbs , gibco , rockville , md , usa ) , 100 u / ml penicillin and 100 g / ml streptomycin ( gibco , rockville , md , usa ) . cell culturewas done in a humidified atmosphere containing 95% air and 5% co2 at 37. osteogenic medium , which contains 10% fbs , 10 m dexamethasone ( sigma , st . louis , mo , usa ) , 25 g / ml l - ascorbic acid ( sigma , st . louis , mo , usa ) , and 10 mm -glycerophosphate , was added to the culture medium . ( 1 ) nc group cultured on a machined titanium disc without the addition of cell differentiation media.(2 ) pc group cultured on a plate with cell differentiation media.(3 ) m group cultured on a machined surface titanium disc with cell differentiation media.(4 ) mm group cultured on a mg - incorporated surface titanium disc with cell differentiation media . ( 1 ) nc group cultured on a machined titanium disc without the addition of cell differentiation media . ( 2 ) pc group cultured on a plate with cell differentiation media . ( 3 ) m group cultured on a machined surface titanium disc with cell differentiation media . ( 4 ) mm group cultured on a mg - incorporated surface titanium disc with cell differentiation media . osteogenic ability was evaluated by measuring the activity of alp , which is a biochemical marker for osteoblasts . the initial seeding density was 1 10 cells / ml / well in a humidified atmosphere containing 95% air and 5% co2 at 37. by the 7 , 14 and 21 day , the medium was completely removed and washed 3 times with pbs and treated with 1 ml of 0.1% triton x-100 ( sigma ) in an ultrasonic processor for membrane dissolution . after centrifugation at 13,000 rpm for 10 minutes at 4 , 200 l of upper phase was added to a mixture of 50 l diethanolamine buffer ( ph 9.8 , containing magnesium chloride , sigma , mo , usa ) and 50 l p - nitrophenyl phosphate substrate , and then incubated for 1 hour . when enzyme corresponded with the substrate and appeared a yellowish color , 100 l of 1 n sodium hydroxide was combined to stop enzyme reaction . then absorbance measurements were made utilizing a microplate reader ( bio - rad , hercules , ca , usa ) . the cells were seeded on discs in 6-well culture plates with initial seeding densities of 1 10 cells / well , and cultured for 7 and 14 days . from the cultured cells on 6 titanium discs , total rna was extracted and quantified at each incubation time by utilizing rneasy mini kit ( qiagen , valencia , ca , usa ) . first - strand cdnas were produced by reverse transcription of 1 g of extracted rna using superscript first - strand synthesis system ( invitrogen , carlsbad , ca , usa ) . to determine various mrna levels of osteopontin ( opn ) , collagen 1 ( col1 ) , bone sialoprotein ( bsp ) , and osteocalcin ( ocn ) , real - time pcr reaction performance was obtained utilizing primers shown in table 1 . for this process , real - time pcr was perfomed by dynamo syb green qpcr kit ( finnzymes , espoo , finland ) and abi7300 real - time thermal cycler ( applied biosystems , forster , ca , usa ) . using alizarin red s staining , of the cell layer mineralization was observed . triplicate plated osteoblasts at a density of 1 10 cells / ml droplet were cultured on prefabricated titanium discs or tissue culture plastic . the 40 specimens were incubated at 37 in an incubator . after 21 days of culture , medium was then eliminated and cultured cells were gently rinsed 3 times with phosphate - buffered saline ( pbs ) and fixed in 70% ethanol for 1 hour at -20. after being fixed , the culture cells were rinsed with nanopure water ( no calcium ion ) and stained with 2% alizarin red - s ( ar - s , kanto chemical , tokyo , japan ) for calcium at room temperature for 20 minutes . 10% cetylpyridinium chloride was added and absorbance was measured by spectrophotometer ( molecular devices , menlo park , ca , usa ) at 540 nm to evaluate the intensity of ar - s staining . mouse bone marrow - derived macrophages ( bmms ) cells were cultured in a humidified atmosphere containing 95% air and 5% co2 at 37. the culturing medium was minimum essntial medium alpha ( alpha - mem , gibco , ny , usa ) containing 10% fetal bovine serum ( fbs , gibco , ny , usa ) . 100 g / ml rankl and 40 g / ml m - csf were used for differentiation of the cells . staining actin filaments with rhodamine - conjugated phalloidin the cells ( bone marrow macrophages bmms ) were cultured for 6 days for the actin ring formation assay by being seeded in 48 well - plates with the presence of 25 ng / ml rankl . at the end of incubation , cells were examined by a zeiss axiolab fluorescence microscope ( fluoview fv300 confocal microscope , olympus , tokyo , japan ) . total rna was extracted from the cultured cells and isolated using rna rneasy kit ( qiagen , valencia , ca , usa ) according to the manufacturer 's instructions , and cdna was synthesized from 1 g of extracted rna using oligodt ( invitrogen , carlsbad , ca , usa ) by using bone marrow macrophages ( bmms ) seeded in 6-well plate at densities of 1 10 cells / ml / well . a specific primer was added to the synthesized cdna to perform rt - pcr by pcr premix ( bioneer , daejeon , korea ) . the primer used in rt - pcr was synthesized from a part of tartrate resistant acid phosphatase ( trap ) gene , which was used as an indicator of osteoclast differentiation . the housekeeping gene , glyceraldehyde-3-phosphate dehydrogenase ( gapdh ) , was utilized as the standard control group ( table 2 ) . after the initial denaturation step at 94 for 4 minutes , 32 pcr cycles were run at 94 for 30 seconds , 57 - 66 for 1 minute and 72 for 1 minute for gene amplification . dna concentration was measured using ethidium bromide stained 2% agarose gel by a uv absorption spectrophotometer . chicago , il , usa ) , which aided in calculating the standard deviation and mean of the data . one - way analysis of variance ( anova ) with the tukey 's multiple comparisons test was executed to calculate differences among groups . the size of each disc is 10 mm diameter 3 mm thickness ( fig . 1a ) . machined surface ( m ) is more hydrophobic than the mg - implanted machined surface ( mm ) showing a bigger contact angle ( fig . mm did not alter extremely , but changed slightly smoother after ion implantation in the micron scale . the reason for the change of surface morphology is due to ion bombardment during the mg ion implantation process . however , the surface roughness of the mm slightly decreased due to ion implantation . after culturing , the morphology of the mc3t3-e1 of both groups was round and it spread partially over the experimental surfaces . the cells grew along the parallel grooves of the titanium surface and proliferated and covered the experimental surface . the cells were flattened and well spread , and there was little difference between m and mm . for investigating the cell differentiation , alp activities showed an increase inincubation time in all the groups until the 14 day . after 21 days , alp activities decreased or maintained stable . only in the negative control group 14 day of culture , cells cultivated on culture plate with cell differentiation ( positive control ) showed the highest alp activity and on culture plate without cell differentiation ( negative control ) , the lowest alp activity was seen . mm exhibited lower alp activity than those of m ( p<.01 at 7 and 21 days , p<.05 at 14 days ) . mm group showed relatively lower alp activity at 7 days , but explosively increased at 14 days and relatively maintained stable at 21 days . compared with m , alp activities of the mm quantitative real time pcr analysis of mrna levels for osteopontin ( opn ) , collagen 1 ( col1 ) , bone sialoprotein ( bsp ) , and osteocalcin ( ocn ) in cells grown on different surfaces was performed on the 7 and 14 day of culture . 3 . enhanced alkaline phosphatase activity on m and mm on the 7 and 14 day resulted in simultaneous increases in the expression of marker genes ( bsp and osteocalcin ) for osteoblastic differentiation at 7 and 14 days . enhanced expression of diverse integrins associated in cell grown on the mm at an early incubation time resulted in consecutive increase in bsp and ocn expressions on the 7 and 14 day . expression levels of mrna in bsp and ocn escalated in accordance with elapsed incubation time in all groups . opn and col1 mrna expression were elevated in cells grown on both surfaces than negative control in every case . while the level of expression decreased as time passed , the patterns of opn and col1 mrna expression were dissimilar to that of alkaline phosphatase activity on the 7 and 14 day of culture . although mm surface did not exhibit a higher opn , col1 , and osteocalcin mrna expression levels on the 14 day , mm surface displayed relative stable mrna expression on the 7 and 14 day . alizarin red - s stain for mineralization demonstrated that osteoblasts cultured on positive control , m and mm surfaces had higher levels of mineralization ; more intense red staining which indicate calcium deposition was observed . when quantified by image analysis programs , significant ( p<.05 ) enlargement in mineral amount we examined the outcome of osteoclast maturation and differentiation ability to resorb bone during bone remodeling . mouse bone marrow - derived macrophages ( bmms ) cells were plated on each ti disc . cells were stimulated with 100 g / ml rankl and 40 g / ml m - csf . rankl and m - csf stimulated bmms on m and mm surfaces and cells differentiated , suggesting that the bone resorption activity of cells made them into an active state resembling osteoclasts , which were produced by an actin ring structure . the majority of negative control ( nc ) group cells without addition of rankl and m - csf displayed no actin rings , while m and mm group cells revealed well - formed actin rings . as expected , m and mm group cells showed many full actin rings and disrupted actin rings with more than 50% intact compared to the nc group cells . no significant variation between m and mm group were observed , but the mm group showed relatively filled actin rings . phenotypes of differentiated mouse bone marrow - derived macrophages ( bmms ) were characterized by investigating the gene expression by using rt - pcr ( fig . gapdh expression wasdecided inorder to validate the usage of similar amounts of rna for rt - pcr . currently , biochemical bonding mechanisms have been observed utilizing a variety of chemical modifications of titanium surfaces ; i.e. ion implantation.3,5 plasma source ion implantation ( psii ) was produced to implant ions into the ti surface by changing the surface chemistry but not altering the surface topography . previous studies have proven that mg incorporated oxide surface manufactured by an anodic oxidation process makes stronger bone integration.6,7 because a stronger bone response was investigated , mg ion implantations have the possibility of higher osteoconductivity . therefore it is necessary to understand the osteoblast and osteoclast responses on the mg - incorporated titanium implant surface . in this study , the surface topography which may be triggered by bombarding changed slightly after mg ion implantation . throughout this energetic bombardment of ions , the transfer of kinetic energy from incident particle to atoms on the surface of the specimen results in some of the atoms being removed from the surface . recent studies suggest that these textures can also have an effect on the osteoblasts.8 this change can also provide a chance for stable cellular proliferation and differentiation because of good biocompatibility . mg ion implantation has potential enhancement in the cell response at initial stage of osseointegration.9,10 in this study , the surface topography and surface chemistry of the substrates appeared to influence the initial cell response of osteoblast and osteoclast . therefore , we can speculate that the initial cellular response was not affected by the surface roughness but that the surface