Datasets:

ewhfef

/

mix_cpt

like 1

regional anesthesia techniques provide important advantages including excellent pain control , reduced side - effects , and shortened stay in the post anesthesia care unit . however , these early advantages can be short - lived and limited by the relatively brief duration of action of currently available local anesthetics ( las ) , potentially resulting in block resolution before the period of worst postoperative pain . increasing the volume of la may prolong the duration of analgesia , but may also increase the risk of la systemic toxicity . although continuous catheter - based nerve blocks can extend postoperative analgesia , their placement requires additional time , cost , and skill . ropivacaine has a long duration of action , with similar pharmacology to bupivacaine but a wider safety margin . adjuvants with las in brachial plexus block are used to achieve a quick , dense , and prolonged block . the concurrent injection of 2 adrenergic agonist drugs has been suggested to improve the nerve block characteristic of la solutions . dexmedetomidine is a selective 2 adrenoceptor agonist , which has higher affinity to 2 receptors compared to clonidine . with ropivacaine , it results in a dose - dependent increase in the duration of sensory and motor block . however , their combination in supraclavicular brachial plexus block has not been studied till now ; hence , the need for the study . secondary outcomes include the time to onset of sensory and motor blockade , duration of sensory and motor blockade and complications / side effects if any . this placebo - controlled randomized trial was conducted at a tertiary referral hospital from october 2012 to april 2014 . sample size calculation was done based on a pilot study in which it was estimated that a minimum of ten patients in each group would be required to detect a difference in the average duration of analgesia as small as 2 times with 95% confidence level . the standard deviation ( sd ) of the two groups was 80 and 137 min of a and b groups , respectively . the level of significance and the power of the study were fixed as 0.05 ( ) and 0.9 ( 1- ) . a larger sample size of 30 in each group was selected to avoid the skewness of the primary outcome variable ( time to first analgesic ) , to obtain significant difference in the secondary outcomes among the two groups and to eliminate any other confounding biases . eligible participants were patients aged between 18 and 70 years , american society of anesthesiologists physical status ( asa ) i / ii / iii , and those undergoing elective upper limb surgeries . exclusion criteria were patient refusal for the block , patients on anticoagulants or with bleeding disorders , those with severe respiratory disease , neurological deficits involving the brachial plexus , allergy to study drugs , local infection at the injection site , those on sedatives or antipsychotics , body mass index ( bmi ) > 35 , cardiac arrhythmias , advanced heart block and/or severe ventricular dysfunction , those on other vasodilators or negative chronotropic agents , altered sensorium , and pregnant and nursing women . sixty patients satisfying the inclusion criteria undergoing elective upper limb surgery were included in the study , after obtaining an informed consent and ethical committee approval . they were randomized and divided into two groups in a double - blind fashion using computer generated random number table with assignments provided in sealed opaque envelopes . group a patients ( n = 30 ) received 30 ml of 0.5% ropivacaine + 1 ml saline , and group b patients ( n = 30 ) received 30 ml of 0.5% ropivacaine + 1 g / kg dexmedetomidine . all the patients were premedicated with 150 mg ranitidine and 8 mg ondansetron orally on the morning of surgery . after documenting the baseline vital parameters , the patients received intravascular midazolam 1 mg and fentanyl 0.5 g / kg prior to the block . the supraclavicular brachial plexus block was performed by the classical approach using a single - injection and nerve stimulator technique . once the desired response was obtained , that is a muscle twitch of the fingers that is clearly visible ; the current strength was reduced to 0.6 ma . if there was no adequate response , the needle was moved anteriorly or posteriorly along the first rib to elicit a response . following the injection , sensory block was assessed by pinprick test at each minute after completion of drug injection in the dermatomal areas corresponding to the median nerve , ulnar nerve , radial nerve , and musculocutaneous nerve till complete blockade . sensory block was assessed by a 3 point scale : 0 normal sensation , 1 loss of sensation of pinprick ( analgesia ) , 2 loss of sensation of touch ( anesthesia ) . onset time was defined as the time interval between the end of la administration and complete sensory block ( score 2 ) . duration of sensory block was defined as the time interval between the end of la administration and the complete resolution of anesthesia ( score 0 ) . motor blockade was assessed by modified bromage scale ( mbs ) for the upper limb . motor block onset time was defined as the time interval between the end of total la administration and complete motor block ( mbs score 2 ) . duration of motor block was defined as the time interval from the onset to the recovery of complete motor function ( mbs score 0 ) . inadequate sensory and motor blockade beyond 30 min following the infiltration was considered as an unsuccessful block and was supplemented with general anesthesia . pain was assessed using a standard 10 cm visual analog scale ( vas ) by an independent anesthesiologist . intraoperative heart rate , systolic , diastolic and mean arterial pressures , sensory and motor block scores , and the vas scores were noted every 5 min during the first 15 min , then every 15 min throughout the surgery and hourly thereafter till complete recovery of the block . intravenous paracetamol 1 g was administered 6 hourly for the first 24 h. time for the first request of postoperative analgesic when vas > 3 ( duration of analgesia ) was noted and rescue analgesic intramuscular tramadol , 50 mg was given . hypotension ( systolic blood pressure more than 20% fall from baseline value ) , bradycardia ( heart rate < 50/min ) , and postoperative complications such as nausea and vomiting , horner 's syndrome , phrenic nerve palsy , pneumothorax , respiratory depression , and signs and symptoms of la systemic toxicity were looked for and managed , if any . the above assessments were made by an investigator who was blinded to the drugs used in the study . results of continuous measurements were presented as mean sd and analyzed using student 's unpaired t - test . results of categorical measurements were presented in number ( % ) and compared using test of significance . in the above tests , a p < 0.05 was accepted as indicating statistical significance . data analysis was carried out using statistical package for social science version 18 ( spss inc . , chicago , il , usa ) and microsoft word and excel were used to generate graphs and tables . results of continuous measurements were presented as mean sd and analyzed using student 's unpaired t - test . results of categorical measurements were presented in number ( % ) and compared using test of significance . in the above tests , a p < 0.05 was accepted as indicating statistical significance . data analysis was carried out using statistical package for social science version 18 ( spss inc . , chicago , il , usa ) and microsoft word and excel were used to generate graphs and tables . a total of eighty patients were approached for participation in the study from october 2012 to april 2014 . patient flow ( according to consort chart ) there was no significant difference in the patient characteristics including age , gender , height , weight , bmi , asa grade , type of surgery , and duration of surgery as summarized in table 1 . comparison of demographic variables onset of sensory and motor blockade was significantly faster in group b compared to group a [ table 2 ] . duration of analgesia and duration of sensory and motor blockade were also prolonged in group b compared to group a [ table 2 ] . block onset and duration between groups the hemodynamic variables were comparable between the two groups during the study intervals except that intraoperatively four patients in dexmedetomidine group developed hypotension ( 13% ) , which was managed with a fluid bolus , and one patient had bradycardia ( 3% ) , which was managed by awakening the patient . there was statistically significant difference between the two groups in the incidence of these side effects ( p < 0.001 ) . there were no other side effects such as nausea and vomiting , horner 's syndrome , phrenic nerve palsy , pneumothorax , or respiratory depression in any of the patients . our study demonstrated that addition of an alpha agonist like dexmedetomidine to ropivacaine resulted in prolonged duration of analgesia postoperatively . it also showed that there were early onset and prolonged duration of sensory and motor blocks . by increasing the duration of analgesia with a single block , we could achieve a longer duration of postoperative analgesia without significant clinical side - effects . added dexmedetomidine to levobupivacaine for axillary brachial plexus block and showed that it shortens the onset time of both sensory and motor block ( 9.0 1.1 and 9.5 1.0 min vs. 10.5 1.3 and 11.1 1.2 min , respectively ) , prolongs the duration of block ( 887 66.2 and 773.0 67.6 min vs. 673.0 73.8 and 575.0 65.0 min , respectively ) , and the duration of postoperative analgesia ( 1008.7 164.0 vs. 887.1 260.8 min , respectively ) , which is similar to our study . addition of dexmedetomidine to bupivacaine during infraclavicular brachial plexus block under ultrasound guidance was studied where there was early onset of sensory and motor blockade , with prolonged analgesia and prolonged duration of sensory and motor block similar to our study . in another study , adding dexmedetomidine to ropivacaine for posterior tibial nerve block under ultrasound guidance had prolonged duration of sensory blockade ( 21.5 vs. 16.2 h ) ; mean pairwise difference 5.3 h similar to the present study but with higher incidence of hypotension and bradycardia . addition of dexmedetomidine to bupivacaine for greater palatine nerve block has demonstrated that increased duration of analgesia ( 22 1.7 h ) can be achieved , which is identical to that in our study . showed that dexmedetomidine enhances duration of bupivacaine anesthesia and analgesia when used for sciatic nerve block in rats without any damage to the nerve . in another study , perineural dexmedetomidine added to ropivacaine for sciatic nerve block in rats prolonged the duration of analgesia by blocking the hyperpolarization - activated cation , which was reversed by a hyperpolarization - activated cation channel enhancer but not by 2 adrenoceptor antagonist . this indicates that the analgesic effect of peripheral perineural dexmedetomidine was caused by the enhancement of the hyperpolarization - activated cation current , which maintains the nerve in a hyperpolarized state and prevents it from subsequent firing . the efficacy of peripheral action of perineural dexmedetomidine added to bupivacaine and ropivacaine for sciatic nerve block in rats has been established . the increase in duration of analgesia is dose dependent , and the effect is peripheral ( not caused by centrally mediated or systemic analgesia ) . in our study , the higher incidence of bradycardia and hypotension in dexmedetomidine group is a problem and can not be ignored . bradycardia and hypotension are potentially life - threatening , and if not detected in time , there can be dangerous consequences . thus , when dexmedetomidine is being used as an adjuvant to ropivacaine , monitoring of the patient in a high dependency area is required at least for 24 h. the lack of other side effects such as nausea , vomiting , and respiratory depression make dexmedetomidine an attractive choice as an adjuvant for the block . use of ultrasound guidance for the peripheral nerve block is one of the latest , precise , and safe methods these days . this could have helped us to understand any long - term neural side effects of the study drugs used . nonavailability of ultrasound equipment during the course of our study and no long - term follow - up are our limitations . further studies using ultrasound guidance and with long - term follow - up may be needed . the findings of this study indicate that dexmedetomidine can be safely used with la in peripheral nerve blocks ; however , study to determine any toxic effects on neural structures in humans is needed . we conclude that dexmedetomidine added to perineural ropivacaine in supraclavicular brachial plexus block is effective in providing prolonged duration of analgesia .

compounds that stabilize microtubules ( msa ) , which include taxanes ( paclitaxel , docetaxel ) , are effective anticancer drugs . it is known that the therapeutic effect of these drugs is associated with cell cycle arrest , followed by initiation of apoptotic processes . however , the exact mechanism that links cell division impairment with apoptosis induced by drugs is still poorly understood . the mammalian cell cycle is controlled by cyclin - dependent kinases , whose activity is modulated by several activators and inhibitors . cdks are serine / threonine kinases that play a key role in regulating both cell cycle and transcription through the phosphorylation of transcription factors and tumor suppressor proteins involved in dna replication and cell division . the cdk modulators include a 2 , 6 , 9-substituted purine analogue , roscovitine ( cyc202 ) , which inhibits cdk activity directly by competing for the atp - binding sites of cdk and causing apoptosis within various tumor cells . a study of clinical utility of roscovitine showed its anticancer effects and limited toxicity for humans in clinical trials . the aim of this study was to establish a connection between the effect of paclitaxel on cell cycle and induction of apoptotic processes in colon ( cc ) and anaplastic thyroid cancer ( atc ) cell lines aro and ktc-2 . atc cell lines ktc-2 were established at kawasaki medical school ( okayama , japan ) . human cancer cell line aro ( initially assumed to be anaplastic thyroid carcinoma cell line but recently reclassified into colon carcinoma ) was initially provided by j. a. fagin ( university of cincinnati college of medicine , cincinnati , oh , usa ) . throughout all experiments , cancer cell lines were grown in rpmi 1640 supplemented with 5% fetal bovine serum ( fbs ) and 1% penicillin / streptomycin ( all reagents from invitrogen life technologies , paisley , uk ) in a 5% co2 humidified atmosphere at 37c . after 2 d incubation , when the culture reached about 80% confluence , cells were washed twice with pbs ( ph 7.4 ) at 37c , and a fresh medium was added to each dish . cells were incubated for additional 24 h , exposed to the drug(s ) as described below , and then collected at different time intervals . cultures were established in the 96-well flat - bottom microtiter plates in rpmi 1640 containing 5% fbs . cell suspensions ( 100 l , ~1000 cells / well ) were added to each well and incubated for 24 h before treatment . ptx ( wako chemicals , osaka , japan ) and roscovitine dissolved in dimethylsulfoxide ( dmso ) and the control ( dmso only ) were added to each well at varying concentrations , six wells for each concentration . after incubation , a water - soluble tetrazolium salt - based assay ( wst ) was performed as follows : 11 l of the cell counting kit solution ( cck-8 , dojin , osaka , japan ) were added to each well and incubated for 1 h at 37c . adherent cells were washed twice with an ice - cold pbs supplemented with sodium pyrophosphate and orthovanadate , scraped with a rubber policeman , collected in 1 ml pbs , and centrifuged for 3 min at 1000 rpm at 4c . the pellet was then resuspended in 200 l of the lysis buffer ( cell signaling technology , danvers , ma , usa ) containing a cocktail of protease and phosphatase inhibitors . after 15 min on ice , lysates were centrifuged for 15 min at 15,000 g and stored at 80c until use . protein concentration was determined with a bicinchoninic acid assay reagent kit ( sigma , st . total cell lysates were boiled in a sample buffer ( 100 mm tris - hcl , 4% sodium dodecyl sulfate , 0.2% bromophenol blue , 20% glycerol , 10% dithiothreitol ) and separated by sds - page 7.515% gradient gels . the homogeneous 8 and 15% gels were used for better separation of high- and low - molecular - weight proteins , respectively . membranes were blocked with tris - buffered saline/0.1% tween 20 containing 5% nonfat dry milk or 5% bsa and incubated with primary antibodies ( cell signaling technology or santa cruz biotechnology , santa cruz , ca , usa ) , as appropriate , at 4c overnight . after washing three times with tris - buffered saline/0.1% tween 20 , the blots were incubated with horseradish peroxidase - conjugated species - specific secondary antibody ( cell signaling technology ) for 1 h at ambient temperature and then again washed three times . complexes were visualized using ecl reagents ( amersham , arlington heights , il , usa ) . it is believed that the basis of the mechanism of apoptosis induction by ptx in tumor cell is phosphorylation with subsequent degradation of the antiapoptotic protein bcl-2 , which stabilizes the mitochondrial membrane [ 4 , 5 ] . a decrease in this protein amount leads to an imbalance between pro- and antiapoptotic proteins causing a release of mitochondrial cytochrome c and other apoptotic factors followed by caspase-9 activation . the jnk - dependent phosphorylation of bcl-2 and its further degradation were considered as the most probable event , which mediates the ptx action . however , experiment with a jnk inhibitor , sp600125 , showed that inhibition of jnk in atc cells did not reduce bcl-2 phosphorylation as expected but even slightly increased it ( figure 1(1 ) ) . since ptx in atc cells activates a number of cell cycle regulators , a specific inhibitor of cdk , roscovitine , it was found that inhibition of cdk caused a nearly complete , qualitative inhibition of bcl-2 phosphorylation ( figure 1(2 ) ) . thus , cdk activated by ptx is directly or indirectly responsible for phosphorylation of antiapoptotic protein bcl-2 . these results are confirmed by data obtained on kb-3 human carcinoma cell line evidenced that cdk1 phosphorylated bcl - xl / bcl-2 and thus attenuated their antiapoptotic function . it should be noted that jnk , and to a lesser extent p38mapk , also mediates ptx - induced apoptosis in atc cells but obviously through parallel mechanisms . future experiments will show whether there are any interrelationships between these mechanisms and cdk or cdk - dependent signaling . some data point out the possibility of such an interaction [ 8 , 9 ] . one of the roscovitine targets in the cell is cdk1 ( cdc2 ) [ 10 , 11 ] , which in combination with cyclin b1 promotes the transition of cells from g2 phase to mitosis . it has been shown that in atc cells ptx , like other msa , stopped the transition , caused an arrest of cycle at the g2/m stage . this triggered the activation of a number of cell cycle regulators , which , on the background of a decrease in quantity of cdk - inhibitors ( p27 and p21 ) , stimulated overcoming of the g2/m barrier . among the most important events , it should be noted the activation of phosphatase cdc25c ( dephosphorylation of ser216 ) , which in turn activates cdk1 by removing inhibitory phosphate at position 15 tyrosine residues , and a significant increase in cdk1 cofactor cyclin b1 expression ( figures 1(3)1(5 ) ) . perhaps an excessive activation of cdk1 , which is observed under the influence of ptx , is one of the triggers that initiated the process of apoptosis in tumor cells . thus , it may be suggested that the initiation of mitochondrial apoptosis in cells of anaplastic thyroid cancer under the action of ptx is mediated by cyclin - dependent kinases . however , a study of the effects of combined action of roscovitine and ptx upon apoptotic mechanisms showed that roscovitine activated caspase-9 , caspase-8 , and parp cleavage but attenuated ptx - dependent activation of caspase-9 , parp cleavage , and especially caspase-8 activation ( figures 2(a ) and 2(b ) ) . on the other hand , roscovitine significantly decreased antiapoptotic xiap level , which is high under ptx action ( figure 2 ) . cell survival study on aro cells showed that after 24 h of incubation roscovitine enhanced ptx cytotoxicity at low drug concentration , and there were no effects at higher ptx concentrations : 1025 nm and after 48 h of incubation ( figures 3(a ) and 3(b ) ) . in ktc-2 cells roscovitine , after 24 h of incubation , enhanced ptx cytotoxicity at all studied drug concentrations ( figure 3(c ) ) . after 48 h of incubation , roscovitine increased ptx cytotoxicity at low ( 2.55 nm ) concentrations and did not affect or even inhibited cell death at higher drug concentrations ( figure 3(d ) ) . certain inhibition of ptx cytotoxicity at 25 nm by roscovitine probably reflected the reduced activity of caspases under combined effects of ptx and roscovitine ( figures 2(a ) and 2(b ) ) . the difference in roscovitine action on aro and ktc-2 cell line as well as a higher sensitivity of ktc-2 cells to the drugs may be due to the presence of an active tp53 gene in the latter . it is known that roscovitine can induce activation and stabilization of p53 by suppression of mdm2 expression [ 12 , 13 ] . thus , roscovitine in atc and cc cells showed marked proapoptotic effects , which can be explained by phosphorylation of antiapoptotic protein bcl-2 and inhibition of iap expression . there is evidence also that roscovitine suppressed antiapoptotic mcl-1 expression and downregulated flice - inhibitory proteins in breast cancer cells . other data show that roscovitine increases the proapoptotic bax and decreases antiapoptotic survivin and xiap expression , resulting in caspase - dependent apoptosis of sarcoma cells . combined action of micromolar concentrations of roscovitine and low ( 15 nm ) concentrations of ptx may be a promising strategy for further preclinical investigations .

hek293 cells were maintained in dulbecco 's modification of eagle 's medium ( dmem ) supplemented with 10% fetal bovine serum ( sigma ) . mda - mb-231 and mda - mb-468 breast cancer cells were obtained from the atcc ( rockville , md ) and grown in dmem / ham 's f-12 medium supplemented with 10% fetal bovine serum . plasmids for mammalian cell expression of green fluorescent protein tagged dlc-1 proteins , the full - length ( 1 - 1091 amino acids ) and truncated sequences of the dlc-1 cdna ( genbank accession number nm_006094 ) were generated by pcr and subcloned into the bamhi site of pegfp - n1 ( bd biosciences ) . the truncated fragments of dlc-1 are as follows : dlc-1 sam ( 77 - 1091 amino acids ) , dlc-1 n ( 609 - 1091 amino acids ) , dlc-1 start ( 875 - 1091 amino acids ) , dlc-1 start ( 1 - 878 amino acids ) , dlc-1 n1 ( 1 - 638 amino acids ) , dlc-1 sam ( 1 - 83 amino acids ) , and dlc-1 rhogap ( 609 - 878 amino acids ) . serial amino - terminal truncations of dlc-1 ending with residues 252 , 439 , 609 , and 629 were generated by pcr from full - length pegfp - dlc-1 , and serial carboxyl - terminal truncations of dlc-1 ending with residues 850 , 828 , and 878 were generated by pcr from pegfp - dlc-1 n ( 609 - 1091 ) and subcloned into the bamhi site of pegfp - n1 . additional mutant constructs are explained in the figure legends and text . for expression of glutathione s - transferase ( gst ) fusion recombinant protein , cdna sequences for full - length dlc-1 , dlc-1 sam , and dlc-1 rhogap domain were subcloned into the pgex-5x-3 ( ge healthcare ) bacterial expression vector . pgex plasmids for expression of gst fusions of wild type human rhoa have been described previously ( 26 ) . the pax142-rhoa ( 63l ) and pax142-cdc42(12v ) mammalian expression vectors for activated rho gtpases have been described previously ( 27 ) . mda - mb-468 cells on coverslips were transiently transfected with various egfp - tagged dlc-1 constructs using lipofectamine 2000 ( invitrogen ) . after 24 h of transfection , the cells were fixed with 4% paraformaldehyde for 5 min , permeabilized with 0.2% ( v / v ) triton x-100 for 5 min at room temperature , and stained with either alexa fluo 568-phalloidin ( molecular probes ) for f - actin or anti - vinculin antibody ( sigma ) or monoclonal anti - dlc-1 antibody ( bd biosciences ) followed by incubation with fluorescently conjugated secondary antibody . the anti - dlc-1 antibody was shown to be specific versus other members of the dlc family ( data not shown ) . for cotransfection experiments , hek293 cells plated in 24-well plates were transiently transfected with 0.15 g of pegfp - dlc-1 sam and 0.45 g of pax142-rhoa(63l ) or pax142-cdc42(12v ) using lipofectamine 2000 . twenty - four hours after transfection , the cells were trypsinized and replated on fibronectin - coated coverslips ( 10 g / ml ) in dmem supplemented with 10% fetal bovine serum for 1 h. the cells were fixed , stained as described above , and observed on an olympus confocal fv300 fluorescent microscope with a 60 oil immersion objective ; the images were acquired by using olympus fluoview software . in vitro rhogap assay the in vitro gap activity of dlc-1 was measured with a fluorescence - based technique as we described previously ( 5 ) . briefly , plasmids encoding gst fusion proteins of dlc-1 and rho gtpases were transformed into the bl-21 escherichia coli strain , and expression of the gst fusion proteins of dlc-1 and rhoa was induced with 100 mm and 250 mm isopropyl -d-1-thiogalactopyranoside for 16 h at room temperature , respectively . bacterially expressed rho gtpases were purified by glutathione - sepharose 4b chromatography and were preloaded with gtp in an exchange buffer for 1 min at 37 c . hydrolysis assays were initiated with adding 0.30 mm dlc-1 in an assay buffer containing 15 mm mdcc - phosphate - binding protein and 2 mm gtp - bound gtpase . the increases in pi production from gtp hydrolysis were measured with a spectramax gemini ( molecular devices ) spectrofluorimeter by checking increases in fluorescence ( ex = 425 nm and em = 465 nm ) . the full - length and various fragments of dlc-1 cdna were subcloned into the egfp - tagged expression vector , pegfp - n1 , resulting in the expression of carboxyl - terminal gfp - tagged fusion proteins . the full - length and various fragments of dlc-1 cdna were subcloned into the egfp - tagged expression vector , pegfp - n1 , resulting in the expression of carboxyl - terminal gfp - tagged fusion proteins . rhoa activation assay a gst fusion of the rho - gtp - binding domain of rhotekin ( amino acids 7 - 89 ) , an effector of rhoa , was used in pulldown assays to detect expression of activated rhoa - gtp as described previously ( 28 ) . in brief , hek293 cells plated in 100 mm of culture were transfected with dlc-1 plasmids for 20 h , treated with lysophosphatidic acid for 30 min , and lysed in 300 l of ice - cold lysis buffer ( 50 mm tris - hcl , ph 7.4 , 500 mm sodium chloride , 0.1% sds , 0.5% deoxycholate , 1% triton x-100 , 0.5 mm magnesium chloride , 1 mm sodium orthovanadate , 10 g / ml leupeptin , 10 g / ml aprotinin , and 1 mm phenylmethanesulfonyl fluoride ) and clarified by centrifugation at 14,000 rpm for 20 min at 4 c . a 5% aliquot was removed for determination of total quantities of the gtpase being analyzed . clarified lysates were then incubated with 5 g of gst - rhotekin rho - gtp - binding domain fusion protein for 1 h at 4 c that had been precoupled to glutathione - sepharose 4b beads ( amersham biosciences ) and washed three times with the lysis buffer . the samples were analyzed by sds - page and western blotting using anti - rhoa antibody ( bd biosciences ) to detect bound activated gtpases . whole cell lysates were also analyzed for the presence of expressed rhoa and tubulin for normalization . migration analysis cells plated overnight were transiently transfected with various pegfp - dlc-1 plasmids using lipofectamine 2000 . after 12 - 18 h of transfection , the cells were trypsinized , replated sparsely on fibronetin - coated ( 10 g / ml ) glass - bottomed dishes in dmem supplemented with 10% fetal bovine serum and placed in a temperature- and co2-controlled chamber of a microscope equipped with 40 objective lenses . time lapse recording was started 30 min or 1 h after plating , and differential interference contrast images were collected at 5-min intervals over 6 h using a coolsnap hq cooled charge - coupled device ( roper scientific ) linked to a zeiss axiovert 200 m microscope controlled by slidebook software ( intelligent imaging , denver , co ) , or alternatively brightfield images were collected with a high content screening instrument , bd pathway 855 bioimager ( bd biosciences ) . to explore the effects of rho kinase ( rock ) inhibition on cell migration , hek293 cells on fibronectin - coated ( 10 g / ml ) glass - bottomed dishes in dmem supplemented with 10% fetal bovine serum were treated for 3 h with 50 m of the rock inhibitor y27632 ( calbiochem inc . ) before starting time lapse recording . the velocity and persistence of migratory directionality ( d / t ) were measured by manually tracking of the location of cell centroids at each frame using image j or metamorph software ( molecular devices ) . each figure shown is representative of a minimum of two to three independent experiments analyzing 10 - 25 cells each . the velocity was calculated as [ total length of migration paths ( m)/time ( min ) ] and the persistence of migration was calculated as [ net displacement ( m)/total length of migration paths ( m ) ] . distinct roles of amino- and carboxyl - terminal sequences in regulation of dlc-1 subcellular localization recent studies suggest that amino - terminal sequences between the sam and rhogap domains regulate dlc-1 subcellular localization ( 22 , 25 ) . to further evaluate the contribution of amino- and carboxyl - terminal sequences in regulation of dlc-1 , we generated expression vectors that encoded more precise deletion and truncation mutants that were coupled at the carboxyl terminus to enhanced green fluorescent protein ( egfp ) to allow us to monitor dlc-1 expression and localization in live cells ( fig . 1 ) . first , we wanted to verify that our ectopic expression of a tagged dlc-1 protein showed physiologic subcellular localization . we utilized western blot analyses of a series of breast carcinoma cell lines for expression of dlc-1 and determined that mda - mb-468 and mda - mb-231 cells are negative and positive for endogenous dlc-1 protein expression , respectively ( data not shown ) . in agreement with previous studies using amino - terminally tagged dlc-1 fusion proteins ( 20 - 22 ) , we found that full - length dlc-1 with a carboxyl - terminally fused gfp partially localized at the tips of actin filaments in mda - mb-468 cells ( fig . because proteins that are ectopically expressed can be mislocalized , we also examined the distribution of endogenous dlc-1 in mda - mb-231 cells , and we found that a significant portion of endogenous dlc-1 also seems to be localized at actin tips within focal adhesion - like structures ( fig . these results confirm that the ectopically expressed gfp - tagged dlc-1 has a similar subcellular localization as endogenous dlc-1 and may thus be an appropriate surrogate for the endogenous protein . to assess the role of amino- and carboxyl - terminal sequences in regulation of dlc-1 function , we next evaluated the subcellular location of several gfp - tagged dlc-1 truncation mutants when transiently expressed in mda - mb-468 cells ( fig . 2c ) . full - length dlc-1 largely colocalized with vinculin - containing focal contacts . the isolated sam domain ( dlc-1 sam ) and the isolated start domain ( dlc-1 start ) did not show localization to focal adhesions but showed the same localization as egfp alone . hence , the sam or start domains alone are not sufficient for focal adhesion targeting . however , inclusion of amino - terminal sequences upstream of the rhogap domain ( dlc-1 n1 ) showed an apparent focal adhesion localization similar to that of full - length dlc-1 . these observations suggested that the aminoterminal region between the sam and gap domains was necessary for the focal adhesion localization of dlc-1 . these results are consistent with recent studies determining that dlc-1 association with focal adhesions is mediated through tensin family protein binding to a nonphosphorylated tyr residue that serves as a binding site for the tensin src homology 2 domains ( 20 - 22 ) . unexpectedly , we found that expression of any truncation mutant lacking the amino - terminal sam domain caused drastic cell rounding and formation of protrusions that complicated our ability to accurately visualize the subcellular localization abilities of these truncation mutants . however , as we demonstrate in a section below , this problem can be overcome . supplemental table s1 provides a semiquantitative analysis of the morphological effects and subcellular localization of the various dlc-1 constructs . a , dlc-1 negative mda - mb-468 cells grown on glass coverslips were transiently transfected with egfp - tagged full - length dlc-1 , stained with rhodamine - phalloidin , and imaged with a confocal fluorescence microscope to observe subcellular localization and the effects on cell morphology . b , dlc-1 positive mda - mb-231 cells were fixed and stained with anti - dlc-1 antibody followed by anti - mouse secondary antibodies conjugated to alexa fluor 488 and rhodamine - phalloidin ( upper panel ) . a higher magnification of the analysis is shown in the lower panels . c , the various egfp - tagged dlc-1 constructs indicated were transiently transfected into mda - mb-468 cells , and the cells were stained with an anti - vinculin antibody followed by a alexa fluor 594 labeled secondary antibody . a , dlc-1 negative mda - mb-468 cells grown on glass coverslips were transiently transfected with egfp - tagged full - length dlc-1 , stained with rhodamine - phalloidin , and imaged with a confocal fluorescence microscope to observe subcellular localization and the effects on cell morphology . b , dlc-1 positive mda - mb-231 cells were fixed and stained with anti - dlc-1 antibody followed by anti - mouse secondary antibodies conjugated to alexa fluor 488 and rhodamine - phalloidin ( upper panel ) . a higher magnification of the analysis is shown in the lower panels . scale bar , 20 m . c , the various egfp - tagged dlc-1 constructs indicated were transiently transfected into mda - mb-468 cells , and the cells were stained with an anti - vinculin antibody followed by a alexa fluor 594 labeled secondary antibody . the sam domain functions as an autoinhibitory regulator of rhogap activity in vitro and in vivo we further evaluated the consequences of deletion of the sam domain for dlc-1 function . as seen in fig . 2c truncation mutants of dlc-1 lacking the sam domain alone ( dlc-1 sam ) or with the entire amino - terminal region deleted ( dlc-1 n ) produced dramatic changes in morphology including the development of long neurite - like protrusions that often terminated in lamellipodia , as well as the loss of mature vinculin staining focal adhesions . a similar result was produced by expression of dlc-1 rhogap comprised of only the functional rhogap domain ( amino acids 609 - 878 ) linked to gfp . however , these morphological changes and the loss of vinculin staining did not occur upon expression of gfp alone or gfp - tagged full - length and other mutants of dlc-1 . these observations suggest that amino - terminal truncations may activate dlc-1 , thus leading to the changes in cell shape . similar morphological alterations were also produced in other cell types including mda - mb-231 , mda - mb-361 , and mcf-7 cells ( data not shown ) . the morphological changes caused by sam domain - deleted dlc-1 are similar to those that we have seen with inhibition of endogenous rhoa function by overexpression of the p190 rhogap and the rnd3 antagonist of rhoa ( 29 ) . therefore , we speculated that deletion of the sam domain rendered dlc-1 rhogap constitutively activated , causing inactivation of endogenous rhoa function . consistent with this possibility , we found that any of the three disabling mutations in the dlc-1 rhogap domain ( r677e , k714e , or k718e ) resulted in dlc-1 sam mutants that were unable to induce morphological changes in cells ( see supplemental fig . figure 3.sam domain deleted dlc-1 shows enhanced catalytic activity for rhoa . a , bacterially expressed full - length , sam domain deleted ( amino acids 77 - 1091 ) , and rhogap domain fragment ( amino acids 609 - 878 ) of dlc-1 were purified for analysis of in vitro gap activity . purified gst - rhoa fusion proteins were preloaded with gtp , and gtp hydrolysis was monitored by incubation with a phosphate - binding protein that undergoes a major increase in fluorescence upon binding inorganic phosphate . c , gtp loading of rhoa in cells was monitored by a rhotekin pull - down assay as described under experimental procedures . a , bacterially expressed full - length , sam domain deleted ( amino acids 77 - 1091 ) , and rhogap domain fragment ( amino acids 609 - 878 ) of dlc-1 were purified for analysis of in vitro gap activity . purified gst - rhoa fusion proteins were preloaded with gtp , and gtp hydrolysis was monitored by incubation with a phosphate - binding protein that undergoes a major increase in fluorescence upon binding inorganic phosphate . c , gtp loading of rhoa in cells was monitored by a rhotekin pull - down assay as described under experimental procedures . the increased biological effects of dlc-1 sam , suggested that the sam may serve as an autoinhibitor domain and regulate intrinsic dlc-1 activity . to determine whether this was based on an increase in intrinsic gap catalytic activity we undertook biochemical studies of full - length or truncated dlc-1 proteins expressed in bacteria and analyzed via an in vitro assay for gap activity . we recently reported that the isolated rhogap domain displays substantially greater gtp hydrolysis than full - length dlc-1 in vitro ( 5 ) , indicating that the amino - terminal and/or carboxyl - terminal regions of dlc-1 negatively regulate gap activity . we found that full - length dlc-1 accelerated the intrinsic gtp hydrolysis activity of rhoa 3.3-fold and that dlc-1 sam stimulated gtp hydrolysis to a 3-fold greater degree than full - length dlc-1 , whereas the isolated rhogap domain stimulated to an even greater degree ( 36-fold greater than the full length ) ( fig . thus we suggest that the sam domain functions as a negative intramolecular regulator of intrinsic dlc-1 rhogap catalytic activity . this may account for the greater in vivo effects of dlc-1 sam versus full - length dlc-1 in causing morphological changes . however , the greater activity of dlc rhogap suggests that additional amino- and/or carboxyl - terminal sequences may also function as autoinhibitory sequences . because in vitro assays may not precisely reflect spatially regulated events in living cells , we also evaluated the gap activity of dlc-1 mutants using a pulldown assay with a gst fusion protein containing the rhotekin rho gtpase - binding domain , which associates preferentially with rhoa - gtp . 3c , transient expression of full - length dlc-1 in hek293 cells partially reduced the level of rhoa - gtp , whereas dlc-1 sam caused a further reduction . as we observed in vitro ( fig . 3a ) , the isolated rhogap domain exhibited greater activity in vivo , but expression of the rhogap - dead version of dlc-1 rhogap ( r718e ) was without effect . thus the cellular assay results closely parallel the in vitro biochemical studies and illustrate the activating effect of the sam domain truncation . these results also support the possibility that dlc-1 sam functions as a constitutively activated version of dlc-1 and may be a useful reagent for evaluating the role and mechanism of dlc-1 tumor suppression . the striking change in morphology produced by activated dlc-1 gave us the chance to more precisely define the boundaries of the rhogap domain . a previous report had indicated that the start domain was indispensable for rhogap catalytic activity in vivo ( 6 ) . however , our deletion analyses more precisely defining the minimal sequences required for a functional rhogap domain ( 609 - 878 ; see supplemental fig . s2 for a detailed analysis ) suggest that the previous study may have utilized a nonfunctional rhogap domain for their analyses . note that our definition of the rhogap domain ( 609 - 878 ) differs from the conventional definition depicted in green in fig . 1 ( 655 - 801 ) that is based on homologies to other rhogaps . reversal of effects of activated dlc-1 by rho and cdc42dlc-1 has been reported to have robust gap activity for rhoa and the closely related rhob and rhoc proteins and to a lesser degree for cdc42 , based on in vitro biochemical studies . thus we tested whether transient cotransfection of gap - insensitive , constitutively activated versions of rhoa and cdc42 could reverse the dramatic morphological changes produced by expression of dlc-1 sam or dlc-1 n in hek293 cells . as seen in fig . 4a , cotransfection with gap - insensitive rhoa(q63l ) fully reversed the morphological effects and the loss of focal adhesions caused by dlc-1 sam , whereas cotransfection of gap - insensitive , active cdc42(g12v ) largely restored the overall shape but failed to restore the presence of mature focal contacts or actin stress fibers . the fraction of cells with approximately normal morphology versus those with extensive neurite - like protrusions was quantitated and summarized in fig . 4b . the ability of coexpressed rhoa(q63l ) to block the morphologic effects of sam - deleted truncations mutants provided us with an approach to better evaluate the role of amino - terminal sequences in regulation of dlc-1 subcellular localization . therefore , we evaluated the focal adhesion localization of additional amino - terminal deletion mutants of dlc-1 when coexpressed with rhoa(q63l ) ( fig . deletion of the sam domain alone did not disrupt dlc-1 association with focal adhesions . although deletion of residues 1 - 252 ( dlc-1 n1 ) did not perturb dlc-1 association with focal adhesions , as expected , deletion of residues 1 - 609 ( dlc-1 n3 ) that includes the tensin src homology 2 domain binding motif ( siydnv ; amino acids 440 - 445 ) was sufficient to impair dlc-1 association with focal adhesions . deletion of 1 - 439 ( dlc-1 n2 ) also dramatically abolished focal adhesion localization ; this may be due to disruption of the adjacent tensinbinding site . active dlc-1 increases cell migration velocity but reduces directionality spatially directed rhoa activation at the rear of migrating cells is thought to facilitate directional cell migration ( 1 ) . we thus examined dlc-1 effects in wound type migration assays and observed that , as reported by others ( 6 ) , expression of dlc-1 results in a reduction in directional migration in this assay ( data not shown ) . to determine the role of specific domains in regulating the role of dlc-1 in cell migration figure 4.effects of active rhoa and cdc42 on the morphology of cells expressing dlc-1 . a , hek293 cells were cotransfected with pegfp - dlc-1 sam and vector alone ( pax142 ) or constructs expressing active forms of rhoa(q63l ) or cdc42(12v ) and replated on fibronectin - coated coverslips ( 10 g / ml ) for 1 h. the overall cell shapes as well as the localization of dlc-1 and of actin filaments were imaged by confocal fluorescence microscopy . unusual , multi - branched shapes were frequently seen in cells transfected with pegfp - dlc-1 sam as illustrated in the top row . b , the bar graph shows the fraction of cells displaying long , branched , neurite - like projections ( black bars ) and cells displaying flat morphology similar to untransfected hek293 cells ( gray bars ) in the experiment described in a. the means s.d . c , hek293 cells were cotransfected with various amino - terminal truncations of pegfp - dlc-1 and with rhoa(q63l ) or control vector . the overall cell shapes as well as the localization of dlc-1 were imaged as above . a , hek293 cells were cotransfected with pegfp - dlc-1 sam and vector alone ( pax142 ) or constructs expressing active forms of rhoa(q63l ) or cdc42(12v ) and replated on fibronectin - coated coverslips ( 10 g / ml ) for 1 h. the overall cell shapes as well as the localization of dlc-1 and of actin filaments were imaged by confocal fluorescence microscopy . unusual , multi - branched shapes were frequently seen in cells transfected with pegfp - dlc-1 sam as illustrated in the top row . b , the bar graph shows the fraction of cells displaying long , branched , neurite - like projections ( black bars ) and cells displaying flat morphology similar to untransfected hek293 cells ( gray bars ) in the experiment described in a. the means s.d . c , hek293 cells were cotransfected with various amino - terminal truncations of pegfp - dlc-1 and with rhoa(q63l ) or control vector . the overall cell shapes as well as the localization of dlc-1 were imaged as above . figure 5.migration of cells transfected with various truncations or mutations of dlc-1 . for migration experiments hek293 cells transfected with various truncation constructs or mutants of dlc-1 were plated on fibronectin - coated ( 10 g / ml ) 35-mm glass - bottomed culture dishes for 30 min to 1 h. digital images were taken every 5 min for a total of 6 h / experiment . a , the migration speeds of the cells ( 15 - 25 cells / condition ) were determined by dividing the total length of migration path by the total time elapsed . b , directional persistence ( d / t ) was determined by dividing the net displacement ( d ) by total length of the migration path ( t ) . a and b illustrate results for hek293 cells transfected with various pegfp - dlc-1 constructs or treated with the rho kinase inhibitor y27632 . in b only the dlc-1 sam transfected cells ( star ) displayed a statistically significant difference from egfp transfected controls . c , mda - mb-231 cells were transfected with various dlc-1 truncation constructs and migration speeds of the cells ( 15 - 20 cells / condition ) were determined as described above . migration of cells transfected with various truncations or mutations of dlc-1 . for migration experiments hek293 cells transfected with various truncation constructs or mutants of dlc-1 were plated on fibronectin - coated ( 10 g / ml ) 35-mm glass - bottomed culture dishes for 30 min to 1 h. digital images were taken every 5 min for a total of 6 h / experiment . a , the migration speeds of the cells ( 15 - 25 cells / condition ) were determined by dividing the total length of migration path by the total time elapsed . b , directional persistence ( d / t ) was determined by dividing the net displacement ( d ) by total length of the migration path ( t ) . a and b illustrate results for hek293 cells transfected with various pegfp - dlc-1 constructs or treated with the rho kinase inhibitor y27632 . in b only the dlc-1 sam transfected cells ( star ) displayed a statistically significant difference from egfp transfected controls . c , mda - mb-231 cells were transfected with various dlc-1 truncation constructs and migration speeds of the cells ( 15 - 20 cells / condition ) were determined as described above . for these analyses , we additionally utilized hek 293 cells , because they have been used extensively to study the involvement of rhoa in cell migration . hek 293 or breast tumor cells were transiently transfected with various dlc-1 constructs , and the effects on the velocity and directionality of cell migration were observed . digital images were taken every 5 min for a total of 6 h / experiment . blot analyses verified comparable expression of wild type and truncated dlc-1 proteins , except that dlc-1 n ( 1 - 638 ) was expressed at slightly lower levels than the other constructs ( see supplemental fig . our analyses revealed profound differences in migration behavior between controls and cells expressing wild type and mutant dlc-1 proteins . quantitation of results drawn from observations of multiple cells in terms of cell velocity and directionality ( fig . 5 , a and b ) led to the following observations . whereas ectopic expression of wild type dlc-1 did not increase cell velocity , when compared with gfp - expressing controls , cells expressing constitutively activated dlc-1 sam showed a marked increase in velocity ( fig . cells expressing constitutively activated dlc-1 ( dlc-1 rhogap ) displayed similar velocity and directionality as controls . these observations suggest that both activation of the rhogap domain and as yet unknown functions of the amino - terminal domain of dlc-1 are involved in effects on motility . interestingly , the rock inhibitor y27632 produced an increase in the velocity of migration similar to that produced by transfection of dlc-1 sam ( fig . this suggests that effects of active dlc-1sam on velocity are mediated primarily through rho / rock , whereas effects on directionality may be mediated through cdc42 , which would not be affected by y27632 or by other rho effectors not sensitive to this inhibitor . the dramatic effect of dlc-1 sam on directionality 6 . whereas a control cell expressing gfp changed direction only five times during a 300-min time period , a cell expressing dlc-1 sam changed direction 10 times in less than 200 min . the images were taken at the indicated time ( min ) and illustrate the rapid changes in directionality ( lack of persistence ) in cells transiently transfected with pegfp - dlc-1 sam as compared with control cells transfected with the pegfp empty vector . the images were taken at the indicated time ( min ) and illustrate the rapid changes in directionality ( lack of persistence ) in cells transiently transfected with pegfp - dlc-1 sam as compared with control cells transfected with the pegfp empty vector . mda - mb-231 cells were transiently transfected with pegfp , pegfp - dlc-1 n ( 252 - 508 ) , or pegfp - dlc-1 n ( 252 - 1091 , r718e ) . these proteins retain the tensin - binding sequence that leads to focal adhesion localization but do not have rho gap activity , nor are they recognized by the antibody that binds full - length dlc-1 . transfected cells were then were replated on fibronectin - coated coverslips ( 10 g / ml ) for 4 - 5 h and stained with anti - dlc-1 monoclonal antibodies ( to visualize endogenous dlc-1 ) followed by anti - mouse secondary antibodies conjugated to alexa fluor 594 and imaged with a confocal fluorescence microscope . mda - mb-231 cells were transiently transfected with pegfp , pegfp - dlc-1 n ( 252 - 508 ) , or pegfp - dlc-1 n ( 252 - 1091 , r718e ) . these proteins retain the tensin - binding sequence that leads to focal adhesion localization but do not have rho gap activity , nor are they recognized by the antibody that binds full - length dlc-1 . transfected cells were then were replated on fibronectin - coated coverslips ( 10 g / ml ) for 4 - 5 h and stained with anti - dlc-1 monoclonal antibodies ( to visualize endogenous dlc-1 ) followed by anti - mouse secondary antibodies conjugated to alexa fluor 594 and imaged with a confocal fluorescence microscope . the amino - terminal domain of dlc-1 acts as a dominant negative to block cell migration we had evaluated a gap - deficient variant of activated dlc-1 ( dlc-1 sam ( r718e ) ) as a control to verify that the enhancement in velocity was due to inactivation of rho gtpase function . unexpectedly , we observed that dlc-1 sam ( r718e ) , which we anticipated to be an inactive protein , rendered cells almost completely immobile ( fig . we then addressed the possibility that dlc-1 sam ( r718e ) may function as a dominant inhibitory mutant by antagonizing endogenous dlc-1 association with focal adhesions . if so , then the isolated amino - terminal region of dlc-1 , which localizes at focal adhesions , should also inhibit cell motility . to probe this further , we compared the effects of expressing the isolated amino - terminal domain ( dlc-1 n1 ( 1 - 638 ) ) versus the same amino - terminal fragment that contains a missense mutation ( y442f ) at the site reported ( 22 , 25 ) to be involved in binding to tensins and required for focal adhesion association ( fig . 1 ) . we also examined an amino - terminal fragment of dlc-1 , dlc-1 n2 ( 1 - 251 ) , which is truncated prior to the tensin - binding site . 5a , a striking difference was observed , with the wild type dlc-1 n1 causing a marked inhibition of cell motility , whereas the two tensin binding - deficient amino - terminal fragments were without effect . these results suggest that the isolated wild type amino - terminal domain of dlc-1 can act as a dominant inhibitor of cell migration that is dependent on association with tensin and focal adhesions . we also performed a similar series of cell migration experiments in mda - mb-231 cells ( fig . these results were similar to those seen in hek293 cells , even though the expression levels of the various dlc-1 constructs were substantially lower ( data not shown ) . thus constitutively activated dlc-1 sam enhanced cell migration velocity , whereas dominant negative dlc-1 sam ( r718e ) or dlc-1 n1 strongly inhibited cell movement . the amino - terminal domain can displace dlc-1 from focal adhesion sites our observations with hek293 and mda - mb-231 cell lines ( fig . 5 ) suggested that dlc-1 activity at focal adhesion sites may be critical for cell motility and that expression of the native amino - terminal domain construct may displace endogenous dlc-1 and thus block motility . we examined this by determining whether amino - terminal fragments of dlc-1 ( n 252 - 1091 or n 252 - 508 ) that strongly associate with focal adhesions but are not recognized by the monoclonal antibody that reacts with the region amino acids 47 - 249 can disrupt endogenous dlc-1 subcellular localization . 7 , expression of these constructs in mda - mb-231 cells resulted in reduced levels of endogenous dlc-1 at focal adhesion sites . this suggests that the dominant negative effect of the amino - terminal domain could be due to displacement of endogenous dlc-1 from focal adhesions , possibly by blocking its interaction with tensin . dlc-1 affects cell protrusions another aspect of dlc-1 function was also revealed from our live cell imaging analyses . initially we interpreted the long projections seen in cells expressing highly active dlc-1 as tail retraction fibers caused by a reduction in rhoa activity ( 2 ) . however , it is clear that cells expressing active dlc-1 also showed a high degree of protrusive activity . thus , as illustrated in fig . 6 , cells that express activated dlc-1 sam displayed extensive ruffled membranes that rapidly switch direction , as well as displaying multiple branched projections . some of these projections were due to defects in tail retraction . however , in addition to retraction fibers , the cells expressing constitutively activated dlc-1 also clearly displayed enhanced protrusive activity , with many cells with rapidly extending long , branched , neurite - like projections ( see supplemental fig . restoration of dlc-1 activity in dlc-1-deficient tumor cells causes reduced growth rates , restores a more normal phenotype ( 7 , 8 , 17 ) , and impairs invasion and metastasis ( 30 ) . because a key aspect of dlc-1 involves inhibition of rho function and rho gtpases are implicated in cell motility , in the present study we focused on the role of dlc-1 function in regulation of actin organization , focal contact organization , and cell migration ( note : additional images of the subcellular localization of various dlc-1 constructs and their relation to focal adhesions are presented in supplemental figs . we undertook a structure - function analysis to evaluate the contributions of the various domains of dlc-1 to its overall effects on the rhogap activity and its consequences on actin cytoskeletal organization , cell morphology , and cell motility . first , we determined that the amino - terminal sam domain is a negative regulator of the intrinsic rhogap activity in vitro and in vivo . second , we established that a dlc-1 variant lacking the sam domain had strong effects on the velocity and directionality of cell migration . further , the isolated amino terminus ( positions 1 - 638 ) can function as a dominant inhibitory variant of dlc-1 and dramatically reduce migration . dlc-1 is a multi - functional protein with additional domains and sequences beyond its rhogap catalytic sequences . these additional sequences may regulate rhogap activity as well as dictate rhogap - independent functions of dlc-1 . in previous work we had shown that deletion of both amino- and carboxyl - terminal domain sequences resulted in a very active core rhogap domain ( 5 ) . here we show that deletion of the sam domain alone substantially increased dlc-1 rhogap activity both in in vitro assays and within cells . one possibility is that the aminoterminal sam domain regulates the catalytic domain via an intramolecular interaction . this type of regulation has been seen commonly in rhogefs and to a lesser extent in other rhogaps ( 1 , 3 , 4 ) . alternatively intermolecular interactions or the recruitment of accessory regulatory proteins may be involved . in any case , we suggest that the sam domain may facilitate stimulus - mediated post - transcriptional mechanisms for the regulation of the intrinsic rhogap activity of dlc-1 . furthermore , because the signaling mechanisms that activated dlc-1 function remain to be identified , similar to activated mutants of rho gtpases , this constitutively activated dlc-1 variant will be a very useful reagent for further delineation of dlc-1 activity in normal and neoplastic cell biology . expression of the active dlc-1 sam results in profound changes in cytoskeletal organization with the loss of actin stress fibers and reduction of focal adhesions . however , by reverting the effects of dlc-1 sam with a constitutively active rho , we show that dlc-1 sam retains the ability to localize to focal contacts and thus can be a properly localized activated gap . expression of dlc-1 sam also profoundly affects cell migration , leading to an increase in velocity but a reduction in directionality . the dual effect of dlc-1 sam on cell velocity and directionality may be due to the fact that this protein has gap activity for both rho and for cdc42 , a key mediator of cell polarity ( 2 , 5 ) . interestingly expression of the highly active construct dlc-1 rhogap fails to mimic the effect of dlc-1 sam , suggesting that both gap activity and as yet undefined functions of the amino - terminal domain are essential for dlc-1 effects on cell motility . by contrast , the change in cell morphology resulting from expression of an activated dlc-1 is not dependent on the presence of amino - terminal sequences . as expected , expression of the rhogap domain containing the inactivating r718e mutation had little effect on migration , indicating the critical role of gap activity in motility . surprisingly , however , expression of full - length dlc-1 containing the gap - inactive r718e mutation caused a profound reduction in cell movement . this effect was not seen with a mutated version ( y442f ) of the amino - terminal domain that fails to bind to the focal adhesion protein tensin , suggesting that focal contact localization is a key to these effects . the wild type version , but not the y442f version , of the amino - terminal domain was able to displace endogenous dlc-1 from focal adhesions . because dlc-2 and dlc-3 share similar tensin - binding sequences , it seems likely that the isolated dlc-1 amino - terminal can also displace endogenous dlc-2 and dlc-3 as well . thus these observations argue that proper placement of appropriate ( endogenous ) levels of dlc family members at focal adhesions is critical for the maintenance of normal cell motility . finally , we have found that interfering rna suppression of endogenous dlc-1 in lung and breast cancer cells typically does not result in a robust biological consequences ( data not shown ) , most likely because of the continued expression of the functionally related dlc-2 and dlc-3 isoforms . therefore , this dominant inhibitory mutant of dlc-1 , similar to the dominant inhibitory rho gtpase mutants that block the activity of multiple rho activators , will be an important reagent for further dissection of role of dlc loss of function in tumor progression and growth . the mechanism(s ) one likely possibility is that it may be critical to facilitate a precise spatial inactivation of rhoa activity to support migration . consistent with this possibility , we recently found that ectopic expression of wild type dlc-1 caused inactivation of rhoa preferentially at the leading edge of migrating cells ( 5 ) . our observations on dlc-1 and cell migration seem consistent with a recently published model of the mechanisms relating lamellipodial activity and adhesion site formation ( 31 ) . in this model , forward motion of the leading edge involves localized actin extension , adhesion formation , contraction , and backward flow of actin , all in balance . when dlc-1 is active , arp 2/3 complex - mediated actin protrusion continues ( even if rac activity is not increased ) , but contractility and adhesion site formation will be reduced as rho / rock activity goes down ; this tilts the balance toward rapid leading edge protrusion and rapid migration . when dlc-1 is displaced from adhesion sites , for example by the amino - terminal fragment , local rho is greatly activated , leading to increased contractility , to enhanced strength of focal adhesions , and to enhanced backward retraction of actin and thus paralysis of motion . an interesting observation is that expression of activated dlc-1 stimulated extensive protrusive activity , but the mechanistic basis for these events is unclear . there is a well established antagonism between rho and rac in regulation of the cytoskeleton and protrusive activity ( 32 ) . this antagonism may be based in part on filgap , a filamin - binding racgap that is negatively regulated by rho and rock and reciprocally on down - regulation of rho via rac - generated reactive oxygen species ( 33 , 34 ) . thus a reduction in rho activity by dlc-1 could lead to an increase in rac activity that would enhance cell protrusions . however , we have not been able to detect an overall increase in rac - gtp loading in cells expressing activated dlc-1 ( data not shown ) ; possibly the effects are localized and difficult to detect at the biochemical level . in neuronal cells p190rhogap has been shown to play a positive role in axon extension and branching morphogenesis through suppression of an axon retraction pathway mediated by rho and rock ( 35 , 36 ) . our observations suggest that rhogaps , particularly dlc-1 , may also play a key role in supporting protrusive activity . in summary , our structure - function analyses established two critical roles for two distinct amino - terminal sequence elements in regulating dlc-1 . whereas the sam domain functions as an autoinhibitory element of intrinsic rhogap catalytic activity , the tensin - binding sequences are critical for dlc-1 localization to focal adhesions , which is critical for regulation of cell migration . our preliminary analyses of additional amino - terminal deletion mutants have identified a second autoinhibitory sequence that coincides with sequences important for tensin binding . hence , our future studies will focus on determining whether tensin binding may also serve as a mechanism to regulate both the spatial and intrinsic activity of dlc-1 . finally , our studies additionally identified both gain - of - function and dominant negative variants of dlc-1 that will be very useful reagents for further delineation of the role of dlc-1 loss in human oncogenesis .

ovarian cancer is responsible for almost half of deaths from cancer of the female genital tract because malignant tumours often spread outside the ovary by the time a definite diagnosis is made . they tend to affect the axial skeleton and are associated with abdomino - pelvic disease . median interval time between diagnosis of ovarian cancer and documentation of metastatic disease is 44 months ( 1 ) . however median survival of patients with bony metastasis from ovarian malignancy is low , in the range 4 - 7.5 months ( 2,3 ) . a normally fit and independent 79 year old ex - smoker experienced new onset episodes of urinary retention and incontinence over a 9 month period . uss showed a well circumscribed 12.5 cm 9.1 cm mass , mostly solid with some cystic components pressing on the bladder . the gynaecologists undertook a laparotomy , left ovarian cystectomy , right salpingo oophrectomy , and omentectomy with peritoneal washings . there was partial rupture of the cyst during removal but no residual macroscopic disease in the pelvis post - operatively . tissue histology was that of a high grade left ovarian serous / endometrioid adenocarcinoma with no surface involvement . there was no vascular or lymphatic invasion and no evidence of malignancy in the right ovary . she made a good post - operative recovery and was commenced on a four weekly regime of adjuvant chemotherapy . follow - up ct abdomen/ pelvis four weeks after the laparotomy revealed possible regrowth of abnormal tissue at the left adenexa measuring 37 mm 36 mm 32 mm . on the day of scanning she was struck by a slow & moving car and presented to a&e with a painful , shortened and externally rotated right leg . x - ray revealed a displaced oblique sub cervical fracture of her proximal right femur with medial displacement of the lesser trochanter . she underwent gamma i m nail fixation and given her recent diagnosis and abdominal surgery , reamed specimens were sent for histological analysis . a pathological lesion did not seem obvious on any radiographs either pre or intra operatively . tissue histology revealed malignant cells with a degree of nuclear moulding , and occasional intranuclear inclusions and intra cytoplasmic lumen . immunohistochemistry showed tumour expression of cytokeratin 7 , cytokeratin 20 , ca 125 , the oestrogen receptor , e cadherin ( cd 324 ) and ttf1 . comparison to the left ovarian specimen confirmed a similar morphological appearance and immunohistochemical phenotype , consistent with metastatic ovarian carcinoma . follow - up 592 mbq technetium bone scanning showed abnormal uptake in the proximal right femoral shaft and neck , distal right femoral shaft , spine , both wings of the sacrum , skull , medial aspect of the right femoral condyle and the left ankle . following discussion within the multidisiplinary gynaecological oncology team it was decided that she was not fit for further chemotherapy and that her life expectancy was too short for radiotherapy to be beneficial . approximately 10 weeks after her initial presentation she presented once again to a&e with severe lumbar back pain , bilateral leg weakness and confusion . x - ray lumbar spine showed a grade 2 compression fracture of l2 and she was re admitted . she unfortunately became progressively more confused over the subsequent 10 days , developed dic , and passed away peacefully 3 months after her initial presentation . ovarian cancer accounts for 6% of all cancers in females and is the third most common cause of cancer of the female genital tract . endometrioid tumours account for approximately 20% of ovarian cancers , most of which are carcinomas ( 4 ) . they spread predominantly directly within the pelvis and abdomen and can form large intra abdominal masses . rose et al studied the autopsy findings of 428 patients with various histologic types of ovarian cancer to determine metastatic patterns . the incidence of bony metastases from ovarian malignancy with epithelial histology was very low at 0.06 cormio et al ( 1 ) determined the incidence of distant metastases in ovarian cancer patients with stage iv disease . they demonstrated that out of 67 metastatic sites , only 2 ( 3% ) were to bone . median interval time between diagnosis of ovarian cancer and documentation of metastatic disease was 44 months ( range 3105 ) ( 1 ) . dauplat et al ( 2 ) reviewed 255 patients with epithelial ovarian carcinoma , and found that only 4 patients ( 1.6% ) had bony metastases . median survival among these patients was noted to be 4 months ( 2 ) . in keeping with these studies , an extensive literature review using pubmed and google scholar reveals few documented cases of serous / endometrioid ovarian adenocarcinoma with bony metastases . particularly rare is the presentation of bony metastases very shortly after the initial diagnosis of apparently early stage ovarian adenocarcinoma . bony metastases tend to affect the axial skeleton preferentially , and presentation with femoral fracture , such as in this case , is rare . kumar et al ( 3 ) found that of 103 patients with ovarian carcinoma over 3 years just 4 patients had bony involvement , 2 of which were of serous histology . the commonest sites of bony involvement were vertebrae , pelvic bones and skull ( 3 ) . kumar et al ( 3 ) also found that 3 of the 4 cases with bony involvement were associated with abdomino pelvic pathology . literary evidence shows that presentation with pathological fracture of the proximal femur from this type of ovarian cancer is uncommon , especially so soon after primary diagnosis . given the high volume of low energy fractures in elderly patients managed routinely by orthopaedic surgeons this case highlights the importance of a thorough history , abdominal examination and investigations during orthopaedic admission so that cases such as this are not missed and patients mismanaged , especially as median survival after this point is low and subsequent clinical course may be rapid deterioration .

it is assumed that it mediates protection by stimulating macrophages for mycobacteria killing [ 13 ] . the concept is supported by the increased susceptibility of ifn--deficient mice to experimental tb [ 46 ] and severe mycobacterial infections in humans bearing mutations in ifn-/ifn- axis [ 79 ] . however , several recent studies contradict this concept and suggest new roles for ifn- during tb ( reviewed in ) . in particular , in recent experimental studies ifn- was suggested to contribute to protection by inhibiting neutrophilic inflammation , whereas its role in the inhibition of mtb replication was questioned [ 1113 ] . further , ifn- levels and the frequencies of mtb - specific ifn- producing cells induced by vaccination poorly correlate with the protection against tb [ 1418 ] . in pd-1 knockout mice , uncontrolled cd4 t cell response accompanied by increased ifn- production was deleterious [ 19 , 20 ] . thus , while a complete lack of ifn- increases mice susceptibility to mtb infection , it remains unclear how quantitative characteristics of ifn- responses are associated with the infection outcome . one of the most widely used approaches to address the role of a factor in tb protection in human is to compare its expression in individuals with latent tb infection ( ltbi ) and patients with microbiologically confirmed sputum smear - positive tb . in this approach , individuals with ltbi are considered as developing effective immune responses , while tb patients as being unable to efficiently contain mtb infection . some authors showed increased plasma levels of ifn- or increased frequencies of circulating ifn- producing cells in tb patients compared to ltbi . other groups reported reduced capacity of peripheral blood mononuclear cells from tb patients for antigen - driven secretion of ifn- [ 2224 ] and suggested that ifn- deficiency contributes to tb pathogenesis . these inconsistencies can be explained by the differences between the studies in methodology ( i.e. , antigens used to stimulate cells and stimulation procedures ) and patient spectrum . another possible explanation takes into account the complexity of the relationships between ifn- responses and mtb infection activity . indeed , the extent of ifn- responses controlled by genetic and/or other mtb infection independent factors ( e.g. , nutritional and stressful ) affects the outcome of mtb infection . in this model , the lower the ifn- response is , the higher the infection activity would be . on the other hand , thus , the more active the infection is , the higher the immune response should be . next , chronic infection and persistent antigenic stimulation induce t cell exhaustion dampening ifn- secretion . additional complexity comes from the fact that tb disease is highly heterogeneous by its manifestations and severity . this heterogeneity is rarely taken into account , resulting in a poor understanding of how ifn- associates with tb severity and outcomes . in this study we have used a standardized procedure of quantiferon - tb gold in - tube ( qft ) assay to analyze the extent of ifn- responses in tb patients and examine how quantitative characteristics of these responses are associated with the activity and the severity of mtb infection in human . all studies were conducted in accordance with the principles expressed in the helsinki declaration , approved by the irb # 1 of the central tuberculosis research institute and performed between years 2010 and 2015 . they formed the following groups : tb patients ( tbp ) , tb suspects ( tbs ) , mtb - exposed healthy individuals having high risk of ltbi ( tb contacts , tbc ) , and healthy donors with no known records of mtb exposure ( hd ) ( figure 1 ) . patients from tbp group ( n = 88 ; age 35.8 1.4 ; 48 women , 40 men ) underwent treatment in the central tuberculosis research institute , moscow ( ctri ) . eighty - two patients were diagnosed for tb based on clinical and radiographic evidences of tb and identification of mtb and/or mtb dna in the sputum . in six patients , the diagnosis was based on clinical and radiographic evidences of tb and positive response to anti - tb therapy ( i.e. , positive clinical and radiographic dynamics assessed by independent clinicians 2 months following the treatment ) . in these patients , final diagnosis was made after the performance of qft ; all clinicians were blind to qft results . among 88 tb patients , 81 patient had recently diagnosed tb ; 7 patients had chronic tb ( > 1 year ) and had received several courses of therapy by the time of analysis . in tbp with recently diagnosed tb , tbs ( n = 108 ; age 45.8 1.6 years ; 59 women , 49 men ) were examined at the ctri for the diagnostic purposes without hospitalization . in this group , the diagnosis was based on the results of microbiological , radiological , and clinical examinations . of 108 tbs , 42 patients were diagnosed for active pulmonary tb ( tbs - tb ) , 9 patients had residual tb lesions ( tbs - rl ) ; 51 patient had non - tb pulmonary diseases ( tbs - tb , i.e. , sarcoidosis , pneumonia , bronchitis , cancer , and chronic obstructive pulmonary disease ) . six patients did not return for the examination , had undetermined final diagnosis , and were excluded from the analysis . the group of tbc ( n = 67 ; age 42.8 1.6 years ; 52 women , 15 men ) included ctri employees who had been working in tight contacts with tbp for at least 1 year ( 9.1 1.1 years ) and had no clinical or radiographic evidences of tb . the group of hd ( n = 50 ; age 39.2 2.0 years ; 20 women , 30 men ) included participants with no records of mtb exposure . all tbp were hiv - seronegative . in tbs , tbc , and hd hiv status carnegie , australia ; qiagen , valencia , ca , usa ) . briefly , venous blood was drawn into nil , ag , and mit tubes containing no antigen , mtb antigens ( esat-6 ; cfp-10 ; tb 7.7 ) , and mitogen , respectively . tubes were hand - shaken and incubated at 37c for 24 h. samples were centrifuged and plasma was collected and stored at 20c until analysis ( 714 days ) . at the day of analysis , samples were thawed , and elisa was conducted according to the manufacturer 's instructions . optical densities were measured using sunrise reader and magellan software ( tecan group ltd .. , switzerland ) . concentration of ifn- in each tube and the results of the assay were determined using quantiferon - tb gold analysis software ( cellestis ltd . ) and interpreted as specified by the manufacturer . due to a limited linear range of elisa reader , values greater than 10 iu / ml were assigned a value of 10 iu / ml , the upper limit of the standard curve , as previously suggested by other authors [ 26 , 27 ] . because the truncation could impact the results of statistical analysis , samples from patients having high levels of ifn- in ag tubes ( > 10 iu / ml ) were diluted , qft was repeated for all probes ( i.e. , nil , ag , and mit ) , and results were reanalyzed ( shown in supplementary figures in supplementary material available online at http://dx.doi.org/10.1155/2016/7249369 ) . statistical analysis was performed using prizm 4.0 ( graphpad software inc . ) and r - studio . in the text , differences between independent variables were analyzed using nonparametric mann - whitney test for two variables and one - way anova on ranks ( kruskal - wallis test with dunn 's posttest ) ( graphpad software ) . correlations between variables were analyzed using spearman test with benjamini - hochberg correction ( r - studio ) . pulmonary tb disease has multifarious manifestations that mirror diverse aspects of disease pathology and severity . to examine associations between ifn- and tb severity , we evaluated the following characteristics of tb disease : the form of pulmonary pathology , the degree of pulmonary destruction , disease extent ( pulmonary area affected by tb process ) , bacteria excretion , and intoxication . all tb characteristics were evaluated and scored by independent radiologists , microbiologists , and clinicians who were unaware of the results of qft . to ensure the accuracy of the evaluations , only patients undergoing treatment in the ctri and being under prolonged observation were included in the analysis . the forms of pulmonary pathology : score 1 : tuberculoma ; score 2 : tb infiltrate ; score 3 : cavitary tb ; score 4 : disseminated tb ; score 5 : caseous pneumonia . tb extent was scored based on the area of the lung tissue affected by tb process , that is , score 1 : the process affected one to three segments of the lung ; score 2 : the process affected four or more segments in different lobes of the lung or one - two whole lobe(s ) ; score 3 : three lobes in different lungs ; score 4 : one whole lung or both lungs . the degree of lung tissue destruction was scored based on the number and size of destructive ( lucent ) foci , that is , score 1 : no foci ; score 2 : one small ( < 2 cm diameter ) focus ; score 3 : several small foci or one large ( 2 cm ) transparent focus ; score 4 : multiple foci of which at least one was large . the presence of mtb in the sputum and the level of bacteria excretion were evaluated based on the results of sputum smear ( auramine - rhodamine smear microscopy ) , sputum culture ( bactec radiometric method , becton dickinson , sparks , md , usa , or solid media culture ) , and real - time is6110-based pcr ( amplitub - rv , syntol , moscow , russia ) assays . the results were scored as follows : score 1 : no acid - fast bacilli ( afb ) in sputum smear plus negative sputum culture / bactec and pcr results ; score 2 : 09 afb per 100 view fields and positive result of sputum culture / bactec or pcr ; score 3 : 1099 afb per 100 view fields and positive sputum culture / bactec results ; score 4 : 110 afb in one view field and positive sputum culture / bactec results ; score 5 : more than 10 afb per one view field and positive sputum culture / bactec results . the degree of intoxication was scored from 1 to 4 based on the presence of systemic intoxication symptoms ( fatigue , asthenia , night sweating , caught , and fever ) : score 1 : no symptoms ; score 2 : one to two symptoms without fever ; score 3 : several symptoms plus subfebrile body temperature ; score 4 : several symptoms and febrile temperature . the patients displayed the great variability regarding the above manifestations of tb disease and their severity ( table 1 ) . to assess ifn- responses , we examined tbp for the results of qft ( i.e. , positive or negative ) and the levels of ifn- secretion in unstimulated ( nil ) , mtb - antigen stimulated ( ag ) , and mitogen - stimulated ( mit ) probes . spearman correlation analysis with benjamini - hochberg correction showed that qft results and the levels of antigen - driven ifn- secretion ( i.e. , ag and ag - nil ) did not correlate with any characteristic of tb severity ( table 2 ) . significant correlations were found only between ( i ) the levels of spontaneous ifn- production ( nil probes ) and patient ' age ( r = 0.391 , p = 0.001 ) and ( ii ) the levels of mitogen - induced ifn- production ( mit probes ) and the form of pulmonary pathology ( r = 0.352 , p = 0.004 ) and tb extent ( r = 0.395 , p = 0.001 ) . the results indicated that the basal production of ifn- increases with age and that in patients having more extended pulmonary tb ifn- responses are suppressed in antigen - independent manner . on the other hand , the levels of ifn- secretion driven by mtb - specific antigens appeared to be not associated with tb severity . because associations between ifn- and tb severity are complex and may be nonlinear , we next divided all patients into groups based on the scores for each tb characteristic and analyzed ifn- responses in each group . tbp having similar severity scores were highly heterogeneous with regard to ifn- responses ( figure 2 ) . the differences between the groups in the levels of antigen - driven ifn- secretion were not very strong . in mann - whitney test , significant differences with p < 0.05 were detected between patients with disseminated tb / caseous pneumonia and patients with tuberculoma ( scores 4/5 and 1 , resp . ) , patients with high pulmonary destruction and patients with mild destruction ( scores 3 and 2 , resp . ) , and patients with mild bacteria excretion and patients with low bacteria excretion or the absence of bacteria in the sputum ( scores 3 , 2 , and 1 , resp . however , in kruskal - wallis test with dunn 's posttest , all comparisons were insignificant . of note , in some patients , the levels of ifn- secretion in ag tubes exceeded the upper limit of qft test and were assigned a value of 10 iu / ml . because the truncation could affect the results of statistical analysis , and antigen - driven ifn- secretion was in the main focus of our study , we next diluted these samples and repeated qft test . the differences between the groups were similar to those described above ( supplementary figure 1 ) . it should also be noted that some associations between antigen - driven ifn- responses and tb characteristics tended to be second - order polynomial . for example , the levels of ifn- were higher in patients having the least and the highest degrees of bacteria excretion compared to patients with mild bacteria excretion ( y = 10.64 + x + x ) . this supports the concept that ifn- response both influences and is influenced by tb disease characteristics . we next evaluated ifn- production in tbc ( i.e. , participants having high risk of ltbi ) and hd ( i.e. , participants having low risk of tb infection ) . positive qft results were registered in 23 out of 67 tbc ( 34% ) and in 6 out of 50 hd ( 12% ) . thus , the rate of positive qft results increased in a row : hd < tbc < tbp , that is , on a group level , mirrored the probability / risk of tb infection ( figure 3(a ) ) . the levels of antigen - driven ifn- secretion also were higher in tbp compared to tbc and hd ( figures 3(c ) and 3(d ) and supplementary figures 2c and 2d ) . radiologically , all tbp included in the study had signs of high disease activity , that is , signs of tissue infiltration , destruction , and/or dissemination . aiming to analyze whether ifn- responses are associated with the activity of mtb infection , we next evaluated ifn- production in tbs who supposedly could have different activity of tb disease . subsequently , they were diagnosed for active tb ( tbs - tb ) , residual tb lesions ( tbs - rl ) , or non - tb pulmonary diseases ( tbs - tb ) ( figure 1 ) . radiological examination of tbs - tb showed that they differed by the activity of tb process : 22 patients had high tb activity ( i.e. , they had radiological sings of tissue infiltration , destruction , and/or dissemination ) , whereas 20 patients exhibited evidences of low tb activity ( i.e. , they had radiological sings of calcification and condensation of pulmonary lesions ) . positive qft results were registered in 18 out of 22 patients with high tb activity ( 82% ) , 12 out of 20 patients with low tb activity ( 60% ) , 2 out of 9 tbs - rl ( 22% , one patient had undetermined qft results ) , and 7 out of 51 tbs - tb ( 14% , figure 3(b ) ) . thus , the rate of positive qft results increased in a row : tbs - rl < tbs - tb with low tb activity < tbs - tb with high tb activity ( figure 3(b ) , supplementary figure 2b ) . the levels of antigen - driven ifn- secretion also were higher in patients with more active tb disease ( figures 3(e ) and 3(f ) ; supplementary figures 2e and 2f ) . we then scored mtb infection activity ( score 1 : tbs - rl , score 2 : tbs - tb with low tb activity ; score 3 : tbs - tb with high tb activity ) and analyzed its correlation with the levels of antigen - driven ifn- secretion ( ag - nil ) . the correlation was significant ( r = 0.419 , p = 0.003 for ifn- levels truncated at 10 iu / ml , r = 0.440 , p = 0.001 for real ifn- concentrations ; see section 2 ) . an association between the levels of antigen - driven ifn- secretion and infection activity was indirectly confirmed when we compared ifn- responses in hd , tbc , and tbp with positive qft results ( i.e. , in hd - qft , tbc - qft , and tbp - qft ) . in this comparison , patients with active tb ( tbp - qft ) had higher levels of antigen - driven ifn- secretion compared to participants with ltbi ( figures 3(g ) and 3(h ) ) . overall , participants with more active mtb infection developed higher antigen - driven ifn- response compared to participants with less active infection . its complete lack leads to extremely severe mycobacterial infections [ 4 , 5 , 79 ] . in the absence of mutations in genes encoding ifn-/ifn- axis proteins , ifn- is readily produced in response to host exposure to mtb . however , whether the levels of ifn- secretion affect mtb infection activity and outcomes is not fully clear . besides the fact that ifn- contributes to protection , it is used for screening purposes and the identification of mtb infection in igra assays . thus , understanding the relationships between the levels of ifn- secretion and the status of mtb infection is important for both diagnostic purposes and the development of host - directed therapy . in this study we have used qft assay to quantify the levels of basal , antigen - driven , and mitogen - induced ifn- secretion by blood cells isolated from tbp , tbc , hd , and tbs diagnosed for tb or non - tb pulmonary diseases . the rate of positive qft results and the levels of antigen - driven ifn- secretion increased in a row : hd ( 12% ) < tbc ( 34% ) < tbp ( 72% ) , that is , mirrored the probability / risk of mtb infection . qft assay is based on the detection of memory t cells that are generated and maintained in response to tb exposure and mtb infection . it is assumed that qft identifies mtb infection and associates with the level of mtb exposure but fails to distinguish active tb and ltbi [ 28 , 29 ] . our data on the rate of positive qft results in hd , tbc , and tbp groups are in a good line with this concept . the performance of qft during active tb has been addressed in multiple studies [ 2832 ] . it is usually assumed that suboptimal sensitivity of qft for active tb is due to the immune suppression developed as a result of severe tb disease . our data do not support this concept . in the study , we paid a special attention to the careful examination of tb patients and thorough assessment of tb disease characteristics , including microbiological ( i.e. , the degree of bacteria excretion ) , radiological ( i.e. , the form of pulmonary pathology , tb extent , and the degree of pulmonary destruction ) , and clinical ( i.e. , the degree of intoxication ) . we found no strong correlation between the levels of antigen - driven ifn- secretion and tb severity . when tbp were divided into groups based on tb severity scores , significant differences in ifn- secretion were observed mainly between patients having most severe and least severe tb ( e.g. , between patients with tuberculoma and disseminated tb / caseous pneumonia , but not between patients having tuberculoma , tb infiltrate , and cavitary tb ) . moreover , even between the polar groups , the differences were not highly significant ( i.e. , p < 0.05 in mann - whitney test and insignificant in kruskal - wallis test with dunn 's posttest ) . thus , tb severity was not tightly associated with the levels of antigen - specific ifn- response . this suggests that suboptimal qft sensitivity for active tb can hardly be attributed to the immune suppression developed in severely - ill patients and that quantitative parameters of systemic ifn- responses play minor role in determining tb severity ( unless there is a complete lack of ifn-/ifn- axis proteins , which leads to severe consequences for the host [ 79 ] ) . in contrast to antigen - driven ifn- secretion , mitogen - induced secretion correlated significantly and inversely with tb severity , in particular , with tb extent . these results indicate that severe tb disease induces immune suppression / anergy but in antigen - independent manner . while qft performance did not associate with tb severity , it appeared to be associated with the activity of tb disease . in our study , the rates of positive qft results and the levels of antigen - driven ifn- secretion increased in a row : tbs - rl < tbs - tb with low tb activity < tbs - tb with high tb activity : that is , they were higher in patients with more active tb disease . these results extend existing observations on qft performance and raise a question on the sensitivity of qft for ltbi ( i.e. , inactive mtb infection ) . in our study , only 34% of individuals working in tight contact with tb patients had positive qft results . our data on suboptimal qft sensitivity for active tb along with a better performance of qft in tbs with more active disease indirectly support the second hypothesis . in the absence of a gold standard for ltbi , it is difficult to conclude which of the explanations is more likely . however , the possibility that at least some individuals with negative igra may harbor ltbi should be taken into account . to summarize , in this study we have demonstrated that ( i ) in tb patients the levels of antigen - driven ifn- secretion and qft results are not associated with tb severity evaluated in microbiological and radiological tests or clinical examinations ; ( ii ) the levels of antigen - driven ifn- secretion are associated with the activity of tb disease . the results suggest that quantitative parameters of ifn- responses mirror the activity of mtb infection but play a minor role in determining the course and severity of tb disease . the reasons for the suboptimal qft sensitivity for active tb disease are yet to be determined .