chemistry influenced the cellular response through the initial and early stages , especially on osteoclasts . by measuring the alp activity of mc3t3-e1 cells cultured on m and mm but on both mg surfaces that were incorporated and machined , mc3t3-e1 cells showed increased and maintained alp activity and expression of various osteoblast phenotype gene which induce osteoblastic differentiation . specific osteoblast phenotype genes ( opn , col1 , ocn , and bsp ) appeared during active osteoblastic differentiation.11,12 our findings conclude that the expression of osteoblastic phenotype genes , especially on bsp and ocn , parallels a similar induction to alp activity which is in accord with previous literatures . it is understood that magnesium ions aid the binding of the physiologic ligand to activated cation - binding a - domain.13 therefore elevated levels of ligand - binding integrins activate integrin - mediated intracellular signaling pathways and can positively influence the consequent cell behavior on titanium substrates.14 olivares - navarrete et al.15 demonstrated that integrin a2b1 can mediate osteoblastic response to the microscopicsurface topography topography and chemistry of titanium substrate . promoted differentiation and adhesion of osteoblastic cells induce the expression of transcription factor gene and osteoblast marker genes such as bsp and ocn.16 the improved osteoblast differentiation with incorporated magnesium ions in the titanium oxide layer may be accredited to increase magnesium ion - mediated binding to critical integrins activating consequent osteoblastic differentiation.9 increased alp activity and gene expression demonstrate the capability to differentiate into osteoblastic cells . through the alizarin red s staining , mineralization was observed in every surface cell layer during osteoblast differentiation of the mc3t3-e1 cells . therefore our data indicate that the mc3t3-e1 cells proliferated and differentiated in osteoblast cell on both m and mm without significant difference . at the end of incubation , osteoclasts were stained with rhodamin - conjugated phalloidin for actin and dapi for nucleus . osteoclasts displayed full actin rings or disrupted actin rings with more than 50% intact.17,18 m and mm group cells revealed well - formed actin rings compared to the nc group cells which showed no actin rings . the expression levels of tartrate - resistant acid phosphatase ( trap ) mrna were evaluated by semi - quantitive rt - pcr duringculture . as shown in fig . this data shows that mm has more affect in differentiation of the bmms than m. in the bmms , various intracellular signaling pathways are activated in osteoclast precursor cells and differentiating osteoclasts on mm . previous studies showed that various intracellular signaling pathways involving erk , jnk , p38 , and akt / protein kinase b ( pkb ) are involved in the differentiation of osteoclasts.19,20 in particular , osteoclast activity was higher in the mm group . such outcomes suggest that both machined and magnesium incorporated oxide surfaces enhance osteoblastic and osteoclastic cell differentiation , but mg - incorporated oxide surfaces are able to mature and differentiate osteoclasts better . although further detailed studies are in demand to find if this surface could also show in vivo bone healing - promoting effects , the limited outcomes from this in vitro study imply that the magnesium incorporated titanium oxide layer fabricated may have a synergistic effect by promoting osteoclastic differentiation . the results obtained in this paper propose that the use of mg - incorporated ti oxide implant body can lead to improvements in bone remodeling by enhancing osteoclastic differentiation . from analysis of the response on the magnesium surface , there is anticipationof the magnesium ion implantation for application as a potential biochemical bond . further studies are needed to examine the precise mechanism of magnesium ion implantation and the long term effects of mg ion implants in humans . both machined titanium surface ( m ) and mg - incorporated ti oxide discs ( mm ) have a good effect on osteoblastic and osteoclastic cell differentiation , but mm may speed the bone remodeling process by substantially activating on osteoclast differentiation . mg ion coating may be an effective approach in improving the osteoconductivity and bone remodeling of commercial titanium implants .
fossil records and molecular data suggest that am symbiosis is evolutionary ancient and that it occurred with the first terrestrial plants . however , species diversity of amf is low , with only approximately 240 recognized species [ 3 , 5 ] , although molecular studies have suggested the existence of a significantly larger number of species . it was suggested that low diversity in amf is characteristic for mutualistic symbiosis because there is low selection pressure for speciation in the fungal partner . traditionally , the taxonomy of amf has been based on the morphological characteristics of spores produced in soil features , including size , color , and various layers of the cell wall [ 18 , 19 ] . however , amf spores have simple structures with only a few morphological characteristics . in addition , spores collected from field soil are not in original condition , and several species of amf may not produce spores under controlled conditions . these problems of morphological identification of amf allow species identity to be determined only by experts and have obstructed ecological studies as well as systematics of amf . amf have been placed within six genera of an order glomales ( zygomycota ) using phylogenetic analysis , using morphological characteristics . however , sequence analysis of ribosomal rna showed that all amf species are included in a monophyletic clade and separated from all major fungal groups . in addition , it was so diverse within the group that all amf species were placed into a new phylum , the glomeromycota . in a recent study , krger et al . analyzed sequences of 136 species of amf , including 27 undescribed species , and suggested that the number of described species was definitely underestimated . the region of small subunit ( ssu ) rdna has been most widely used for phylogenetic sequence analysis for amf , because intraspecific variation of the internal transcribed spacer region rdna , which is generally used for identification and barcoding fungal species , is too high to be used in distinguishing species in amf [ 20 , 21 ] . thus , information from sequences , such as large subunit ( lsu ) and -tubulin , would be required for better understanding of actual diversity of amf [ 3 , 23 , 24 ] . ecological studies of amf have also relied on spores collected from soil . however , spore data collected from soil do not necessarily reflect the actual diversity and functionally active amf colonizing plant roots . therefore , identification of amf species within plant roots is critical for their ecological study . however , identification of amf hyphae to species level within roots using morphological features is not possible . in addition , due to the complex root systems , it is not possible to distinguish active symbionts of amf in an individual plant from spore communities in soil . specific pcr primers have been developed for all amf lineages for use in pcr [ 25 - 27 ] , and the lsu sequences were used for identification of amf and for construction of a more accurate system [ 28 - 30 ] . molecular based methods in amf studies have enabled direct identification of am fungal species in plant roots or in soils , and it was revealed that actual amf diversity in ecosystems could be higher than expected [ 22 , 28 ] . in addition , dna polymorphism within am fungal isolates by different geographic origin , even within a single spore , was identified by use of molecular techniques [ 7 , 20 ] . these findings incited an argument regarding the cause of genetic variation in amf and their role in ecosystems . hundreds or thousands of nuclei exist together within a single spore or hypha of amf , meaning that the genetic structure of amf is ' multi genomic ' . there has been debate regarding the genetic characteristics of nuclei in a spore or hypha . however , evidence supports that each nucleus within a single spore was not genetically identical and that genetic variation is inherited in an individual nucleus , and is not shared by nuclei [ 32 , 33 ] . despite recognition of the importance of genetic diversity of amf , little is known about its role in ecosystems . recent experimental evidence indicating that genetically different am fungal isolates could differ in their ability of survival or functionality on their host plants supports that genetic variation increases diversity of am fungal communities more than expected . although the roles of genetic variation in am fungal communities and ecosystems are not yet clearly understood , the genetic variation offers the possibility of functional diversity of amf in ecosystems . it is clear that genetically different am fungal isolates , even from the same species , have different effects on their host plants [ 10 , 35 ] . more studies on genetic variation within or among amf species should be conducted for better understanding of the roles of functional diversity of amf in ecosystems . the function of mycorrhizal symbiosis could vary significantly between fungal species and even between isolates within a species . functional diversity of amf can often refer to a variety of functions associated with plant growth responses to am fungal colonization . although the mechanisms causing the functional diversity are still uncertain , involvement of the exchange of phosphorus and photosynthate between plants and amf is evident . it can be defined as the amount of carbon gained by a growth response from the symbiotic relationship with amf minus the amount of carbon lost by investment in maintaining the symbiotic relationship . in most cases recent studies have reported that the efficiency of am symbiosis could differ according to the genotype of the two partners , host plants and amf , as well as the combination of the partners [ 10 , 11 , 14 ] . croll et al . reported a strong preference for am fungal genotype by host plants in his experiment . in addition , functional differences by genotype among amf isolates for host plants were identified by angelard et al . , who used genetically different amf isolates , g. intraradices , to promote the growth of rice and found that specific am fungal genotype could increase the biomass of rice up to five times compared with other isolates . the specific amf genotype affects host plants by different functionality , including spread of extraradical mycelia , efficiency of nutrient absorption , and mycorrhizal - specific gene expression , and causes different growth responses in host plants . the extraradical mycelium of amf absorbs the mineral nutrients from soil and transports them to the host plant . however , the capacity of the mycelium to spread , and the viability , structure , and possibility of anastomosis might vary among amf genotypes , even among those collected from the same origin [ 39 - 41 ] . in addition , it is known that there are differences in ability to take up and supply phosphorus and nitrogen to plants even within amf species , caused by the expression levels of p - transporter and n - assimilation genes [ 42 , 43 ] . use of molecular method - based studies has enabled a clearer understanding of mycorrhiza - specific genes , expressed in the early stage after inoculation . in different amf taxa , a similar gene expression pattern was identified in a set of nutrient - transport related genes in early stages of infection , and liu et al . reported a similar gene expression pattern in an amf - related gene set in different plant taxa . however , hohnjec et al . reported that the gene expression pattern was similar in infections by two amf species but that some genes were expressed more in specific host plants , meaning that mycorrhizae - specific gene expression was affected by the combination of host plant and amf species . finally , the continuous signal exchange between amf and host plant is important to completion of their life cycle from colonizing roots to sporulation in soils [ 46 , 47 ] . genetic variation caused by the composition of hyphal nuclei is important in mutual recognition of am symbiosis . in addition , genetically different isolates of amf could affect colonization strategy and mycorrhizal morphology of the plant . although amf species diversity is lower than that of other fungal taxa , its effects on growth and structure of plant communities are very diverse . thus , when considering the many causes that lead to the actual diversity of amf in ecosystems , the functional differences among amf species or isolates can not be simply measured as shown . amf are distributed among a variety of environments as symbionts with plants from sub - polar to tropical latitudes and from swamps in low lands to mountainous areas of high elevation . the host plants offer carbon compounds to amf ( approximately 20% of photosynthate ) in exchange for inorganic minerals and protection against environmental stresses from amf . amf play an important role in phosphorous absorption , circulation of nitrogen in ecosystems , tolerance to heavy metals and saline conditions , and increasing protection from nematodes and root diseases in the rhizosphere [ 51 , 52 ] . rhizospheres with amf have very dense hyphal networks , akin to extended roots , which occupy an extensive biomass . although amf have low host specificity in their symbioses with plants , they share hyphal networks with different host plants and affect not only a single plant species but also populations and plant species composition . despite wide distribution and abundance of amf in various environments as well as a broad range of relationship with most land plants , however , molecular evidence has shown that the diversity would be much higher in ecosystems than expected . in addition , differences in functionality between am fungal isolates could complement species diversity of amf by changing the functional units interacting with plants from species to genotype . in such a point of view , we need a novel ecological concept of amf from decomposer to producer or assistant producer of plants , increasing productivity and fitness of plants in ecosystems , not restricted in conventional view of fungi . they are adapted to various environments and have symbiotic relationships with more than 200,000 plant species ; however , only about 240 species have been described to date . this means that morphological diversity of amf spores is not sufficient to reveal actual diversity of the fungi in ecosystems . use of molecular techniques in studies of amf has led to a significant increase in taxonomic diversity and studies have indicated high genetic diversity within a population and even within a single spore . functional diversity by the combination of host plant and amf results from the genetic structure of amf , which is multi - genomic and composed of hundreds or thousands of nuclei with different genetic composition . the genetic variation of nuclei in a single spore affects genetic diversity at the population level and it could increase the functional diversity of amf in ecosystems . experimental evidence supports that genetically different amf isolates , even within species , could have different effects on host - plant growth . amf are regarded as the most widespread microorganisms in soil , except in sterile or contaminated sites where plants can not survive . they contribute to nutrient cycling ( e.g. , the n cycle ) in ecosystems and improve soil conditions through soil aggregation and increasing the nutrient uptake of plants . however , the taxonomic species diversity of amf reflects only a small part of am fungal diversity in actual ecosystems compared with their functional diversity . the characteristics of amf related to host - plant selection , rapid adaptation to various environments , and functional differences in growth response in host plants could be understood when the genetic diversity of amf and their roles have been more clearly determined .
access to zinc is essential for organisms throughout the three domains of life . it is the only metal that occurs as a cofactor in all six classes of enzymes , from oxido - reductases to lyases ( 1 ) , and the average proportion of enzymes containing zinc is 8.8% in eukaryotic proteomes ( 2 ) . in pathogens , virulence - associated proteins frequently bind zinc for structural stability or catalytic activity ; e.g. , the ser / thr - protein kinase prkc of bacillus anthracis , which is essential for its pathogenicity , is regulated by zinc ( 3 ) . in the pathogenic yeast candida albicans , three out of six known superoxide dismutases ( casod1 , casod4 , and casod6 ) are copper - zinc dependent . enzymes of this class detoxify reactive oxygen species and thus contribute to virulence ( 46 ) . therefore , it is of particular importance for both benign and pathogenic microbes to ensure a sufficient zinc supply , especially when faced with a micronutrient - poor environment . exploiting this dependency , mammalian hosts manipulate levels of accessible zinc and other metals to inhibit pathogen growth and dissemination . this targeted limitation of micronutrients is known as nutritional immunity and is one of the main strategies used to defend against pathogenic microorganisms ( 7 ) . to oppose zinc deprivation , pathogenic bacteria and fungi evolved specialized uptake mechanisms to obtain zinc ( 8 , 9 ) . for example , a high - affinity zinc transporter system is required for virulence of salmonella enterica in mice ( 10 ) . the intracellular zinc homeostasis is generally strictly controlled , and in c. albicans , the response to zinc deficiency is mediated by the transcription factor csr1 ( candida suppressor of rok1 ) ( 11 ) , the ortholog of saccharomyces cerevisiae zap1 ( zinc - responsive activator protein ) . within the candida clade , csr1 orthologs have been found in all sequenced species . however , to date , this transcriptional factor has been investigated only in c. albicans in more detail , while the function of csr1 in other pathogenic yeasts like candida glabrata or even in the closest relative of c. albicans , candida dubliniensis , is unknown . both c. dubliniensis and c. albicans are harmless gastrointestinal colonizers , but they can cause diseases ranging from superficial mucosal infections to life - threatening candidemia , especially in immunocompromised individuals . interestingly , c. dubliniensis is less frequently isolated from patients with nosocomial bloodstream infections than c. albicans ( 2 to 3% versus 10% , respectively ) ( 1214 ) . the overall lower virulence of c. dubliniensis has also been confirmed in mice infection models ( 15 ) and was found to be associated with differences in species - specific pathogenicity properties , such as the ability to adhere and to form true hyphae , which allow tissue invasion ( 16 , 17 ) . finding differences in the genetic setup and infection - relevant phenotypes of these two fungi is , therefore , a promising avenue to dissect virulence in pathogenic yeasts and may provide insights into the mechanisms of evolutionary rewiring of regulatory factors among related microbes . in c. albicans , csr1 is known to have dual functions : it plays the key role both in transcriptional regulation of zinc homeostasis and in biofilm formation . c. albicans mutants lacking csr1 hence can not proliferate under low - zinc conditions and show reduced filamentation in the presence of serum ( 11 ) accompanied by altered biofilm formation ( 18 ) . further analysis of genes regulated by csr1 of c. albicans ( cacsr1 ) under biofilm - inducing conditions revealed 60 targets , including cazrt1 - 3 , capra1 , and cacsr1 itself ( 18 ) . it is noteworthy that in biofilm - producing communities , a c. albicans csr1/ mutant strain secretes smaller amounts of the quorum - sensing molecule farnesol , which contributes to an altered morphology ( 19 ) . the zrt proteins belong to the zip ( zrt / irt - like proteins ) transporter family and facilitate zinc ion transfer across membranes into the cytosol or cellular organelles . zrt1 of s. cerevisiae ( sczrt1 ) is a high - affinity transporter in s. cerevisiae that mediates zinc uptake under strong zinc depletion , but it is downregulated under low - zinc conditions . there , the low - affinity zinc transporter sczrt2 ensures import of zinc ( 20 , 21 ) . tightly controlled zinc uptake mechanisms in response to extracellular zinc levels have been observed not only in s. cerevisiae but also in schizosaccharomyces pombe and aspergillus fumigatus ( 2224 ) . finally , pra1 is a zinc - binding protein which is part of a novel zinc uptake mechanism of c. albicans recently discovered by citiulo et al . a c. albicans csr1/ mutant is known to be proliferation defective during murine infections ( 26 ) and to elicit a decreased immune response in mice ( 27 ) . in addition to this observation , expression of csr1 and some of its target genes was increased up to 10-fold during the early stage of infection with the corresponding c. albicans wild - type strain ( 27 ) . in the present work , we analyzed the role of the c. dubliniensis transcription factor csr1 ( cd36_44490)a homolog of c. albicans csr1in zinc homeostasis , germ tube formation , and virulence traits . candida strains were routinely propagated on ypd agar ( 20 g peptone , 10 g yeast extract , 20 g glucose , 15 g agar per liter ) at 30c and stored as frozen stocks in ypd medium with 15% ( vol / vol ) glycerol at 80c . for zinc starvation experiments , low - zinc medium ( lzm ) the medium was supplemented with znso4 as indicated ( lzm0 contains no zinc ; lzm25 and lzm2000 contain 25 m and 2,000 m znso4 , respectively ) , and 25 m feso4 was used as a source of iron . strains were grown in ypd overnight ( 30c and 180 rpm ) , washed with double - distilled water ( ddh2o ) , and transferred into filament - inducing medium at an optical density at 600 nm ( od600 ) of 0.2 . to stimulate filamentation , we used spider medium ( 1% mannitol , 1% nutrient broth , 0.2% k2hpo4 [ ph 7.2 ] ) , liquid ypd , or h2o plus 10% ( vol / vol ) fetal calf serum . cultures were shaken ( 180 rpm ) for 4 h at 37c , and morphology was microscopically analyzed ( axiovert , zeiss , germany ) . chlamydospore production was induced on rice extract - tween 80 agar ( bd , heidelberg , germany ) or staib agar ( 28 ) , both prepared as described before . the plates were incubated at 28c for 2 to 4 days in the dark , and chlamydospore formation was monitored microscopically . an apai - xhoi fragment with csr1 upstream sequences was cloned after amplification by pcr with the primers csr1 - 1 and csr1 - 2 ( see table s1 in the supplemental material ) using genomic dna from c. dubliniensis w284 as the template . a sacii - saci fragment containing csr1 downstream sequences the csr1 upstream and downstream fragments replaced ssu2 upstream and downstream fragments in plasmid pssu2m2 ( 29 ) via the introduced restriction sites , to result in pcsr1m2 , in which the sat1 flipper is flanked by csr1 sequences . the whole csr1 gene for the gene reconstitution was amplified using the primers cdcsr1 - 1 and cdcsr1 - 5 , the apai / bglii - cut dna fragment was integrated into psap2ks1 ( 30 ) , and the csr1 downstream dna element was inserted as described above . for the generation of the pra1 overexpression cassette , a xhoi - bglii fragment was amplified via pcr with the primers pra1 - 1 and pra1 - 2 . this dna fragment was introduced behind the cdadh1 promoter into the pcdadh1e2 vector ( 31 ) , and the plasmid was named pcdpra1e1 . the plasmids pcdzrt1e1 and