ectopic liver tissue develops at various sites near the liver , such as the gallbladder , intra - abdominal ligaments , omentum , retroperitoneum and thorax [ 1 , 2 , 3 ] . the incidence of ectopic liver tissue has been reported to be 0.240.47% [ 3 , 4 ] . ectopic liver is a very rare entity , usually asymptomatic , but occasionally it causes unexpected problems such as intra - abdominal bleeding at the site of origin and hepatocarcinogenesis . hepatocellular carcinoma ( hcc ) arising from ectopic liver is even more rare ; only 26 cases have been reported in japan . multiple ectopic hcc arising in the abdominal cavity has been reported in only 3 cases , including the present case , and its pet - ct findings have never been reported . this report presents a case of hcc that disseminated in the abdominal cavity and probably developed from ectopic liver tissue present on the peritoneum . a 42-year - old otherwise healthy male presented with liver dysfunction at a general health checkup . although he had been aware of general fatigue recently , there was no other condition such as fever , diarrhea or appetite loss with nausea and vomiting . he had no history of alcohol abuse , and his family history was noncontributory . on admission , his laboratory results were generally unremarkable , including levels for cea and ca19 - 9 . however elevations in serum ast ( 117 u / i ) , alt ( 254 u / i ) , alpha - fetoprotein ( 241 ng / ml ) and pivka - ii ( 69,349 mau / ml ) were shown . computed tomography revealed multiple nodular lesions in the abdominal cavity with ascites but no other possible primary tumor ( fig . 1 ) . no lesion was found in the liver . for peritoneal dissemination of unknown primary lesion , exploratory laparoscopy was performed which revealed bloody ascites and multiple brown nodular tumors measuring approximately 10 mm in size that were disseminated on the peritoneum and mesentery ( fig . 2 ) . in microscopic examination , tumor cells resected from the peritoneum showed nodular lesion composed of atypical hepatocyte forming irregular trabecular or pseudoglandular structures with focal intraluminal or intracytoplasmic bile pigments . the atypical cells showed swollen and various - sized nuclei , distinct nucleoli and eosinophilic cytoplasm ( fig . a postoperative pet - ct scan was performed but it did not reveal any evidence of a tumor in the native liver ( fig . anomalous liver is classified into four types : accessory liver lobe , small accessory lobe , ectopic liver , and ectopic liver tissue . we distinguish between ectopic liver , which is outside the liver proper without any connection to it , and accessory liver , which is connected to the liver , often by a stalk . ectopic livers are islands of normal liver parenchyma separated from the main lobes of the liver and can occur at various sites near the liver , such as the gallbladder , intra - abdominal ligaments , omentum , retroperitoneum and thorax [ 1 , 2 , 3 ] . ectopic liver is usually found incidentally , but it may also be found because of neoplastic change or compressive effects . most ectopic livers seem to be more prone to hepatocarcinogenesis . the common risk factors for hcc , such as infection with hepatitis b or c and cirrhosis , appear to be less implicated ; only 32% of ectopic hccs are reported to be associated with cirrhosis . a diagnosis of ectopic hcc requires the identification of noncancerous liver parenchyma around the mass lesion . it is possible that ectopic or accessory livers are subjected to specific additional carcinogenic factors , independent of the mother liver , as a result of their poor blood supply and biliary drainage secondary to their abnormal location . the resection of an ectopic hcc can be curative because the carcinogenetic potential of these tumors is usually limited to the ectopic liver itself . a review of the pertinent literature suggests that approximately 21 cases of primary hcc in ectopic liver have been reported to date , and most of these case reports are from japan [ 6 , 7 , 10 , 11 ] . these case reports described the occurrence of hcc in the ectopic liver and one report described the occurrence of hcc within both the ectopic liver as well as the native liver . hcc seems to evolve in ectopic liver tissue several years prior to that in the native liver because small ectopic liver tissue does not have a complete architecture and may be handicapped metabolically , which accelerates the carcinogenetic process . asymptomatic hepatitis b infection and excessive consumption of tobacco and/or alcohol are among the better - known predisposing factors for the development of primary hcc in the inhabitants of asia . the presence of these etiological factors might hasten the process of carcinogenesis within the ectopic liver tissue . ultrasonography and computed tomography revealed multiple nodular lesions in the abdominal cavity with ascites in the current patient , but no other possible primary tumor . laboratory examination showed elevations in serum ast ( 117 u / i ) , alt ( 254 u / i ) , alpha - fetoprotein ( 241 ng / ml ) and pivka - ii ( 69,349 mau / ml ) . the present case was preoperatively diagnosed to have hcc that probably originated from an ectopic liver in the abdominal cavity . exploratory laparoscopy was performed which revealed bloody ascites and multiple brown nodular tumors disseminated on the perineum and mesentery . the tumors probably arose from ectopic liver on the peritoneum or mesentery , and thereafter became disseminated in the abdominal cavity . a postoperative search for primary malignancy within the mother liver was done with the help of a pet - ct scan but it did not reveal any evidence of tumor in the native liver . in conclusion , this report presents a rare case of multiple ectopic hccs arising in the abdominal cavity .

four different types of dendritic cells exist in lymph nodes , namely , histiocytic , fibroblastic , interdigitating , and follicular cells . their main function is the presentation of antigens and the generation and regulation of the germinal center reaction . follicular dendritic cells participate in the immune system by presenting antigens for b cells and by stimulating b cell proliferation and differentiation . these cells are localized to areas of b cells in the germinal centers of lymphoid follicles . interdigitating dendritic cells participate in the immune system by stimulating t lymphocytes and are found in the t cell areas of peripheral lymphoid tissues ( 1 - 3 ) . dendritic cell neoplasms are rare tumors , though they are being recognized with increasing frequency . they were previously classified as lymphomas , sarcomas , or histiocytic neoplasms . however , the world health organization ( who ) classified dendritic cell neoplasms into five groups : langerhans cell histiocytosis ( lch ) , langerhans cell sarcoma ( lcs ) , interdigitating dendritic cell sarcoma / tumor ( idcs ) , follicular dendritic cell sarcoma / tumor ( fdcs ) , and dendritic cell sarcoma , not specified otherwise ( 4 ) . idcs are infrequent neoplasms , and therefore , a limited number of cases have been reported . although most arise in lymph nodes , rare cases of idcs have been described in extranodal sites , such as the spleen , small intestine , nasopharynx , skin , testis , ovary , urinary bladder , and tonsils ( 5 - 12 ) . here , we report a case of extranodal idcs presenting in the pleura , a hitherto unreported site . on october 1st , 2009 , a 32-yr - old man visited the outpatient clinic with a 1-month history of progressively worsening blood - tinged sputum and chest pain . the patient had worked in a small educational institute for three years , and was currently working as a company employee . however , he denied exposure to asbestos . on physical examination , hepatosplenomegaly and peripheral lymphadenopathy were absent , but a chest examination revealed retraction and tenderness of the left chest wall . laboratory testing revealed hemoglobin 12.3 mg / dl , white cell count 11,100/l , and platelet count 519 10/l . computed tomography ( ct ) of the chest showed irregular pleural thickening and pleural effusion in the left lung ( fig . an incisional biopsy of pleura was performed , and histologic findings suggested a malignant undifferentiated tumor . the tumor cells had oval to spindled nuclei , and indented nuclei were frequently observed . the cytoplasm of the tumor cells was abundant and slightly eosinophilic with an indistinct border ( fig . , immunohistochemistry was performed on the benchmark automated immunostaining system ( ventana medical system , tuscon , az , usa ) . the monoclonal antibodies used were the following : s100 ( 1:800 ; dako , glostrup , demark ) , vimentin ( 1:200 ; dako ) , cd45 ( 1:100 ; leica , newcastle - upon - tyne , uk ) , ck ( 1:600 ; leica ) , myeloperoxidase ( 1:200 ; leica ) , hmb45 ( 1:150 ; leica ) , cd1a ( 1:20 ; leica ) , cd20 ( 1:200 ; leica ) , cd21 ( 1:60 ; leica ) , cd23 ( 1:100 ; leica ) , cd31 ( 1:300 ; leica ) , cd34 ( 1:20 ; leica ) , cd56 ( 1:150 ; leica ) , ck5 ( 1:300 ; leica ) , wt-1 ( 1:40 ; leica ) , calretrenin ( 1:100 ; leica ) , cd68 ( 1:600 ; dinona , iksan , korea ) , cd3 ( 1:300 ; neo , fremont , usa ) , cd35 ( 1:50 ; cell marque , rocklin , ca , usa ) , and ck6 ( 1:50 ; thermo , fremont , ca , usa ) . 3 ) , vimentin , and cd68 , but negative for cytokeratin ( epithelial cell marker ) , myeloperoxidase ( myeloid cell marker ) , hmb45 ( melanoma marker ) , cd1a ( lcs marker ) , cd3 ( t - cell marker ) , cd20 ( b - cell marker ) , cd21 , cd23 , cd35 ( fdcs marker ) , cd31 ( vascular endothelial cell marker ) , cd34 ( myeloid stem cell marker ) , cd56 ( neuroendocrine cell marker ) , ck5 , ck6 , wt-1 , and calretrenin ( mesothelioma marker ) . the patient underwent a positron emission tomography ( pet)-ct scan , which revealed 18-fluoro - deoxyglucose ( fdg ) uptake in the thickened pleura and whole axial skeleton ( standardized uptake value ( suv ) ; 10.5 and 9.8 ) compatible with malignant tissue ( fig . subsequently , the patient was treated with two courses of chop ( cyclophosphamide , doxorubicin , vincristine , prednisone ) and one course of imep ( ifosfamide , methotrexate , etoposide , prednisolone ) . however , the pleura - based masses were aggravated , and he died of progressive disease 3 months after diagnosis . tumors arising from dendritic cells , such as , fdcs and idcs , are very rare . fewer than two hundreds of cases have been reported to date ( 4 ) , and only 37 cases of idcs have been reported in the english literature ( 5 ) . idcs usually is encountered in a lymph node , but extranodal idcs is rare and can occur in a wide variety of sites ( 5 - 12 ) . the recognition of extranodal idcs requires a high index of suspicion because of its rarity . we present a case of extranodal idcs in the pleura that was diagnosed using a combination of morphologic and immunophenotypic characterizations . as far as we know , only one case of idcs with pleural effusion has been reported , in which malignant pleural effusion occurred during disease course in a idcs patient presented with multiple lymphadenopathies ( 13 ) . moreover , the reported case might not be idcs due to its expression of surface cd1a in the tumor cells . to the best of our knowledge , this is the first case report to describe extranodal idcs initially presented with diffuse pleural involvement . the diagnosis was confirmed histologically on slides stained with hematoxylin and eosin and a wide panel of antibodies , which included probes recognizing antigens specifically expressed by follicular and interdigitating dendritic cells ( 2 , 3 ) . neoplastic cells were large , fusiform spindle cells with indistinct cell borders , oval central nuclei , finely dispersed chromatin , and small but prominent nucleoli , and often formed a storiform or whorled , fascicular growth pattern . idcs should be differentiated from fdcs , lcs , s100 positive histiocytic tumors , melanoma , and fibroblastic reticular cell tumors . immunohistochemistry demonstrated neoplastic cells positivity for all histiocytic markers , including cd68 , lysozyme , and macrophage transcription factor pu.1 , and showed that the dendritic cell markers fascin and s100 were strongly expressed . however , they were negative for cd1a ( lcs marker ) , cd21/23/35 ( fdcs marker ) , cd20 ( b cell marker ) , cd3 ( t cell marker ) , and cd34 ( myeloid stem cell marker ) ( 5 - 8 ) . neoplastic cells in our case were strongly positive for s100 and negative for t cell , b cell , epithelial , and follicular dendritic cell markers . treatments administered have varied in accord with clinical context of the affected patients . in patients with localized disease several chemotherapeutic regimens have been tried including chop , abvd ( doxorubicin , bleomycin , vinblastine , dacarbazine ) , dhap ( dexamethasone , cisplatin , high - dose cytarabine ) , epoch ( etoposide , prednisone , vincristine , cyclophosphamide , doxorubicin ) , ice ( ifosfamide , carboplatin , etoposide ) , and cisplatin / epirubicin with limited response ( 1 , 3 , 6 ) . for the greater part , remission durations are usually short , and limited results for bone marrow transplantation are not encouraging ( 3 ) . our patient was treated using the chop and imep regimens , but eventually succumbed to disease progression . furthermore , its unusual location , extreme rarity , and the morphological similarities between idcs and fdcs and with other poorly differentiated tumors can easily delay diagnosis . the possibility of idcs with an unusual extranodal site should be considered when an undifferentiated neoplasm with a mixed population of lymphocytes is encountered . awareness of this tumor , particularly in extranodal sites , and the use of immunohistochemical stains with appropriate markers are crucial for arriving at a correct diagnosis .

a rapid and good outcome osseointegration is a fundamental prerequisite for a successful dental implantation and depends on the shape , structure , and composition of the used surface . the main requirements for a good material are its ability to promote attraction and adhesion of bone precursor cells and their proliferation and differentiation . the ability of the materials to reduce the space between implant and body tissues results in a successful superficial adhesion and cell proliferation . cell recruitment , interaction , and adhesion play a crucial role in how cells react to the material to which they are attached . upgrade those steps would improve vascularity at the implant surface and would decrease the risk of a bacterial infection . several data suggest that prosthesis anchorage to bone and soft tissue can be modulated by surface characteristics . having observed that smooth surfaces are less suitable to induce a similar behavior , different treatments can be used to obtain surface roughness and promote fibroblast adhesion and colonization . , titanium is considered a gold standard because of its biocompatibility and good corrosion resistance . with regard to this , titanium surfaces showed an excellent corrosion resistance and biocompatibility , when tested in vitro . titanium can be characterized by several degree of purity , depending on the relative percentage of different elements as iron , aluminum [ figure 1 ] , vanadium , and molybdenum . human fibroblast ( hfb ) gene expression profile after 7 days ( a ) and 15 days ( b ) of treatment with aon 4gr recently , a new type of implant with a spiral form has been produced ( ultimate , aon , grisignano di zocco , vi ) . the aim of this work was to compare two different aon titanium layers ( gr4 and gr5 ) to investigate which one had a greater osteoconductive power using human fibroblast ( hfb ) culture at two different time - points . the expression levels of some adhesion and traction - resistance related genes ( col11a1 , col2a1 , col9a1 , dsp , eln , has1 , and tfrc ) were analyzed using real time reverse transcription - polymerase chain reaction ( real time rt - pcr ) . in this work we used two type of aon alloy disk ( named aon 4gr and aon 5gr ) , with a diameter of 5 mm , that differed for chemical processing . aon 5gr , on the other hand , having a different purity degree underwent a double sand - blasting process ( corundum and aluminum ) . the pieces were transferred in 75 cm culture flasks containing dmem ( dulbecco 's modified eagle medium ) medium ( sigma aldrich , inc . st louis , mo , usa ) supplemented with 20% fetal calf serum and antibiotics ( penicillin 100 u / ml and streptomycin 100g / ml ; sigma aldrich , inc . ) . cells were harvested after 30 days of incubation . for the investigation , hfb at the second passage were seeded on two different types of aon titanium dishes ( 4gr and 5gr ) . the medium was changed three times a week and the cells were maintained in a humified atmosphere of 5% co2 at 37c . cells were trypsinized and lysed for rna extraction , after 7 and 15 days of treatment . reverse transcription to cdna was performed directly from cultured cell lysate using the taqman gene expression cells - to - ct kit ( ambion inc . , briefly , cultured cells were lysed with lysis buffer and rna released in this solution . cell lysate were reverse transcribed to cdna using the rt enzyme mix and appropriate rt buffer ( ambion inc . ) . finally , the cdna was amplified by real - time rt - pcr using power sybr green pcr master mix ( applied biosystems , foster city , ca , usa ) and the specific assay designed for the investigated genes . the gene expression levels were normalized to the expression of the house - keeping gene tfrc and were expressed as fold changes relative to the expression of the untreated hfb . reverse primers for the selected genes were designed using primer express software ( applied biosystems ) and are listed in table 1 . all pcr reactions were performed in a 20 l volume using the abi prism 7500 ( applied biosystems ) . each reaction contained 10lof 2 power sybr green pcr master mix ( applied biosystems , 400 nm concentration of each primer , and cdna ) . in this work we used two type of aon alloy disk ( named aon 4gr and aon 5gr ) , with a diameter of 5 mm , that differed for chemical processing . aon 5gr , on the other hand , having a different purity degree underwent a double sand - blasting process ( corundum and aluminum ) . the pieces were transferred in 75 cm culture flasks containing dmem ( dulbecco 's modified eagle medium ) medium ( sigma aldrich , inc . , st louis , mo , usa ) supplemented with 20% fetal calf serum and antibiotics ( penicillin 100 u / ml and streptomycin 100g / ml ; sigma aldrich , inc . ) . for the investigation , hfb at the second passage were seeded on two different types of aon titanium dishes ( 4gr and 5gr ) . the medium was changed three times a week and the cells were maintained in a humified atmosphere of 5% co2 at 37c . cells were trypsinized and lysed for rna extraction , after 7 and 15 days of treatment . reverse transcription to cdna was performed directly from cultured cell lysate using the taqman gene expression cells - to - ct kit ( ambion inc . , briefly , cultured cells were lysed with lysis buffer and rna released in this solution . cell lysate were reverse transcribed to cdna using the rt enzyme mix and appropriate rt buffer ( ambion inc . ) . finally , the cdna was amplified by real - time rt - pcr using power sybr green pcr master mix ( applied biosystems , foster city , ca , usa ) and the specific assay designed for the investigated genes . the gene expression levels were normalized to the expression of the house - keeping gene tfrc and were expressed as fold changes relative to the expression of the untreated hfb . reverse primers for the selected genes were designed using primer express software ( applied biosystems ) and are listed in table 1 . all pcr reactions were performed in a 20 l volume using the abi prism 7500 ( applied biosystems ) . each reaction contained 10lof 2 power sybr green pcr master mix ( applied biosystems , 400 nm concentration of each primer , and cdna ) . cell behavior was evaluated by measuring the gene expression levels of adhesion and traction - resistance related genes at two time - points ( 7 and 15 days ) . real time rt - pcr data showed that after 7 days of treatment with tia 4gr , the only two up - regulated genes were col2a1 and dsp . after 15 days of treatment , no gene was overexpressed [ figure 1a and b ] . in fact , dsp expression was still greater than untreated cells , while col2a1 and col9a1were weakly up - regulated . also in this case , all genes were under - expressed in 15 days treated cells than in untreated cells [ figure 2a and b ] . human fibroblast ( hfb ) gene expression profile after 7 days ( a ) and 15 days ( b ) of treatment with aon 5gr a tight joint between implant and surrounding tissues is essential for a long - term successful and inflammation - free dental implant . such a result depends on cell growth and adhesion at the tissue - implant interface . recently , immediate loading seems to be the gold standard implant [ figure 3 ] used for edentulous patients to get a better immediate comfort . the aim of this study was to compare fibroblasts behavior cultured on two different types of aon titanium disks . aon 5gr , having a different purity degree ( as consequence of having a different chemical composition ) , underwent a double sand - blasting process ( corundum and aluminum ) . after 7 and 15 days of treatment the expression levels of several genes were measured by relative quantitation method using real time rt - pcr in hfb . after 7 days of exposure aon 4gr caused up - regulation of col2a1 and dsp . at the second time point ( 15 days ) all genes resulted under - expressed . col2a1 gene promotes the production of the type 2 collagen , primarily found in cartilage , whose deficiency has been related to several skeletal diseases . dsp encodes desmoplakine , an essential component of desmosomes that anchor intermediate filaments to desmosomal plaques . its up - regulation suggest the involvement of this protein in cell cell and cell matrix adhesion . the other type of titanium disks is aon , which caused an up - regulation of dsp and just a weak over - expression of col2a1 and col9a by exposition to hfb . our preliminary results suggest that neither aon 4gr nor aon 5gr are able to promote the production of protein involved in cell cell and cell matrix adhesion and in stress - resistance , required for a good outcome in dental implantology .

anterior crossbite is defined as a malocclusion resulting from the lingual positioning of the maxillary anterior teeth in relationship to the mandibular anterior teeth.1 dental crossbite involves localized tipping of a tooth or teeth and does not involve basal bone.2 patients with anterior dental crossbite will show a normal anterior - posterior skeletal relationship with a smooth path of mandibular closure into an angle class i relationship and coincident centric occlusion and centric relation.3 anterior dental crossbite has a reported incidence of 45% and usually becomes evident during the early mixed - dentition phase.47 a variety of factors have been reported to cause anterior dental crossbite , including a lingual eruption path of the maxillary anterior incisors ; trauma to the primary incisor resulting in lingual displacement of the permanent tooth germ ; supernumerary anterior teeth ; an over - retained necrotic or pulpless deciduous tooth or root ; odontomas ; crowding in the incisor region ; inadequate arch length ; and a habit of biting the upper lip.39 various treatment methods have been proposed to correct anterior dental crossbite , such as tongue blades , reversed stainless steel crowns , fixed acrylic planes , bonded resin - composite slopes and removable acrylic appliances with finger springs.3,911 this article documents 3 cases in which anterior dental crossbite were successfully corrected using bonded resin - composite slopes . all of the cases reported here were in early mixed dentition and had class i molar and canine relationships . in every case there was sufficient mesiodistal distance to achieve labial movement of the maxillary tooth . following clinical and radiographic examinations , the decision was made to create a bonded resin - composite slope . the labial surface of the occluding lower incisor or incisors were etched with 37% phosphoric acid ( etch-37 with bac , bisco , usa ) for 15 seconds rinsed and dried . an adhesive system ( gluma one bond , heraus kulzer , germany ) was applied and cured for 20 s using a visible light unit ( hilux , benlioglu dental , ankara , turkey ) . composite resin ( charisma , heraus kulzer , germany ) was formed into an inclined slope and applied to the labial surface of each incisor to create a slope of 34 mm in thickness at a 45 angle to the longitudinal axis of the tooth . the composite was cured and polished using a polishing disc . the occlusion was checked to confirm that the treated incisors represented the only points of contact between the arches . ( typically , posterior teeth do not contact immediately following slope placement ; however , normal posterior occlusion is re - established as soon as the maxillary incisor is displaced labially . ) the children were motivated to maintain good oral hygiene and recalled after 1 week to clinically evaluate the treatment progress and periodontal health of the anterior teeth . following correction , the resin slope was removed with a diamond bur at low speed , the enamel surface was polished using aluminum oxide finishing discs , and topical fluoride was applied . a composite slope was bonded to the mandibular left central and lateral incisors and remained in place for 1 week ( figure 1b and 1c ) . intraoral examination revealed the permanent maxillary right and left central incisors were in crossbite ( figure 2a ) . a 7-year - old girl presented at our clinic with a maxillary right central incisor in crossbite with the mandibular central and lateral incisors ( figure 3a ) . a bonded resin - composite slope was applied , and the crossbite was corrected in 1 week ( figure 3b and 3c ) . all of the cases reported here were in early mixed dentition and had class i molar and canine relationships . in every case there was sufficient mesiodistal distance to achieve labial movement of the maxillary tooth . following clinical and radiographic examinations , the decision was made to create a bonded resin - composite slope . the labial surface of the occluding lower incisor or incisors were etched with 37% phosphoric acid ( etch-37 with bac , bisco , usa ) for 15 seconds rinsed and dried . an adhesive system ( gluma one bond , heraus kulzer , germany ) was applied and cured for 20 s using a visible light unit ( hilux , benlioglu dental , ankara , turkey ) . composite resin ( charisma , heraus kulzer , germany ) was formed into an inclined slope and applied to the labial surface of each incisor to create a slope of 34 mm in thickness at a 45 angle to the longitudinal axis of the tooth . the composite was cured and polished using a polishing disc . the occlusion was checked to confirm that the treated incisors represented the only points of contact between the arches . ( typically , posterior teeth do not contact immediately following slope placement ; however , normal posterior occlusion is re - established as soon as the maxillary incisor is displaced labially . ) the children were motivated to maintain good oral hygiene and recalled after 1 week to clinically evaluate the treatment progress and periodontal health of the anterior teeth . following correction , the resin slope was removed with a diamond bur at low speed , the enamel surface was polished using aluminum oxide finishing discs , and topical fluoride was applied . a composite slope was bonded to the mandibular left central and lateral incisors and remained in place for 1 week ( figure 1b and 1c ) . intraoral examination revealed the permanent maxillary right and left central incisors were in crossbite ( figure 2a ) . a 7-year - old girl presented at our clinic with a maxillary right central incisor in crossbite with the mandibular central and lateral incisors ( figure 3a ) . a bonded resin - composite slope was applied , and the crossbite was corrected in 1 week ( figure 3b and 3c ) . one of the chief objectives of pediatric dentistry is to guide the developing dentition to a state of normalcy in line with the stage of oral - facial growth and development.12 the period of mixed dentition offers the greatest opportunity for occlusal guidance and interception of malocclusion.13 if delayed to a later stage of maturity , treatment may become more complicated.14 anterior dental crossbite requires early and immediate treatment to prevent abnormal enamel abrasion , anterior teeth mobility and fracture , periodontal pathosis and temporomandibular joint disturbance.8,9,1519 the main goal of treatment is to tip the affected maxillary tooth or teeth labially to the point where a stable overbite relationship exists.19 relapse is usually prevented by the normal overjet / overbite relationship that is achieved.20 different techniques have been used to correct anterior dental crossbite . the reversed stainless steel crown is a well - known method for correcting anterior dental cross - bite.21,22 the chief disadvantage of this method is the difficulty in adapting a preformed crown to fit the tooth in crossbite.21 furthermore , the reversed stainless steel crown is an unaesthetic treatment that is often rejected by children and their relatives.18,22 the tongue blade can also be an effective method of treatment during the early phase of eruption ; however , it requires total cooperation from the patient , which in most cases is difficult to obtain.10 similarly , the use of removable acrylic appliances with posterior bite opening platforms and anterior finger springs for labial tipping of maxillary teeth9,16,19 also requires patient cooperation.14 a lower acrylic inclined - bite - plane is another effective treatment method ; however , it requires a laboratory phase , which increases the price of treatment , and the cement used with this type of appliance may cause gingivitis.23,24 because of the disadvantages of the methods mentioned above , the cases reported here were all treated using a bonded resin - composite slope . this method represents a safe , quick , easy and esthetically acceptable alternative for the correction of anterior dental crossbite . the procedure is low - cost , involves no discomfort , and it can be completed in only a few visits to the clinic . treatment time is short , since retention is achieved once the tooth is in the correct position , and it is also low - cost.8,21 in all of the cases reported here , correction of anterior dental crossbite was observed within 12 weeks , with no damage to teeth or marginal periodontal tissue . as demonstrated in these three cases , a bonded resin - composite slope is a simple and effective method for treating anterior dental crossbite .

ewing s sarcomas is a rare primitive neuroectodermal tumour ( pnet ) which has an annual incidence of 2.9 /million population in usa 1jeffery toretsky et al ( 2008 ) they are very uncommon in african and asian population . it is commonly associated with reciprocal translocation between chromosome 11 and 12 t ( 11:12 ) or less frequently the t(21;22)(q22;ql 2 ) translocation . it is highly aggressive tumor which is pas- and cd99 ( mic2)-positive relatively few variant translocations have been reported in primary ewing s sarcomas ( es ) . we are hereby presenting a case of extra skeletal soft tissue ewing s sarcoma with unusual translocation of chromosome t ( 4 , 22 ) ( q35 , q12 ) . patient presented to us in advanced stage with pulmonary metastasis and lower limb neurological deficit . relatively few variant translocations have been reported in primary ewing s sarcomas ( es ) . to date , 13 variants of the ews fusion gene have been described in literature . they are extremely rare , representing altogether < 1% of the cases 23we are reporting a case of a variant simple translocation of chromosome t ( 4 ; 22 ) ( q35;1 2 ) . in our exhaustive literature search we could find only one case of complex translocation which was identified in a dysmorphic 15-year - old girl , t ( 4:11 ; 22)(q21 ; q24 ; q12 ) reported by squire jet al ( 1993 ) . this type of translocation is extremely rare and has not been reported in the literature so far . clinical presentation was initial indolent but later at the time patient presented to our institute he had developed pulmonary metastases and paraplegia due to involvement of spine . our case report will provide new insight about rare translocation types in ewing s sarcoma and understand their clinical behavior of ewing s sarcoma with such type of translocation . ewing sarcoma ( es)/primitive neuroectodermal tumor ( pnet ) of bone is the second most common primary malignant bone cancer in children and adolescents , the extra skeletal variety has been reported in adults . it is commonly associated with reciprocal translocation between chromosome 11 and 12 t ( 11:12 ) or less frequently the t ( 21;22)(q22;ql 2 ) translocation . the median age at the time of diagnosis is 15 years and there is a male predilection of 1.5/11 . the demonstration of translocation by karyotype analysis with short term culture and metaphase spreads is labor intensive , time consuming and requires fresh tissue specimen . hence the advent of florescence insitu hybridization technique and reverse transcriptase polymerase chain reaction helps in rapid diagnosis of translocations . 1 ) presented to our hospital with history of swelling in right distal thigh associated and dull aching pain which started after a trivial trauma about three years back . he was seen by his primary care physician who has diagnosed the condition as soft tissue tumor for which patient underwent 4 cycles of chemotherapy followed by resection of tumor . patient remained asymptomatic in the subsequent year but unfortunately developed recurrence of swelling in same region that gradually increased in size . when he presented to our institution with the swelling over right distal thigh ( fig . 2 ) he had developed low backache and complete weakness of both lower limbs . at the time of examination patient had a large irregular shaped swelling measuring about 352520 cm at distal half of right thigh(fig . the skin over swelling appeared shiny and stretched shiny with engorged veins movements of knee was restricted . x ray pelvis and spine showed multiple lytic skeletal metastases . chest x ray ( fig . the core needle biopsy from tumor under microscope revealed tumor cells predominantly arranged in sheets , cells round to oval with centrally placed hyper chromatic nucleus and scanty cytoplasm , rosettes seen at places ( fig . 7 ) showed variant translocation karyotype 46 , xy , t ( 4 , 22 ) ( q35 , q12 ) . since the patient presented to us in an advanced state it was decided to start palliative treatment . clinical photo of patient with swelling over distal aspect of right thigh swelling measuring almost 352520 , skin appears stretched and dilated veins are vible . previous surgery scar x ray of right femur showing soft tissue mass with irregeular perisosteal reaction ap and lateral view of spine showing pathological compression fracture d11(kyphosis ) with widespread mets microscopy showing tumor cells predominantly arranged in sheets , cells round to oval with centrally placed hyperchromatic nucleus and scanty cytoplasm , rosettes seen at places cytogenetics showing variant translocation 46,xy , t(4,22 ) ( q35,q12 ) immunohistocytochemistry positive for cd99 tumors with the type 1 transcript ( ews - fly1 ) are associated with a better prognosis than those with other transcripts . the common genetic alteration in es is a translocation between the ews gene on chromosome 22 and various genes of the ets family of transcription factors . alternatively , chromosome 22 is found as partner in 10% of the cases . to date , 13 variants of the ews fusion gene have been described , involving many chromosomes : 2 , 6,7,9,11,12 17 and 22 . previously only one case of complex translocation was identified in a dysmorphic 15- year - old girl , t ( 4 ; 11 ; 22 ) ( q21 ; q24 ; q12 ) . our patient was initially treated somewhere outside by the time he presented to our institute he had a irregular swelling over right distal thigh , restricted movements of knee , feeble peripheral pulse and pure motor deficit . what is unusual about this case is from the time patient noticed the swelling and was treated by his primary care physician the tumor behaved indolent . patient has lost the details about the details of chemotherapy before surgical excision of tumor and unfortunately could not be obtained . the earliest symptom is pain associated with swelling which progressed to form large tumors in soft tissues . imaging modalities like x ray , ct , mri , isotope scan will help in diagnosis and detecting distant metastasis . the definitive diagnosis is made by biopsy , providing sufficient material for conventional histology , immune histochemistry and molecular biology . es is a small blue round - cell tumor , pas- and cd99 ( mic2)-positive . apart from various prognostic factors recently it has been reported that the type of ews / flil fusion transcript is prognostically relevant , as patients with the type l ews / flil fusion transcript appear to have increased disease - free survival over that of patients with other fusion transcript types 6 . ewing s sarcoma is a rare primary malignant bone tumor which is often indistinguishable from primary neuroectodermal tumors by histopathology . clinically both these type of tumors behave same hence the clinical management remains the same with adjuvant chemotherapy , excision and radiotherapy being the cornerstone of treatment . karyotype and insitu hybridization helps to detect the type of chromosomal translocation which can predict the overall prognosis of the tumor . we have reported a very unusual variant simple translocation of chromosome t ( 4 ; 22 ) ( q35 ; 12 ) . this patient had widespread metastasis with a complete paraplegia due to involvement of spinal cord . since patient presented in grade 4 stage at the time of presentation to our institute this type of translocation further study is required to evaluate the prognosis of ewing s sarcoma in patients with this type of unusual translocation . it is imperative to conduct appropriate immunohistocytochemistry to confirm this type of translocation when patient presents with unusual clinical presentation .

in general we differentiate between the terms benefit basket ( also benefit package ) and benefit catalogues . the benefit basket refers to the totality of services , activities , and goods covered by publicly funded statutory / mandatory insurance schemes ( social health insurance , shi ) or by national health services ( nhs ) . in contrast , we define benefit catalogues as the document(s ) in which the different components of the benefit basket are stated in detail , i.e. , which enumerate the services , activities , and goods in a more detailed way , listing single interventions ( i.e. , specific technologies ) . thus a benefit basket may be further defined by one or more benefit catalogues . basically , the coverage of a given population for health services can be characterized in three dimensions : breadth as the extent of covered population , depth as the number and character of covered services , and height as the extent to which costs of the defined services are covered by prepaid financial resources as opposed to cost - sharing requirements . services or goods which are not covered at all ( i.e. , with a copayment of 100% ) are not considered to be part of the benefit basket . this article mainly focuses on the coverage of services ( depth of benefit coverage ) .fig . 1 three dimensions of coverage three dimensions of coverage an open questionnaire was developed to explore the different benefit baskets and their underlying benefit catalogues of the participating nine countries , and this served as guide in compiling standardized country reports . to scan the different health systems in search for existing benefit catalogues we followed the framework of functional categories of health care services and goods proposed by the oecd in its system of health accounts ( table 1 ) . as an initial step the researchers in each country were asked to identify the decision - making processes on the benefit basket as a whole in their country . as a second step they were asked to provide a detailed description of the existing benefit catalogues for each functional category , the actors involved in decision making , and the decision criteria.table 1 framework of health care functional categories , system of health accountshc.1 services of curative care hc.1.1 in - patient curative care hc.1.2 day cases of curative care hc.1.3 out - patient care hc.1.3.1 basic medical and diagnostic services ( primary health care ) hc.1.3.2 out - patient dental care hc.1.3.3 all other specialized care hc.1.3.9 all other out - patient curative care hc.1.4 services of curative home carehc.2 services of rehabilitative care hc.2.1 in - patient rehabilitative care hc.2.2 day cases of rehabilitative care hc.2.3 out - patient rehabilitative care hc.2.4 services of rehabilitative home carehc.3 services of long - term nursing care hc.3.1 in - patient long - term nursing care hc.3.2 day cases of long - term nursing care hc.3.3 long - term nursing care at homehc.4 ancillary services to health care hc.4.1 clinical laboratory hc.4.2 diagnostic imaging hc.4.3 patient transport and emergency rescue hc.4.9 all other miscellaneous serviceshc.5 medical goods dispensed to out - patients hc.5.1 pharmaceuticals and other medical non - durables hc.5.1.1 prescription medicines hc.5.1.2 over - the - counter medicines hc.5.2 therapeutic appliances and other medical durables hc.5.2.1 glasses and vision products hc.5.2.2 orthopedic appliances and other prosthetics hc.5.2.3 hearing aids hc.5.2.4 medico - technical devices hc.5.2.9 all other miscellaneous medical durableshc.6 prevention and public health services hc.6.1 maternal and child health ; family planning and counseling hc.6.2 school health services hc.6.3 prevention of communicable diseases hc.6.4 prevention of non - communicable diseases hc.6.5 occupational health care hc.6.9 all other miscellaneous public health services framework of health care functional categories , system of health accounts a generic pattern of establishing and shaping health baskets is found in most of the countries consisting of two levels . at the higher level , legislation passed by the national parliaments ( sometimes even rooted in the country s constitution , e.g. , poland ) establishes the general framework by enumerating the areas of health care , often similar to the oecd health care categories , included in the benefit basket . at the lower level , the benefit basket is further shaped by specifying certain procedures provided within each area of health care as part of the benefit catalogues . the extent to and the way in which this shaping actually takes place varies considerably from country to country and within each country from sector to sector of health care . there are several ways used to establish benefit catalogues such as legislations passed by central or regional parliaments , decrees issued by national or regional governments , directives issued by self - governing bodies or by national and/or local authorities , and other documents considered as quasilaws ( rules without legal character , e.g. , clinical guidelines ) . in all countries studied a general definition of a benefit basket could be identified at the higher level . depending on the organization of the system ( nhs or shi ) , the logic underlying the general definition of the benefit basket differs . in nhs countries the definition of a benefit basket refers to the specification of the duties and obligations of the purchasing organization ( regional health authorities ) , and in shi countries the issue of the benefit basket is more related to the specification of entitlements of the insured persons . however , it can not be said that either nhs or shi countries generally define their benefits more explicitly than the other . in most nhs countries a coherent legislation contains a list of the areas of care to be provided by the respective nhs , including regional health services as part of the benefit basket of regions in decentralized nhs systems , for example , italy and spain . denmark represents an exception from this as the legislation consists of separate acts concerning the categories of hospital , primary and long - term care , and pharmaceuticals . the vaguest definition of a benefit basket may be that of the nhs foundation act ( 1946 ) in england and related posterior documents , where the secretary of state for health is legally required to provide services to such extent as he considers necessary to meet all reasonable requirements . the responsibility for making available general practitioner , dental , ophthalmic , and pharmaceutical services lay until 2003 with health authorities and since then with primary care trusts . in contrast , the framework of the italian and spanish benefit baskets , each of which was established in recently implemented legal documents , is structured in more detail [ 13 , 14 ] . common to all four , however , is the differentiation between hospital care and primary care , including specialist outpatient services , as well as preventive or health promotion services . the level of explicitness is not only heterogeneous across different countries , but also within the same country . for instance , in spain some areas of health care may be further shaped by mentioning specific services or in some cases even specific procedures or technologies being in- or excluded from the benefit basket . thus the definition of the benefit basket within nhs countries does not always follow a systematic approach of going into further detail . it rather addresses shortcomings perceived by decision makers of each health care system , not necessarily being based on evidence . concerning the origin of more detailed benefit catalogues some similarities are observed across countries with similar organization of the health care system or with similar organizational demands ( i.e. , the need to reimburse providers in free practice ) . in the two countries with regionalized nhs , italy and spain , the motivation for defining a detailed benefit catalogue is to be seen in the autonomous status of regions . the national benefit basket can be regarded as a minimum basket of health services that must be provided by the regional health authorities . therefore the regions in both countries are free to offer additional services not included in the national benefit basket . health baskets in shi countries stem from two different roots . on the one hand , shi countries formulate the basket as an entitlement for persons insured under the respective statutory health insurance schemes . the main reason for this lies in the fact that shi schemes have evolved from fragmented voluntary / statutory health insurance schemes not covering the whole population and only covering certain services , for example , sickness benefits . statutory health insurance in germany as well as in the netherlands does still not cover the whole population [ 15 , 16 ] . therefore in shi countries the health basket is also used to indicate the boundaries between those insured under the statutory health insurance and those insured under other schemes . the second root are fee catalogues which were originally more prevalent in shi than in nhs countries due to the frequently used fee - for - service reimbursement system , at least in ambulatory specialist care . another common characteristic of decision making on health baskets in most shi countries is the role of the self - governing institutions . within a general framework stipulated by laws , self - governing institutions ( e.g. , sickness funds , physician associations ) specify the rules to explicit benefit catalogues or remuneration schemes with the character of benefit catalogues , limiting the scope of service provision . as observed in nhs countries , the level of explicitness also varies considerably among shi countries . poland has by far the most explicit benefit basket , which is even rooted in the constitution . different legal acts define benefit catalogues specifying detailed procedures or even technologies being provided . at the other extreme , germany probably has the vaguest legal definition of the benefit basket among the shi countries , with the social code book as a general framework . for instance , inpatient services in germany are limited to only a certain extent by the diagnosis - related group ( drg ) reimbursement system because they can be provided unless they are explicitly excluded by directives . there is a trend in all shi countries towards more explicit benefit baskets . in the netherlands a system of diagnosis - procedure combinations has been introduced in 2005 defining procedures provided in inpatient care and by specialists in outpatient care . in france a similar list is currently being prepared , while germany and hungary recently updated their outpatient remuneration schemes specifying certain procedures that are reimbursed by the statutory health insurance [ 17 , 19 ] . as in other sectors of the health care system , the provided inpatient services can either be listed as procedures being part of an explicit benefit catalogue or indirectly determined by grouping systems that serve remuneration purposes , for example , drgs . france , poland , and spain have defined explicit benefit catalogues , grouped according to medical specialties , for inpatient services listing detailed procedures serving as positive lists [ 10 , 14 , 20 ] . while there are clear decision criteria for the inclusion of benefits in the benefit catalogue in france and spain , no transparent criteria are applied in poland . in all other countries drg and other grouping systems serve as a tool for estimating resource consumption supporting budget assignations or providing the basis for remuneration . in general , they classify a single episode of care according to main diagnoses , comorbidities and main surgical interventions into one of a limited number of groups . thus each classified episode is assumed to require more or less homogeneous resource consumption , independently of whether exactly the same items ( e.g. , drugs , diagnostics ) are used . as , finally , monetary values are attached to the different groups , the use of drugs , diagnostics etc . four countries have introduced drg systems : italy , germany , hungary , and denmark . england and the netherlands have drg - like grouping systems called , respectively , health care resource groups and diagnose behandeling combinaties . the main features of the drg and other grouping systems are very similar ( table 2 ) [ 12 , 18 ] . in each country the groups have been developed from data collected on resource consumption , clustering in homogeneous resource consumption groups . the observed variability in the number of classified groups in each system may be explained by the different criteria used to classify them ( table 2 ) . another possible explanation is the creation of additional groups in certain countries to increase the scope for the use of new innovative technologies ( devices , procedures , and even drugs theoretically ) which are considered to be worth the promotion ( i.e. , because of higher efficacy ) . this has been the case in italy , where the regional health authority of lombardy added three new drgs to its system in order to specifically consider the use of drug - eluting stents and to encourage its utilisation .table 2 inpatient benefit catalogues or substitutescountryname of taxonomy , year of introductionapplied geographical areataxonomy ( and grouping criteria)actors involved in decision makingcriteria for in-/ exclusion of benefitsdenmarkdrg system ( nordic - drg ) ; 1998national25 mdc ( anatomical , etiological , other ) with 589 drg , special category for chemotherapy and radiotherapy . grouping criteria : main diagnosis , procedures , sex , age , cause of dischargelegislation at the national level ( law , general framework)need , budgetministry for the interior and health ( approval)national board of health ( drg catalogue)county level ( budgeting , hospital plan)clinicians ( priority setting in hospital)francecommon classification of medical procedures ( ccam ) ; 2005nationalccam lists reimbursable and excluded medical procedures thus being a positive and negative list ; grouping criteria : anatomic classification , medical specialtiesnational level ( law , general framework)effectiveness , safetyministry of health ( approval)national union of health insurance funds ( in- and exclusion of services)high health authority ( advisory body on in- and exclusion of services)germanyg - drg system ( based on ar - drg 4.1 ) ; stepwise 20032009national25 mdc ( anatomical/ etiological/ other ) with 876 drg , 71 extra remunerations for special services ( in 2005 ) . grouping criteria : main diagnosis , procedures , age , comorbidity , cause of dischargelegislation at the national level ( law , general framework)services can be provided as long as they are not explicitly excluded . adequate , expedient and cost - effectiveministry of health ( approval)federal joint committee ( exclusion of benefits)institute for hospital reimbursement with assistance of the committee of on hospitalpayment ( drg catalogue)clinicians ( priority setting in hospital)hungarydrg system ( us - drg ) ; 1993national26 mdc ( anatomical , etiological , other ) with 786 drg . grouping criteria : main diagnosis , procedures , age , comorbiditylegislation at the national level ( law , general framework , budgeting)costs , effectivenessministry of welfare , health division ( drg catalogue)national health insurance fundadministration , especially ( prepares decisions)clinicians ( priority setting in hospitals)italydrg system ( hcfa no . 10 ) ; 1995national reference list with regional differences23 mdc ( anatomical , etiological , other ) with 489 to 506 drg , exceptional drgs ( e.g. liver and bone marrow transplantation ) . grouping criteria : main diagnosis , procedures , age , comorbidity , cause of dischargelegislation at the national level ( law , general framework)effectiveness , costscentral level ( national drg catalogue)regional level ( redefines drg catalogue , sets tariffs)clinicians ( priority setting in hospitals)the netherlandsdiagnose behandeling combinaties ( dbc ) ( drg - like system ) ; jan . 2005national111,527 procedures regarding diagnosis and therapy ( dbcs ) are combined to 641 product groups . dbcs are on three different lists determining the status for tariff negotiations or excluding dbcs from the benefit package . grouping criteria : medical specialty , product grouplegislation at the national level ( law , general framework)costs , effectiveness , ministry of health ( decrees)dbc maintenance organization ( dbc system)clinicians ( priority setting in hospitals)polandgovernmental decrees and catalogue of benefitsnationalcatalogue lists all services covered under social health insurance scheme ; services are linked to the respective regulation / law . grouping criteria : area of care ( e.g. , hospital care ) , medical specialtylegislation at the national level ( law , general framework)/ministry of health ( regulations decrees)national health fund ( catalogue)spainroyal decree 63/1995 / law 16/2003 on cohesion and qualtiy of the national health systemnational with regional differencesservices are listed explicitly in decree . in some cases services grouping criteria : area of care , medical specialtylegislation at the national level ( law , general framework)safety , efficacy , efficiencyfederal government ( decree)inter - territorial council and council of the state ( inclusion of new benefits)clinicians ( provision of services relating to entitlements defined by decree)englandhealth care resource group ( drg - like system ) ; stepwise 20042009nationalin april 2004 there were only 48 hrgs in use . grouping criteria : diagnosis , complexity , procedurelegislation at the national level ( law , general framework)costs , budgetministry of health ( catalogue)primary care trusts ( negotiate with providers on quantity and tariffs ) inpatient benefit catalogues or substitutes the fact that specific procedures and technologies drive the development of drg systems confirms our hypothesis that they serve as some kind of benefit catalogues . technologies specifically mentioned in certain groups may not be used if less resource consuming alternatives are available . in this way a less specific drg system may act as a hidden negative list of technologies which de facto are not available for beneficiaries of publicly financed care since the monetary value assigned to certain groups does not cover the actual resource consumption associated with its use . furthermore , in most applied grouping systems certain groups ( e.g. , in drg systems so - called surgical drgs ) are even defined by specific procedures or specific technologies , such as drug - eluting stents . these groups can therefore be considered as a kind of explicitly defined benefits , similar to a positive list . thus it can be assumed that grouping systems are applied as substitutes for benefit catalogues , containing incentives to limit the provision of benefits for those services not being explicitly mentioned . in the outpatient sector benefit although they generally seem to be more explicit than the inpatient catalogues , the explicitness varies even more than in the inpatient sector ( table 3 ) . these different degrees of explicitness are due mainly to the applied remuneration schemes in each country . if physicians receive fixed budgets or capitations , the benefit catalogue ( i.e. , the procedures that they can offer ) is indirectly restricted by the amount of money allocated to them . therefore in these countries the benefit package for outpatient care is regulated rather implicitly through decrees issued by national or regional health authorities describing the obligation of physicians to provide those benefits that are considered necessary . examples of these kind of implicit benefit catalogues are the health insurance treatment and services decree for care provided by general practitioners in the netherlands and the general medical services contract in england . these decrees do not mention specific procedures , although in the case of the netherlands , the general practitioners association , the landelijke huisartsen vereniging , defined a basic general practitioner benefit package in the 1980s .table 3 outpatient benefit catalogues or substitutescountryname of taxonomyapplied geographical areataxonomy ( and grouping criteria)actors involved in decision makingcriteria for in-/exclusion of benefitsbenefits , procedures explicitly excludeddenmarkhealth care reimbursement scheme fee schedulenationalservices are grouped according to medical specialty and for gps additionally in basic , supplementary , laboratory and miscellaneous services . it is referred to the respective legislation decree specifying the benefit , certain goods , procedures or in rare cases indicationsnational level ( law , general framework)needalternative careministry for the interior and health ( approval)counties ( budgeting , health plan)health care reimbursement negotiating committee and health professional associations ( negotiate catalogue)francecommon classification of medical procedures ( ccam)nationallists all medical procedures reimbursable and excluded . grouping criteria : anatomic classification , medical specialtiesnational level ( law , general framework)effectiveness , safetyspa treatments ; cosmetic surgeryministry of health ( approval)national union of health insurance funds ( in- and exclusion of services)high health authority ( advisory body on in- and exclusion of services)germanyshi - ebm , shi - bema , shi - bel - iinationalservices are grouped according to the medical specialty allowed to provide the service . each service is assigned a numeric code in accordance with the subjection of the cataloguenational level ( law , general framework)diagnostic and therapeutic expedience , medical necessity and cost - effectivenessorthopedic services after the age of 18 yearsfederal joint committee ( approval of new benefits)valuation committee ( negotiates ebm)dental valuation committee ( negotiates bema , bel - ii)hungarygovernmental decrees and reimbursement cataloguesnationalsimilar services are listed in groups . governmental decrees relate to different areas of care ( e.g. , dental care , specialist services ) . items in reimbursement catalogues are listed with the respective icpm code and a point valuelegislation at the national level ( law , general framework , budgeting)costs , effectiveness ministry of welfare ( decrees , approval)national health insurance fundadministration , especially ( prepares decisions)payment codes updating committee ( reimbursement catalogues)italynational contract for primary care ; decree on specialist outpatient servicesnational benefit package , regions include additional servicescontract for primary care describes obligations of gp . decree on specialist outpatient services lists services in three sections : available , availability restricted to specific indications , excludedgovernment at national level ( sets decree , negotiates contract)effectiveness , costsnonconventional treatments ( e.g. , acupuncture , phytotherapy ) ; vaccination for traveling purposesrepresentatives of gps ( negotiate contract)ministry of health ( transfers contract into law)government at regional level ( negotiates additional contracts)the netherlandshealth insurance ( treatment and services ) decree ; diagnose behandeling combinaties ( dbc ; drg - like system ) ; jan . 2005nationalgp services are regulated in generic terms only by decree , dbc catalogue ( 111,527 dbcs ) combine information on diagnosis and treatment for medical specialists . dbcs are on three different lists determining the status for tariff negotiations or excluding dbcs from the benefit package . grouping criteria : medical specialty , product grouplegislation at the national level ( law , general framework)costs , effectiveness ministry of health ( decrees)dbc - maintenance organization ( dbc - system)physicians ( priority setting)polandgovernmental decrees and catalogue of benefitsnationalcatalogue lists all services covered under social health insurance scheme . grouping criteria : area of care , medical specialtylegislation at the national level ( law , general framework)vaccination ; acupuncture , unless part of chronic pain managementministry of health ( regulations)national health fund ( catalogue)spainroyal decree 63/1995national with regional differencesservices are listed explicitly in decree . in some cases , services are restricted to specific patient groups . decree lists services in 5 areas of care ( e.g. , primary care , specialized care , pharmaceutical care ) which are further subdivided.legislation at the national level ( law , general framework)safety , efficacy , efficiencycosmetic surgery ( transplantation of hair and nails ) ; sex changefederal government ( decree)inter - territorial council and council of the state ( inclusion of new benefits)clinicians ( provision of services relating to entitlements defined by decree)englandnational service framework nationalhealth resource groups are linked to procedures . guidelines recommend services to be used on certain indicationslegislator at national level ( law , general framework)need , effectivenesscosmetic dental treatmentsgeneral medical services contractnational , with possible variation at pct - levelnhs confederation and general practitioners committee ( negotiate contract)need , costsclinical guidelinesnationalprimary care trusts ( pct ) ( negotiate additional contracts)need , costs , effectivenessnice ( clinical guidelines ) outpatient benefit catalogues or substitutes in contrast , the countries remunerating providers on the basis of fee - for - service schemes need detailed lists of procedures or at least of service complexes ( aggregated multiple procedures ) to be able to negotiate on price and/or volumes . these lists can therefore be interpreted as substitutes for benefit catalogues , as physicians are usually reimbursed only for those items listed . some countries issue detailed lists of all procedures to be performed by physicians ( e.g. the common classification of medical procedures in france ) while other countries list service complexes making physicians responsible for the priority setting within such a service complex ( e.g. , shi - ebm or shi - bema in germany and the health care reimbursement scheme fee schedule in denmark ) . for example , in denmark , france , germany , hungary , and the netherlands services are grouped according to medical specialty . certain outpatient benefits are also linked to indications or special patient groups in poland and spain [ 10 , 14 ] . the high degree of explicitness regarding the definition of the benefit package is also underlined by the diverse lists of excluded services , common in all countries . exclusion practices vary from issuing negative lists ( e.g. , spain , poland ) and directives of self - governmental institutions with the character of negative lists ( e.g. , germany ) to excluded services within the framework of the national law ( e.g. , england ) . however , most countries exclude similar benefits such as cosmetic surgery ( if not closely linked to certain treatments ) , vaccination for nonstandard diseases ( e.g. , for traveling purposes ) , and certain nonconventional treatments ( e.g. , acupuncture ) . benefits of dental care are either restricted to specific treatment methods or age groups ( e.g. , germany ) . as in other sectors of the health care system , the provided inpatient services can either be listed as procedures being part of an explicit benefit catalogue or indirectly determined by grouping systems that serve remuneration purposes , for example , drgs . france , poland , and spain have defined explicit benefit catalogues , grouped according to medical specialties , for inpatient services listing detailed procedures serving as positive lists [ 10 , 14 , 20 ] . while there are clear decision criteria for the inclusion of benefits in the benefit catalogue in france and spain , no transparent criteria are applied in poland . in all other countries drg and other grouping systems serve as a tool for estimating resource consumption supporting budget assignations or providing the basis for remuneration . in general , they classify a single episode of care according to main diagnoses , comorbidities and main surgical interventions into one of a limited number of groups . thus each classified episode is assumed to require more or less homogeneous resource consumption , independently of whether exactly the same items ( e.g. , drugs , diagnostics ) are used . as , finally , monetary values are attached to the different groups , the use of drugs , diagnostics etc . four countries have introduced drg systems : italy , germany , hungary , and denmark . england and the netherlands have drg - like grouping systems called , respectively , health care resource groups and diagnose behandeling combinaties . the main features of the drg and other grouping systems are very similar ( table 2 ) [ 12 , 18 ] . in each country the groups have been developed from data collected on resource consumption , clustering in homogeneous resource consumption groups . the observed variability in the number of classified groups in each system may be explained by the different criteria used to classify them ( table 2 ) . another possible explanation is the creation of additional groups in certain countries to increase the scope for the use of new innovative technologies ( devices , procedures , and even drugs theoretically ) which are considered to be worth the promotion ( i.e. , because of higher efficacy ) . this has been the case in italy , where the regional health authority of lombardy added three new drgs to its system in order to specifically consider the use of drug - eluting stents and to encourage its utilisation .table 2 inpatient benefit catalogues or substitutescountryname of taxonomy , year of introductionapplied geographical areataxonomy ( and grouping criteria)actors involved in decision makingcriteria for in-/ exclusion of benefitsdenmarkdrg system ( nordic - drg ) ; 1998national25 mdc ( anatomical , etiological , other ) with 589 drg , special category for chemotherapy and radiotherapy . grouping criteria : main diagnosis , procedures , sex , age , cause of dischargelegislation at the national level ( law , general framework)need , budgetministry for the interior and health ( approval)national board of health ( drg catalogue)county level ( budgeting , hospital plan)clinicians ( priority setting in hospital)francecommon classification of medical procedures ( ccam ) ; 2005nationalccam lists reimbursable and excluded medical procedures thus being a positive and negative list ; grouping criteria : anatomic classification , medical specialtiesnational level ( law , general framework)effectiveness , safetyministry of health ( approval)national union of health insurance funds ( in- and exclusion of services)high health authority ( advisory body on in- and exclusion of services)germanyg - drg system ( based on ar - drg 4.1 ) ; stepwise 20032009national25 mdc ( anatomical/ etiological/ other ) with 876 drg , 71 extra remunerations for special services ( in 2005 ) . grouping criteria : main diagnosis , procedures , age , comorbidity , cause of dischargelegislation at the national level ( law , general framework)services can be provided as long as they are not explicitly excluded . adequate , expedient and cost - effectiveministry of health ( approval)federal joint committee ( exclusion of benefits)institute for hospital reimbursement with assistance of the committee of on hospitalpayment ( drg catalogue)clinicians ( priority setting in hospital)hungarydrg system ( us - drg ) ; 1993national26 mdc ( anatomical , etiological , other ) with 786 drg . grouping criteria : main diagnosis , procedures , age , comorbiditylegislation at the national level ( law , general framework , budgeting)costs , effectivenessministry of welfare , health division ( drg catalogue)national health insurance fundadministration , especially ( prepares decisions)clinicians ( priority setting in hospitals)italydrg system ( hcfa no . 10 ) ; 1995national reference list with regional differences23 mdc ( anatomical , etiological , other ) with 489 to 506 drg , exceptional drgs ( e.g. liver and bone marrow transplantation ) . grouping criteria : main diagnosis , procedures , age , comorbidity , cause of dischargelegislation at the national level ( law , general framework)effectiveness , costscentral level ( national drg catalogue)regional level ( redefines drg catalogue , sets tariffs)clinicians ( priority setting in hospitals)the netherlandsdiagnose behandeling combinaties ( dbc ) ( drg - like system ) ; jan . 2005national111,527 procedures regarding diagnosis and therapy ( dbcs ) are combined to 641 product groups . dbcs are on three different lists determining the status for tariff negotiations or excluding dbcs from the benefit package . grouping criteria : medical specialty , product grouplegislation at the national level ( law , general framework)costs , effectiveness , ministry of health ( decrees)dbc maintenance organization ( dbc system)clinicians ( priority setting in hospitals)polandgovernmental decrees and catalogue of benefitsnationalcatalogue lists all services covered under social health insurance scheme ; services are linked to the respective regulation / law . grouping criteria : area of care ( e.g. , hospital care ) , medical specialtylegislation at the national level ( law , general framework)/ministry of health ( regulations decrees)national health fund ( catalogue)spainroyal decree 63/1995 / law 16/2003 on cohesion and qualtiy of the national health systemnational with regional differencesservices are listed explicitly in decree . in some cases services grouping criteria : area of care , medical specialtylegislation at the national level ( law , general framework)safety , efficacy , efficiencyfederal government ( decree)inter - territorial council and council of the state ( inclusion of new benefits)clinicians ( provision of services relating to entitlements defined by decree)englandhealth care resource group ( drg - like system ) ; stepwise 20042009nationalin april 2004 there were only 48 hrgs in use . grouping criteria : diagnosis , complexity , procedurelegislation at the national level ( law , general framework)costs , budgetministry of health ( catalogue)primary care trusts ( negotiate with providers on quantity and tariffs ) inpatient benefit catalogues or substitutes the fact that specific procedures and technologies drive the development of drg systems confirms our hypothesis that they serve as some kind of benefit catalogues . technologies specifically mentioned in certain groups may not be used if less resource consuming alternatives are available . in this way a less specific drg system may act as a hidden negative list of technologies which de facto are not available for beneficiaries of publicly financed care since the monetary value assigned to certain groups does not cover the actual resource consumption associated with its use . furthermore , in most applied grouping systems certain groups ( e.g. , in drg systems so - called surgical drgs ) are even defined by specific procedures or specific technologies , such as drug - eluting stents . these groups can therefore be considered as a kind of explicitly defined benefits , similar to a positive list . thus it can be assumed that grouping systems are applied as substitutes for benefit catalogues , containing incentives to limit the provision of benefits for those services not being explicitly mentioned . in the outpatient sector benefit catalogues are , again , often replaced by grouping systems serving remuneration purposes . although they generally seem to be more explicit than the inpatient catalogues , the explicitness varies even more than in the inpatient sector ( table 3 ) . these different degrees of explicitness are due mainly to the applied remuneration schemes in each country . if physicians receive fixed budgets or capitations , the benefit catalogue ( i.e. , the procedures that they can offer ) is indirectly restricted by the amount of money allocated to them . therefore in these countries the benefit package for outpatient care is regulated rather implicitly through decrees issued by national or regional health authorities describing the obligation of physicians to provide those benefits that are considered necessary . examples of these kind of implicit benefit catalogues are the health insurance treatment and services decree for care provided by general practitioners in the netherlands and the general medical services contract in england . these decrees do not mention specific procedures , although in the case of the netherlands , the general practitioners association , the landelijke huisartsen vereniging , defined a basic general practitioner benefit package in the 1980s .table 3 outpatient benefit catalogues or substitutescountryname of taxonomyapplied geographical areataxonomy ( and grouping criteria)actors involved in decision makingcriteria for in-/exclusion of benefitsbenefits , procedures explicitly excludeddenmarkhealth care reimbursement scheme fee schedulenationalservices are grouped according to medical specialty and for gps additionally in basic , supplementary , laboratory and miscellaneous services . it is referred to the respective legislation decree specifying the benefit , certain goods , procedures or in rare cases indicationsnational level ( law , general framework)needalternative careministry for the interior and health ( approval)counties ( budgeting , health plan)health care reimbursement negotiating committee and health professional associations ( negotiate catalogue)francecommon classification of medical procedures ( ccam)nationallists all medical procedures reimbursable and excluded . grouping criteria : anatomic classification , medical specialtiesnational level ( law , general framework)effectiveness , safetyspa treatments ; cosmetic surgeryministry of health ( approval)national union of health insurance funds ( in- and exclusion of services)high health authority ( advisory body on in- and exclusion of services)germanyshi - ebm , shi - bema , shi - bel - iinationalservices are grouped according to the medical specialty allowed to provide the service . each service is assigned a numeric code in accordance with the subjection of the cataloguenational level ( law , general framework)diagnostic and therapeutic expedience , medical necessity and cost - effectivenessorthopedic services after the age of 18 yearsfederal joint committee ( approval of new benefits)valuation committee ( negotiates ebm)dental valuation committee ( negotiates bema , bel - ii)hungarygovernmental decrees and reimbursement cataloguesnationalsimilar services are listed in groups . governmental decrees relate to different areas of care ( e.g. , dental care , specialist services ) . items in reimbursement catalogues are listed with the respective icpm code and a point valuelegislation at the national level ( law , general framework , budgeting)costs , effectiveness ministry of welfare ( decrees , approval)national health insurance fundadministration , especially ( prepares decisions)payment codes updating committee ( reimbursement catalogues)italynational contract for primary care ; decree on specialist outpatient servicesnational benefit package , regions include additional servicescontract for primary care describes obligations of gp . decree on specialist outpatient services lists services in three sections : available , availability restricted to specific indications , excludedgovernment at national level ( sets decree , negotiates contract)effectiveness , costsnonconventional treatments ( e.g. , acupuncture , phytotherapy ) ; vaccination for traveling purposesrepresentatives of gps ( negotiate contract)ministry of health ( transfers contract into law)government at regional level ( negotiates additional contracts)the netherlandshealth insurance ( treatment and services ) decree ; diagnose behandeling combinaties ( dbc ; drg - like system ) ; jan . 2005nationalgp services are regulated in generic terms only by decree , dbc catalogue ( 111,527 dbcs ) combine information on diagnosis and treatment for medical specialists . dbcs are on three different lists determining the status for tariff negotiations or excluding dbcs from the benefit package . grouping criteria : medical specialty , product grouplegislation at the national level ( law , general framework)costs , effectiveness ministry of health ( decrees)dbc - maintenance organization ( dbc - system)physicians ( priority setting)polandgovernmental decrees and catalogue of benefitsnationalcatalogue lists all services covered under social health insurance scheme . grouping criteria : area of care , medical specialtylegislation at the national level ( law , general framework)vaccination ; acupuncture , unless part of chronic pain managementministry of health ( regulations)national health fund ( catalogue)spainroyal decree 63/1995national with regional differencesservices are listed explicitly in decree . in some cases decree lists services in 5 areas of care ( e.g. , primary care , specialized care , pharmaceutical care ) which are further subdivided.legislation at the national level ( law , general framework)safety , efficacy , efficiencycosmetic surgery ( transplantation of hair and nails ) ; sex changefederal government ( decree)inter - territorial council and council of the state ( inclusion of new benefits)clinicians ( provision of services relating to entitlements defined by decree)englandnational service framework nationalhealth resource groups are linked to procedures . currently only 48 hrgs are in use . guidelines recommend services to be used on certain indicationslegislator at national level ( law , general framework)need , effectivenesscosmetic dental treatmentsgeneral medical services contractnational , with possible variation at pct - levelnhs confederation and general practitioners committee ( negotiate contract)need , costsclinical guidelinesnationalprimary care trusts ( pct ) ( negotiate additional contracts)need , costs , effectivenessnice ( clinical guidelines ) outpatient benefit catalogues or substitutes in contrast , the countries remunerating providers on the basis of fee - for - service schemes need detailed lists of procedures or at least of service complexes ( aggregated multiple procedures ) to be able to negotiate on price and/or volumes . these lists can therefore be interpreted as substitutes for benefit catalogues , as physicians are usually reimbursed only for those items listed . some countries issue detailed lists of all procedures to be performed by physicians ( e.g. the common classification of medical procedures in france ) while other countries list service complexes making physicians responsible for the priority setting within such a service complex ( e.g. , shi - ebm or shi - bema in germany and the health care reimbursement scheme fee schedule in denmark ) . for example , in denmark , france , germany , hungary , and the netherlands services are grouped according to medical specialty . certain outpatient benefits are also linked to indications or special patient groups in poland and spain [ 10 , 14 ] . the high degree of explicitness regarding the definition of the benefit package is also underlined by the diverse lists of excluded services , common in all countries . exclusion practices vary from issuing negative lists ( e.g. , spain , poland ) and directives of self - governmental institutions with the character of negative lists ( e.g. , germany ) to excluded services within the framework of the national law ( e.g. , england ) . however , most countries exclude similar benefits such as cosmetic surgery ( if not closely linked to certain treatments ) , vaccination for nonstandard diseases ( e.g. , for traveling purposes ) , and certain nonconventional treatments ( e.g. , acupuncture ) . benefits of dental care are either restricted to specific treatment methods or age groups ( e.g. , germany ) . the analysis of benefits defined in the countries under study reveals that there is a clear trend towards a more explicit definition of benefit baskets and their benefit catalogues . those countries which recently introduced new health care legislations , such as italy , poland , and spain , other countries with older health care legislations , for example , the uk s english - nhs foundation act ( 1946 ) and germany s social code book ( 1988 ) have rather implicitly defined benefit catalogues , but increasingly work with negative lists , based on evidence provided by independent institutions such as the englisch nice and the german institute for quality and efficiency ( iqwig ) [ 12 , 17 ] . apart from negative lists remuneration schemes , for example , drgs and procedures catalogues used for grouping are more and more used as benefit catalogues . these developments indicate that all included countries move towards a more explicit definition of benefit catalogues . explicitly defined benefit catalogues , however , require clear and transparent decision criteria for the in- or exclusion of benefits . , further inquiries often demonstrate that there is no rational process of reviewing the available evidence on specific procedures or technologies . in reality the decision - making process is rather guided by lobbying activities of certain actors in the system . especially those countries with very explicit benefit baskets , e.g. poland , often lack transparency of decision criteria . in contrast to this , countries with rather implicitly defined benefit baskets , such as england and germany , define very transparent criteria for benefit exclusion , although lists with excluded services are minor compared to explicitly oriented countries . in addition , criteria such as cost - effectiveness and even effectiveness are often restricted to one or few sectors of the health care system , for example , pharmaceuticals or medical devices , and are not generalizable to all products or services . in general the transparency of decision criteria must be improved in all countries in order to achieve accountability for all actors of the health care systems as well as consumers . this contribution , as well as the overall eu health basket project , provides useful information for health care providers and industrial companies willing to invest in eu countries but do not have the necessary information on benefit baskets and their underlying decision - making processes . however , to improve the environment for investments and to provide confidence for foreign investors , public documents should be regularly prepared by each country giving a transparent overview of the health baskets and the decision - making criteria . the information provided will be beneficial especially to decision makers at all levels of health policy enabling them to compare different approaches of benefit definitions in order to develop their own position . the need for benchmarking will grow in line with the further development of cross boarder flows and the establishment of coherent benchmark criteria as part of the open method of coordination initiated by eu policy makers [ 24 , 25 ] . however , the project results also demonstrate that a harmonization of health baskets of eu countries , which in the view of certain decision makers could be the final stage after identifying best practice in benchmarking , is not realistic in the short or medium term since the definitions of benefit baskets vary substantially . additionally , as shown in the cases of italy and spain , especially in nhs countries there is rather a trend towards more decentralization of decision making on benefits , delegating to regions the autonomy to offer certain benefits in addition to nationally defined health baskets [ 26 , 27 ] . on the other hand , this could also mean that in future a minimum basket of health benefits may be defined by all countries on the national level , which could be harmonized on the eu level at a certain stage due to systems competition as a result of increased cross - border flows . beyond this minimum basket