pcdzrt2e1were constructed in a similar way by amplifying a xhoi - bglii fragment with the primer pair zrt1 - 1 and zrt1 - 2 or zrt2 - 1 and zrt2 - 2 . the primer zrt2 - 1 carried a sali restriction site that is compatible with the xhoi overhang of the parental plasmid pcdadh1e2 . linear dna fragments were transformed by electroporation into chemically competent c. dubliniensis cells ( 32 ) , and clones were selected on ypd plates containing nourseothricin ( werner bioagents , jena , germany ) . the usage of the sat1 flipper strategy allowed the recycling of the selection marker , as described here ( 33 ) . after dna separation on an agarose gel ( 1% ) , dna was stained with ethidium bromide and transferred onto a nylon membrane using a vacuum blot system . uv - linked dna was hybridized with chemiluminescence - labeled probes and detected via the amersham ecl direct nucleic acid labeling and detection kit ( ge healthcare , braunschweig , germany ) according to the manufacturer 's instructions ( see fig . strains were pregrown overnight in ypd at 30c and after repeated washing , cells with an od600 of 0.4 were inoculated in lzm0 without additional zinc . after starvation in lzm0 for 24 h at 30c , cells were diluted to an od600 of 0.01 in lzm supplemented with various concentrations of znso4 . cultures were incubated at 30c in a magellan tecan plate reader with shaking for 30 s , and the od600 was determined every 15 min over 48 h. changes of the od600 were plotted against the incubation time . to determine gene expression rates , cells were precultured in ypd overnight ( 30c and 180 rpm ) and washed with phosphate - buffered saline ( pbs ) . a total of 5 10 cells / ml were inoculated into 200 ml lzm plus 2,000 m znso4 , and the cells were grown for an additional 24 h ( 30c and 180 rpm ) . to remove residual zinc , cultures were washed four times with ultrapure water , and all yeast cells were transferred into 200 ml lzm0 without zinc . cells from 20 ml of liquid culture were sampled and frozen in liquid nitrogen at 0 h , 0.5 h , 4 h , and 24 h. rna was isolated using an rneasy kit ( qiagen , hilden , germany ) following the manufacturer 's instructions . a bioanalyzer instrument ( agilent , santa clara , ca ) was used to measure rna quality , and rna concentration was determined via nanodrop ( thermo fisher scientific , waltham , ma ) . a 700-ng portion of rna was treated with dnase and transcribed into cdna ( enzymes by promega [ fitchburg , wi ] ) . finally , a total amount of 13.3 ng cdna was used for each qrt - pcr that included evagreen as fluorescent dye and rox as an internal reference ( biosell , feucht , germany ) . the experiments were performed in a thermal cycler ( bio - rad , hercules , ca ) and run in biological duplicates and technical triplicates . the expression rates reported here are relative to the expression values of the housekeeping gene tef3 . the protein sequences of c. dubliniensis cd36_44490 ( cdcsr1 ) , c. albicans orf19.3794 ( cacsr1 ) , c. glabrata cagl0j05060 g ( cgcsr1 ) , s. cerevisiae yjl056c ( sczap1 ) , aspergillus fumigatus afu1g10080 ( zafa ) , and cryptococcus neoformants ( cnzap1 ) were compared using ncbi pblast ( http://blast.ncbi.nlm.nih.gov/blast.cgi ) ; they were aligned with the clustalw2 multiple - sequence - alignment tool ( http://simgene.com/clustalw ) , and the phylogenetic tree was constructed at http://www.phylogeny.fr ( 34 ) . this phylogenetic analysis includes muscle ( v3.7 ) alignment , removal of ambiguous regions with gblocks ( v0.91b ) , and the reconstruction of the phylogenetic tree used the maximum - likelihood method implemented in the phyml program ( v3.0 alrt ) . pro coffee ( 35 ) was used as a tool to align homologous promoter regions of zrt2 from c. dubliniensis , c. albicans , and s. cerevisiae . the embryonated chicken infection model was used to study virulence as described previously ( 36 ) . briefly , overnight cultures of yeasts were washed with pbs and adjusted to 10 cells / ml . an inoculum of 10 yeast cells / egg was applied to the chorioallantoic membrane at developmental day 10 via an artificial air chamber . in each experiment , the viability of 20 eggs per group ( candida or pbs control ) was evaluated daily by candling for 7 days . surviving embryos were humanely terminated by chilling on ice at the end of the experiment . all experiments were performed in compliance with the german animal protection law . according to this , no specific approval is needed for work performed on avian embryos before the time of hatching . protein sequence comparisons using ncbi pblast revealed a high similarity of the c. dubliniensis protein cd36_44490 with the c. albicans transcription factor and zinc acquisition regulator csr1 ( also known as zap1 ; 86% identities and 91% positives ) , the s. cerevisiae zinc - responsive activator protein zap1 ( 37%/52% ) , and the zap1 ortholog cnag_05392 in cryptococcus neoformans serotype a ( 43%/51% ) . multiple sequence alignments showed the highest similarities for the c - terminal part of the protein sequence with a high degree of conservation of this domain . phylogenetic tree reconstruction using the protein sequences of csr1 homologs from the yeasts c. dubliniensis ( cdcsr1 ) , c. albicans ( cacsr1 ) , c. glabrata ( cgcsr1 ) , and s. cerevisiae ( sczap1 ) , from the filamentous fungus a. fumigatus ( zafa ) , and from the basidiomycete c. neoformans ( cnzap1 ) shows the relationship of the csr1 proteins in fungi ( fig . 1a ) . the close relationship of c. dubliniensis and c. albicans is well reflected in this analysis ( a ) phylogenetic analysis of homologous csr1/zap1 protein sequences from distinct fungi : candida dubliniensis cd36_44490 ( cdcsr1 ) , c. albicans 19.3794 ( cacsr1 ) , c. glabrata cagl0j05060 g ( cgcsr1 ) , s. cerevisiae yjl056c ( sczap1 ) , cryptococcus neoformans serotype a cnag_05392 ( cnzap1 ) , and aspergillus fumigatus afu1g10080 ( zafa ) . the scale bar indicates the genetic distance , which is proportional to the number of amino acid substitutions . zap1 from s. cerevisiae contained two activation domains ( ad1 and ad2 ; in gray ) that are absent in both candida species . seven c2-h2-like zinc finger domains ( black ) were found in all analyzed species , and comparison of the c - terminal dna binding domain ( dbd ) regions showed highest similarities . the protein domain architecture of csr1 in s. cerevisiae , c. albicans , and c. dubliniensis was then analyzed using the smart program ( 34 , 37 ) . in all these homologs , 1b ) . both activation domains ( ads ) present in sczap1 , ad1 and ad2 ( 38 ) , the characteristics of the zrt2 promoter region in s. cerevisiae allow both transcriptional activation and repression of zrt2 via zap1 in response to zinc levels ( 39 ) . an alignment of the homologous zrt2 promoter regions in s. cerevisiae , c. albicans , and c. dubliniensis using pro coffee ( 35 ) revealed a strong divergence of the zinc - responsive elements ( sczre1 and sczre2 ) between the candida species and s. cerevisiae ( 39 ) . however , a direct comparison of c. albicans and c. dubliniensis promoter sequences revealed a high similarity between two species . this hints at a promoter type - specific , distinct regulation of the zrt2 genes among the different yeasts . the aim of this study was to elucidate the functions of the transcriptional factor cdcsr1 , called csr1 here , in c. dubliniensis . additionally , the zinc responsive genes zrt1 , zrt2 , and pra1 were expressed under the control of the constitutive adh1 promoter both in the c. dubliniensis wild - type strain w248 and in the csr1/ mutant strains . all mutants were constructed as independent duplicates and gene deletions were confirmed by southern blot analyses ( see fig . s1 in the supplemental material ) . to investigate the role of csr1 for zinc acquisition in c. dubliniensis , growth of prestarved ( 24 h without zinc ) wild - type and mutants strains was monitored for 2 days in defined medium ( lzm ) with no ( 0 m ) , little ( 25 m ) , or plentiful ( 2,000 m ) zinc . the prestarvation step was designed to largely deplete the internal zinc storage , so that fungal growth depended on the ability to acquire zinc from the surrounding medium . the growth of wild - type and all mutant strains was nearly abolished when no zinc was added to the lzm ( fig . 2a ) . under low - zinc conditions ( 25 m znso4 ) , all c. dubliniensis strains harboring at least one intact csr1 allele proliferated robustly and at a rate virtually identical to the wild - type strain w284 , whereas most mutants lacking csr1 ( the csr1/ , csr1/+zrt1 , and csr1/+pra1 strains ) failed to adapt and grow in the low - zinc medium ( fig . only artificial overexpression of zrt2 in the csr1/ mutant could largely phenocopy wild - type growth under low - zinc conditions ( fig . growth of wild - type and mutant strains depends on extracellular zinc levels . c. dubliniensis w284 and the csr1/ , csr1/+csr1 , zrt1 , csr1/+zrt1 , zrt2 , csr1/+zrt2 , pra1 , and csr1/+pra1 strains were assayed for growth . cells were prestarved in lzm0 for 24 h at 30c , and afterwards strains were grown in lzm without zinc ( a ) and with addition of 25 m ( b ) or 2000 m ( c ) znso4 . at the starting point , the optical density at 600 nm was adjusted to 0.01 , and changes were monitored every 15 min for 48 h. addition of 2,000 m znso4 to the lzm rescued the growth defect of all csr1/ mutant strains ( fig . 2c ) . we concluded that csr1 is a key regulator of c. dubliniensis for growth in environments with low zinc . while overexpression of neither zrt1 nor pra1 in the csr1/ background improved growth under conditions of low zinc , the zrt2 overexpression mutant displayed intermediate growth in lzm plus 25 m znso4 , which indicates that this zinc transporter may play an important role under conditions of low zinc . in s. cerevisiae , all of these are regulated in response to zinc levels and contain zinc - responsive elements ( zres ) to which zap1 binds ( 40 ) . additionally , c. albicans csr1 is known to control not only zinc homeostasis but also the hypha - associated gene hwp1 under filament - inducing conditions ( 11 ) and during biofilm formation ( 18 ) . to determine whether selected homologs of these target genes are also zinc responsive in c. dubliniensis , the transcription levels of genes encoding putative zinc transporters ( zrt1 to zrt3 ) , the zincophore gene pra1 , and the hypha - associated gene hwp1 were analyzed by quantitative real - time pcr ( qrt - pcr ) . cells were precultured for 24 h in lzm plus 2,000 m znso4 before these lzm - adapted cells were shifted into lzm without added zinc . this ensured that changes in gene expression were solely due to zinc deficiency and not the medium per se . at 2,000 m zinc in the preculture , the csr1/ mutant strains proliferated at wild - type levels ( fig . 2c ) the relative gene expression was normalized to tef3 , an established c. dubliniensis reference gene used for northern blot analyses ( 41 ) . in the wild - type strain w284 , a 10-fold increase of csr 1 mrna levels was observed within the first 4 h of starvation , reflecting the transcriptional response to the absence of external zinc . the transcript levels remained highly elevated until the end of the experiment at 24 h ( 1,440 min ) ( fig . this gives additional support to the presumptive key role for csr1 in the upkeep of zinc homeostasis . all zrt genes were highly ( > 20 ) upregulated at 24 h. by 4 h , the expression of the putative low - affinity zinc transporter zrt2 and the vacuolar zinc exporter zrt3 was increased 37-fold and 7-fold , respectively . in contrast , zrt1 ( likely encoding a high - affinity zinc transporter ) transcript levels slightly decreased within the first 4 h but reached a 125-fold upregulation after 24 h compared to the zero time point . the transcript level of pra1 reached its measured maximum after 24 h , where this zincophore - encoding gene showed the highest transcript level of all genes investigated in the wild - type strain . qrt - pcr gene expression analysis of putative csr1 target genes in the wild - type strain w284 ( a ) , the csr1/ knockout strain ( b ) , and the csr1/csr1 revertant strain ( c ) . the analyzed genes ( csr1 , zrt1 , zrt2 , zrt3 , pra1 , and hwp1 ) are putatively regulated by csr1 . the cells were grown in lzm0 medium , and rna samples were taken directly after inoculation in lzm0 and 30 min , 240 min , and 1,440 min postinoculation . the bars represent the relative change in expression normalized to expression of the housekeeping gene cdtef3 , and the results are the means and standard deviations ( sd ) from two biological and three technical replicates . the change in expression was significant ( one - way analysis of variance [ anova ] , p < 0.05 ) within one strain ( * ) or compared to the expression level in the csr1/ knockout strain at the same sampling time point ( # ) . morphologically , no hypha formation was observed under zinc limitation ( data not shown ) , in agreement with a negligible mrna level of hwp1 at all time points ( compared to tef3 ) in the wild type . as expected , no csr1 gene expression was measured in the csr1/ mutant , and in addition , transcript levels of the zrt genes and of pra1 were significantly decreased compared to those in the wild type ( fig . the absolute amount of zrt1 transcripts was mostly below the detection limit , showing its dependency on csr1 during zinc depletion . a slight increase was observed for zrt2 , zrt3 , and pra1 mrna levels after 24 h , suggesting that their expression is regulated by other factors in addition to csr1 . reintroduction of one csr1 allele into the csr1/ mutant restored the overall expression pattern of csr1 as well as of the other zinc - responsive genes , although the transcript amounts of zrt3 and pra1 did not fully achieve the level of the wild type ( compared to tef3 ) ( fig . previously , kim et al . reported a filamentation defect for the c. albicans csr1/ mutant in serum - containing medium ( 11 ) . to test the possible relevance of c. dubliniensis csr1 for initiation of germ tubes , the wild type , the csr1/ mutant , and the revertant were tested for germ tube induction in water with 10% serum or in liquid spider medium at 37c . invariably , all strains formed proper germ tubes under these filament - inducing conditions ( fig . , germ tube formation was tested for the overexpressing strains zrt1 , zrt2 , pra1 , csr1/+zrt1 , csr1/+zrt2 , and csr1/+pra1 . no difference relative to the wild - type phenotype was detected in any strain ( data not shown ) . these results confirm the findings from our gene expression analysis of hwp1 , and together they demonstrate that in c. dubliniensis , in contrast to c. albicans , hypha formation is not regulated by csr1 under all our investigated conditions . filamentation of the wild - type strain w284 , the csr1/ mutant , and the csr1/csr1 revertant in 10% ( vol / vol ) serum and spider medium . cells were grown overnight in ypd at 30c and shifted to germ tube - inducing medium for 4 h at 37c . germ tube induction was tested for w284 ( a ) , the csr1/ mutant ( b ) , and the csr1/csr1 strain ( c ) in water plus 10% serum and liquid spider medium . the simultaneous deletion of two zinc transporter genes tzn1 and tzn2 in neurospora crassa caused a growth defect under zinc depletion conditions , and this double mutant strain failed to exhibit conidiation ( 42 ) . in this context , we tested production of chlamydospores on staib and rice agar under chlamydospore - inducing conditions ( see fig . all strains analyzed in this study were able to produce these morphological structures in wild - type - like quality and quantity . to study the role of csr1 during an infection with c. dubliniensis , we used the embryonated chicken egg model ( 36 ) . we compared the virulence of the c. dubliniensis wild type , the c. dubliniensis csr1/ mutants , and the respective complemented strains . to allow a better estimate of c. dubliniensis ' virulence , we analyzed the c. albicans wild - type strain sc5314 in parallel . c. albicans is known to generally have a higher virulence than c. dubliniensis ( 16 ) , which was confirmed in our study . the average survival rate 7 days after c. albicans infections in ovo was 14% , whereas c. dubliniensis infections were survived by 44% of the embryonated eggs at the end of the experiment ( fig . 5 ) . one of the independent c. dubliniensis csr1/ deletion mutants showed a significantly decreased mortality rate ( 33% ) versus the c. dubliniensis wild type ( 56% ) and both reconstituted strains ( 62% and 67% ) . the second csr1/ mutant ( csr1/b ) similarly exhibited a clear , but not statistically significant , attenuated virulence with a mortality rate of 46% . the reintegration of csr1 into the knockout strains restored the virulence pattern of the wild type . these observations indicate an important role for csr1 during in vivo infections by c. dubliniensis . virulence of the wild - type strain w284 , the csr1/ mutant , and the csr1/csr1 revertant in infected chicken embryos . there were 20 chicken embryos per group per experiment , and the combined results of two independent experiments are shown . the mutant csr1/a exhibited significantly attenuated virulence ( p < 0.01 ) compared with the wild type and the reconstituted mutant csr1/csr1a , as calculated by the log - rank ( mantel - cox ) test . c. dubliniensis is an important emerging pathogen but is generally considered less virulent than c. albicans ( 43 , 44 ) . while the two fungi share many similarities , genetic , regulatory , and/or phenotypic differences must exist between them to explain this gap in virulence potential ( 16 ) . the very close evolutionary relationship between c. dubliniensis and c. albicans can thus provide us with important tools to investigate the genetic basis of virulence in fungi . one important aspect of host - pathogen interaction is the struggle for micronutrients like iron and zinc ( 45 ) . in this study , we hence focused on the role of the transcriptional factor csr1 and other putative zinc - responsive genes in zinc homeostasis of c. dubliniensis . between c. dubliniensis and c. albicans , the transcriptional regulators cdcsr1 and cacsr1 share a high sequence similarity . both differ in the n - terminal zinc - responsive activation domains from their s. cerevisiae homolog , the zinc - dependent regulator zap1 ( 46 ) . both candida species lack ad1 and ad2 ( 11 and this study ) . in s. cerevisiae , ad1 binds multiple zn(ii ) ions and is required for proper catalytic function ( 47 ) . the absence of the ads indicates differences in the structure of this zinc - responsive regulator between s. cerevisiae and the candida species . in support of that , multiple zinc finger domains were predicted in the c - terminal region of both cdcsr1 and cacsr1 , which could allow zinc binding even in the absence of the ads . two out of seven c2h2 domains in both csr1 proteins were predicted with low confidence , and other authors thus describe only five zinc finger domains in cacsr1 ( 11 , 48 ) . more than 270 genes are known to have lower transcription levels in a c. albicans csr1/ mutant compared to the wild type during biofilm formation ( 18 ) . the largest differences in expression were found for the zinc homeostasis genes pra1 , csr1 , zrt2 , and zrt1 . our data indicate that c. dubliniensis csr1 shares these target genes with c. albicans , as all four genes were not upregulated during zinc limitation in the csr1/ knockout strain . in c. albicans , however , in c. albicans csr1/ , the overexpression of the zinc transporter genes zrt1 and zrt2 is known to improve growth of the mutant during zinc depletion ( 18 ) , while overexpression of zrt1 or pra1 in c. dubliniensis csr1/ did not lead to any phenotypic rescue . the artificial expression of this zinc transporter or the zinc scavenger protein is evidently not sufficient to allow efficient zinc uptake by c. dubliniensis . alternatively , both partners of the zincophore uptake system are required in c. dubliniensis for zinc acquisition . in c. albicans , zinc uptake can occur via a zincophore system comprising both pra1 to sequester extracellular zinc ions and zrt1 to transport zinc into the fungal cell ( 25 ) . based on their close genetic relationship possibly , c. albicans , but not c. dubliniensis , has sufficient remaining transcriptional activation of pra1 and zrt1 in the absence of csr1 to compensate for growth defects during artificial expression of only one reaction partner under low - zinc conditions . on the other hand , overexpression of zrt2 in the c. dubliniensis csr1/ mutant allowed growth under low - zinc conditions , which hints at an important role for this transporter in such environments . in s. cerevisiae , zrt1 is known to be the high - affinity extracellular zinc transporter ( 21 ) . comparisons of the sczrt1 protein with the c. dubliniensis proteome revealed a higher similarity with cdzrt2 ( 43% identities and 59% positives ) than with cdzrt1 ( 27%/48% ) , in agreement with a recent report showing a rather distant relationship between sczrt1 and its homologous proteins in several candida species ( 49 ) . furthermore , regulatory zres were not detected in the promoter sequence of the two candida species , which points to differences in the transcriptional regulation between candida spp . and s. cerevisiae . therefore , we hypothesize zrt2 , rather than zrt1 , to be the high - affinity zinc transporter in c. dubliniensis . the zinc transporters zrt1 and zrt2 of c. dubliniensis exhibit only 30% amino acid sequence identity , suggesting nonredundant functions . eide showed that in s. cerevisiae , the regulation of zrt1 and zap1 transcription differs from that of zrt2 , with the first two being downregulated at higher zinc concentrations ( 50 ) . this indicates , for baker 's yeast , the presence of both a high - affinity zinc uptake system , comprising the regulator zap1 and the transporter zrt1 , and a low - affinity zinc uptake system mediated by zrt2 ( 20 ) . here , we measured the expression levels of putative zinc - responsive genes in a c. dubliniensis csr1/ mutant and noticed a strong dependency of zrt1 on csr1 . bird et al . showed a peak in zrt2 mrna accumulation at 300 to 1,000 m zinc ( 39 ) . in a different study , a -galactosidase activity assay demonstrated zrt2 promoter activity under low - zinc conditions , which was reduced under conditions of increased zinc abundance ( 250 m or more ) ( 46 ) . in our experiments , we observed a strong upregulation of c. dubliniensis zrt2 during zinc depletion . zrt2 transcription is hence in agreement with a role for zrt2 as a high - affinity zinc transporter in c. dubliniensis . a detailed study on the structural basis of the transcriptional regulation of zrt2 in s. cerevisiae revealed that one of three zres ( zre3 ) is located inside the promoter region . zinc deprivation results in repressional binding of zap1 to zre3 , which inhibits the initiation of zrt2 transcription ( 39 ) . as we observed a significant upregulation of zrt2 in the absence of zinc , promoter regions of zrt2 in both candida species were aligned with sequences from s. cerevisiae . the lack of the repressing zre3 domain in candida species supports our finding that zrt2 was upregulated during zinc limitation . these differences in the promoter sequence seem to be clade specific , as bird et al . reported a conserved zrt2 promoter region for different saccharomyces species ( 39 ) . furthermore , eide suggested an at least partial independency of zrt2 transcription from zap1 in s. cerevisiae ( 50 ) . we observed the same phenomenon in c. dubliniensis with a delayed and reduced but measurable upregulation of zrt2 even in the csr1/ background . interestingly , in addition to zrt2 , zrt3 and pra1 also remained responsive to zinc starvation in a