lymphocytes survey antigen by circulating through blood , lymph nodes ( lns ) and lymph and shape specific immune responses in lns . to enter lns , lymphocytes must undergo extensive interactions with high endothelial cell venules ( hevs ) ( butcher , 1991 , frster et al . , 2008 , ley et al . , 2007 , muller , 2011 , springer , 1994 , vestweber and blanks , 1999 , von andrian and mempel , 2003 , wagner and frenette , 2008 ) . lymphocytes initially tether on peripheral nodal addressin ( pnad ) expressed on hevs using l - selectin ( cd62l ) as a ligand . lymphocytes roll along the vascular endothelium and become activated via interactions of the chemokine receptors ccr7 and cxcr4 with their respective ligands ccl21 and cxcl12 . activated leukocytes use the integrin lfa-1 ( cd11a ) to bind to icam-1 to promote adhesion and finally emigrate into the ln parenchyma . after ln entry , lymphocytes interact with dendritic cells in order to scan presented antigen ( gasteiger et al . , 2016 ) , and finally emigrate into efferent lymphatic vessels . for this egress , expression of the sphingosine-1-phosphate - receptor 1 ( s1p1 , encoded by s1pr1 ) on lymphocytes is critical , recognizing the chemoattractant phospholipid sphingosine-1-phosphate ( s1p ) ( matloubian et al . , 2004 ) . s1p concentrations are high in blood and lymph but low in tissues , thus providing a gradient that guides lymphocytes out of the ln and into efferent lymph ( cyster and schwab , 2012 ) . this mechanism is therapeutically exploited for treating multiple sclerosis patients by antagonizing s1p1 function with the drug fty720 ( fingolimod ) to keep autoreactive t cells from exiting lns and entering the central nervous system ( massberg and von andrian , 2006 ) . lymphocyte trafficking into lns is believed to occur in a continuous fashion , and not to be influenced by time - of - day variables . moreover , it is generally unclear whether circadian rhythms regulate overall cellularity in these tissues ( arjona and sarkar , 2005 , esquifino et al . , 1996 , fortier et al . , 2011 , hemmers and rudensky , 2015 ) . circadian rhythms are important drivers for most physiological processes as they align the body with rhythmically occurring daily changes in the environment ( dibner et al . , 2010 ) . they normally rely on an intricate interplay of cell - intrinsic clock genes driving circadian responses ( mohawk et al . , 2012 ) . daily oscillations of lymphocyte counts in blood have been described ( arjona et al . , 2012 , curtis et al . , 2014 , haus and smolensky , 1999 , labrecque and cermakian , 2015 , scheiermann et al . , 2013 ) and cells of the adaptive immune system such as t and b cells , as well as dendritic cells , possess the components of the molecular clock machinery ( bollinger et al . in contrast to monocytes of the innate immune system ( nguyen et al . , 2013 ) , however , the functional relevance of these cell - intrinsic oscillations for lymphocytes is unclear ( hemmers and rudensky , 2015 ) . stimulated by previous findings , which described periodic oscillations in innate immune cell function ( gibbs et al . 2012 ) and t helper-17 ( th17 ) cell differentiation ( yu et al . , 2013 ) , we postulated that the migration of lymphocytes through murine lns might be regulated in a circadian manner with direct relevance for the mounting of adaptive immune responses . in contrast to circulating blood lymphocyte numbers , which peak during the day in mice around zeitgeber time ( zt ) 5 ( i.e. , 5 hr after light onset ) ( figure 1a ) , numbers for cd4 and cd8 t cells as well as b cells showed delayed oscillations ( by 8 hr ) in inguinal lymph nodes ( ilns ) , with highest counts occurring at the beginning of the dark phase ( zt13 , i.e. , 1 hr after lights off ) ( figure 1a ) . these rhythms were consistently observed for naive and central memory t cells , demonstrating a broad phenomenon also affecting t lymphocyte subpopulations ( figures s1a s1c ) . oscillations were not only observed in the rhythmic environment represented by 12 hr light:12 hr dark conditions ( ld ) but were sustained in constant darkness ( dark : dark , dd ) , indicating their bona fide endogenous circadian nature ( figure 1b ) . light exposure was an important entrainment factor , since rhythms were inverted when the light regime was reversed ( dl ) ( figure 1b ) . rhythms were furthermore detected across various types of lns ( figure 1c and figures s1d s1f ) , indicating a relevant phenomenon across the ln compartment . to investigate the underlying mechanisms driving these oscillations , we focused on the cellular ln input and output pathways by blocking lymphocyte homing or egress , both critical determinants of ln cellularity ( lo et al . , dramatically decreased ln cellularity over 24 hr while blocking lymphocyte egress with fty720 increased ln cellularity over the same time frame , confirming the temporally highly dynamic cellular nature of this tissue ( figures 1d and 1e ) . both treatments ablated rhythmicity , indicating that lymphocyte homing and egress but not intranodal proliferation ( figures s1 g and s1h)were the central determinants of circadian oscillatory cellularity . these data demonstrate a striking circadian oscillation in lymph node cellularity , peaking at night onset . we next used adoptive transfer techniques to determine whether lymphocyte homing to the ln was occurring in a rhythmic manner . ln infiltration of lymphocyte subpopulations peaked around night onset and remained low during the day ( figure 2a ) . to define whether oscillations were determined by lymphocyte - intrinsic and/or microenvironmental signals , we adoptively transferred cells harvested at zt5 ( day ) or zt13 ( night ) into ld - entrained recipients at either zt5 or zt13 . ( recipient ) transfers exhibited the lowest homing capacity and night into night transfers the highest , a mixed contribution of both lymphocyte and microenvironment timing was observed in the day into night and night into day chimeras ( figure 2b ) . a screen for oscillations of promigratory factors on t and b cells revealed that expression of the chemokine receptor ccr7 exhibited rhythmicity peaking at zt13 ( figure 2c ) while the adhesion molecules cxcr4 , cd11a , and l - selectin showed either no oscillations or not for all lymphocyte subpopulations ( figures s2a and s2b ) . in addition , expression analyses of whole lymph node mrna and extracellular protein on hevs revealed oscillatory amounts of the chemokine ccl21 , a ligand for ccr7but not cxcl12 ( not shown)being high around night onset ( figures 2d and 2e ) . hevs also exhibited rhythmic expression of icam-1 but not of pnad ( figures s2c and s2d ) . oscillations in lymphocyte chemokine receptors were critical for rhythmic homing because a titrated , short pretreatment of adoptively transferred cells with pertussis toxin ( ptx ) ( lo et al . , 2005 ) , an inhibitor of chemokine receptor signaling , ablated rhythmicity ( figure 2f ) . to investigate the involvement of ccr7 in this process , we analyzed total lymph node cellularity of ccr7-deficient mice , as well as the rhythmic homing capacity of isolated ccr7-deficient cells . ccr7 mice exhibited no oscillations in lymph node cell counts while also exhibiting the expected lower overall numbers ( frster et al . , 1999 ) ( figure 2 g ) . in addition , ccr7 cells failed to show rhythmic lymph node homing ( figure 2h ) . these data demonstrated that lymphocyte recruitment to lns is determined by rhythms in leukocytes and the microenvironment , along with in - phase expression of the ccr7-ccl21 receptor - ligand axis . lns exhibit oscillations of clock genes ( figure 3a ) , prompting us to investigate the role of lymphocyte clocks in their migratory behavior . we generated mice in which the core clock gene bmal1 ( also known as arntl ) was deleted in t cells ( bmal1xcd4-cre ) or b cells ( bmal1xcd19-cre ) ( figure 3b and figures s2e and s2f ) . remarkably , loss of lymphocyte bmal1 ablated the overall rhythmicity of t and b cell numbers in lymph nodes ( figure 3c and figure s2 g ) . in addition , rhythmic homing of bmal1xcd4-cre t cells into wt recipients was ablated ( figure 3d ) . in agreement with these findings , rhythmic expression of ccr7 surface protein ( figure 3e ) and mrna ( figure 3f ) was absent in bmal1-deficient cd4 t cells , indicating the regulation of the molecule at the transcriptional level by the circadian clock . together , these data provide evidence for a functional role of cell - autonomous clocks in lymphocyte migration . because our data indicated that , in addition to a rhythmic homing component , lymphocyte egress might counterbalance ln oscillations ( figures 1d and 1e ) , we quantified lymphocyte numbers in lymph fluid by cannulating efferent lymphatic vessels . prominent rhythms in cellular counts were detected , peaking at zt9 and exhibiting a low at zt21 ( figure 4a ) . these oscillations were observed for different lymphocyte populations ( figure 4a and figures s2h and s2i ) and were bona fide circadian in nature as they persisted in constant darkness ( figure 4b ) . rhythms were not due to higher lymph volume or flow rates at different times of the day ( figure s2j ) . to verify whether oscillations in lymph cellularity were truly attributable to rhythmic egress and not secondary to rhythmic input into lns ( figure 2a ) , we transferred lymphocytes at different times of the day , blocked subsequent ln entry and quantified their transit through the ln into lymph over time ( mandl et al . , 2012 ) . a higher ln retention capacity of cells injected at zt13 was observed compared to zt5 and a less rapid accumulation of cells in lymph ( figures 4c and 4d and figure s3 ) , demonstrating lymphocyte egress to be highly rhythmic . this effect resulted in longer ln half - lives of cells injected at zt13 ( cd4 : 12 hr , cd8 : 12 hr , b cells : 16 hr ) compared to zt5 ( cd4 : 9 hr , cd8 : 9 hr , b cells : 13.5 hr ) ( figures 4c and 4d and figure s3 ) . t- and b cell - specific bmal1-deletion ablated oscillations in lymph , indicating the importance of cell - autonomous clocks also for lymphocyte egress ( figure 4e and data not shown ) . of importance , adoptively transferred bmal1-deficient cd4 t cells exhibited no time - of - day variations in their ln half - life ( figure 4f ) , demonstrating the relevance of t cell clocks in their rhythmic trafficking behavior . using a mathematical approach , we assessed whether oscillatory ln counts could be modeled with only either homing or egress to be rhythmic or whether both components needed to oscillate . although oscillations were also observed when only one component was rhythmic , the best fit was achieved when both homing and egress were assumed to oscillate , thus supporting our experimental data ( figure 4 g and figure s4 ) . in summary , lymphocyte clocks and the time - of - day entry of cells into lns have functional consequences for ln transit and egress into lymph . s1p - receptors are critical in regulating lymph node egress ( cyster and schwab , 2012 ) . we therefore investigated whether expression of s1p - receptor family members exhibited oscillations using quantitative pcr ( q - pcr ) . all s1p receptors exhibited robust diurnal oscillations peaking between zt1 and zt9 ( figure 5a and figure s5a ) , which coincided with high lymphocyte egress . in addition , fty720 , as well as the s1p1-specific functional antagonist sew2871 strongly down - modulated lymphatic egress in a time- and concentration - dependent manner ( figures 5b and 5c and figure s5b ) . the observation that fty720-treated animals exhibited reduced but still rhythmic lymph cellularity indicated a daytime - sensitive role for s1p1 in mediating lymphocyte exit . rhythmic expression of s1pr1 was ablated in bmal1-deficient cd4 t cells , pointing toward a regulation of the gene by the circadian clock ( figure 5d ) . to investigate this in more detail , we performed an in vitro assay , in which the promoter region of s1pr1 was cloned in front of the luciferase ( luc ) reporter gene . luciferase activity in hek293 cells transfected with the s1pr1-luc reporter was decreased after co - transfection of increasing amounts of bmal1 and clock expression plasmids ( figure 5e ) . this demonstrated that expression of s1pr1 is regulated by bmal1 and clock . to confirm the role of s1p1 in the time - of - day - dependent egress genetically , we generated t cell - specific mice that were heterozygous for s1pr1 in order not to completely block lymphocyte egress ( matloubian et al . , 2004 ) but to titrate s1p1 amounts , as loss of one allele had been demonstrated to result in haploinsufficiency ( lo et al . , 2005 ) . s1pr1xcd4-cre mice exhibited no more oscillations in ln counts and altered lymph rhythmicity , demonstrating the importance of s1p1 in the proper timing of lymphocyte egress ( figures 5f and 5 g and figure s5c ) . importantly , no diurnal oscillations were observed in amounts of s1p in efferent lymph ( figure 5h ) or in s1p synthesizing or degrading enzymes in lymph node ( figure s5d ) , suggesting that oscillatory expression of the receptor ( s1p1 ) and not its ligand ( s1p ) was the driver for rhythmic lymphocyte egress . together , these data demonstrate a critical role for s1p1 in mediating circadian lymphocyte egress from lymph nodes into efferent lymph . we hypothesized that oscillatory lymphocyte counts in lns might have functional consequences in a potential time - of - day dependence of adaptive immune responses . we therefore tested whether the activation status of lymphocytes in lns varied over the course of the day . more activated t cells were present in lns at night onset as assessed by cd69 staining , coinciding with higher overall lymphocyte counts at this time ( figure 6a ) . because dendritic cells ( dcs ) are key antigen - presenting cells critical in the activation of lymphocytes and the generation of adaptive immune responses ( girard et al . , 2012 ) , we next investigated whether these cells also exhibited oscillatory ln counts . migratory dc cellularity showed strong oscillations peaking in phase with lymphocytes ( figure 6b and figure s6a ) . these data point to the existence of a concerted circadian migration pattern of antigen - bearing ( dcs ) and antigen - recognizing ( t cells ) cells in lns . recent evidence indicates that the immune system can respond to challenges in a rhythmic fashion ( fortier et al . , 2011 , gibbs et al . , 2014 , nguyen et al . , 2013 , we therefore investigated the pathophysiological significance of circadian oscillatory ln counts in the autoimmunity model of eae . mice immunized during the late light phase ( zt8 , when cell counts are high in lns , figures 1a and 1c ) showed a dramatically accelerated disease progression 2 weeks later , with higher clinical scores compared to late night - immunized animals ( zt20 , when ln counts trough ) ( figure 6c ) . differences in disease scores were associated with higher immune cell infiltration and demyelination in the spinal cord at the peak of the disease ( figures 6d and 6e ) . we detected elevated interleukin-2 ( il2 ) mrna amounts ( figure 6f ) and a higher number of il-17 producing as well as very - late antigen ( vla)-4 integrin positive cd4 t cells in lns of zt8-immunized mice , subtypes that have been shown to be critical for the induction of eae ( kawakami et al . this indicated that circadian regulation of immunization occurred at a very early phase of the process when t cells are activated in draining lymph nodes ( figure s6b ) . two days after induction of eae , an increase of both naive and activated cd4 and cd8 t cells was detected in draining lymph nodes of zt8-immunized animals , while in zt20-immunized animals t cell numbers remained relatively low ( figures 6h6j and figure s6c ) . thus , oscillations in the numbers of cd4 t cells in lymph nodes during initial encounter with antigen appear to be pivotal for the severity of eae . to investigate whether t cell autonomous clocks regulate this response , we genetically deleted t cell circadian clock function . although in control animals disease development depended on the time of immunization , in t cell specific bmal1 mice it did not ( figure 6k ) . two days after immunization , total and t cell counts in draining lymph nodes were different at zt15 between day- and night - immunized control , but not in t cell specific bmal1 mice ( figure 6l and figure s6d ) . hence , t cell clocks determine time - of - day function and , after challenge , development of autoimmune sequelae . mice were infected with the gastric bacterial pathogen helicobacter pylori at three different time points during the day , and lymph node counts were quantified 3 weeks later . also in this chronic infection model , ln counts showed strong circadian responsiveness to the initial infection with highest numbers present at zt7 , analogous to the eae immunization experiments ( figure s6e ) . in addition , acute viral infection with influenza a virus led to stronger pulmonary infiltration of cd8ifn- t cells when animals were infected at zt8 compared to zt20 , 8 days post infection ( figure s6f ) . together , these data strongly indicate that immunization reactions and the adaptive immune responses to various pathogens follow a circadian rhythm ( figure 6 m and movie s1 ) . we have described here the mechanisms that govern a circadian rhythmicity in the capacity of lymphocytes to enter and exit lymph nodes , which depend on cell - autonomous , clock - gene - controlled expression of promigratory factors . lymphocytes entered lns most prominently at the onset of the night phase and egressed from the tissue during the day . this resulted in oscillatory cell counts in lymph nodes and lymph and time - of - day differences in the adaptive immune response weeks after immunization . in addition , dcs were found to be present in ln in highest numbers around night onset , peaking in phase with the lymphocyte populations . our data reveal that t cell - autonomous circadian oscillations are critical in regulating adaptive immunity . it is surprising to note that lymph nodes exhibit circadian differences in their cellularity , given that they represent such a central tissue of the immune system and , accordingly , have thus been intensely studied . since we observed oscillations in all investigated lymph nodes , the phenomenon appears to be broad and robust and not restricted to specific body locations . it is noteworthy that other lymphoid organs such as the thymus ( data not shown ) and the bone marrow do not exhibit overt circadian oscillations in absolute numbers . at least the latter , however , still displays circadian activity in cellular trafficking as hematopoietic stem and progenitor cells ( hspcs ) are mobilized into blood ( lucas et al . 2008 ) and recruited back into the bone marrow ( scheiermann et al . , 2012 ) at different times . the fraction of mobilized and homed cells might be small compared with the overall numbers , though , which might explain why overt oscillations of total cells in the bm are not observed . in contrast to the bm , lymph node total cellularity is highly dynamic over 24 hr , as seen when homing or egress is blocked . still , homing of leukocytes to lymph nodes and bone marrow occurs predominantly at night , while egress ( or mobilization in the case of the bone marrow ) occurs predominantly during the day . thus , rhythmic egress of lymphocytes via efferent lymph is a major mechanism underlying the oscillatory leukocyte numbers in blood . whether other egress routes for lymphocytes , from the thymus or the spleen , occur in a circadian manner is currently unclear . our data point to a critical role of cell - intrinsic clock - dependent mechanisms in the regulation of t and b lymphocyte trafficking . while global bmal1 deficiency results in a diverse array of phenotypes ( bunger et al . , 2000 ) , such as altered b cell numbers ( sun et al . , 2006 ) , few studies have focused on cell - type specific deletion of bmal1 in the immune system . lineage - specific ablation of bmal1 in myeloid cells results in a pro - inflammatory state ( nguyen et al . , 2013 ) , yet a similar approach targeting lymphocytes yielded no obvious phenotype ( hemmers and rudensky , 2015 ) . the latter finding might be due to mice with clock - deficient lymphocytes exhibiting phenotypes only at specific times , so that only when tested over multiple time points across the day can alterations be detected . our data showing that lack of bmal1 in t cells ablated oscillations in eae disease scores indicates an important role for t cell clocks in the adaptive immune response . this is in line with a previous observation that t cells harvested from clock mutant mice exhibited altered proliferation responses at specific times ( fortier et al . we demonstrated the critical regulators of lymphocyte trafficking , ccr7 and s1pr1 , to be under circadian control . ccr7 and s1pr1 oscillations showed opposite phases , being high in the evening for the former and high during the day for the latter . this agrees with the additional role of ccr7 as a retention factor for t cells in lymph nodes that can antagonize s1p1 function ( pham et al . in addition , more t cells expressed the activation marker cd69 at night onset , a negative regulator of s1p1 ( shiow et al . , 2006 ) . these inverted oscillations of retention and egress factors appeared to be responsible for keeping lymphocytes retained in the node at night and promoting daytime egress . in addition to these lymphocyte intrinsic signals , the microenvironmental fluctuation of ccl21 indicated an additional rhythmic component that was non cell - autonomous . whether direct autonomic innervation governs these oscillations as has been shown for the bone marrow and skeletal muscle ( mndez - ferrer et al . , 2008 , scheiermann et al . , 2012)and / or humoral factors as has been shown for the lung ( gibbs et al . , 2014 ) , is outside the scope of this manuscript and should be investigated in the future . lymph nodes act as the body s immunological sieve , capturing lymph - borne antigens and antigen - presenting cells ( apcs ) and bringing these components in close contact with lymphocytes . our data show that not only t cells migrate to the lymph node in a circadian manner but that also dendritic cells , the major apcs , are present more prominently around night onset , peaking at the same time as lymphocytes . both cell types need to interact to produce a functional adaptive immune response ( gasteiger et al . , 2016 ) . it therefore appears likely that having them present at the same time in the confined environment of the lymph node enhances the likelihood of antigen encounter by the very few specific t cell clones , as opposed to cells entering and exiting at random times . this process of more effective cellular interactions appears to be further helped by the fact that during the night fewer cells exit the tissue than during the day , thus giving apc - t cell pairs more time to interact functionally . whether also antigen encounter with apcs at peripheral surfaces is occurring in a rhythmic manner , which could ultimately be driving a circadian migratory dc process , should be the subject of future investigations . compared to the immediate response of the innate immune system , which is under circadian control ( gibbs et al . , 2014 , keller et al . , 2009 , nguyen et al . , 2013 , scheiermann et al . , 2012 ) , it is remarkable that also the adaptive immune system appears to be temporally regulated , because these responses take much longer to be mounted . how can the time - of - day dependent differences encountered during the initial stimulus be preserved to exhibit circadian gating of immune responses weeks later ? it appears that the initial hours in the generation of the adaptive immune response and the number of cells present in the lymph node are critical in regulating the strength of the response ( moon et al . , 2007 ) , which can not be compensated for by the next circadian cycle . in steady state , critical factors of the immune system oscillate in mice and humans with opposite phases according to their inverted rest - activity times ( arjona et al . , 2012 , curtis et al . , 2014 , labrecque and cermakian , 2015 , scheiermann et al . , circulating leukocyte counts are high during the respective resting phases , which occur during the day in mice and at night in humans . in addition , also under stimulated conditions timing matters , as administration of granulocyte colony - stimulating factor ( g - csf ) to patients in order to mobilize hematopoietic stem cells from bone marrow into blood yields higher numbers at different times than in mice ( lucas et al . , 2008 ) . these data suggest that also adaptive immune responses in humans could be under circadian control . since in our eae model , immunization close to the onset of the activity phase produced a higher immune response in mice , in humans the early morning hours should produce a higher adaptive immune reactivity . indeed , this appears to be the case as recent studies have unveiled that administration of hepatitis a ( phillips et al . , 2008 ) and flu vaccines ( long et al . , together , our data provide mechanistic insights for a time - of - day difference in lymphocyte trafficking and adaptive immune responses , thus warranting further investigations into time - of - day optimization of immune therapies and vaccination programs . cd4cre , lckcre , cd19cre , bmal1 , and s1pr1 mice were obtained from jackson laboratories and crossbred to target t cells and b cells , respectively . 7- to 8-week - old wild - type c57bl/6 mice were purchased from charles river and janvier . mice were housed under a 12 hr:12 hr light - dark cycle with food and water ad libitum . to induce changes in light regime , we placed mice in a light cycler ( park bioservices ) with a 12 hr - inverted light cycle for a minimum of 2 weeks to completely establish an inverse light cycle or kept in constant darkness . all animal experimental procedures were carried out in accordance with the german law of animal welfare and approved by the regierung of oberbayern or the ethics committee of the schleswig - holstein state ministry of energy , agriculture , environment and rural areas . counts were obtained using an idexx procyte dx cell counter or a hemavet hematology analyzer 950fs ( drew scientific ) . spleens , lymph nodes , or thymi were harvested from animals and processed through a cell strainer ( 4070 m pore size ) and resuspended in pbs . for quantification of dendritic cells , lymph nodes were first chopped into small pieces and incubated in collagenase iv ( 1 mg / ml , c5138 , sigma ) and dnase i ( 0.2 mg / ml , roche ) for 30 min at 37c with gentle agitation . following digestion , cells were passed through a 40 m strainer and resuspended in pbs supplemented with 2% fetal bovine serum ( gibco ) . a 20 min blocking step using anti - cd16/32 antibody ( 2.4g2 ; bd biosciences ) single - cell suspensions were stained with fluorescence - conjugated antibodies and analyzed by flow cytometry using a gallios flow cytometer ( beckman coulter ) or a facscanto ii flow cytometer ( bd biosciences ) . prior to staining of intracellular cytokines , cells were restimulated for 5 hr with pma and ionomycine ( cell stimulation cocktail with protein transport inhibitors , ebioscience ) . lymphocytes from spleen and peripheral lymph nodes ( ratio 80:20 ) were labeled with 1.5 m of carboxyfluorescein succinimidyl ester ( cfse , thermo fisher scientific ) or 2.5 m celltracker red cmtpx ( thermo fisher scientific ) in pbs containing 0.2% bsa and 2 mm edta for 20 min at 37c and washed 4 times . 20 10 cells were then injected i.v . into recipient mice . in some experiments , lymph node entry was blocked two and 12 hr later by intraperitoneal ( i.p . ) administration of 100 g anti-l ( cd11a , clone m17/4 ; bioxcell ) and anti-4 ( cd49d , clone ps/2 ; bioxcell ) integrin antibodies in pbs . in some experiments , cells were pre - incubated with a 200 ng / ml pertussis toxin ( ptx ) pulse of 10 min at 37c and washed 4 times before injection together with control - treated cells ( lo et al . , 2005 ) . the subsets of adoptively transferred cells in the recipient mice were analyzed via flow cytometry . the s1pr1-gaussia luciferase ( s1pr1-gluc ) gluc - on promoter clone containing a 1 kb fragment upstream of the transcription start site and a 0.3 kb fragment of the exon 1 of murine s1pr1 in pezx - pg04 vector ( also containing a constitutively expressed secreted alkaline phosphatase ( seap ) secondary reporter as an internal control ) was obtained from genecopoeia . hek293aav cells ( cellbiolabs ) were plated onto 96-well plates and maintained in dmem with 2 mm stable glutamine supplemented with 10% fetal bovine serum ( fbs ) and 10,000 u penicillin / streptomycin at 37c with 5% co2 . upon 80%90% confluence , cells were transfected with the following expression plasmids : 20 ng s1pr1-luc with various combinations of the following clock gene constructs : ha - clock , ha - bmal1 , and pcdna3.1 ( mock transfection ) as indicated per well using lipofectamine 3000 transfection reagent ( thermo fisher scientific ) according to the manufacturer s protocol . medium was changed once on the next day and was collected for measurement 48 hr after transfection . the secreted gluc and seap activities were measured with the secrete - pair dual luminescence assay kit ( genecopoeia ) according to the manufacturer s protocol using the berthold tristar lb 941 plate reader ( berthold technologies ) . 40 min prior to cannulation , 200 l olive oil was administered intragastrally to identify mesenteric lymph vessels that are located just upstream of the thoracic duct . mice were anesthetized ( 100 mg / kg ketamine , 20 mg / kg xylazine , 1% acepromazin i.p . ) , vessels were cannulated and lymph was drawn via a fine bore polythene tubing ( smiths medical ) that had previously been flushed with pbs containing edta . in some experiments , mice were injected i.p . with 1 mg / kg ( or less ) of fty720 or 10 harvested lymph nodes were embedded in oct ( tissuetec ) , frozen and sectioned with a thickness of 10 m on a cryostat ( leica ) . sections were fixed in methanol or left unfixed , incubated with fluorescently coupled antibodies and imaged on an axio examiner.d1 microscope ( zeiss ) equipped with leds of 405 nm , 488 nm , 561 nm , and 642 nm excitation wavelengths or equipped with a 4-color laser stack and a confocal spinning - disk head ( intelligent imaging innovations ) . for investigations of protein expression in hevs , all quantifications were performed using mask analysis ( zeiss software ) based on pecam-1 expression and quantifying expression of other fluorescent channels within the mask containing pecam+-pixels delineating hev vascular structures as previously detailed ( scheiermann et al . , 2012 ) . for eae induction the mog35 - 55-cfa emulsion ptx kit ( ek-2110 , hooke labs ) was used according to the manufacturer s protocol . mice were anesthetized ( 100 mg / kg ketamine and 10 mg / kg xylazine i.p . ) and bilaterally s.c . injected with 200 g myelin oligodendrocyte glycoprotein ( mog ) 3555 in 200 l complete freund s adjuvant ( cfa ) at the indicated time points , followed by two i.p . injections of 200 ng pertussis toxin ( ptx ) in phosphate buffered saline ( pbs ) , immediately after immunization and 24 hr later . from day 8 on , paralysis was assessed using the clinical scoring system : 0 , no obvious signs of disease ; 0.5 , distal paralysis of the tail ; 1 , complete tail paralysis ; 1.5 , mild paresis of one or both hind legs ; 2 , severe paresis of both hind legs ; 2.5 , complete paralysis of one hind leg ; 3 , complete paralysis of both hind legs ; 3.5 , complete paralysis of hind legs and paresis of one front leg . animals with scores of 2 and up were provided access to food and water on the bottom of the cage . cd4 t cells for q - pcr analysis were purified from lymph nodes of c57bl/6 wt , s1pr1xcd4-cre , bmal1xcd4-cre or littermate control mice using the easysep mouse cd4 t cell enrichment kit ( stemcell technologies ) . b220 b cells for western blot analysis were purified from spleens of bmal1xcd19-cre or littermate control mice using the easysep mouse b cell enrichment kit ( stemcell technologies ) . the pan t cell isolation kit ( miltenyi biotec ) was used to purify total t cells from mouse splenocytes . splenocytes were labeled with a mixture of biotin - conjugated monoclonal antibodies directed against cells other than t cells and followed by conjugate binding with anti - biotin microbeads . magnetically labeled non - t cells were depleted with automacs ( miltenyi biotec ) and the negative fraction was collected , yielding an average 90% purity of ( cd3 ) t cells . comparisons between two samples were performed using the paired and unpaired student s t tests or mann - whitney test . one - way anova analyses followed by tukey s multiple comparison test , two - way anova analyses followed by bonferroni s post hoc test were used for multiple group comparisons . statistical significance was assessed as p < 0.05 , p < 0.01 , p < 0.001 , and p < 0.0001 . d.d . and o.m . designed and performed experiments , analyzed results , and wrote the manuscript ; l.i . , performed experiments and provided valuable inputs on the manuscript ; c. schmal and h.h . performed modeling analyses ; b.k . provided access to mass spectrometers ; w.s . and h.o . designed and supervised experiments , discussed data , and wrote the manuscript ; c. scheiermann conceived and supervised the study , designed and performed experiments , discussed data , and wrote the manuscript .

high rates of infection of target cells with two or more retroviral vectors are often required to achieve a desired biological outcome . in particular , the production of induced pluripotent stem ( ips ) cells requires a high rate of coinfection in order to obtain a sufficient fraction of cells that express all four reprogramming factors , oct4 , sox2 , klf4 , and c - myc [ 1 , 2 ] . methods are needed to ensure that high coinfection rates are reliably achieved . when introducing reprogramming genes into human fibroblasts , yamanaka 's group used a complex strategy to increase coinfection to a rate sufficient for reprogramming . they first introduced the ecotropic retrovirus receptor into the target human cells using a lentiviral vector , and then infected the cells with retroviruses produced in the ecotropic plat - e packaging cell line . plat - e and plat - a cells are retrovirus packaging cell lines derived from the 293 t cell line . while other packaging cell lines used viral ltrs for expression of viral structural genes , plat - e and plat - a cells utilize the potent ef1 promoter in combination with a kozak consensus sequence upstream of the initiation codon , resulting in high expression of viral structural proteins . however , the plat - a cell line , used for amphotropic pseudotyping , produces a titer of only about one - tenth that of the ecotropic packaging cell line plat - e . titers from other amphotropic retrovirus packaging cell lines derived from 293 t , such as phoenix - ampho , are similar . consistent with a lower rate of vector production by plat - a than by plat - e cells , yamanaka 's group showed that human fibroblasts infected with vector from plat - e cells following introduction of the ecotropic retrovirus receptor were transduced at ~3 times the rate of fibroblasts infected with vector from plat - a cells . in experiments involving coinfection to achieve cellular reprogramming unconcentrated retroviruses have been used . generally , unconcentrated preparations produced by amphotropic packaging cells are sufficient for the introduction of single genes into cells . however , higher levels of vector are needed for efficient coinfection with two or more retroviruses . there has been little work on optimizing conditions for coinfection with amphotropic or ecotropic retroviral vectors . although it may be assumed that any improvement in the rate of infection will increase the rate of coinfection , this has rarely been tested . we hypothesized that the use of optimized protocols could result in much higher coinfection rates by amphotropic retroviral vectors produced by packaging cell lines like plat - a . strategies for increasing the amount of amphotropic or ecotropic vector that can be delivered to target cells include ( a ) increasing vector production rates by the packaging cells , ( b ) concentrating the vector , and ( c ) increasing the rate or level of attachment of vector to the target cells . amphotropic retroviruses can be concentrated by centrifugation , although some loss of titer may be encountered [ 7 , 8 ] . retroviruses pseudotyped with vesicular stomatis virus g ( vsv - g ) protein can readily be concentrated by centrifugation , but preparation of this type of vector typically requires cotransfection of 293 t cells with multiple plasmids . a convenient and efficient method for concentrating amphotropic retroviral vectors was introduced recently ; this comprises flocculation of the vector with high concentrations of polymers such as polybrene followed by a brief centrifugation [ 10 , 11 ] . this process also separates active viral particles from inactive particles that can compete for receptors on target cells . polymers , usually polybrene , are also used in standard infection protocols to increase attachment of viral vectors to target cells . this is particularly effective in established cell lines in combination with low - speed centrifugation of the vector onto the surface of the target cells , a process termed spinoculation or spin - infection [ 8 , 14 ] . the two processes should be complementary : separation of the vector from the bulk medium by polybrene flocculation can be followed by resuspension of the vector in culture medium and optimized infection of the target cells by spinoculation . in the present experiments we tested whether amphotropic retroviral vectors can be concentrated and efficiently delivered to target cells ( primary human fibroblasts and 3t3 cells ) by spinoculation . coinfection rates were determined by the use of retroviral vectors encoding two different fluorescent proteins , egfp and dsred2 . we found that the combination of flocculation by polybrene together with delivery of the precipitated retrovirus - polybrene complex to target cells by spinoculation raised the coinfection rate by > 10-fold over that observed using maximal volumes of unconcentrated viral vector . plat - a amphotropic retrovirus packaging cells were obtained from cell biolabs ( san diego , calif , usa ) . newborn human skin fibroblasts ( crl-2703 , also termed ccd-1137sk ) and swiss mouse 3t3 cells were obtained from the american type culture collection , manassas , va , usa . cells were cultured in dulbecco 's modified eagle 's medium supplemented with 10% cosmic calf serum ( hyclone laboratories , logan , utah , usa ) , 0.1 mg / ml penicillin and 0.05 mg / ml gentamicin ( referred to here as complete culture medium ) . plat - a cells were grown in medium that also contained 10 g / ml blasticidin and 1 g / ml puromycin . a retroviral vector encoding egfp ( plegfp - n1 ) was obtained from clontech , palo alto , calif , usa . a retroviral vector encoding the red fluorescent protein dsred2 was derived by cloning the dsred2 coding region ( clontech ) downstream of the ltr in plasmid pmxs to form pmxs - dsred2 . plat - a cells were plated at 2 10 per 6-cm dish ( poly - l - lysine coated ; bd biosciences ) . the following day , the culture medium was replaced with fresh medium containing 25 m chloroquine and 10 mm sodium butyrate . immediately following this , cells were transfected with 10 g retroviral plasmid dna using the calcium phosphate precipitation procedure . after 16 hours the medium after 24 hours the vector - containing medium was removed and filtered through a 0.45 m syringe filter . a second 24 hour medium collection was also used for infections . for each experiment , a single pool of egfp vector ( green vector ) from the plat - acells was combined with a single pool of dsred2 vector ( red vector ) . we investigated whether the titers of the green and red vectors used were equivalent when tested on target cells , phf or 3t3 . in each experiment crl-2703 cells or 3t3 cells were plated in 6-well plates ( bd biosciences ) ( ~10 cells per well ) . infection was begun when cells were dividing maximally at ~6070% confluence . viral vector - containing medium ( 3.5 ml egfp vector plus 3.5 ml dsred2 vector ) was added to cells with the addition of 8 g / ml polybrene [ hexadimethrine bromide ( sigma ) , usually referred to by the trademarked name polybrene ] . the next day cells were infected a second time using the same procedure . following this , cells were grown in regular complete medium . for spinoculation , vector - containing medium ( 3.5 ml egfp vector plus 3.5 ml dsred2 vector ) was added to the target cells with addition of polybrene . plates were wrapped in parafilm to minimize ph changes resulting from loss of co2from the medium . plates were transferred to a plate carrier and centrifuged using a beckman js-4.3 swinging bucket rotor for 2 hours at different temperatures and speeds ( see section 3 ) . subsequently , either 50% of the medium was replaced with fresh medium after 2 hours , or 100% was replaced after 4 hours ( see section 3 ) . equal volumes of medium containing egfp and dsred2 vectors , of approximately equal titers , were mixed and centrifuged at 10000 g for 3 hours at 4c [ 7 , 8 ] . volumes of vector - containing medium used were equal to those from either 3 or 16 plates of egfp- and dsred2-transfected plat - a cells ( see section 3 ) . the pellet ( usually not visible ) was resuspended in 7 ml complete culture medium and added to target cells with polybrene . the following day , medium was changed with addition of the same amount of concentrated vector . following this , polybrene ( 320 g / ml ) was added to vector - containing medium of a volume equal to that from 16 plates of egfp- and dsred2-transfected plat - a cells . the medium was incubated at 37c for 20 minutes followed by centrifugation at 10,000 g for 10 minutes at 4c . the pellets were combined into complete culture medium to a final volume of 7 ml which was added to the target cells . the following day , medium was changed with addition of the same amount of concentrated vector . following this , cells were grown in regular complete medium . for the combination of concentrating the vector together with spinoculation , viral pellets were resuspended in 7 ml complete culture medium for transfer to target cells , which were subjected to the spinoculation procedure described above ( 1200 g at 15c for 2 hours ) . the two retroviral vectors used encode fluorescent proteins , egfp and dsred2 , enabling detection of transduced cells by fluorescence microscopy . at 4 days following infection , photographs of random fields of cells three images were obtained for each cell field : a phase - contrast image , a red image and a green image ( the latter two images are gray - scale images obtained using appropriate specific filters for egfp and dsred2 ) . each cell that was scored as positive in the red image was located on the phase - contrast image and marked as such . this results in two copies of the phase - contrast image , one with green cells marked and the other with red cells marked . we then made three totals , those cells that are red but not green , those that are green but not red , and those that are both red and green . the percentage coinfection were determined as [ number of cells that are both green and red]/[number of cells that are either green or red ] 100 . in coinfection experiments , statistical analysis was carried out by one - way anova and post hoc analysis by the neuman - keuls multiple comparison test ( prism software , graphpad software , san diego , calif , usa ) . we tested whether spinoculation is a suitable procedure for increasing infection of phf by amphotropic pseudotyped retrovirus produced by plat - a cells . in preliminary tests using literature protocols we found that low - speed centrifugation at 25c or above was detrimental to phf cell viability . we tested spinoculation at lower temperatures and found that infection was increased by ~5-fold when cells were centrifuged at 1200 g for 2 hours at 15c , whereas it was increased ~4-fold at 10c . because of the apparent susceptility of phf to damage by spinoculation at room temperature , we also investigated whether a lower speed ( 600 g ) might be more effective than conventional speeds ( 1200 g ) . we found that spinoculation at 600 g for 2 hours at 15c increased infection ( ~3-fold over no spinoculation control ) but was less effective than higher speeds . additionally , we found that 1200 g , 2400 g and 4200 g ( 2 hours at 15c in each case ) produced similar increases over the no spinoculation control . in figure 1 , we show an example of the increase in infection in phf when spinoculation was used at 600 g and 2400 g. we decided to use 1200 g , 15c as a standard protocol because speeds > 1200 g gave results similar to 1200 g , and thus it was unnecessary to use higher speeds . in repeated experiments , spinoculation of phf at 1200 g for 2 hours at 15c resulted in increases in infection in the range of 5- to 10-fold . having confirmed that spinoculation is a suitable method for infecting phf with vector produced by plat - a cells , we then combined optimized spinoculation with vector concentration . because our aim was to improve coinfection , we measured coinfection rates for unconcentrated vector , spinoculation , vector concentrated by ultracentrifugation or polybrene flocculation , and the combination of spinoculation and concentration . to measure coinfection rates , cells were infected with a 1 : 1 mixture of retroviruses encoding green ( egfp ) and red ( dsred2 ) fluorescent proteins of approximately equal titers . representative fields of infected cells are shown in figure 2 . merged green and red images it was noticeable that relatively few cells were coinfected with unconcentrated vector , despite the fact that there were many cells that had been infected with either the green or the red vector . images of cells infected by spinoculation or with vector concentrated by polybrene flocculation show greater numbers of coinfected cells . however , the combination of concentration and spinoculation produced an obvious and dramatic increase in coinfection rates ( figure 2 ) . using a protocol described in detail in section 2 , the increase in coinfection rates with spinoculation and concentration was assessed as the number of cells that are both green and red as a percentage of the cells that are either green or red ( i.e. , coinfected cells as a percentage of infected cells ) . these values varied from a low of ~4% for unconcentrated vector to > 50% for the combination of concentration by polybrene flocculation and spinoculation ( figure 3 ) . we confirmed , as found by others , that concentrating amphotropic retroviruses by centrifugation is feasible . when a single retroviral vector was used , concentrating the vector from medium equivalent to that from 3 or 16 plat - a plates resulted in approximately the expected increase in infection of target cells ( either hdf or 3t3 ) . when we tested coinfection , vector that had been concentrated from a volume of medium equivalent to that from 3 plates of green vector and 3 plates of red vector resulted in a small increase in coinfection over unconcentrated vector , while concentrating vector from 16 sets of plates increased coinfection to ~25% . we found comparable values for coinfection using vector concentrated by centrifugation alone ( 10,000 g for 3 hours ) and for vector concentrated by polybrene flocculation . because polybrene flocculation is much faster ( ~30 minutes versus 3 hours ) this method is preferable . when polybrene flocculation was combined with spinoculation , this was a significant increase over either concentration alone or spinoculation alone . to determine whether the results in phf were reproducible in another cell type , the effects of spinoculation and polybrene flocculation were tested on coinfection rates in swiss mouse 3t3 cells . both spinoculation and polybrene flocculation resulted in increased coinfection , while the combination of polybrene flocculation and spinoculation resulted in a coinfection rate of 35% . while high rates of coinfection are needed for efficient delivery of genes to target cells , for example for ips cell production , few studies have been performed with the aim of improving coinfection rates with retroviral vectors . here we combined two protocols , spinoculation and concentration , with the result that coinfection of hdf improved from ~4% to > 50% . concentration of amphotropic retroviral vectors can be performed by 10,000 g centrifugation or by polybrene flocculation , but the latter is preferred because of its rapidity . in these experiments we investigated coinfection by a mixture of two viral vectors . as the number of different types of retroviral vectors in a mixture increases , cells that have been infected with all the viral types in the mixture become increasingly infrequent , thus emphasizing the necessity for optimizing coinfection conditions . in the context of human ips cell generation , coinfection rates for viruses encoding the four reprogramming factors were not measured . yamanaka 's group reported a rate of human ips cell generation of 10 colonies per 50,000 starting cells together with 100 non - ips - like colonies ; when c - myc was omitted , far fewer non - ips - like colonies were generated , and 0 - 5 ips colonies arose from a population of 500,000 cells . the importance of a high rate of coinfection was also shown recently by another group , who initially reported that four reprogramming factors were insufficient for ips cell generation from adult human fibroblasts . when a sufficiently high retroviral multiplicity of infection was employed , the other factors were not needed . another consideration is that it may be necessary to achieve infection rates high enough not only to deliver four reprogramming factors efficiently but also to produce multiple integrations of each viral genome in target cells [ 1 , 2 , 1922 ] . this is unlikely to represent a requirement for insertional mutagenesis ; probably , only cells with multiple integrations achieve levels of expression of the reprogramming factors that are high enough for ips cell generation . recent results show that ips cell generation is possible with one or two transcription factors in combination with small molecules that induce reprogramming . for the immediate future , generation of ips cells may use combinations of viral methods , which require high efficiency coinfection , together with other innovative techniques . the application of the relatively simple methods described here to increase coinfection should be useful for ips cell generation and for other experiments in which high coinfection rates are required .

bsis can be primary or secondary bsi , based on the source of origin . primary / intravascular bsi originates from the cardiovascular system itself ; while , some other infectious focus in the body gives rise to the secondary / extra vascular bsi . coagulase negative staphylococcus ( cons ) and staphylococcus aureus are the most commonly isolated gram positive bacteria from blood culture samples . s. aureus is a major cause of bsis , both in the hospital and the community setting . the case fatality ( cf ) associated with s. aureus bacteremia ( sab ) remains high , ranging from 7% to 39% . studies have found gram positive organisms to be the major contributors of bsis . in the past few decades cons are present on skin as commensal flora , therefore presence of cons in blood is usually considered to be due to blood culture contamination , especially if a single culture is positive . recent studies have challenged this hypothesis and tried to establish the significance of single blood culture positive for cons . therefore , we conducted this study to ascertain the clinical significance of staphylococcal bacteremia , especially with respect to the associated mortality . our objective was to ascertain the clinical significance of cons bacteremia and compare its clinical profile and outcome with bacteremia caused by s. aureus , in a setting of trauma patients . we hypothesized that in severely traumatized patients , on multiple life support devices , the significance of bacteremia due to s. aureus or cons would be low , in terms of attributable mortality . since all medico - legal trauma patients are subjected to autopsy , we tried to evaluate the contribution of bsi due to s. aureus / cons to a fatal outcome in such patients . the study was conducted at the jpna trauma center , which is the first level-1 trauma center of india , where patients from all over india are referred . the trauma center is a part of the aiims hospital , which itself is a 2,200 bedded , tertiary , referral and teaching hospital of india . of the total 152 beds in the trauma center , 32 are icu beds . a total of 6 nurses function as full time hospital infection control nurses ( hicns ) . we have initiated a targeted surveillance of device associated infections ( vap , cr - bsi , ca - uti ) and clinical sepsis , based on the definitions proposed by cdc 's nhsn . all patients whose blood samples yielded s. aureus or cons were included in the study . in addition , each isolate was identified by the vitek 2 system using the gp - id cards . the data was separately analyzed for patients with blood culture positive for staphylococcus aureus isolates and cons presenting with / without clinical signs or symptoms of septicemia . the aim of this study was to determine the mortality associated with staphylococcus bacteremia and to determine the clinical significance of single blood culture positive for cons . we also looked at the methicillin resistance profile and mortality associated with these bsi and tried to determine the probable cause of death . the antimicrobial susceptibility of bacterial isolates was done by the disc diffusion method according to the clsi guidelines . staphylococcus aureus atcc 25923 , escherichia coli atcc 25922 and pseudomonas aeruginosa atcc 27853 were taken as control strains . for gram positive cocci , the following antibiotics were tested : ampicillin ( 10 g ) , vancomycin ( 30 g ) , clindamycin ( 2 g ) , erythromycin ( 15 g ) , linezolid ( 30 g ) , tetracycline ( 30 g ) , teichoplanin ( 30 g ) , amplicillin / sulbactam ( 10/10 g ) , penicillin ( 10 units ) , rifampicin ( 5 g ) , amoxicillin / clavulinic acid ( 20/10 g ) , amikacin ( 30 g ) , netilmicin ( 30 g ) , gentamycin ( 30 g ) , ciprofloxacin ( 5 g ) , co - trimoxazole ( 25 g ) , cefoxitin ( 30 g ) , levofloxacin ( 5 g ) and oxacillin ( 1 g ) . the interpretative zone diameters used were as per clsi recommendations . apart from this , the minimum inhibitory concentrations ( mics ) were determined for all bacteria and candida isolates by the vitek 2 system ( using ast gp / gn / yst cards ) . bsi was defined as per cdc 's definition . the definition of primary and secondary bsi was defined as per standard definition . for each positive culture , an intensive effort was made to trace the source of infection . since tracheal aspirate and urine samples moreover , an intensive surveillance for vap , uti and ssi is done at our center . all trauma victims who had medico - legal causes of trauma and had fatal outcome are subjected to autopsy . thus , for all the patients in our series whose autopsy was done , the clinical and autopsy cause of death was recorded . for all other fatal cases , the attributable cause of death due to staphylococcal bacteremia was ascertained by noting the cause of death , the time interval between a positive culture and fatal outcome and other associated infections like vap , wound infections , meningitis etc . the study was conducted at the jpna trauma center , which is the first level-1 trauma center of india , where patients from all over india are referred . the trauma center is a part of the aiims hospital , which itself is a 2,200 bedded , tertiary , referral and teaching hospital of india . of the total 152 beds in the trauma center , 32 are icu beds . a total of 6 nurses function as full time hospital infection control nurses ( hicns ) . we have initiated a targeted surveillance of device associated infections ( vap , cr - bsi , ca - uti ) and clinical sepsis , based on the definitions proposed by cdc 's nhsn . all patients whose blood samples yielded s. aureus or cons were included in the study . in addition , each isolate was identified by the vitek 2 system using the gp - id cards . the data was separately analyzed for patients with blood culture positive for staphylococcus aureus isolates and cons presenting with / without clinical signs or symptoms of septicemia . the aim of this study was to determine the mortality associated with staphylococcus bacteremia and to determine the clinical significance of single blood culture positive for cons . we also looked at the methicillin resistance profile and mortality associated with these bsi and tried to determine the probable cause of death . the antimicrobial susceptibility of bacterial isolates was done by the disc diffusion method according to the clsi guidelines . staphylococcus aureus atcc 25923 , escherichia coli atcc 25922 and pseudomonas aeruginosa atcc 27853 were taken as control strains . for gram positive cocci , the following antibiotics were tested : ampicillin ( 10 g ) , vancomycin ( 30 g ) , clindamycin ( 2 g ) , erythromycin ( 15 g ) , linezolid ( 30 g ) , tetracycline ( 30 g ) , teichoplanin ( 30 g ) , amplicillin / sulbactam ( 10/10 g ) , penicillin ( 10 units ) , rifampicin ( 5 g ) , amoxicillin / clavulinic acid ( 20/10 g ) , amikacin ( 30 g ) , netilmicin ( 30 g ) , gentamycin ( 30 g ) , ciprofloxacin ( 5 g ) , co - trimoxazole ( 25 g ) , cefoxitin ( 30 g ) , levofloxacin ( 5 g ) and oxacillin ( 1 g ) . the interpretative zone diameters used were as per clsi recommendations . apart from this , the minimum inhibitory concentrations ( mics ) were determined for all bacteria and candida isolates by the vitek 2 system ( using ast gp / gn / yst cards ) . the definition of primary and secondary bsi was defined as per standard definition . for each positive culture moreover , an intensive surveillance for vap , uti and ssi is done at our center . all trauma victims who had medico - legal causes of trauma and had fatal outcome are subjected to autopsy . thus , for all the patients in our series whose autopsy was done , the clinical and autopsy cause of death was recorded . for all other fatal cases , only the clinical cause of death was recorded . the attributable cause of death due to staphylococcal bacteremia was ascertained by noting the cause of death , the time interval between a positive culture and fatal outcome and other associated infections like vap , wound infections , meningitis etc . during this 30 month period , a total of 10,509 blood samples were received from 2,938 patients . a total of 1,961 samples taken from 905 patients were positive for one or more pathogens . overall , 53% of isolates were s. aureus ( 248/469 ) ; cons ( 221/469 ) contributed for the remaining 47% . a total of 51 of 76 ( 67% ) of deaths were due to septicemia as determined on autopsy . however , in our opinion , in 38 of these 51 ( 75% ) patients , staphylococcal bsi alone can not be associated with these deaths due to various confounding factors like prolonged time gap between culture positivity and death and presence of other concomitant ante - mortem infections like vap , meningitis or abdominal sepsis . therefore , in our opinion only 17% ( 13/76 ) deaths were attributable to staphylococcal septicemia [ tables 1 - 3 ] . demographic profile of patients with staphylococcal bsi cause of death in our patient population resistance profile of all staphylococcal isolates a total of 248 blood culture samples from 181 patients were positive for s. aureus . of these , 7 had s. aureus isolated from infected wounds and one had vap , with tracheal aspirate positive for s. aureus . a total of 146 ( 59% ) of the s. aureus isolates recovered from 185 episodes were methicillin resistant . of the 181 patients who had s. aureus bacteremia , 52 of them ( 29% ) had a fatal outcome . autopsy was performed in 43 patients to determine the cause of death , where 12 ( 28% ) were found to have died due to septicemia . a total of 22 cultures yielded cons . however , only 22 episodes of clinically significant cons bacteremia were seen in 22 patients . of the 22 patients who had cons bacteremia , 3 ( 14% ) had a fatal outcome . the same organism was isolated from central venous catheter in two and from peripheral venous catheter in one patient . a total of 173 blood cultures from 171 patients were considered to be clinically insignificant based on our defining criteria . autopsy findings revealed that only one of these 31 deaths ( 3% ) was related to septicemia . staphylococcal blood stream infections are associated with high mortality rates . in our study , we found overall 29% crude mortality amongst patients having staphylococcus aureus bsi . , kanafani et al . and forsblom et al . who described a range of 7% to 39% we observed that at our center , 59% of s. aureus strains causing bsi were mrsa . it therefore calls in for better vigilance and implementation of more effective mrsa screening programs complemented with improved infection control practices . in various studies , age , co - morbid conditions , hemodynamic status , immunosuppression , infecting organism , timely diagnosis and treatment etc . , which play a role in the downward trend of events in patients with bsi . death is the end result of the downhill course in the clinical status of a patient . studies by kaech et al . have shown 2% of mrsa prevalence in bacteremia patients with crude mortality ranging from 13% in nosocomial and 26% in community acquired staphylococcus aureus bacteremia , respectively . however , it has been observed in studies conducted by kaech et al . , jensen et al . and cunney et al . that the mortality caused by community acquired staphylococcus aureus bacteremia was greater as compared to nosocomial cases , probably due to earlier detection and commencement of appropriate therapy of bsi in a hospital setting as compared to community acquired infections . in our study , mortality was seen in 31% ( 45/146 ) of bacteremia caused by mrsa strains as compared to 18% mortality ( 7/39 ) observed in mssa bacteremia . have found in their study that 50% of the staphylococcal bacteremia cases were caused by mrsa strains and the overall mortality was 29% . the mortality caused by mrsa strains was 34% while mortality due to bacteremia caused by mssa strains was 27% . have found 11% mrsa strains with 39% mortality as compared to 24% mortality in mssa bacteremia . laupland et al . did not find any significant difference between mortality rates in patients suffering from bacteremia caused by either mrsa or mssa strains , although both the study groups found that over the years the staphylococcal bacteremia was caused proportionately more frequently by mrsa strains . this may be a reflection of selective antibiotic pressure over the years . in our study , 59% of the staphylococcal blood stream infections were caused by mrsa strains and overall crude mortality was 29% . although , the methicillin resistance is higher in our study as compared to various studies conducted in u.s . , we did not observe any proportionate increase in crude mortality rates as one would expect in comparison to these studies from west . therefore , crude mortality rates many times can be misleading and may project the infecting resistant organism as having high virulence while there are various other underlying factors leading to adverse outcomes in these patients having bsi . we therefore believe that the prognosis of staphylococcal bsi should be based on a more holistic clinical appraisal of the patients rather than biasing our thought process with the resistance profile of the causative organism . crude mortality was higher in patients having cons isolated from blood single time as compared to those where cons was isolated multiple times from blood ( 23% v / s 14% ) . our observations are in complete agreement of the findings of favre et al . who also reported a higher mortality in patients with single blood culture positive for cons as compared to patients with multiple blood cultures positive ( 15.3% v / s 7.0% at day 14 and 20.8% v / s 11.3% at day 28 ) however , they also did not find a significant difference in mortality of both groups . we fully support their recommendation that a single blood culture positive for cons in presence of clinical manifestations of sepsis should be considered clinically relevant and not simply disregarded as contaminants . mortality in this group is dependent on a number of factors and the most important of them is the severity of injury sustained at the time of trauma and the chances of microbial infections due to loss of normal epithelial barriers and penetrating injuries remain high . these patients have to be monitored invasively , undergo multiple surgeries and have a prolonged intra - hospital stay ; all of these factors predispose them to various hospital acquired infections . therefore , it is sometimes difficult to attribute their mortality to a single cause as most often there are multiple factors involved in the downhill course to death in these patients . hence , our attribution of death in these patients having staphylococcal bloodstream infections may not be totally appropriate . moreover , the number of patients having cons bacteremia in presence or absence of clinical features of sepsis was not good enough to draw meaningful conclusions . in future , better studies with larger number of study subjects can be planned to add more power to the study and hence validate the results . mortality in this group is dependent on a number of factors and the most important of them is the severity of injury sustained at the time of trauma and the chances of microbial infections due to loss of normal epithelial barriers and penetrating injuries remain high . these patients have to be monitored invasively , undergo multiple surgeries and have a prolonged intra - hospital stay ; all of these factors predispose them to various hospital acquired infections . therefore , it is sometimes difficult to attribute their mortality to a single cause as most often there are multiple factors involved in the downhill course to death in these patients . hence , our attribution of death in these patients having staphylococcal bloodstream infections may not be totally appropriate . moreover , the number of patients having cons bacteremia in presence or absence of clinical features of sepsis was not good enough to draw meaningful conclusions . in future , better studies with larger number of study subjects can be planned to add more power to the study and hence validate the results . staphylococcus spp . is an important cause of bloodstream infections in our settings and is associated with significant mortality and morbidity . the significance of both staphylococcus aureus and cons bacteremia should be evaluated better in light of clinical profile of the patient . therefore , clinical correlation is a sine qua non in determining the significance of isolation of any bacteria from blood culture samples . high rates of methicillin resistance in our center calls for better screening and infection control practices in the future .

leopold iii , the saint , was the austrian margrave from 1095/1096 until his death in 1136 . his successful marriage policy led to substantial economical and political wealth of the house of babenberg , which ruled austria between 976 and 1246 . with his second wife agnes of waiblingen , daughter of the salian king henry iv , he was reported of having 17 children . whether or not a possible earlier marriage resulted in offspring although the source material situation is unclear , his first son adalbert is generally believed to originate from an earlier relationship . a strong indicator for this assumption is the fact that adalbert was ignored in the line of succession in favor of agnes son , leopold iv , who died in 1141 . his remains were buried in the middle one of three tomb chambers in the monastery of klosterneuburg , lower austria , which he had founded in 1114 . in the northern chamber , adalbert 's remains were laid to rest , when he died around 1138 , shortly after his father . the aim of this study was to investigate whether adalbert was the common son of leopold iii and agnes or derived from an earlier , potentially unknown , relationship of leopold iii . the putative skeletal remains ( femoral bones ) of leopold iii ( l ) , agnes ( ag ) and adalbert ( ad ) from the monastery of klosterneuburg were delivered to the institute of legal medicine , innsbruck medical university . for a second set of experiments we later also received a femoral bone from the monastery of heiligenkreuz , attributed to ernst ( e ) , son of leopold iii and agnes , who died in 1137 . small pieces ( ca . 2 cm 1 cm 1 cm ) were excised from each specimen with a bone saw and subjected to mechanical surface cleaning with sterile scalpel blades . samples were bathed in sodium hypochlorite ( 4% active chlorine ) at room temperature for 15 min , spoiled in purified water ( dna / rna free ) , rinsed in absolute ethanol for 5 min and exposed to uv light for 10 min . samples were dried in a closed laminar flow cabinet over night and then powdered using a vibrating ball mill ( laarmann group bv , roermond , the netherlands ) . buccal swabs were taken from individuals involved in sample handling and extracted using chelex ( bio - rad laboratories , hercules , ca , usa ) according to to detect any potential contamination . the quantity of mitochondrial ( mt ) and nuclear ( n)dna from the bone extracts was determined using a real - time pcr approach according to on a 7500 fast real - time pcr system ( life technologies ( lt ) , carlsbad , ca , usa ) . autosomal short tandem repeat ( str ) profiles were established using the ampfstr ngm select pcr amplification kit ( lt ) and the powerplex esx and esi 17 systems ( promega , madison , wi , usa ) . the familias software package ( http://familias.name/ ) and dnaview software ( version 29.68 ) designed by charles brenner ( berkeley , ca ) were used for kinship likelihood calculations based on str allele frequencies derived from [ 710 ] . y - str analyses were performed using the ampfstr yfiler pcr amplification kit ( lt ) and the yhrd database ( http://www.yhrd.org/ , release 39 ) was used to query the resulting y - str haplotypes . sequences were aligned and interpreted according to using the sequencher software ( v. 5 , gene codes corporation , ann arbor , mi , usa ) . mtdna control region haplotypes were queried in the empop database ( http://empop.org/ , release 7 ) . the femoral bones attributed to leopold iii ( l ) , agnes ( ag ) and adalbert ( ad ) were very well preserved and showed dense compact bone structure ( fig . the mechanical and chemical processing of the samples was performed with the appropriate care required for challenging samples and the derived dna quantification values were plausible with respect to the sample conditions ( table 1 ) . extraction blank quantification values did not indicate relevant dna contamination and str as well as mtdna typing did not yield interpretable dna profiles . all results obtained in this study were different from the dna profiles of all laboratory staff involved in the analyses ( internal elimination database ) and individuals who handled the samples outside the laboratory ( data not shown ) . the sex - specific dna test ( amelogenin ) produced male genotypes ( amelo x , y ) for samples l and ad and a female genotype ( amelo x ) for sample ag ( table 1 ) , which was in agreement with what had been expected . those three femoral bones yielded full autosomal str profiles with the exception of se33 that gave no results most likely due to its relatively large fragment size . the successfully analyzed 15 str loci revealed allele sharing patterns of sample ad with samples l and ag as expected for a son - parent constellation , i.e. , one allele shared per locus with each parent ( table 1 ) . we compared the three hypotheses of the donor of sample ad being the son of both the donors of sample l and ag ( h1 ) , the son of l ( h1a ) and the son of ag ( h1b ) to the alternative scenario that the profiles derive from individuals completely unrelated to each other ( h0 ) , using familias . the corresponding likelihood ratio ( lr ) brought values of 1 10 in favor of h1a , 2 10 in favor of h1b and 1.32 10 of h1 over h0 . this provides strong support for the hypothesis that the donor of sample ad is a son to l and ag . these findings were also confirmed by dna - view resulting in lrs of 7.5 10 ( h1a ) , 1.6 10 ( h1b ) and 5.5 10 ( h1 ) each supporting paternity . the results from both uniparental marker systems corroborate those from autosomal dna analyses : y - chromosomal str typing revealed an identical haplotype between ad and l in the overlapping successfully analyzed loci ( with the exception of an additionally observed allele 10 in dys391 in sample ad ; table 1 ) . the haplotype was found 23 times in 13,143 european males ( yhrd , release 39 ) . the analysis of the mtdna control region yielded identical haplotypes ( barring length variation at the highly mutable homopolymer cytosine tract around nucleotide position 309 ) between ad and ag that belong to haplogroup r0 ( table 1 ) . disregarding length variation in c - tracts , this haplotype was not observed in 4630 west eurasians ( empop , release 7 ) . the compact bone structure of the bone sample e from heiligenkreuz , attributed to ernst , was lighter and less well preserved than the remains from klosterneuburg , which was reflected by much smaller amounts of extracted nuclear and mtdna ( table 1 ) . the mini - amplicon assay for mtdna typing gave a full control region haplotype ( haplogroup t2b ) that was different to the one obtained from ad and ag . autosomal str typing ( 34 cycles , 2 independent amplifications , compound interpretation method ) gave a partial str profile with exclusions in two str loci relative to the genotype of sample l ( table 1 ) . under the assumption of these two mutation events dna - view brought a likelihood ratio of 4 10 for the hypotheses of the donor of sample e being the son of the donor of sample l ( h1a ) to the alternative scenario that the profiles derive from individuals completely unrelated to each other ( h0 ) . the samples from klosterneuburg were investigated under the assumption that they constitute human remains of margrave leopold iii , his wife agnes of waiblingen , and his son adalbert , bearing in mind that such old remains might have been subject to replacement or exchange during history . dna typing was used to test whether or not the putative remains of these three individuals constitute a full biological family or only indicate father son relatedness , as expected from historical sources . successful dna typing results provided strong support for relatedness in a parent son constellation for the samples l , ag and ad , opposing the historical expectation . consequently , an alternative scenario came under consideration : adalbert could still be the son of an earlier wife of leopold if the tested remains ( ad ) were actually from a different male descendant of leopold and agnes . there is historical evidence supporting this assumption that was brought to our attention after completion of the first set of experiments : in the middle of the 13th century , substantial renovations took place in the monastery of klosterneuburg . it was possibly on behalf of friedrich ii , the last of the babenberg dynasty , that before 1240 the remains of his ancestors were transferred to heiligenkreuz , a monastery also founded by leopold iii in 1133 . not only adalbert , but also his brother ernst , who died in 1137 , were to be buried there together , the tombstone still bears both their names today . however , when the putative double burial was opened in heiligenkreuz in 1739 , skeletal remains of only one individual were found , carefully arranged in a transport box . the set of remains assigned to ad were also found in a transport box in the northern tomb chamber of klosterneuburg in 1979 . this leads to the suspicion that both boxes might have been transferred from klosterneuburg to heiligenkreuz in a first attempt , but due to lack in space the tomb in heiligenkreuz was designed in small dimensions , maybe too small for both burials only one transport box was actually buried there while the other one was returned to klosterneuburg . alternatively , both skeletal remains might have been prepared for transportation but only one of them was actually transferred to heiligenkreuz in appreciation of the small dimensions of the tomb there . one way or the other , both scenarios leave room for speculation that the transport boxes might have been mistakenly exchanged and thus the remains of ernst could have ended up in klosterneuburg instead of those of his brother adalbert . to test this hypothesis we investigated a femoral bone sample attributed to ernst ( e ) from heiligenkreuz that was sent to our laboratory for a second set of analyses . autosomal str typing provided evidence against close relatedness of samples e with l and ag , suggesting that those remains belong to a different , unrelated individual to leopold and agnes . the dna analyses on bone samples attributed to adalbert , agnes and leopold iii gave strong evidence of a son - parent constellation , a result that is discordant with the expectations based on historical considerations . a possible exchange of samples between adalbert and a younger brother , ernst , son of leopold iii and agnes according to historical sources , could not be confirmed as dna analysis results indicate an exclusion of fatherhood of leopold iii for sample e. based on the samples provided for dna typing , it seems most likely that adalbert was indeed a son of leopold iii and agnes of waiblingen . ag = agnes , ad = adalbert , e = ernst , l = leopold . ag = agnes , ad = adalbert , e = ernst , l = leopold .

nearly 30%65% of adult urban indians are either overweight , obese , or have abdominal obesity . abdominal obesity plays a major role in the pathogenesis of type 2 diabetes , cardiovascular diseases , and hypertension . indian data suggest that standard cutoff points to define abdominal obesity , are not appropriate for asian indians who are at risk of developing obesity - related comorbidities at a lower level of body mass index ( bmi ) . they have waist circumference ( wc ) , which is abnormal at any value of bmi . despite the lack of clear explanation , there is a strong relationship between visceral fat ( vf ) and insulin resistance ( ir ) , and this fact has been reported in a number of studies . whether it is the mechanism of large free fatty acid ( ffa ) flux into the portal circulation by vf or the increased production of tumor necrosis factor - alpha and interleukin-6 and less secretion of adiponectin by abdominal fat , ir is the end result , thereby causing glucose intolerance . even obese adolescents with a high proportion of vf and relatively low subcutaneous fat ( scf ) have a phenotype , reminiscent of partial lipodystrophy . these adolescents may not be severely obese , yet they suffer from severe metabolic complications . vf showed a strong association with type-2 diabetes and scf did not show such an association . mysore visceral adiposity in diabetes ( myvad ) study * showed that neither vf nor scf had any correlation with ir . to ascertain whether changes in the vf and or scf over a period of time would correlate with ir , this study in the obese , and nonobese nondiabetic patients of myvad study , was undertaken and were followed for the next 3 years . to assess the occurrence of diabetes in obese nondiabetic patients over a 3-year follow - up period with a correlative analysis of vf , fasting levels , and ir . participants in the age group of 1865 years , whose bmi is > 25 kg / m for obese nondiabetics and whose bmi was < 23 kg / m for nonobese nondiabetics . ( 1 ) patients with type 2 diabetes mellitus ( t2 dm ) , ( 2 ) any acute illness , ( 3 ) pregnancy , ( 4 ) patients on antiobesity medications , ( 5 ) comorbid conditions such as chronic obstructive pulmonary disease , hiv , and tuberculosis , and ( 6 ) those who were overweight with a bmi values between 23 - 24.9 kg.m ( these were the exclusion criteria used for the participants in the previous study ) . this was essentially the follow - up of the myvad study cohort that was carried out between march 2010 and april 2011 . 37 obese and 19 nonobese nondiabetics from that study were followed for the next 3 years . the first follow - up was done exactly 6 months after the completion of myvad study . each participant was clinically examined , for height ( to the nearest cm ) and weight ( to the nearest 100 g ) . wc in centimeter was done in the standing position and was measured midway between lower border of the ribs and the iliac crest . their sitting blood pressure ( bp ) average of three readings was taken . their fasting blood sugar ( fbs ) ( god - pap method ) , hba1c ( high - performance liquid chromatography method ) , serum cholesterol ( chod - pap method ) , serum triglycerides ( enzymatic method ) , high - density lipoprotein ( third - generation direct assay ) , low - density lipoprotein ( third - generation direct assay ) , and serum insulin fasting assay ( fasting insulin levels [ fils ] ) ( clia method ) values were obtained for each patient at a nabl accredited standard laboratory . ir was calculated by the homeostatic model assessment - ir assessment formula of fbs in millimoles multiplied by fasting insulin in miu divided by 22.5 . clinical examination , laboratory measurements , and the sonographic assessment of abdominal fat cutoff values for bmi and wc for asian indians according to the idf criteria have been followed in this study . all measurements were made with ge p5 logic system , using multifrequency ( 2 - 5 mega hz ) convex probe for measurements of intra - abdominal fat thickness and a multifrequency ( 812 mg hz ) linear probe for the measurements of abdominal wall fat . intra - abdominal fat ( vf ) thickness is defined as the distance between the anterior border of lumbar vertebra and posterior surface of rectus abdominis muscle . in is measured midway between xiphisternum and umbilicus , i.e. approximately 5 cm from umbilicus at three positions along the horizontal line , each measure were repeated 3 times [ figure 1 ] . all measurements were done at the end of quiet expiration , applying minimal pressure , not displacing or deforming the abdominal contents . measurement of visceral fat by ultrasound abdominal wall fat index is the ratio of maximum preperitoneal to minimum scf thickness . it is measured using a linear probe ( 812 ) placed at the epigastrium perpendicular to the skin . longitudinal scans are obtained along the midline ( linea alba ) and fat skin barrier . the thickness of the scf is defined as the distance between the anterior surface of the linea alba and the fat skin barrier [ figure 2 ] . the preperitoneal fat extends from the anterior surface of the left lobe of the liver to the posterior surface of the linea alba . measurement of subcutaneous fat by ultrasound abdominal fat measurement , which included the scf , properitoneal fat ( ppf ) , and vf were measured as per the protocol that was used in our previous study , by the same radiologist at each visit . those individuals either in the test sample or in the control sample who reached a hba1c value of more than 6.5 were considered as diabetic , and their follow - up was stopped as they had reached the end point . those individuals whose hba1c was between > 5.6 and but < 6.4 were considered as having impaired glucose tolerance ( igt ) , and they were followed up until the end of the study . hba1c was not repeated in those who had reached the end point as there was no provision . the results of the six monthly follow - ups were entered it to the excel sheets after each follow - up , both group - wise as well as individually . the following statistical methods were used in this study : ( 1 ) descriptive statistics , ( 2 ) one - way anova , ( 3 ) glm repeated measures to define factors , and ( 4 ) pearson 's product moment correlation . all the statistical calculations were done through spss for windows ( spss for windows , version 16 , chicago , spss inc ) . to assess the occurrence of diabetes in obese nondiabetic patients over a 3-year follow - up period with a correlative analysis of vf , fasting levels , and ir . participants in the age group of 1865 years , whose bmi is > 25 kg / m for obese nondiabetics and whose bmi was < 23 kg / m for nonobese nondiabetics . ( 1 ) patients with type 2 diabetes mellitus ( t2 dm ) , ( 2 ) any acute illness , ( 3 ) pregnancy , ( 4 ) patients on antiobesity medications , ( 5 ) comorbid conditions such as chronic obstructive pulmonary disease , hiv , and tuberculosis , and ( 6 ) those who were overweight with a bmi values between 23 - 24.9 kg.m ( these were the exclusion criteria used for the participants in the previous study ) . this was essentially the follow - up of the myvad study cohort that was carried out between march 2010 and april 2011 . 37 obese and 19 nonobese nondiabetics from that study were followed for the next 3 years . the first follow - up was done exactly 6 months after the completion of myvad study . each participant was clinically examined , for height ( to the nearest cm ) and weight ( to the nearest 100 g ) . wc in centimeter was done in the standing position and was measured midway between lower border of the ribs and the iliac crest . their sitting blood pressure ( bp ) their fasting blood sugar ( fbs ) ( god - pap method ) , hba1c ( high - performance liquid chromatography method ) , serum cholesterol ( chod - pap method ) , serum triglycerides ( enzymatic method ) , high - density lipoprotein ( third - generation direct assay ) , low - density lipoprotein ( third - generation direct assay ) , and serum insulin fasting assay ( fasting insulin levels [ fils ] ) ( clia method ) values were obtained for each patient at a nabl accredited standard laboratory . ir was calculated by the homeostatic model assessment - ir assessment formula of fbs in millimoles multiplied by fasting insulin in miu divided by 22.5 . clinical examination , laboratory measurements , and the sonographic assessment of abdominal fat were repeated every 6 months for the next 3 years . cutoff values for bmi and wc for asian indians according to the idf criteria have been followed in this study . all measurements were made with ge p5 logic system , using multifrequency ( 2 - 5 mega hz ) convex probe for measurements of intra - abdominal fat thickness and a multifrequency ( 812 mg hz ) linear probe for the measurements of abdominal wall fat . intra - abdominal fat ( vf ) thickness is defined as the distance between the anterior border of lumbar vertebra and posterior surface of rectus abdominis muscle . in is measured midway between xiphisternum and umbilicus , i.e. approximately 5 cm from umbilicus at three positions along the horizontal line , each measure were repeated 3 times [ figure 1 ] . all measurements were done at the end of quiet expiration , applying minimal pressure , not displacing or deforming the abdominal contents . measurement of visceral fat by ultrasound abdominal wall fat index is the ratio of maximum preperitoneal to minimum scf thickness . it is measured using a linear probe ( 812 ) placed at the epigastrium perpendicular to the skin . longitudinal scans are obtained along the midline ( linea alba ) and fat skin barrier . the thickness of the scf is defined as the distance between the anterior surface of the linea alba and the fat skin barrier [ figure 2 ] . the preperitoneal fat extends from the anterior surface of the left lobe of the liver to the posterior surface of the linea alba . measurement of subcutaneous fat by ultrasound abdominal fat measurement , which included the scf , properitoneal fat ( ppf ) , and vf were measured as per the protocol that was used in our previous study , by the same radiologist at each visit . those individuals either in the test sample or in the control sample who reached a hba1c value of more than 6.5 were considered as diabetic , and their follow - up was stopped as they had reached the end point . those individuals whose hba1c was between > 5.6 and but < 6.4 were considered as having impaired glucose tolerance ( igt ) , and they were followed up until the end of the study . hba1c was not repeated in those who had reached the end point as there was no provision . the results of the six monthly follow - ups were entered it to the excel sheets after each follow - up , both group - wise as well as individually . the following statistical methods were used in this study : ( 1 ) descriptive statistics , ( 2 ) one - way anova , ( 3 ) glm repeated measures to define factors , and ( 4 ) pearson 's product moment correlation . all the statistical calculations were done through spss for windows ( spss for windows , version 16 , chicago , spss inc ) . the two groups that were taken from our previous study ( myvad ) for follow - up in this study were the obese and nonobese nondiabetics . all the 37 participants of the obese group and 19 from the nonobese control group formed the subject material for the follow - up . there were a total of 14 dropouts in the obese group and one in the control group in the 3 years of follow - up . eleven dropouts occurred in the first two follow - ups in the obese group and two in the fourth follow - up , whereas one each dropout occurred in the fifth follow - up . the data of the lost to follow - up cases were not considered for analysis . in the end , 23 from the obese group and 18 from the control group finished the study , and their data were taken for analysis [ figure 3 ] . follow up tree of the participants maximum participants in the obese group were in the age group of 3050 + and < 3040 years in the control group [ table 1 ] . age group analysis of the participants ( crosstab ) there were 11 males and 12 females in the obese group and 16 males and only 2 females in the control group [ table 2 ] . the various parameters that were taken for analysis both at the start of the follow - up and at the end of 3 years were weight , bmi , wc , bp ( both systolic and diastolic ) , fbs , fils , hba1c , components of lipid profile , scf , ppf , and vf . the significance between the groups , between the sexes , and between group and sex is also shown in the same table . as seen none of the parameters have shown any statistical significance at the end of the study . values of physical and biochemical parameters at the beginning and completion of the follow - up pearson correlation coefficient method was used to correlate , scf , vf , fil , ir , and hba1c with one another in both obese and control groups scf had no correlation with any of the other parameters , whereas vf had a significant correlation with fil ( 0.019 ) and ir ( 0.033 ) . ir significantly correlated with fil ( 0.000 ) , hba1c ( 0.000 ) , and vf ( 0.033 ) in the obese group as shown in table 4 . pearson correlation of various parameters ( test group ) in the control group , both scf and vf had no correlation with fil , hba1c , and ir . here , also ir correlated significantly with both fil ( 0.000 ) and hba1c ( 0.003 ) shown in table 5 . pearson correlation of various parameters ( control group ) to have more information on those who developed igt and diabetes , the total participants were divided into three groups ; the five diabetics formed the first group , the 14 participants who showed hba1c in the range of 5.66.4 ( igt ) formed the second group , and the rest 22 formed the third group . in this analysis , it was clearly shown that those who showed diabetes had statistically significant higher values of fil ( 0.000 ) , hba1c ( 0.000 ) , ir ( 0.000 ) , total cholesterol ( 0.007 ) , and bmi ( 0.042 ) . even those who had igt showed higher values of fil , hba1c , and ir compared to the others group [ table 6 ] . comparison among the three groups by one - way anova table 7 shows the values of vf in the obese and control groups before the study and their values after a follow - up of 3 years . as can be seen , the vf has decreased in the obese group by 0.05 cm , and by 0.59 cm in the control group , both were not significant . comparison of visceral fat , after 3 years of follow - up table 8 shows the risk of diabetes with ir , in the cohort of 41 cases to be 1.278 with 95% confidence interval ( ci ) from 1.030 to 1.585 . obesity is perhaps the longest studied and best - described risk factor for type 2 diabetes . two long - term big studies found that both overall and abdominal obesity strongly and independently predicted t2 dm . body surface measurements such as wc , do not distinguish between various adipose tissue depots . hence , ct and mri were used to differentiate scf and vf and many studies documented that vf was more associated with ir and t2 dm than scf . debate is going on regarding which of these fat depots are more important in determining ir . one study found that both vf and scf being independently and strongly related to ir . a south indian study showed that only vf and not scf was associated with ir . most of the evidence on vf and scf has emerged from analyses that have used cross - sectional designs , in which exposure variability of interest is measured at the same time as the outcome variability . results from studies using such design have to be interpreted with caution since temporality of association can not be determined . in contrast , longitudinal study designs , in which measurement of the exposure precedes the occurrence of the outcome is more desirable . we found in our earlier myvad study , which had a cross - sectional design that bmi , wc , vf , and scf had no correlation with ir . since it was a study limited for only 6 months , we thought a long - term follow - up of obese nondiabetics would throw some light on the changes in their abdominal fat as well as ir . our primary goal was to find out whether any change in the abdominal fat , be it scf or vf would have any influence in the causation of ir and diabetes after following them for 3 years . obese males showed increase in their bmi , fbs , scf , and hba1c , whereas as decrease in their wc , vf , fil , and ir but none were statistically significant . obese females showed increase in their bmi , wc , fbs , ir , hba1c , scf , and vf and decrease in fil , but again none were of any statistical significance [ table 3 ] . since no conclusions could be drawn with these findings , correlation of vf and scf was done with fil , hba1c , and ir in both the groups . opined that 79 cm for men and 78 cm for women nondiabetics would be the cutoff points . the pioneering study matthews et al . said that 1.351.96 would be the lower and upper limits of ir in nondiabetics . this study showed higher value of vf only in those who developed diabetes whereas higher ir values were seen not only in obese but also in nonobese nondiabetics . fil and hba1c correlated significantly with ir ( 0.000 ) , while scf did not correlate with any of the parameters , vf correlated with ir ( 0.033 ) and fil ( 0.019 ) in the obese group [ table 4 ] . in the control group , neither scf nor vf correlated with fil , ir , and hba1c . these findings showed that vf has a probable role in the causation of ir in obese nondiabetics . when we divided the whole participants into dm group , igt group , and others , the findings were really significant as dm group showed significantly higher values of fil , ir , hba1c , bmi , and tc . these values were also higher in the igt group , but vf and scf in spite of being highest in dm and higher in igt group were not statistically significant . these significant changes were seen despite the fact that the vf of the obese group had little change over a period of 3 years ( 8.08 2.08 vs. 8.03 3.29 ) , so also in the control group ( 5.86 1.65 vs. 5.27 2.66 ) [ table 7 ] . our primary objective was to find changes in vf and we found very little change over the years . we have found three ( 13% ) participants having hba1c in the diabetic range and 12 ( 52% ) in the igt range out of the 23 followed in the obese group , despite no appreciable changes in the vf , which appears to us , highly significant . increased vf was seen in the obese , who developed diabetes and was not seen in obese , who had igt , but still a significant risk factor for the development of ir which culminates in igt and dm . the importance of this study is that we have shown that an increase in vf over a period of time , is not necessary for the development of ir , as increased ir was seen not only in obese but also in the controls . as far as the reason for the causation of ir , it could be anything from ffa excess to chronic inflammation in the vf , both of which could not be proved in our earlier studies . we also found hba1c in the range of diabetes in 2 ( 11% ) and igt in 2 ( 11% ) in the controls despite having lower vf which defies explanation and needs further research . the risk for development of diabetes in this whole cohort with ir has been 1.278 with 95% ci 1.0301.585 [ table 8 ] . we would like to propose the estimation of fbs and fil in all obese nondiabetics in the beginning itself to know their ir which would give an idea of the probability of them going into diabetes and measures for prevention could be taken at that time itself . routine measurement of vf may not throw much light in the beginning , even though it is an important risk factor for the development of dm . the only limitation of this study was the small sample size to begin with , which dwindled further with dropouts . this may be the reason for the lack of statistical significance of many parameters despite them showing changes . the only limitation of this study was the small sample size to begin with , which dwindled further with dropouts . this may be the reason for the lack of statistical significance of many parameters despite them showing changes . this follow - up study on south indians has shown that vf is a significant risk factor for the development of ir . ir can develop without any increase in the volume of the vf , is the essential finding of this study . we recommend fbs and fil in all the obese nondiabetics to calculate ir , which has given much insight in the development of igt and diabetes . the research grant for the entire 3 years of this follow - up study was provided by the association of physicians of india , karnataka chapter , bengaluru . the research grant for the entire 3 years of this follow - up study was provided by the association of physicians of india , karnataka chapter , bengaluru .