csr1/ deletion mutant . hence , additional factors besides csr1 likely contribute to expression of zinc - responsive genes in c. dubliniensis . finally , it is known that zrt1 and pra1 share the same intergenic promoter region in c. albicans , which allows efficient zinc assimilation by their coregulation ( 25 ) . the synteny of this pra1-zrt1 locus is conserved in c. dubliniensis , and we detected largely synchronous shifts in gene expression during zinc starvation as long as csr1 was present . s. cerevisiae stores zinc intracellularly under zinc - replete conditions via the vacuolar importer zrc1 . under conditions of low extracellular zinc availability , we observed a clear upregulation of zrt3 in c. dubliniensis within 4 h of zinc starvation . likely , the cells had filled their vacuolar storage during the adaption phase in 2,000 m zinc , which was then used to maintain zinc homeostasis under starvation . we found zrt3 upregulation to be dependent on csr1 , as zrt3 expression never exceeded the initial levels in the csr1/ mutant . this is in agreement with the zap1-mediated upregulation of zrt3 in s. cerevisiae ( 51 ) . a highly interesting aspect of candida pathobiology is that human infections with c. dubliniensis occur much less frequently than those with c. albicans . c. dubliniensis is also far less able to disseminate into the kidney and liver in oral - intragastrically infected mice . histological analyses of these organs revealed that c. dubliniensis remained as yeast cells in vivo , whereas c. albicans formed true hyphae and caused major tissue damage ( 17 ) . due to their potential role as a pathogenicity factor differentiating c. albicans and c. dubliniensis , we characterized the ability of a c. dubliniensis csr1/ deletion mutant to produce hyphae in vitro . a filamentation defect has been observed for the c. albicans csr1/ deletion mutant in inducing medium , accompanied by impaired gene expression of the hypha - associated hwp1 gene ( 11 ) . similar hypha formation defects were observed in in vitro - grown biofilms and in vivo using a rat intravenous catheter model ( 18 ) . in the same study , expression of hypha - associated genes like hyr1 , hwp1 , ihd1 , and rbt1 were found to be positively regulated by csr1 , while the yeast - specific ywp1 was downregulated in a c. albicans wild - type biofilm ( 18 ) . therefore , we investigated the capacity of c. dubliniensis csr1/ to induce germ tubes and found no differences relative to the wild - type strain . hence , in contrast to c. albicans , hypha induction is not coupled to the zinc - responsive transcription factor csr1 in c. dubliniensis . this constitutes a species - specific phenotype which may help to explain the different in vivo morphologies of the two fungi . in fact , one of the main differentiation criteria between c. dubliniensis and c. albicans is the differences in regulation of true hypha formation ( 52 ) . compared to the common ancestor , c. dubliniensis underwent reductive evolution and pseudogenization , which affected several virulence factors , including genes known to be hypha associated in c. albicans . this includes the disappearance of members of the sap gene family , als3 and hyr1 , and a strong divergence in the hwp1 gene , among others ( 53 ) . interestingly , the latter two are also targets of csr1 in c. albicans ( 18 ) , which might contribute to the filamentation defect in the absence of csr1 . this offers a possible explanation for the filamentation of c. dubliniensis even with a csr1/ background . interestingly , a c. albicans csr1/ mutant was also shown to produce less of the quorum - sensing molecule farnesol during biofilm formation ( 19 ) . as farnesol is also able to block hypha formation in c. dubliniensis ( 54 ) , our data hint at possible species - specific differences in the relation of cdcsr1 and cacsr1 to farnesol production and/or detection . a supply of micronutrients like zinc is essential for a microbial pathogen to survive and disseminate during an infection . previous studies have shown that orthologs of csr1 are essential for pathogenicity of different fungal pathogens : a murine infection with zap1 and zafa knockout strains resulted in milder forms of cryptococcosis and aspergillosis , respectively ( 48 , 55 ) . very recently , the effect of a c. albicans csr1/ deletion on virulence in mice and the associated transcriptome changes were assayed ( 27 ) . in the present work , we used the embryonated egg infection model ( 36 ) for the first time to examine the virulence of wild type and mutant c. dubliniensis . this alternative infection model reflected the species - specific differences in virulence observed in human infections with c. albicans and c. dubliniensis . the survival rate of chicken embryos infected with c. dubliniensis w284 ( 44% ) was more than three times higher than after infection with c. albicans sc5314 ( 14% ) and paralleled previously published data on murine infections ( 68% versus 19% survival ) ( 56 ) . the attenuated virulence of the c. dubliniensis csr1/ strains is of special interest , as hypha formation was still intact in vitro , and these results thus hint at an important role for zinc homeostasis during c. dubliniensis infections . this is also in agreement with data for csr1 in c. albicans obtained by infection experiments in mice , where csr1/ cells were strongly depleted in infected kidneys ( 26 , 27 ) . however , in c. albicans , a lack of filamentation by the csr1 mutation may have played an additional or even dominant role besides the defect in zinc supply , although the c. albicans csr1/ mutant showed no reduction in hypha - associated gene expression during kidney invasion ( 27 ) . likely , important differences exist in hypha - related gene regulation by cdcsr1 and cacsr1 ( zap1 ) in vitro and in vivo . thus , our data provide an important hint at an independent contribution of the zinc supply to the success of fungal infection . interestingly , the few virulence - associated genes verified in c. dubliniensis are generally associated with hypha formation , e.g. , via calcineurin signaling ( 57 ) or telomere - associated open reading frames ( orfs ) ( 58 ) . csr1 , in contrast , seems be a virulence factor that is not mandatorily linked to a global filamentation defect . in conclusion , we found that zinc homeostasis regulation by csr1 seems to be generally conserved among c. dubliniensis , c. albicans , and s. cerevisiae , although there are important differences , especially with regard to its role in hypha formation . furthermore , we identified csr1 as a virulence factor in c. dubliniensis , which underlines the general relevance of micronutrient supply during fungal infections .
amyotrophic lateral sclerosis ( als ) is a rapidly progressive neurodegenerative disease that primarily affects upper and lower motor neurons , resulting in death three to five years after symptom onset in the majority of patients ( 1 ) . the pathomechanism of als is largely unknown , but research efforts have been focused on several hypothetical models such as glutamate excitotoxicity , oxidative damage , mitochondrial dysfunction , inflammation and apoptosis ( 2 ) . numerous clinical trials have been performed , but unfortunately all failed to demonstrate any beneficial effects on the disease progression or survival , with the exception of riluzole . ursodeoxycholic acid ( 3 , 7-dihydroxy-5-cholanic acid , udca ) , a hydrophilic tertiary bile acid , is a major component of black bear bile that was used in traditional chinese medicine ( 3 ) . it is the current mainstay of treatment of primary biliary cirrhosis as the only drug approved by the us fda , and has been increasingly used for the treatment of various cholestatic liver diseases such as primary sclerosing cholangitis and progressive familial intrahepatic cholestasis ( 4 , 5 ) . although the mechanisms of action is not completely understood , udca and its taurineconjugated derivative ( tudca ) have been shown to strongly inhibit apoptosis in different type of cells by either stabilizing the mitochondrial membrane , or modulating the expression of specific upstream targets of apoptosis ( 6 - 11 ) . tudca improved the survival and function of nigral transplants in a rat model of parkinson 's disease ( 12 ) , and the neuroprotective effect was also reported in a transgenic mouse model of huntington 's disease ( 13 ) , and rat models of ischemic and hemorrhagic stroke ( 14 , 15 ) . als must be such a complex disease with numerous factors contributing to the degeneration of motor neurons , that an approach targeting a single molecule or process may not be effective ( 2 ) . in this respect , udca may be a promising therapeutic candidate because of its multiple mechanisms of cytoprotective actions which may include antiapoptotic , immunomodulatory and antioxidant effects ( 6 , 16 , 17 ) . despite these therapeutic potentials , this is because of its unique pharmacokinetic properties which prevent the molecule from being delivered through systemic circulation , for example , to the central nervous system at potentially therapeutic concentrations ( 18 ) . udca capsules or tablets , for instance , contain acid crystals with a very low solubility at ph < 7 , and after administration of the pharmacological dose ( 10 - 15 mg / kg / day ) udca is absorbed through passive non - ionic diffusion , which is largely limited by dilution mostly in the small intestine ( 18 ) . moreover , a large proportion of udca taken up from the portal blood is conjugated with glycine or taurine during its first hepatic passage , and actively secreted into the bile ( 18 ) . a new udca formula , oral solubilized udca ( yoo 's solution ; us patent 6251428 , 7166299 , 7303768 with ptc ) , was developed to broaden its therapeutic targets beyond the liver and biliary tracts eluding those pharmacokinetic limitations such as the enterohepatic circulation and high first - pass metabolism . the new formula contains intact udca molecules and soluble starch conversion product that enables udca to remain in solution . the product is highly soluble in water with a solubility of 80 mg / ml , and stable from ph 1 to 14 without producing precipitate ( 19 , 20 ) . it can deliver therapeutically effective amounts of solubilized intact udca to the systemic circulation with a cmax of 20.4 g / ml at a tmax of 15 min in human blood after oral administration of single dose containing 500 mg of udca ( 20 ) . moreover , a preliminary study showed that udca can be effectively delivered to the central nervous system ( cerebrospinal fluid , csf ) with oral administration of solubilized udca ( described in the methods ) . the present study was performed to evaluate the efficacy and safety of oral solubilized udca treatment in patients with als . the study was a double - blind , placebo - controlled , randomized , cross - over , single center , phase iii trial . inclusion started in march 2005 , and the final patient completed the study in july 2007 . patients with definite or probable sporadic als , according the revised el escorial criteria , were enrolled ( 21 ) . they had to be at or above 20 yr of age , and have disease duration of less than 60 months . the appel als rating scale ( aalsrs ) total score had to be between 40 and 120 at baseline ( 22 ) . patients who had a forced vital capacity of less than 30% , those with signs of major psychiatric disorders and/or dementia , and acute cholecystitis or occlusion of bile duct , or patients who had another concomitant conditions likely to interfere with drug compliance and outcome assessment were excluded . eligibility was assessed by two of the authors , and the eligible patients who gave informed consents were randomly assigned to one of the two treatment groups according to a randomization schedule prepared by prime pharm tech , corp ( suwon , korea ) . there was no stratification of patients according to the onset region , age or respiratory function , since all the patients enrolled were supposed to receive both treatments ( oral solubilized udca and placebo ) sequentially in this cross - over trial . after a run - in period of 1 month , one group received oral solubilized udca ( udca 3.5 g/140 ml q.d . , prime pharm tech , corp . ) for 3 months , while the other group received placebo ( identically - appearing , equal amount of solution q.d . , prime pharm tech , corp . ) . subsequently , the two groups switched to receive the other treatment for another 3 months during the second period of study . to eliminate a possible carry - over effect of oral solubilized udca , a wash - out period of 1 month was set at the beginning of the second period . to ensure blinding , placebo was made to be identical to oral solubilized udca in viscosity as well as appearance ( color , packaging and labeling ) , and to be similar in bitter taste ( by adding quinine hydrochloride in placebo ) . a preliminary study was performed to test if udca can be effectively delivered to the central nervous system with oral administration of solubilized udca . after the first 3 months of treatment , pure udca was detected with concentrations ranging from 0.75 to 1.72 m / l in csf of these patients ( jasco bile acid analysis system , japan spectroscopic co. , ltd . , tokyo ; data not shown ) . patients were scheduled to visit for outcome assessment at month 1 , 4 , 5 , and 8 throughout the 8-month study period . the primary outcome measure was the rate of progression , measured by the aalsrs , i.e. , the slope of aalsrs ( 22 , 23 ) . secondary outcome measures were the deterioration rates , assessed by the revised als functional rating scale ( alsfrs - r ) and forced vital capacity ( fvc , % of predicted value ) ( 24 , 25 ) . to preserve blinding , efficacy measures were assessed by two independent investigators , who were not otherwise involved in the care of patients throughout the trial . treatment adherence was checked monthly by a pharmacist , and noncompliant patients who took the study medications less than 80% of the given were considered to have violated the treatment protocol . standard laboratory tests including blood counts , chemistry , renal and liver function , and electrocardiogram were performed at baseline and at the posttreatment discontinuation visit . safety was evaluated as the incidence and severity of adverse events , and their relationship to treatment which were based on the results of laboratory tests , patients ' reports and the investigator 's judgements . we hypothesized that oral solubilized udca therapy slows the deterioration of function in patients with als , as assessed by comparing the slopes of aalsrs while the patients were treated with oral solubilized udca to those whilst on placebo . it was calculated that 48 patients , i.e. , 24 patients in each treatment group , would have to be included in order to detect a difference of 10% in the mean slope of aalsrs between the two treatments with a power of 80% and an alpha risk of 5% . the sample size calculation was based on data from a previous study using the aalsrs to measure the functional deterioration in patients with als ( 26 ) . efficacy was analyzed using the data from the patients who completed the study without any protocol violation . data for efficacy analysis were divided into two sets of per - protocol ( pp ) . the first pp ( pp ) dataset were defined as the data from the patients who completed either the first or second period of study , while the second pp ( pp ' ) dataset consisted of the data only from the patients who completed both the first and second periods of study . data of the patients whose slopes of aalsrs were steep ( defined as greater than 24 points during a 3-month period ) were excluded from efficacy analysis because inclusion of those atypical patients who progressed very rapidly could seriously distort the result ( 26 ) . using the sas general linear model ( glm ) , analysis of covariance ( ancova ) was performed with the slope as the dependent variable , treatment as factor , and the period and sequence as covariates . safety analysis was performed in all randomized patients who had taken at least one study drug or placebo . baseline characteristics of patients including demographic and clinical variables were compared between patients treated with oral solubilized udca and those with placebo . incidence of adverse events was compared between the two treatments using the chi - square . statistical significance was set at p < 0.05 , and the results are reported with two - sided p values . the study was conducted according to the declaration of helsinki , and korean good clinical practice ( kgcp ) guidelines . the study protocol was submitted to and approved by the korean food and drug administration ( kfda ) ( 16409 ) , and the institutional review board ( irb ) of seoul national university hospital ( h-0301 - 099 - 007 ) . overall trial - related activities and documents were overseen by an independent auditory board ( c&r research , seoul , korea ) . the study was a double - blind , placebo - controlled , randomized , cross - over , single center , phase iii trial . inclusion started in march 2005 , and the final patient completed the study in july 2007 . patients with definite or probable sporadic als , according the revised el escorial criteria , were enrolled ( 21 ) . they had to be at or above 20 yr of age , and have disease duration of less than 60 months . the appel als rating scale ( aalsrs ) total score had to be between 40 and 120 at baseline ( 22 ) . patients who had a forced vital capacity of less than 30% , those with signs of major psychiatric disorders and/or dementia , and acute cholecystitis or occlusion of bile duct , or patients who had another concomitant conditions likely to interfere with drug compliance and outcome assessment were excluded . eligibility was assessed by two of the authors , and the eligible patients who gave informed consents were randomly assigned to one of the two treatment groups according to a randomization schedule prepared by prime pharm tech , corp ( suwon , korea ) . there was no stratification of patients according to the onset region , age or respiratory function , since all the patients enrolled were supposed to receive both treatments ( oral solubilized udca and placebo ) sequentially in this cross - over trial . after a run - in period of 1 month , one group received oral solubilized udca ( udca 3.5 g/140 ml q.d . , prime pharm tech , corp . ) for 3 months , while the other group received placebo ( identically - appearing , equal amount of solution q.d . , prime pharm tech , corp . ) . subsequently , the two groups switched to receive the other treatment for another 3 months during the second period of study . to eliminate a possible carry - over effect of oral solubilized udca , a wash - out period of 1 month was set at the beginning of the second period . to ensure blinding , placebo was made to be identical to oral solubilized udca in viscosity as well as appearance ( color , packaging and labeling ) , and to be similar in bitter taste ( by adding quinine hydrochloride in placebo ) . a preliminary study was performed to test if udca can be effectively delivered to the central nervous system with oral administration of solubilized udca . after the first 3 months of treatment , pure udca was detected with concentrations ranging from 0.75 to 1.72 m / l in csf of these patients ( jasco bile acid analysis system , japan spectroscopic co. , ltd . , tokyo ; data not shown ) . patients were scheduled to visit for outcome assessment at month 1 , 4 , 5 , and 8 throughout the 8-month study period . the primary outcome measure was the rate of progression , measured by the aalsrs , i.e. , the slope of aalsrs ( 22 , 23 ) . secondary outcome measures were the deterioration rates , assessed by the revised als functional rating scale ( alsfrs - r ) and forced vital capacity ( fvc , % of predicted value ) ( 24 , 25 ) . to preserve blinding , efficacy measures were assessed by two independent investigators , who were not otherwise involved in the care of patients throughout the trial . treatment adherence was checked monthly by a pharmacist , and noncompliant patients who took the study medications less than 80% of the given were considered to have violated the treatment protocol . standard laboratory tests including blood counts , chemistry , renal and liver function , and electrocardiogram were performed at baseline and at the posttreatment discontinuation visit . safety was evaluated as the incidence and severity of adverse events , and their relationship to treatment which were based on the results of laboratory tests , patients ' reports and the investigator 's judgements . we hypothesized that oral solubilized udca therapy slows the deterioration of function in patients with als , as assessed by comparing the slopes of aalsrs while the patients were treated with oral solubilized udca to those whilst on placebo . it was calculated that 48 patients , i.e. , 24 patients in each treatment group , would have to be included in order to detect a difference of 10% in the mean slope of aalsrs between the two treatments with a power of 80% and an alpha risk of 5% . the sample size calculation was based on data from a previous study using the aalsrs to measure the functional deterioration in patients with als ( 26 ) . efficacy was analyzed using the data from the patients who completed the study without any protocol violation . data for efficacy analysis were divided into two sets of per - protocol ( pp ) . the first pp ( pp ) dataset were defined as the data from the patients who completed either the first or second period of study , while the second pp ( pp ' ) dataset consisted of the data only from the patients who completed both the first and second periods of study . data of the patients whose slopes of aalsrs were steep ( defined as greater than 24 points during a 3-month period ) were excluded from efficacy analysis because inclusion of those atypical patients who progressed very rapidly could seriously distort the result ( 26 ) . using the sas general linear model ( glm ) , analysis of covariance ( ancova ) was performed with the slope as the dependent variable , treatment as factor , and the period and sequence as covariates . safety analysis was performed in all randomized patients who had taken at least one study drug or placebo . baseline characteristics of patients including demographic and clinical variables were compared between patients treated with oral solubilized udca and those with placebo . incidence of adverse events was compared between the two treatments using the chi - square . statistical significance was set at p < 0.05 , and the results are reported with two - sided p values . the study was conducted according to the declaration of helsinki , and korean good clinical practice ( kgcp ) guidelines . the study protocol was submitted to and approved by the korean food and drug administration ( kfda ) ( 16409 ) , and the institutional review board ( irb ) of seoul national university hospital ( h-0301 - 099 - 007 ) . overall trial - related activities and documents were overseen by an independent auditory board ( c&r research , seoul , korea ) . a total of 80 patients were assessed for eligibility , and 64 patients were enrolled in this study ( one in error ) . reasons for exclusion were the aalsrs total score greater than 120 or disease duration longer than 60 months ( n = 10 ) , severe depression ( n = 3 ) , and clinically possible als ( n = 2 ) and cognitive impairment ( n = 1 ) . forty of 63 patients were assigned to receive oral solubilized udca in the first period of study , and the other 23 patients to receive placebo . during the first period , 19 of 40 ( 47.5% ) patients treated with oral solubilized udca and 15 of 23 ( 65.2% ) patients treated with placebo completed the study . all patients who