one of the neuropathologic features invariably found in the brains of individuals with alzheimer 's disease ( ad ) is the amyloid - beta ( a ) containing senile plaque ( sp ) . blood samples have been assessed for changes in a levels driven by the abundant data that a in the brain was the prime candidate for precipitating ad . we showed as did others that circulating levels of the shorter form of a ( a40 ) increased with decreasing cognitive performance within a control population . levels of a40 were increased even further in mild cognitive impairment ( mci ) compared to controls , and circulating levels of a40 are decreased in ad compared to mci . we suggested that gradually increased production of a occurred with effective clearance from the brain when individuals change from control to mci and that reduced clearance was evidenced as lower circulating a levels with concurrently increased central accumulation in the transition from mci to ad . this is consistent with findings in the cholesterol - fed rabbit model of human coronary artery disease where we identified numerous neuropathologic features of ad including central accumulation of a. early studies were performed in animals administered a diet containing 2% cholesterol and tap water for only 8 weeks compared to animals administered normal rabbit chow and tap water for a similar length of time . further studies suggested that the induction of ad - like a neuropathology by dietary cholesterol depended on the quality of water the rabbit was drinking . animals fed 2% cholesterol and drinking distilled water showed minimal ad - like neuropathology , whereas animals drinking tap water were severely affected . subsequent studies indicated that it was the copper in the tap water that produced the difference in severity of the cholesterol - produced ad - like a pathology . it was clear that cholesterol caused the overproduction of a in the brain and copper influenced its clearance to the blood via inhibition of lrp at the vascular interface [ 5 , 6 ] . have shown that increased copper intake significantly increases the rate of progression of ad in the setting of elevated fat intake . a role for altered copper metabolism as a cause of neurodegenerative disorders other than ad is clearly recognized , and a role for copper in ad is emerging . have been shown to be elevated in the blood of patients with ad compared to controls by most [ 913 ] , but not all , investigators . have reported a significant increase in circulating copper in ad and a trend for increased ceruloplasmin . these authors also reported a significant negative correlation in ad between increased copper / ceruloplasmin and decreased scores on the mmse , avlt - a7 , and the clock draw [ 15 , 16 ] . similar to squitti 's data , we have shown that there are significant increases in blood copper / ceruloplasmin in ad compared to age - matched controls . moreover , circulating copper / ceruloplasmin levels increased in controls with lower performance on the avlt - a7 and mmse and remained elevated in mci and ad as cognitive ability progressively deteriorated . although found in many other tissues of the body , tau protein in brain is the precursor for the other important neuropathologic feature of ad , the neurofibrillary tangle ( nft ) . specifically phosphorylated - tau ( p - tau ) is a main component of the nft . single strands of p - tau become paired into filaments called paired helical filaments ( phf ) , which then assemble into fibrillary complexes within a neuron eventually becoming an nft . it has been reported that there are increased tau and 181-p - tau levels in mci subjects converting to ad and that levels are stable in controls and mci subjects not converting to ad . although there are reports that the protein tau may have a copper binding site [ 2022 ] , there is only one study investigating any relationship between the protein tau and copper in the blood and csf in ad , where a significant positive relationship ( p < .03 ) between copper levels in the serum and tau levels in the csf was identified in ad compared to controls . nevertheless , there are no reports of changing cognitive performance ( i.e. , ad versus control ) and a relationship between csf copper and tau levels or copper and tau levels in the circulation . we recently measured total tau in human plasma and have found significant differences between cognitively normal individuals , subjects with mci , and patients with ad ( unpublished observation ) . tau levels ( total human tau ) were established in each plasma sample using elisa , kits and standards purchased from invitrogen corp . , camarillo , ca . the mean circulating tau level ( picograms / ml ) is depressed in plasma of patients with ad when compared to both cognitively normal control and individuals with mild cognitive impairment ( mci ) ( p < .0001 and .0002 , resp . ) . the mean tau levels were also significantly reduced in mci compared to control ( p = .048 ) , and a significant age - related increase was identified ( p = .042 ) in the control population ( unpublished observation ) . in our previous rabbit studies we administered 2% cholesterol and varying qualities of drinking water , and we were able to manipulate a accumulation and memory but were unable to identify any changes in tau as the major component of the other characteristic lesion in ad - nft . a recent publication indicated that administering lower levels of dietary cholesterol ( 1% ) over longer periods of time ( 7 months ) could produce nft - like changes in the brain along with a deposition in female rabbits . an even more recent publication found similar features and behavioral dysfunction in a hypercholesterolemic rat model . using the same methods employed in the current study , the authors note increased a , tau , and p - tau in the cortex of cholesterol - fed rats . antibodies have been developed to detect different stages of the nft formation , including phf-1 antibody identifying phf and at8 antibody highlighting p - tau . seven months of 1% cholesterol diet caused increased phf-1 immunoreactivity in hippocampus of female rabbits as well as plaque - like a deposition in the hippocampus and cortical brain regions . we performed a pilot study of female rabbits fed 1% cholesterol and drinking distilled water , copper containing distilled water , or local tap water compared to animals administered normal chow and tap water . in this preliminary study we focus on changes in tau by measuring total tau levels by elisa and evaluating the brain for the presence of p - tau by performing at8 immunohistochemistry . twenty female new zealand white ( nzw ) rabbits approximately 2.5 kilograms body weight were obtained , acclimated to the vivarium for 810 days , and assigned to one of four groups . fifteen of them were fed 1% cholesterol diet purchased from purina testdiet , the remaining five were fed normal high - fiber chow from purina labdiet . the control animals along with five of the cholesterol fed animals were allowed distilled water to drink . five of the remaining rabbits received local tap water . and the other five were administered distilled water with copper ion added ( 0.12 ppm copper ion as sulfate ) . us filter 's analysis of the local sun city tap water used can be seen in a previous publication . late in the study , 2 of 5 animals fed the 1% cholesterol chow developed fatty liver disease and/or severe atherosclerosis . these animals were anesthetized and perfused with normal saline as soon as symptoms of either disease appeared . counter - part animals in the other three groups were sacrificed and similarly processed for tissue collection . blood samples were collected prior to initiating administration of the experimental diet and water ( baseline ) . at the end of 21 weeks ( 5 months ) animals were sacrificed after each rabbit was deeply anesthetized with ketamine ( 5075 mg / kg ) and xylazine ( 5 mg / kg ) given intramuscularly in the upper thigh . additional ketamine was given at 20% of the original dose , if it was determined that the animal was not deep enough . once the rabbit was anesthetized , the chest and cranium were shaved , and the animal was placed on an embalming board . an incision was made over the sternum and ribs are reflected to expose the heart . a 23-gauge vacutainer needle was introduced into the left ventricle , and 10 cc of blood is collected in purple top tubes . the needle was removed and replaced with a 23-gauge 1.5 inch catheter attached to an iv line . the catheter is advanced into the left atrium and secured into place using a vascular clamp . the right atrium is then cut to facilitate drainage using a pair of mayo scissors . the rabbit was then perfused with a minimum of 120 milliliters of sterile saline using a syringe pump set to deliver 600 cc per hour . once the animal was perfused , various organs were collected , including the brain , heart , liver , spleen , and kidneys ; half of the brain was dissected fresh ( frontal pole , whole hippocampus ) , frozen on dry ice and then stored at 70c , and the other organs and half - brain were emersion - fixed in 4% paraformaldehyde . brain samples were homogenized thoroughly in a cold solution ( 1 : 8 ; w : v ) of 5 m guanidine hcl and 50 mm tris hcl , ph 8.0 using a dounce homogenizer . this solution was transferred to an eppendorf tube and mixed at room temperature for 3 - 4 hours . this sample was diluted 1 : 50 with a dulbecco 's phosphate buffered saline with 5% bsa and 0.03% tween-20 , ph 7.4 supplemented with protease inhibitor cocktail ( sigma p8340 or calbiochem no . this diluted sample was centrifuged at 16,000 g for 20 minutes at 4c prior to use . a fifty l aliquot of each sample was assessed in the tau elisa assay . frozen plasma samples were slowly thawed , and a 20 l aliquot was diluted 1 : 10 with undiluted standard dilution buffer provided with each tau elisa kit . a fifty l aliquot of this solution was added to the appropriate well in the following assay . all reagents used were supplied in the kit including the standards dilution buffer . wash buffer was prepared by diluting the supplied concentrate 1 : 25 with purified water . standards were prepared by diluting the supplied standard with standard dilution buffer as specified on labeling to 2000 pg / ml . serial dilutions were made into standard dilution buffer to 1000 , 500 , 250 , 125 , 62.50 , and 31.25 pg / ml . 50 l of standard dilution buffer was added to the rest of the wells . 50 l of sample ( fresh frozen brain or plasma collected in a purple top vacutainer ) was added to elisa wells in duplicate . the elisa plate was covered and incubated for 2 hours at room temperature on a rotary shaker ( 1200 rpm ) and thereafter washed 4 times . a 100 l aliquot of anti - tau detection antibody was added to each well , and the plate was incubated as above for 1 hour and thereafter washed 4 times . antirabbit hrp concentrate was diluted 100x into hrp diluent and added to wells at 100 l / well , and the plate is incubated for 30 minutes . after emptying the plate 100 l of stabilized chromogen was added to each well , and the uncovered plate was incubated at room temperature in the dark for 2030 minutes on the rotary shaker . stop solution , and the plate was then read at 450 nm in a bio - tex elx800 plate reader . reader software calculated standard curve , concentration , sd , and cv% ( 4 parameter algorithm ) . blocks of paraformaldehyde fixed tissue were affixed to a metal block with superglue , and 50 m vibratome sections were collected and stored in 4% paraformaldehyde until use . on the first day , 50 m thick vibratome tissue sections were washed twice in 0.01 m tris buffered saline ( tbs ) ph 7.6 for 10 minutes . sections were then transferred to a solution of 3% h2o2 in 0.01 m tbs and incubated at room temperature for 30 min . sections were then washed twice for 10 minutes in 0.01 m tbs + 0.1% triton x-100 ph7.6 . sections were transferred to 88% formic acid for 2 - 3 min and washed twice for 10 minutes in0.01 m tbs + 0.1% triton x-100 ph 7.6 and then transferred to antigen retrieval solution ( genetex , # sections were washed again and then incubated in 3% horse serum in 0.01 m tbs + 0.1% triton x-100 ph 7.6 for 1 hour . m tbs + 0.1% triton x-100 ph 7.6 and transferred to 1 antibody ( 1 : 500 dilution of antihuman phf - tau at8 monoclonal antibody - pierce biotechnology or 1 : 100 dilution of 10d5 antibody to aelan pharmaceuticals ) in 0.01 m tbs + 0.1% triton x-100 ph 7.6 ) overnight at 4c . on the following day the sections were washed once in 0.01 m tbs + 0.1% triton x-100 ph 7.6 and transferred to 2 antibody ( vectastain abc kit pk-6102 mouse igg , 1 drop/10 ml 0.01 m tbs + 0.1% triton x-100 + 1% horse serum ) for 1 hour . m tbs + 0.1% triton x-100 ph 7.6 and transferred to a / b solution ( vectastain kit , 4 drops a + 4 drops b/10 ml 0.01 m tbs + 0.1% triton x-100 ) , washed twice for 10 minutes in 0.05 m tris ph 7.9 and then developed in a diaminobenzidine solution in dark ( 15 mg dab + 20 l 30% h2o2 in 100 ml 0.05 m tris ) for 610 minutes . the reaction was stopped by transferring the sections back into 0.05 m tris ph 7.9 . the groups were compared for differences by anova followed by independent t - test . although mean differences were substantial , the limited number of animals assessed in this preliminary study precluded significance greater than trends ( .05 < p < .10 ) . we performed a pilot study of long - term dietary cholesterol in four groups of rabbits . one group was administered normal chow and tap water , and three groups were administered 1% cholesterol for five months . the cholesterol - fed groups were administered either distilled water , distilled water supplemented with 0.12 ppm copper ion , or local tap water ( routinely containing 0.20 ppm copper ion as well as other trace elements and compounds ) . employing methods to measure total tau in human plasma , we measured total tau levels in plasma , hippocampus , and frontal cortex in each animal sacrificed after 5 months of dietary manipulation . we also assessed the hippocampus and frontal and temporal cortex for at8 staining of p - tau and the frontal and temporal cortex for a accumulation ( figure 1 , a4d4 ) . plasma samples were taken from each animal at baseline and at sacrifice 21 weeks after initiating experimental diet and controlled diet and water . it is important to note that even though previous studies administered a 1% cholesterol diet and purified water for 7 months [ 23 , 25 ] , we decided to leave open the possibility of identifying enhanced tau pathology in animals on copper containing distilled water and/or tap water and administered experimental diet and drinking water for only 5 months . we initially had five animals in each of the four groups , but an animal on 1% cholesterol and tap water became ill after 4 months of diet and was sacrificed along with one animal in each of the other groups . after 4.5 months of diet another 1% cholesterol and tap water animal became ill as well as an animal on 1% cholesterol and copper supplemented distilled water these two animals and a counterpart animal in the other 2 groups were sacrificed . accordingly there were only 3 animals in each group that completed the 5-month pilot study . plasma levels of tau were increased by 4050% in each of the cholesterol - fed animal groups after 5 months of experimental diet compared to animals on normal rabbit chow and tap water ( table 1 ) . tau levels in fresh hippocampus were 5-fold higher in animals administered 1% cholesterol and distilled water compared to animals on normal rabbit chow and tap water ; levels of tau were 3-fold higher in animals on 1% cholesterol and copper supplemented distilled water and less than 2-fold in animals on 1% cholesterol and tap water ( table 1 ) . a similar graded effect on at8 staining of p - tau was glaringly apparent in sections of fixed hippocampus ( figure 1 ) . in the fascia dentata of the hippocampus at8 staining is increased dramatically in animals on cholesterol and distilled water ( figure 1 , b1 ) , is less pronounced in the animals on cholesterol and copper ( figure 1 , c1 ) , and is further reduced in animals on cholesterol and tap water ( figure 1 , d1 ) , all compared to animals on normal chow and tap water ( figure 1 , a1 ) . this is equally apparent when viewing the whole hippocampus at low power ( figure 1 , 4x ; a2d2 ) . these data support the concept that increasing tau levels are directly related to the severity and intensity of at8-stained features in the hippocampus . and on the flip side , the data support the premise that our measured levels of tau in plasma and brain tissue are valid and accurate . further support of this comes from finding similar graded effects when assessing frontal cortex . in the frontal cortex we found a 6-fold increase of tau in animals on 1% cholesterol diet and distilled water compared to animals fed normal rabbit chow . in contrast we found a less than 2-fold increase in tau levels in the frontal cortex of cholesterol - fed animals on copper - supplemented distilled water and tap water ( table 1 ) . identical to the hippocampus , the number and severity of nft - like lesions deposits identified in the frontal cortex by at8 staining correlated to the levels of tau measured ( data not shown ) . at8 immunoreactive neurons were not observed in the frontal cortex of any animal on normal rabbit chow and tap water . in all of the cholesterol - fed rabbits becomes administered distilled water to drink , there were abundant at8 stained nft - like lesions in frontal cortex ( table 1 ) . the frontal cortex in two of three cholesterol - fed rabbits drinking copper supplemented distilled water exhibited a few at8 stained cells showing fine processes and considerable arborization ( less nft - like ; table 1 ) . only one animal fed cholesterol diet and drinking tap water showed a single faintly stained at8 immunoreactive neuron in the frontal cortex . in the superior temporal cortex no at8 immunoreactive neurons were observed in animals fed normal chow and drinking tap water ( table 1 ; figure 1 , a3 ) , but 3 of 3 animals fed 1% cholesterol diet and distilled water demonstrated abundant at8 immunoreactive features which occurred in patches of 2 - 3 nft - like lesions ( table 1 ; figure 1 , b3 ) . all three of the cholesterol - fed animals drinking distilled water supplemented with copper showed numerous isolated at8 stained nft - like lesions in the superior temporal cortex ( table 1 ; figure 1 , c3 ) . two of three animals fed cholesterol drinking tap water showed very few isolated cells stained with at8 antibody ( table 1 , figure 1 , d3 ) . adjacent sections of hippocampus , and frontal and temporal cortex were stained for the presence of a using 10d5 antibody employing the detailed methods . as expected , we found that administration of copper containing distilled water or tap water to drink increased the accumulation of a in hippocampus ( not shown ) and frontal cortex ( not shown ) and superior temporal cortex ( figure 1 , a4d4 ) of animals fed 1% cholesterol diet compared to animals drinking unaltered distilled water , as found previously in rabbit fed 2% cholesterol diet . similar to findings in animals fed 2% cholesterol diet , we observed a graded effect on a accumulation in animals fed 1% cholesterol diet , with the greatest a accumulation occurring in animals administered tap water ( figure 1 , d4 ) , somewhat less accumulation in animals administered copper supplemented distilled water to drink ( figure 1 , c4 ) , while there is minimal a staining in the superior temporal cortex of animals drinking distilled water ( figure 1 , b4 ) , all compared to animals administered normal chow and drinking tap water ( figure 1 , a4 ) . overall , there seemed to be an inverse relationship between neuronal accumulation of a and increased levels of tau and associated at8 immunoreactive nft - like lesions , based on varying water quality and region of brain . this disconnect suggests that accumulation of a may not cause increased levels of tau , and that once sufficient elevations tau occur in the brain , this in turn leads to deposition of p - tau containing nft - like lesions . this is the first study of the effect of intake of copper or trace metals on levels of the protein tau in the blood and brain . we have shown that there is increased tau neuropathology associated with production of increased tau levels in the blood and brain of the cholesterol fed rabbit . this could be similar to induction of accelerated aging as these findings are consistent with our unpublished observation of age - related increases in plasma tau levels in cognitively normal humans coupled with reported increases in the occurrence and severity of nft pathology with increasing age in the absence of dementia [ 26 , 27 ] . the inverse relationship between tau and a pathology depending on water quality is difficult to reconcile when attempting to apply conventional wisdom , where the accumulation of a containing sp is thought to precede the occurrence of p - tau containing nft in ad and that the processes leading to the formation of the lesions may be linked . what we may have uncovered is that these processes may actually not be linked at all . in this cholesterol - fed rabbit model of a and tau neuropathology , we show that increased accumulation of a occurs concurrently with reduced levels of tau and the incidence of at8 stained nft - like lesions . it must be remembered that plaque - only and nft - only variants of ad have been reported [ 28 , 29 ] . neuropathologic evaluation revealed that most clinically diagnosed ad patients had both plaques and tangles , although in the rare circumstance there were individuals who had only senile plaques or only nft in their brains [ 28 , 29 ] . coming full circle there are those who would contend that these individuals were misdiagnosed and those demented patients with only plaques or tangles did not have ad at all ( william r. markesbery , personal communication ) . an important feature of animal research is the opportunity to disclose possible mechanisms to explain observations in human studies . much of disclosing a likely mechanism for altered levels of total tau in plasma in relation to tau concentration in the brain would depend on the origin of the peptide deposited in the brain . if , as all evidence suggests , a accumulates in the brain with increasing change in the vasculature , which in turn leads to reduced clearance of the toxin to the blood [ 5 , 6 ] and eventually the liver , it is difficult to envision how such an alteration in the vascular blood brain barrier ( bbb ) leads to increased levels of tau and associated formation of nft - like lesions in the brain unless the tau accumulating in brain has its origin in the blood . assuming that 1% cholesterol diet increases tau plasma levels by 4050% in each cholesterol - fed animal groups , the question is how this similar increase in blood tau has differential effects on tau accumulation in the brain , in terms of tau levels and at8 immunoreactive nft - like lesions ( 5 - 6 fold increases in the group versus 2 - 3 fold increases in the distilled water + copper group , versus 40% in the tap water in other words , the evidence presented would suggest that reduced bbb permeability induced by varying water quality attenuates brain uptake of tau from the blood at the same time it reduces the clearance of a. therefore , a normally functioning bbb in animals administered cholesterol and distilled water allows clearance of a concomitant with central accumulation of tau due to a concomitant increase in the concentration of tau in the blood . by the addition of copper to the distilled drinking water there is a decrease in bbb permeability leading to either an increased accumulation of a or a decrease in tau levels and associated at8 immunoreactive features in the brain , while tau concentrations remain elevated to the same level in general circulation . by further reducing water quality by administration of tap water there is even greater compromise in bbb permeability and an even greater accumulation of a and a greater reduction of tau levels and at8 immunoreactive nft - like lesions in the brain , again while circulating concentrations of tau remain elevated to the same level . accordingly it can be proposed that tau deposited in the brain of the cholesterol - fed rabbit model of ad may have come from the circulation . however , it remains unclear how a neuron might take up extracellular tau protein for nft formation . although provocative , one must keep in mind that these are preliminary data and as such require replication . even so it may be all well and good to be able to induce the production of nft - like lesions in the brains of cholesterol - fed rabbits , but our eventual goal would be much more important - to find a method or medication to make them go away or not form in the first place .

the actual meaning and the selective advantages induced by this deregulation remain nowadays still a matter of debate despite the pioneering work of warburg about the impact of the alteration of the energetic metabolism in cancer cells . certainly , several reasons have significantly contributed to delay the advancement in this area of investigation . for many years , the search for new anticancer therapeutic agents has been extremely focused on fighting the two most intuitive altered features of cancer cells , namely , their sustained and uncontrolled proliferation and their ability of evading death . accordingly , we have assisted over the years in the development of different classes of therapeutic agents reducing cancer cell proliferation or inducing cancer cell death . the main target of these studies was the differential susceptibility of cancer versus normal cells to these treatments . over the time , however , we have also learned about the limits of this approach considering the high incidence of therapeutic failure and the frequent development of systemic toxicity . recently , the high level of complexity and heterogeneity of cancer allowed considering this disease as a dynamic multicellular system with complex forms of interactions and cellular communications with the own environment . it has become evident that consolidated cancer hallmarks including sustained and uncontrolled cell proliferation and resistance to cell death need to be reconsidered in a much more complex modulatory context if we want to therapeutically succeed with cancer . at the light of this new vision , the ability of cancer cells to reprogram their cellular energetic metabolism is passing through a renaissance of interest in cancer biology for these chapters of fundamental biochemistry . the discovery of unexpected cross - talks between well - known metabolic factors and mediators of unrelated processes is fuelling this renewed interest . on one side , noncanonical regulatory functions of specific metabolic enzymes or substrates are emerging ; on the other side , oncogenes , tumour suppressors , as well as modulators controlling events typically altered at the very early stages of cancer progression including immune response , cell proliferation , or cell death appear in the dual role of controlled / controllers of metabolic processes . decoding the roles of metabolic changes occurring during carcinogenesis and identifying the key nodes that differentiate pathological and healthy behavior have two important implications : novel predictive biomarkers and new drug discovery strategies . consequently , additional knowledge may offer new tools to troubleshoot frequent chemotherapeutic failures ; additionally , compounds targeting metabolic processes may also be potentially used for chemopreventive purposes . this research is only emerging , transforming the identification of metabolically active agents into an opportune challenge . remarkably , almost 80% of all anticancer compounds are isolated from plants , fungi , and microorganisms . both natural and chemically modified molecules ( in order to improve stability , specificity , and/or activity ) are able to counteract each of the cancer hallmarks [ 1 , 2 ] recently reclassified by hanahan and weinberg . remarkably , many of these compounds are food constituents or have been used since a long time in traditional medicine . thus , they show a favorable profile in terms of their absorption / metabolism in the body with low toxicity . the preferential switch from oxidative phosphorylation to aerobic glycolysis represents the most discussed and investigated altered metabolic feature of cancer cells and was first described by otto warburg in the 1920s . defects in the enzymatic respiratory chain exist in cancer cells ; however , there is no clear correlation between the incidence of mitochondrial dysfunctions and the metabolic switch to glycolysis , the latter being commonly reported in cancer cells . in a number of instances , instead , cancer tissues / cells even consistently rely on mitochondrial respiration to produce atp . furthermore , under specific circumstances , cancer cells may also be forced to reactivate mitochondrial energy production . these observations clearly show that mitochondria are generally functional in cancer cells and support the hypothesis that the propensity of cancer cells to exacerbate the glycolytic pathway , while decreasing oxidative phosphorylation , must be an active option conferring important advantages despite the evident energetic inefficiency of glycolysis . nevertheless , identification of these selective advantages is not an obvious task , being indeed matter of debate . theoretically , metabolic alterations during carcinogenesis could provide multiple benefits as cancer cells need to satisfy a continuous demand in macromolecule precursors to maintain their high proliferation rate . as a matter of fact , the reduction of mitochondrial respiration prevents a complete degradation of glucose to carbon dioxide ( co2 ) and water and leads to accumulation of precursors used by the major cellular synthesis pathways leading to amino acids , nucleotides , and lipids . second , cancer cells experience moderate to severely reduced oxygen tension , and the fact to preferentially exploit glycolysis to produce energy in this situation represents an interesting adaptation . accordingly , overexpression or stabilization of the hypoxia - inducible factor ( hif ) in response to low - oxygen conditions promotes the glycolytic metabolism , by inducing transcription of glucose transporters and numerous key glycolytic enzymes . an increased glycolytic flux means also very frequently overexpression and/or increased activity of specific isoforms of several glycolysis - related enzymes . glucose transporters , or key enzymes as hexokinase ii ( hkii ) , glyceraldehyde-3-phosphate dehydrogenase ( gapdh ) , lactate dehydrogenase ( ldh ) and the isoform m2 of pyruvate kinase ( pkm2 ) are upregulated in cancer cells and accordingly suggested as potential therapeutic targets [ 8 , 9 ] . interestingly , nonglycolytic functions are also emerging for several of these enzymes , and the novel activities ascribed do further promote cancer aggressiveness . for example , gapdh , ldh , or pkm2 may additionally activate gene expression by working as direct transcriptional factors or by interacting with and , thereby , modulating the activity of other nuclear proteins [ 1012 ] ( including hif-1 and the signal transducer and activator of transcription 3 ( stat3 ) [ 13 , 14 ] ) required in the transcription of genes especially implicated in cell proliferation ( e.g. , histones h2a and h2b , mek5 , c - myc , cyclin d1 , and androgen receptor [ 10 , 1315 ] ) . on one side , it activates the glycolytic pathway , ensuring the regeneration of nicotinamide adenosine diphosphate ( nad ) , as part of a feedback regulatory mechanism ; on the other side , it is secreted outside the cells where it promotes angiogenesis and spreading of cancer cells from their primary site . for example , the extracellular acidification due to the transport of lactate coupled to h extrusion promotes upregulation of hif-1 [ 16 , 17 ] . hif-1 , in turn , transactivates the ldh - a promoter . besides , acidic conditions destabilizes the behavior of the immune system , which further contributes to cancer invasion . lactate secretion , indeed , impairs the function of specific immune cells ( including cytotoxic t lymphocytes ) and cytokine production . furthermore , it promotes cell motility by controlling the expression level of constituents of the matrix [ 19 , 20 ] . identifying further advantages of the warburg effect , reducing the mitochondrial metabolism may inevitably decrease accumulation of reactive oxygen species ( ros ) . suppression of ros formation has been suggested as an important advantage for rapidly proliferating cell systems ; these cells may be better protected against the risk of dna damage during dna synthesis . this model seems to be encouraged by the observation that healthy highly proliferating systems temporarily switch to glycolysis before entering in s - phase . moreover , c - myc , which activates transcription of the glycolytic enzymes hkii , enolase-1 ( eno-1 ) , and ldh ( subunit a ) , further promotes this switch in concomitance with the entry in s - phase [ 2224 ] . more recently , unconventional roles were ascribed to pyruvate , the end product of glycolysis , which is massively converted into lactate in cancer cells instead of being transported into mitochondria to initiate mitochondrial metabolism . the plasma membrane transporter slc5a8 was reported to be downregulated in different human cancer cells [ 25 , 26 ] . its silencing occurs at very early stages of carcinogenesis ; moreover , the restoration of its expression triggers cell death . this transporter couples na extrusion to the intake of extracellular monocarboxylates , including pyruvate , into the cell . the group of ganapathy has proposed an interesting model to explain the tumour suppressor activity of slc5a8 specifically centered on the role of pyruvate . according to their findings , pyruvate acts as a specific inhibitor of histone deacetylase-(hdac-)1 and -3 isoforms , an event that in turn promotes cell death . therefore , keeping low levels of pyruvate may stabilize specific epigenetic aberrations established in cancer cells and promote cancer cell survival . accordingly several mechanisms may participate in buffering the intracellular pyruvate levels together with upregulated ldh - a in cancer cells . they include also transporters as slc5a8 and , conceivably , other monocarboxylate - specific transporters whose expression is modulated in cancer cells . therefore , the control of intracellular pyruvate levels could play an active and central role in the altered metabolic profile of cancer cells . moreover , it prompts us to consider additional roles for typical altered metabolic conditions in cancer cells that deal directly or indirectly with pyruvate accumulation . the preferential expression of the less efficient dimeric form of pkm2 ( slowly accumulating pyruvate ) or the relevance of the exacerbated conversion of pyruvate into lactate would be two interesting conditions to further investigate . in addition , these considerations remind us how much each metabolic alteration in cancer may play multiple functions , well exploited by cancer cells to succeed and ultimately survive and proliferate . preferential exploitation of aerobic glycolysis by cancer cells is a key issue of reprogrammed metabolism . it is becoming clear that other metabolic pathways or mediators may play a fundamental role in cancer . the availability of recent sophisticated experimental approaches to study the metabolic profile of cancer cells has allowed identification of an impressive number of alterations . they essentially concern levels of expression / accumulation or status of enzymes or intermediate substrates involved in several anabolic pathways . despite the evident advantage of these modifications within the anabolic process in which they are mainly involved , additional noncanonical functions have emerged , including control of redox homeostasis or specific signalling events enabling the high cellular proliferation rate . in this section , we will briefly discuss two key pathways suitable for therapeutic targeting . beside glucose , this amino acid is uptaken through specific transporters and directed to the mitochondria where it is converted first in glutamate ( by a mitochondrial glutaminase ) . glutamate then fuels the tricarboxylic acid cycle ( tca ) , upon further conversion to -ketoglutarate in a reaction catalyzed by glutamate dehydrogenase ( gdh ) . exceeding substrates from the tca cycle can be again available in the cytosol where they become the precursors of several anabolic pathways leading to biosynthesis of lipids , other aminoacids , and nucleotides . beside its relevant role in anabolic pathways , glutamine metabolism may also promote further accumulation of lactate ( via malate formation ) and therefore exacerbate glycolysis and nicotinamide adenine dinucleotide phosphate - oxidase ( nadph ) generation ( glutaminolysis ) , the latter further buffering potential oxidative stress into the cells . studies highlight that specific forms of cancer including glioblastoma develop an impressively high rate of glutamine metabolism , which goes beyond the real nitrogen demand , thus suggesting that glutamine consumption in cancer cells may represent a fast and preferential carbon source to replenish several biosynthetic pathways . this preferential use of glutamine may be further promoted by other factors , whose expression level is altered in cancer cells , for example , the nfe2-related factor ( nrf2 ) . altogether these observations imply that cancer cells may become addicted to glutamine metabolism to maintain their high rate of proliferation . therefore , targeting their ability to degrade glutamine may be of therapeutic relevance especially in glutamine - dependent types of cancer . a growing body of evidence depicts a determinant role of altered lipid homeostasis in enabling the cancer cell phenotype . the pattern of alterations described suggests that lipid metabolism plays a multitasking role in cancer . beyond the relevance of metabolic modifications that promote lipogenesis and therefore specific anabolic activities , lipid - related factors appear essential in controlling redox homeostasis and accumulation of specific lipid messengers , including lysophosphatidic acid and prostaglandins . accordingly , several enzymes and transcription factors controlling lipogenesis and lipid homeostasis are overexpressed in cancer , as we will detail later . these alterations were initially identified in hormone - dependent malignancies such as those affecting breast and prostate , thus confirming the relevance of steroid hormone - dependent pathways in the observed altered lipid metabolism . more recently , comparable patterns of alterations were identified in other cancer cell lines derived from melanoma , osteosarcoma , colorectal [ 36 , 37 ] , and lung cancer , as well as in hematopoietic cancer cells [ 39 , 40 ] . these cellular environments allowed to identify additional modulatory upstream pathways including mitogen - activated protein kinase-(mapk- ) dependent , phosphatidylinositol-3-kinase ( pi3k)/akt pathway [ 41 , 42 ] , h - ras and amp - activated protein kinase , ampk . in addition , a lipid - related transcription factor , the sterol regulatory element - binding protein ( srebp ) , whose target genes promote cancer aggressiveness , is upregulated in cancer . it is well - known that fatty acid neosynthesis is triggered by excess glucose leading to increased mitochondrial citrate concentrations . citrate is then converted in the cytoplasm into palmitoyl - coa , the precursor of triglycerides , and phospholipids synthesis . accumulation of triglycerides may be reverted after starvation when a decrease of the lipogenic intermediate malonyl - coa reactivates carnitine palmitoyltransferase-1 ( cpt-1 ) , thus leading to mitochondrial fatty acid oxidation . in cancer cells , de novo fatty acid synthesis is sustained and several lipogenic enzymes are typically upregulated . the consequent burst in lipidogenesis confers the advantage to further exacerbate additional biosynthetic anabolic activities enabling cell growth . the enzymes atp - citrate lyase ( acl ) , acetyl - coa carboxylase ( acc ) , and the fatty acid synthase ( fas ) are frequently overexpressed in cancer cells . especially fas was described as a potential cancer biomarker [ 47 , 48 ] for therapeutic purposes . this dual clinical potential is supported by the observation that fas inhibitors suppress carcinogenesis in in vivo procarcinogenic models of breast and lung tissues ; moreover , they trigger cell death in a number of cancer cell lines [ 34 , 47 , 5153 ] , without affecting normal lipogenic tissues . additionally , fas expression correlates with metastasis formation and its targeting alleviates chemoresistance when combined with chemotherapeutic agents . these multiple anticancer activities together with the observation that fas are overexpressed in premalignant lesions [ 56 , 57 ] strongly point at a very early role of fas overexpression in carcinogenesis and led to the speculation that this enzyme may effectively be considered an oncogene [ 5860 ] . besides , cancer cells show a preferential synthesis of phospholipids ( i.e. , lysophosphatidic acid ) instead of triglyceride . this biosynthetic diversion of lipid precursors leads to the accumulation of lipid messengers regulating a number of signalling events promoting cancer cell growth , survival and migration to other tissues . an accumulation of prostaglandins ( i.e. , prostaglandin e ) strengthens the procarcinogenic roles played by proinflammatory signalling events during carcinogenesis . remarkably , a tight cross - talk exists between lipid metabolism and modulation of the expression of the main proinflammatory mediator cyclo - oxygenase 2 ( cox-2 ) , which is constitutively overexpressed in cancer [ 62 , 63 ] . in line with these observations is also the fact that lipolytic enzymes like the monoacylglycerol lipase ( magl ) are overexpressed in cancer and may directly control the prostaglandin levels . taking into account recent publications about the roles of lipid metabolism in cancer , we are convinced that further discoveries will further strengthen the importance of these pathways in cancer treatment and prevention . cell death resistance and angiogenesis are two important pathways involved in tumour progression and survival [ 6668 ] . these independent processes are closely linked to cancer cell metabolism [ 67 , 69 ] . recent publications highlight mitochondria as modulators of these two critical pathways and promoters of metabolic homeostasis in cancer cells . the mitochondrion is the most important coordinator of both energy production and accumulation of biosynthetic precursors for cellular maintenance and survival . altered mitochondrial bioenergetics and functions play an important role in tumorigenesis by affecting cancer cell metabolism , decreasing mitochondria - dependent apoptosis , and contributing to angiogenesis [ 66 , 7072 ] . cancer cells present frequently a mitochondrial metabolic shift from glucose oxidation ( go ) to glycolysis , thus assimilating a larger amount of glucose compared to normal cells . by this way , cancer cells refuel themselves with phosphorylated intermediates required for growth and proliferation , through regulation of the metabolic key enzymes that govern the balance between go to glycolysis and by reducing the entry of pyruvate into mitochondria thus reducing the rate of tca cycle [ 17 , 73 , 74 ] . the accumulated pyruvate is in part converted to lactate during aerobic glycolysis and secreted to keep glycolysis active . the extracellular secreted lactate influences the extracellular matrix lowering the ph of the tumour environment , allowing a remodelling of the matrix and inducing blood vessel invasion in response to tumour - induced angiogenic factors . therefore , the reduced mitochondrial efficiency may induce the activation of hif-1 resulting in angiogenesis activation , cell migration , increased cell survival , and energy metabolism [ 75 , 76 ] . it has been demonstrated that dichloroacetate ( dca ) , which inhibits pyruvate dehydrogenase kinase ( pdk ) , activates go in mitochondria thus leading to decreased tumour growth in many cancer cell lines ; this event is accompanied by the inhibition of hif-1 . alterations in mitochondrial function not only influence the cellular metabolic status but also contribute to the control of the redox status of cancer cells . the large amounts of glucose available in the cells are metabolized through the pentose phosphate pathway ( ppp ) producing nucleosides and generating nadph [ 70 , 73 ] . high levels of ros , as generated in cancer cells , can promote oxidative damage - induced cell death . therefore , cancer cells maximize their ability to produce nadph to reduce ros activity . the difference in the redox status between normal and cancer cells may be a target to selectively kill cancer cells by ros - generating drugs . thus , the elicitation of ros can be exploited to induce cancer cells to undergo oxidative damage - induced cell death . another important modulator of the redox status in cancer cells is b - cell lymphoma-2 ( bcl-2 ) protein that is , overexpressed in a variety of cancer cells . the potential tumorigenic activity of bcl-2 is due to its antiapoptotic properties maintaining the integrity of the outer mitochondrial membrane and preventing its permeabilisation through sequestration of the proapoptotic protein b - cell lymphoma - associated x ( bax ) and bcl-2 homologous antagonist killer ( bak ) . however , regulation of ros levels by bc-2 was also demonstrated [ 81 , 82 ] as bcl-2 may affect the intracellular redox status in order to maintain the ros potential at the most favorable level for cancer cell survival . it supplies intracellular nutrients when the external ones are not available . unlike normal cells , cancer cells are placed in an environment deprived of nutrients and oxygen due to an insufficient vascularization . autophagy may support tumour growth ensuring the availability of endogenous metabolic substrates necessary to feed glycolysis , atp production , and pyruvate for the mitochondrial metabolism . autophagy recycles intracellular organelles and the resulting breakdown products contribute to produce energy and build up new proteins and membranes . indeed , autophagy provides an internal source of sugar , nucleosides , amino acids , and fatty acids by the degradation of protein , lipids , carbohydrate , and nucleic acids . thus , autophagy sustains cell metabolism and subsequently favors cancer cell survival in nutrient lacking tumours , besides preventing that cancer cells may accumulate dysfunctions in their mitochondria . number and the health status of mitochondria are controlled by an autophagic process called mitophagy . mitophagy is a mitochondrial quality control by means of which excessively damaged mitochondria become a substrate for autophagic degradation . dysfunctional mitochondria are linked to ros generation , induction of dna damage , and cell death . however , both activation and inhibition of the autophagic pathways may play a role in cancer therapy . it has been demonstrated that inhibitors of autophagy may target autophagy - dependent cancer cells because this modulation inevitably impairs cancer cell survival . on the other side , therefore , cytotoxic cancer therapies exacerbating autophagy may provoke increased oxidative stress or severe cell damage , thus sensitizing cancer cells to cell death ( i.e. , apoptosis ) . bcl-2 regulates autophagy by binding to the proautophagy protein beclin-1 and the proapoptotic protein bax . therefore , the cross - talk between autophagy and the mitochondrial metabolism is an important issue to be considered for cancer therapy . moreover , redox alterations associated with mitochondrial dysfunctions may be pivotal in preventing cancer formation , growth , and establishment at very early steps of carcinogenesis . the logical consequence of the elucidation of the multiple roles played by altered metabolism in cancer is the exploitation of this knowledge for preventive and therapeutic purposes . the existence of specific patterns of modulations identifies also potential molecular targets for future novel classes of anticancer compounds . in this section , it is essential for a cancer cell to activate the glycolytic pathway to satisfy the anabolic demand in consistent amounts of intracellular glucose . glucose is carried into cells via specific plasma membrane transporters that lead to glucose internalization by facilitation or active coupling to ion fluxes like the extrusion of na . frequently , specific isoforms of glucose transporters are overexpressed in cancer cells . the facilitative glucose transporters ( gluts ) belonging to the solute carrier ( slc2 ) several natural compounds have been described as potential modulators of glucose transporters ( figure 1 ) . a critical reading of the literature indicates that these compounds most likely affect expression of glucose transporters indirectly , rather controlling upstream modulatory mechanisms . annonaceous acetogenins are long chained fatty acid derivatives extracted from different tropical plants such as the tree annona muricata , also known as graviola . it has been recently shown that graviola extracts exert multiple anticancer activities on pancreatic cancer cell models . the extract reduces cell proliferation and viability by inducing necrosis ; besides , it counteracts cell motility . the potential anticancer properties have been confirmed with mouse xenograft models , where graviola extract reduces both tumour growth and formation of metastasis . an analysis centered on metabolic parameters underlines the ability of this compound to inhibit glucose uptake ; besides , it strongly reduces the expression levels of several metabolic actors , including glut1 and glut4 , hkii , and ldh - a . this pattern of modulation is the consequence of the modulation of multiple factors and pathways including the reduction of hif-1 and nuclear factor b ( nf-b ) expression levels and the inhibition of erk ( extracellular - regulated kinase ) and akt activation . due to the difficulties of specifically targeting glucose transporter expression without affecting many other intracellular pathways , an interesting alternative is to identify molecules that modulate the activity of glucose transporters . in this context several natural compounds deserve attention . following a natural product screening assay based on crude extracts of microbial origin aimed at identifying new inhibitors of filopodia protrusion ( special membrane structures involved in promoting metastasis ) , kitagawa and colleagues accordingly , the compound impairs the accumulation of the nonmetabolizable tritiated glucose analog 2-deoxyglucose ( dg ) without affecting the key glycolytic enzyme hk . their findings suggest that gpa may act by mimicking a glut1 substrate . from plants , polyphenols are interesting bioactive anticancer molecules as several of them have been repeatedly reported to control glucose transporter activity in different cancer cell models ; fisetin , myricetin , quercetin , apigenin , genistein , cyaniding , daidzein , hesperetin , naringenin , and catechin are well - known inhibitors of glucose uptake . investigations designated hexose and dehydroascorbic acid transporters including glut1 and glut4 [ 94 , 95 ] as their targets . comparative studies indicate that these compounds do not exhibit the same mode of action as they bind different domains of glut1 . genistein binds the transporter on the external face whereas quercetin interacts with the internal face . the ability of these compounds to act as protein - tyrosine kinase inhibitors is currently considered as the main mechanism responsible for the modulation of the glucose uptake . hexokinase ( hk ) is the enzyme controlling the first enzymatic step of glycolysis , allowing intracellular transformation of glucose via phosphorylation ( figure 1 ) . in cancer cells , hkii is the main isoform and is involved in the warburg effect and in enhanced cell proliferation . hk associates with the outer mitochondrial membrane in proximity of atp molecules required for hk 's enzymatic activity . the destabilization of this physical interaction negatively affects the overall cancer cell energetics ; moreover , it dramatically perturbs mitochondria , triggering the release of cytochrome c and , subsequently , inducing apoptosis . methyl jasmonate is a plant stress hormone produced by many plants including rosemary ( rosmarinus officinalis l. ) , olive ( olea europea l. ) , or ginger ( zingiber officinalis ) ; it binds to hk and perturbs its association with the voltage - dependent anion channel ( vdac ) in cancer cells . this event leads to overall energetic impairment ; moreover , it promotes the release of cytochrome c from mitochondria , triggering apoptosis . its use in combination with the antiglycolytic agent 2-deoxyglucose or chemotherapeutic agents is currently under investigation . glyceraldehyde-3-phosphate dehydrogenase ( gapdh ) is a key glycolytic enzyme catalyzing the conversion of glyceraldehyde-3-phosphate to glycerate 1,3-biphosphate , accompanied by the generation of nadh . there is evidence that gapdh may play multiple noncanonical functions implicated in cell growth and survival . the bis - quinone alkaloid saframycin , a bacterial product of fermentation , exhibits antiproliferative properties in both adherent and nonadherent cancer cell models . this compound possesses activities comparable to alkylating agents . the group of myers has shown that saframycin may form a nuclear ternary complex with gapdh and dna involved in the antiproliferative effect ascribed to this compound . recently , the embryonic isoform m2 ( pkm2 ) is attracting interest for diagnostic and therapeutic purposes in cancer . enzymes of the pyruvate kinase family catalyze the final , rate - limiting , step of glycolysis , leading to the accumulation of pyruvate from phosphoenolpyruvate in an atp - producing reaction . importantly , pkm2 exists as a dimeric or a tetrameric form ; the latter one efficiently catalyzes pyruvate formation whereas the dimeric form is nearly inactive . in cancer cells high - throughput screenings based on an enzymatic ldh assay to explore a compound library including molecules approved from the food and drug administration ( fda ) and purified natural products have led to the identification of three potential chemical structures associated with a potential inhibitory activities on pkm2 . active compounds include thiazolidinediones and natural compounds belonging to the group of naphthoquinones : shikonin , alkannin , and their derivatives ( extracted from different plants including arnebia sp . and alkanna tinctoria ) these compounds reducing lactate production and glucose consumption in cancer cells are also known to induce necroptosis . however , the inhibitory effect on pkm2 is independent of their effect on cell viability , rather suggesting an impairment of the glycolytic metabolism . even though pkm2 is crucial for cancer cell survival subsequently , a second line of research currently aims at promoting the reactivation of pkm2 in cancer cells . the increase of tetrameric versus dimeric pkm2 isoform ratio abrogates the warburg effect and may reactivate oxidative phosphorylation . so far a few promising studies have been published identifying some chemical scaffolds as potential pkm2 activators . they include sulfonamides , thieno[3,2-b]pyrrole[3,2-d]pyridazinones , and 1-(sulphonyl)-5-(arylsulfonyl)indolines that act as small - molecule allosteric modulators binding to a surface pocket of the enzyme , thus facilitating the association of different pkm2 subunits . identification of first chemical scaffolds may be the basis for the discovery of structurally related natural compounds . there is no doubt that hif-1 is a central molecule in the control of the expression of glucose transporters and key glycolytic enzymes as well ( figure 1 ) . several attempts rely on cell - based assays with reporter gene constructs under the control of a hif-1 response element . the group of zhou has discovered and characterized novel hif-1 inhibitors in ( i ) manassantins ( manassantin b and 4-o - demethylmanassantin ) extracted from the aquatic plant saururus cernuus and ( ii ) alpinumisoflavones ( alpinumisoflavone and 4-o - methyl alpinumisoflavone ) isolated from the tropical legomaceous plant lonchocarpus glabrescens . these compounds inhibit hypoxia - induced hif-1 activation ; besides , they may affect the expression of hif-1 and hif-1 target genes including glut1 and/or vegf . similarly , the group of nagasawa has identified the cinnamic acid derivatives baccharin and drupanin , extracted from the brazilian green propolis as inhibitors of hif-1-dependent luciferase activity . they inhibit the expression of hif-1 and its target genes ( glut1 , hkii , and vegf ) ; besides , they exhibit antiangiogenic effects . several natural compounds have been shown to be able to target mitochondrial metabolism and functions , besides affecting cell death and angiogenesis , both important pathways involved in cancer progression . curcumin is a natural compound extracted from curcuma longa , widely used as a spice . its anticarcinogenic and chemopreventive effects target mitochondrial metabolism and function inducing cell death and angiogenesis in a variety of cancer models . in human colorectal carcinoma cells , curcumin induces mitochondrial membrane potential , induces procaspase-3 and -9 cleavage and apoptosis in a dose- and time - dependent manner accompanied by changes , and release of lactate dehydrogenase . it leads to cell cycle arrest in s phase , accompanied by the release of cytochrome c , a significant increase of bax and p53 levels , and a marked reduction of bcl-2 and survivin in lovo cells . dimethoxycurcumin ( dimc ) , a synthetic analogue of curcumin , induces cell cycle arrest in s phase and apoptosis in human breast carcinoma mcf-7 cells by affecting mitochondrial dysfunction by oxidative stress . accordingly , it was observed that dna damage and apoptosis followed an induction of ros generation and a reduction of glutathione levels . mitochondrial dysfunction was also witnessed by a reduction of the mitochondrial membrane potential and a decrease of the cellular energy status ( atp / adp ) by the inhibition of atp synthase . therefore , the mitochondrial dysfunctions correlated with changes in the expression of apoptotic markers like bax and bcl-2 . several studies indicated redox alterations as a causative mechanism implicated in mitochondrial dysfunction in cancer . chen et al . published a novel pathway for curcumin regulation of the ros - lysosomal - mitochondrial pathway ( lmp ) and identified cathepsin b ( cath b ) and cathepsin d ( cath d ) as key mediators of this pathway in apoptosis . in lung a549 cancer cells , curcumin induces apoptosis via lysosomal membrane permeabilisation depending on ros increase , which precedes the occurrence of mitochondrial alterations . further studies demonstrated that curcumin - induced ros generation decreases the mitochondrial membrane potential followed by downregulation of bcl-2 expression , bax activation , and release of cytochrome c into the cytosol , paralleled by the activation of caspase-9 and -3 in small cell lung cancer ( sclc ) and npc - tw 076 human nasopharyngeal carcinoma cells [ 111 , 112 ] . curcumin - induced apoptosis in the colon cancer cell line hct116 is significantly enhanced by the suppression of mitochondrial nadp(+)-dependent isocitrate dehydrogenase activity which plays an essential role in the cell defense against oxidative stress by supplying nadph for the antioxidant systems . amaryllidaceae alkaloid pancratistatin isolated from the bulb of hymenocallis littoralis exhibits potent apoptotic activity against a broad panel of cancer cells lines with modest effects on noncancerous cell lines . pancratistatin led to ros generation and mitochondrial depolarization , leading to caspase - independent cell death in breast carcinoma cells . in colorectal carcinoma cell lines , but not in noncancerous colon fibroblast cells , pancratistatin decreased mitochondrial membrane potential and induced apoptotic nuclear morphology independently on bax and caspase activation . in colon cancer cells , resveratrol , a natural stilbene from grapes , blueberries , or cranberries , induces apoptosis by nitric oxide production and caspase activation . conversely , in multiple myeloma cells resveratrol increased apoptosis , by blocking the activation of nf-b and subsequently downregulation of target genes including interleukin-2 and bcl-2 , leading to cell cycle arrest . the cross - talk between mitochondria and the autophagic machinery could be used as a therapeutic strategy . it has been demonstrated that resveratrol induced a crosstalk among autophagy and apoptosis to reduce glioma growth . indeed , resveratrol has an impact on the formation of autophagosomes in three human gbm cell lines , accompanied by an upregulation of autophagic proteins atg5 , beclin-1 and lc3-ii . however , the inhibition of resveratrol - induced autophagy triggered apoptosis with an increase in bax expression and cleavage of caspase-3 . thus , resveratrol activates autophagy by inflicting oxidative stress or cell damage , in order to sensitize glioblastoma cancer cells to apoptosis . also , curcumin treatment of human liver - derived hepg2 cells induces the reduction of mitochondrial membrane potential and the activation of autophagy . this finding underlines the importance of mitophagy in the process of cell death of nasopharyngeal carcinoma cells . as mentioned earlier , another important pathway in mitochondrial dysfunction involved in tumour progression is hif-1. it has been published that curcumin plays a pivotal role in tumour suppression via the inhibition of hif-1-mediated angiogenesis in mcf-7 breast cancer cells and in hepg2 hepatocellular carcinoma cells [ 119 , 120 ] . anticancer activity of curcumin is attributable to hif-1 inactivation by aryl hydrocarbon nuclear translocator ( arnt ) degradation . bavachinin inhibited increased hif-1 activity in human kb carcinoma derived from hela cells . in human hos osteosarcoma cells under hypoxia , bavachinin decreased transcription of genes associated with angiogenesis and energy metabolism that are regulated by hif-1 , such as vascular endothelial growth factors ( vegfs ) , glut1 , and hkii . bavachinin may be used as a therapeutic agent to inhibit tumour angiogenesis . indeed , in vivo studies showed that injecting bavachinin significantly reduced tumour volume in nude mice with kb xenografts . figure 2 summarizes the major mechanisms of action described for natural compounds as mitochondrial modulators . glutamine and glucose are the main carbon sources used by cancer cells to satisfy their anabolic demand . published data indicate a role for glutamine metabolism within the malignant cell phenotype . accordingly , several cancer cell lines present a high rate of glutamine consumption and strategies are investigated to target enzymes implicated in this pathway . inhibiting the activity of glutamate dehydrogenase ( gdh ) is an effective anticancer strategy as documented in glioblastoma cells with combinatorial treatments with agents depleting cells of glucose or inhibiting specific kinase-(i.e . polyphenols extracted from green tea including epigallocatechin gallate ( egcg ) and catechin gallate ( cg ) inhibit gdh , by recognizing and binding to the site of the allosteric regulator adp [ 123 , 124 ] . these findings allow to speculate about the potential use of these polyphenols and of their derivatives with improved bioavailability in the treatment of glutamine - dependent forms of cancer . fas sustains the altered lipid metabolism in cancer cells . as discussed in section 2.2.2 , this property amplifies the possibility of impairing its enzymatic activity with different specific compounds . the antibiotic cerulenin ( extracted from the fungus cephalosporium caerulens ) acts as noncompetitive inhibitor of the -ketoacyl synthase domain . tetrahydrolipstatin , also known as orlistat ( a derivative of the natural compound lipstatin ) , targets the thioesterase domain of fas . triclosan affects the enoyl - reductase activity of the enzyme . finally , the synthetic chemical derivative of cerulenin c75 is the most potent compound in vitro able to affect all the three domains mentioned earlier in a competitive irreversible way . orlistat was approved by the food and drug administration ( fda ) for its ability to reduce body weight . besides , all these molecules display anticancer activities by blocking cancer cell proliferation and triggering cancer cell death . nevertheless , their actual application for cancer treatment is hindered by several side effects , which include their ability to modulate other enzymes ( i.e. , the increase of cpt-1 activity and fatty acid oxidation by cerulenin and c75 leading to weight loss [ 130 , 131 ] ) , their reduced bioavailability ( i.e. , orlistat ) , or stability in vivo ( i.e. , c75 inactivation by intracellular glutathione and other small thiols ) . current research efforts focus on the design of new synthetic derivatives of this first group of molecules , on one side , and on the identification of new compounds of natural origin , on the other side , both potentially showing improved characteristics of specificity and bioavailability / stability in vivo . in this context , the potential identification of new fas inhibitor from natural compounds is a particularly interesting strategy , especially by investigating compounds of vegetal origin showing the double favorable profile of being regularly consumed in the diet and displaying at the same time hypolipidemic and anticancer activities . further investigations have identified catechin gallate derivatives ( including egcg , epicatechin gallate ( ecg ) , and catechin gallate ( cg ) ) as specific fas inhibitors as demonstrated by in vitro assays of fas enzymatic activity [ 134 , 135 ] . the galloyl moiety of the catechins is essential for the inhibitory activity of these molecules ; it directly interacts and modulates the function of the -ketoacyl reductase domain of fas [ 134 , 135 ] . the group of tian has first described several flavones including luteolin , quercetin , kaempferol , myricetin , fisetin , and baicalein as inhibitors of the -ketoacyl reductase domain . the flavone luteolin and the flavonols quercetin and kaempferol ( and with a lower extent the flavone apigenin and the flavanone taxifolin ) have been shown to act as potent inhibitors of lipogenesis in a comparative study with egcg in prostate cancer . an in vitro fas enzymatic activity assay confirmed their ability to inhibit fas , however , less potently compared to ecgc . tian and colleagues suggested that all polyphenolic fas inhibitors share a biphenyl core potentially responsible for their described inhibitory activity . possible differences may account for a structure - dependent mechanism of action , where flavones as quercetin and kaempferol containing hydroxyl groups at specific positions display a reversible fast binding inhibitory activity , whereas egcg and ecg exhibit an irreversible slow binding activity . it has been taken into account , however , that further variability may be associated with differential uptake , metabolization , and intrinsic stability of the compounds . finally , the effects on lipid metabolism may be the result of multiple intracellular signalling events , modulated by polyphenolic compounds and eventually converging towards the control of the lipid metabolism . this ability may be partially linked to the known antagonistic activity of this compound towards the nf-b - mediated pathway . besides , curcumin and its derivatives have recently been shown to modulate the ampk - srebp pathway [ 141 , 142 ] . green tea extracts prevent egf - induced upregulation of fas in mcf-7 via modulation of a pi3 k / akt - dependent pathway . other polyphenolic compounds have been identified as inhibitors of lipidogenesis by targeting fas and/or the transcription factor srebp expression through the modulation of specific pathways . these findings may therefore suggest further relevant pathways involved in the control of the lipid metabolism in cancer cells . for example , resveratrol , a stilbene contained in grapes , produces hypolipidemic effects by activating the nad - dependent deacetylase sirtuin 1 ( sirt-1 ) , which positively modulates ampk ; ampk activation , in turn , prevents lipid accumulation by controlling several events , including fas downregulation . moreover , it is a common property shared with compounds from other plants showing hypolipidemic properties , as observed with extracts from hibiscus sabdariffa . promising interesting therapeutic implications may derive also from phenolic compounds contained in the extra - virgin olive oil , which was described as a very active inhibitor of fas expression and controller of lipid biosynthesis in breast cancer cell models . compounds belonging to lignans ( 1-[+]-pinoresinol and 1-[+]-acetoxy - pinoresinol ) , flavonoids ( apigenin and luteolin ) , and secoiridoids ( deacetoxyoleuropein aglycone , ligstroside aglycone , oleuropein glycoside , and oleuropein aglycone ) appear as the most active compounds , by activating ampk and reducing srebp-1 expression . similarly , polyphenols oleuropein and hydroxytyrosol from extra - virgin olive oil were able to inhibit fas activity in colorectal cancer sw260 cells , and this effect correlated with their antiproliferative potential . however , this effect could not be confirmed in another colon model ( ht-29 ) suggesting cell - type specific effect and further unrelated mechanisms . targeting lipid metabolism and especially fas activity remains a promising perspective to target cancer cell survival . brusselmans and colleagues showed that palmitate added to the culture medium of prostate cancer cells allowed to bypass the downstream effects of fas inhibition by luteolin on lipid metabolism and prevented the cytotoxic effect of this compound ; moreover , the silencing of fas expression with fas sirna produced similar cellular alterations as luteolin . these findings allow predicting a causative role of fas inhibition in the antiproliferative and cytotoxic effect of polyphenols and prompt to explore the relevance of the control of the lipid metabolism by polyphenols in the anticancer activities ascribed to many of these compounds . the targeting of altered cell metabolism in cancer cell is a promising still unexplored area in anticancer strategies . in this review , we have highlighted that many of these modifications take place at very early steps of carcinogenesis , thus at preneoplastic stages . therefore , their targeting may be a powerful weapon for chemopreventive purposes . besides , the literature clearly shows the crucial addiction of cancer cells to several metabolic aberrations to proliferate and survive , further underlining the importance of the targeting of some metabolic - related factors in future anticancer therapies . identification of specific aberrantly regulated metabolic keynodes , in terms of the expression and/or activity of these factors , delineates the nature of potential pursuable molecular targets . despite all these considerations , the effective number of agents under investigations for antimetabolic purposes is still very poor and at a very preliminary stage . good candidates should present a favorable profile ensuring excellent differential toxicity against cancer versus healthy cells , a reduced risk of systemic toxicity , combined to a favorable profile in specific pharmacological properties including bioavailability , half - life , and stability . many natural compounds have so far been identified as anticancer agents by affecting almost each cancer hallmark . taking into account recently identified cross - talks between altered metabolic mediators and altered proliferation , survival , or migration properties , we may suspect that many of the anticancer properties so far ascribed to natural compounds are mainly due to a their potential in modulating cellular metabolism . remarkably , we have reported here many examples of dietary polyphenolic compounds from fruits and vegetables , which display specific antimetabolic functions ( figure 1 ) . although there is consistent evidence of multiple beneficial biological properties on health , there are yet some obstacles which hinder promising natural compounds from being already used for chemopreventive and therapeutic purposes including bioavailability and adsorption . moreover , information concerning the stability and the clearance of natural occurring compounds frequently remains to be yet determined ; additional efforts will be required towards the elucidation of this important properties in the next future . rapid advancement in new screening systems allowing the analysis of large libraries of isolated naturally occurring compounds offers new important and fast tools for the selection of promising antimetabolic compounds especially from dietary origins with reduced side effects . relatively low costs for their extraction / production in large amounts make them interesting for commercial objectives and represent a good basis for chemical modifications that may further improve their anticancer activities and facilitate their pharmacological use and efficiency .

the foundation for teaching and learning of family medicine for undergraduates was laid in sri lanka in the year 1983 and a limited clinical exposure was introduced to the curriculum of the faculty of medicine , university of colombo . family medicine was introduced to the undergraduate curriculum of the faculty of medicine , university of kelaniya in early 1990s and other medical faculties in the country have also incorporated this discipline into their curricula . the curriculum was revised in a stepwise manner guided by student feedback and program evaluations conducted from time to time and the current curriculum includes 12 lectures and two small group discussions ( sgd ) scheduled in the 3 year and a clinical attachment of 1 month duration in the 4 year of the 5 year curriculum . by 4 year , students complete at least one rotation in each of the other medical disciplines namely internal medicine , general surgery , pediatrics , obstetrics and gynecology and psychiatry and at least some of the sub - specialties , for example ophthalmology and otolaryngology . on the other hand , most of the basic and applied science modules are being covered by then . during this attachment , students are exposed to primary medical care in three settings : university family medicine clinic ( ufmc ) , general practices in the community and the out - patient department ( opd ) at the nearby teaching hospital . the ufmc delivers its services free of charge to patient attending the clinic from surrounding areas . at the commencement of the clerkship each student is given a study guide containing learning objectives , teaching learning activities , learning resources , details of assessment and work sheets to record learning experiences . at the ufmc , they are exposed to a variety of teaching and learning experiences . students are expected to take a history , examine their patients and think about a possible plan of management before that patient is seen by a doctor . subsequently , management of this patient is observed and discussed during the actual consultation where teaching takes place in a one - to - one basis . this arrangement facilitates active participation of the student and high level of supervision and constructive feedback by the trainer . they are given opportunities , on an individual basis , to elicit histories from patients , convey information , share decisions and arrange follow - up plans appropriately . similarly , clinical examination skills are learned through observation and performing examination under the supervision of the teacher . student could learn procedural skills , like blood pressure measurement , use of peak flow meter , ophthalmoscope and auroscope . in addition , they receive hands - on experience in documentations such as writing prescriptions and referral letters , requesting investigations and record keeping , especially in the general practice setting . kogan et al . concluded following a literature review that direct observation of medical trainees with actual patients by clinical supervisors is critical for teaching and assessing clinical and communication skills . practical demonstrations are held on clinical skills such as ear - nose - throat examination , recording an electrocardiogram , nebulization , vision assessment after which they get the opportunity to practice them . each student should complete the checklist of clinical skills [ box 1 ] during the attachment . a sgd [ box 2 ] is held every day following the clinical training to discuss family medicine concepts , common clinical conditions seen in general practice and symptom evaluation and management in primary care . from the very beginning , on a roster basis , the student who is assigned to the reception desk on a particular day is expected to register patients , open medical records , update records and direct patients to wherever necessary . this provides an opportunity for students to gather hands - on experience and familiarize with the roles of other members of the practice staff . this exposure may help them to appreciate , even at undergraduate level , the importance of multidisciplinary involvement in patient management and practice management . during this attachment students visit the general practices of the extended faulty staff on three saturdays where they are exposed to primary care in the community . they learn by observing consultations , taking histories , examining patients and discussing subject matters with their gp tutors . at the general practice they are also expected to write a detailed account of a patient case write - up to demonstrate family medicine principles involved in the management of that particular patient . log entries by all students will be pooled together to provide an overall picture of the spectrum of problems seen in family practice . the data is summarized and presented at the seminar under three topics ; patient profile - age and sex distribution , reason for encounter , problem definition and management ( pharmacological and non - pharmacological ) of the patient . students also should observe the lay out and organization of the practice they visit and make a presentation at this seminar . this seminar is held at the end of the attachment and students make presentations , discuss and share their learning experience with gps in the community . during their two visits to the opd of the nearby teaching hospital they are expected to identify a patient visiting the opd at the point of registration and be with him / her throughout their visit until they leave the hospital premises . they are expected to study differences between a family practice and an opd and think of measures to improve the care given at an opd . the aim of this activity is to stimulate students to critically think and appreciate the strengths and weaknesses of general practice care and other sources of primary care . assessment of students is as important as the course content and the nature of the assessment tends to motivate and guide what and how students learn . direct observation and feedback , the checklist and work sheets where students make log entries during the gp visits are the in course and formative assessment methods incorporated into this attachment . in course formative assessments are being increasingly recognized as improving effective learning as well as monitoring student progress . a review of literature by fromme et al . concluded that direct observation is a unique and useful tool in the assessment of medical students and assessing learners in natural settings offers the opportunity to see beyond what they know and into what they actually do . by observing and assessing learners with patients and providing feedback , trainers could help trainees to acquire and improve skills . a committee on medical education and accreditation has also recommended on - going assessment that includes direct observation of trainees clinical skills . the checklist specially is an indication of the level of clinical experience and competence achieved by the student and it 's a means of self - assessment to student . the written assessment which comprised of two structured essay questions to be answered within a h duration contributes to the final summative assessment at the end of the academic year . this study was planned to evaluate this attachment by exploring student views on teaching and learning methods , learning environment and availability of resources for their training with a view to identify successes and failures of the attachment . the outcome will be of benefit to other medical schools already incorporated and planning to introduce family medicine / general practice training programs to students . this descriptive cross - sectional study was carried out among consenting students over a period of 6 months in 2011on completion of the clinical attachment using a pre - tested self - administered feedback form . close - ended questions which the responses were put into likert scale , evaluated the students satisfaction on teaching learning methods , learning environment and resources . the consenting students were requested to place the completed questionnaire in a sealed box which was opened after the completion of their final assessment in family medicine at the end of the 4 year . completed questionnaires were submitted by 114 students with a response rate of more than 99% . vast majority ( 90% ) had a clear idea about the learning outcomes of the clinical appointment and 93% acknowledged the importance of previously learnt factual information and skills to maximize the benefits of the clinical attachment . preference in teaching learning methods figures 2 and 3 show the opportunity they had to learn different skills . opportunity to develop skills opportunity for examination skills / procedures following table 1 shows their views on other aspects of the attachment . student feedback is extremely important to assess if students have achieved particular objectives of a training program . such a feedback helps to design , develop , construct and strengthen training programs and improve the quality of teaching and learning and beneficial to students , faculty and institution alike . this study was conducted at the end of the clinical attachment but before the final assessment which is held at the end of the academic year . researches attempted to overcome a possible bias in student feedback by requesting them to place the completed questionnaire without any identification link in a sealed box and by informing them that it would be opened only after the release of the results of the summative assessment at the end of the academic year . it is encouraging that students had a clear idea about the learning outcomes of the attachment . if students learn without having an understanding of the objectives they will not be able to engaged in focused learning to acquire desired knowledge and skills . study guide which students receive on the 1 day spells out the learning objectives for each setting . by the expression of 90% students in this study shows that one of the objectives of providing a study guide has been achieved . therefore providing a document with the objectives , learning outcomes and details of the program at the beginning is a successful strategy in informing students of the objectives . this is an important revelation since it gives the correct idea of the discipline to students as well . family medicine is a specialty in breath which encompasses almost all the other branches of medicine but at a different level ( primary care ) and at a different depth . one of the objectives of this attachment is to train students to apply knowledge and skills gathered from other disciplines for management of patients at primary care level . it 's an encouragement that the vast majority ( 92% ) appreciated the teaching methods in general . this has been shown in similar studies . in a study of general practice attachment in scotland , students conducting their own consultations was the most valued activity and a study conducted at the faculty of medicine , colombo , sri lanka also highlighted the value of supervised patient consultations . grant and michael robling revealed that students valued one - to - one teaching in their study conducted in uk . kalantan et al . has identified lack of student involvement in the consultation as a reason for poor student satisfaction . students preferred learning from interacting with patients , seminar and debate but there was a relatively low rating for sgds . it 's an eye - opener for teachers and sgds should be planned and conducted in a more meaningful manner . in our study , learning opportunities for practical skills are significantly low except for a few basic skills . poor opportunities to perform or improve procedural skills in general practice settings has been a constant finding in many other studies conducted in different parts of the world . one reason for this could be the fact that patients spend only a limited time in an outpatient set up in contrast to patients in a ward where students get ample opportunities to sharpen their skills . other reason may be the non - availability of adequate number of equipment which students have revealed in this study . students have gained adequate understanding of family medicine concepts and practice organization , which are the main objectives of the attachment . program for the entire month is prepared at the beginning and its available to students as well as teachers . since both groups are aware of teaching and learning activities beforehand they can prepare for their tasks in advance . however , they are satisfied with the space in the consultation room . when planning a teaching practice it 's important to ensure adequate space for student activities . students have agreed that the end of attachment assessment was linked to their learning experience . teachers were mindful and have selected and set questions in relation to learning objectives and the past questions would have guided them to acquire specific knowledge . overall student satisfaction was at a higher level . direct observation and feedback from teachers was the most popular . emphasis should be placed on retaining and further strengthening participatory based learning methods preferred by studentsintervention is needed to obtain adequate clinical equipment and improve facilities in the learning environmentmore learning opportunities need to be created to enhance acquisition of clinical skills . this may be a difficult task considering the hurdles and knowledge emanating from other studies . students should be encourage to practice and acquire these clinical skills from other clinical attachments and skills lab . emphasis should be placed on retaining and further strengthening participatory based learning methods preferred by students intervention is needed to obtain adequate clinical equipment and improve facilities in the learning environment more learning opportunities need to be created to enhance acquisition of clinical skills . this may be a difficult task considering the hurdles and knowledge emanating from other studies . students should be encourage to practice and acquire these clinical skills from other clinical attachments and skills lab .

impairments in physical and cognitive functioning , as well as onset of chronic diseases , are often feared in later life as such changes lead to dependence in tasks of daily living , depression , and hospitalization . compared to white elders , african american older adults experience a greater number of years exposed to the negative impacts of chronic disease and functional disability making disability intervention especially important for this minority group . the field of gerontology has identified lower - extremity physical performance measures as key for identification of early changes that may lead to disability in older adults . lower - extremity measures of physical performance are predictive of several outcomes in later life including declines in activities of daily living ( adls ) , hospitalization , risk for death , nursing home placement , and hip fracture [ 2 , 3 ] . reflecting the observed racial and socioeconomic discrepancies in rates of disability among older adults , african american elders score more poorly on performance - based measures of physical function than both white adults and suburban african americans . while much evidence exists for the relationship between cognitive functioning and adl declines [ 68 ] , fewer studies have focused on the associations between physical performance and cognition , specifically executive functioning , in minority populations . executive functioning encompasses a broad range of cognitive abilities such as the planning , sequencing , and execution of complex goal - directed behaviors characteristic of iadls ( instrumental activities of daily living ) [ 9 , 10 ] . amongst cognitive domains such as memory , language , visuospatial ability , and psychomotor speed , executive functioning is deemed as essential to preserved functional status [ 11 , 12 ] . prior studies have found that executive functioning is related to mobility and balance among older adults [ 1315 ] ; however , this relationship may be attenuated after accounting for disease burden in african american elders . additionally , it remains unclear whether performance of physical tasks may involve executive functioning more than other domains of cognition and whether screening measures of global cognitive functioning , such as the mini mental status exam ( mmse ) , which are commonly used in disability risk assessments , may adequately predict physical performance declines [ 14 , 17 , 18 ] . neuroimaging studies and clinical observation of age - related cognitive disorders such as parkinson 's disease and vascular dementia , provide evidence that changes in brain structures result in impairments in both cognitive functioning and physical performance . the frontal subcortical region , implicated in tasks of executive functioning , is particularly sensitive to effects of cardiovascular risk factors ( cvrfs ) such as atherosclerosis , hypertension , stroke , and diabetes [ 2024 ] . vascular burden is associated with presence of white matter hyperintensities ( wmhs ) , brain atrophy and infarcts . older adults with compromise to the white matter pathways connecting subcortical and frontal regions secondary to vascular processes demonstrate poor executive functioning , slow gait speed and depression [ 15 , 25 ] . the co - occurrence of these symptoms is associated with greater functional dependency , poorer physical performance , and mortality . african american adults have higher body mass index ( bmi ) , and a greater number of health conditions , particularly cvrfs such as hypertension and diabetes , when compared to their white , same - gender peers [ 27 , 28 ] . both obesity and inactivity are associated with disability . exercise interventions have been shown to improve scores on measures of lower - extremity functioning and decrease risk for mortality , frailty , disease and obesity ; however , it remains unclear what level of exercise is needed to decrease disability risk . in order to develop interventions and delay disability onset within african american elders , a high - risk group of older adults , further work is needed to understand the impact of medical conditions and the potential benefit of exercise to prevent early disability . the goals of this study are to ( 1 ) identify whether a specific domain of cognition versus global cognitive functioning may be uniquely associated with physical performance ; and ( 2 ) to examine relationships between physical performance and a range of factors associated with disability risk including cognition , depression , exercise , disease burden , bmi and demographics in a sample of community - dwelling african american older women . based on previous research it was predicted that executive functioning would be significantly associated with physical performance while other domains of cognition would not and that physical performance would be related to demographics , depression , exercise , health , and cognition . participants were drawn from the health , disability and cognitive function in urban african american older adults dataset , which includes 130 community - dwelling african american adults between the ages of 55 and 100 who resided in the city of detroit . this project received approval from the institutional review board , human investigation committee of wayne state university . subjects were recruited from independent living centers , community centers and senior apartments through presentations within the community given by the pi . fliers stating that the aim of the study is to understand health and cognitive functioning in older african american adults were also given to potential participants . individuals were excluded if they ( 1 ) did not self - report as african american or black ; ( 2 ) were unable to speak english fluently ; ( 3 ) had major hearing or vision loss ; and/or ( 4 ) were below age 55 . because the dataset contained a significantly greater proportion of females ( 87.7% ) , male participants were excluded from these analyses . a summary of participant characteristics is presented in table 1 and mean raw scores on cognitive measures for the final sample are presented in table 2 . the final sample was comprised of 106 african american women ages 56 to 91 ( mean = 71.83 ; sd = 7.73 ) , and with 6 to 18 years of formal education measures reported in this study were administered as part of a larger evaluation that involved data collection on demographics , physical health , cognition , health behaviors , and mental health in urban african american elders for a dissertation project . data was collected in an individual interview session format by three trained interviewers who were supervised by a research psychologist ( pl ) . participants were informed of the length of the test battery prior to participation . however , due to participant time restraints leading them to leave early or arrive late , as well as slowness in completing the measures , the battery occasionally had to be shortened or terminated before all measures were completed . the fome is a measure of verbal memory that involves recall of 10 common objects . recall trials are separated by a distraction task to minimize the effects of short - term memory . the mmse is an 11-item screening tool used to obtain an estimate of an individual 's global cognitive functioning and orientation to date , time , and place . the stroop c / w test is a measure of processing speed and mental flexibility . the stroop test is comprised of three subtasks : color word naming , color naming , and naming the color of ink a color name is printed in . for example , saying green when the word red is printed in green ink . trail making test , part a ( tmt - a ) . part a of the tmt is a measure of attention and psychomotor processing speed in which participants are asked to connect numbers in numerical order ( 1 - 2 - 3 and so on ) as quickly as possible . the wasi block design subtest is a timed measure of visuoconstructional abilities in which participants use blocks to construct three - dimensional figures from a two - dimensional drawing in the stimulus book . the gds-15 is a shortened version of the original 30-item screening questionnaire that is presented verbally to the participant . respondents answer yes or no to questions regarding how they have felt over the last two weeks . total scores range from 0 to 15 , with higher scores indicating greater depressive symptomology . participation in exercise was obtained from self - reported answers to the following questions : ( 1 ) do you participate in a regular program of exercise ? and if yes , then participants were asked whether a doctor had ever told them that they have health conditions that were grouped into two disease categories : ( 1 ) cardiovascular ( i.e. , hypertension , stroke , myocardial infarct , congestive heart failure , vascular disease , and diabetes ) , or ( 2 ) general health ( i.e. , arthritis , chronic obstructive pulmonary disease , gastrointenstinal conditions , kidney disease , and liver disease ) . table 3 shows the number of participants that reported each of these health conditions . the sppb used in this study was replicated from methodology used in the established populations for epidemiologic studies of the elderly ( epese ) studies that examined physical functioning in over 5,000 mostly white older adults . lower - extremity function was assessed through the performance of three tasks : standing balance , walking , and chair stands . balance was assessed by recording the amount of time each participant could maintain each of the following three poses : semitandem ( heel of one foot to the side of the first toe of the other foot ) , tandem ( heel to toe ) , and side - by - side . timing stopped when the participant lost balance , grasped for the examiner , or ten seconds had elapsed . 's criteria , participants received a score of a 1 if they were able to hold a side - by - side position for 10 seconds , but were unable to hold a semi - tandem position ; a score of a 2 if they could hold a semi - tandem position for 10 seconds but were unable to hold a full tandem for more than 2 seconds ; a score of a 3 if they could stand in full tandem for 3 to 9 seconds ; and a score of a 4 if they could stand in full tandem for 10 seconds . gait speed was assessed by two 3-meter walks , at a normal everyday pace , which was marked out for each subject in advance . the faster of their two walks was used as their final score which was recorded in quartiles such that a score of 1 = 5.6 seconds ; a score of 2 = 4.45.5 seconds ; a score of 3 = 3.84.3 seconds ; and a score of 4 = 3.7 . the final task , chair stands , required the participants to fold their arms across their chest and to stand up from a sitting position once . upon successful completion of this task , participants were asked to stand up and sit down with their arms across their chest five times as quickly as they could . times were then recorded into quartiles such that a score of a 1 = 16.1 seconds ; a score of a 2 = 12.9 to 16.0 seconds ; a score of a 3 = 9.9 to 12.8 seconds ; and a score of a 4 = 9.8 seconds . summing the scores for each subtask ( standing balance , gait speed , and chair rises ) creates a summary performance score that was used in the analyses . all statistical analyses were performed using pasw statistics 18 ( spss inc . , 2009 ) . participants who were missing data on variables of interest ( n = 6 ) were excluded from the analyses . all variables were examined to ensure they met assumptions of normality . all variables except bmi were within acceptable ranges ; a logarithmic transformation was performed on bmi . the transformed variable was used in all analyses . to initially ascertain the relationships between the sppb and predictor variables , pearson product moment correlations were obtained . to examine the relationship between physical performance and specific domains of cognition , a multiple regression analysis was conducted in which sppb total score was regressed on age , education , and mmse . each individual cognitive test ( stroop c / w , tmt - a , mmse and wasi block design ) was entered into separate regression analyses . next , to examine the relationship between physical performance and demographic variables ( i.e. , age , and education ) , cognition , exercise , mood , disease burden and bmi , a hierarchical regression analysis was conducted . in block 1 , sppb total score was regressed on age and education . to examine the incremental variance accounted for by other variables of interest , stroop c / w raw score was entered in block 2 , exercise was entered in block 3 , gds total score was entered in block 4 , total number of both vascular health and general health conditions were entered in block 5 , and bmi was entered in block 6 . for both sets of analyses , examination of preliminary analyses revealed significant bivariate relationships between the sppb and age ( r = .34 ; p < .00 ) , education ( r = .20 ; p < .04 ) , bmi ( r = .27 ; p < .00 ) , exercise ( r = .20 ; p < .05 ) , vascular health ( r = .29 ; p < .00 ) , general health ( r = .25 ; p < .01 ) , and the gds ( r = .26 , p < .01 ) . all cognitive variables were also significantly correlated with sppb performance ( mmse , r = .29 , p < .00 ; wasi bd , r = .24 , p < .01 ; tmt - a , r = .33 , p < .00 ; stroop c / w , r = .36 , p < .00 ) , except the fome ( r = .18 , p = .07 ) . to examine our first hypothesis , a multiple regression was conducted to determine the association of each cognitive domain ( i.e. , attention , visuospatial skills , and executive functioning ) with physical performance after accounting for age , education , and general cognitive functioning ( mmse ) . in block 1 , age ( p < .00 ) and mmse ( p < .05 ) significantly contributed to sppb scores . upon entry of each cognitive measure individually in block 2 , only stroop c / w was significantly associated with physical performance ( p < .05 ) . this model accounted for 18.8% of the variance in physical performance scores ; see table 4 for results . next , a hierarchical regression was conducted to ascertain the amount of variance in physical performance accounted for by demographics , cognition , exercise , depression , vascular health , general health and bmi . based on results of the initial analyses , r change was significant at block 1 with entry of demographics , r = .15 , f(2,103 ) = 9.39 , p < .00 . age ( p < .00 ) and education ( p < .05 ) were both significant predictors in block 1 . in block 2 , stroop c / w significantly improved prediction of sppb scores ( p < .00 ) ; r = .05 , f(1,102 ) = 7.01 , p < .00 . with the addition of stroop c / w , , exercise did not significantly improve prediction ( p > .05 ) ; r = .02 , f(1,101 ) = 2.74 , p = .10 . gds significantly improved prediction ( p < .05 ) in block 4 ; r = .04 , f(1,100 ) = 5.36 , p < .05 . in block 5 , both vascular health ( p < .05 ) and general health were significant ( p < .05 ) ; r = .08 , f(2,98 ) = 5.93 , p < .00 . with the entry of the health variables in block 5 , the gds became non - significant ( p = .21 ) . in block 6 , bmi was significant ( p < .05 ) ; however , vascular and general health became non - significant ( p > .05 ) ; r = .03 , f(1,97 ) = 4.84 , p < .03 . in the final model , age , stroop c / w , and bmi were significant contributors , and accounted for 32.8% ( adj . r ) of the variance in sppb scores . block 6 results are reported in table 5 . confirming our hypothesis , among cognitive domains of memory , attention , and visuospatial construction , only executive functioning was significantly associated with physical performance after controlling for general cognitive functioning . a secondary analysis demonstrated that among a range of factors shown to contribute to disability onset , age , executive functioning , and bmi were associated with physical performance scores . these findings have clinical implications for improving gerontology 's understanding of disability and helping clinicians and researchers to design and implement interventions aimed at delaying disability onset among african american women . foremost , this study provides further evidence that executive functioning contributes not only to adl disability onset , but also to declines in physical performance , an early indicator of disability , in african american older adults [ 1 , 17 , 39 ] . executive functioning accounted for a small , yet significant , proportion of variance in physical performance , and our findings suggest that performance of basic physical tasks included in the sppb involve executive processes such as inhibition and mental flexibility . an older adult 's ability to inhibit attention to extraneous information in the environment and to make appropriate responses is involved in the successful performance of physical tasks . executive functions may become even more important in complex scenarios older adults face in daily life , such as when avoiding obstacles in their home or when attempting to multitask ( i.e. , walking and talking ) . these findings are supported by and expand upon our previous work using a separate dataset of african american elders from the detroit area . in this study , two of three measures of executive functioning ( trail making test , part b and animal naming ) were significantly associated with sppb scores after controlling for general cognitive functioning . the current study demonstrates that even after examination of four other domains of cognition , only executive functioning is associated with physical performance . providing convergent evidence of this relationship in a similar study of african american older adults , nieto and colleagues report that after adjusting for age , gender , comorbidity , global cognition , education levels , and global memory , individuals with poor executive function were four times more likely to have impaired lower - extremity functioning . these results are congruent with several other studies reporting relationships between executive functioning and physical performance in samples of predominantly white older adults [ 14 , 15 , 40 ] . executive functioning measures such as the stroop are brief , easy to administer and are well tolerated by older adults . however , we argue that the addition of executive function measures would improve assessment of disability risk . our second analysis provides further information about mechanisms potentially underlying the relationship between physical performance and executive functioning . along with executive functioning , age and bmi although both vascular and general health conditions were significantly associated with physical performance , they became non - significant after entry of bmi . outcomes of and contributors to bmi and obesity are difficult to separate ; however , obesity is highly associated with medical burden , particularly cardiovascular conditions and arthritis , as well as frailty and decreased exercise tolerance and mobility . associations between vascular burden , obesity , and both physical and cognitive declines is of particular interest [ 4345 ] . our results support the idea that vascular disease in later life increases an older adult 's risk for physical declines , and that physical performance is associated with executive dysfunction . brain insult to shared neuroanatomical pathways secondary to cvrfs may partially explain mutual declines in cognition and physical performance . supporting this hypothesis , leung and colleagues found that stroop performance was related to activation in the anterior cingulate gyrus , as well as inferior and middle frontal regions ; areas implicated in physical performance tasks and sensitive to the impact of vascular burden . because the frontal lobe integrates informational input from multiple regions of the brain , wmhs and atrophy to shared pathways in the frontal region could result in both physical performance declines and executive dysfunction . previous work has demonstrated that exercise interventions yield better performance on the sppb [ 31 , 47 ] when participants were engaged in moderate exercise for approximately 150 minutes per week . our ability to find a relationship between exercise and the sppb may have been attenuated by the amount and intensity of exercise of our participants . also , physical activity is difficult to accurately measure via self - report as older adults often participate in unstructured , low - intensity physical activities that can be difficult to recall . one final consideration is that exercise is a health behavior , while the variables that were significant in the model , namely bmi and cognition , are the outcome of cumulative lifelong processes . though depression was not significantly related to physical performance in the final model , it was a significant predictor prior to the entry of vascular and general health , and is related to poorer physical performance in other studies . the relationship between physical performance and depression within samples of african american elders requires further clarification . foremost , due to our small sample size ( n = 106 ) , our findings should be considered exploratory in nature . further work is needed to extend and support these findings within a larger sample of african american elders drawn from various geographic regions . because the stroop involves processing speed , as do sppb tasks , it may be questioned whether the processing speed factor accounts for its association with the sppb . though three of the five cognitive measures were timed ( i.e. , stroop c / w , tmt - a and wasi block design ) , and two involved a motor component ( i.e. , tmt - a and wasi block design ) , none involved lower - extremity physical performance . only the stroop c / w was significantly associated with physical performance while other measures that involved speeded processing were not , suggesting that the executive functioning components , mental flexibility , and inhibition , account for its association with physical performance rather than processing speed . in the future it would be of interest to use a broader range of executive functioning measures to determine whether a relationship between executive functioning and physical performance would remain , specifically , for untimed measures . because the sppb is designed to measure only lower - extremity function , this may be viewed as a limitation of our study . however , measures of lower , versus upper , extremity performance are more predictive of future disability because lower extremity function has a greater impact on an older adult 's ability to remain independent . additionally , performances on lower - extremity measures decline across time more than performances on upper - extremity measures suggesting that they are a more sensitive indicator of change in functional status . self - reported disability is also more strongly correlated with lower - extremity than upper - extremity tasks . finally , many studies fail to examine racial differences or race - specific relationships with regard to risk factors for disability . though not directly compared , the risk factors in this study are similar to those identified in previous studies that used primarily white older adults . differences in comorbidity account for african american / white disparities in disability rates , suggesting that disease burden may contribute to disability differently in african americans versus whites . though there is generally greater variance among individuals in a group than between groups , disease burden may present an exception . african american older adults experience greater comorbidity at an earlier age of onset of chronic diseases , and have a greater average bmi than their white counterparts [ 28 , 52 ] . additionally , many social factors contribute to differences in healthcare seeking and health behaviors in african americans versus whites . study results provide further information regarding correlates of physical performance , an indicator of predisability , in older african american women . foremost , they support previous work demonstrating that executive functioning is related to physical performance and may serve as an indicator of disability risk within african american elders . bmi , which is highly associated with disease burden and health behaviors , was also related to physical performance . disease processes may underlie the relationship between physical performance and executive function and serve as an important target for interventions .

since first described in 1970 ( 1 ) , prostate - specific antigen ( psa ) was considered a useful tumor marker for detecting prostate cancer ( pca ) and assessing treatment responses and follow - up among patients with pca gradually . a psa level of more than 4.0 ng / ml was considered to have predictive value for the prostate cancer ( 2 , 3 ) . however , prostate cancers were not rare in patients with psa level of 4.0 ng / ml or less and could be detected even in patients with psa level lower than 0.5 ng / ml ( 4 , 5 ) . overall , 82% of prostate cancers in younger men and 65% of cancers in older men would be missed with a psa cutoff of 4.1ng / ml ( 6 ) . some investigators have suggested lowering the diagnostic threshold to increase the sensitivity of psa in detecting prostate cancer ( 710 ) . however , a lower threshold not only significantly increases the unnecessary biopsies but also cause the over diagnostic and the proportion of biopsies that identify clinically insignificant disease . therefore , we investigated the psa density ( psad ) and free to total psa ratio ( f / t psa ) to assess a possible relationship with prostate cancer detection in the total psa levels of 4.0 ng / ml or less . between april 1996 and december 2012 , 2976 subjects , age 30 to 91 yr old , with psa levels higher than 4.0ng / ml and/or abnormal findings on dre or trus were biopsied in chinese pla general hospital , china . all patients were provided written informed consent , and the study was approved by the institutional review boards of the hospital . the abnormal dre findings were defined as palpable induration , nodularity , irregularity , or asymmetry and the abnormal trus findings were defined as capsular irregularity , deformation , or existence of a hypoechoic region / nodule . trus were performed with acuson sequoia512 ( siemens medical solutions usa , inc , mountain view , california , usa ) and iu22 ( philips ultrasound , bothell , washington , usa ) scanners . trus - guided sextant biopsies were performed , and , if trus or dre revealed abnormal findings , we performed additional one to two biopsies in the suspicious areas . we defined the inclusion criteria as follows : 1 ) all patients were biopsied for the first time ; 2 ) sextant biopsies was down , and , if trus or dre revealed abnormal findings , we performed additional one to two biopsies in the suspicious areas ; 3 ) psa level was 4.0 ng / ml or less . the exclusion criteria as follows:1 ) patients with a present or past history of detecting prostate cancer or treatment for benign prostatic hyperplasia ; 2)the pathology result lost and/or gleason score was not available ; 3 ) the pathology results proved to be non - prostate cancers . we stratified the patients into four groups with the psa levels of 0.01.0 ng / ml1.12.0 ng / ml2.13.0 ng / ml and 3.14.0 ng / ml , and assessed the diagnostic significance of psad , f / t psa , trus and dre in prostate cancer detection . meanwhile , we stratified the patients into five groups with the age of 49 years , 5059 years , 6069 years , 7079years and 80years to assess the cancer detection rate according to age . analysis was performed using the statistical package for social sciences software program ( spss for windows ver.11.5 ) . we used the t or t test to compare cancer detection rates by psad and f / t psa ratio . we also performed the chi - square test to compare cancer detection rates by age . we calculated the positive predictive value and 95% confidence interval ( ci ) for cancer detection stratified by psad and f / t psa ratio . receiver operating characteristic curves ( roc - curve ) analyses were performed and areas under the curve were calculated . an area under the curve of 1.0 indicates a test with perfect discrimination between subjects with disease and those without disease , whereas an area under the curve of 0.5 indicates a test with no discriminatory power . among the 343 patients , 65 prostate caners were detected and the detection rate was 19.0% . the diagnostic sensitivity of dre and trus was 66.2% and 69.2% , and the specificity was 34.2% and 33.1% respectively . the cancer detection rate was relevant low with the psa levels of 1.0ng / ml or less , and it increased gradually as the psa levels up . table 1 shows the cancer detection rate of dre and trus relative to psa range . among all the patents , the f / t psa decreased gradually as the psa level increased , and f / t psa was lower in cancer group than in non - cancer group ( p<0.05 ) , but as we stratified them into four groups according to the psa levels , we could find that the f / t psa had no statistical significance ( p>0.05 ) in psa groups 0.01.0ng / ml and 1.12.0 ng / ml , and it had statistical significance ( p<0.05 ) in psa groups 2.13.0 ng / ml and 3.14.0 ng / ml . the psad was slightly higher in cancer groups ( 0.090.16ng / ml / cc ) than in non - cancer groups ( 0.060.07ng / ml / cc ) , but there had no statistical significance . table 2 shows the p value of f / t psa and psad in differentiating cancers and non - cancers relative to psa ranges . roc curves for psad and f / t psa ratio with psa range 0.04.0 ng / ml showed in fig . 1 . the areas under the curves for psad and f / t psa ratio in each psa group showed in table 3 . in the 65 cancers , 31 with gleason score6 , 17 with gleason score=7 and 17 with gleason score8 . among the 31 patients with gleason score6 , 10 ( 32.26% ) from psa group 0.01.0 ng / ml , eight ( 25.81% ) from psa group 3.14.0 ng / ml ; among the 17 patients with gleason score8 , nine ( 52.94% ) from psa group 0.01.0 ng / ml , one ( 5.88% ) from psa group 3.14.0 ng / ml . psa : prostate - specific antigen , f / t : free to total psa ratio , psad : prostate - specific antigen density , pca : prostate cancer psa : prostate - specific antigen , f / t psa : free to total psa ratio , psad : prostate - specific antigen density , roc : receiver operating characteristic ; auc : areas under the curves the gleason score had no statistical significance in the four psa groups . table 4 shows the proportion of patients with different gleason score in each psa group . psa : prostate specific antigen the cancer detection rate increased as the psa levels up , but there had no statistic significance among the age groups . seven cancers were detected in the group of younger than 49 and the detection rate was 23.33% , 12 cancers were detected in the group of older than 80 and the detection rate was 20.69% . table 5 shows the cancer detection rates of the five age groups relative to psa ranges . dre was the principal method for prostate cancer screening before the advent of psa testing . the positive predictive value ( ppv ) of a suspicious dre was 5% , 14% and 29% in white men and 8% , 37% and 50% in black men with psa of 01.0 ng / ml , 1.12.5 ng / ml and 2.64.0 ng / ml , respectively ( 8) . trus has not been used in the first - line screening examination for prostate cancer because it lacks the ability to diagnose the prostate cancer in early stage , while the cancers with psa levels of 4.0 ng / ml or less are mostly in the early stage ( 9 , 11 ) . the detection rate of abnormal findings on dre and trus was 14.4% and 9.5% respectively with patients psa levels of 4.0 ng / ml or less , and adding trus to dre increased the detection rate of prostate cancer to 30.8% in the patients with psa levels of 2.0 to 4.0ng / ml ( 7 ) . the authors suggested that trus should be undertaken in patients with psa levels of 2.0 to 4.0ng / ml and prostate biopsy should be undertaken in patients with abnormal findings on trus in this psa range , and they also suggested that in patients with a psa level of less than 2.0 ng / ml and slightly abnormal dre findings did not need a routine biopsy ( 7 ) . in the current study , the cancer detection rate for dre with psa range of 01.0ng / ml , 1.12.0 ng / ml , 2.13.0 ng / ml and 3.14.0 ng / ml was 15.1% , 18.8% , 21.1% and 23.9% respectively , and for trus was 14.1% , 20.6% , 23.5% and 25.0% respectively . the detection rate for both methods was relatively low with the psa level of 1.0 ng / ml of less , and it increased gradually with an increase in psa levels . reported a 14% incidence of psa in the range of 1.0 to 3.9 ng / ml , and 28% of these men had cancer ( 12 ) . this phenomenon could be found in patients with a psa level lower than 4.0 ng / ml . thompson et al . reported in the prostate cancer prevention trial ( pcpt ) that the incidence of prostate cancer was 15.2% in subjects with a psa level lower than 4.0ng / ml or less , and the incidence was 6.6% , 10.1% , 17.0% , 23.9% and 26.9% in subjects with psa level range of 00.5 ng / ml , 0.61.0 ng / ml , 1.12.0 ng / ml , 2.13.0 ng / ml and 3.14.0 ng / ml ( 13 ) . in the current study , the cancer detection rate was 19.0% , which was a little more higher than thompson s finding 15.2% , and which maybe because of the patients in our study were all had positive findings with dre or trus . at the same time , we found in our study that the cancer detection rate increased gradually with the psa level increased and which in accordance with thompson s findings . in patients whose cancer was detected in the psa range of 2.0 to 4.0 ng / ml , the f / t psa was significantly lower ( 14 ) , and f / t psa could provide increased specificity in cancer detection when psa levels were less than 4.0ng / ml ( 15 ) . carlson et al . reported that f / t psa was not predictive of prostate cancer when psa level was less than 4.0 ng / ml ( 16 ) . in current study , the f / t psa was 0.220.13 in cancer group and 0.270.13 in non - cancer group , and there were statistical significance between the two groups ( p<0.01 ) , but when we stratified the subjects into four groups according to the psa levels of 0.01.0ng / ml , 1.12.0 ng / ml , 2.13.0 ng / ml and 3.14.0 ng / ml , we could find that the f / t psa had no statistical significance between cancer group and non - cancer group with the psa levels of 2.0 ng / ml or less , while it had statistical significance ( p<0.05 ) with the psa range of 2.1 to 4.0 ng / ml . use 0.15 as the cutoff of f / t psa , the sensitivity and specificity for cancer detection was 64.3% and 84.8% respectively , the ppv and negative predictive value ( npv ) was 46.9% and 85.7% respectively in subjects with the psa range of 2.1 to 4.0 ng / ml . the psad was a little higher in cancer group ( 0.060.03 ng / ml / cc ) than in non - cancer group ( 0.040.06 ng / ml / cc ) , but there had no significance between the two groups ( 13 ) . in current study , the psad was ( 0.090.16 ) ng / ml / cc in cancer group and ( 0.060.07 ) ng / ml / cc in non - cancer group , and there had no statistical significance between the two groups . furthermore , there had no statistical significance between the two groups when stratified the subjects according to the psa levels . men with a psa level of 4.0 ng / ml or lower represent 14% of incident prostate cancer cases , and approximately 54% of patients with psa levels of 4.0 ng / ml or lower at the time of diagnosis had low - risk cancers ( 17 ) . men with screen - detected cancer and with a psa level of 4.0 ng / ml or lower were less likely to have high - grade tumors , and more than half were classified as having low - risk cancer and with lower gleason scores ( 17 ) . the natural history of prostate cancer is to be progressing , and it is impossible to identify with certainty cancers that do not have the capacity to cause suffering or death during the lifetime of any given individual ( 5 ) . in the united states and europe , the proportion of men with prostate cancer and organ - confined disease was 84% to 87.9 % ( 18 ) . even prostate cancer found at psa level of 4.0 ng / ml or less can be highly aggressive ( 13 ) . for these prostate cancers , psa can not be the useful marker for detecting prostate cancer and assessing treatment responses and follow - up . some patients with psa level of 0.5ng / ml or less had a higher rate of seminal vesicle invasion , extracapsular tumor extension and regional lymph node metastasis than those with higher psa levels ( 19 ) , which was thought that the epithelial ells of these cancers lost expression of a psa encoding gene ( 20 ) . the follow - up should be taken regularly for the patients with psa levels of 2.1 ng / ml to 4.0ng / ml , and prostate biopsy should be taken if the f / t psa less than 15% . for the patients with psa levels of 2.0ng / ml or less , dre , trus , f / t psa and psad can not diagnose the prostate cancer effectively . maybe with the presence of new biomarkers like benign prostate specific antigen ( bpsa ) , inactive prostate specific antigen ( ipsa ) and precursor of psa , we can distinguish the prostate cancer more effectively . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors .

kidney transplantation is the treatment of choice for selected patients with end - stage renal disease ( esrd ) . health - related quality of life ( hqol ) has emerged as an important outcome to quantify the success of transplantation in the long term [ 1 , 2 ] . although hqol has been systematically assessed to uniformly document a positive effect of transplantation ( with larger gains in the dimensions of hqol most affected by physical health and more modest improvements in areas affected by psychosocial functioning ) , there is increasing recognition that transplantation generates unique demands and challenges for patients , and families alike [ 35 ] . the generic hqol questionnaires provide useful and important information on the multiple dimensions hqol such as functional status , pain , mood and social welfare , yet they fail to capture issues that are unique to transplant patients . issues related to the donation , feelings of guilt , concerns about viability of graft and uncertainty about the future have been shown to define transplantation experience [ 711 ] and are hence fundamental to understanding overall sense of well - being in transplant recipients . this has led to the development and use of the transplant effects questionnaire , a validated condition - specific questionnaire for the assessment of organ transplant recipients [ 6 , 7 , 12 , 13 ] . as graft survival has improved dramatically in last decades the question of long - term outcomes in kidney transplantation becomes increasingly important . the preponderance of literature in patient - reported outcomes in kidney transplantation to date has focused on early post operative period or cross - sectional comparisons of recipients and/or long - term transplant survivors with their dialysis counterparts . significant associations are typically found between time elapsed since transplantation and symptom experience / burden which may compromise adjustment and hqol . data on longitudinal changes over the posttransplantation period are sparse and typically do not extend to more than 2 years posttransplant [ 1820 ] . our previous study comparing livings related donor ( lrd ) and cadaver tran - plant recipients , like many on patient - reported outcomes in kidney transplantation was cross sectional which limits conclusions as to the trajectory and course of transplantation - specific outcomes between the two transplant groups . outcomes focusing on longitudinal changes in hqol and transplantation specific outcomes are largely lacking in the literature . there is need for further prospective studies using generic and transplantation specific instruments to document long - term patient outcomes beyond the immediate and short term post- transplantation period . there is also a need to establish predictors of long - term outcomes in this population . the current study examines 6-year changes in hqol and transplantation - specific outcomes in a cohort of kidney transplant recipients . it also compares reported outcomes in living related donor and cadaver transplant recipients and explores whether demographics and clinical variables are predictors of long - term transplantation outcomes . this is a prospective study in which a baseline kidney transplant cohort was reassessed after a 6 years followup period using the same instruments . ( participants were only followed up until 6-year from baseline assessment due to the planned relocation and merging of one of the transplant units with another renal unit . thus , it became difficult , if not impossible , to follow patients ' health outcomes . ) this prospective study evaluated patient - reported outcomes at two points in time - on an average of 6 years apart . kidney transplant recipients from two transplant centres ( middlesex hospital and royal free hospital , london , uk ) who participated in a questionnaire study of hqol and emotional responses between october 1999 and february 2002 were invited to the followup study . the study protocol was approved by the institutional review board and informed consent was obtained from each participant . clinical practice and health care procedures ( post - transplantation followup care and patient support services ) were identical on both hospital sites . there were no known changes at organizational and health care system structures during study window . target study subjects were the subgroup of kidney transplant patients from our previous cross - sectional study who still had functioning grafts . multiorgan recipients and recipients under 18 years of age at the time of evaluation , patients who had an acute rejection or infection within a month of data collection , had dementia , mental illness , or severe visual / hearing impairment were excluded . data on patients who died or lost their graft and were placed back on dialysis are also not reported in this paper . eligible participants were approached by letter or by the clinical nurse specialist to participate in the 6-year followup study . following consent into the study , assessment sessions were scheduled at patients ' convenience with most assessments coinciding with one of their regular check - up outpatient appointments . these included information on age , gender , education level , relationship status ( married / cohabitating relationship or single , separated , widowed ) , occupation ( full / part time or unemployed , retired or looking after home / family ) and financial situation ( annual income ; change in income categorized as up , down , or stable ) . perceived ability to work was assessed by a single question developed by evans et al . : are you now able to work full time , part time , or not at all . medical and transplant - related data were extracted from medical records : primary kidney disease diagnosis , medications ( including current immunosuppressive regime ) , vintage ( time elapsed since renal replacement ; time elapsed since transplant ) , donor type ( cadaver versus living related ) , relationship to donor number of infection and rejection episodes , comorbidities . the presence / absence of seven of the most common comorbid disorders ( plus an other category ) was recorded . these included diabetes mellitus , hypertension , ischaemic heart disease , peripheral vascular disease , cancer , bone diseases and chronic obstructive airways disease . all these socioeconomic and clinical parameters were considered both in terms of baseline levels and change over the followup period . for each variable a change score was calculated comparing the data at followup with that at baseline . changes in these clinical variables were defined as improving , static , or worsening with the static group being treated as the reference group . glomerular filtration rate ( gfr ) was measured following the intravenous administration of 3 mbq 51cr - edta diluted to 10 ml on 0.1% w / v excess edta solution . transplantation - specific emotional and behavioural outcomes were measured using the transplant effects questionnaire ( txeq ) . the 23-item txeq contains fve sub - scales that assess worry about the transplant ; feelings of guilt towards the donor , disclosure of transplantation medication adherence and perceived responsibility to do well . subscale scores are expressed as a mean by dividing the total score by the number of items , hence ranging from 1 to 5 . higher scores signify more worry about the transplant , more guilt , more disclosure , more perceived responsibility , respectively , and greater adherence . the questionnaire has data to support its internal structure and factorial validity and has been found to have acceptable internal consistency , test retest reliability and face validity . hqol was measured with the 36-item medical outcome study short form health survey ( sf-36 ) . the uk version 2 of the sf-36 was used to ensure face validity and maximize acceptability in british participants . the sf-36 is a generic multidimensional measure of hqol that contains eight sub - scales representing physical functioning ( pf ) , social functioning ( sf ) , role limitations due to physical health problems ( rph ) , role limitations due to emotional problems ( rem ) , mental health ( mh ) , vitality ( vt ) , bodily pain ( bp ) and general health perceptions ( gh ) . in addition , summary scores were calculated for physical ( pcs ) and mental ( mcs ) components . to facilitate interpretation and comparisons to the norms , normative - based scoring involves a linear t - transformation to ensure that all sf-36 sub - scales and summery scores had a mean of 50 and a sd of 10 in the general uk population . the sf-36 has been proved reliable and valid in various demographic and patient populations including esrd and transplant patients [ 29 , 30 ] . a difference of five - points in a particular dimension is considered a minimal clinically significant change . patients ' levels of functional ability to perform activities of daily life was determined by the karnofsky performance status completed by transplant nurses . scores range from 0100 with 0 indicating death and 100 indicating full capacity to perform normal activity . in general scores 5070 represents an individual who requires additional assistance and inability to work and a score lower than 50 represents needs for hospitalization , nursing care or institutionalization [ 3234 ] . data analyses were performed using statistical package for social sciences statistical software for windows ( version 17.0 ; spss inc . , descriptive statistics were performed as appropriate , depending on measurement level and distribution of the data for the sample population and the subgroups . analyses of variance were performed to test between - group differences , and general linear models for repeated measures assessed intra - individual effects for the study cohort . trajectories of change ( improvement ; deterioration ; stable ) were also calculated to examine change in hqol in individual participants . classification was based half sd ( 5 points ) to determine significant change [ 31 , 35 ] . inferential statistics included pearson 's or spearman 's correlations ( as appropriate ) , cross tabulations , chi - square , or fischer 's exact test to investigate the impact of relevant variables ( absolute baseline and change scores ) on hqol . variables were entered into the regression model when a significant relationship using bivariate analyses was detected . a total of 102 out of 172 ( 59.3% ) eligible transplant survivors from the original cohort participated in the six - year followup assessment at a mean interval of 76.48 ( 7.28 ) months since baseline assessment . transplant vintage , that is , time elapsed since transplantation at study entry / baseline , was 8.08 ( sd = 6.89 ) years . nineteen patients ( n = 19 ) refused to participate because of frail / poor health , n = 16 due to time commitments , n = 16 due to burden of work involved or disinterest ; n = 6 were undecided , and n = 2 were unable to be reached in listed contact numbers / addresses or at their scheduled hospital appointments during the study window . mortality was due to cardiovascular reason / events ( n = 27 ) , malignancy ( n = 7 ) , and other causes ( n = 5 ) . cumulative 6-year rates of infection episodes were .08 ( 1.2 ) per patient . a total of n = 38 of patients who lost their transplant were treated with hemodialysis , n = 13 were on peritoneal dialysis regimes and n = 11 patients were attending low clearance clinic ( stage 35 chronic kidney disease ) . the paper reports findings on the transplant survivors ( see figure 1 for information of the cohort ) . the mean age of this group was 46.57(14.21 ) years ; 58.8% of patients were males and most were cadaver transplant recipients ( 79.4% ) . immunosuppressive medications were cyclosporine ( 63.7% ) or tacrolimus ( 32.3% ) , mycophenolate mofetil ( 7.8% ) and/or azathioprine , 34.3% ) , and steroids reflecting the state of the art immunosuppression when these patients were transplanted . non responders had lower karnofsky score ( p = .042 ) and reported more comorbid conditions ( p = .023 ) , albeit there were no differences in charlson comorbidity index scores or comorbidities diagnoses abstracted through medical records . all other socioeconomic parameters ( e.g. , gender , income , work , and relationship status ) and clinical markers ( e.g. , gfr , source of transplant , total esrd time or transplant vintage , rejection episodes , hospitalisation days ) were comparable between responders and non responders . table 1 details the baseline demographic and clinical characteristics of the study sample and two transplant subgroups relationship status for n = 85 ( 83.3% ) patients was unchanged across the two assessments , n = 9 ( 8.8% ) respondents reported having lost their spouse / partner through divorce or widowing and n = 4 ( 3.9% ) reported change from single / divorcee status to getting married or being in a cohabiting relationship at the 6-year followup . a total of 19 patients reported changes in employment status with n = 12 ( 12.2% ) patients who were employed at baseline , no longer being employed at followup and n = 7 ( 7.1% ) patients who were not employed at baseline resuming work . the vast majority had no change in occupational details ( n = 74 ; 80.4% ) . perceived ability to work remained unchanged in n = 75 ( 76% ) , n = 6 ( 6% ) respondents downgraded ability to work and n = 18 ( 18% ) reporting improvements in ability to work from baseline to 6-year followup . likewise income was undifferentiated in vast majority of respondents ( n = 61 ( 89.2% ) of respondents ) , n = 1 ( 1.5% ) reported lower income and n = 6 ( 9.2% ) reported higher income at followup compared to baseline . rates of comorbid conditions ( i.e. , diabetes mellitus , hypertension , ischemic heart disease , peripheral vascular disease , cancer , bone diseases and chronic obstructive airways disease ) were comparable across assessments ; mean gfr levels were significantly lower at 6-year followup reflecting process of chronic rejection ( mean gfr at followup = 35.5 , sd = 16.8 ; f = 3.42 , p = .04 ) . the observed sf-36 scores across assessments were comparable to those in general population ( within 1 sd of norms ; normative mean = 50 ; sd = 10 ) with the exception of the physical functioning and general health perception scores which were slightly lower than 1 sd below population norms . repeated measures anovas revealed significant differences in 6 of 10 sf-36 scores ( see table 2 ) . physical hqol declined from baseline to 6-year followup : physical component score ( f = 14.87 , p = .001 ) , pain ( f = 10.04 , p = .002 ) . emotional hqol indicators on the other hand significantly improved over time : mental component score ( f = 16.64 , p = .000 ) mental health ( f = 41.49 , p = .000 ) , vitality ( f = 13.54 , p = .000 ) ; the only exception being role - emotional which was worse at followup assessment ( f = 4.49 ; p = .037 ) . significant differences over time were found for two of txeq subscales with worry about graft viability ( f = 4.52 , p = .036 ) and perceived responsibility to do well increasing over time ( f = 7.34 , p = .008 ) . as time since transplantation was varied , analyses were repeated using transplant vintage at study entry ( baseline ) as a between - subject factor to compare outcomes in patients who had their graft for less than 2 years ( 19.6% ; n = 20 ) with those who had their grafts between 25 years ( 22.5% ( n = 23 ) and those with more than 5 years post - transplant 57.8% ( n = 59 ) . results replicated the same pattern of changes in sf-36 and txeq scores in all subgroups with the exception that there were no significant changes across time in role limitations due to emotional problems ( p = .18 ) . there were no significant group or interaction effects in any of the outcomes suggesting that transplant vintage had no effect on the study outcomes across time . to evaluate patterns of intra - individual change the two summary hqol scores ( physical component score ; mental component score ) and frequencies of patterns were analyzed for the slope between time points ( from baseline to 6 years ) : worse ( scores at followup 5 points , i.e. , 0.5 sd than baseline ) , improved ( scores at followup 5 points , i.e. , 0.5 sd than baseline ) , stable ( scores at followup within 4.99 points of baseline ) . the 0.5 sd was used as this represents the minimally clinical significant difference [ 31 , 33 ] . when evaluating the breakdown of participants into the 3 patterns with respect to physical component score , n = 23 ( 30.7% ) had no change in physical component score , n = 40 ( 53.3% ) worsened , and n = 12 ( 16.0% ) improved over time . similar analysis on mental component score scores revealed that n = 34 ( 45.3% ) had no change in mental component score , n = 25 ( 33.3% ) worsened , and n = 16 ( 21.3% ) improved . anovas followed by post hoc comparisons indicated that patients who reported improvements on physical component score scores have had their grafts for longer ( mean = 11.01 ; sd = 2.46 ) compared to the no change physical component score group ( mean = 4.92 , sd = 4.71 ) ( f = 7.34 , p = .011 ) . the only variable to differentiate between the mental component score groups was txeq worry change scores . post hoc comparisons indicated that patients whose emotional hqol ( i.e. , mental component score ) worsened experienced increased worry about the viability of their graft ( mean worry change score = 2.18 , sd = 4.92 ) compared to patients whose mental component score improved ( mean worry change score = 2.50 , sd = 7.39 ) ( f = 5.35 , p = .027 ) . comparisons of outcomes by transplant source showed that hqol levels were comparable for the two transplant groups with the exception of physical functioning and physical component scores . repeated measures ancovas controlling for casemix differences ( i.e. , age , income and duration of transplant ) indicated significant interaction effects in physical functioning ( f = 7.07 ; p = .009 ) and physical component score ( f = 6.03 , p = .017 ) . post hoc tests showed that lrd transplant patients had higher physical functioning score and physical functioning scores at baseline compared to cadaver transplant ( f = 5.72 , p = .019 , and f = 8.13 , p = .005 , resp . ) but followup scores were equivalent . within - groups post hoc tests showed that physical functioning declined significantly from baseline to 6-year followup in the lrd transplant group ( f = 9.34 , p = .007 ) whereas scores for cadaver transplant recipients remained unchanged ( see figure 2(a ) ) . physical component scores diminished in both transplant groups , yet the decrease was greater in lrd transplant patients ( see figure 2(b ) ) . a significant transplant type by time interaction effect was also found for disclosure ( f = 4.817 , p = .031 ) . post hocs tests revealed no group difference in absolute value between cadaver and lrd transplant recipients ; yet lrd transplant recipients reported a nearing - significant increase in disclosure behaviours over time ( f = 4.20 , p = .055 ) whereas levels of disclosure remained unchanged in cadaver transplant patients ( f = .003 , p = .959 ) . correlation analysis between sociodemographic , medical variables and txeq sub - scales ( absolute scores at followup ) showed that increasing age was associated with less worry regarding the transplant ( r = .24 , p = .023 ) , more disclosure ( r = .25 , p = .019 ) and more perceived responsibility to do well ( r = .22 , p = .036 ) at the 6-year followup . feelings of worry about the graft at followup were significantly higher in patients who perceived themselves as able of full or part time employment ( mean = 3.33 , sd = .70 ) compared to patients who identified themselves as unable to work ( mean = 2.95 , sd = .80 ) ( f = 3.97 , p = .049 ) . caucasian patients reported higher levels of disclosure about their transplant ( mean = 4.08 , sd = .95 ) than patients of other ethnic groups ( mean = 3.55 , sd = 1.17 ) ( f = 4.47 , p = .037 ) . longer transplant vintage was associated with greater increase in feelings of guilt ( r = .28 , p = .008 ) and in feelings of responsibility across time ( r = .27 , p = .011 ) . increase in worry about the transplant was greater in patients who perceived themselves to be capable of part or full time work ( mean worry change score = 2.09 , sd = 5.14 ) relative those who reported being unable to work ( mean worry change score = 2.71 , sd = 7.31 ) ( f = 8.73 , p = .004 ) . significant associations were also found between the txeq sub - scales ( absolute and change scores ) . stronger feelings of guilt were significantly correlated with more worry about the transplant ( r = .45 , p = .001 ) , higher perceived responsibility ( r = .43 , p = .001 ) , and lower disclosure ( r = .43 , p = .001 ) . feelings of responsibility to do well were positively associated with worry about the transplant ( r = .35 , p = .001 ) and adherence levels ( r = .28 , p = .006 ) . guilt change scores were positively correlated with concomitant changes in worry ( r = .39 , p = .001 ) and responsibility ( r = .30 ; p = .004 ) , and negatively correlated with changes in disclosure ( r .32 , p = .002 ) . worry about transplant change scores were also correlated with change scores in responsibility ( r = .27 , p = .015 ) . no significant associations were found between hqol and gender , ethnicity or measures of illness severity ( haemoglobin levels , duration of dialysis prior to transplantation , time since transplantation ) ( data not shown ) . however , there were significant associations between number of comorbidities / long - standing illnesses , age , work status , perceived work ability , income , relationship status , karnofsky scores and physical hqol at followup in the expected direction ( see table 3 ) . significant associations were also found between worry about transplant and lower emotional hqol at followup : mental component score , social functioning , mental health , vitality , and general health perception with correlation coefficients ranging from r = .30 to r = .27 ( p .014 ) . disclosure shares a positive correlation with role - emotional ( r = .24 , p = .024 ) , adherence to medication with mental component score ( r = .25 , p = .029 ) . feelings of responsibility were negatively associated with physical component score , physical functioning and social functioning ( see table 3 ) . univariate analyses on hqol and txeq change scores revealed several significant associations : increased worry about viability of graft was associated with reduction in physical component score ( r = .32 , p = .008 ) , role physical ( r = .35 , p = .004 ) , role - emotional ( r = .32 , p = .004 ) , social functioning ( r = .45 , p = .000 ) , mental health ( r = .31 , p = .006 ) , bodily pain ( r = .24 , p = .028 ) , vitality ( r = .297 , p = .008 ) , general health perception ( r = .47 , p = .000 ) , indicative of worse hqol across time . increase in guilt is related to role - emotional reduction ( r = .24 , p = .028 ) , and increase in adherence to medication is associated to a reduction in physical functioning ( r = .23 , p = .040 ) . hqol changes were associated with income , perceived work ability , and relationship status in that hqol losses were greater in the disadvantaged socioeconomic groups : low income and role - physical and social functioning ( f = 4.11 , p = .046 ; f = 7.03 , p = .010 , resp . ) ; not able to work and role - emotional ( f = 4.63 ; p = .036 ) , social functioning ( f = 8.47 , p = .005 ) and mental component score ( f = 7.32 , p = .004 ) , not in marital or cohabiting relationship ( i.e. , widowed , single or divorced / separated ) and social functioning ( f = 6.76 , p = .011 ) and bodily pain ( f = 5.20 , p = .025 ) . the variables selected for these analyses were those associated with physical component score and mental component score ( absolute and/or change scores ) in the univariate analyses at p < .05 . the results indicated that baseline physical component score ( beta = .353 , p = .014 ) , worry about transplant ( beta = .30 , p = .025 ) , and perceived ability to work ( beta = .294 , p = .039 ) were significant predictors of absolute physical component score at followup accounting for r = 36% ( adjr 31.1% ) of variance . when variables were regressed on physical component score change scores the only significant predictor was worry change scores ( beta = .384 , p = .012 ) explaining r = 14.7% ( adjr = 12.6% ) of changes in physical hqol over time . the regression model to predict mental component change scores in the combined transplant sample indicated that only perceived ability to work was significant ( beta = .442 , p = .003 ) , accounting for r = 19.5% ( adjr = 17.5% ) in mental component changes scores . perceived work ability ( beta = .299 , p = .026 ) and worry about transplant ( beta = .265 , p = .043 ) were significant in the regression to predict absolute mcs at the followup jointly explaining r = 15.9% ( adjr = 12.7% ) of the variance . it has been long established that hqol of transplant recipients improves from before to after receipt of the tx graft [ 1 , 36 , 37 ] . previous studies have suggested that organ tx patients may reach a plateau at 1 - 2 years post - transplant with anticipated downturns thereafter but empirical evidence is lacking . this study provides unique longitudinal data on the patient reported outcomes in kidney transplantation extending time frame of the analyses beyond the first 2 years posttransplantation . study findings showed that the widely documented hqol improvements pre- to post - transplantation [ 1 , 38 ] can not only be sustained but in some domains improved further over a much longer period . our data indicate that decline in hqol is not an inevitable consequence of long - term condition or advancing illness in the context of kidney transplantation there is a small shift towards worsening of overall physical hqol and domains most affected by health such as pain and physical functioning yet emotional dimensions of hqol and vitality show marked improvements over time . mean hqol levels for combined sample and for both tx groups remained within 1 sd of general population norms at the followup yet individual hqol trajectories were variable . analysis of individual patterns showed differences in trajectories of change with 50% and 25% of transplant recipients reporting substantial decline of at least 5 points from baseline levels in physical component score and mental component score , respectively , indicating that group analysis may mask considerable interindividual variation in long - term outcomes . although it may be tempting to attribute the observed changes to normal aging , studies of hqol in cohorts of nonmedical community populations show hqol across domains of physical and psychological health as well as emotional and social role functioning do not deteriorate substantially with aging but remain stable [ 39 , 40 ] . the deterioration in physical functioning , and role limitations levels over the 6-year window may be related to the chronic immunosuppressed state and the physical- and health - related consequences of long - term immunosuppression [ 4143 ] . physical hqol impairments may also be related to incidence of diabetes which in renal transplant recipients as opposed to other transplant recipients is an end - organ / morbidity imposing disease rather an additional complication . as such it may limit posttransplantation improvement or lead to physical hqol reduction in renal recipients . as the number of diabetic patients in our sample was very small , the question of differential outcomes trajectories between patients with and without diabetes could not be examined . the decline in physical dimensions functioning was evident in both transplant groups , yet the slope of deterioration was markedly greater for the lrd transplant recipients . the pronounced reduction of physical well - being in lrd transplant group is clearly noteworthy as clinical outcomes for these patients tend to be superior to those of cadaveric transplantation [ 45 , 46 ] . previous cross - sectional studies have reported comparable hqol among transplant groups [ 7 , 47 ] , yet our longitudinal data suggest that physical hqol is better preserved in cad transplantation compared to lrd transplantation . our data showed that physical hqol in lrd transplant recipients is significantly higher than that of cadaver counterparts at baseline but diminishes dramatically over time to reach equivalent levels of those cadaver transplant patients at 6-year followup assessment . it is not clear what may be driving this differential pattern of changes over time in the two transplant groups . the findings albeit limited due to small numbers of lrd transplant patients suggest that a major area of improvement in transplant care is to preserve the physical hqol benefits derived early on for this patient group . although routinely the clinical care focuses mainly on adjustment of immunosuppression , prevention of complications , greater emphasis is needed on functional outcomes and rehabilitation throughout post - transplant care and beyond the immediate or early posttransplantation period . another important finding is that despite physical quality of life declines , emotional well - being/ hqol improved over time . mean scores in mental health for instance , increased by nearly 1 sd from baseline to 6-year followup . these results contrast with findings of increased rates in anxiety and depressive disorders in kidney transplant recipients [ 48 , 49 ] although the hqol data was not designed to diagnose emotional disorders or measure specific emotions . despite the emotional hqol gains , worry about viability of the graft remained prominent in transplant recipients and increased significantly over time in line with the worsening physical hqol evaluations . late kidney graft loss remains a significant problem and hence patients increased feelings of worry about graft viability may reflect their awareness of the reality of finite graft function [ 50 , 51 ] . although clinical events or illness severity were not related to increased worry in this study it still remains likely that worry may be fuelled either through patients ' direct experience of complications , bouts of ill health ( not necessary related to renal condition ) or vicariously when being informed of graft loss or death of other transplant patients . as shown in other settings these indirect experiences can have a profound effect on surviving patients which may explain the increasing level of worry on one hand and improved emotional well being as patients may attach more significance and appreciate more their prolonged graft survival in the face on unpredictability of post - transplantation course . the concomitant increase in worry about transplant viability and perceptions of responsibility to do well may suggest patients ' resolve / determination to exert some control over graft uncertainty and unpredictability of prognosis or likely recurrence of underlying renal disease . it may be that perceptions of responsibility are acting as approach directed coping to maintain emotional morale and try to live up to expectations while putting fears and uncertainty behind them / aside . it is also of note that worry about transplant was associated with both absolute and hqol change scores , albeit , effect sizes were small . attention should be particularly directed towards monitoring these concerns amongst the younger transplant recipients who appear to be more preoccupied / troubled with such concerns . older patients reported lower levels of worry about transplant at followup despite worsening physical hqol . interventions based on psychotherapy principles have been shown to be effective in addressing emotional issues in transplant recipients [ 9 , 54 ] . the important question on predictors of hqol changes in the kidney transplant population remains largely unanswered . we took into consideration several potential explanations for these findings but overall variance explained was fairly small importantly , a number of illness and socioemotional variables albeit significantly associated with absolute hqol scores consistent with previous cross sectional work [ 7 , 42 , 53 , 55 ] were not consistently or reliably associated with the change in physical component score and mental component scores in the multivariate analysis . this clearly highlights the need for more longitudinal research to identify what drives changes in hqol in this population . it is also important to recognize that there may other plausible explanations for the hqol changes not explored in this study . unmet expectations ( discrepancy between health expectations and health experiences ) are thought to adversely impact hqol . transplant patients may have high or even unrealistic expectations for life after kidney transplantation or even view their transplant as cure for their condition which may lead them to under rate physical hqol and functional outcomes especially when complications or limitations are imposed or when rehabilitation or functionality related goals are not fully achieved . further research is needed to examine patients ' expectations on transplantation in the context of esrd and to explore their role in determining immediate and long - term hqol and emotional outcomes in kidney transplantation . first , even in longitudinal investigations issues of causality can not be established with certainty as the findings remain associational in nature . in the absence of an experimental design , alternative explanations for the observed associations such as reverse causality and bidirectionality study participants were not assessed at a uniform post - transplant time although the time interval between assessments was fixed . however , to determine / control for the influence of years post - transplant , it was included as an independent variable in the analyses but shown no significant association with outcomes at followup . it is important to note that , as it was not deemed possible to conduct repeated sequential assessments , future prospective research would benefit from further methodological improvements such as including planned regular assessments of general and transplantation - specific outcomes at fixed time points throughout the early and long - term post - transplantation period . this is partly due to the high turnover of transplant patients ; with n = 38 patients being transferred out of our transplant unit and n = 36 not been traced at the 6-year of followup . part of attrition was due to poor health with n = 21 patients refusing participation citing frail health , mobility issues or being overwhelmed with unresolved health issues which may have led to underestimation of magnitude of quality of life effects over the posttransplant period . related to this , the sample size for the lrd transplant group was fairly small which may have undermined study power to detect significant differences between lrd and cadaver renal transplant recipients . the study exclusion criteria of the present study may limit the generalizability of the results to the kidney transplantation population at large ( i.e. , individuals with psychosis , acute illness , neurological disease and other major organ , failure were not included in this study ) . finally , caution is also warranted in interpreting study findings as p values were not adjusted for multiple comparisons , thereby resulting in inflated type i error rate . the strategy adopted in this article was to be exploratory and to capitalize on chance findings to have greater certainty that no significant effects were overlooked . this highlights the need for further research to attempt to replicate or refute these findings .

glucagon - like peptide-1 ( glp-1 ) is a key incretin hormone with diverse physiological functions in both the periphery and central nervous system ( cns ) that are mediated by the glp-1 receptor ( glp-1r ) , a family b g protein - coupled receptor ( gpcr ) . glp-1r is activated by four endogenous glp-1 peptides ( glp-1 ( 137 ) , glp-1 ( 737 ) , glp(136)nh2 , and glp-1 ( 736)nh2 ) and a fifth structurally analogous peptide oxyntomodulin . due to its key role in the potentiation of insulin secretion and suppression of glucagon scretion , glp-1r is a major focus of therapeutic discovery for type ii diabetes , and several peptide - based drugs have been developed , including exenatide , 1 , and liragulitide , 2 , administered by subcutaneous injection . in the cns , glp-1r is important for neuroprotection , learning , and memory as well as neurogenesis . while these synthetic peptides overcome the short half - life of endogenous glp-1 , adverse events ( e.g. , nausea and gi distress ) contribute to relatively poor long - term adherence . recently , efforts have been directed toward the development of orally bioavailable , nonpeptide approaches , particularly small - molecule positive allosteric modulators ( pams ) , for which several chemotypes 37 have been reported ( figure 1 ) . while allosteric modulation is an attractive approach for glp-1r modulation , these early pam tool compounds suffer from weak potency and/or efficacy , ligand and/or stimulus bias as well as innate electrophilicity ( 2 covalently modifies glp-1r ) . thus , we decided to pursue the discovery of novel glp-1r pams to enable the in vitro and in vivo assessment of the therapeutic potential of glp-1 potentiation in the periphery , and importantly , the cns , for which no cns penetrant glp-1r pams have been reported . all known glp-1 pams have noatble limitations in assessing the glp-1 potentiation mechanism in the periphery and cns . we performed a duplexed ( glp-1r and glucagon receptor ( gr ) ) triple - add , functional high - throughput screen to identify glp-1r pam and glucagon pam leads . for this effort , we screened our internal collection ( 175478 compounds ) in human glp-1r 9 - 3-h cells measuring intracellular calcium mobilization as well as a secondary glosensor camp assay because both read - outs are glp-1r primary coupling pathways which identified 98 primary hits . pams and ago - pams active in both calcium and camp assays , that were devoid of activity at the gr , as well as in a counter - screen against the melanocortin 4 receptor ( mc4r ) , were further profiled as putative glp-1r pam leads . of the confirmed hits ( figure 2 ) , our attention focused on 8 , an intriguing racemic 1-oxo-2,9-dihydro-1h - pyrido[3,4-b]indole-4-amide scaffold , which was active in both primary assays ( glp-1r ec50 = 4.1 m , pec50 = 5.38 0.13 , glp-1r% max = 58.9 2.3 ) and inactive at gr and mc4r with good physiochemical properties ( mw = 434 , clogp = 3.7 ) . following the route shown in scheme 1 , we synthesized the single enantiomers ( s)-8 ( glp-1r ec50 = 2.4 m , pec50 = 5.69 0.12 , glp-1r% max = 53.4 2.03 ) and ( r)-8 ( glp-1r ec50 > 10 m ) and found that all the activity resided in the ( s)-8 enantiomer . commercial acid 9 was coupled to either ( s)- or ( r)-tert - butyl-2-(aminomethyl)pyrrolidine-1 carboxylate to provide 10 . deprotection of the boc moiety under acidic conditions delivered 11 , which underwent a subsequent reductive amination reaction with acetaldehyde to give ( s)- and ( r)-8 in 6268% overall yield for the three step sequence . ( s)-8 afforded no calcium response in the absence of glp-1 but potentiated an ec20 concentration of glp-1 and had no effect on gr ( glp-1r ec50 = 2.4 m , pec50 = 5.69 0.12 , glp-1r% max = 53.4 2.0 ) and ( r)-8 ( glp-1r ec50 > 10 m ) ( figure 2b ) . in a standard fold - shift experiment , response curve ( crc ) , and increased the glp-1%max ( from 100.3 to 129.6 ) . ( b ) pam crcs for ( s)-8 in the presence of an ec20 concentration of either glp-1 or glucagon . reagents and conditions : ( a ) hatu , diea , dmf , ( s)- or ( r)-tert - butyl-2-(aminomethyl)pyrrolidine-1 carboxylate , 8285% ; ( b ) 4 m hcl in dioxane , dcm , 99% ; ( c ) acetaldehyde , nabh(oac)3 , dcm , 8183% . preliminary dmpk evaluation of ( s)-8 demonstrated a clean p450 inhibition profile ( 1a2 , 2c9 , 2d6 ic50s > 20 m ; 3a4 ic50 = 3.2 m ) , good plasma free fraction ( fu > 10% in rat and human ) , but high liver microsome - predicted clearance ( rat clhep = 69 ml / min / kg ) and in vivo clearance ( 92 ml / min / kg ) due to n - dealkylation of the n - ethyl pyrrolidine and oxidation of the n - cylopentyl moiety . nevertheless , ( s)-8 afforded an 1.5-fold potentiation of glucose - stimulated insulin secretion in primary mouse islets in the presence of 2 . encouraged by these early data , we initiated an analogue library effort to evaluate sar following the route described in scheme 1 . replacement of the n - cylcopentyl moiety of ( s)-8 with n - me , n - isobutyl led to inactive compounds ( glp-1 ec50s > 10 m ) , as did deletion of the indole n - me . due to the rapid n - dealkylation of the n - ethyl pyrrolidine , we surveyed a broader diversity of amide congeners , but all proved to be devoid of glp-1r pam activity . finally , we elected to survey alternative n - alkyl pyrrolidines 9 ( table 1 ) following the route depicted in scheme 1 . this effort identified pure pams ( ( s)-9c - e ) as well as ago - pams ( ( s)-9b ) , but once again , little structural diversity was tolerated . in general , these were low efficacy pams ( 4868% glp-1 max ) , but ( s)-9b , ( s)-2-cyclopentyl - n-((1-isopropylpyrrolidin2-yl)-9-methyl-1-oxo-2,9-dihydro-1h - pyrrido[3,4-b]indole-4-carboxamide , appeared worthy of further inspection ( glp-1 ec50 = 1.3 m , 59.2% glp-1 max ) . glp-1 pec50 and glp-1 max data reported as averages + sem from our calcium mobilization assay ; n = 3 . again , sar was driven on human glp-1r 9 - 3-h cells measuring intracellular calcium mobilization in response to an ec20 concentration of glp-1 . this proved challenging due to the relative instability and short half - life of endogenous glp-1 in cells and in vivo . still , it was important to identify pams that could potentiate the endogenous peptide , as other reported pams displayed ligand bias and diminished activity at native glp-1 . to expand the utility of ( s)-9b , we evaluated its propensity for ligand bias by assessing its ability to potentiate subthreshold concentrations ( ec20s ) of native glp-1 and the synthetic peptide agonists exenatide , 1 , and liragulitide , 2 ( figure 3 ) . here , ( s)-9b , an ago - pam ( direct activation of glp-1 at higher concentrations , e.g. , 20% max efficacy at 30 m ) robustly potentiates both glp-1 and synthetic peptide 1 . in fact , ( s)-9b was more efficacious with 1 than glp-1 , while liragulitide was less efficacious and the crc did not plateau at 30 m . overall , these findings reveal potentiation across three ligands , suggesting a lack of substantial ligand bias . as with ( s)-8 , the maximum fold - shift of the glp-1 crc was 1.6-fold at 30 m , but the efficacy increased from 100% to 140% . molecular pharmacology of ( s)-9b . ( a ) crc of ( s)-9b in the presence and absence of an ec20 of glp-1 ( ec50 = 1.8 m , pec50 = 5.74 0.2 , 59.2 2% glp-1 max ) . ( b ) crc of ( s)-9b in the presence and absence of an ec20 of 1 ( ec50 = 8.4 m , pec50 = 5.07 0.3 , 71.5 5% 1 max ) . ( c ) crc of ( s)-9b in the presence and absence of an ec20 of 2 ( ec50 = 30 m , pec50 = 4.5 0.2 , 59.2 1% 1 max ) . ( d ) fold - shift experiment of glp-1 in the presence of increasing concentrations of ( s)-9b , with a maximum fold - shift of 1.6-fold at 20 m . fold shift experiment of liraglutide in the presence of 5 , 10 , and 20 m ( s)-9b on the recruitment of -arrestin ( a ) and glp-1 receptor internalization ( b ) using the pathhunter express discoverx assay platform . efficacy of receptor internalization was increased by 2.26-fold at 20 m , while there was little to no effect on -arrestin recruitment . data are normalized to the maximal response of liraglutide alone and fit to a four - parameter logistic equation with variable slope . values are expressed as mean sem , n = 3 . on the basis of observations with previously reported glp-1r pams 35 , we also evaluated the pharmacological response of ( s)-9b on -arrestin recruitment and receptor internalization ( figure 4 ) by potentiation of liragulitide , 2 . very weak impact on -arrestin recruitment was noted , along with a more significant effect on glp-1 receptor internalization . peptide agonist 1 has been shown to potentiate glucose - induced insulin secretion in primary mouse pancreatic islets , and , based on the ability of ( s)-9b to potentiate 1 , we wanted to determine if ( s)-9b could potentiate the effects of low dose 1 under low and high glucose conditions . as shown in figure 5 , in the presence of 1 , ( s)-9b significantly increased insulin secretion beyond that of either glucose alone or glucose and 1 . measurement of the effect of 30 m ( s)-9b on potentiation of glucose - stimulated insulin secretion in primary mouse islets in the presence of 10 nm 1 . islets were isolated from c57bl/6 male mice , size - matched into wells of a 12-well plate , and treated with vehicle , exendin-4 , or exendin-4 + ( s)-9b at both low ( 5.6 mm ) and high ( 11 mm ) glucose for 60 min . data are represented as mean insulin response sem per 100 islet equivalents and analyzed using 2-way anova followed by sidak s multiple comparisons test . * * p < 0.01 , * * * * p < 0.0001 . having achieved efficacy in primary tissue , we next evaluated the dmpk profile of ( s)-9b to assess its potential as an in vivo tool ( table 2 ) . ( s)-9b , like ( s)-8 , displays an elevated plasma clearance ( clp , 72 ml / min / kg ) that approaches hepatic blood flow in male sprague dawley rats . coupled with a high volume of distribution predicted at steady - state ( vss , 4.0 l / kg ) , ( s)-9b produced a half - life ( t1/2 ) of approximately 1 h in vivo ( table 2 ) . importantly , ( s)-9b was found to possess cns permeability ( kp , 2.7 , kp , uu , 0.25 ) , a first among reported glp-1 pams , although a kp , uu < 1 did indicate a lack of true equilibrium at the tmax of 0.5 h. the elevated clearance and poor associated oral bioavailability ( f , < 1% , observed for ( s)-9b in rat was consistent with the predicted hepatic clearance ( table 2 ) . rat and human liver microsome incubations revealed the principal routes of biotransformation for ( s)-9b to be cyclopentyl oxidation and oxidative n - dealkylation of the pyrrolidine moiety , respectively . the propensity of ( s)-9b to mediate a p450 drug drug interaction ( ddi ) was assessed in an in vitro cassette microsome inhibition assay of 1a2 , 2c9 , 2d6 , and 3a4 . the results of the inhibition screen indicated ( s)-9b to possess low risk of mediating a ddi , displaying micromolar ic50 values against these p450 enzymes ( table 2 ) . while oral delivery of this agent is limiting , intraperitoneal dosing readily enables in vivo work to be performed . to assess ancillary pharmacology , and to ensure that in vivo activity was due to potentiation of glp-1 , ( s)-9b was profiled in a eurofin radioligand binding panel of 68 gpcrs , ion channels , and transporters at a concentration of 10 m , which revealed no significant off - target activity ( no inhibition > 50%@10 m , i.e , kis > 10 m ) . liver microsome clearance was predicted using the well - stirred model with 20 and 45 g liver per kg body weight and 21 and 70 ml / kg hepatic blood flow for human and rat , respectively . in numerous preclinical studies models of parkinson s disease , 1 reverses key deficits and arrests progression ; additionally , the peptide agonist is neuroprotective and neurorestorative in 6-ohda rats . in a recent clinical trial with 1 ( despite very low and variable cns exposure ) , 1 improved both cognition and motor symptoms . we and others routinely employ haloperidol - induced catalepsy ( hic ) as a first tier pharmacodynamic assay to assess potential symptomatic benefit for novel anti - parkinsonian mechanisms . interestingly , neither glp-1 agonists , such as 1 or 2 , or pams have been evaluated in this preclinical model of the motor symptoms of pd . we determined the ability of ( s)-9b to reverse the cataleptic state induced by haloperidol ; these studies were performed in comparison to a positive control , the a2a antagonist preladenant . we tested both 10 and 30 mg / kg doses , administered ip , for their ability to reverse the catalepsy induced by two doses of haloperidol , a screening dose of 0.75 mg / kg , and a more robust challenge at 1.5 mg / kg ( figure 6 ) . excitingly , at the lower challenge of 0.75 mg / kg haloperidol , statistically significant reversal in catalepsy was noted at both the 10 mg / kg ( 36.3% reversal ) and 30 mg / kg ( 50.4% reversal ) doses . for the 1.5 mg / kg dose of haloperidol , the same trend is noted , but significance is only achieved at the 30 mg / kg dose ( 36.6% reversal ) ; data for the a2a antagonist preladenant is shown for comparison ( 62% reversal ) . in satellite animals , the 10 mg / kg dose afforded brain levels of 481 nm , below the glp-1 pam ec50 value of ( s)-9b ; however , the ec50 is based on an ec20 concentration of glp-1 . we do not known the glp-1 tone in the cns or the central concentration of the other three peptidic forms of glp-1 or oxyntomodulin ; thus , the potency and efficacy of glp-1 potentiation by ( s)-9b could be significantly higher in vivo . moreover , the absolute cns concentration 1 is low in both preclinical species as well as humans , despite displaying robust efficacy , perhaps speaking to high receptor reserve of glp-1 in the cns . to further eliminate nonmechanism based efficacy in this model , we performed a spontaneous locomotor activity assay and noted no effect on locomotion or sedative effects ; coupled with the clean ancillary pharmacology in the eurofins panel , it is reasonable to assume the efficacy is due to potentiation of glp-1 . thus , the glp-1r ago - pam ( s)-9b is the first example of glp-1r activation displaying efficacy in a haloperidol - induced catalepsy model , and importantly , ( s)-9b is efficacious by potentiation of endogenous glp-1 as opposed to potentiation of exogenously administered 1 or 2 . glp-1r ago - pam ( s)-9b produces a dose - dependent reversal of haloperidol induced catalepsy in rats . ( a ) ( s)-9b at doses of 10 and 30 mg / kg ip ( 10% tween 80 ) significantly reverse a 0.75 mg / kg ip dose of haloperdiol . ( b ) ( s)-9b at doses of 30 mg / kg ip significantly reverse a 1.5 mg / kg ip dose of haloperidol and the clinically validated a2a antagonist preladenant is shown for comparison . catalepsy was measured as the latency to withdraw the forepaws from a horizontal bar with a cutoff of 30 s. vertical bars represent the means sem of 1012 rats / treatment group . * all compounds were purified to 95% as determined by analytical lcms ( 214 nm , 254 nm and elsd ) as well as h nmr . the general chemistry , experimental information , and syntheses of all other compounds are supplied in the supporting information . to a round - bottom flask was added at room temperature ( s)-2-cyclopentyl-9-methyl-1-oxo - n-(pyrrolidin-2-ylmethyl)-2,9-dihydro-1h - pyrido[3,4-b]indole-4-carboxamide ( 200 mg , 0.51 mmol ) dissolved in ch2cl2 ( 4 ml ) and dry acetone ( 100 l ) . the resultant mixture was stirred at room temperature for 5 min before adding sodium triacetoxyborohydride ( 150 mg , 0.71 mmol ) , at which point the mixture was stirred an additional 4 h. upon completion by lc / ms , the reaction was quenched with sodium bicarbonate ( 5 ml ) and extracted with ch2cl2 . the combined organic layers were dried by passage through a phase separator and concentrated in vacuo . the orange residue was taken up in dimethyl sulfoxide and purified via reverse - phase preparative hplc using acetonitrile in water with 0.5% nh4oh added to elute . pure fractions were pooled and concentrated to dryness in vacuo to afford desired product as a foamy yellow solid in 73% yield . specific rotation [ h nmr ( 400 mhz , cdcl3 ) ( ppm ) : 8.32 ( d , j = 8.2 hz , 1h ) , 7.497.45 ( m , 2h ) , 7.397.37 ( m , 1h ) , 7.247.20 ( m , 1h ) , 7.08 ( m , 1h ) , 5.475.43 ( m , 1h ) , 4.24 ( s , 3h ) , 3.743.68 ( m , 1h ) , 3.383.32 ( m , 1h ) , 3.123.07 ( m , 1h ) , 3.022.95 ( m , 1h ) , 2.942.89 ( m , 1h ) , 2.572.51 ( m , 1h ) , 2.252.22 ( m , 2h ) , 1.961.81 ( m , 3h ) 1.811.67 ( m , 7h ) , 1.12 ( d , j = 6.6 hz , 3h ) , 1.02 ( d , j = 6.4 hz , 3h ) . c nmr ( 100.6 mhz , cdcl3 ) ( ppm ) : 166.93 , 156.23 , 141.05 , 126.54 , 126.47 , 124.77 , 124.06 , 120.09 , 119.92 , 113.34 , 109.64 , 58.17 , 55.52 , 49.70 , 47.36 , 42.47 , 32.35 , 32.32 , 31.05 , 29.06 , 24.41 , 23.48 , 22.23 , 16.24 . hrms ( tof , es+ ) calcd for c26h35n4o2 ( m + 1 ) , 435.5915 ; found , 435.5917 .

renal angiomyolipomas ( raml ) are uncommon benign renal tumours , composed of fat cells , smooth muscle cells and blood vessels . they are associated with a tendency to rupture resulting in sometimes - torrential retroperitoneal hemorrhage as the wunderlich syndrome or as severe potentially exsanguinating hematuria . these lesions may be sporadic in about 80% of cases or be associated with genetic disorders such as the tuberous sclerosis complex . when hemorrhage from raml occurs in pregnancy it presents a unique challenge requiring timely and systematic holistic definitive intervention with the goal of preventing fatality , preserving renal function as well as preventing fetal loss if possible . currently a gamut of management options are available including arterial embolization , radiofrequency ablation , cryoablation , mammalian target of rapamycin ( mtor ) inhibitors ; everolimus and partial or total nephrectomy . we report the management of severe bleeding from raml in pregnancy and highlight the need to adopt a management strategy that suits the practice environment and offers the patient standard and enduring care . a 26-year old trader , in her 16 week of pregnancy ( gravida 2 para 1 ) , presented on account of right flank pain and swelling with associated haematuria ( often in clots ) , weakness , vomiting and anorexia . physical examination revealed severe pallor , pulse ; 118 beats per min , blood pressure ; 90/60 mmhg respiratory rate ; 28/min , and a firm , tender right lumbar mass extending to the right upper quadrant . investigations revealed a pcv of 18% . she was admitted and resuscitated with blood transfusions , analgesics and bladder washouts via a 24 g 3 way foley catheter . when normotensive , tocolysis was commenced with oral nifedipine 20 mg with hourly monitoring of blood pressure . abdominal ultrasound findings showed a pulsatile well delineable oblong hypoechic fluid mass about 77.862 mm in size with its medial compartment in the mid pole . the fluid within the mass had a swirling character and on doppler insonation , this fluid had characteristics consistent with av fistulous aneurysmatic lesion or av malformation . liver harboured two hypoechoic solid focal lesions in the right lobe with features of haemangiomata . magnetic resonance imaging ( mri ) showed a large well defined complex mixed intensity mass involving the anterior and inferior aspects of the right kidney , 1512 cm in size and causes caliectasis of the supero - posterior remnant part of the kidney . the liver harboured poorly circumscribed multiple masses , which are hyperintense on t1 and t2 and post contrast . counseling was done , where the diagnosis and available treatment options ( surgical extirpation after stabilization ) were explained . she was also advised on the risk of perioperative fetal loss as well as the need for long term follow up for the clinically silent hepatic lesions . findings were those of a perirenal haematoma and large hemorrhagic renal mass involving the lower and mid poles and compressing the upper pole ; histopathology revealed renal angiomyolipoma ( figures 2 and 3 ) . angiomyolipoma ( aml ) is a benign mesenchymal tumor composed of variable proportions of adipose tissue , spindle and epithelioid smooth muscle cells and abnormal thickwalled blood vessels ; with the two organs most commonly involved being the kidney ( 77% ) and liver ( 14% ) . amls occur in two distinct ways , either sporadically or in association with tuberous sclerosis ( ts ) . and in this cohort the tumours are usually small , multiple and bilateral . although rare , amls can result in wunderlich s syndrome and or frank hematuria the prevalence of sporadic renal angiomyolipoma is 0.44% , with 0.60% in the female and 0.28% in the male subpopulations . though the causal mechanism is not clearly defined , it is thought that this is due to ubiquitous expression of oestrogen and progesterone receptors in amls . haemorrhage occurring in raml in pregnancy has been shown to be rare ; with only 22 cases reported in the last 35 years . the mean age of the mothers was 30.8 years with a mean gestation of 29.6 weeks . fetal survival till term in the patients treated by nephrectomy is also rare , to our knowledge , only reported in a 15 week pregnant patient with a raml of 7.510 cm . our patient who was 14.5 weeks pregnant , though with a larger tumor 1512 cm ( mri ) had a similar outcome ; she had caesarian section at 40 weeks with a healthy baby . concerning treatment options ranging from minimally invasive options such as embolization , radiofrequency ablation , cryoablation , novel therapies like everolimus to partial or total nephrectomy . earlier workers have shown that prevalence of major bleeding is high in sporadic amls with a diameter of > 6 cm . bleeding aml in pregnancy is a rare and complex vascular surgical emergency and should be managed in a multidisciplinary team . management is largely influenced by the haemodynamic stability of the mother , gestational age , presence or absence of foetal distress and the ready availability of facilities such as an angiography suite , operating theatre and neonatal intensive care . challenges experienced in her management include the absence of facilities for angiography and embolization and absence of in- house facilities for mri . this required careful consideration as to when patient could be moved to get the imaging done . we demonstrate that it is possible to manage severe bleeding from raml by resuscitation and well - timed radical nephrectomy at 14 weeks gestation with excellent maternal and fetal outcome .