completed the first period switched to receive the other treatment in the second period . the patients who dropped out during the first period of study were also scheduled to enter the second period of study after originally planned three months had passed with the other treatment given for the second period . thus , 31 of 40 ( 77.5% ) randomized to oral solubilized udca and 19 of 23 ( 82.6% ) randomized to placebo for the first period switched to receive placebo and oral solubilized udca , respectively , for the second period of study . during the second period , 6 of 19 ( 31.6% ) treated with oral solubilized udca and 13 of 31 ( 41.9% ) treated with placebo completed the study . drop - out rates were higher during the second period ( 62% ) than the first ( 46% ) , and also higher whilst on oral solubilized udca ( 57.6% ) than placebo ( 48.1% ) . only 16 out of 63 enrolled patients completed the entire cross - over trial of 8-month , receving both treatments . missed visits was the most common reason for drop - out ( 62% ) , followed by lost to follow - up ( 18% ) , discontinuation due to adverse events ( 12% ) and a rapid progression ( 8% ) . the demographic and clinical characteristics of patients treated with either oral solubilized udca or placebo are outlined in table 1 . the patients treated with oral solubilized udca and placebo were comparable to each other at baseline with respect to sex , age at onset , disease duration from symptom onset to diagnosis , onset region , severity , and level of diagnostic certainty . we constructed the dataset for efficacy analysis separately for each outcome , because the aalsrs and fvc measures were missing more frequently than the alsfrs - r . the results of efficacy analysis for each outcome were summarized in table 2 . as for the pp datasets , the slope of aalsrs was 1.17 points / month lower while the patients were treated with oral solubilized udca than with placebo ( 2.3 vs 3.47 points / month , 95% ci for difference 0.08 - 2.26 , p = 0.037 ) . however , the slope of neither alsfrs - r nor fvc ( % ) did not show any significant differences between treatments . efficacy analysis from the pp ' datasets revealed the same results as from the pp datasets . the slope of aalsrs was 1.63 points / month slower while the patients were treated with oral solubilized udca than with placebo ( 2.24 vs 3.88 points / month , 95% ci for difference 0.60 - 2.68 , p = 0.004 ) , whereas the alsfrs - r and fvc ( % ) deteriorated without significant differences between the two treatments . to infer the clinical meaning from the slope data , kaplan - meier estimation was performed using a 20-points progression in the aalsrs total score as the end point which was reported to represent a clinically meaningful lifestyle change . however , because of the short study period of this trial , the time to reach this endpoint had to be estimated in all patients , and was calculated by assuming that the slope of aalsrs would be linear from the start of treatment through the endpoint . as for the pp ' datasets , the time to a 20-points progression in the aalsrs total score was estimated to be delayed by 14.9 months in oral solubilized udca - treated group compared to placebo - treated group ( 22.5 vs 7.6 months , 95% ci for difference 2.97 - 26.8 months , p = 0.018 ) ( fig . 2 ) . additionally , we compared clinical features between 60 patients who dropped out and 53 patients who completed at least one part of the study . at baseline , sex , age at onset , age at enrollment , disease duration from symptom onset to diagnosis , onset region , severity , and level of diagnostic certainty were not significantly different between two groups ( all , p > 0.05 ) . safety data from each period of study were pooled to provide a whole picture of the adverse event profile . the population for safety analysis consisted of 74 patients who took oral solubilized udca , and 70 patients who took placebo ( table 3 ) . not included for safety analysis were the patien ts who did not take the study drug or placebo at all , 6 patients assigned to oral solubilized udca and 10 patients to placebo . a total of 25 occasions of adverse events were reported in 17 patients ( 23.0% ) treated with oral solubilized udca , and 12 occasions in 10 patients ( 14.3% ) treated with placebo . except for the expected complications of als such as dyspnea and dysphagia , adverse events that could be possibly attributed to the study drug or placebo were reported in 12 patients ( 16.2% , 16 occasions ) treated with oral solubilized udca , and in 6 patients ( 8.6% , 7 occasions ) treated with placebo . gastrointestinal adverse events were significantly more common in patients treated with oral solubilized udca ( p < 0.05 ) , but serious events were reported in only one patient who discontinued the drug due to abdominal pain , anorexia and vomiting . none of the 80 patients who were randomized died during the 8-month period of study , with tracheostomy performed in 2 patients . the results of this study suggest that oral solubilized udca therapy may have a beneficial effect on the rate of functional decline in patients with als . as for the slope of aalsrs , the difference between oral solubilized udca and placebo was 1.17 and 1.63 points per month on the average for the pp and pp ' datasets , respectively , which correspond to 34% and 42% relative slowing of the rate of deterioration in this scale . although estimated , the time to a 20-points progression in the aalsrs also showed that oral solubilized udca treatment could delay this endpoint by more than 1 yr compared to placebo . although it was not statistically significant , the efficacy data in the other outcomes also showed a trend favoring oral solubilized udca . although gastrointestinal adverse events developed more frequently in patients treated with oral solubilized udca , these were mostly tolerable and oral high dose solubilized udca was well tolerated in vast majority of patients . taken together , this study suggests a therapeutic potential and acceptable safety profile of oral solubilized udca in als patients . however , no firm conclusion can not be made on the efficacy of oral solubilized udca because of several critical problems and limitations of this study which should be acknowledged herein . first of all , the major problem was the large drop - out rate in this trial . in fact , only about a fourth of the initially randomized patients completed both parts of the study with missed visits , followed by lost to follow - up , being the most common drop - out reason . the patients , who had already severe disease at enrollment or became progressively more disabled during the study , tended to refuse to visit the clinic for outcome measures . thus , it is likely that the broad inclusion criteria regarding disease severity , and the lack of adherence to visit schedule for outcome measures account for the large attrition rate . the second problem of this study is the way data were analyzed , i.e. , ' completers - only ' analysis . since only the patients who completed the planned treatment course were included for efficacy analysis , this does not conform to the intention - to - principle . we can not rule out faster declines for patients after their dropout , and excluded cases can cause a bias , although baseline clinical features of patients completing the study and patients dropping - out the study were not different . however , we could not apply the intention - to - treat principle , since the attrition rate was too large for us to perform any valid imputation procedure for missing data . other limitations of this study are the short treatment period and limited number of datapoints to assess the rates of functional deterioration . treatment period of 3 months might not be sufficient duration to capture a small effect . in addition , the outcome measures may not be reproducible to give accurate statistics with only two datapoints . finally , it also should be pointed out that all the patients who were excluded due to their rapid progression rates ( > 8 points / month ) were those taking oral solubilized udca . an ethical concern about treatment with placebo was the main reason we adopted a cross - over design instead of conventional two parallel arm study ( 27 ) . it was also expected that the crossover design would be more efficient in detecting the same effect with a smaller sample size , since within - patient variability may be smaller than between - patient variability when the deterioration rates of functional scales are used as endpoints ( 28 , 29 ) . however , there might be disadvantages to the cross - over trial as well , and some of these indeed caused difficulties for analysis and interpretation of our study . first , there may be a bias which is related to the unequal randomization for the first treatment period . it is likely that merely the sequence of treatment may explain the difference between treatments , although we adjusted the effects of sequence and period using ancova to evaluate the effect of treatment itself . the other problem is a treatmentperiod interaction , so - called a carry - over effect . the wash - out period of 1 month may be insufficient to completely eliminate the effect of treatment given before . however , we could exclude the inflation of alpha - error resulting from the carry - over effect , because any persistence of the drug effect would have reduced the magnitude of difference during the second treatment period . it is worth emphasizing that udca can be effectively delivered to the central nervous system ( csf ) with oral administration of solubilized udca in our study . a recent pilot study by parry et al . also showed that udca was well absorbed after oral administration and crossed the blood - brain barrier in a dose - dependent manner in als patients ( 30 ) . eighteen patients were received udca in tablet formula at doses of 15 , 30 , and 50 mg / kg of body weight per day and the concentration of udca in csf ranged 43.1 to 281.7 nm / l after 4 weeks of treatment . these results suggest that oral udca is well delivered to csf of als patients and the therapeutic effects deserve to be expected although it remains to be elucidated which formula or dose of udca is more tolerated , absorbed , delivered and effective in als patients . although the mechanisms of cytoprotection of udca remain to be elusive , it does not seem to be limited to hepatic cells . udca modulates the apoptotic threshold in both hepatic and non - hepatic cells through the downregulation of p53 pathway ( 10 , 11 ) . recently , a study using oral solubilized udca demonstrated that udca treatment can suppress cisplatin - induced p53 accumulation and apoptosis in mouse sensory neurons ( 19 ) . it was also reported that this highly soluble and acid stable udca formula can scavenge the reactive oxygen species and prevent apoptosis in helicobacter pylori - induced gastritis ( 20 ) . in line with these previous reports , we also found that the new udca formula improved the motor performance and survival of g93a sod1 mutant transgenic mice ( in preparation ) . therefore , the therapeutic effect of udca may be ascribed to the successful delivery of udca to the central nervous system and its multiple cytoprotective actions . oral solubilized udca treatment seems to be tolerable in als patients , but regarding the efficacy we could not make any conclusions due to several problems and limitations of this pilot study as discussed above . still , the effect of udca deserves to be expected in als , due to its multiple neuroprotective mechanism . as we know , a phase ii trial for the efficacy and tolerability of tauroursodeoxycholic acid , taurine conjugate of udca in als patients is also ongoing ( nct00877604 ) by italian researchers . further large scale study with minimal attrition rate is warranted to confirm the efficacy and safety of oral solubilized udca for patients with als .