diabetic ketoacidosis ( dka ) is an acute metabolic complication that occurs mainly in type 1 diabetes mellitus ( 1 ) . the risk factors are omission of insulin , infection , trauma and acute pancreatitis ( 2 , 3 ) . insulin deficiency increase free fatty acid ( ffa ) and amino acids release from adipose tissue and muscle , respectively and increased counter - regulatory hormones causes increased gluconeogenesis and glycogenolysis in the liver ( 4 , 5 ) . elevated ffa taken up by liver leads to increased production of very low density lipoprotein ( vldl ) , which causes hypertriglyceridemia ( 2 - 4 ) . hypertriglyceridemia is an uncommon cause of acute pancreatitis accounting for 1 - 4% of cases , especially when the serum triglyceride ( tg ) level exceeds 1,000 mg / dl ( 5 ) . in korea , 13 cases of hypertriglyceridemia - induced acute pancreatitis have been reported . in two cases , where hypertriglyceridemia was noted along with dka , the serum tg levels were severely elevated ( 12,864 and 11,929 mg / dl ) but it did not cause acute pancreatitis ( 6 , 7 ) ( tables 1 , 2 ) . the present case also involved dka and an extremely high tg level ( 15,240 mg / dl ) , which ultimately culminated in the development of acute pancreatitis . a 20-yr - old female visited the emergency department because of a 1-day history of vomiting ( 10 times ) and was experiencing epigastric pain with diarrhea on march 23 , 2009 . the patient had been drinking almost daily alcoholic beverages soju ( alcohol concentration in the range of 19 - 22% ) for 5 days prior to admission . the patient had a smoking history of one pack - year . two years previously , the patient experienced dka accompanied by acute pancreatitis . at that time , the patient had been diagnosed with type 1 diabetes mellitus . however , 7 months prior to the current admission , the patient ceased taking insulin . upon admission , the patient was determined to be 161 cm in height , 55 kg in weight with a body mass index of 21.2 . on admission , initial vital signs were blood pressure 90/60 mmhg , pulse rate of 88 beats / min , respiratory rate of 20/min and body temperature of 36.5. physical examination revealed a dehydrated tongue and skin turgor . no palpable lymph node enlargement was apparent on head and neck examination , and no abdominal tenderness on abdominal examination . initial laboratory findings were abga ( ph 7.148 , pco2 12.9 mmhg , po2 126 mmhg , hco3 8.4 mm / l , sao2 98.0% ) , glucose level 281 mg / dl , hemoglobin a1c 13.8% , c - peptide ( premeal ) 0.441 ng / ml ( normal reference : 1.1 - 4.4 ng / ml ) , total cholesterol 1,640 mg / dl , tg 15,240 mg / dl , measured low density lipoprotein cholesterol ( ldl - c ) 246 mg / dl ( determined by homogeneous enzymatic colorimetry method assay ) , high density lipoprotein cholesterol ( hdl - c ) 69 mg / dl , serum ketone body 3.1 mm / l ( normal reference 0 - 0.05 mm / l ) , total bilirubin 1.2 mg / dl , ast 19 iu / l , alt 14 iu / l , total protein 8.4 g / dl , serum albumin 4.1 g / dl , alkaline phosphatase 147 iu / l , serum amylase 81 u / l , serum lipase 108 u / l , wbc 13,310/l , hemoglobin 13.9 g / dl , hscrp 5.616 mg / dl , bun 14.0 mg / dl , creatinine 0.6 mg / dl , sodium 125 meq / l , potassium 4.4 meq / l and chloride 95 meq / l . anti - glutamic acid decarboxylase ( gad ) antibody was 0.12 u / ml ( normal reference 0 - 0.9 u / ml ) , and anti - islet antibody-2 ( ia-2 ) antibody was < 0.4 u / ml ( normal reference 0 - 0.4 u / ml ) . the patient was aggressively hydrated and treated with intravenous insulin in the intensive care unit . on admission , serum sodium was 125 meq / l and serum osmolality was 317 mosm / kg . we suspected pseudohyponatremia caused by hyperlipidemia and hyperglycemia , and tried normal saline infusion . in spite of significant improvement in glucose level for the first 12 hr , sodium level dropped to 115 meq / l . after correcting the hyponatremia with 3% nacl solution , continuous insulin infusion and hydration for next 12 hr , serum sodium level rose to 121 meq / l . on the second day of hospitalization , follow - up laboratory analyses revealed a serum amylase level of 443 u / l and a serum lipase level of 615 u / l . on abdominal computed tomography ( ct ) scan , the pancreas was diffusely swollen with peripancreatic fat infiltration and fluid collection , which suggested acute pancreatitis grade d , according to the balthazar ct severity index ( fig . there was no lipidemia retinalis on an ophthalmologic exam . on the third day of hospitalization , the tg was 506 mg / dl , total cholesterol 281 mg / dl , ldl - c 101 mg / dl and hdl - c 36 mg / dl . on the fourth day of hospitalization , the serum amylase level was 50 u / l and lipase level was 36 fourteen days after discharge , analyses revealed total cholesterol 308 mg / dl , tg 309 mg / dl , ldl - c 184 mg / dl , hdl - c 66 mg / dl , serum amylase level 107 u / l and serum lipase level 48 u / l . in dka , the deficiency of insulin activates lipolysis in adipose tissue releasing increased ffa , which accelerates formation of vldl in the liver . in addition , reduced activity of lipoprotein lipase in peripheral tissue decreases removal of vldl from the plasma , resulting in hypertriglyceridemia ( 8) . however , severe hypertriglyceridemia , which is defined as a tg level > 2,000 mg / dl , is rare . although morbidity is < 1% , clinicians should be aware that devastating consequences such as acute pancreatitis or lipidemia retinalis are possible ( 8) . in extreme cases , co - existence of genetic mutations in lipoprotein lipase should be suspected ( 10 ) . during treatment of dka with severe hypertriglyceridemia , pseudohyponatremia or pseudonormoglycemia due to laboratory interference frier et al . suggested that if serum triglyceride concentration exceeds 2,500 mg / dl , measured electrolyte can decrease by over 5% because of the intracellular movement of serum lipid components . therefore , in the hyponatremic state , the clinician should consider the possibility of pseudohyponatremia and avoid overtreatment with hypertonic saline ( 11 ) . meq / l during the recovery phase , which necessitate temporary correction with 3% hypertonic saline . in severe hypertriglyceridemia the mechanism is related to high plasma chylomicrons or tgs , which are hydrolyzed by lipase in the pancreatic capillaries and subsequently trigger ffa release ( 12 ) that , in turn , causes activation of trypsinogen and commences pancreatic capillary damage by free radical damage ( 13 , 14 ) . the common clinical scenario of hypertriglyceridemia - induced acute pancreatitis involves poorly - controlled diabetes mellitus with type iv hyperlipidemia ( 5 ) , or chronic alcoholism ( 15 ) . in contrast , moderate hyperlipidemia ( usually < 400 mg / dl ) can be observed secondary to acute pancreatitis and should not be confused with the marked hypertriglyceridemia that causes acute pancreatitis ( 16 ) , as in the present case . of note , normoamylasemia is possible in about 50% of patients with hypertriglyceridemia - induced pancreatitis . the mechanism is believed to be the interference with in vitro determination of the actual amylase level by disturbance of the calorimetric method . serial dilutions of the sample could reduce interference of light transmission by hyperlipidemic serum ( 17 ) . in the present case , increased amylase occurred parallel to the decreased tg level , which might have delayed the diagnosis of acute pancreatitis at initial presentation . although acute pancreatitis can initiate dka , dka itself may mask a co - existing acute pancreatitis that occurs in 10 - 15% of cases due to ambiguous clinical presentations ( 16 ) . even worse , nonspecific elevations of amylase and/or lipase without clinical evidence of pancreatitis have been reported in 24.7 - 79.0% of dka cases ( 17 ) . at least in those patients with continuous abdominal pain , it is prudent to seek further laboratory evaluation or a ct scan of the abdomen . in our case , not surprisingly , because of the severe dehydration secondary to dka , the initial and 48 h ranson 's score was 4 points each , which is relatively high . in a previous study , the clinical course of acute pancreatitis with dka seemed to be mild , although the mean ranson 's score was 1.360.5 and the mean ct severity index ( total 20 point ) score was 4.61.2 ; none of the patients developed systemic complication ( 17 ) . in the present case , however , in severe hypertriglyceridemia , physicians should consider the application of plasma exchange to avoid complications ( 18 ) . the present patient has since been administered fibrate , which is the first - line drug of hypertriglyceridemia , and insulin treatment , in order to prevent recurrence of pancreatitis ( 19 ) . to our knowledge , this is the first report of a case in korea of dka and severe hypertriglyceridemia , complicated by acute pancreatitis . although moderate hypertriglyceridemia in dka is common , if the tg level exceeds 1,000 mg / dl , the clinician should consider the devastating consequences such as acute pancreatitis or lipemic retinalis , which might benefited from insulin administration and conservative management , unless otherwise necessitating the plasma exchange .

posttraumatic cerebral infarction ( ci ) is a well recognized complication of traumatic brain injury ( tbi ) and is frequently associated with a poor outcome17 ) . however , its frequency , timing , and risk factors are not well - defined17 ) . furthermore , few data are available to quantify risk factors related to the occurrence of ci following tbi . medical consideration of the causation and apportionment of trauma in patients with ci has utmost importance in compensation or reparation . however , differentiation of spontaneous and traumatic ci is often almost impossible . comprehensive analysis on the etiology of a certain case of ci may lack objectivity , even though the assumption is correct . there is a scoring method , so - called trauma apportionment score ( tas ) for ci , which was consisted with three items , such as the age , the interval from injury to ci , and the severity of the tbi11 ) . we also selected consecutive 50 patients , who admitted this hospital in 2012 due to spontaneous ci . ci was classified into lacunar infarction ( 23 cases ) , territory infarction ( 22 cases ) , border - zone infarction ( 3 cases ) , and cerebellar infarction ( 2 cases ) by the radiological findings . tas for ci was consisted with three items , such as the age , the interval from injury to ci , and the glasgow coma score ( gcs ) after the tbi ( table 1 ) . when tas was calculated in the patients with spontaneous cis , the interval and gcs scores were supposed as 3 ( within 7 days ) and 1 ( gcs 13 - 15 ) . to enhance the reliability , we revised tas ( rtas ) adding three more items , such as systemic illness , bad health habits , and doctor 's opinion ( table 2 ) . the tas was 8 in the 26-year - old male15 ) , which implied the apportionment ranged 80 to 100 percent . however , the tas was only 4 in the 38-year - old male9 ) , which implied the apportionment ranged 50 to 70 percent . even in 50 patients with spontaneous ci , the tas was 4 in 44 patients , and 5 in 6 patients ( table 3 ) . tas with three items failed to differentiate the apportionment of trauma efficiently , especially when the age was young . we recalculated rtas in both patients with traumatic and spontaneous ci . in 50 patients with spontaneous ci , the rtas was less than 12 in 36 patients , and 12 in 11 patients ( table 4 ) . the rtas was 17 in the 26-year - old male15 ) , which implied the apportionment ranged 81 to 100 percent . the rtas was still 12 in the 38-year - old male9 ) , which implied the apportionment ranged only 21 to 40 percent . although the rtas may enhance the discriminating ability , there were still significant overlapping areas . tas with three items only failed to differentiate the traumatic ci from the spontaneous ci efficiently . posttraumatic ci is a well - known complication of tbi , with a frequency ranging from 1.9% to 10.4%2,6,12,14,16,17 ) . posttraumatic ci may occur secondary to focal mass effect , vascular impingement usually caused by herniation , cerebral vasospasm , thromboembolism , cerebrovascular injury , systemic hypoperfusion or venous congestion at craniectomy sites6,12,14,16 ) . the multivariate analysis identified that low gcs , low systolic blood pressure ( bp ) , brain herniation , and decompression craniotomy were risk factors for ci in patients with moderate or severe tbi17 ) . to diagnose a traumatic ci , the following criteria should be satisfied : 1 ) there should be a radiological evidence , 2 ) there should be an acute onset of corresponding clinical signs and symptoms , and 3 ) patients should not have a history of cerebral infarction or low - density lesions as possible surgical or traumatic complications17 ) . as a radiological evidence , there should be a distinctly low - density area within a defined cerebral vascular territory , involving the entire territory ( complete ) or part of it ( incomplete ) , or situated in the terminal zones of perforating arteries within the deep white matter was identified on repeated ct scans , and the admission ct revealed no abnormality in same area17 ) . however , these criteria can not be sufficient to evaluate the causation of the ci after tbi . since a spontaneous ci can be developed after a tbi , a ci after a tbi does not mean the cause is trauma . to evaluate the causation or apportionment of trauma on the ci , we should explore various risk factors of ischemic strokes and pathophysiological effects of tbis . the incidence of stroke rises exponentially with age and is therefore low in young adults5 ) . only 3 % of cis occur in patients under the age of 407 ) , and about 10% of all strokes occur in patients < 50 years of age8 ) . in korea , about 5% of spontaneous cis including transient ischemic attacks , occurred in patients under the age of 404 ) . platelet aggregation was not associated with injury severity , shock or severe brain injury18 ) . it was associated with a 10.2- , 4.6- , and 2.3-fold increased risk of subsequent stroke during 3 months , 1 year , and 5 years of follow - up , respectively3 ) . the risk of stroke among patients with skull fracture was more pronounced than among patients without skull fracture , both compared with those in the comparison cohort3 ) . in addition , the risk of subarachnoid hemorrhage and intracerebral hemorrhage increased more considerably in patients with tbi , compared with individuals unaffected by tbi . the mechanism by which a tbi may influence the incidence of stroke is still vague . yet , several possibilities such as direct damage to the vessels , clot formation at the site of injury and other parts of the head , or loosening of clots from an atherosclerotic blood vessel , could help explain the link between tbi and stroke3 ) . even in the aged victims , although we can not ignore the role of trauma in the aged , the apportionment of trauma will be more important in the young patients than in the aged patients . traditionally , lacune infarctions were considered as spontaneous infarctions , since the 2 most common causes of them are atherosclerosis and lipohyalinosis in the adult population . however , ischemia of the basal ganglia may result from stretching or vasospasm of perforating arteries as an immediate consequence of minor head trauma in children and young adult10,21 ) . the interval from injury to ci can be an important clue to presume the apportionment of the trauma . traumatic ci developed early in the clinical course ( median 8.7 days , range 1 - 59 days ) , usually within 2 weeks after the injury17 ) . it appeared within the first week in 31% , 8 days to 2 weeks in 43% , 2 to 3 weeks in 14% , 3 weeks to 1 month in 7% , and 1 to 3 months in 5%17 ) . in pediatric ages , most ( 26/29 ) of the patients developed the neurological symptoms and signs within 72 hours after trauma , 51.7% within 30 minutes19 ) . the risk of ci after tbi is highest within the first week , then rapidly diminished . although tbi was independently associated with a 2.3-fold increased risk of subsequent stroke during up to 5 years of follow up3 ) , the probability of causation would be decrease with time . the occurrence of traumatic ci was significant correlated to low systolic bp , brain herniation , admission gcs , and decompressive craniectomy6,17 ) . infarction was primarily due to gross mass effects producing transfalcine and/or transtentorial herniation and occurred in a wide variety of vascular territories12 ) . the probability of cis after mild tbis will be very lower than cis after severe tbis . anyway , tas with these three items was not so useful . adding three items more , such as systemic illness , bad health habits , and doctor 's opinion , rtas was proposed . for ischemic stroke , nine risk factors , such as hypertension , smoking , abdominal obesity , diet , physical activity , diabetes mellitus , alcohol intake , psychosocial factors , and apolipoproteins , accounted for about 90% of the population - attributable risk13 ) . hypertension , diabetes , and cardiac disorders were present in 47% , 16% , and 8% of patients with ci in korea , respectively4 ) . we selected two most common disorders , hypertension and diabetes , as a component of the rtas . traditional risk factors for stroke such as hypertension and diabetes are not very frequent in young adults5 ) . however , current smoking , and long - term heavy alcohol consumption are major risk factors for stroke in young adults , along with diabetes , hypertension , and heart disease20 ) . of course , there are some other permanent or transient risk factors such as oral contraceptives , migraine , use of illicit drugs , and pregnancy or puerperium5 ) . we should consider all these risk factors along with any evidences of traumatic brain injury to determine the causation . the role of trauma can not be fully assessed by the five components of the rtas . there may be a direct evidence of trauma or sufficient evidences of spontaneous origin . the doctor may influence on the score , by careful considerations on the all other components related to the causation of the ci . the interval and gcs scores were artificially supposed as 3 ( within 7 days ) and 1 ( gcs 13 - 15 ) to simulate obscure cis . if the interval was longer than 7 days , the rtas would be low , which means the possibility of traumatic ci would be decrease . in this condition , differentiation of traumatic cis from spontaneous cis severe head injury may cause traumatic cis . if the gcs was low ( 8 ) , the rtas will increase 2 points . although differentiation of traumatic cis from spontaneous cis will be obscure , actually the possibility of traumatic ci would be increase . argument on the causation is more common in mild head injuries . in all patients with spontaneous ci , although the interval and gcs scores were again supposed as 3 and 1 , the rtas was not more than 11 in more than 70% of the spontaneous ci . compared to tas , rtas definitely enhanced the discriminating ability . when the doctor thought the causation was obscure , even in spontaneous cis , the rtas reached up to 13 in 3 patients , which implied trauma apportionment rate as 41 - 60% . tas alone is insufficient to differentiate the cause or apportionment of trauma in some obscure cases of ci . although the rtas may enhance the reliability , it also should be used with cautions .

medical interventions directly targeting epigenetic functionalities are among the most promising novel approaches for treatment of serious pathological states such as cancer , metabolic and neurological diseases , inflammation , and viral infections . the first marketed epigenetic drug ( vorinostat ) provided in 2006 the proof - of - concept for targeting epigenetic machinery by small molecules in a therapeutic manner . since then , a multitude of epigenetic proteins have been suggested as potential targets for pharmacotherapy , including families of enzymes like the histone acetyltransferases ( hats ) , the dna methyltransferases ( dnmts ) , and the histone deacetylases and sirtuins ( hdacs and sirts ) . bromodomains ( brds ) comprise a family of 61 epigenetic modules implicated in recognition of acetylated lysine ( kac ) residues mainly on histones . the brds can be found as components of at least 46 multidomain proteins of the human genome . the discovery of a small molecule selectively inhibiting brds in bromo- and extra - terminal ( bet ) proteins ( brd2 , brd3 , brd4 , brdt ) has provided solid evidence for brd druggability . the fused triazole - thienodiazepine scaffold - based 1 ( ( + ) -jq1 ) has shown antiproliferative effects in brd4-dependent human nut midline carcinoma ( nmc ) cells in vivo . an increasing number of studies provides a compelling rationale for using 1 as well as a structurally related triazolobenzodiazepine - based bet inhibitor ( i - bet762 , see figure 1a ) , mainly as antiproliferative or immunomodulatory agents . ( a ) structures of known brd inhibitors along with their specificity profile within the various brd subfamilies . ( b ) chemical structures for selected compounds evaluated as brd inhibitors in this study . the establishment of the bet group of brds as valid therapeutic targets for the aforementioned aggressive form of cancer , along with the increasing amount of data showing that brd modules critically affect several cellular functions , have led to the emergence of brds as appealing targets for development of highly specific inhibitors . as all brd are not equally druggable , the family can be subdivided into nine subfamilies ( i to ix ) according to structural features that define druggability of each member . at present , an increasing number of compounds selectively inhibiting brds outside the bet group ( subfamily ii ) are described . among the available molecules are i - cbp112 and cbp30 that target subfamily iii c - amp response element - binding protein binding protein ( crebbp ) and e1a binding protein p300 ( ep300 ) , compounds lp99 , i - brd9 , and bi9564 inhibiting subfamily iv brd7 and brd9 , compounds ni57 , of-1 , and pfi-4 targeting subfamily iv bromodomain and phd finger containing-1 , -2 , and -3 ( brpf1 , brpf2 , and brpf3 ) , compounds gsk2801 and baz2icr targeting subfamily v bromodomain adjacent to zinc finger containing - domain 2a and 2b ( baz2b / a ) , and 2 ( pfi-3 ) targeting subfamily viii swi / snf related , matrix associated , actin dependent regulator of chromatin subfamily a , member 2 and 4 ( smarca2/4 ) and pb1(5 ) , while a number of molecules targeting sets of brds have been developed as well ( compound structures are shown in figure 1a , b ; for a more complete overview please see review refs ( 29 , 30 ) ) . such compounds with single or group - wise brd - selective inhibitory properties can significantly advance the elucidation of biological roles of targeted brds and may thus serve as invaluable chemical biology probes for mechanistic studies or as possible drug candidates . the brds of subfamily viii have been characterized as proteins of intermediate or difficult druggability , in contrast to highly druggable subfamilies such as i or ii ( the bets ) or individual members of subfamilies iii , iv , and vii . subfamily viii is comprised by brds that are mostly components of the chromatin remodeling complexes of swi / snf family . indeed , all swi / snf complexes contain a central helicase with a bromodomain ( smarca2/4 ) while the polybromo - associated brg1 or hbrm - associated factor ( pbaf ) complex , a subtype of the swi / snf complex ( or swi / snf - b ) , contains also the polybromo protein pb1 ( or baf180 ) which comprises six individual brd modules . remodeling complexes of the swi / snf family play a central role in development , particularly of the cardiac cells . mutations in components of these chromatin modulators have been tightly linked to development of numerous cancer types including epithelioid sarcoma and malignant rhabdoid tumors . especially in the case of renal cell carcinoma and pancreatic cancer , normal expression of the pbrm1 gene encoding for pb1 protein is considered as a critical factor of tumor progression . moreover , truncating mutations of pb1 which have been found in breast cancer cells suggest a possible role for pb1 as a tumor suppressor . although the precise mechanism for its tumor repressor activity is not yet clearly understood , it is thought that this functionality might be partially mediated through the ability of pb1 to regulate p21 induction . moreover , the tumor - suppressing role of pb1 has been shown to be related to promotion of centromere cohesion and thus preservation of genomic stability in a manner independent from its involvement in transcriptional regulation . an additional aspect of its tumor suppressing role is highlighted by its activity as a repressor of transcription in response to double - strand breaks of dna . finally , the occurrence of six distinct brds on pb1 has raised a number of questions regarding their concerted or complementary function or even their redundancy . two of pb1 brds lack the canonical asparagine that coordinates the kac carbonyl ( or equivalent moieties in inhibitors ) . it is likely that these brds bind therefore much weaker to inhibitors that typically hydrogen bond directly with this asparagine residue . as pb1(5 ) showed strongest interaction to acetyl - lysine containing histone peptide arrays , it is therefore likely the most relevant brd anchoring pb1 ( and the swi / snf complex ) to chromatin in an acetyl - lysine dependent way . as a result , discovery of highly specific chemotypes with inhibitory properties toward brds of subfamily viii such as pb1 and more specifically pb1(5 ) can be regarded as a challenging project , which would advance the existing knowledge concerning their underlying biological roles of these domains in health and disease . this notion is further highlighted by the finding that , while the atpase module seemingly surpasses smarca2/4 as a drug target for synthetic - lethal interventions in a number of swi / snf - related cancer types , targeting pb1(5 ) and smarca2/4 does not result in toxicity but in differentiation phenotypes and thus simultaneous inhibition of several swi / snf brds can possibly provide alternative routes for therapeutically modulating chromatin remodeling . in this study , the utilization of three virtual screening ( vs ) methodologies of high orthogonality and their combination in a simple consensus scheme is presented . the national cancer institute / developmental therapeutics program ( nci / dtp ) repository was systematically evaluated against a group of underexplored brds with moderate druggability and a pyrazoloisocoumarin hit showing low micromolar affinity , and a promising selectivity profile toward the fifth brd of pb1 was identified . the attempt to optimize this ligand was based on the integration of thermodynamic and structural data obtained by x - ray crystallography and isothermal titration calorimetry ( itc ) analysis with theoretical calculations . hydration mapping was performed by implementation of the two most robust algorithms , namely szmap and watermap , which afforded a high degree of convergence . subsequent synthesis of rationally designed analogues where specific water molecules would be targeted by gradual expansion of the exocyclic methyl group resulted in derivatives demonstrating improved binding affinity and high selectivity for pb1(5 ) over related brds , displacing the protein from chromatin in cells and reducing viability of human fibroblasts . a screening initiative was undertaken as a means to discover compounds that selectively bind brds of subfamily viii , thus providing novel and tractable scaffolds for sustaining an inhibitor development project . the nci / dtp compound repository comprising approximately 260000 entries was selected due to its open - access policy . it was reasoned that an in silico computational evaluation of the collection prior to experimental screening would increase the anticipated hit recovery rate and additionally enhance the overall rational character of the study by providing structural insight from the initial steps of the process . therefore , three distinct yet complementary vs methodologies were implemented in a stepwise protocol aiming at the optimal exploitation of sampling efficacy in a time - efficient manner . these methods would directly account for binding to the protein cavity ( docking and scoring calculations featuring protein ligand energy terms and implicit solvent contributions to binding ) as well as conformational likeliness of the screened compounds to a known active compound ( three - dimensional similarity involving pharmacophoric sites and shape in real space ) or for the existence of hidden or nonobvious molecular motifs ( two - dimensional similarity of topological fingerprints representing structural features and chemical functionality ) commonly occurring between the screened collection entries and a known active template . the overall workflow of the implemented integrated vs protocol is depicted in figure 2 . in the first step , a ligand - based approach would be used to evaluate the total nci / dtp collection and find compounds that were similar to 1 . for this purpose , two - dimensional similarity screening was performed using canvas ( schrdinger inc . ) . canvas was additionally used in this step to create a potentially enriched subset of the initial library containing 5000 diverse compounds ( 2% of the total ) . in the second step , results of the ligand - based diversity evaluation would be redirected as input to a structure - based screening approach by implementing docking - scoring calculations of the enriched subset toward the bromodomain kac - binding pocket using glide sp ( schrdinger inc . ) . in parallel , a separate ligand - based three - dimensional similarity screening of the global library finally , results of the different approaches were combined by a consensus scoring scheme and the top - ranked compounds would be selected for in vitro assays . the high degree of orthogonality between the two different screening pathways was thought as a means to effectively enhance sampling robustness and thus accuracy of the vs protocol , while their combination in a mixed serial - parallel manner was expected to optimize screening speed with the most time - consuming structure - based method being preceded by a ligand - based , fast prescreening of 2d similarity . virtual screening protocol utilized for the evaluation of the nci / dtp repository . compounds were subjected to three different in silico screening methodologies . two - dimensional similarity ( toward 1 , canvas software , left - side funnel ) was performed after discarding benzodiazepine - containing structures ( bzds ) . the top 2% diverse nci / dtp molecules were additionally docked to the brd ( glide software , middle funnel ) . in parallel , three - dimensional similarity was undertaken for the total collection ( toward 1 , rocs software , right - side funnel ) . finally , rank - ordered results originating from each of the three distinct filters were combined by a consensus ranking approach and the top 40 compounds were assayed experimentally for their brd - binding affinity . the nci / dtp repository was independently prepared in terms of correct protonation state , tautomerization , and stereoisomerization for docking calculations and 3d similarity searches using ligprep ( schrdinger , inc . ) and quacpac ( openeye , inc . ) , respectively . in the case of 3d similarity screening , filter and omega ( openeye inc . ) the query molecule used in both ligand - based approaches was 1 , the only high - potency brd inhibitor known at the time of the study . the compound does not show strong binding to any bet group brd . however , on the basis of the highly conserved fold and high homology between brd4 and pb1 ( sequence similarity 61.6% ) as well as in the absence of any other template , it was thought that the overall molecular geometry of 1 would adequately outline the fundamental structural requisites for competing kac binding needed for hit recovery . it should also be noted that all nci repository entries containing the benzodiazepine ( bzd ) core were filtered out and excluded from the screening study as a means to aid the discovery of novel scaffolds with brd binding properties . in the 2d screening approach , the structures of all nci / dtp compounds were converted to fingerprint ( fp ) strings by utilizing a variety of different algorithms for fp derivation . then , the structural similarity of each nci / dtp compound with respect to the query molecule was determined by comparing the tanimoto distance of its fps with the corresponding fps calculated for 1 . setup of the 2d screening calculations was not straightforward , as the selection of the most appropriate combination among the wide array of fp derivation methods and similarity measuring metrics available in canvas is not always trivial . for this reason , a minimal training set was prepared with 20 fragments of known binding affinities for brd4 , crebbp , and baz2b ( sgc unpublished data ) seeded into a set of 6000 randomly chosen entries from the nci / dtp repository regarded as inactive decoys . then , a total of 60 screens were performed using several recommended combinations of the canvas 2d - screening parameters and the efficiency of each screen to top - rank the 20 active fragments among the 6000 decoys was quantified . of these 60 screens , 11 afforded high recovery rates of the known actives , with enrichment factor at 20% of screened library ( ef20% ) reaching 2.22.5 for the 11 selected fp combinations while it was 01.2 for the remaining ( efmax20% is 5 ) . these fp combinations were further selected for screening the global nci / dtp repository ( concerning fp derivation , scaling , and atom - typing methods ; see supporting information , table s1 ) . in the structure - based approach , the 5000 molecules of the enriched nci / dtp subset derived from 2d - prescreening were sequentially docked to the brd kac - binding pocket and their theoretical affinity for the protein was evaluated using the glidescore empirical scoring function as implemented in glide . concerning the 3d - sceening methodology , similarity searches were performed for 200-conformer ensembles of each nci / dtp entry against 1 at its bioactive conformation . the 3d similarity was determined in terms of overall molecular shape overlap ( shape similarity ) as well as spatial similarity of pharmacophoric sites such as positive and negative atoms , hydrogen bond donors and acceptors , hydrophobes , and rings ( color similarity ) . each of the implemented screening approaches ( 2d similarity - assisted docking and scoring screen , independent 2d and 3d similarity screens ) afforded a distinct list of compounds ranked according to their potential to bind the brd pocket and compete with acetylated histone binding . the lists were combined by a simple consensus scoring approach accounting for the frequency of appearance of each compound within a given percentage threshold of the top of the individual lists . by using this consensus scoring scheme , the 40 top - ranked compounds were selected for assessing their brd binding properties in vitro using a differential scanning fluorimetry ( dsf ) assay . the 40 compounds that scored higher in the consensus scheme were assayed in vitro using the thermal shift dsf screening assay ( supporting information , table s2 ) . this method is based on measurement of the thermal stabilization of a protein in the presence of a small - molecule binder , as determined by the increase of the protein ligand complex melting temperature ( tm ) compared to that of the apoprotein . a screening panel of six brds was utilized for obtaining insight into the specificity profile of the potential hits . the dsf assay was implemented with high protein and ligand concentrations and resulted in the identification of seven compounds ( 39 , figure 1b ) with detectable temperature shifts ( supporting information , table s3 for tm curves and screening method of selection ) . out of those , five failed to bind pb1(5 ) but showed very weak binding toward brd4(2 ) , with corresponding tm values ranging between 0.8 and 2.0 c . these results were in accordance with the well - established , favorable druggability of this brd ( and the bet group in general ) . compound 8 ( nsc76484 ) resulted in a 3.2 c stabilization toward brd4(2 ) . this particular scaffold demonstrated a rather obvious structural similarity with known brd4 inhibitors , as its tricyclic ring system contained a triazole moiety reminiscent of the corresponding pharmacophore of 1 . the most interesting finding was compound 9 ( nsc356476 ) , which showed a marked stabilization of 4.1 c toward pb1(5 ) and at the same time only weak binding to brd4(2 ) ( tm of 1.9 c ) at 100 m compound concentration . the results of the thermal shift assay were considered as a good indication that 9 , a pyrazoloisocoumarin derivative of relatively low molecular weight ( 200 da ) , could constitute a novel brd - binding scaffold and at the same time a promising hit with a highly preferable specificity profile toward brd related to the swi / snf chromatin remodeling complexes . to better understand the interaction between 9 and pb1(5 ) , the cocrystal structure of the protein ligand complex was determined at a resolution of 2.02 and the binding mode of 9 was elucidated ( supporting information , table s4 ) . the ligand bound with the benzopyrone system buried deeply in the kac pocket , while the n3 of the pyrazole ring accepted a hydrogen bond from the amide nitrogen of the conserved n739 ( figure 3b d ) . with the exception of this hydrogen bond , the most important contacts of 9 with the bromodomain are accommodated by l687 and l693 of the za loop , by i745 of c - helix as well as by i683 and f684 , two residues that constitute along with a682 the wpf shelf of the kac cavity in pb1(5 ) . a weak edge - to - face stacking interaction notably , the overall conformation of the za loop in the complex of 7 and pb1(5 ) did not induce structural changes when compared to the apoprotein , suggesting that the unusual loop conformation observed for pb1(5 ) in a previously released structure ( pdb code : 3g0j ) is not induced as a result of ligand binding . binding of 9 to pb1(5 ) leads to displacement of water molecules . ( a ) apo - structure of pb1(5 ) ( pdb code : 3g0j ) with the canonical water network . the main secondary structure elements as well as acetyl - lysine binding site residues are shown in stick representation . the inset shows a 2fofc electron density map contoured at 2 around the ligand . the main residues and water molecules present in the apo - structure are shown . ( d ) surface representation showing that 9 displaces four of five structural waters present in the acetyl - lysine binding site . interestingly , compound 9 displaced four of the five of the conserved buried water molecules that are observed in the majority of the available brd these waters form an extensive hydrogen bond network in the kac - binding cavity which is usually retained in most of the released bromodomain inhibitor cocrystal structures ( b - values of waters between 28 and 40 , similar to main chain calpha positions in the protein backbone ) . in the case of 9 , however , the only water molecule that was not displaced seems to be stably bound through a multidirectional system of four hydrogen bonds to the side chain hydroxyl of y696 , the side chain amide of n734 , and the backbone carbonyls of m704 and m731 ( supporting information , figure s1 ) . this water was the most deeply buried of the aforementioned network of conserved waters , and it was located within hydrogen - bonding distance to both the exocyclic carbonyl of 9 and the side chain of the conserved y696 of za loop . this water molecule is highly conserved and forms a hydrogen bond with the hydroxyl group of y696 in acetyl - lysine containing peptides and acetyl - lysine mimetic inhibitor complexes . an additional water that participates in ligand binding was found in the first hydration shell on the solvent - accessible side of the kac cavity , forming a hydrogen bond bridge between n2 of 9 and the side chain carbonyl of n739 . finally , the good complementarity of the ligand to the acetyl - lysine binding cavity was indicated by the solvent - accessible surface area that was buried upon binding which was 172 for the ligand ( 135 apolar ) and 188 for the protein ( 177 apolar ) . a binding mode displacing four of the five structural water molecules similar to 9 has also been described for 2 and salicylic acid - containing fragments . it was therefore explored whether compounds containing phenolic moieties similar to 2 and salicylic acid or pyrone - related structures similar to the isocoumarin system of 9 could induce the same water displacement motif with 9 and hence demonstrate binding affinity for pb1(5 ) . moreover , due to increased stability of compounds bearing closed rings , such as 9 , against hydrolysis when compared to 2 , identifying new scaffolds interacting with swi / snf bromodomains using this unique water displacing binding mode was of high interest to us . screening of a small in - house library of natural products identified 5,3,4-trihydroxyflavone ( 14 ) and luteolin ( 15 ) as binders of brds with strongest temperature shifts observed for pb1(5 ) ( figure 4a , b ) . subsequent cocrystallization studies indeed confirmed the hypothesized water displacing acetyl - lysine binding modes for both flavones , maintaining only water w5 in the binding pocket ( figure 4c f ) . the critical role this buried solvent molecule seems to have in complex stabilization should certainly be considered when planning chemical modifications targeting hit optimization . yet , its net energetic contribution to binding should be carefully assessed because there might be a considerable penalty component due to its restrained positioning . the affinity of 15 was determined using isothermal titration calorimetry , resulting in a kd of 12.9 m . flavonoids 14 and 15 interact with the acetyl - lysine binding site of pb1(5 ) in a water displacing binding mode . ( a ) temperature shift assays of 14 and 15 measured on diverse bromodomains at 10 m and 100 m inhibitor concentration . ( b ) isothermal titration calorimetry revealed a dissociation constant of 12.9 m for 15 . shown are raw titration heats as well as normalized binding heats ( inset ) . ( c ) binding mode of 14 shown in ball and stick representation with yellow carbon atoms in pb1(5 ) ( inset : 2fofc map ) . ( d ) binding mode of 15 shown in ball and stick representation with yellow carbon atoms in pb1(5 ) ( inset : 2fofc map ) . water molecules that are displaced in the 14 complex are highlighted by a red cross . water molecules that are displaced in the 15 complex are highlighted by a red cross . to accurately determine the binding affinity of pyrazoloisocoumarin 9 for pb1(5 ) , we measured the dissociation constant ( kd ) in solution using itc . this analysis revealed a kd value of 11.5 m , single site binding stoichiometry and a favorable binding enthalpy change ( h of 5.6 kcal / mol ) were measured at 288 k , affording a fairly high ligand efficiency ( le ) index of 0.46 for this hit ( table 1 ) . the low micromolar affinity of 9 in combination with its high le showed that the compound could indeed be considered as a promising starting point for rational development of analogues with improved binding affinity . the estimated gbinding indicated that binding is dominated by enthalpic interactions , in accordance with the structural analysis , showing the formation of polar interactions . as mentioned before , the flavonoid hit 15 had a similar affinity ( kd of 12.9 m ) ( figure 4b ) . however , by considering the less pronounced originality and chemical tractability of the flavone system and , most importantly , the poor selectivity of 15 ( figure 4a ) over other brds and other target families ( e.g. , kinases ) , the aforementioned scaffold was not prioritized at that stage and 9 was selected for further activity optimization . the g values predicted by fep - rest for each mutation along with corresponding errors are calculated using the bennett method as implemented in desmond software , while the maximum error between predicted and experimental binding affinities is within 0.6 kcal / mol . in an effort to devise a rational optimization strategy for the newly characterized pyrazoloisocoumarin hit to a possible lead compound , structural and thermodynamic data were combined and considered collectively . inspection of the binding mode of 9 indicated three major extension vectors that could be utilized for hit optimization ( shown in figure 5a , b ) . nevertheless , no obvious hydrogen bonding or electrostatic interaction partner was located within a reasonable radius around the bound ligand . moreover , the apparent optimal fit of 9 and pb1(5 ) in combination with the known overall relative rigidity of the brd fold set skepticism with respect to its capacity to explore more extensive models for hit expansion . it was hypothesized that affinity of 9 could be potentially enhanced through manipulation and fine - tuning of solvent effects that may affect the binding interaction . to explore this , the computational analysis of the protein hydration pattern was undertaken using the two currently available algorithms , szmap ( openeye inc . ) and watermap ( schrdinger , inc . ) . comparison of the 9pb1(5 ) complex hydration analysis results obtained using szmap and watermap . ( a ) hydration sites predicted using szmap algorithm are shown as yellow ( negative g , stable ) and magenta ( positive g , unstable ) spheres . ( b ) water molecules predicted for 9pb1(5 ) complex using watermap algorithm are depicted as spheres colored according to their g ( green , low ; red , high ) . the three most feasible extension vectors of the pyrazoloisocoumarin scaffold are depicted as red dashed arrows , and the related protein solvation sites are marked with their corresponding energy values in kcal / mol . the two methods afforded fairly comparable results showing highest convergence toward predicting unstable solvent molecules of za channel as the most promising hydration site that was therefore targeted by structural modifications of the hit . computational solvation mapping of a binding site ( e.g. , as performed by szmap or watermap ) can identify hydration sites that may confer ligand potency should that ligand for example efficiently displace or replace water molecules of appropriate energetics . as such , solvation mapping can suggest possible lead optimization modifications to optimize enthalpic protein ligand interactions while simultaneously decreasing unfavorable entropy that results from localization of bulk water . indeed , it has been shown that brds accommodate solvent - mediated interactions with their ligands that involve buried , conserved water molecules and are regarded as critical for binding . this highlights the considerable impact that the equilibrium between solvent dynamics and ligand binding can have to the druggability of each brd . the hydration analysis performed for pb1(5 ) was focused to three separate regions of interest corresponding to the most promising extension vectors of the pyrazoloisocoumarin scaffold ( figure 5a , b ) . those three regions were ( i ) the inner side of the kac cavity , ( ii ) the entrance of the binding cavity , and ( iii ) the periphery of the za channel , a narrow saddle - shaped surface created by the za loop in the boundary of the brd cavity in direct contact to the bound ligand . those regions were extensively mapped utilizing the two above - mentioned computational approaches and inspected visually . concerning the first region , szmap predicted a hydration site partially overlapping with the buried water of the kac cavity , a site thus needed to be efficiently replaced by a ligand polar group capable of forming equally extensive stabilizing interactions with the protein . for the second region , szmap predicted a hydration site also corresponding to a highly stable water molecule that would consequently favor binding if merely being replaced by a polar group of the ligand . however , concerning the third region , szmap predicted a cluster of unstable waters residing at the outer boundary of this hydration site . those waters were seemingly trapped in a relatively hydrophobic environment yet in close proximity to the bulk solvent , thus they could be possibly targeted by nonpolar ligand groups ( figure 5a ) . the utilization of watermap was also successful in identifying the aforementioned regions of interest concerning the protein hydration landscape ( figure 5b ) . results obtained using watermap showed high convergence with the corresponding szmap data with respect to the role of the buried water molecule ( supporting information , figure s1 ) . both approaches predicted that this was a highly stable water that would be rather difficult to increase binding affinity by replacing it by the ligand . however , watermap predicted that the hydration site located at the entrance of the binding site harbors a relatively unstable water , but these results were not confirmed by szmap . this slight discrepancy was likely due to the actual position of these waters close to the first hydration shell of the protein and also to algorithmic differences implemented by each methodology . however , the prediction concerning the third region of interest was in good agreement between both methods . more specifically , at least two sites of unstable waters were predicted in the periphery of the za channel , in good overlap with the cluster of unstable waters predicted by szmap . moreover , another conserved water site was identified in fair proximity at the inner side of the za channel . interestingly , prediction of the latter as well as one of the former sites was well supported by the actual presence of crystallographic water molecules in the protein ligand complex , as the unstable water was visible only in one brd molecule present in the asymmetric unit , while a water molecules predicted to be stable was present in both binding sites and interacted with three hydrogen bonds to the backbone carbonyls or amide nitrogens of residues a682 , f684 , l685 , and r686 . in a consensus point of view , this third site at the periphery of the za channel was the most promising region in terms of structural interventions targeting affinity optimization through manipulation of the solvent component . both approaches used for hydration analysis suggested that this site , as occupied by unstable waters , can be regarded as moderately exposed to the solvent environment and , therefore , it is possibly suitable to be targeted by nonpolar ligand groups in a manner that could favor affinity by replacing those waters . in light of the structural , thermodynamic , and hydration analysis performed so far , inspection of the available extension vectors of 9 led to the selection of the 1-methyl group of the pyrazole ring as the most suitable for chemical elaborations . most substitutions on the phenyl ring of 9 would possibly lead to steric clashes with the protein as was suggested by the optimal fit observed for 9 in the x - ray structure of the complex . efficacious replacement of the buried structural water was deemed highly challenging given the enthalpic penalty predicted for the elimination of this water , a notion in agreement with several lead optimization studies available for brds ( figure 5 and supporting information , figure s1 ) . likewise , efficient replacement of the stable water at the inner side of the za channel seemed unlike due to the pronounced high free energy penalty estimated by szmap ( 12.55 kcal / mol ) and watermap ( 1.97 kcal / mol ) for this particular water . moreover , any possible modifications targeting the nitrogens of the pyrazole ring were avoided , as this part of the scaffold constitutes an essential element of the pharmacophore that anchors 9 to the protein , as shown in figures 3b d . combined with the insufficient convergence between the two hydration mapping methodologies concerning the region corresponding to the binding site entrance , the unstable waters of the za channel were finally selected to be targeted . a conservative , proof - of - concept strategy was devised wherein the 1-methyl would be gradually extended to an alkyl chain of up to four carbon atoms ( i.e. , from 1-methyl to 1-n - butyl ) . indeed , in accordance with the predictions , the microenvironment at the outer boundary of the za channel toward where the introduced alkyl chain was anticipated to be directed and reside is highly hydrophobic and consists of residues i683 , f684 , l685 , and p688 . moreover , the limited concavity and the overall shape of the region suggested that the unavoidable conformational entropy penalty expected by restriction of the alkyl chain upon binding could be kept minimal , thus outbalancing any unfavorable impact on ligand affinity . yet , to check the appropriateness of the designed modifications , free energy perturbation - replica exchange solute tempering ( fep - rest ) calculations were undertaken and the predicted changes in free energy of binding were determined . shaw research ) was used , and 5 ns simulations were performed for each transformation of the ligand either inside the protein environment or in pure water using an explicit solvent representation . the simulation results showed that the designed analogues demonstrated moderately higher predicted affinities compared to the original methyl analogue . interestingly , the most promising modification was shown to be the introduction of the long butyl chain . while there is no accurate methodology based on fep calculations for distinguishing between the enthalpic and entropic components of the predicted free energy release , visual inspection of the structures indicated that the displacement of the unstable waters by the za channel periphery by the extruding alkyl chain was realistic . moreover , because of the limited nature of the designed structural modifications , fep simulations were considered as reliable . thus , the encouraging predictions of fep prompted us to proceed with synthesis of the novel analogues . compound 9 was synthesized along with a series of new analogues as depicted in scheme 1 . ozcan et al . later achieved the synthesis of the nor - pyrazoloisocoumarin 13 ( scheme 1 ) from homophthalic anhydride using a one - pot reaction consisting of vilsmeier/1,3-cyclization . taking advantage of the reactive methylene group in benzylic position ( c4 ) of homophthalic anhydride , a combined strategy of the two above - mentioned literature data was developed for the generation of a first set of analogues . introduction of carbonyl moieties with different carbon chains lengths in the c4-position of homophthalic acid is rendered possible by nucleophilic substitution in alkaline media . the reaction of homophthalic acid with thionyl chloride afforded homophthalic anhydride in excellent yields , in accordance with literature data . c4-deprotonation of homophthalic anhydride in mild conditions using anhydrous pyridine and followed by nucleophilic substitution of acetic , propionic , butyric , and valeric anhydride afforded the corresponding intermediates 9a12a in low to moderate yields despite numbers of efforts to optimize the conditions ( time , base , temperature ) , slightly improved only by the addition of anhydrous thf as solvent in the reaction media . the 4-acyl - isochroman-1,3-diones 9a12a were subjected to pyrazole formation in the presence of hydrazine monohydrate in refluxing dmf . the affinity of the novel analogues for pb1(5 ) was determined by itc , which demonstrated that the synthesized derivatives were indeed stronger binders than the original methyl hit ( figure 6b ) . the kd values of 10 ( ethyl ) , 11 ( propyl ) , and 12 ( butyl ) derivatives were 3.4 , 3.3 , and 5.1 m , respectively thus affording a 3.5-fold affinity improvement ( table 1 ) . moreover , the conservative structural modifications had a minor effect on le , as the corresponding index was 0.48 for 10 and 0.45 for 11 , while 12 afforded a slightly lower le of 0.41 . notably , good agreement was obtained between gbinding determined by itc and the corresponding values predicted by fep - rest calculations for the three novel analogues with errors within 0.6 kcal / mol ( table 1 ) . to address the structural basis of the improved affinity , the crystallographic determination of the complexes of 10 , 11 , and 12 with pb1(5 ) as expected , the overall binding mode of the analogues carrying the extended alkyl chain on position 1 was highly similar to the corresponding mode of the original methyl hit , thus sustaining the basic protein ligand interactions such as the hydrogen bond of the pyrazole to n739 and the overall hydrophobic packing of the ligand aromatic system inside the brd cavity ( figure 7a , b ) . the alkyl chain of the novel analogues was positioned toward the periphery of the za channel where it resided , most notably the butyl moiety , in fully extended conformation stabilized by extensive contacts with p688 and the side chains of i683 , l693 , and i745 . these crystallographic data were in good agreement with the computational hydration analysis , in terms of the anticipated effect on binding affinity of solvent reorganization and increase of buried nonpolar surface area of the ligand . indeed , superposition of the alkyl chain binding geometries with the hydration sites predicted by watermap and szmap showed that the alkyl groups overlapped with water molecules characterized by high free energy and thus predicted as unstable ( figure 5 ) . because of the lack of specific stabilizing interactions between those molecules and the brd , their anticipated release to bulk solvent would offer a fair gain in binding affinity without serious perturbations on the overall enthalpy / entropy compensation landscape , as the ligand groups would substitute the solvent by forming comparable contacts with the protein . furthermore , a binding geometry comparison between 12 , 15 , and 2 additionally showed that the butyl chain of 12 matches the interactions of the aromatic decorations of both 2 and the flavonoid 15 ( figure 7c , d ) . it is thus possible that ring b of flavonoids contributes to binding affinity by displacing unstable waters in a similar manner to that of the butyl chain of 12 . in addition , another common sar element between the new analogues and 15 was the presence of a pair of h - bond acceptors anchoring each ligand to n739 and water w5 , respectively ( figure 7c , d ) . ( a ) temperature shift assays of compounds 912 on subfamily viii brds as well as selected other bromodomains . ( b ) isothermal titration calorimetry data for compounds 912 as well as 2 . shown are raw binding heats after baseline subtraction as well as normalized binding heats ( lower panel ) . the solid lines represent nonlinear least - squares fits to the experimental data , and experimental binding heats are color coded as indicated in the figure . all fitted and calculated thermodynamic data are shown in supporting information , table s6 . ( b ) superimposition of the binding modes of inhibitors 1012 showing a high degree of similarity . the remaining conserved water molecule ( w5 ) is highlighted . the surface of the acetyl - lysine binding pocket is shown as a transparent sphere . ( d ) comparison of binding modes of 12 and the pb1/smarca inhibitor 2 . notably , systematic thermodynamic and structural studies of similar systems have shown that in many cases , increasing the length of an alkyl chain leads to gain in enthalpy that is , hence , fully offset by an unfavorable entropy change , thus affording a negative net effect on binding affinity . in this study , we demonstrated the use of designing constructive interactions with the water environment of a protein / ligand system on the basis of utilizing available solvation mapping algorithms . in a theoretical druggability assessment of brds based on the available x - ray crystallographic data , the degree by which different members of the family constitute tractable drug targets was determined . in this partition , brds of pb1 were clustered along with 57% of total studied brds that were classified as of either intermediate ( pb1 bd2 and 5 ) or difficult ( pb1 bd1 , 3 , 4 , and 6 ) druggability . however , in that study , structural water molecules of the included brds were left intact and thus druggability determination was based on the assumption that those waters are not displaceable . the results presented herein show that such an approach could be challenged by the notion that the net contribution of solvent thermodynamics in binding can not always be straightforwardly generalized across a whole family of proteins solely on the basis of structural similarity of related proteins . to address the issue of selectivity and check whether the applied structural modifications and the observed affinity improvement had any unfavorable impact to the specificity profile of the scaffold , the affinity of 12 was determined toward a panel of 15 brds ( figure 6a and supporting information , table s5 ) extended with a representative group of subfamily viii members . compound 12 showed selectivity toward pb1(5 ) over the closely related brds , with low binding ( tm not exceeding 2 c ) observed only toward pb1(3 ) ( supporting information , table s5 ) . notably , no binding was observed toward either brd4 or , most importantly , the closely related smarca2 , thus highlighting the possibility of designing a high affinity chemical probe targeting exclusively pb1(5 ) . to further confirm these data , itc was used , confirming that 12 did not interact with smarca brds ( supporting information , table s6 ) . to test the ability of 12 to bind to the bromodomain of pb1 and displace binding of pb1 from chromatin , a fluorescence recovery after photobleaching ( frap ) assay chromatin was hyperacetylated using the histone deacetylase inhibitor suberoylanilide hydroxamic acid ( saha ) to increase the assay window . cells were transfected with a plasmid encoding gfp fused to either full length pb1 or to mutant pb1(2 ) and pb1(5 ) , showing reduced ability to bind to chromatin . cells were bleached with a laser and recovery time measured with or without compound treatment . despite the fairly low potency in vitro 12 was able to displace pb1 from chromatin to levels of the control 2 and the mutant protein and showed similar half recovery times of 2 s ( figure 8) . the kd of 2 is 48 nm for pb1(5 ) measured by itc as compared to 5.1 m for 12 . this is therefore in line with the effects observed in frap , where an effect on pb1(5 ) is seen for 2 at 1 m and for 12 at 20 m . frap experiments suggest that , at least in part , the complex can be displaced . yet , as this experiment has been performed using overexpressed proteins , it can not be excluded that the endogenous swi / snf complex remains bound to chromatin in the presence of pb1(5 ) inhibitors . ( a ) frap half recovery times of gfp - pb1 are significantly decreased when treated with compound 12 at 20 m as indicated . cells expressing mutants of the bromodomain pb1(2 ) ( n263a ) or pb1(5 ) ( n754y ) reducing the binding to chromatin were analyzed as comparison as was the compound 2 . significant differences to cells treated with saha of p < 0.05 are shown by * . ( b ) time dependence of fluorescence recovery in the bleached area of cells expressing wt or mutant gfp - pb1 with the corresponding treatment as in ( a ) . analogue 12 was additionally subjected to a viability assay in 1br - htert human fibroblast cells . the drug very slightly reduced viability of the cells above 5 m ( supporting information , figure s2a ) , while 2 also reduced viability to a similar level ( supporting information , figure s2b ) . it was next determined whether 12 reduces the ability of baf180 to bind to chromatin using chromatin fractionation and western blotting . consistent with the frap results , treatment of 1br - htert cells with 12 slightly reduced the levels of chromatin - bound pb1 ( supporting information , figure s2c ) . loss of pb1 sensitizes cells to dna damaging agents including mitomycin c ( mmc ) . while u2os pb1 knockout cells were more sensitive to mmc than control cells , 12 did not result in any significant sensitization to this drug and this was true for experiments using 2 as well ( supporting information , figure s2d ) . this suggests that the remaining level of chromatin - bound pb1 is sufficient to perform the function of pb1 in mmc - induced dna repair . finally , the effect of 12 on cell proliferation was studied using wst-1 and the multiple myeloma ( mm ) lines l363 , h929 , and jjn3 . in agreement with earlier reports , exposure of cells to 12 did not lead to significant inhibition of proliferation on jjn3 cells . precise estimation of the energetics accompanying solvent dynamics and reorganization upon ligand binding is an aspect of structure - based drug design that demands attention , as it concerns one of the less comprehensible events addressed by currently available theoretical approaches in response to the increasing demand for high - quality free energy predictions . especially with brds , the available structural data seem to converge toward identifying an ensemble of four to five buried water molecules that are considered as an almost integral part of the kac binding cavity . however , whether those waters should ( or could ) be effectively displaced upon compound binding , aiming at an affinity gain in a selective fashion over the various brd members is still debatable . discovery of the low micromolar pyrazoloisocoumarin ligand of pb1(5 ) through a consensus virtual screening approach provided a valuable starting point for probing the importance of solvent effects in brd hit optimization . although relatively low ( 1 molecule active toward pb1(5 ) out of 40 top - ranked compounds assayed in vitro ) , the hit rate achieved in this virtual screen was considered satisfactory , given the serendipitous fact that the discovered hit demonstrated a highly original binding mode involving displacement of waters in a manner not seen in most brd ligand binding events including the interaction of the template jq1 with its target brd4 . rational elaboration of the scaffold was pursued by combining experimental results obtained by itc and x - ray crystallography with theoretical data derived by predictive algorithms modeling hydration of the target protein . the effort was not focused on structural waters occupying the brd kac cavity but rather on solvent trapped on the macromolecule surface . by doing so , it successfully indicated a means to affinity gain by chemical modifications targeting secondary contributors as an indirect and alternative route to binding affinity optimization . navely , it would seem that growing an alkyl chain into solvent where it can not sustain considerable hydrophobic interactions with the protein , would not contribute favorably to ligand binding potency in any system . however , in this study , it was shown that by considering the impact of solvent dynamics in binding , one can achieve optimization of a hit through alternative and possibly more efficient routes than those solely based on inspection of protein ligand interactions . to facilitate this , one should go beyond utilization of structure - based techniques like protein x - ray crystallography or docking and also look to solvent mapping or other methods which take into consideration solvent dynamics . the combination of different approaches demonstrating considerable orthogonality with each other but with the potential to be reasonably integrated affords a highly reliable and constructive representation of complex systems such as those of protein / ligand / solvent regularly studied in drug discovery . more specifically , by using innovative computational tools for solvation mapping such as szmap and watermap , independently and in a consensus fashion , one can distinguish between stable ( structural ) and unstable ( trapped ) waters and thus devise modifications targeting each category appropriately . this work shows that by releasing unstable waters into bulk solvent , one may achieve a favorable , although small , improvement in kd , in contrast to the expected view that growing an alkyl chain toward water would result to derivatives of lower affinity . the advances in the field of epigenetics , and more specifically the discovery of compounds interfering with brds in a medically relevant manner , underline the necessity for focused screening efforts targeting proteins of the underexplored brd subfamilies and thus enabling elucidation of their functionalities and involvement in different pathological states . on the other hand , rational approaches for hit identification or lead optimization can substantially facilitate the discovery process . the integral approach presented in this study can enable the most efficient exploitation of available structural , biophysical , and biochemical data toward rational development of hit compounds into promising leads for probe or drug discovery . the characterization of cell - permeable pyrazoloisocoumarin derivatives showing single - digit micromolar affinity toward the fifth brd and high selectivity over other subfamily members such as smarca is anticipated to facilitate development of a chemical probe for exploring the biological role of this protein interaction module in the epigenetic mechanisms mediated by swi / snf complexes . prior to calculations , the nci / dtp repository compounds were enumerated and prepared in terms of correct protonation states , tautomerism , and stereoisomerism using the ligprep routine ( schrdinger inc . ) . the nci / dtp collection was prepared independently for rocs screening using the enumeration and conformer generation tools provided by openeye inc . the ligand - based approach was based on the rocs algorithm ( openeye inc . ) with the tanimoto - combo scoring scheme and the implicit mills with respect to the structure - based approach , rigid docking was performed using the glide v. 5.7 sp sampling algorithm and the corresponding gscore sp5 scoring scheme ( schrdinger inc . ) with the van der waals atom radii scaling set to 0.9 for the protein grid and to 0.8 for the screened ligands . protein preparation was performed by the corresponding routine as implemented in schrdinger 2014 suite . the three screening methodologies were combined by a simple consensus statistical scheme on the basis of frequencies of appearance for each compound at the top of a given percentage threshold in each of the computationally ranked lists using microsoft excel 2010 . for fep - rest calculations , the ligand mutation module as implemented in desmond software ( d.e . shaw research ) was used with default settings and 5 ns simulations were performed for each transformation of the ligand either inside the protein environment or in pure water using an explicit solvent representation . all chemicals were purchased from aldrich chemical co. microwave - assisted reactions were performed in a single mode cem apparatus . nmr spectra were recorded on bruker drx 400 and bruker avance 600 spectrometers ( h 400 and 600 mhz ) ; chemical shifts are expressed in ppm downfield from tms . columns chromatography were conducted using flash silica gel 60 ( 4063 m ) from merck . hplc chromatograms have been recorded on a thermo finnigan chain ( pump p4000 , controller sn4000 , autosampler as3000 , uv detector uv6000lp ) equipped with a supelco discovery hs c18 5 m column ( 25 cm 4.6 mm ) . all the solvents were degassed in an ultrasound bath for 15 min and then filtered ( nylon membrane , 0.45 m ) prior to use . samples were diluted in hplc grade methanol ( 1 mg / ml ) and filtered ( nylon membrane , 0.45 m ) . retention times ( tr ) are given in minutes . homophthalic acid ( 3 g , 0.01665 mol ) was dissolved in anhydrous ch2cl2 . the mixture was then warmed at reflux for 12 h. after completion of the reaction , solvent was evaporated and the crude residue dried under high vacuum to remove remaining traces of thionyl chloride . h nmr ( 400 mhz , cdcl3 , in ppm , j in hz ) : 8.25 ( d , j = 7.56 , 1h , h-1 ) , 7.37 ( d , j = 7.6 , 1h , h-4 ) , 7.54 ( t , j = 7.56 , 1h , h-2 ) , 7.72 ( t , j = 7.56 , 1h , h-3 ) , 4.17 ( s , 2h , h-5 ) . homophthalic anhydride ( 1 equiv ) was dissolved in anhydrous pyridine ( 2 equiv ) . after 15 min , the corresponding anhydride ( 4 equiv ) was added dropwise . et2o was then added and the precipitate filtered and washed with an extra amount of et2o to afford the desired 4-acyl-1,3-isochromandione as a white solid . the product was then used for the next step without further purification . the desired 4-acyl-1,3-isochromandione 9a12a ( 1 equiv ) was dissolved in anhydrous dmf and stirred for 15 min . hydrazine monohydrate was then added dropwise ( 4.2 equiv ) and the mixture warmed to reflux for 12 h. after completion of the reaction , the mixture was cooled and water was added . the precipitate is then filtered , washed with water , and dried , affording the corresponding isochromeno[3,4-c]pyrazol-5(2h)-one 912 . h nmr ( 600 mhz , dmso , in ppm , j in hz ) : 12.39 ( s , 1h , h-2 ) , 8.20 ( d , j = 8.00 , 1h , h-6 ) , 7.85 ( m , 2h , h-8 and h-9 ) , 7.49 ( t , j = 8.00 , 1h , h-7 ) , 2.63 ( s , 3h , 1-ch3 ) . c nmr ( 150 mhz , dmso , in ppm ) : 161.39 ( c-5 ) , 156.97 ( c-3a ) , 135.78 ( c-5a ) , 135.47 ( c-8 ) , 133.58 ( c-9a ) , 130.94 ( c-6 ) , 126.12 ( c-7 ) , 122.01 ( c-9 ) , 118.07 ( c-1 ) , 96.55 ( c-9b ) , 11.68 ( 1-ch3 ) . hrms ( esi+ ) m / z = 201.0659 ( [ m + h ] ) ( calculated mass : 200.19 ) . hplc : method a tr = 3.17 min ; method b tr = 2.83 min . h nmr ( 600 mhz , dmso , in ppm , j in hz ) : 12.95 ( s , 1h , h-2 ) , 8.21 ( d , j = 7.9 , 1h , h-6 ) , 7.87 ( t , j = 7.5 , 1h , h-8 ) , 7.82 ( d , j = 7.5 , 1h , h-9 ) , 7.49 ( t , j = 7.90 , 1h , h-7 ) , 3.04 ( q , j = 7.55 , 2h , h-2 ) , 1.32 ( t , j = 7.55 , 3h , 1-ch3 ) . c nmr ( 150 mhz , dmso , in ppm ) 161.35 ( c-5 ) , 156.94 ( c-3a ) , 141.43 ( c-5a ) , 135.59 ( c-8 ) , 133.42 ( c-9a ) , 131.02 ( c-6 ) , 126.13 ( c-7 ) , 122.10 ( c-9 ) , 118.16 ( c-1 ) , 95.71 ( c-9b ) , 19.24 ( c-1 ) , 12.61 ( c-2 ) . hrms ( esi- ) m / z = 213.0672 ( [ m h ] ) ( calculated mass : 214.22 ) . hplc : method a tr = 3.40 min ; method b tr = 2.91 min . h nmr ( 600 mhz , dmso , in ppm , j in hz ) : 12.93 ( s , 1h , h-2 ) , 8.17 ( d , j = 7.91 hz , 1h , h-6 ) , 7.81 ( m , 2h , h-8 and h-9 ) , 7.45 ( t , j = 7.91 hz , 1h , h-7 ) , 2.96 ( t , j = 7.41 hz , 2h , h-1 ) , 1.7 ( h , j = 7.31 hz , 2h , h-2 ) , 0.95 ( t , j = 7.31 hz , 3h , h-3 ) . c nmr ( 150 mhz , dmso , in ppm ) 161.34 ( c-5 ) , 156.89 ( c-3a ) , 140.04 ( c-5a ) , 135.59 ( c-8 ) , 133.44 ( c-9a ) , 131.03 ( c-6 ) , 126.15 ( c-7 ) , 122.09 ( c-9 ) , 118.20 ( c-1 ) , 96.01 ( c-9b ) , 27.47 ( c-1 ) , 21.30 ( c-2 ) , 13.43 ( c-3 ) . hrms ( esi ) m / z = 227.1287 [ m h ] ( calculated mass : 228.25 ) . hplc : method a tr = 3.72 min ; method b tr = 3.01 min . h nmr ( 600 mhz dmso , in ppm , j in hz ) 12.95 ( s , 1h , h-2 ) , 8.21 ( d , j = 7.99 hz , 1h , h-6 ) , 7.87 ( t , j = 7.5 hz , 1h , h-8 ) , 7.81 ( d , j = 7.5 hz , 1h , h-9 ) , 7.48 ( t , j = 7.99 hz , 1h , h-7 ) , 3.01 ( t , j = 7.50 hz , 2h , h-1 ) , 1.69 ( quintuplet , j = 7.52 hz , 2h , h-2 ) 1.40 ( h , j = 7.52 hz , 2h , h-3 ) , 0.94 ( t , j = 7.39 hz , 3h , h-4 ) . c nmr ( 150 mhz , dmso , in ppm ) 161.33 ( c-5 ) , 156.90 ( c-3a ) , 140.21 ( c-5a ) , 135.59 ( c-8 ) , 133.44 ( c-9a ) , 131.04 ( c-6 ) , 126.13 ( c-7 ) , 122.05 ( c-9 ) , 118.20 ( c-1 ) , 95.94 ( c-9b ) , 30.01 ( c-1 ) , 25.35 ( c-2 ) , 21.65 ( c-3 ) , 13.59 ( c-4 ) . hplc : tr = [ m h ] ( calculated mass : 242.28 ) . hplc : method a tr = 4.29 min ; method b tr = 3.21 min . the activity of the compounds was validated by x - ray crystallography of all protein compound complexes and by various different binding affinity measuring methodologies such as itc and dsf as well as cell - based assays . cdna encoding human the fifth brd of pb1 ( ncbi gene i d : 55193 ) was obtained from the sgc clone collection and was used as template to amplify the kinase domain region of the protein , using the polymerase chain reaction ( pcr ) in the presence of platinum pfx dna polymerase ( invitrogen , uk ) . pcr products were purified ( qiaquick pcr purification kit , qiagen ltd . uk ) and further subcloned into a pmcsg7 derived expression vector ( pnic28-bsa4 ) , using ligation independent cloning . this vector includes sites for ligation - independent cloning and a tobacco etch virus ( tev)-cleavable n - terminal his6-tag ( extension mhhhhhhssgvdlgtenlyfq*sm ) . after digestion with tev protease , the protein retains an additional serine and methionine on the n - terminus . the constructs were transformed into competent mach1 cells ( invitrogen , uk ) to yield the final plasmid dna . colonies from freshly transformed plasmid dna in competent escherichia coli bl21(de3)-r3-prare2 cells ( phage - resistant derivative of bl21(de3 ) cell ( invitrogen ) , with a prare plasmid encoding rare codon trnas ) were grown overnight at 37 c in 30 ml of 2 luria bertani medium ( lb - broth , amresco ) with 50 g / ml kanamycin and 34 g / ml chloramphenicol ( startup culture ) . the startup culture was diluted 1:100 in terrific broth ( tb , merck ) , and cell growth was allowed at 37 c to an optical density of about 1.5 ( od600 ) before the temperature was decreased to 18 c . when the system equilibrated at 18 c , the optical density was about 3.0 ( od600 ) and protein expression was induced overnight at 18 c with 0.1 mm isopropyl--d - thiogalactopyranoside ( iptg ) . the bacterial cells were harvested by centrifugation ( 8700 g for 15 min at 4 c , fiberlite f9 - 6x1000 lex rotor , on a thermo scientific sorvall lynx 6000 centrifuge ) and were frozen at 20 c as pellets for storage . cells expressing his6 tagged protein were resuspended in lysis buffer ( 50 mm hepes , ph 7.5 at 25 c , 500 mm nacl , 20 mm imidazole , 5% glycerol , 1 mm tris(2-carboxyethyl)phosphine ( tcep ) ) and lysed using a sonics vibra cell sonicator on ice . the lysate was cleared by centrifugation ( 23000 rpm for 30 min at 4 c , t29 - 8x50 rotor , on a thermo scientific sorvall lynx 6000 centrifuge ) and was applied to a cobalt - nitrilothiacetic acid agarose column ( imac sepharose 6 fast flow , ge healthcare charged with co , 5 ml , equilibrated with 20 ml of lysis buffer ) . the column was washed with 30 ml of lysis buffer at gravity flow , and the protein was eluted using a step elution of imidazole in lysis buffer ( 50 , 100 , 2 300 mm imidazole in 50 mm hepes , ph 7.5 at 25 c , 500 mm nacl , 1 mm tcep ) . all fractions were collected and monitored by sds - polyacrylamide gel electrophoresis ( bio - rad criterion precast gels , 1020% tris - hcl 1.0 mm , from bio - rad , ca ; gel run conditions , 200 v , 2030 ma , 50 min in sds buffer ) . the eluted protein was further purified with size exclusion chromatography on a superdex 75/200 16/60 hiload gel filtration column ( ge / amersham biosciences ) on an ktaprime plus system ( ge / amersham biosciences ) . samples were monitored by sds - polyacrylamide gel electrophoresis and concentrated to 10 mg / ml in the gel - filtration buffer , 10 mm hepes ph 7.5 , 150 mm nacl , 5% glycerol , 0.5 mm tcep using a 10 kda cutoff concentrator and were used for dsf assay and isothermal titration calorimetry . protein handling was carried out on ice or in a cold room in all the above steps . aliquots of the purified pb1 domain 5 ( uniprot identifier as pb1_human q86u86 - 1 fragment 645766 ) were set up for crystallization using a mosquito crystallization robot ( ttp labtech , royston uk ) . coarse screens were typically setup onto greiner 3-well plates using three different drop ratios of precipitant to protein per condition ( 200 + 100 nl , 150 + 150 nl , and 100 + 200 nl ) . all crystallizations were carried out using the sitting drop vapor diffusion method at 277.15 k. crystals with compound 9 were grown by mixing 150 nl of the protein ( 12.65 mg / ml and 5 mm final ligand concentration ) with an equal volume of reservoir solution containing 18% peg3350 , 0.15 m sodium malonate ph 7.0 , 10% ethylene glycol , and 0.1 m bis - tris - propane ph 8.1 . crystals in complex with the compound 10 ( 5 mm final concentration ) were obtained by mixing 150 nl of the protein ( 6.5 mg / ml ) and 150 nl crystallization buffer ( 0.1 m trisodium citrate dihydrate ph 5.6 , 20% 2-propanol , 20% peg 4k ) ; pb1 bromodomain 5 crystals in complex with the compound 11 ( 5 mm final concentration ) were grown by mixing 200 nl of the protein ( 6.45 mg / ml ) and 100 nl of crystallization buffer ( 0.2 m ammonium sulfate , 0.1 m mes ph 6.5 , 30% pegmme 5k ) ; pb1 bromodomain 5 crystals in complex of the compound 12 ( 5 mm final concentration ) were grown by mixing 200 nl of the protein ( 6.45 mg / ml ) and 100 nl of crystallization buffer ( 0.1 m lithium sulfate monohydrate , 0.1 m tris ph 8.5 , 30% peg4k ) . complex crystals were cryoprotected using the well solution supplemented with additional 20% ethylene glycol and was flash frozen in liquid nitrogen . data for the pb1(5 ) complex with 9 were collected in - house on a rigaku fre rotating anode system equipped with a raxis - iv detector at 1.52 . all other diffraction data were collected at diamond light source 03 and i04 - 1 beamlines at a single wavelength of 0.9763 and 0.9207 , respectively . data for the pb1(5 ) complex with 9 were indexed and integrated using mosflm , and scaling was performed with scala . other data sets were indexed and integrated using xds , and scaling was performed with aimless . initial phases were calculated by molecular replacement with phaser using the apo template structure 3g0j.pdb . unique and initial solutions were improved in a total of 50 cycles of automated protein chain tracing starting from existing model and computed using arp / warp , further manual building with coot , and refinement against maximum likelihood target using refmac5 . thermal motions were analyzed using tlsmd , and hydrogen atoms were included in late refinement cycles . data collection and refinement statistics are compiled in supporting information , table s2 . the models and structure factors have been deposited with pdb accession codes : 5ii1 ( compound 9 ) , 5hrv ( compound 10 ) , 5hrw ( compound 11 ) , 5hrx ( compound 12 ) , 5iid ( compound 14 ) , and 5ii2 ( compound 15 ) . the proteins at 2.5 m ( 20 m in preliminary high - throughput screening mode ) were mixed with ligands at 100 m ( 200 m in preliminary high - throughput screening mode ) , and the assays and data evaluation for melting temperatures were performed using a rt - pcr mx3005p machine ( stratagene ) as previously described . all calorimetric titration experiments were carried out in a vp - itc calorimeter at 15 c . the buffer condition used was 20 mm hepes ph 7.5 , 150 mm nacl , and 0.5 mm tcep . titration was performed by injecting the proteins ( 200 m ) into a reaction cell containing the inhibitors ( 15 m ) . corrected data were fitted to a single binding site model using a nonlinear least - squares minimization algorithm and binding parameters including reaction enthalpy changes ( h ) , reaction entropy changes ( s ) , equilibrium dissociation constants ( kd ) , and stoichiometry were calculated . in all experiments , full length cdna for the isoform 8 of human polybromo-1 protein ( pb1 , q86u86 - 8 ) was amplified by pcr from an image clone ( image : 40082629 ) and cloned into pdonr-221 vector using gateway bp reaction producing gateway entry clones . mutations which impair binding to a second ( n263a ) and fifth ( n754y ) brds were introduced into full length pb1 gateway entry clones using 15 cycles quikchange ii pcr protocol ( agilent technologies ) . mammalian expression constructs encoding n - terminal egfp tag were constructed by gateway lr recombination reaction between vivid colors pcdna6.2/n - emgfp - dest ( invitrogen , catalogue no . v356 - 20 ) and a wild - type or mutated pb1 gateway entry clone . u2os cells were transfected ( fugene hd ; roche ) with mammalian overexpression constructs encoding gfp fused to the n - terminus of full length wild - type or mutant pb1 . the imaging system consisted of a zeiss lsm 710 laser - scanning and control system ( zeiss ) coupled to an inverted zeiss axio observer z1 microscope equipped with a high numerical aperture ( n. a. 1.3 ) 40 oil immersion objective ( zeiss ) . samples were placed in an incubator chamber in order to maintaining temperature and humidity . frap and gfp fluorescence imaging were both carried out with an argon - ion laser ( 488 nm ) and with a pmt detector set to detect fluorescence between 500 and 550 nm . once an initial scan had been taken , a region of interest corresponding to approximately 50% of the entire gfp positive nucleus was empirically selected for bleaching . a time lapse series was then taken to record gfp recovery using 1% of the power used for bleaching . the image data sets and fluorescence recovery data were exported from zen 2009 , the microscope control software , into origin to determine the average half - time for full recovery for 1020 cells per treatment point . data were analyzed using one - way analysis of variance ( anova ) with dunnett s multiple comparisons test . 1br - htert and u2os cells were cultured at 37 c in a 5% co2 incubator in dmem ( gibco ) supplemented with 10% fbs , 1% penicillin / streptomycin , and 1% l - glutamine . first , 5000 1br - htert cells were seeded into 96-well plates in triplicate format . then after 24 h , cells were incubated with dmso or 10 m 12 with or without mitomycin c. viability was analyzed 4 days following drug treatment using celltiter - glo reagent ( promega ) . first , 6 10 1br - htert cells were plated into 10 cm dishes and grown for 24 h. dmso or 10 m 12 was then added for 48 h , and the cells were harvested , washed in pbs , and pelleted . cell pellets were resuspended in low salt lysis buffer ( 50 mm tris ph 8.0 , 2 mm edta , 2 mm egta , 150 mm nacl , 0.2% triton - x100 , 0.3% np40 ) and incubated on ice for 5 min . cell lysates were centrifuged at 3000 rpm for 4 min at 4 c and the supernatant removed as the soluble fraction . the chromatin pellet was washed three times in ice - cold pbs before incubation with benzonase ( sigma ) in nuclease buffer ( 50 mm tris ph 8.0 , 20 mm nacl , 2 mm mgcl2 ) for 30 min on ice . an equal volume of twice the high salt / triton buffer ( 1.86 m nacl , 0.4% triton - x100 ) was added before sonication in a water bath and centrifuged at 14000 rpm for 5 min at 4 c . then 50 g of protein from the soluble or chromatin fractions were run on polyacrylamide gels using sds - page before western blotting using antibodies against baf180 ( bethyl , a301 - 591a ) , -tubulin ( abcam , ab7291 ) , and cenpa ( abcam , ab13939 ) . cell proliferation of mm lines was measured by the colorimetric wst-1 assay ( clontech , mountain view , usa ) according to the manufacturer s instructions . the method measures the metabolic activity of viable cells based on the enzymatic cleavage of the tetrazolium salt wst-1 ( 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2h - tetrazolium ) to formazan dye by cellular mitochondrial dehydrogenases , present in viable cells . as cells proliferate more wst-1 is converted to the formazan dye product , which can be quantified by measuring the absorbance at 450 nm in a multiwell das plate reader . a number of 5 10 cells ( 1 10 cells / ml ) were seeded into each of 96-well microtiter plates ( corning ) . the plates were incubated in a humidified incubator in 5% co2 at 37 c for 24 h , and 23 h prior to analysis , 10 l of wst-1 solution was added to each well .

cellulose is the most abundant biomass on earth . it is the primary product of photosynthesis in terrestrial environments and the most abundant renewable bioresource produced in the biosphere [ 2 , 3 ] . this enzyme is produced by several microorganisms , commonly by bacteria and fungi [ 47 ] . the source of cellulose is in plants and it is found as microfibrils ( 220 nm in diameter and these form the structurally strong framework in the cell walls . despite a worldwide and enormous utilization of natural cellulosic sources , there are still abundant quantities of cellulosic sources and there are still abundant quantities of cellulose containing raw materials and waste products that are not exploited or which could be used more efficiently . the problem in this respect is , however , to develop processes that are economically profitable . complete hydrolysis of the enzyme requires synergistic action of 3 types of enzymes , namely , cellobiohydrolase , endoglucanase or carboxymethylcellulase ( cmcase ) , and beta - glucosidases . bacteria which have high growth rate as compared to fungi have good potential to be used in cellulase production the cellulolytic property of some bacterial genera such as cellulomonas , cellvibrio , pseudomonas sp . enzyme production is closely controlled in microorganisms and for improving its productivity these controls can be ameliorated . cellulase yields appear to depend upon a complex relationship involving a variety of factors like inoculums size , ph value , temperature , presence of inducers , medium additives , aeration , growth time , and so forth . enormous amounts of agricultural , industrial , and municipal cellulosic wastes have been accumulating or used inefficiently due to the high cost of their utilization processes . cellulose , a polymer of glucose residues connected by beta 1,4 linkages , being the primary structural material of plant cell wall , is the most abundant carbohydrate in nature . therefore , it has become of considerable economic interest to develop processes for effective treatment and utilization of cellulosic wastes as inexpensive carbon sources . cellulase is the enzyme that hydrolyses the beta 1,4 glycosidic bonds in the polymer to release glucose units . cellulose containing wastes may be agricultural , urban , or industrial in origin ; sewage sludge might also be considered a source of cellulose since its cellulosic content provides the carbon needed for methane production in the anaerobic digestion of sludge . agricultural wastes include crop residue , animal excreta and crop - processing wastes , slashing generated in logging , saw dust formed in timber production , and wood products in forestry originated activities . the previous negative attitude in which wastes were viewed self - consciously as valueless and even offensive and for disposal only has been replaced in large part by a positive view in which wastes are recognized as raw materials of potential value . this cellulose - degrading enzyme can be used , for example , in the formation of washing powders , extraction of fruit and vegetable juices , and starch processing . although a large number of microorganisms can degrade cellulose , only a few of them produce significant quantities of free enzymes capable of completely hydrolysing crystalline cellulose . cellulases are used in the textile industry for cotton softening and denim finishing ; in laundry detergents for colour care , cleaning ; in the food industry for mashing ; in the pulp and paper industries for drainage improvement and fibre modification , and they are even used for pharmaceutical applications . in nutshell , the cellulose enzymes will be commonly used in many industrial applications and the demands for more stable , highly active and specific enzymes will also grow rapidly . so , cellulose enzyme will be the most stirring technology of future . and continuous research for advances in speckled aspects for cellulose production ( such as cost , substrate specificity , and specific activity ) is desired to achieve improved technoeconomic feasibility . the present work was carried out to optimize the nutritional and environmental parameters for improving cellulose production by bacterial strains . cellulase - producing bacteria were isolated from soils by the dilution pour plate or spread plate method using cmc agar media . the plates were incubated at 45 , 50 , and 55c for 24 hours . to visualize the hydrolysis zone , the plates were flooded with an aqueous solution of 0.1% congo red for 15 min and washed with 1 m nacl . to indicate the cellulose activity of the organisms , diameter of the clear zone around colonies on cmc agar was measured . besides , a more quantitative assay method was used to determine the cellulose activity of the selected bacterial isolate in liquid medium . the cellulase activity of each culture was measured by determining the amount of reducing sugars liberated by using a dns method . a bacterial isolate with the highest activity the bacterial isolates were presumptively identified by means of morphological examination and some biochemical characterizations . the parameters investigated included colonial morphology , gram reactions , endospore formation , catalase production , vp reaction , indole production , starch hydrolysis , citrate utilization , and gelatine hydrolysis . production medium contained ( g / l ) glucose 0.5 gm , peptone 0.75 gm , feso4 0.01 gm , kh2po4 0.5 gm , and mgso4 0.5 gm . ten millilitres of medium were taken in a 100 ml conical flask . the flasks were sterilized in autoclave at 121c for 15 min , and after cooling , the flask was inoculated with overnight grown bacterial culture . the inoculated medium was incubated at 37c in shaker incubator for 24 h. at the end of the fermentation period , the culture medium was centrifuged at 5000 rpm for 15 min to obtain the crude extract , which served as enzyme source . briefly , a reaction mixture composed of 0.2 ml of crude enzyme solution plus 1.8 ml of 0.5% carboxymethyl cellulose ( cmc ) in 50 mm sodium phosphate buffer ( ph 7 ) was incubated at 37c in a shaking water bath for 30 min . the reaction was terminated by adding 3 ml of dns reagent . od of samples was measured at 575 nm against a blank containing all the reagents minus the crude enzyme . flasks with broth containing the optimum concentration of substrate and carbon source are taken and the ph of the broth is adjusted to 7.0 , 8.0 , 9.0 , 10.0 , and 11.0 in different flasks using 1 n hcl and 1 n naoh and sterilized . the cultures are inoculated and incubated at particular temperature . at the end of incubation period , the broth was incubated at different temperatures from 35 , 40 , 45 , 50 , 55 , and 60c for 24 h. at the end of incubation period , the cell - free culture filtrate is obtained and used as enzyme source . the effect of various carbon sources such as starch , glucose , maltose , lactose , and fructose at the concentration of 1 to 5% was examined in the production medium . various nitrogen sources like yeast extract , peptone , urea , and ammonium sulphate were examined for their effect on enzyme production by replacing 0.5% peptone in the production medium . to find out the suitability of agro - based waste as substrate for enzyme production , different substrates , that is , groundnut cake , coconut cake , soy cake , and wheat bran , cellulase - producing bacteria were isolated from soil . based on the morphological and biochemical characteristics , the isolates were identified as pseudomonas fluorescens , bacillus subtilus , e. coli , and serratia marscens . all the four isolates were allowed to grow in media of different ph ranging from 6.0 to 11.0 . maximum enzyme activity was observed in medium of ph 9.011.0 in case of e. coli , pseudomonas fluorescens , bacillus subtilis , and serratia marscens ( figure 1 ) . this result was in correlation with the finding of other workers for different bacillus subtilis strains [ 2022 ] . enzyme activity recorded at different temperatures revealed that all the four bacteria yielded maximum cellulase production at 40c ( figure 2 ) . the temperature was found to influence extracellular enzyme secretion , possibly by changing the physical properties of the cell membrane . ( 2005 ) who found that the cellulase enzyme produced by pseudomonas fluorescence was activated at 30 to 35c showing the optimum temperature at 35c . reported that minimum cellulase yield was observed when fermentation was carried out at 45c , while maximum yield was obtained at 40c by bacillus subtilis and bacillus circulans . immanuel et al . also recorded maximum endoglucanase activity in cellulomonas , bacillus , and micrococcus sp . at 40c and neutral ph various sources of carbon such as starch , fructose , maltose , and sucrose were used to replace glucose which was the original carbon source in growth media . results obtained showed that glucose brought the highest cellulase production compared to other carbon sources at 24 h incubation . hence , glucose was found to be the best source for cellulase production ( figure 3 ) . glycerol is the best substrate for cellulase production with the efficiency of 28.7% on the added substrate weight . studied the utilization of d - xylose as carbon source for the production of cellulase membrane and deduced that xylose is not well metabolized by any bacterial strains that exhibited high cellulose production in glucose medium , whereas sucrose , glucose , and mannitol were found to be suitable for optimum levels of cellulase production . various concentrations of carbon sources were used to replace 1% sugar which was the original concentration in growth media with 2 to 5% . results obtained showed that 5% carbon source brought the highest cellulase production compared to other % carbon sources at 24 h incubation ( figures 4 , 5 , 6 , 7 , and 8) . production of extracellular cellulase has been shown to be sensitive to repression by different carbohydrate and nitrogen sources . the effect of nitrogen sources was studied in the growth medium , where peptone was replaced by ammonium sulphate , urea , and yeast extract . among the various nitrogen sources tested , ammonium sulphate was found to be the best nitrogen source for cellulase production ( figure 9 ) . nitrogen is one of the major cell proteins and stimulation of cellulase activity by ammonium sulphate salt might be due to their direct entry in protein synthesis . the effect of agro based by - products as alternative substrate on bacterial cellulase production under fermentation was studied by several workers . in the present study , coconut cake was found to be the best inducer of cellulase enzyme production by all the four bacterial isolates ( figure 10 ) . the aim of the present work was to isolate and identify a high cellulase producer from soil . pseudomonas fulorescens among e. coli , bacillus subtilis , and serratia marscens produced maximum yield of cellulases . the optimum temperature and ph were determined as 40c and 911 ph and best carbon and nitrogen sources were glucose and ammonium sulphate . this information has enabled the ideal formulation of media composition for maximum cellulase production by this organism . after optimization , the mass production was carried in one litre of optimized media at 40c for 48 hrs at a ph of 10 on a rotary shaker at 110 rpm . bacteria , which have high growth rate as compared to fungi , good potential to be used in cellulose production . however , the application of bacteria in producing cellulase is not widely used . cellulolytic property of some bacterial genera such as cellulomonas , cellovibrio , pseudomonas , sporocytophaga spp . , bacillus , and micrococcus was also reported . enzyme production is closely controlled in microorganisms and for improving its productivity , these controls can be ameliorated . cellulase yields appear to depend on a complex relationship involving a variety of factors like inoculum size , ph value , temperature , presence of inducers , medium additives , aeration , growth time , and so forth . further studies were in progress in the purification and application of cellulase in different commercial fields . the purified cellulase can be used for various purposes in detergent industries , food industries , and pharmaceutical industries . the high activity and stability of cellulase enzymes between neutral to alkaline ph and high temperature will be of use in various industrial and biotechnological applications .

in this issue of critical care , dr haenggi and co - workers from bern university hospital present a study evaluating bispectral index ( bis ) , state entropy ( se ) and response entropy ( re ) during sedation in 44 patients in the intensive care unit ( icu ) . the authors used a meticulous protocol with parallel se , re and bis measurements , web camera monitoring and a computer program for noting sedative administration and interventions to find a clinical indication for the use of entropy or bis during icu ramsay sedation scale - targeted sedation . statistically significant but poor correlation was found between the electroencephalogram ( eeg ) measurements and clinical assessment ; correlation coefficients for re and se were -0.372 and -0.360 , respectively . for bis and clinical assessment these results , together with an overlap of entropy and bis values between clinical sedation levels , led the authors to conclude that " bis - index or entropy do not add information which can be used to guide sedation in the general icu population . " other investigators have attempted to find correlation between eeg measurements of sedation and clinical parameters , similarly finding considerable overlap of displayed values between clinically different sedation levels and also close correlation with facial electromyographic activity [ 2 - 4 ] . the conclusions of these studies are identical to those of dr haenggi and co - workers , namely that bis and entropy are not reliable in describing the level of sedation or guiding sedative administration in icu patients . after more than a decade of use , the role of eeg parameters for sedation monitoring in the icu is yet to be defined . for bis probably the most studied eeg parameter for icu sedation no study has yet shown clear benefit when used for sedation monitoring of icu patients . in contrast , new methods for clinical monitoring and titration of sedatives and analgesics have led to significant improvements in patient outcomes [ 6 - 8 ] . a daily wake - up test during sedation and mechanical ventilation has been shown to reduce time for mechanical ventilation and may also reduce icu and hospital length of stay and reduce complications of critical illness . in a recent study , combining daily awakenings with spontaneous breathing tests additionally improved one - year survival , the effect probably depending on a lesser likelihood of oversedation . modifying sedation regimens may also modify patients memory panorama from the icu and long - term psychological status . it may be tempting to introduce plug - and - play eeg monitors for measuring anesthetic depth such as bis in the icu . the concept of a number on a monitor informing clinicians how to titrate drug doses for adequate sedation is appealing . the problem with applying bis for icu sedation is that it was not originally designed to detect the main indications for sedative administration , namely discomfort and anxiety . the anesthesia end - point that bis primarily was developed to target and is marketed for amnesia may not be a valid end - point for icu sedation . furthermore , given the data from the study and previous studies of bis in icu sedation , aiming for a target bis - interval in icu patients would likely lead to clinical problems of under- or oversedation in individual patients [ 1 - 4 ] . acknowledged endpoints of icu sedation are rather optimal patient comfort and safety . eeg measures may not reflect the efficacy of sedation or analgesia with regard to these endpoints . the previously prevailing idea of sleep being necessary for comfort in icu patients may have emanated from transferring the anesthesia endpoint hypnosis from the operating room into the icu , at a time when mechanical ventilation was less refined than it is today . new ventilators with more patient - friendly modes of ventilation may cause less patient - ventilator dysynchrony during light to moderate sedation , thereby potentially reducing sedative requirements . the development of new analgosedation concepts highlight this quandary of old and new sedation end - points in icu patients . while eeg monitoring in patients receiving neuromuscular blocking treatment may be of some value given the lack of other methods for monitoring sedation depth , there is presently no evidence or rationale for the use of bis or entropy in monitoring or titrating sedation of icu patients . a number on a monitor indicating ' adequate sedation ' can not replace the common sense of sedating a patient with clinical signs of discomfort or agitation , or reducing sedation in a unresponsive patient , unless patient outcome studies prove such an approach to be successful . the reasonable current sedation end - point should not , therefore , be deep sedation , a certain bis or entropy value , but rather patient comfort and safety . before considering new monitors for icu sedation , we need to be confident that they make a difference in these end - points . for now , let 's treat patients and not numbers . bis : bispectral index ; eeg : electroencephalogram ; icu : intensive care unit ; re : response entropy ; se : state entropy .

most thyroid hormones are bound to their carrier proteins such as thyroxine - binding globulin ( tbg ) , thyroxine - binding prealbumin ( tbpa ) , and albumin ( alb ) . triiodothyronine ( t3 ) distribution in plasma is as follows : 80% bound to tbg ; 9% bound to tbpa ; 11% bound to alb , and 0.3% available as free t3 ( ft3 ) . the tetraiodothyronine ( t4 ) distribution in plasma is as follows : 68% bound to tbg ; 11% bound to tbpa ; 20% bound to alb ; and 0.02% available as free t4 ( ft4 ) . the molecular weights of tbg ( 54 kda ) , tbpa ( 54 kda ) , and alb ( 66 kda ) are similar . in nephrosis , these proteins are passed into the urine , thereby can cause hypothyroidism because thyroid hormones are bound to their carrier proteins . this is the first report of thyroid hormones and their carrier proteins in the pleural effusion of a patient with hypothyroidism . we discuss the possible relationship between hypothyroidism and edema from the viewpoint of thyroid hormone carrier proteins and their transudation from the blood vessels into the third space . this report might provide a better understanding of proper treatment for patients with hypothyroidism and edema . in october 2010 , a 72-year - old woman was brought to the emergency department with symptoms of dyspnea , general fatigue , and systemic edema . one year before , she already exhibited diabetic nephrosis [ blood urea nitrogen ( bun ) , 22 mg / dl ; creatinine ( cre ) , 1.7 mg / dl ; urinary protein 3 + but not quantified ] and her thyroid hormones were near normal without medications ; thyroid stimulating hormone ( tsh ) , 6.48 /ml ( reference range , 0.354.94 /ml ) ; ft3 , 2.08 pg / ml ( reference range , 1.713.71 pg / ml ) ; and ft4 , 1.19 ng / dl ( reference range , 0.701.48 ng / dl ) . after several examinations , her condition was diagnosed as diabetic nephrosis [ urinary protein , 9.5 g / day ; blood urea nitrogen ( bun ) , 45 mg / dl ; creatinine ( cre ) , 3.2 mg / dl ] with pleural effusion and systemic edema . in addition , she exhibited hypothyroidism ; tsh , 111.47 /ml ; ft3 , 1.58 pg / ml ; and ft4 , 0.61 ng / dl ( table 1 ) . however , no thyroid antibody was detected and thyroid echography was within normal limits . table 1the clinical course of the patient.admission day 0severe day 18improve day 28discharge day 46weight ( kg)56.053.644.243.8furosemide ( mg / day)8080160120tsh ( 0.354.94 /ml)111.47211.1834.414.36ft3 ( 1.713.71 pg / ml)1.581.642.791.76ft4 ( 0.701.48 ng / dl)0.61<0.400.921.02levothyroxine ( g / day)012.5500bun ( 720 mg / dl)45354357cre ( 0.40.9 mg / dl)3.23.03.23.7urinary protein ( 0.00.12 g / day)9.59.610.79.2tsh , thyroid stimulating hormone ; ft3 , free triiodothyronine ; ft4 , free tetraiodothyronine ; bun , blood urea nitrogen ; cre , creatinine . tsh , thyroid stimulating hormone ; ft3 , free triiodothyronine ; ft4 , free tetraiodothyronine ; bun , blood urea nitrogen ; cre , creatinine . diuretics ( furosemide 80 mg / day ) and low - dose levothyroxine ( 12.5 g / day ) were initiated . however , the hypothyroidism worsened ; tsh , 211.18 /ml ; ft3 , 1.64 pg / ml ; and ft4 , < 0.40 g / dl ( table 1 ) . the pleural effusion was transudates with light s criteria : pleural albumin / plasma albumin = 1.0 g / dl / 2.0 g / dl = 0.5 and pleural lactate dehydrogenase ( ldh ) / plasma ldh = 61 iu / 308 iu = 0.2 . the concentrations of thyroid hormones and their carrier proteins in the pleural effusion were 3050% of those in the plasma ( table 2 ) . table 2thyroid hormones and their carrier proteins in the pleural effusion.plasmapleural effusionreferencetbg23.912.012.028.0 g / mltbpa16.26.522.040.0 mg / dlalb2.01.03.65.1 g / dlft31.640.61.713.71 pg / mltt357.0 < 20.070.0176.0 ng / dlft4 < 0.40 < 0.400.701.48 ng / dltt43.21.24.810.5 g / dltbg , thyroxine - binding globulin ; tbpa , thyroxine - binding prealbumin ; alb , albumin ; ft3 , free triiodothyronine ; tt3 , total triiodothyronine ; ft4 , free tetraiodothyronine ; tt4 , total tetraiodothyronine . tbg , thyroxine - binding globulin ; tbpa , thyroxine - binding prealbumin ; alb , albumin ; ft3 , free triiodothyronine ; tt3 , total triiodothyronine ; ft4 , free tetraiodothyronine ; tt4 , total tetraiodothyronine . we increased the dose of diuretics ( furosemide 160 mg / day ) and levothyroxine ( 50.0 g / day ) . notably , the amount of urinary protein remained unchanged during hospitalization ( table 1 ) . in this patient , the pleural effusion included thyroid hormones and their carrier proteins , which were considered to have been transuded from the blood vessels . we hypothesize that the large amount of transudation from the blood vessels to the third space , thereby reducing thyroid hormones in the plasma , was associated with the patient s hypothyroidism , and that the hypothyroidism might have aggravated her edema . in addition , we have speculated on the explanations for the phenomena that we observed in this patient . ( question ) why did she recover to euthyroidism and no longer required levothyroxine at discharge ? ( answer ) once the third space disappeared , the thyroid hormones with their carrier proteins no longer transuded from the blood vessels . since the patient s body weight at discharge ( dry weight ) was 43.8 kg , the estimated volume of blood in her body was 43.8/13=3.37 l. her hematocrit at discharge was 25.9% ; therefore , the estimated plasma volume was 3.37 ( 10.259 ) = 2.5 l. since her body weight at admission was 56.0 kg and was 43.8 kg at discharge , 56.043.8 = 12.2 l of systemic edema including pleural effusion was accumulated . the amount of systemic edema ( 12.2 l ) is approximately 5 times as much as the plasma volume ( 2.5 l ) . if the 12.2 l of systemic edema contains 40% of thyroid hormone carrier proteins and thyroid hormones compared with those in the plasma , the systemic edema corresponds to 12.20.40=4.9 l of the plasma , approximately 2 times as much as the actual plasma volume ( 2.5 l ) . thyroid hormones and carrier protein levels in pleural fluid of patients with hyperthy - roidism were recently reported , this is the first report on those in hypothyroidism . medical practitioners ought to pay attention to thyroid hormones in patients with edema , particularly those with nephrosis , because the loss of protein to urine can cause hypothyroidism , and both nephrosis and hypothyroidism can cause edema . this case report might contribute to the better understanding and treatment for patients with hypothyroidism and edema .

sertoli leydig cell tumors are rare sex - cord stromal tumors of the ovary that can present with a variety of histological elements , which may complicate diagnosis and treatment . a 40-year - old female presenting with pelvic pain is found to have a large complex right adnexal mass and elevated alpha - fetoprotein . the mass was diagnosed as a sertoli leydig cell tumor with heterologous elements including carcinoid and hepatoid components . she was treated with surgical resection followed by adjuvant chemotherapy and remains clear of disease . prognostic indicators for sertoli leydig cell tumors include degree and type of heterologous element differentiation . sertoli leydig cell tumors ( slcts ) are rare tumors , accounting for less than 0.5% of all ovarian cancers ( disaia and creasman , 1997 ) . the varying histopathology and differentiation of this tumor present difficulties with proper diagnosis and development of optimal treatment regimens . the prevalence of sertoli leydig tumors with hepatoid differentiation is exceedingly uncommon with few published case reports , resulting in an additional diagnostic dilemma . we report the case of a sertoli leydig cell tumor found in a 40-year - old female with intermediate differentiation and heterologous elements including endometrioid and hepatoid differentiation with alpha - fetoprotein expression . the patient is a 40-year - old female with a past medical history of morbid obesity ( body mass index 54.3 kg / m ) , abnormal uterine bleeding status post - endometrial ablation , and extensive abdominal surgeries , including three cesarean sections and repair of a large ventral hernia with mesh , who presented to the emergency department with a chief complaint of progressive left lower quadrant abdominal pain over a period of five years . on abdominal computed tomography ( ct ) and ultrasound imaging , she was found to have a 13 cm complex right adnexal mass . she was taken to the operating room where initial exploration noted no evidence of disseminated disease but , due to extensive adhesions from her prior surgeries , prolonged adhesiolysis was performed , including resection of a portion of small bowel densely adherent to the previously placed abdominal wall mesh . once visualized , the right adnexal mass was excised , with frozen section noting ovarian neoplasm , favor malignant , with suspicion for mucinous components . the left ovary was also grossly abnormal in appearance , so it too was removed . final pathology , however , noted a moderately differentiated sertoli leydig cell tumor with heterologous elements , including liver tissue demonstrating alpha - fetoprotein expression , confined to the right ovary [ fig she received 2 cycles of carboplatin and paclitaxel , which was poorly tolerated and met with significant side effects . she was admitted following cycle 1 for intractable nausea and was noted to have chronic helicobacter pylori infection on esophagogastroduodenoscopy . following cycle 2 , she was treated for possible shingles and continued to have significant abdominal pain and nausea . subsequent to multiple emergency room visits , she had a ct scan showing no evidence of recurrent or residual disease as well as no additional acute findings . in light of her poor tolerance to the medications and favorable findings at time of surgery , the decision was made in conjunction with the patient to discontinue chemotherapy . to date , she has remained without evidence of disease for 20 months . ovarian sex cord - stromal tumors are a heterogeneous group of ovarian tumors that comprise only 1.2% of all primary ovarian cancers ( disaia and creasman , 1997 ) . sertoli leydig cell tumors ( slcts ) , also called androblastomas , are a subset of ovarian sex cord - stromal tumors that constitute less than 0.5% of all ovarian tumors ( disaia and creasman , 1997 ) . slcts are characterized as well differentiated , intermediately differentiated , and poorly differentiated , with the degree of differentiation corresponding to patient prognosis ( chen et al . , 2014 , young and scully , 1985 ) . these tumors most often occur in young women 20 to 30 years old , are unilateral , confined to the ovary , and large ( young and scully , 1985 ) . though frequently characterized by the presence of androgen production , only 30% of patients display virilization or defeminization on presentation ( young and scully , 1985 ) . specifically , classic endocrine manifestations are rarely seen in slcts of retiform type or those with heterologous elements ( chen et al . , 2014 ) . instead , these tumors are highly variable in their proportions of sertoli cells , leydig cells , and/or fibroblastic cells , and patients most often present with abdominal pain or distention ( chen et al . , 2014 ) . pure sertoli cell tumors are usually estrogenic and on occasion secrete renin resulting in hypertension and hypokalemia . in contrast , pure leydig cell tumors are androgen secreting , though reports of these are rare ( oliva et al . , 2005 ) . approximately 20% of sertoli leydig cell tumors contain heterologous elements such as gastrointestinal epithelium , carcinoid , cartilage and skeletal muscle ( oliva et al . , 2005 ) . leydig cell tumor immunohistochemical expression includes negative staining for epithelial membrane antigen and positive staining for inhibin and caltretinin ( weng et al . , 2013 ) . although rare , alpha - fetoprotein ( afp ) has been reported in approximately 30 cases of slcts ( sekkate et al . , 2013 ) . afp is a plasma protein produced by the yolk sac and fetal hepatocytes during development . it is closely coupled to cellular division and the degree of cell differentiation ( sung et al . , 2013 ) . as such , elevated levels of serum afp are often associated with hepatocellular carcinoma , neuroblastoma , endodermal sinus ( yolk sac ) tumors , and carcinomas involving endodermally derived organs including the lung , esophagus , stomach and pancreas ( sung et al . , 2013 ) . it has additionally been noted in teratomas , though the association is likely due to a component of endodermal sinus tumor present in the teratoma . likewise , it has been associated with wilms ' tumor , which is also notable for the presence of hepatoid cells ( young and scully , 1985 ) . the differential diagnosis of sertoli leydig cell tumors with hepatoid components and alpha - fetoprotein expression includes granulosa cell tumors , female adnexal tumor of probable wolffian origin ( fatwo ) , endometrioid carcinoma , hepatoid carcinoma of the ovary , serous carcinoma , and endodermal sinus tumor [ table 1 ] . improper diagnosis due to the homogeneity of these tumors has led to the utilization of immunohistochemical stains to distinguish tumors with similar cell types ( weng et al . , 2013 ) . slcts can sometimes be differentiated from granulosa cell tumors through the absence of call - exner bodies on microscopic analysis . in addition , granulosa cell tumors often do not present with heterologous elements ( sekkate et al . , fatwos can be distinguished from slcts by the absence of heterologous elements and endocrine disturbance in addition to the microscopic presence of a mixture of closely packed tubules and sieve - like growth of various sized cysts with diffuse spindle or polygonal cells ( chen et al . , 2014 ) . endometrioid tumors have immunohistochemical staining positive for ema and ck7 while their neoplastic glands are negative for inhibin and caltretinin ( chen et al . , 2014 ) , which is in contrast to slcts . hepatoid carcinoma of the ovary ( hco ) can similarly present as a large pelvic mass with elevated serum afp and hepatoid cells ; however , on microscopic evaluation , hco forms a characteristically solid sheet of uniform cells with abundant eosinophilic cytoplasm , distinct borders , and centrally located nuclei with prominent nucleoli ( sung et al . , slct differs from serous carcinoma in that no serous tumors have been found positive for afp production , as in this case . afp producing endodermal sinus tumors ( est ) present similarly as pelvic masses in young women . they display elevated serum afp levels and contain hepatoid cells , however , ests display characteristic papillary cells termed schiller duval bodies , which were absent in this specimen ( young and scully , 1985 ) . the heterogeneous nature of slcts makes determining prognostic outcomes difficult . metastatic disease is rare in well - differentiated subtypes of slcts as compared to the intermediate and poorly differentiated subtypes ( young and scully , 1985 ) . the presence of heterologous elements and retiform pattern is more common with intermediate and poorly differentiated subtypes , conferring an additionally poor prognosis . tumor stage based on extraovarian spread and rupture or spillage of the tumor presents a greater risk of metastasis , in addition to larger tumor size . corresponding to the degree of differentiation , prognosis correlates most meaningfully with tumor stage at time of presentation ( chen et al . though the malignant potential of slcts is approximated at 1030% , the risk of recurrence for slcts , specifically those with hepatoid differentiation and heterologous elements is approximately 40 to 50% in published case reports . as such management for slcts can include fertility - sparing surgery for stage ia / ic patients who desire future childbearing . combination chemotherapy regimens for slcts have been generalized from recommendations for other sex cord - stromal tumors ( scsts ) , most often adult granulosa cell tumors . however , the optimal treatment algorithm is unknown given the rarity of scsts and has evolved from vincristine , doxorubicin and cyclophosphamide ( vac ) to bleomycin , etoposide and cisplatin ( bep ) ( brown et al . though the platinum - based chemotherapy is widely used for sex cord - stromal tumors given the overall response rate , the side effect profile for bleomycin limits its utility and the relapse rate can also exceed 40 to 50% ( chen et al . , 2014 ) . as such , a study by brown et al . in 2005 suggested an alternative regimen utilizing taxanes with or without a platinum agent , for the treatment of scsts . the study showed sensitivity of scsts , specifically granulosa cell tumors , to taxane chemotherapy with similarly efficacy to bep and the potential for a more durable response with less toxicity ( brown et al . , 2005 ) . our patient was treated with carboplatin and paclitaxel given concerns about pulmonary toxicity and because the patient 's personal obligations precluded inpatient hospitalization for treatment . at this point , she has remained without evidence of disease recurrence . thorough evaluation of her histopathology was crucial given the uncommon nature of disease , and underscores the need for accurate diagnosis of rare tumors as the appropriate adjuvant treatment in these cases , which is ultimately tied to patient outcome ; may vary .

insulin resistance and hyperinsulinemia are associated with hypertension , impaired glucose tolerance , obesity and dyslipidemia ( 1 - 4 ) . hyperinsulinemia is characterized by low high density lipoprotein ( hdl)-cholesterol and high low density lipoprotein ( ldl)-cholesterol , which causes coronary arteriosclerosis . this reflects the rate of mortality due to cardiovascular diseases . to date , euglycemic hyperinsulinemic clamp test has been accepted as a standard test that measures insulin resistance accurately ( 5 ) . however , since euglycemic hyperinsulinemic clamp test is very complex as well as requires skillful technicians and many instrument , it has not been widely used in a clinical setting . alternately , homeostasis model assessment ( homa ) index was designed to assess insulin resistance in many patients , in which the concentrations of fasting insulin and glucose are simply measured , and recently has been widelyused ( 6 , 7 ) . considering that insulin resistance is the risk factor for coronaryheart disease , it may be closely related to the prognosis of patients who underwent percutaneous coronary intervention ( pci ) . to date , however , few studies have been conducted to examine whether insulin resistance is correlated with the prognosis of patients who underwent pci . some studies have reported that severe coronary angiographic findings and stent restenosis were closely associated with insulin resistance ( 8 , 9 ) . based on the assumption that insulin resistance is closely associated with the complications after pci or the prognosis after pci , we conducted a 30-day follow - up clinical study to observe major adverse cardiac events ( mace ) in patients who underwent pci . in this study , we examined 98 consecutive patients with chest pain who underwent diagnostic coronary angiography between may and september 2004 . we excluded patients who were treated for diabetes mellitus ; those who were newly diagnosed as diabetes mellitus ; those who had thyroid or adrenal insufficiency ; those who underwent pci for coronary heart disease within a recent 6-month period ; and those who underwent primary pci for acute myocardial infarction . the clinical diagnosis on admission was stable angina pectoris in 29.6% ( 29 patients ) and unstable angina pectoris in 70.4% ( 69 patients ) . on admission , patients were interviewed to collect such data as the risk factors for coronary heart disease , the personal history of smoking , diabetes mellitus and hypertension , the family history and the past history of myocardial infarction or stroke . all patients gave informed consent according to a protocol approved by the chonman national university hospital ethics committee . in our patients , samples were collected from venous blood after overnight fasting , and blood chemistry was performed . fasting plasma glucose and insulin were measured . then , the following parameters were measured : 1 ) the concentrations of serum lipid including total cholesterol , triglyceride , hdl - cholesterol , ldl - cholesterol , apolipoprotein ai ( apo ai ) , apolipoprotein b ( apo b ) and lipoprotein ( a ) [ lp ( a ) ] ; 2 ) leukocyte count , monocyte count , erythrocyte sedimentation rate ( esr ) and high - sensitivity c - reactive protein ( hscrp ) ; and 3 ) the concentrations of fibrinogen , fibrinogen degradation product ( fdp ) and homocysteine . insulin resistance was calculated by the homeostasis model assessment of insulin resistance ( homa - ir ) , proposed by mattews et al . , whose formula was : homa - ir ( mg / dlu / ml)=fasting glucose ( mg / dl)fasting insulin ( u / ml)/405 ( 6 ) . to determine cut - off points of the homa - ir as predictors of in - hospital and 30-day adverse cardiac events , receiver operating characteristics ( roc ) analyses were performed . the area under curve ( auc ) of homa - ir was 0.738 ( p=0.006 ) . cut - off points of homa - ir for in - hospital and 30-day cardiac events , determined by roc analysis , were 2.56 , 2.60 , respectively . therefore , we used 2.6 as a cut - off point for the analysis in clinical usefulness . the cut - off point for in - hospital and 30-day adverse cardiac events yielded sensitivities of 66.8% and 77.9% and specificities of 68.2% and 70.2% , respectively.based on the cut - off value of 2.6 , therefore , we divided patients into group i ( the value of homa - ir < 2.6 ) and group ii ( the value of homa - ir 2.6 ) . we accessed left or right femoral artery by the seldinger method or accessed radial artery , and performed coronary angiography using the judkins method . coronary angiographic findings were interpreted by two examiners who were blinded to patients ' profile of insulin resistance . significant stenosis was defined as a luminal narrowing of 50% or greater ( 10 ) . stenting was performed in cases whom percutaneous balloon dilatation produced suboptimal results that the residual stenosis was more than 30% , and the dissection was developed ( 11 , 12 ) . on diagnostic coronary angiography , the patency of the treated artery was evaluated by the thrombolysis in myocardial infarction ( timi ) score . successful reperfusion following pci was defined as timi iii flow with < 25% residual stenosis ( 13 ) . in all patients , aspirin ( 300 mg / day ) and clopidogrel ( 150 mg / day ) were loaded or aspirin ( 100 mg daily ) and clopidogrel ( 75 mg daily ) started > 3 days before procedure . an intravenous bolus of 5,000 u of unfractionated heparin was given , and then additional heparin boluses were given to maintain activated clotting time > 300 sec during procedure . aspirin ( 100 mg / day ) and clopidogrel ( 75 mg / daily for 30 days ) were prescribed to all patients after procedure . in - hospital adverse outcomes were defined as the overall procedure was not successfully done since coronary wire or balloon catheter could not pass through the lesion ; myocardial infarction was developed following pci ; patients underwent repeated pci or emergent coronary artery bypass graft ( cabg ) surgery for target vessel revascularization ( tvr ) . myocardial infarction was defined as a ck - mb elevation greater than three times the upper normal limit or a new change of ekg findings . between group i and ii , we compared mace such as death , myocardial infarction and target vessel revascularization during a 30-day period . intergroup analysis was done using independent t - test and test , and intragroup analysis was done using paired t - test . spearman correlation was used to examine the relationship between homa - ir and other laboratory findings . in this study , we examined 98 consecutive patients with chest pain who underwent diagnostic coronary angiography between may and september 2004 . we excluded patients who were treated for diabetes mellitus ; those who were newly diagnosed as diabetes mellitus ; those who had thyroid or adrenal insufficiency ; those who underwent pci for coronary heart disease within a recent 6-month period ; and those who underwent primary pci for acute myocardial infarction . the clinical diagnosis on admission was stable angina pectoris in 29.6% ( 29 patients ) and unstable angina pectoris in 70.4% ( 69 patients ) . on admission , patients were interviewed to collect such data as the risk factors for coronary heart disease , the personal history of smoking , diabetes mellitus and hypertension , the family history and the past history of myocardial infarction or stroke . all patients gave informed consent according to a protocol approved by the chonman national university hospital ethics committee . in our patients , samples were collected from venous blood after overnight fasting , and blood chemistry was performed . fasting then , the following parameters were measured : 1 ) the concentrations of serum lipid including total cholesterol , triglyceride , hdl - cholesterol , ldl - cholesterol , apolipoprotein ai ( apo ai ) , apolipoprotein b ( apo b ) and lipoprotein ( a ) [ lp ( a ) ] ; 2 ) leukocyte count , monocyte count , erythrocyte sedimentation rate ( esr ) and high - sensitivity c - reactive protein ( hscrp ) ; and 3 ) the concentrations of fibrinogen , fibrinogen degradation product ( fdp ) and homocysteine . insulin resistance was calculated by the homeostasis model assessment of insulin resistance ( homa - ir ) , proposed by mattews et al . , whose formula was : homa - ir ( mg / dlu / ml)=fasting glucose ( mg / dl)fasting insulin ( u / ml)/405 ( 6 ) . to determine cut - off points of the homa - ir as predictors of in - hospital and 30-day adverse cardiac events , receiver operating characteristics ( roc ) analyses were performed . the area under curve ( auc ) of homa - ir was 0.738 ( p=0.006 ) . cut - off points of homa - ir for in - hospital and 30-day cardiac events , determined by roc analysis , were 2.56 , 2.60 , respectively . therefore , we used 2.6 as a cut - off point for the analysis in clinical usefulness . the cut - off point for in - hospital and 30-day adverse cardiac events yielded sensitivities of 66.8% and 77.9% and specificities of 68.2% and 70.2% , respectively.based on the cut - off value of 2.6 , therefore , we divided patients into group i ( the value of homa - ir < 2.6 ) and group ii ( the value of homa - ir 2.6 ) . we accessed left or right femoral artery by the seldinger method or accessed radial artery , and performed coronary angiography using the judkins method . coronary angiographic findings were interpreted by two examiners who were blinded to patients ' profile of insulin resistance . significant stenosis was defined as a luminal narrowing of 50% or greater ( 10 ) . stenting was performed in cases whom percutaneous balloon dilatation produced suboptimal results that the residual stenosis was more than 30% , and the dissection was developed ( 11 , 12 ) . on diagnostic coronary angiography , the patency of the treated artery was evaluated by the thrombolysis in myocardial infarction ( timi ) score . successful reperfusion following pci was defined as timi iii flow with < 25% residual stenosis ( 13 ) . in all patients , aspirin ( 300 mg / day ) and clopidogrel ( 150 mg / day ) were loaded or aspirin ( 100 mg daily ) and clopidogrel ( 75 mg daily ) started > 3 days before procedure . an intravenous bolus of 5,000 u of unfractionated heparin was given , and then additional heparin boluses were given to maintain activated clotting time > 300 sec during procedure . aspirin ( 100 mg / day ) and clopidogrel ( 75 mg / daily for 30 days ) were prescribed to all patients after procedure . in - hospital adverse outcomes were defined as the overall procedure was not successfully done since coronary wire or balloon catheter could not pass through the lesion ; myocardial infarction was developed following pci ; patients underwent repeated pci or emergent coronary artery bypass graft ( cabg ) surgery for target vessel revascularization ( tvr ) . myocardial infarction was defined as a ck - mb elevation greater than three times the upper normal limit or a new change of ekg findings . between group i and ii , we compared mace such as death , myocardial infarction and target vessel revascularization during a 30-day period . intergroup analysis was done using independent t - test and test , and intragroup analysis was done using paired t - test . spearman correlation was used to examine the relationship between homa - ir and other laboratory findings . in studied patients , the mean age was 59.811.5 yr and a male - to - female ratio was 1.8:1 . the mean value of homa - ir was 2.31.69 , and 71 patients were into group i ( the value of homa - ir<2.6 ) and 27 patients into group ii ( the value of homa - ir2.6 ) . between group i and ii , there were no significant differences in cardiovascular risk factors including hypertension , diabetes mellitus and smoking ( table 1 ) . the concentrations of fasting plasma glucose were 101.213.89 mg / dl in group i and 108.49.79 mg / dl in group ii , and those of fasting insulin were 11.94.99 u / ml in group i and 31.814.23 u / ml in group ii ( table 2 ) . the concentration of triglyceride was significantly higher in group ii than in group i ( 151.4192.43 mg / dl vs. 94.562.86 mg / dl , p=0.028 ) . homa - ir was correlated with body mass index ( r=0.489 , p<0.001 ) , levels of total cholesterol ( r=0.204 , p=0.045 ) , triglyceride ( r=0.334 , p=0.001 ) , and apolipoprotein b ( r=0.212 , p=0.038 ) . coronary angiography revealed the presence of significant stenosis in 64 patients ( group i ; 43 patients , group ii ; 21 patients ) . there was no significant differences in the prevalence of multi - vessel disease between the two groups ( p=0.164 ) . the lesion locations were left anterior descending artery ( lad ) in 72.1% , left circumflex artery ( lcx ) in 16.3% and right coronary artery ( rca ) in 11.6% of group i ; and lad in 47.6% , lcx in 19.0% and rca in 33.3% of group ii ( p=0.085 ) . according to the american college of cardiology and american heart association ( acc / aha ) classification , type b1 was demonstrated in 44.2% , type b2 in 34.9% and type c in 20.9% of group i ; and type b1 in 28.6% , type b2 in 33.3% and type c in 33.3% of group ii ( p=0.283 ) . preprocedural timi flow grades were grade 0 in 16.3% , grade i in 7.0% , grade ii in 9.3% and grade iii in 67.4% of group i ; and grade 0 in 19.0% , grade i in 9.5% , grade ii in 19.0% and grade iii in 52.5% of group ii ( p=0.623 ) . in 59 patients , the procedural failure due to crossing failure of guide wire or balloon catheter occurred in no patient ( 0.0% ) of group i and 2 patients ( 11.1% ) of group ii . procedure - related complications included one case of myocardial infarction ( 2.4% ) in group i ; and two cases of myocardial infarction ( 11.1% ) , one case of emergent cabg ( 5.6% ) in group ii . the procedure - related complications were more prevalent in group ii than group i ( p=0.008 ) . the mace at 30-day follow - up was 1 case ( 2.4% ) of tvr in group i and 4 cases ( 22.2% ) of tvr in group ii , and the incidence of mace was significantly higher in group i than group ii ( p=0.008 ) . multivariate analysis revealed that the value of homa - ir 2.6 was the independent prognostic indicators for mace ( p=0.048 ) ( table 4 ) . our clinical study indicated that high homa - ir value is related with the high incidence of complications and shortterm major adverse cardiac events ( mace ) following pci even in non - diabetic patients . insulin resistance plays a crucial role in the development of metabolic disorder accompanied by obesity , dyslipidemia , diabetes mellitus , impaired glucose tolerance and hypertension ; and is also closely related to the incidence of cardiovascular disease ( 14 - 22 ) . several large - scale studies have revealed that hyperinsulinemia is closely associated with the mortality due to cardiovascular disease ( 14 , 21 , 23 ) . to date , however , few large - scale studies have been conducted to examinethe relationship between insulin resistance and coronary heart disease ( 24 , 25 ) . recently , iras ( insulin resistance atheroscleorsis study ) group has conducted large - scale epidemiologic studies , and has reported that insulin resistance rather than insulin concentration is an independent , powerful risk factor for coronary heart disease ( 26 ) . the mechanism by which insulin resistance provokes cardiovascular disease is mainly associated with the development of metabolic syndrome . it is well established that non - diabetic patients with insulin resistance exhibits high concentration of serum triglyceride , hypertension and low concentration of hdl - cholesterol ( 1 , 4 , 23 , 24 ) . in recent years , among several types of apolipoprotein that determines the conformational stability and the metabolic direction of lipoprotein , apolipop - rotein b has been elevated particularly in patients with insulin resistance ( 27 , 28 ) . in addition , insulin resistance has been reported to reduce flow - mediated vasodilation ( fmd ) of brachial artery , and to thereby trigger the endothelial dysfunction ( 20 ) . the present study has shown that the value of homa - ir was correlated with levels of triglyceride and inversely correlated with that of hdl - cholesterol , which is similar to the results of previous studies ( 1 , 23 , 24 ) . to date , only few studies based on coronary angiography have examined the relationship between insulin resistance and coronary atherosclerosis ( 8 , 24 , 25 ) . according to takezako et al . , the profile of insulin resistance based on homa - ir model was correlated with severity of coronary atherosclerosis based on gensini 's score ( 8) . other studies have reported that the incidence of mace following pci was higher in non - diabetic patients with high concentration of hba1c than those with low concentration of hba1c , although these studies did not evaluate using insulin resistance ( 29 ) . here , the concentration of hba1c was lower in non - diabetic patients than in diabetic patients although it was ' high ' . on the other hand , some studies have reported that hyperinsulinemia and insulin resistance measured by homa are closely associated with restenosis following stenting in non - diabetic patients ( 9 , 30 ) . in our series , we have predicted that since insulin resistance is the risk factor for coronary atherosclerosis and is associated with the mortality due to cardiovascular disease , it will affect the prognosis following pci . as predicted , the results were that the higher value of homa - ir was associated with the higher incidence of mace , since more tvr was performed in cases with higher value of homa - ir . although our results were based on non - diabetic patients , these findings suggested that patients with high insulin resistance exhibited high incidences of complex and heavy calcified lesions , commonly noted in coronary artery of patients with diabetes mellitus . henceforth , comparative studies will be conducted regarding this matter between diabetic and non - diabetic patients . the limitation of present study has disclosed that it examined the small number of patients within a short period of time . to date , however , few studies have been conducted to examine whether insulin resistance is correlated with the prognosis following pci . for this reason , the present study has its own value that it is a preliminary study for further large - scale studies . moreover , the present study failed to testify the reproducibility since it did not measure the value of homa - ir in a repetitive manner during the period of admission . the concentrations of serum glucose and insulin can be altered at each different measuring time , although the present study measured them only once in the morning that diagnostic coronary angiogram was performed . however , homa - ir index is well reflected in euglycemic hyperinsulinemic clamp test , a standard test , and the clinical usefulness has been well established . in conclusion , insulin resistance is associated with poor prognosis in non - diabetic patients after pci . however , long - term large clinical follow - up studies should be conducted in diabetic and non - diabetic patients .

insomnia is defined as the subjective perception of difficulty with sleep initiation , duration , consolidation , or quality , which occurs despite adequate opportunity for sleep , and results in some form of daytime impairment . chronic insomnia is diagnosed according to the diagnostic and statistical manual of mental disorders , fifth edition , and the international classification of sleep disorders , which have similar criteria for making the diagnosis . these criteria specify that symptoms must cause clinically significant functional distress or impairment , be present for at least 3 nights / week for at least 3 months , and not be linked to other sleep , medical , or mental disorders . various studies worldwide have shown the prevalence of insomnia in 10%30% of the population , some even as high as 50%60% . it is common in older adults , females , and people with medical and mental ill health . the consequences of insomnia are significant , such as depression , impaired work performance , work- related / motor vehicle accidents , and overall poor quality of life . it is an easy - to - diagnose condition with many self - answerable questionnaires for aid , yet goes unrecognized in a significant number of patients coming to the outpatient department with other comorbid conditions . the objective of this study was to determine the prevalence of chronic insomnia , to look for any association with socioeconomic factors and medical comorbidities , and also to assess the patient 's perception of having insomnia . this cross - sectional study was conducted in the family medicine outpatient department ( opd ) of a 450-bedded general hospital in bengaluru - st . philomena 's hospital . all adult patients attending the opd from september 1 to october 30 , 2015 , were enrolled in the study after obtaining written consent . data about age , gender , education , occupation , monthly family income in rupees , and medical comorbidities were collected using a questionnaire . athens insomnia scale was given to the patient to score ; illiterate patients were helped by asking the same questions in their local language . the analysis was done using spss 19.0 software ( ibm , bangalore , india ) , and the chi - square test was used for analyzing the association of risk factors . patients < 18 years and > 60 years , patients with known psychiatric illnesses , acutely ill patients , and alcoholics were excluded from the study . patients < 18 years and > 60 years , patients with known psychiatric illnesses , acutely ill patients , and alcoholics were excluded from the study . two hundred and seventy - eight patients were enrolled in the study after obtaining consent 180 were female and 98 were male . insomnia was found in 92 ( 33% ) patients - 63 ( 68% ) were female and 29 ( 32% ) were male . twenty - nine ( 32% ) patients below the age of 35 had insomnia , of which 20 ( 69% ) were female and 9 ( 31% ) were male . sixty - three ( 68% ) patients were of age > 35 years - of which 43 ( 68% ) were female and 20 ( 32% ) were male . prevalence of insomnia with age and gender table 2 shows the association of insomnia with socioeconomic variables . insomnia was found to be significantly higher in patients > 35 years of age ( p = 0.015 ) . the educational background did not significantly affect insomnia - 40% of illiterate or people with basic schooling , 19% of undergraduates , 30% of graduates , and 19% of postgraduate degree holders were found to have insomnia . employment also had no significant correlation with insomnia - 38% unemployed , 33% unskilled laborers , 45% skilled workers , and 30% professionals were found to have insomnia although statistically insignificant . family income was another insignificant variable - 29% of patients with monthly income < rs . 25,000 had insomnia , 37% in the group of income between 26,000 and 50,000 , 50% with income between 51,000 and 75,000 , and 41% with income > rs . association of socioeconomic variables with insomnia table 3 shows the association of insomnia with medical comorbidities . patients with diabetes had statistically significant insomnia compared to those without diabetes ( p = 0.001 ) . hypertension ( 37% vs. 32% ) , ischemic heart disease ( 50% vs. 33% ) , thyroid disorders ( 42% vs. 31% ) , respiratory disorders ( 35% vs. 33% ) , kidney diseases ( 67% vs. 33% ) , liver diseases ( 51% vs. 32% ) , and other disorders such as arthralgia / tuberculosis / seizures / gastrointestinal disorders ( 48% vs. 33% ) were found to have statistically insignificant correlation with insomnia . association of medical comorbidities with insomnia table 4 shows the association of actual insomnia with the patient 's perception . twenty - five patients ( 27% ) did not have the perception of insomnia although they had a score of > 6 in athens scale , which had a significant p value ( p < 0.05 ) . association of patient 's perception with actual insomnia the present study was done to determine the prevalence of chronic insomnia in the adult population in a family medicine outpatient clinic . in this study , the prevalence was found to be 33% with statistically significant correlation with increasing age and diabetes . a similar study conducted in south india found a prevalence of 18.6% among healthy adults attending a tertiary hospital another indian study identified 15.4% prevalence of insomnia ; incidence was high in persons with comorbid chronic physical illness ( 28.1% ) compared to persons free from that ( 10.9% ) , also higher among people living in joint families than those living in a nuclear family and increasing significantly with increasing age . a recent study among corporate employees in india showed a prevalence of insomnia in 13.8% of participants , of which undiagnosed population was 96.4% . the common comorbid conditions associated with insomnia were anxiety , hypertension , and depression , and alcohol consumption was observed to be significantly higher in the sufferers of insomnia . our study showed a much higher prevalence rate compared to the above three indian studies . a multinational study done in latin american countries using athens insomnia scale and other sleep scales in middle - aged females showed 56.6% of surveyed women suffered from either insomnia , poor sleep quality , or both . increasing age , the presence of chronic disease , troublesome drinking , anxiety , depression , vasomotor symptoms , and drug use ( hypnotics and hormone therapy ) were significant risk factors related to the presence of sleep disturbances . many other international studies have also shown insomnia to be more common in women and elders . dr . ohayan 's landmark review of approximately 50 prevalence studies reported roughly 30 - 20 - 10 rule for prevalence i.e. , 30% of adults have symptoms , 15%20% report symptoms , and < 10% are likely to meet the diagnostic and statistical criteria . a meta - analysis done in the us showed that of the patients attending primary care clinics , more than 50% complained of insomnia , only if specifically asked about it , 30% visit their general practitioners ( gps ) on their own initiative , and only 5% go to consultation with the main objective of receiving treatment to solve their problem . another international survey of sleep disorders in general population found that many individuals with insomnia ( 47%67% ) did not seek medical attention for their sleep difficulties . among those who sought medical help a study on malaysian patients attending primary care clinics showed that 38.9% patients had frequent insomnia symptoms ( > 3 times / week ) , 30.7% had chronic insomnia without daytime consequences , and 28.6% had chronic insomnia with daytime dysfunction . indian ethnicity , age 50 , anxiety symptoms , and depression symptoms were risk factors for chronic insomnia with daytime dysfunction . this study also analyzed the association of various comorbidities with insomnia and showed statistically significant correlation with patients having diabetes mellitus . in a similar study , taylor et al . demonstrated that people with chronic insomnia reported more of the following than did people without insomnia : heart disease ( 21.9% vs. 9.5% ) , high blood pressure ( 43.1% vs. 18.7% ) , neurologic disease ( 7.3% vs. 1.2% ) , breathing problems ( 24.8% vs. 5.7% ) , urinary problems ( 19.7% vs. 9.5% ) , chronic pain ( 50.4% vs. 18.2% ) , and gastrointestinal problems ( 33.6% vs. 9.2% ) . conversely , people with the following medical problems reported more chronic insomnia than did those without those medical problems : heart disease ( 44.1% vs. 22.8% ) , cancer ( 41.4% vs. 24.6% ) , high blood pressure ( 44.0% vs. 19.3% ) , neurologic disease ( 66.7% vs. 24.3% ) , breathing problems ( 59.6% vs. 21.4% ) , urinary problems ( 41.5% vs. 23.3% ) , chronic pain ( 48.6% vs. 17.2% ) , and gastrointestinal problems ( 55.4% vs. 20.0% ) . when all medical problems were considered together , only patients with high blood pressure , breathing problems , urinary problems , chronic pain , and gastrointestinal problems had statistically higher levels of insomnia than those without these medical disorders . insomnia was also considered as a predictor for other sleep disorders such as obstructive sleep apnea in some studies . a recent study done in singapore illustrated that many patients with chronic insomnia have underlying primary sleep disorders . our study did not consider evaluating for other sleep disorders due to practical difficulties in doing sleep studies in primary care settings . a survey among adult french population in 20012002 regarding insomnia found that 25% of randomly selected respondents were dissatisfied with their sleep and only 13% had consulted a health - care provider , especially for insomnia . in the south indian study quoted above , only 2.2% people perceived themselves as having sleep - related problems . in the study on indian population in west bengal , it was found that 43.2% of insomniac patients never seek medical advice for insomnia and only 15.3% actually consulted a doctor for their sleep problem . in our population , no patient had actually presented with insomnia as their primary complaint , but 27% of insomniacs did not perceive their condition . the present study was done to determine the prevalence of chronic insomnia in the adult population in a family medicine outpatient clinic . in this study , the prevalence was found to be 33% with statistically significant correlation with increasing age and diabetes . a similar study conducted in south india found a prevalence of 18.6% among healthy adults attending a tertiary hospital another indian study identified 15.4% prevalence of insomnia ; incidence was high in persons with comorbid chronic physical illness ( 28.1% ) compared to persons free from that ( 10.9% ) , also higher among people living in joint families than those living in a nuclear family and increasing significantly with increasing age . a recent study among corporate employees in india showed a prevalence of insomnia in 13.8% of participants , of which undiagnosed population was 96.4% . the common comorbid conditions associated with insomnia were anxiety , hypertension , and depression , and alcohol consumption was observed to be significantly higher in the sufferers of insomnia . our study showed a much higher prevalence rate compared to the above three indian studies . a multinational study done in latin american countries using athens insomnia scale and other sleep scales in middle - aged females showed 56.6% of surveyed women suffered from either insomnia , poor sleep quality , or both . increasing age , the presence of chronic disease , troublesome drinking , anxiety , depression , vasomotor symptoms , and drug use ( hypnotics and hormone therapy ) were significant risk factors related to the presence of sleep disturbances . many other international studies have also shown insomnia to be more common in women and elders . dr . ohayan 's landmark review of approximately 50 prevalence studies reported roughly 30 - 20 - 10 rule for prevalence i.e. , 30% of adults have symptoms , 15%20% report symptoms , and < 10% are likely to meet the diagnostic and statistical criteria . a meta - analysis done in the us showed that of the patients attending primary care clinics , more than 50% complained of insomnia , only if specifically asked about it , 30% visit their general practitioners ( gps ) on their own initiative , and only 5% go to consultation with the main objective of receiving treatment to solve their problem . another international survey of sleep disorders in general population found that many individuals with insomnia ( 47%67% ) did not seek medical attention for their sleep difficulties . among those who sought medical help a study on malaysian patients attending primary care clinics showed that 38.9% patients had frequent insomnia symptoms ( > 3 times / week ) , 30.7% had chronic insomnia without daytime consequences , and 28.6% had chronic insomnia with daytime dysfunction . indian ethnicity , age 50 , anxiety symptoms , and depression symptoms were risk factors for chronic insomnia with daytime dysfunction . this study also analyzed the association of various comorbidities with insomnia and showed statistically significant correlation with patients having diabetes mellitus . in a similar study , taylor et al . demonstrated that people with chronic insomnia reported more of the following than did people without insomnia : heart disease ( 21.9% vs. 9.5% ) , high blood pressure ( 43.1% vs. 18.7% ) , neurologic disease ( 7.3% vs. 1.2% ) , breathing problems ( 24.8% vs. 5.7% ) , urinary problems ( 19.7% vs. 9.5% ) , chronic pain ( 50.4% vs. 18.2% ) , and gastrointestinal problems ( 33.6% vs. 9.2% ) . conversely , people with the following medical problems reported more chronic insomnia than did those without those medical problems : heart disease ( 44.1% vs. 22.8% ) , cancer ( 41.4% vs. 24.6% ) , high blood pressure ( 44.0% vs. 19.3% ) , neurologic disease ( 66.7% vs. 24.3% ) , breathing problems ( 59.6% vs. 21.4% ) , urinary problems ( 41.5% vs. 23.3% ) , chronic pain ( 48.6% vs. 17.2% ) , and gastrointestinal problems ( 55.4% vs. 20.0% ) . when all medical problems were considered together , only patients with high blood pressure , breathing problems , urinary problems , chronic pain , and gastrointestinal problems had statistically higher levels of insomnia than those without these medical disorders . insomnia was also considered as a predictor for other sleep disorders such as obstructive sleep apnea in some studies . a recent study done in singapore illustrated that many patients with chronic insomnia have underlying primary sleep disorders . our study did not consider evaluating for other sleep disorders due to practical difficulties in doing sleep studies in primary care settings . a survey among adult french population in 20012002 regarding insomnia found that 25% of randomly selected respondents were dissatisfied with their sleep and only 13% had consulted a health - care provider , especially for insomnia . in the south indian study quoted above , only 2.2% people perceived themselves as having sleep - related problems . in the study on indian population in west bengal , it was found that 43.2% of insomniac patients never seek medical advice for insomnia and only 15.3% actually consulted a doctor for their sleep problem . in our population , no patient had actually presented with insomnia as their primary complaint , but 27% of insomniacs did not perceive their condition . insomnia is the most commonly encountered sleep disorder and occurs in 10%50% of the population according to studies conducted worldwide . the pathophysiology of insomnia can actually be somewhat complex ( or at least multi - factorial ) because of the many inputs to the sleep - wake system in general and the additional specific behaviors and cognitions which an individual layers on top of the physiologic substrates . studies show that insomnia negatively affects work performance , impairs decision - making , can damage relationships , increase chances of work - related / motor vehicle accidents , and lead to overall decline in quality of life . despite the prevalence of poor sleep quality and insomnia in the general population , people with sleep problems often go unnoticed in the health - care system . when insomnia lasts for 4 weeks or more , it is classified as chronic insomnia . it is further subclassified into with or without comorbidities ( medical and psychiatric ) and associated with another primary sleep disorder . numerous self - report instruments exist for the assessment of sleep disturbance . among them , the most widely used are pittsburgh sleep quality index , epworth sleepiness scale , athens insomnia score , and insomnia severity index . athens insomnia scale was chosen for this study because of its simple language , ease of questions and calculation , effectiveness , and reprint rights . this study showed a prevalence of chronic insomnia in 33% in the sample population surveyed , with females being more affected compared to males but in statistically insignificant values . there was a significant prevalence in patients having diabetes irrespective of the duration of diabetes and drugs taken . there was no major correlation with education / social / economic factors and comorbid conditions such as hypertension , asthma , migraine , heart diseases , and liver or kidney diseases . there is also poor knowledge and awareness about sleep disorders and their health - related negative consequences in our population . insomnia is a common sleep disorder which is many times missed by a primary care physician until / unless asked for ; the prevalence of which was as high as 33% in this study . hence , all diabetic patients should be screened for insomnia by the primary care physician / diabetologist with a self - assessed questionnaire . a caring physician should assess the sleep pattern of every patient and give adequate counseling or treatment for the same .

nowadays , the incidence of fungal agents causing candidiasis has increased remarkably , especially in patients infected with human immunodeficiency virus ( hiv ) , immunocompromised hosts , intravenous drug abusers , bone marrow and solid organ recipient , those who present underlying valvular heart diseases , implantation of prosthetic valves and prolonged use of intravenous catheters . candida albicans is one of the most prevalent opportunistic agent in candidiasis specifically in immunocompromised host followed by non albicans ( 14 ) , however , approximately 17% of the nosocomial infections are caused by c. parapsilosis , c. glabrata , c. tropicalis and c. krusei . moreover , critically ill patients admitted to the oncology and infectious disease wards are at greatest risk of fungal infections ( 59 ) . colonized patients are the main reservoir of c. albicans in hospitals , and the cross contamination may occurs between them . thus , understanding the source of colonization and the transmission route , to control of nosocomial infections due to c. albicans among admitted patients will improve , and recognize the characteristics of the infectious strains ( 1012 ) . due to the high degree of phenotypic similarity between candida species , identification and differentiation may not be very successful , are time consuming and difficult to interpret . therefore , it is now well established that advanced molecular methods , which have driven new developments in fungal taxonomy , are more reliable than classical methods ( 1315 ) . mlst is one of a series of techniques for phylogenetic studies and genotyping and is well suited for distinguishing closely related organisms at the species to strain level . it has been extensively used because of it has high discriminatory power for the identification of various microbial pathogens ( 4 , 1619 ) . in addition , mlst technique has many advantages compared to other marker technologies such as randomly amplified polymorphic dna ( 13 ) , restriction fragment length polymorphism ( 20 ) , southern blot hybridization with discriminating probes ( 21 ) , amplified fragment length polymorphism analysis ( 22 ) and microsatellites ( 14 ) . the genotypes determined by this technique can be compared with stored data in a central database ( http://calbicans.mlst.net ) ( 1618 , 2325 ) . as regards mlst method directly analyze the polymorphism within dna sequences ; we performed the first nationwide study into the genotypic relationships of c. albicans strains obtained from oropharynx and bronchoalveolar lavage ( bal ) samples from immunocompromised patients . during may 2006 to august 2012 ; 14 clinical isolates of c. albicans recovered from cancer patients with oropharynx lesions ( n=7 ) and bal samples ( n=7 ) from mazandaran university of medical sciences , sari , iran . stock cultures for transient working collections were initially grown on malt extract agar ( mea ) ( difco , u.s.a ) at 24c for 23 days . all organisms were identified to the species level by sequencing of the internal transcribed spacer ( its ) region of the rdna ( 26 ) . mlst was used for typing the fourteen clinical isolates as previously described ( 18 ) . briefly , genomic dna was extracted using previously described glass bead / phenol / chloroform method ( 27 ) . mlst was performed based on the seven housekeeping genes , i.e. , aat1a , acc1 , adp1 , mpib , sya1 , vps13 , and zwf1b ( 18 ) . the primers used for amplification and sequencing are shown in table 1 . gene fragments and primers used for mlst analysis pcr reactions were performed on a thermal cycler ( biorad - c1000 ) in a 25 l volumes containing 25 ng of template dna , 2.5 l reaction buffer ( 0.1 m tris - hcl , ph 8.0 , 0.5 m kcl , 15 mm mgcl2 , 0.1% gelatine , 1% triton x-100 ) , 0.1 mm of each dntp and 1.0 u taq dna polymerase ( itk diagnostics , leiden , the netherlands ) . amplification of those genes were performed with cycles of 5 min at 94c for primary denaturation , followed by 35 cycles at 94 c ( 30s ) , 55 c ( 60 s ) and 72 c ( 60 s ) , with a final 5 min extension step at 72 c . amplicons were purified using qiaquick dna and gel band purification kit ( cat . sequencing was done on an abi 3730xl automatic sequencer ( applied biosystems , foster city , ca , u.s.a ) . alignments of sequence data were adjusted manually for each gene using mega 5.05 ( http://www.megasoftware.net/ ) and boiedit ver . the heterozygosity was identified by the presence of two peaks at the same polymorphic loci on both strands and the consensus sequences of seven loci of all isolates were determined . the number of alleles and diploid sequence types ( dsts ) was determined by comparing the sequences with those available in the c. albicans mlst database ( http://calbicans.mlst.net ) . the eburst analysis ( http://eburst.mlst.net/ ) was performed and dsts of 14 isolates were compared with all available dsts ( n = 2099 ) in the database at july 2014 and split into eburst clonal clusters . the upgma dendrogram based on mlst sequence data was drawn using clc sequence viewer 6 software ( http://www.clcbio.com/ ) which can analyze the heterozygous code data for nucleotide p - distances . during may 2006 to august 2012 ; 14 clinical isolates of c. albicans recovered from cancer patients with oropharynx lesions ( n=7 ) and bal samples ( n=7 ) from mazandaran university of medical sciences , sari , iran . stock cultures for transient working collections were initially grown on malt extract agar ( mea ) ( difco , u.s.a ) at 24c for 23 days . all organisms were identified to the species level by sequencing of the internal transcribed spacer ( its ) region of the rdna ( 26 ) . mlst was used for typing the fourteen clinical isolates as previously described ( 18 ) . briefly , genomic dna was extracted using previously described glass bead / phenol / chloroform method ( 27 ) . mlst was performed based on the seven housekeeping genes , i.e. , aat1a , acc1 , adp1 , mpib , sya1 , vps13 , and zwf1b ( 18 ) . the primers used for amplification and sequencing are shown in table 1 . gene fragments and primers used for mlst analysis pcr reactions were performed on a thermal cycler ( biorad - c1000 ) in a 25 l volumes containing 25 ng of template dna , 2.5 l reaction buffer ( 0.1 m tris - hcl , ph 8.0 , 0.5 m kcl , 15 mm mgcl2 , 0.1% gelatine , 1% triton x-100 ) , 0.1 mm of each dntp and 1.0 u taq dna polymerase ( itk diagnostics , leiden , the netherlands ) . amplification of those genes were performed with cycles of 5 min at 94c for primary denaturation , followed by 35 cycles at 94 c ( 30s ) , 55 c ( 60 s ) and 72 c ( 60 s ) , with a final 5 min extension step at 72 c . amplicons were purified using qiaquick dna and gel band purification kit ( cat . sequencing was done on an abi 3730xl automatic sequencer ( applied biosystems , foster city , ca , u.s.a ) . alignments of sequence data were adjusted manually for each gene using mega 5.05 ( http://www.megasoftware.net/ ) and boiedit ver . the heterozygosity was identified by the presence of two peaks at the same polymorphic loci on both strands and the consensus sequences of seven loci of all isolates were determined . the number of alleles and diploid sequence types ( dsts ) was determined by comparing the sequences with those available in the c. albicans mlst database ( http://calbicans.mlst.net ) . the chromatograms of new alleles and dsts were assigned to central mlst database curator . the eburst analysis ( http://eburst.mlst.net/ ) was performed and dsts of 14 isolates were compared with all available dsts ( n = 2099 ) in the database at july 2014 and split into eburst clonal clusters . the upgma dendrogram based on mlst sequence data was drawn using clc sequence viewer 6 software ( http://www.clcbio.com/ ) which can analyze the heterozygous code data for nucleotide p - distances . fourteen c. albicans specimens from immunocompromised patients were used in this study and all specimens were successfully typed by evaluating the dna sequences of the fragments from seven different housekeeping genes , which yielded a set of 2,883 nucleotides for each isolate . mlst analysis showed that seventy - one ( 2.5% ) nucleotide sites found to be variable and all of the isolates were found to be heterozygous . sixty different alleles were identified in seven loci of the fourteen c. albicans isolates ; vps13 generated the most number of alleles ( n = 12 ) , while adp1 generated the least ( n = 7 ) ( table 2 ) . characteristics of the seven housekeeping loci studied among sixty alleles , two new alleles were determined in adp1 locus ( allelic number 123 ) and other was in mpib locus ( allelic number 130 ) and added to the mlst database ( http://calbicans.mlst.net ) . as shown in table 2 , the sequenced genes yielded a total of 71 variable sites which vps13 and mpib loci produced the highest ( n = 13 ) of polymorphic sites , while acc1 produced the lowest number ( n=6 ) . the allelic diversity at the seven loci for the 14 c. albicans isolates has been found in twelve unique dsts , which all dsts submitted into www.calbicans.mlst.net . among these dsts , seven dsts belonged to previously described dsts , and the five novel dsts added to the database . the i d numbers of five new sts , which are assigned in www.calbicans.mlst.net , are 2246 , 2248 and 2252 up to 2254 . the eburst package ( http://eburst.mlst.net/ ) was used to analyze the genotype relationships comparing with those available dsts ( n = 2099 ) in mlst database at july 2014 . a total 108 eburst clusters and 707 singleton strains produced . twelve isolates were placed in 10 clonal clusters ( cc ) while two isolates were single - tons . results revealed 10 out of 14 strains had a different dsts , but two isolates ; af24 and af52 ; had identical dsts 172 which belonged to cc 172 and also two other isolates ; af57 and af60 ; had same dst 1751 which assigned to cc 461 ( fig . 1 ) . one the isolates with new dst 1110 is clustered in cc 344 and identified as st bootstrap subgroup 99% ( fig . 2 , dst 1110 is subset of cc 344 and known as st bootstrap of 35 strains . the upgma dendrogram for the concatenated variable sequences from the 14 isolates with different source clearly showed the clustering pattern ( fig . 1 ) . summarizes the all information of 14 c. albicans clinical isolates analyzed by mlst technique . this comprises the allelic number for each locus , dsts , clonal clusters , clades and it also illustrates the upgma dendrogram based on mlst data . all geographic origins were situated in mazandaran , iran h1 : amir kola hospital ; h2 : rajaee hospital ; h3 : imam khomeini hospital . : same dsts from different patients new dst 1110 from bal sample is clustered in cc 344 by eburst analysis and identified as st bootstrap subgroup 99% the mlst results have showed that some isolates have the same dst . in total among 14 unrelated clinical isolates ( oropharynx and bal samples of immunocompromised patients ) , showed 12 different dsts ( 85.7% ) . the same dst 1751 profile was found among two patients ; p33 and p36 ; and same dst 172 discovered in two patients ; p18 and p31 . strain typing , or the ability to distinguish between clonally unrelated isolates , is an indispensable tool in the clinical microbiology laboratory and for hospital epidemiology . some of the most important reasons to perform strain typing in the mycology field are patient monitoring and treatment follow - up , outbreak analysis , environmental monitoring and the study of local and global epidemiology of fungal pathogens . mlst is one of a series of techniques for typing studies and it is highly discriminative method that using in this context can detect micro variations and microevolutions in the genomes of epidemiological related strains of c. albicans ( 9 , 17 , 28 ) . a discriminatory strain typing system would be useful for clinical and epidemiological studies to obtain information of sources , carriage , transmission , correlation and properties , i.e. , virulence and antimicrobial resistance ( 14 , 29 ) . this method is also used to the study of c. albicans isolates obtained from different patients at different times and locations , which are known as epidemiologically unrelated strains and usually are not genetically closely related and classify in different clusters ( 17 , 23 ) . in the present study , we investigated the genetic diversity of c. albicans strains and now discuss the implications of a comparison of 14 clinical isolates . based on the mlst of seven loci we classified strains of c. albicans into seven clades , which were supported by high bootstrap values ( fig . 1).the aim of this study was to evaluate the genetic diversity and relationships among unrelated c. albicans isolates recovered from oropharynx and bal samples . we used mlst to determine c. albicans genotypes , and found that ten patients ( 71.5% ) were infected by ten strains with different dst . two strains with identical mlst patterns were isolated from two patients ; p33 and p36 ; who admitted at the same infectious disease ward in different time . therefore , it seems that colonized patients are a main reservoir of c. albicans in hospitals and the isolation of c. albicans with the same dst in more than one patient is remarkable and may provide evidence for cross contamination between patients , which might be a crucial factor for nosocomial infections . in addition , two other strains with the same dst were isolated from two patients ; p18 and p31 ; admitted in different hospital . sum total 12 unrelated isolates belonged to seven out of 17 clades , ( 4 , 19 ) , while 2 isolates not assigned into defined clades . odds showed that the five clades ( numbered 1,2,3,4 and 11 ) are the largest clades at mlst database of c. albicans ( 19 ) and among 14 isolates of this study , six strains ( 43% ) belonged to three out of this five clades ( 3 , 4 , 11 ) . the five ( 36% ) of our isolates were new dst which one of those ( dst 1110 ) was clustered in cc 344 based on eburst analysis and identified as st bootstrap and 35 strains were located as subset of dst 1110 . in other our study , afsarian and colleagues applied mlst for 30 epidemiologically related c. albicans isolates and acquired 18 dsts and was identified significant genetic relation among the epidemiologically related c. albicans isolates from burn patients at the same burn icu during the same 6 months ( 30 ) . tavanti and colleagues analyzed 416 unrelated c. albicans isolates by the eburst software and 228 ( 54.8% ) were assigned to clonal clusters which belonged to 12 clades . bougnoux and co - workers found 27 dsts among the 28 epidemiologically unrelated c. albicans isolates . therefore , they showed mlst of 14 epidemiologically related isolates that recovered from patients in the same hospital ward during the same 3 months had specific dsts , although 73% of these isolates were genetically related ( 17 ) . therefore , according to the previous studies ( 17 , 23 , 30 ) and obtained data in current study indicate that genetic diversity is variable among unrelated strains isolated from different patients and from non - identical places . therefore , mlst generates evidence for similarities and differences between isolates from sequences determined and mlst schemes provide a high discriminatory power when applied to a collection of epidemiologically unrelated isolates . isolates that show identical or very similar allelic profiles are presumed identical or closely related . this would be used to evaluate the relationships between isolates identified within a specific environment . pathogen distribution and relatedness for determining the epidemiology of nosocomial infections is highly recommended for pathogen control methods . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors .

since its establishment by sir william osler in the late 19 century , enormous strides have been made in the overall structure and regulation of residency training to the point that it is now about the only path toward post - graduate medical specialization in most countries . today , every country has its own accrediting and governing bodies for residency training programs . the many advances in medicine and the evolution of numerous medical specializations and subspecializations have resulted in a narrowing of the scope of practice for specialized physicians . , residents are required to attain competency in different areas and acquire the necessary skills , knowledge , and proper attitudes for their primary specialty practices as well as those that overlap with other specialties . various advances and challenges have led medical educators of training programs for different specializations to structure and design clinical training for residents in a manner that incorporates clinical rotations other than the residents main specializations . the saudi commission for health specialties ( schs ) is the governing body for postgraduate medical training in saudi arabia . each residency training program has its own scientific council that has oversight for the design , implementation , and evaluation of the curriculum . these are either in - service ( that is , confined to the resident 's main specialization ) or off - service ( in another specialization or sub - specialization ) . the scope of off - service rotations vary a great deal from one specialization to another , sometimes making up to 40% of the entire residency - training curriculum as is the case in emergency and family medicine . accrediting bodies strive to ensure the quality of post - graduate medical education , but their main focus is on the standardization of the curricula of core specializations , leaving the postgraduate medical teaching institutions with the opportunity to develop their own individual curricula for off - service rotations . having identified gaps in curriculum evaluation , learning contracts , the educational objectives and assessment of off - service residents , medical educators in north america have suggested the need for the unification of off - service curricula . in a survey of the residency leaders of all accredited allopathic emergency medicine residency programs in the united states , branzetti et al . , for instance , found that only 5% of these programs provided specifically designed didactic education directed at the needs of their off - service rotating residents . in an attempt to improve the quality of residency education in saudi arabia , schs and national guard health affairs ( ngha)/king saud bin abdulaziz university for health sciences ( ksau - hs ) in collaboration with the royal college of physicians and surgeons of canada , conducted the first saudi arabian conference on residency education in november 2010 . a better understanding of all residency training curricula , including off - service rotations is required so that the best evidence medical educational practices could be implemented in order to achieve excellence in residency training . there should also be continuous assessment and evaluation of all educational activities in the residency training . evaluation , in particular , serves as both a safeguard and a trigger for quality improvement . residents feedback on their education is an important source of information for any educational program assessment and improvement . indeed , the input of residents has already been utilized for accreditation purposes , and as a means to predicting residents overall satisfaction . owing to the lack of effective means of coordination between different specializations and the absence of national standards , residency educational programs tend to suffer . based on residents perceptions of these programs , abdulrahman and al - dakheel contended that the saudi residency training program in family medicine needed improvement . in another study , al shanafey et al . showed that most surgical residents in riyadh were dissatisfied with their training programs , a claim that agrees with al ghamdi 's finding on the saudi dermatology residency training program . published data on residents perceptions , experiences , and overall satisfaction with their off - service rotations in saudi arabia is scarce . our experience in hospitals shows that residents often discuss their impressions on off - service rotations informally with each other , sometimes with staff , and but rarely , and then only cautiously with their supervisors . for some residents , these rotations constitute a break from the demands of their own specializations ; others find it an enjoyable productive educational experience ; for some others , these rotations are very stressful , dark spots in their journey through residency . this diversity of impressions is the natural consequence of inappropriate planning , design , implementation , and evaluation of the various educational activities . this study , aimed to assess the residents perceptions , opinions , and general level of satisfaction with their off - service rotations in hospital with the hope that their quality might be improved . this was a cross - sectional study with two parts : in the first part , a questionnaire was developed to assess the opinions of off - service residents regarding their curriculum and their level of satisfaction with the training.the second part of the study involved validating a questionnaire to assess the satisfaction and quality of off - service residency training . it was envisaged that a good questionnaire could help with the regular quality control of off - service rotations . in the first part , a questionnaire was developed to assess the opinions of off - service residents regarding their curriculum and their level of satisfaction with the training . the second part of the study involved validating a questionnaire to assess the satisfaction and quality of off - service residency training . it was envisaged that a good questionnaire could help with the regular quality control of off - service rotations . this questionnaire - based study was conducted in the king fahad national guard hospital ( kfngh ) , a tertiary care facility in riyadh , saudi arabia , which is one of the largest residency training centers in the kingdom . in collaboration with schs , kfngh provides post - graduate residency training in different specializations and sub - specializations such as emergency medicine , internal medicine , family medicine , neurology , pediatrics , obstetrics , and surgery . kfngh is the primary site for residency training : residents from different specializations to complete their on - service and off - service clinical rotations . in addition to its own sponsored residents , the facility also accommodates rotating residents from other parts of the kingdom who have elected to complete their clinical rotations in the region . the self - addressed questionnaire was designed using close - ended questions based on a literature review and the recommendations of local educators , residency directors , and medical educationists at ksau - hs . some items were derived and modified from the accreditation council for graduate medical education ( acgme ) residents and fellows survey . the first section had demographic questions ( primary specialization , current off - service rotation , level of training , and gender ) . the second part included questions on the curriculum of the off - service rotation ( learning objectives , teaching , resources , organization , assessment , and evaluation . ) the third part asked questions about residents satisfaction with the learning environment and educational experiences of their off - service rotations . the first draft of the questionnaire was discussed with a medical educator and a program director to elicit further comments and corrections . the corrected version was finalized after it was pilot tested on nine residents not included in the final study . with the help of residency directors these residents were invited to participate in the study , and a formal consent for their participation was taken . the questionnaire was distributed to all 110 off - service rotating residents , regardless of their sponsoring institutions . the residents were in different departments at ngha hospital during the period of september 2011 to december 2011 . non - responders received phone calls and e - mails as reminders after one to two weeks in order to maximize the response rate . data were first entered into microsoft excel and then transferred and analyzed using the statistical package for social sciences program , v. 17 ( spss ) off - service residents satisfaction levels on various aspects of the off - service clinical rotations ( for items 16 - 27 ) were transformed into a total percentage score out of 100 based on a maximum possible score . a comparison of satisfaction scores between resident groups was accomplished by conducting an analysis of variance ( anova ) and an independent samples t - test . the reliability of the questionnaire was cronbach 's alpha 0.57 ( excluding questions about demographics ) , with all items contributing equally . principal component factor analysis with varimax rotations and kaiser normalizations was carried out to assess the validity of the questionnaire . this was a cross - sectional study with two parts : in the first part , a questionnaire was developed to assess the opinions of off - service residents regarding their curriculum and their level of satisfaction with the training.the second part of the study involved validating a questionnaire to assess the satisfaction and quality of off - service residency training . it was envisaged that a good questionnaire could help with the regular quality control of off - service rotations . in the first part , a questionnaire was developed to assess the opinions of off - service residents regarding their curriculum and their level of satisfaction with the training . the second part of the study involved validating a questionnaire to assess the satisfaction and quality of off - service residency training . it was envisaged that a good questionnaire could help with the regular quality control of off - service rotations . this questionnaire - based study was conducted in the king fahad national guard hospital ( kfngh ) , a tertiary care facility in riyadh , saudi arabia , which is one of the largest residency training centers in the kingdom . in collaboration with schs , kfngh provides post - graduate residency training in different specializations and sub - specializations such as emergency medicine , internal medicine , family medicine , neurology , pediatrics , obstetrics , and surgery . kfngh is the primary site for residency training : residents from different specializations to complete their on - service and off - service clinical rotations . in addition to its own sponsored residents , the facility also accommodates rotating residents from other parts of the kingdom who have elected to complete their clinical rotations in the region . the self - addressed questionnaire was designed using close - ended questions based on a literature review and the recommendations of local educators , residency directors , and medical educationists at ksau - hs . some items were derived and modified from the accreditation council for graduate medical education ( acgme ) residents and fellows survey . the first section had demographic questions ( primary specialization , current off - service rotation , level of training , and gender ) . the second part included questions on the curriculum of the off - service rotation ( learning objectives , teaching , resources , organization , assessment , and evaluation . ) the third part asked questions about residents satisfaction with the learning environment and educational experiences of their off - service rotations . the first draft of the questionnaire was discussed with a medical educator and a program director to elicit further comments and corrections . the corrected version was finalized after it was pilot tested on nine residents not included in the final study . with the help of residency directors , we identified 110 off - service rotating residents . these residents were invited to participate in the study , and a formal consent for their participation was taken . the questionnaire was distributed to all 110 off - service rotating residents , regardless of their sponsoring institutions . the residents were in different departments at ngha hospital during the period of september 2011 to december 2011 . non - responders received phone calls and e - mails as reminders after one to two weeks in order to maximize the response rate . data were first entered into microsoft excel and then transferred and analyzed using the statistical package for social sciences program , v. 17 ( spss ) off - service residents satisfaction levels on various aspects of the off - service clinical rotations ( for items 16 - 27 ) were transformed into a total percentage score out of 100 based on a maximum possible score . a comparison of satisfaction scores between resident groups was accomplished by conducting an analysis of variance ( anova ) and an independent samples t - test . the reliability of the questionnaire was cronbach 's alpha 0.57 ( excluding questions about demographics ) , with all items contributing equally . principal component factor analysis with varimax rotations and kaiser normalizations was carried out to assess the validity of the questionnaire . out of 110 off - service rotating residents invited to participate in the study , 80 candidates completed and returned the survey questionnaire , generating a response rate of 73% for inclusion in our analysis . thirteen ( 16% ) of the respondents , were in their 1 year of residency training , 25 ( 31% ) in their second , 26 ( 33% ) in their third , and 16 ( 20% ) in their fourth . the mean age of the residents was 28 ( 3 ) years ; 66 ( 82% ) were males . had a clear set of goals and educational learning objectives , and only 25 ( 31% ) had any information about educational resources before starting their off - service rotations . sixty four residents ( 80% ) had protected time for residency educational activities , and 63 ( 79% ) believed that they had been given sufficient clinical exposure and learning opportunities [ table 1 ] . curriculum and learning contract for off - service rotations the mean levels of satisfaction of residents with off - service rotations ( items 16 - 27 ) , on a scale of 1 - 5 ( 1 = not at all satisfied , 5 = extremely satisfied ) , are given in table 2 . residents satisfaction with their off - service rotations a total resident satisfaction score for items 16 - 27 was calculated and then converted to a score out of 100 ; the mean scores were compared according to their primary specializations , kinds of off - service rotations , training levels , gender , and sponsoring institutions [ table 3 ] . surgical specializations had low satisfaction mean scores 57.2 11.9 compared to emergency medicine specializations 70.7 16.2 in off - service clinical rotation , p value ( 0.03 ) , whereas there were no significant differences in satisfaction levels according to gender , sponsorship , level of training , or specialization . comparison of mean satisfaction scores between different groups ( out of 100 ) more than half of the residents surveyed felt that they were discriminated against in terms of duty scheduling and service obligations in their off - service rotations . residents also claimed that sometimes to very often their learning abilities and clinical education had been compromised because of the presence of trainees , who were part of the off - service specialization programs , as well as by excessive service obligations [ table 4 ] . residents satisfaction with the learning environment of their off - service rotations residents were asked whether they felt that their rotation was beneficial to them in achieving their ultimate goals and responsibilities within their primary specializations . the responses showed differences that corresponded to different off - service rotations as follows : surgical and medical off - service rotations had mean scores of 3.2 0.8 and 3.2 0.7 respectively , and intensive care and emergency medicine off - service rotations had mean scores of 4 0.5 , and 3.7 0.6 respectively , with a p < 0.001 . in addition , males and females responded differently 3.6 0.9 and 3.9 0.3 , respectively , with female respondents being more positive with a p value of 0.012 . there was no significant difference between the responses of those sponsored by ngha 3.7 0.8 and those sponsored by other institutions 3.6 1.0 ; neither was there any significant difference corresponding to the training levels of residents and their primary specializations . for off - service rotation educational experience , the overall satisfaction mean score of the residents was 3.5 0.8 . the surgical off - service rotations satisfaction mean score was 2.9 0.6 , as compared to the mean scores of intensive care , emergency medicine , and medical off - service rotations of 3.8 0.5 , 3.6 0.9 , and 3.6 0.9 , respectively , with a p value of 0.001 . females were more satisfied with their overall experiences during the rotation 4.0 0.4 compared to males 3.4 0.8 , with a p < 0.001 . there were again no statistically significant differences among the groups according to residency training level , sponsoring institution , or primary specialization . the vast majority of residents believed that their off - service rotations would benefit them toward the achievement of their ultimate goals and objectives for their primary specialization programs . overall , the group was satisfied with its educational experiences within the off - service clinical rotations . factor analysis yielded a 4-factor solution after varimax rotation , which converged in 7 iterations ( eigen value at 1 ) , thus accounting for a variance of 51% in the data . these four factors were : educational environment , educational balance , educational goals and objectives , and learning ability [ table 5 ] . three variables had negative loadings on these factors and did not load onto any factor ; a total of 24 factors had appropriate loadings . the four factors linked together appropriately . in future questionnaires , the three items that did not load onto any factor will not be used . only 26 residents ( 33% ) had a clear set of goals and educational learning objectives , and only 25 ( 31% ) had any information about educational resources before starting their off - service rotations . sixty four residents ( 80% ) had protected time for residency educational activities , and 63 ( 79% ) believed that they had been given sufficient clinical exposure and learning opportunities [ table 1 ] . the mean levels of satisfaction of residents with off - service rotations ( items 16 - 27 ) , on a scale of 1 - 5 ( 1 = not at all satisfied , 5 = extremely satisfied ) , are given in table 2 . residents satisfaction with their off - service rotations a total resident satisfaction score for items 16 - 27 was calculated and then converted to a score out of 100 ; the mean scores were compared according to their primary specializations , kinds of off - service rotations , training levels , gender , and sponsoring institutions [ table 3 ] . surgical specializations had low satisfaction mean scores 57.2 11.9 compared to emergency medicine specializations 70.7 16.2 in off - service clinical rotation , p value ( 0.03 ) , whereas there were no significant differences in satisfaction levels according to gender , sponsorship , level of training , or specialization . comparison of mean satisfaction scores between different groups ( out of 100 ) more than half of the residents surveyed felt that they were discriminated against in terms of duty scheduling and service obligations in their off - service rotations . residents also claimed that sometimes to very often their learning abilities and clinical education had been compromised because of the presence of trainees , who were part of the off - service specialization programs , as well as by excessive service obligations [ table 4 ] . residents satisfaction with the learning environment of their off - service rotations residents were asked whether they felt that their rotation was beneficial to them in achieving their ultimate goals and responsibilities within their primary specializations . the responses showed differences that corresponded to different off - service rotations as follows : surgical and medical off - service rotations had mean scores of 3.2 0.8 and 3.2 0.7 respectively , and intensive care and emergency medicine off - service rotations had mean scores of 4 0.5 , and 3.7 0.6 respectively , with a p < 0.001 . in addition , males and females responded differently 3.6 0.9 and 3.9 0.3 , respectively , with female respondents being more positive with a p value of 0.012 . there was no significant difference between the responses of those sponsored by ngha 3.7 0.8 and those sponsored by other institutions 3.6 1.0 ; neither was there any significant difference corresponding to the training levels of residents and their primary specializations . for off - service rotation educational experience , the overall satisfaction mean score of the residents was 3.5 0.8 . the surgical off - service rotations satisfaction mean score was 2.9 0.6 , as compared to the mean scores of intensive care , emergency medicine , and medical off - service rotations of 3.8 0.5 , 3.6 0.9 , and 3.6 0.9 , respectively , with a p value of 0.001 . females were more satisfied with their overall experiences during the rotation 4.0 0.4 compared to males 3.4 0.8 , with a p < 0.001 . there were again no statistically significant differences among the groups according to residency training level , sponsoring institution , or primary specialization . the vast majority of residents believed that their off - service rotations would benefit them toward the achievement of their ultimate goals and objectives for their primary specialization programs . overall , the group was satisfied with its educational experiences within the off - service clinical rotations . factor analysis yielded a 4-factor solution after varimax rotation , which converged in 7 iterations ( eigen value at 1 ) , thus accounting for a variance of 51% in the data . these four factors were : educational environment , educational balance , educational goals and objectives , and learning ability [ table 5 ] . three variables had negative loadings on these factors and did not load onto any factor ; a total of 24 factors had appropriate loadings . the four factors linked together appropriately . in future questionnaires , the three items that did not load onto any factor will not be used . our study demonstrates several important areas of deficiency in off - service rotation curricula in king fahd national guard hospital ( kfngh ) , king abdulaziz medical city ( kamc ) as perceived by off - service residents of different residency training specialization programs . sixty - seven percent or more of the residents had no set goals or objectives , nor were they given directions for educational resources . program organization and planning should be based on clear statements of goals and educational objectives , which training residents and educators should utilize to better guide the learning process training program and assessment . the accreditation bodies for residency training programs in canada developed national standards to evaluate and accredit their programs , strongly emphasizing a statement of educational objectives for residents rotations . standard b2 , for instance , reads : goals and objectives ( there must be a clearly worded statement outlining the goals of the residency program and the educational objectives of the residents ) . similarly , the acmge of the united states indicates that it is essential that educational objectives of educational programs be distributed and studied by residents before the start of their rotations . in contrast , in its second edition of the general requirements for accreditation of training centers , the schs in saudi arabia made no mention of any required standard for these goals and educational objectives . instead , this task is informally delegated to the scientific councils of the residency training programs within each specialization . indeed , it appeared that most of these councils state specific goals and objectives in their published booklets for use in their respective specialization training programs . each specialization focuses on its own program , and the councils do not require that these goals be distributed and studied by medical residents , which may explain the gap that we found in our study . feedback , whether formative or summative , is an essential educational method that guides and enhances each resident 's performance . its importance and its impact on learning is strongly advocated and promoted in medical educational literature . a majority ( 65% ) of the off - service residents in our study this may be the result of a lack of standards or the nature of the curriculum and/or training of the educators involved . the residents satisfaction scores on the various aspects of the off - service curriculum are particularly suboptimal for surgical rotations compared to emergency medicine ( p value 0.03 ) . study that showed that most surgical residents in riyadh were dissatisfied with their on - service training programs . even the combined score in our study ( i.e. , the combined score of residents in intensive care , medical , surgical , and emergency medicine off - service rotations ) was less than 80% . these findings should arrest the attention of program directors , postgraduate medical education authorities , and schs since they suggest a potential for improvement in off - service clinical rotations curricula in saudi arabia . more than half of the residents surveyed felt that they were discriminated against in terms of duty scheduling and service obligations in their off - service rotations . a majority felt that their learning abilities and clinical education had been compromised because of trainees , who were part of the off - service specialization programs and because of excessive service obligations . the royal college of physicians and surgeon of canada ( rcpsc ) addresses the conflict between residents service obligations and their overall education in its white paper series , and concludes that this issue is specialization - specific and emphasizes the meeting of training objectives . there should be a balance so that the learning ability and education of off - service residents is not compromised , especially when staff and on - service residents also need supervision and training . despite these outstanding issues , we found that the vast majority of residents believed that their off - service rotations were beneficial toward the achievement of their ultimate goals and objectives in their primary specialization programs . furthermore , they were , on the whole , satisfied with their educational experiences in their off - service clinical rotations . the results of factor analysis provide empirical evidence of the construct validity of the questionnaire that was developed and used in this study . the questionnaire might also be used with caution for different off - service rotations at other institutions . there are significant weaknesses in the current off - service clinical rotations curricula in kfngh.most residents are satisfied with their off - service clinical rotation educational experiences at kfngh and feel that these experiences are useful for their training in their primary specializations . there are significant weaknesses in the current off - service clinical rotations curricula in kfngh . most residents are satisfied with their off - service clinical rotation educational experiences at kfngh and feel that these experiences are useful for their training in their primary specializations . it is necessary for the organization and planning of off - service clinical rotations to be based on clear statements of the goals and educational objectives of the rotations.program directors and post - graduate medical education authorities can use our data as a baseline for quality improvements in other off - service rotations.we suggest the potential of a multi - center study , with a larger sample and a mixed - method study design to obtain an in - depth understanding of off - service clinical rotations.the questionnaire also needs to be tested with other residents and in other rotations . it is necessary for the organization and planning of off - service clinical rotations to be based on clear statements of the goals and educational objectives of the rotations . program directors and post - graduate medical education authorities can use our data as a baseline for quality improvements in other off - service rotations . we suggest the potential of a multi - center study , with a larger sample and a mixed - method study design to obtain an in - depth understanding of off - service clinical rotations . because these results derive from a single institution and from only 80 respondents , any generalization of the conclusions should be carried out with caution . our findings shed some light on the forgotten curriculum of off - service rotation . it is necessary for the organization and planning of off - service clinical rotations to be based on clear statements of the goals and educational objectives of the rotations.program directors and post - graduate medical education authorities can use our data as a baseline for quality improvements in other off - service rotations.we suggest the potential of a multi - center study , with a larger sample and a mixed - method study design to obtain an in - depth understanding of off - service clinical rotations.the questionnaire also needs to be tested with other residents and in other rotations . it is necessary for the organization and planning of off - service clinical rotations to be based on clear statements of the goals and educational objectives of the rotations . program directors and post - graduate medical education authorities can use our data as a baseline for quality improvements in other off - service rotations . we suggest the potential of a multi - center study , with a larger sample and a mixed - method study design to obtain an in - depth understanding of off - service clinical rotations . because these results derive from a single institution and from only 80 respondents , any generalization of the conclusions should be carried out with caution . our findings shed some light on the forgotten curriculum of off - service rotation .

the chinese american population is one of the most rapidly growing minorities in the united states [ 1 , 2 ] . according to the usa bureau of the census ( 2010 ) , the number of chinese americans increased 229% from 1.62 to 3.8 million from 1990 to 2010 . one - third of chinese americans ( 1.25 million ) reside in california , and the number of chinese americans with dementia is expected to more than triple in the next 30 years . however , few studies have focused on the screening for cognitive impairment among chinese - americans . linguistically and culturally appropriate cognitive screening tests to detect and stage cognitive impairment are needed to facilitate early detection and intervention . the lack of such instruments also limits the participation of chinese americans in cognitive and aging research . the montreal cognitive assessment ( moca ) is a brief cognitive screening test designed to distinguish individuals with mild cognitive impairment ( mci ) who perform in the normal range of the mini - mental state examination ( mmse ) from cognitively normal elderly . since chinese americans migrated primarily from mainland china , hong kong , macau , and taiwan , the chinese - speaking population in the usa consists of three major cultural subgroups whose primary dialect is mandarin [ putonghua ] , cantonese , or taiwanese . these three groups may use different words or expressions for some concepts and may differ in level of education . we therefore translated and adapted the moca for mandarin- , cantonese- , and taiwanese - speaking chinese americans with one common written version named the moca chinese los angeles version ( moca - chla ) . the moca - chla was administered to 1,192 chinese residents in monterey park , california , as part of a population - based study . the city of monterey park in los angeles county , the first suburban chinatown in the usa , has the highest percentage of chinese americans of any usa municipality , at 43.7% of its population ( 60,269 ) in 2010 . the goal of this study was to characterize the effects of preferred language , age , education , and gender on the performance of the moca - chla in this minority population . the moca was specifically developed as a screening tool for mild cognitive impairment and early dementia . compared to the mmse , it includes more memory items and assesses key aspects of executive function . the moca has 12 items that assess 6 cognitive domains including short - term memory , visuospatial construction , executive functions , attention and concentration , language , and temporal and spatial orientation ( table 1 ) . the moca is scored on a 30-point scale and takes about 10 minutes to administer and 1 minute to score . in the original study , the moca was administered to 277 english- or french - speaking canadians , aged 65 years or older , with mean education of 11.9 years ( averaged over normal , mci , and dementia groups ) . one point was added for persons with education of less than 12 years . in terms of identifying mci , a moca score of 26 showed a sensitivity of 90% and a specificity of 87% in the original study . later , a study in the uk found sensitivity of 83% and much lower specificity of 50% ; a korean study reported a sensitivity of 89% and a specificity of 84% ; a recent study in japan reported a sensitivity of 93% and a specificity of 87% in screening for mci . these studies all added 1 point for education < 12 years with the exception of the korean study , where 1 point adjustment was made for education < 6 years . as of april 2010 , the moca has been translated independently into mandarin , cantonese , and taiwanese versions ( http://www.mocatest.org/ ) . we carefully reviewed the instrument and instruction manual of the original moca in english , as well as the three chinese versions developed separately in beijing , hong kong , and taiwan . the written words in the three chinese versions are not identical and in some instances misinterpreted the intention of the original moca test item . for example , in the hong kong version , sentence repetition seems to assess articulation more than attention , as the subject is asked to repeat something like sasha age sixty six . in addition , all 3 chinese versions tend to follow a literal translation of the english instructions , such that the resulting chinese sentences sound unnatural and are difficult to comprehend , especially to individuals with little or no formal education . in developing the moca - chla , we attempted to maintain the neuropsychological intention of the original moca instrument . we incorporated appropriate parts of the existing chinese versions , made modifications of other parts , and ensured that the spoken instructions would be easily understood by mandarin , cantonese , and taiwanese - speakers . in the 5-word learning test , we changed face is a single character word in chinese that could mean the physical face or the social face . velvet can be either a 2-character or a 3-character word depending on the dialect , and could be unfamiliar to older and low - educated chinese . teacup , like church , daisy , and red are all unambiguous 2-character words in chinese and familiar to all . we changed the phonemic fluency task ( generating words beginning with letter f within 60 seconds ) to a semantic fluency task ( generating names of 4-legged animals ) because chinese is a monosyllabic language and each phoneme has multiple ambiguous meanings , which undermines the meaningfulness of phonemic fluency in chinese . generating animal names has shown good validity as a measure of verbal fluency among chinese elderly [ 11 , 12 ] . first , the moca - chla items were adapted jointly by a bilingual neuropsychologist ( elt ) and a bilingual epidemiologist ( lz ) . subsequently , they were back translated into english by a bilingual psychologist ( pl ) without knowledge of the original moca items . successive versions were reviewed for clarity by focus groups of native mandarin , cantonese , or taiwanese speakers in the lay community . wording was adjusted where necessary , and the process was repeated until the final moca - chla was considered by the two bilingual psychologists ( elt and pl ) to be linguistically and semantically equivalent to the original moca , unambiguous , and easily comprehensible . the final version of moca - chla items is shown in figure s1 , see supplementary materials online at doi:10.1155/2012/204623 . an instruction manual for the administration and scoring of the moca - chla was developed and used to train 15 mandarin , cantonese , or taiwanese - speaking interviewers . subtle flaws in the manual were corrected after feedback and field testing of 178 subjects . subsequently , all interviewers underwent rigorous rater training : received a copy of the final record form ( figure s1 ) and manual to study , participated in two in - person training sessions , and passed a 12-item multiple - choice quiz on the administration and scoring of the moca - chla , before starting formal field testing . the moca - chla was administered as part of the chinese american eye study ( ches ) during an in - home interview . the ches is a population - based study designed to estimate the prevalence of visual impairment and major eye diseases among chinese americans aged at least 50 years residing in 9 census tracts in monterey park , los angeles county . we interviewed 2,837 eligible participants at home as of october 18 , 2011 ( figure 1 ) . of these , 764 refused moca - chla screening , 274 could not be tested due to self - reported decreased hearing , and 441 could not be tested due to self - reported vision problems . among 1,358 persons tested with the moca - chla , all participants were tested in their preferred language ; 575 were tested in cantonese , 612 in mandarin , 5 in taiwanese , 4 in vietnamese , and 44 in english . the latter two subgroups were excluded , resulting in a total of 1,192 participants in our analyses . the median education of 12 years was used to divide the sample into high-(1220 years ) and low-(111 years ) education groups . the low - education group was further subdivided into mid - low ( 711 years ) and low - low ( 16 years ) groups . the median age of 60 years was used to divide the sample into middle - age ( 5059 years ) and older age ( 60100 years ) groups . the older age group was further subdivided into young - old ( 6074 years ) and old - old ( 75100 years ) groups . the definition of these subgroups is somewhat arbitrary ; however , these divisions allow sufficient sample size in each category and are comparable with groupings reported in the literature . the moca - chla total score equals the sum of all its subitems unadjusted for years of education . the distribution of the moca - chla total score and demographic variables was examined and nonparametric analyses were performed where appropriate . demographic characteristics , moca - chla total score , and subitem scores were compared between the cantonese- and mandarin - speaking groups among the 3 education groups ( 16 , 711 , and 1220 years ) and among the 3 age groups ( 5059 , 6074 , 75100 years ) using wilcoxon rank sum tests and chi - square tests . due to very small sample size ( n = 5 ) , individuals who preferred to be tested in taiwanese were not included as a separate dialect comparison group . cronbach 's coefficient alpha was used to estimate the internal consistency of the moca - chla for the total sample and for the mandarin - speaking and the cantonese - speaking subgroups separately . nonparametric analysis of covariance ( rank ancova ) was used to compare moca - chla total score and its sub - item scores between the two dialect groups adjusting for age and education ( gender was not included as a covariate as the gender distribution did not differ between the 2 dialect groups ) . in order to clarify the relationships between moca - chla score and age , education , and gender , rank ancova was performed to compare moca - chla total score ( 1 ) among the 3 education groups controlling for age , gender , and testing dialect ; ( 2 ) among the 3 age groups controlling for education , gender , and testing dialect ; ( 3 ) between men and women controlling for age and education ( testing language was not included as a covariate as it did not differ between men and women ) . for each education group , we determined the 15th percentile of the moca - chla score in the middle - age group ( mp15 ) to explore how age relates to possible cognitive impairment . the mp15 scores were 18 in the low - low ( 16 years ) , 20 in the mid - low ( 711 years ) , and 22 in the high-(1220 years ) education groups . the cochran - mantel - haenszel test was used to test whether the percent of participants at or below mp15 score differs as a function of advancing age controlling for level of education . item response theory ( irt ) methods were used to evaluate the test characteristic curves ( tccs ) and test information curves ( tics ) of the moca chla total score and 6 cognitive domain scores ( table 1 shows items comprising each domain ) . . it can be a very useful tool for evaluating the range of measurement and the degree of discrimination at different points of the ability continuum . in addition , the degree to which the tcc is linear provides an indication of the extent to which the measure provides interval scale or linear measurement . a tic relates latent ability in sd unit to the information ( precision of measurement ) for the total or domain scores . the information on the y - axis is the reciprocal of the variance of measurement . the tic provides a means to ascertain what range of ability levels a test is optimally suited to measure . a graded response model was implemented using the r package ltm ( http://www.r-project.org/ ) . all statistical testing except irt analysis was performed at a two - sided 5% level of significance and used statistical analysis system version 9.2 software ( sas institute , cary , nc , usa ) . we administered the moca - chla to 1,192 ( 61.6% female ) chinese americans living in the city of monterey park , los angeles county , california . their mean age at testing was 62.5 years ( median 60 years , range 50 to 100 years ) and mean level of education was 11.6 years ( median 12 years , range 1 to 20 years ) . their mean moca - chla score was 23.8 ( sd 4.2 , median 25 , range 6 to 30 ) . the 5th , 50th , and 95th percentiles were 16 , 25 , and 29 , respectively , ( figure 2 ) . compared to cantonese - speaking participants , mandarin - speaking participants on average were 3 years older , had 3 more years of education , and had 1 point higher moca - chla scores ( table 2 ) . after adjustment for age and education , the two dialect groups did not differ in moca - chla total and item scores , except on sentence repetition , where mandarin speakers scored significantly better . 64.1% of mandarin ( versus 49.6% of cantonese speakers ) received a full score on sentence repetition ( p = 0.003 ) ( data not shown ) . the cronbach 's coefficient alpha of moca - chla as an index of internal consistency was 0.79 , 0.78 , and 0.79 , respectively , for the whole sample ( n = 1,192 ) and for the mandarin ( n = 612 ) and cantonese ( n = 575 ) speakers . in the total sample , the standardized scores of cronbach 's coefficient alpha ranged from 0.77 to 0.79 for all 12 items of the moca - chla . females were disproportionately represented in the low - low education group : 72% , 61% , 59% in the low - low- , mid - low- , and high - education groups , respectively ( p = 0.01 ) ( table 3 ) . the low - low education group was significantly older than the higher education groups ( p = 0.01 ) . significantly more participants ( 75.3% ) were tested in cantonese in the low - low education group while more participants ( 61.9% ) were tested in mandarin in the high - education group ( p < 0.0001 ) . lower education levels were associated with lower moca - chla scores after adjustment for age , gender , and testing dialect ( p < 0.0001 ) . the 25th , 50th , and 75th percentiles for moca - chla scores are shown by the 3 education and the 3 age groups to mitigate ceiling effects ( figure 3 ) . the distribution of the ranks of moca - chla score varied significantly across the 3 education groups after controlling for age ( p < 0.0001 from the friedman 's chi - square test ) . a comparison between the middle - age ( 5059 ) group and old - old ( 75100 ) group shows that , for the p25 scores , there were approximately 4 , 4 , and 6 points of difference for the high- , middle - low- , and low - low - education groups . the corresponding numbers for the p50 scores were 3 , 2 , 6 , and those for the p75 scores were 2 , 3 , and 1 . in other words , in general age - related differences were greatest for the p25 scores , less so for the p50 scores , and least for the p75 scores . even for the low - low - education group age - related differences in p25 and p50 score were prominent but minimal for the p75 score . females were disproportionately represented in the middle - age group : 65.8% , 60.0% , and 49.6% in the middle - age , young - old , and old - old age groups , respectively ( p = 0.001 ) ( table 4 ) . advanced age was associated with higher education with borderline significance ( p = 0.06 ) . significantly more participants ( 70.2% ) were tested in mandarin in the old - old group than the other 2 age groups ( 48.5% in the middle - age group , 49.3% in the young - old group ) ( p < 0.0001 ) . advanced age was significantly associated with lower moca - chla scores with or without adjustment for education , gender , and testing dialect ( p < 0.0001 ) . the percentage of participants who were at or below the mp15 score increased with age , especially among the young - old and old - old groups across all three education groups ( figure 4 ) . in each education group therefore the percentage of participants who were at or below the mp15 score in each education group was greater than 15% . the association between mp15 and age remained strong after adjusting for education ( p < 0.0001 from the cochran - mantel - haenszel test ) . men were on average 2 years older and had 1 more year of education than women ( table 5 ) . fifty percent of women versus 53.5% men were tested in mandarin ( p = 0.39 ) . the mean moca - chla score did not differ between men and women ( p = 0.52 ) . the association remained nonsignificant after adjustment for age and education ( p = 0.59 ) . tccs for the moca chla score in the total sample , cantonese- , and mandarin - speaking groups are shown in figure 5 . these curves relate latent ability / cognitive function in sd units to the expected total score . the moca - chla test demonstrated similar measurement properties in the total sample and the 2 testing dialect groups . a 2-sd change in ability from 3 to 1 corresponded to an approximate 3 point loss in moca - chla score , while a 2-sd change in ability from 3 to 1 corresponded to an approximate 10 point loss in moca - chla score . this indicated very little floor effect and some ceiling effect of the moca - chla . the tics relate latent ability in sd unit to the precision of measurement for domain scores . the tic of the moca chla for the total sample peaked around 1 , indicating that the moca chla mainly provides information for respondents with low to average ability ( 4 to 1 ) . similar patterns of discrimination ability and measurement precision were observed for the 2 testing dialect groups . the tccs relate latent ability in sd units to the expected total domain score ( % of maximum score , for comparability across domains ) . the temporal and spatial orientation domains , attention and concentration domains , and the language domain showed lower discrimination and some ceiling effect in the ability range of 1 to 3 . the executive function and memory domains demonstrated high - discrimination ability for the ability range of 2 to 2 . similar patterns of domain discrimination were observed among the total sample and the 2 testing dialect groups ( figures not shown ) . tics for the 6 cognitive domain scores are shown in figure 7 . the level of information provided by each of the 6 domains varied , with the executive function domain providing the highest precision . the tics for the executive function domain and the memory domain peaked in the ability range of 2 to 2 . for the language domain and the visual spatial domain , most test information was contained in the ability range of 3 to 1 . the attention domain and we administered the moca - chla to 1,192 ( 61.6% female ) chinese - speaking community residents in monterey park , los angeles county , california . the moca - chla had small ceiling effect and no floor effect and good internal consistency regardless of whether the participants spoke mandarin or cantonese . similar to other cognitive screening instruments , the moca - chla score increased with more years of education , decreased with age , and was not related to gender . compared to the education 16 years group , the mean moca - chla score was 2.6 and 4.6 higher in the education 711 and 1220 years groups , respectively . we did not interview a collateral informant regarding possible dementia or cognitive decline and could not determine whether prevalence of dementia might have differed by educational group . therefore , it would be premature to recommend adjustments in the moca score based on level of education , especially in the old - old groups . compared to other cognitive domain scores , irt analysis showed that the executive function domain demonstrated the best discriminating power and precision in measurement for participants in the cognitive function range of 2sd . these properties support the moca - chla as a useful screening tool , with appropriate adjustments for education level , for studies of aging and dementia among individuals speaking the two major chinese dialects of mandarin and cantonese . a major strength of our study is the large sample size of cantonese or mandarin speakers that were tested using one common written version moca - chla . nunnally and berstein suggested 0.70 as an acceptable value for the cronbach 's coefficient alpha . in our study , the moca - chla total score , as well as all the subitems score , demonstrated reasonable internal consistency . this is one of the first studies to demonstrate comparability of a cognitive impairment screening tool in these two dialects . significantly more participants ( 75.3% ) were tested in cantonese in the low - low - education group while more participants ( 61.9% ) were tested in mandarin in the high - education group ( p < 0.0001 ) , which may reflect historically earlier immigration of blue collar workers from canton province in southern china . although the mandarin speakers scored several points higher than the cantonese speakers , these differences were no longer significant after correcting for education . there may be two likely reasons for the small number ( n = 5 ) of participants who expressed a preference to be tested in taiwanese : ( 1 ) in the 20th century , the population living in taiwan comprised 2 major groups : mainlanders who migrated from mainland china to taiwan in 1949 and native taiwanese . in the 1970s and 1980s , the majority of immigrants from taiwan who settled in monterey park were mainlander chinese [ 6 , 19 ] , whose mother language is mandarin rather than taiwanese dialect . ( 2 ) since 1949 , mandarin has been the language taught in all schools and used as the official language throughout taiwan ; native taiwanese may prefer mandarin when taking a test even if they use taiwanese dialect in their daily lives . another strength of our study is a sizable number of participants with less than 12 years of education ( n = 181 for 16 years of education , n = 282 for 711 years of education ) . the effects of age and education are in the expected directions , as we observed higher moca - chla scores among younger and higher educated participants . our data indicate that education is a more potent variable than age in predicting the performance on moca - chla . after adjusting for age , the mean moca - chla scores were , respectively , 2.0 and 4.6 points lower in the mid - low-(711 years ) and low - low-(16 years ) education groups in comparison to that of the high - education ( 1220 years ) group ( table 3 ) . earlier studies have shown that , for cognitive screening tests , the effect of education on test score is greatest at the low end of the education spectrum . our recommendations of adding 2 points for persons with 711 years of education and 5 points for 16 years of education are significantly larger than the 1 point addition recommended in the original moca publication for persons with less than 12 years of education . in the latter study , the sample size was modest ( n = 277 ) , and the proportion of participants with less than 6 years of education was not specified . caution should be exercised in adopting the same rule in other studies . in epidemiologic studies where a significant proportion of participants are poorly educated , the prevalence of cognitive impairment may be overestimated by following the limited education adjustment recommended by the original moca paper . for example , in a korean study , more than 50% of the participants completed 6 years of education or less , but only 1 point was added to the moca score for this education group . we found a significant association between moca - chla and age after controlling for the level of education . moreover , scoring at or below the 15th percentile of the middle - age group , used as a surrogate marker for cognitive impairment , was most prevalent in participants aged 75 or older with less than 7 years of formal schooling ( figure 4 ) . the significance of these findings in this cross - sectional study is not clear and could result from several factors : ( 1 ) low - education is a vulnerability factor for normal cognitive aging , ( 2 ) low education is an independent risk factor for mci or dementia , or ( 3 ) birth cohort effect may differentially affect the old - old group . this is not surprising , given the cultural deemphasis on education of women in china prior to the second half of the 20th century . men were on average 2 years older and had 1 more year of education than women . gender did not affect moca - chla score before and after controlling for age and education . irt analysis suggested that the executive function domain had the best discriminating power and highest precision in measurement for participants in the cognitive function range of 2sd . the memory domain also demonstrated high - discrimination ability although the level of precision is not as high as the executive domain . the executive function domain included the items of alternating trail making , generation of animal names , and verbal abstraction / similarities . our finding supported the moca - chla in screening both executive and memory dysfunction in chinese speaking cantonese or mandarin . these domains are particularly important when screening for cognitive impairment related to cerebrovascular and alzheimer diseases . although the moca - chla was administered by trained interviewers , data from a collateral informant regarding the participants ' cognitive , affective , and physical conditions or functional decline were not obtained . further characterization of the sample will be needed to ( 1 ) provide normative data , ( 2 ) identify cases of mci and dementia , ( 3 ) determine cut points for optimal sensitivity and specificity for the diagnosis of mci , ( 4 ) refine adjustment scores for individuals with low education , and ( 5 ) verify the hypotheses regarding age - related cognitive decline .

white matter hyperintensities ( wmh ) are a common sign of cerebrovascular disease visible on brain imaging in older people ( o'sullivan , 2008 ) . wmh contribute substantially to loss of independence at older ages through a 3-fold increased risk of stroke and a 2-fold increased risk of dementia ( debette and markus , 2010 ) ; in addition , wmh accelerate aging - related cognitive decline ( debette and markus , 2010 ; o'sullivan , 2008 ; schmidt et al . , 2007 ) . although previously regarded as clinically silent , wmh are now recognized to be associated with subtle neurological symptoms ( haley et al . , 2009 ) and subjective awareness of cognitive decline ( silbert et al . , 2009 ) . it is generally considered that the cognitive impairment seen with wmh ( almkvist et al . , 1992 ) childhood intelligence is the strongest predictor of late - life cognitive ability ( deary et al . , 2003 ) and may protect against the effects of cognitive aging ( stern , 2009 ) . higher childhood intelligence is also associated with many health outcomes across the life course , including a lower risk of vascular dementia ( deary et al . , 2009 , 2010b ) . similarly , higher educational attainment is also associated with decreased incidence of dementia ( dufouil et al . , 2003 ) , an association that is as yet unexplained . early - life cognitive ability might therefore influence the risk of developing cerebrovascular disease including wmh . many longitudinal studies show that wmh progression is associated with worsening cognition at older ages and that wmh progression is worst in those with more wmh at inception ( bartres - faz et al . , 2001 ; debette and markus , 2010 ; schmidt et al . , 2007 ) ( we summarize other longitudinal studies not included in those reviews in supplementary table 1 ) . most studies adjusted for educational level and other confounds ( bartres - faz et al . , 2001 ; schmidt et al . , 2007 ) ( supplementary table 1 ) , but most did not examine whether prior cognitive ability or educational level modified the longitudinal wmh cognition association or was associated with cross - sectional wmh burden . in 1 study of 800 individuals , the association between wmh and impaired cognition in older age was strongest in those with lower educational level ( dufouil et al . , 2003 ) . in another study , increased duration of education was associated with less executive dysfunction , but not with wmh severity , in 475 patients with stroke ( ojala - oksala et al . , 2012 ) ; however , this study may have been underpowered to detect any education wmh burden association . a few studies of wmh and cognition were able to control for prior cognitive ability using a validated mental test obtained in youth ( deary et al . , 2003 ) , but these were modestly powered , given the expected effect sizes ( e.g. , about 100 individuals of nearly 80 years of age ( deary et al . 2012 ) , or 233 to 249 participants nearly 70 years of age ( murray et al . , 2011 , 2012 ) and did not consider the effect of stroke . although these showed an important association between iq at age 11 years and late - life cognitive ability , along with the well - documented association between wmh and late - life cognitive decline , they did not find ( and were probably underpowered to do so ) an association between age 11 iq and wmh or other factors that might explain why lower childhood intelligence may increase the risk of vascular dementia ( deary et al . , 2010b ) . we hypothesized that childhood iq would account not just for much of cognitive ability in older age , but would explain some of the apparent cross - sectional wmh cognitive ability association in later life , and that lower childhood iq would be associated with increased wmh . we used both qualitative ( visual scores ) and quantitative ( wmh volume ) indicators of white matter damage , examined 3 key cognitive domains , and used a large , narrow - age cohort to minimise the powerful effect of age on progressing vascular disease . the lbc1936 are community - dwelling surviving members of the scottish mental survey of 1947 , who were all born in 1936 and sat the moray house test no . most were resident in edinburgh and the surrounding lothians when initially recruited at a mean age of 70 years ( deary et al . , 2007 ) . here , we use data from the second wave of testing ( mean age = 72.7 years , sd = 0.7 years ) , at which time 700 participants underwent brain structural magnetic resonance imaging ( mri ) . of the 700 , 672 had all relevant sequences to assess wmh volumes ( detailed below ) ( wardlaw et al . , 2011 ) . participants with mini mental state examination scores < 24 were excluded as scores below this level are commonly taken to be indicative of possible pathological cognitive impairment . the current analyses ( see below ) required complete data for all covariates , resulting in a final sample of 634 adults ( men , n = 337 , 53.2% ) . written informed consent was obtained from all participants under protocols approved by the lothian ( rec 07/mre00/58 ) and scottish multicentre ( mrec/01/0/56 ) research ethics committees . the participants provided their history of hypertension , diabetes , hypercholesterolemia ( in each case , a medical diagnosis or current medication for these conditions ) , smoking status ( which we classified as current / former smoker or never smoked ) and of vascular disease including medically confirmed myocardial infarction and of stroke . details were checked with the study medical advisor and family doctor or hospital records where necessary . details of the full lbc 1936 assessment protocol have been published ( deary et al . all mri data were acquired using a 1.5 t ge signa horizon hdxt clinical scanner ( general electric , milwaukee , wi ) operating in research mode and using a self - shielding gradient set with maximum gradient of 33 mt / m , and an 8-channel phased - array head coil . we acquired t1-weighted , t2-weighted , fluid - attenuated inversion recovery ( flair ) and t2 * axial structural sequences , the full details of which have been published previously ( wardlaw et al . , 2011 ) but are provided in supplementary table 2 . all analyses were performed with the analysts blinded to cognitive and all clinical data , and , along with the validation , are described in detail in supplementary table 2 . we defined wmh as the collective term for punctate or diffuse areas in the white matter and deep gray matter of the cerebral hemispheres or in the brainstem that were 3 mm or larger in diameter and hyperintense with respect to normal - appearing white and gray matter on t2-weighted and flair images ; some hypointensity on t1-weighted mri was allowed , as long as this was not as hypointense as cerebrospinal fluid ( csf ) . we appreciate that not all would agree with including deep gray and white matter hyperintensities in the term wmh , but we are simply using it as an operational term in this instance . we defined infarcts as cortical or large subcortical areas of hyperintensity on t2-weighted or flair , consistent with cerebromalacea and in a vascular distribution . areas of tissue loss and replacement by csf due to infarcts ( including lacunes ) were also included in the stroke lesion volume . where stroke lesions were occasionally contiguous with wml , the boundary between the 2 was determined by evaluation of the wml and underlying anatomy in the contralateral hemisphere and neuroradiological knowledge . we co - registered each subject 's structural mri scans using flirt ( http://www.fmrib.ox.ac.uk/fsl ) and measured intracranial volume ( icv ) , total brain tissue volume , cerebrospinal fluid ( csf ) volume , and wmh volume using a validated semi - automated image processing tool , mcmxxxvi ( available for download at http://sourceforge.net/projects/bric1936/ ) , which implements multispectral color fusion and minimum variance quantization ( valdes hernandez et al . , 2010 ) and performs at least as well as other multispectral methods ( valdes hernandez et al . , 2012a ) . mcmxxxvi maps 2 or more different mri sequences ( e.g. , flair and t2 * ) that display the tissues / lesions at different signal intensity levels to the red / green / blue ( rgb ) color space . it then reduces the color levels of the fused image to 32 clusters using minimum variance quantisation . to segment the wmh , the t2 * -weighted sequence was mapped to the red and flair was mapped to the green color space . the subarachnoid space and ventricles appear in red and wmh and any cortical or other discrete hyperintense infarcts appear in yellow . we also identified and masked separately any visible cortical , cerebellar , or subcortical infarcts or lacunes to exclude them from erroneously influencing the wmh or csf volumes . neuroradiological experts identified these infarcts according to established diagnostic criteria as wedge - shaped or rounded lesions , conforming to a vascular territory , with tissue atrophy and signal characteristics consistent with malacic change . infarcts , defined as above , were separated from wmh manually by thresholding the flair sequences using a region - growing algorithm from analyze 10.0 ( http://www.analyzedirect.com/analyze/ ) . three different wmh volume measures ( wmh volume , percentage of wmh volume in icv , and percentage of wmh volume in brain tissue volume ) all correlated very highly ( 0.99 to 1.00 ) , so we used only the percentage of wmh in icv in the statistical analysis . separately , and blinded to all other data , an expert neuroradiologist provided a wmh visual fazekas score in periventricular and subcortical areas ( fazekas et al . , full descriptions of the cognitive testing have been published ( deary et al . , 2007 ) . we used 14 subtest scores from 12 cognitive ability tests covering domains of cognitive ability that display differential patterns of age - related decline . general cognitive ability ( abbreviated as g ) was measured using 6 subtests of the wechsler adult intelligence scale iii ( wechsler , 1997a ) ( wais - iii ) , namely digit symbol , symbol search , digit span backwards , letter number sequencing , block design , and matrix reasoning . here we explicitly define g based on non - verbal cognitive test scores because tests of more fluid reasoning abilities have been shown to show greater declines in aging ( salthouse , 2009 ) . we acknowledge that some fluid reasoning tests may contain verbal content ; however , knowledge and verbal abilities , such as vocabulary , are largely sustained in healthy aging ( salthouse , 2009 ) . as our primary aim was to produce cognitive scores sensitive to age - related decline , and for consistency , we elected to exclude verbal tests from our definition of g. general memory ability ( g - memory ) , was measured using 5 subtest scores from the wechsler memory scale iii ( wechsler , 1997b ) ( wms - iii ) , namely logical memory immediate and delayed recall , verbal paired associates immediate and delayed recall , and spatial span . we note that this measure of g - memory does not include subscales that primarily test episodic memory . finally , general processing speed ( g - speed ) , was measured using simple and choice reaction time means , a visual processing speed task called inspection time ( deary et al . , 2007 ) , and 2 wais - iii subtests ( digit symbol and symbol search ) . a number of the cognitive subtests are used to identify more than 1 cognitive latent variable . in estimating latent constructs of cognitive ability , the use of a greater number of indicators in generally preferred ; hence our decision to use subtests with substantive overlap as indicators in multiple models . for example , digit symbol coding is a test of information processing speed , and thus contains elements of both reasoning ( here our g factor ) and processing speed ( g - speed ) . g correlated at 0.81 ( p < 0.001 ) with g - memory and 0.49 ( p < 0.001 ) with g - speed when subtests were loaded on more than 1 factor . these correlations were 0.81 ( p < 0.001 ) and 0.89 ( p < 0.001 ) respectively , when the model was re - estimated with non - overlapping tests . , we used the iq - type score computed from the raw age 11 mht scores . this paper - and - pencil test was administered in 1947 as part of the scottish mental survey when participants were a mean age of 11 years . it contains a variety of items with an emphasis on verbal reasoning , and also some items that involve non - verbal reasoning and arithmetic ( deary et al . , 2007 ) . all models were estimated using structural equation modeling ( sem ) in mplus 6.0 ( muthn and muthn , 2010 ) . a full description of basic sem is given in supplementary table 3 ( see also penke and deary , 2010 ) . briefly , sem combines factor analysis and regression to model latent variables and the correlations and directed or regression paths between latent variables . in the current study , we estimated a latent wmh factor with 3 indicators , volume of wmh as a percentage of icv and fazekas ratings in the periventricular and subcortical areas . cognitive ability factors were indicated by the sets of subtests noted above . in each model , latent factors were identified by fixing the latent factor variance to 1.0 . we included direct paths between wmh and each cognitive ability factor to assess the extent to which wmh predicts later life ability . in addition , we included direct paths from age 11 iq and the model covariates to both wmh and cognitive ability latent factors . as such , any associations between wmh and cognitive ability are present after controlling for variance associated with prior ability and the other model covariates . all models were estimated based on the whole sample and also as multi - group models , split by participants ' stroke status . participants who had any prior history of stroke or radiologically identified cortical or subcortical infarct or lacune , or both , were categorized as stroke and those who did not have any of these as no stroke . the use of multi - group sem models allows for formal tests for any differences in the strength of associations between variables across groups ( see supplementary table 3 ) . if measurement invariance is established across groups , then the latent constructs can be considered identical , and meaningful comparisons across groups can be made ( french and finch , 2006 ; widaman , 1993 ) . measurement invariance of latent constructs can be assessed at multiple levels , each providing a sequentially stricter test of invariant measurement ( widaman and reise , 1997 ) configual invariance requires the pattern of factor loadings to be the same across groups . scalar invariance requires the intercepts of the indicators to be the same across groups . here our interest was in metric invariance , because when metric invariance is established , correlation and direct paths between latent constructs can be investigated across groups . here we considered whether the cognitive ability wmh associations differed by stroke status , and also whether the effects of age 11 iq and model covariates differed across these groups . differences in parameters were tested by constraining the parameter to be equal across groups and considering the change if statistic based on a single degree of freedom . model fit was evaluated based on commonly adopted cut - off points of 0.05 for the standardized root mean residual , 0.06 for the root mean square error of approximation , and 0.95 for the tucker lewis index , and the comparative fit index ( schermelleh - engel et al . , 2003 ) . the participants were a median age of 72.7 years ( range , 71.074.2 years ) at mr imaging ( cognitive testing was performed no more than a few weeks before mr imaging ) ( table 1 ) . approximately half of the participants had hypertension ( 49% ) or hypercholesterolemia ( 42% ) . lower proportions of individuals had diabetes ( 10% ) or any cardiovascular disease ( 170 , 27% ) including 135 ( 21% ) with ischemic heart disease alone ; 43 participants reported having had a stroke ( of whom 19 also had a focal cortical , cerebellar , or distinct subcortical stroke lesion on imaging ) , and an additional 70 had imaging - only evidence of a focal cortical , cerebellar , or discrete subcortical stroke lesion , giving a total with any stroke of 113 ( 18% ) . median wmh volume for the whole group was 7.7 ml ( range 098.4 ml ) or median of 0.53% of icv . wmh volume in the 113 participants with history and/or radiological evidence of stroke was larger than that in the 521 participants without stroke ( median 15.3 ml vs. 7.2 ml , respectively , p < 0.001 , mann whitney u test . ) . all non - categorical variables were approximately normally distributed , with skew ranging from 1.27 to 1.70 . for fullness of reporting , the bivariate correlations between the three measures of wmh and the 14 cognitive ability subtest scores are presented in supplementary table 4 . correlations among the vascular risk factors ( hypercholesterolemia , diabetes , hypertension , and smoking history ) and cardiovascular disease or stroke , wmh variables , and cognitive ability test results are shown in supplementary table 5 . the factor loadings for the latent variables were moderate to large ( the g cognitive tests ' loadings range from 0.49 to 0.67 , mean = 0.61 ; the g - memory tests ' range was 0.45 to 0.69 , mean = 0.56 ; the g - speed tests ' range was 0.32 to 0.84 , mean = 0.62 ; the wmh volume indicators ' range was 0.70 to 0.94 , mean 0.79 ) . these values show that the latent variables , g , g - memory , and g - speed , account for between 20% and 84% of variance in the individual cognitive ability subtests ( figs . 13 show the final results for g , g - memory , and g - speed , respectively . age 11 iq explained the greatest proportion of variance in late - life cognitive ability in all models , ranging from approximately 24.0% to 45.1% . over and above the effect of age 11 iq , wmhs were associated significantly in older age with g ( = 0.14 , p < 0.01 ) and g - speed ( = 0.19 , p < 0.001 ) which accounted for approximately 2.6 and 4.4% of additional variance respectively . there was no significant association between wmh and g - memory ( = 0.05 , p = 0.23 ) . given the similarity in the effect sizes for the g and g - speed models , as well as the magnitude of the correlations between the latent factors , we tested the whether each of the latent constructs acted as a mediator for the other with respect to the association with wmh . as may be expected , the inclusion of g - speed as a mediator of the wmh to g association , and of g in the wmh to g - speed association , resulted in the wmh direct effects falling to 0.01 ( p > 0.05 ) . multi - group sem testing examined the associations across those with and without evidence of stroke ( see supplementary data s2 for procedure and s4 for invariance results ) . we found evidence based on model fit indices for measurement invariance across the stroke and no stroke groups for each of the latent constructs in our models . as such , the latent constructs can be considered to be equivalent across groups , and any differences in structural parameter estimates are not a result of measurement bias . no significant differences were found across the stroke and no stroke groups in the associations between wmh and later life cognitive abilities . however , in 2 of the 3 models ( fig . 1 [ g ] and fig . 2 [ g - memory ] ) , the association between age 11 iq and wmh was significantly different between the stroke and no stroke groups ( difference test , stroke = 0.24 ; no stroke = 0.03 ; = 4.18 , df = 1 , p < 0.05 ) , indicating that the association between lower age 11 iq and more wmh at age 73 years was stronger in those with stroke . the pattern of covariate associations with wmh suggested that those with a history of hypertension , with lower age 11 iq , who were older ( even within this narrow age range ) , and female , had more wmh . furthermore , hypertension , age , and sex all had significant effects on g ; sex and age both had significant effects on g - memory ; and only age was a significant covariate for g - speed . these covariate effects accounted for approximately 1% to 2% of the variance in later life cognitive ability scores . re - estimating all models by including cardiovascular disease and stroke , diabetes , smoking history , and cholesterol as additional covariates did not attenuate the associations between wmh and cognition , with any changes being at the second decimal place . the only significant difference was a small additional negative effect of smoking on all 3 cognitive traits . to investigate the effect of using a higher cut - off value for the mmse , we re - ran all models using a cut - off of 26 . of the 20 participants removed , 3 ( 2.6% ) were in the stroke group and 17 ( 3.3% ) in the no stroke group . changes in the direct effects of wmh on g ( 0.13 ) , g - speed ( 0.18 ) , and g - memory ( 0.04 ) were at the second decimal place . furthermore , the differences in these associations across the stroke and no stroke groups remained non - significant , as did the significant differences in the association between age 11 iq and wmh in the g and g - memory models . to our knowledge , the current study is the first that uses longitudinal measures of intelligence from childhood and older age within the same large sample of non - demented individuals , with qualitative and quantitative assessment of wmhs and key health covariates , to identify associations between early - life iq and wmh in later life , particularly among those participants with clinical or imaging evidence of stroke , and to quantify the incremental effect of wmh on reducing cognition in later life . early - life cognitive ability was the strongest single predictor of cognitive ability at about age 73 years . the incremental effect of wmh on reducing both general cognitive ability and processing speed but not memory in later life , after controlling for early - life cognitive ability and health covariates , was modest but relatively robust . wmh had a similarly negative effect on later life cognition in participants with and without stroke . this association was stronger in participants with any evidence of stroke who had almost double the volume of wmh compared with those without stroke , independent of vascular risk factors . the general pattern remained when the participants with mmse < 26 ( n = 20 ) were excluded . our finding warns against assuming that cognitive status in older age is due only to being older or having an aging - associated disease that may affect cognition , such as cerebrovascular disease or incipient dementia . the findings suggest that later - life cognitive decline , the accumulation of wmh and also of stroke may have some of their origins in youth , perhaps through factors that overlap with determinants of lifelong - stable differences in general cognitive ability ( deary et al . , 2010a ) . speculative reasons might include that lower intelligence might be associated with lifestyle choices that predispose to wmh and stroke ( deary et al . , 2010b ) , or because higher iq might be associated with greater resilience to brain insults , for example , through the intelligence white matter integrity association ( penke et al . , 2012 ) , or socioeconomic effects that are not simply acting through greater vascular risk factor exposure ( deans et al . , 2009 ) , or other , completely unknown factors . the finding is highly consistent with , and may provide an explanation for , the evidence from cognitive epidemiology research that finds childhood iq is associated with a range of adverse vascular disorders later in life , including vascular dementia ( deary et al . , 2010b ; stern , 2009 ) . this might also explain the association observed in other studies between educational level and late - life cognitive ability and dementia ( dufouil et al . , 2003 ) , in which educational level could be acting as a proxy for childhood iq . although the association between age 11 iq and wmh was modest , the fact that a significant association can be detected at all , across approximately 6 decades , suggests that it is important and worthy of further evaluation in other large population studies . it would also explain why other , smaller studies that did examine for educational level and wmh did not find this association . these results should not be construed as suggesting that studies on aging , cognition , vascular disease , and brain structure should require cognition measured in early life , but rather as suggesting that proxy measures of premorbid cognitive ability should be considered . this might include the national adult reading test , which provides a good estimate of childhood as well as of premorbid iq when measured in older age ( deary et al . , 2004 , 2007 ) ; or possibly the highest educational attainment or years of education ( collected in many previous studies of wmh ; supplementary table 1 ) could be used cautiously . future studies should consider the role of early - life cognitive ability in development of aging - related diseases , particularly cerebrovascular disease . childhood intelligence is a potential confounder of any examination of cognitive and brain aging ( deary et al . , 2010b ) . consistent with previous findings , the strongest contemporaneous associations were between wmh and g - speed ( gunning - dixon and raz , 2000 ; rabbitt et al . , 2007 ) . furthermore , in accordance with past research , hypertension ( de leeuw et al . , 2002 ) and smoking history ( benowitz , 2003 ; longstreth et al . , 2005 ) had the largest covariate effects on both wmh and g , but these were modest . across studies investigating the associations between wmh and cognitive ability in later life , varied findings may result from the method of wmh assessment ( qualitatively or quantitatively ) , the wide age range of participants ( where increasing wmh may reflect advancing age ; it should be noted that the effect of advancing age was significant even within this very narrow age range cohort ) , prior cognitive ability , the domains of cognition investigated across studies , and health status such as prior stroke ; not only do ischemic stroke lesions have signal properties that confound measurement of wmh volume ( wang et al . , 2012 ) , but stroke itself causes cognitive impairment ( pendlebury and rothwell , 2009 ) . the strengths of the current study included a large , age - homogenous sample ( about 3 times larger than those in other studies that have examined early and late - life cognition ) ( deary et al . , 2011 , 2012 ) ; use of validated cognitive assessment methods ( deary et al . , 2007 ; wardlaw et al . , 2011 ) ; use of both qualitative and quantitative wmh measures ( valdes hernandez et al . , 2012b ) ; and imaging methods that carefully exclude infarcts reducing contamination of wmh volume estimates . we demonstrated highly consistent associations using either type of wmh assessment ( supplementary data ) consistent with their known strong correlation ( valdes hernandez et al . , 2012b ) . methodologically , the large sample and large number of cognitive tests allowed us to apply structural equation modeling , allowing the creation of error - free latent variables for cognitive functions and wmh . as well as providing a framework within which measurement error is accounted for , and in which both substantive and covariate effects can be modeling simultaneously , we were able to apply a multi - group model and to explicitly test for differences in associations in participants with and without evidence of stroke . . additional research should consider other markers of small vessel disease and other markers of all types of stroke . second , we were reliant on participants ' self - reported medical histories for some study covariates , although these were checked with the medical advisor to the study . third , the substantial correlations between the latent factors and the results of the mediation models suggests that the effects seen in the g and g - speed models may not be entirely independent effects . nonetheless , the results still show a clear and robust effect of wmh on later - life cognitive function , but not on memory ability . finally , although the current sample has many strengths , it represents a somewhat select group in that , at entry into the study at age 70 years , participants were largely healthy and free of any major age - related disorders . for the current analyses , this can be seen in the comparatively low proportion of individuals who were hypertensive . as such , a question may be asked as to the degree our findings will generalize to other populations . however , given the selectiveness of the current sample in the upper portions of the health distribution , the estimates provided here are likely underestimates of the true association between wmh and aspects of cognitive function in the population , due to the impact of truncation on parameter estimates ( muthen , 1990 ) . in summary , here we show a novel association between early - life iq and wmh , a known important adverse risk factor for stroke and dementia ( debette and markus , 2010 ) . many studies of wmh , cognition and aging have collected information on duration of education or of educational attainment ( supplementary table 1 ) , which could be used cautiously as a proxy measure of cognitive ability in youth to explore for evidence of an association with occurrence of wmh and/or stroke in later life . the reason for this early - life cognition wmh association and its contribution to impaired cognition and cerebrovascular disease in older age is an important focus for further research .

the eye is an optical device that transmits and focuses light onto the neural retina ( fig . the retina , a 0.2-mm - thick central nervous tissue , is the first station of the visual system . in addition to acting as a light receiver , the retina carries out considerable image processing through circuits that involve five main classes of cells ( i.e. , photoreceptors , bipolar cells , amacrine cells , horizontal cells , and ganglion cells ; fig . these processes collectively amplify , extract , and compress signals to preserve relevant information before it gets transmitted to the midbrain and the thalamus through the optical nerves ( axons of the ganglion cells ; for review see baccus , 2007 ) . the retinal information received by the midbrain is processed to control eye movement , pupil size , and circadian photoentrainment ( huberman et al . , 2008 ) . only the retinal input that terminates at the lateral geniculate nucleus of the thalamus is processed for visual perception and gets sent to the visual cortex . there , information about shade , color , relative motion , and depth are all combined to result in one s visual experience . the visual sense organ . ( a ) diagrams of the eye ; an enlarged diagram of the fovea is shown in the box . retina forms the inner lining of the most of the posterior part of the eye . the rpe is sandwiched between the retina and choroids , a vascularized and pigmented connective tissue . r , rod ; c , cone ; b , bipolar cell ; h , horizontal cell ; a , amacrine cell ; g , ganglion cells ; m , mller cell . the nuclei of the photoreceptors constitute the outer nuclear layer ( onl ) . the nuclei of the bipolar cells , amacrine cells , horizontal cells , and mller glial cells are found in the inner nuclear layer ( inl ) , and the nuclei of ganglion cells form the ganglion cell layer ( gcl ) . the outer plexiform layer ( opl ) contains the processes and synaptic terminals of photoreceptors , horizontal cells , and bipolar cells . the inner plexiform layer ( ipl ) contains the processes and terminals of bipolar cells , amacrine cells , and ganglion cells . the processes of mller glial cells fill all space in the retina that is not occupied by neurons and blood vessels . reproduced from swaroop and zack ( 2002 ) , published by biomed central the nuclei and processes of the retinal cells are segregated into alternate , anatomically distinctive layers ( see legends in fig . photoreceptors lie in the outer part of the retina , the region farthest from incoming light . light passes through transparent inner retinal layers before it can be captured by the photoreceptor . though such an organization may seem counterintuitive , it allows the retinal pigment epithelial ( rpe ) cells that lie juxtaposed to the apical side of the photoreceptors to absorb scattered light or light unabsorbed by the photoreceptors . visual perception begins when the captured photon isomerizes the chromophore conjugated with the visual pigment in the photoreceptor cell . the photoexcited visual pigment then initiates a signal transduction cascade that amplifies the signal and leads to the closure of cation channels on the plasma membranes . as a result , the change in membrane potential is sensed by the synapses , which react by releasing fewer neurotransmitters ( see more in box 1 ; for review see yau and hardie , 2009 ) . this information is relayed to the bipolar cells , and subsequently , the ganglion cells via a forward pathway . this information is also modified by their lateral interactions with the interneurons - amacrine cells and horizontal cells . light initiates the isomerization of the 11-cis retinal , a chromophore covalently conjugated to rhodopsin embedded within the disc membranes . photoactivated rhodopsin activates the heterotrimeric g protein transducin by catalyzing the exchange of gdp for gtp . the dissociated -subunit of transducin then activates cgmp - phosphodiesterase , which rapidly hydrolyzes cytoplasmic cgmp . the decrease in cgmp concentration causes closure of cgmp - gated cation channels on the plasma membrane ( fig . , the cells are hyperpolarized and release less glutamate transmitters to their connected bipolar cells . in the recovery phase , photoactivated rhodopsin is desensitized by phosphorylation and arrestin binding . retinal guanylyl cyclase and guanylyl cyclase activator help to replenish cgmp levels in a ca - dependent manner . na / ca - k exchanger , which resides on the plasma membrane , regulates the ca homeostasis of the os ( molday , 1998 ) . all these components are highly integrated in close proximity on the disc membranes and/or adjacent plasma membranes for fast processing ( fig . photoisomerization converts 11-cis retinal to all trans - retinal , and finally to all - trans - retinol in the os . all - trans - retinol leaves rods and diffuses to the rpe , where it undergoes a series of enzymatic reactions to be converted back to 11-cis - retinal . 11-cis - retinal returns back to the os where it regenerates rhodopsin and completes the visual cycle ( lamb and pugh , 2004 ) . considerable progress has been made in characterizing all the major components of this visual cycle ; however , the cell biology of retinoid trafficking remains largely unknown . humans and other higher primates ( but not other mammals ) have foveas that are 700-m - diameter foci near the central retina . the fovea has the highest visual acuity in comparison with other parts of the retina due to several structural and compositional modifications of this region . for example , the cell bodies of the proximal retinal neurons have been shifted to the side , enabling light paths to enter photoreceptors with minimal distortion ( fig . the cone system has a higher resolution ; each fovea cone is connected to only one bipolar and one ganglion cell . in other areas of the retina , cones are named after their conically shaped light - sensing outer segments ( os ) . the os is a modified cilium , a light - sensing organelle in which phototransduction occurs . the cone os is commonly considered as a structure containing an orderly stack of membranous laminella that are continuous to the plasma membrane and form a highly convoluted surface membrane . electron micrographs depicting cone oss containing closed discs have also been observed ( de robertis and lasansky , 1958 ; dowling , 1965 ; cohen , 1970 ) . three cone pigments with maximal absorption for different wavelengths of light are packed into the os disc membranes of different types of cone cells . unlike other retinal cells , there is only one kind of rod photoreceptor , and it is the predominant cell type in the retina . humans have 130 million photoreceptors , 5 million bipolar cells , and 1 million ganglion cells . rods outnumber cones by 20-fold , and are distributed throughout the retina with the exception of the fovea region . the signal transduction , visual cycle , and electrophysiology of the rod have all been studied comprehensively ( box 1 ) . the unusual structure of rod photoreceptor cells has also become a major source of interest in the field of cell biology as early as half a century ago , though limited accessibility in the past to these cells in vivo has made the study of these photoreceptor cells quite difficult . genetic and mouse model studies from the past two decades have pinpointed the death of rod cells as the root cause of several inherited human retinal degeneration diseases , such as retinitis pigmentosa . retinitis pigmentosa is a common form of progressive rod - predominant dystrophy that occurs in 1 in every 4,000 people . patients with retinitis pigmentosa have impaired night vision and peripheral vision that precede the loss of central vision . many causative genes for retinitis pigmentosa encode key players in phototransduction signaling , the visual cycle , and photoreceptor fate determination ( please refer to http://www.sph.uth.tmc.edu/retnet for a summary of the genes implicated in retinal degeneration ) . interestingly , several of these genes encode molecules that play a significant role in morphogenesis and the vesicular trafficking of photoreceptors . these findings have drawn considerable attention to the fascinating cell biology questions brought about by these neuronal cells . here , rods have evolved a unique structure to detect and process light with high sensitivity and efficiency ; human rods can detect single photons ( hecht et al . , 1942 ; baylor et al . , 1979 ) . each rod contains four morphologically distinguishable compartments : the os , inner segment ( is ) , nucleus , and axon / synaptic terminal ( fig . the length of the rod os ranges from 30 to 60 m in length ( and 1.410 m in diameter ) , depending on the species . basically , the rod os is a cylindrically shaped membrane sac filled with 1,000 flattened , lamellar - shaped membrane discs that are orderly arrayed perpendicular to the axis of the os ( sung and tai , 2000 ; molday , 2004 ) . these discs appear to be floating freely , although filamentous structures bridging adjacent discs and disc rims to the nearby plasma membrane do exist ( fig . 2 , c and d ; roof and heuser , 1982 ; molday , 2004 ) . the visual pigment of the rod , rhodopsin , comprises 95% of the total amount of disc protein ; it is densely packed within the disc lamellae ( i.e. , 25,000 molecules/m ) . the high density of rhodopsin , together with its ordered alignment with respect to the light path , increases the probability of capturing an incident photon . ( a ) 3d cartoons depict the inter - relationship between rod and rpe ( left ) and is os junction ( right ) ; rpe apical microvilli interdigitate the distal half of the os . r , rpe ; v , microvilli ; o , os ; i , is ; n , nucleus , s , synaptic terminal . ( b ) a schematic drawing of a mammalian rod depicting its ciliary stalk and microtubule organizations ; the axonemal ( ax ) and cytoplasmic microtubules ( not depicted ) are anchored at the basal body in the distal is . vlgr1whirlin complexes appear on both cc plasmalemma and the lateral plasmalemma of the is ridge complex . ( c ) electron micrographs reveal the hairpin loop structures of the disc rims and the fibrous links across the gap between the disc rims and plasma membranes ( arrowheads ) . ( d ) the os plasma membrane and disc membrane have distinctive protein compositions ; molecules are either expressed on the plasma membrane or the disc membranes , but not both . the only exception is rhodopsin ; rhodopsin is present on disc membrane ( with a much higher concentration ) and plasma membrane ( not depicted ) . the cgmp - gated channel : na / ca - k exchanger complex on the plasma membrane directly binds to the peripherin-2rom-1 oligomeric complex on the disc rim . the cgmp - gated channel is composed of three a1 subunits and one b1 subunit . abca4 , a protein involved in retinoid cycle , is also enriched on the disc rim . retgc1 , retinal guanylyl cyclase ; cng channel , cgmp - gated channel . adapted from molday ( 2004 ) . ( e ) electron micrograph showing the longitudinal sectioning view of is os junction of rat rod . inset : a transverse section through the cc shows 9 + 0 arrangement ; an arrow points to the cross - linker that gaps the microtubule doublet and adjacent ciliary membrane . ( f ) electron micrographs of a low - power ( inset ) and high - power images of the rat retina , at the junction between the rod os and the rpe . a white arrow points to a group of saccules from the tip of os curls and upwards . white arrows in inset point to two distal os fragments that are engulfed by rpe . the spine of the comb is the ciliary stalk , which contains axonemal microtubules that extend distally to about half the length of the os . the axonemal microtubules are anchored at the basal body located at the distal end of the is , and traverse through the connecting cilium ( cc ) . the cc is a narrow stalk ( 0.31.2 m in length ; 0.3 m in diameter ) that acts as the single physical bridge linking the is and the os . the rod axoneme contains nine outer microtubule doublets and lacks the central pair of microtubules seen in motile cilia ( i.e. , 9 + 0 ; fig . there are fibrous structures cross - linking each microtubule doublet to the overlying plasma membrane , and rows of intramembrane particles in the proximal cc ( i.e. , ciliary necklace ) ; these ciliary structures are speculated to serve as diffusion barriers ( for review see sung and tai , 2000 ) . the distal os axoneme primarily contains microtubule singlets and no fibrous cross - linker . in terms of both morphology and molecular composition , the cc shares similar features with primary cilia . primary cilia are hair - like cell protrusions present on most cells in vertebrate organisms , and are typically 36 m in length . these cilia sense extracellular signals by facing a fluid - filled luminal cavity ( rosenbaum and witman , 2002 ) . the apical portion of the is forms a ridge - like structure that surrounds the circumference of the cc ( fig . the apical surface of the is ridge is closely apposed to the basal os surface ( fig . prominent microvilli extending from the apex of the is ridge surround the proximal os . resembling the calyx of a flower , these protrusions are named calycal processes ( fig . 2 , b and e ) . the lateral surface of the is ridge ( or periciliary plasma membrane ) is closely apposed to the cc , forming a groove - like structure ( fig . supramolecular complexes , which are made up of scaffolding and/or adhesion molecules ( e.g. , usherin , vlgr1 , whirlin , sans ) , are enriched in the specialized ( sub)plasmalemma of the lateral is ridge and/or cc ( fig . it has been proposed that the long ectodomains of the adhesion molecules , usherin and vlgr1 , tether and form fibrous structures between the apposing membranes of these subdomains . these fibrous links are analogous to the ankle links between adjacent stereocilia in developing hair cells . consistent with this idea , mutations in each of these proteins lead to usher syndrome , a human deaf - blind disease ( kremer et al . rod differentiation in rodents starts postnatally , and it takes 23 wk for the os to fully mature ( lavail , 1973 ) . os morphogenesis among the rods is not completely synchronized throughout development until near the end . it begins with the extension of a primitive cilium from the basal body anchored on the plasma membrane ( fig . 3 a ) . this rudimentary cilium has the morphological appearance of a typical primary cilium . the apical end of a primitive cilium gradually becomes swollen and filled with a variety of membranous vesicles , tubules , and sacs . at postnatal days 810 , disc - like membranous cisternae begin to fill the developing os ; however , these discs are often excessively long and highly disorganized ( fig . 3 b ; de robertis , 1956 , 1960 ; besharse et al . , 1985 ) . many of them are aligned parallel to or at an oblique angle relative to the ciliary stalk . the next phase of os differentiation involves a major remodeling that reorganizes the discs to align perpendicular to the ciliary stalk , making them stackable . the terminal phase of rod differentiation is the elongation of the os ; the lengths of oss containing orderly disc stacks increase at an almost linear rate during this period until the oss reach their mature size ( lavail , 1973 ) . ( a ) a drawing depicting the transformation of developing rods during their os morphogenesis . many discs are longer than the matured discs ; running in parallel to the ciliary stalk ( unpublished data ) . ( c ) a rod from a postnatal day 15 mouse lacking rpgrip1 ( rpgrip1 ) containing vertically oriented discs is shown . somewhat unexpectedly , rhodopsin has an indispensable role in disc formation in addition to its well - known role in signal transduction . rods of rhodopsin knockout mice form primitive cilia without disc - containing oss ( jansen et al . , 1987 ; mice lacking one allele of rhodopsin develop oss that adopt a relatively normal appearance , but have lower levels of rhodopsin . furthermore , transgenic mice that overexpress rhodopsin develop oss with increased diameters ( wen et al . , 2009 ) . peripherin-2 ( also called peripherin / rds ) is a photoreceptor - specific tetraspan membrane protein confined to the rim region of the rod discs , which has a characteristic hairpin loop appearance ( fig . 2 , c and d ; molday et al . , 1987 , 2004 ) . like rhodopsin null mice , peripherin-2 null ( or rds / rds ) mice form a bare cilium without os ( jansen et al . , 1987 ; connell et al . , microsome reconstitution studies suggested that peripherin-2 has an intrinsic ability to initiate the hairpin loop structure of the disc rim by simply forming disulphide - linked homodimers or oligomers ( wrigley et al . peripherin-2 is likely to play an additional role in disc size control and/or stabilization of disc organization in adult os . mice with one allele of peripherin-2 form oss characterized by overgrown disc membranes and a shape that resembles whorl profiles ( hawkins et al . , 1985 ) . rom1 , which is also localized on the disc rim , is a homologue of peripherin-2 . rom1 and peripherin-2 form a mixture of homo- and heterotetrameric core complexes ( loewen and molday , 2000 ) . mice null for rom1 develop oss with globally normal appearances but larger basal discs ( clarke et al . , 2000 ) . this indicates that rom1 has a modulating role in size control of newly synthesized discs . the rom1 gene appears late during evolution and it has only been found in mammals . coincidentally , mammalian rods have a much smaller diameter ( 7-fold ) than lower vertebrate rods do . monogenic rom1 disease is rare ; rom1 mutations in humans often have a digenic inheritance associated with either peripherin-2 or rhodopsin mutations ( kajiwara et al . , 1994 ) . although disc genesis mediated by rhodopsin and peripherin-2 is a cellular event specific to the rod , initial ciliogenesis of the rod is most likely characteristic of other cilia as well . it has been well established that intraflagellar transport ( ift ) is essential for the assembly of cilia in all organisms tested ( rosenbaum and witman , 2002 ) . ift is a bidirectional movement of multi - protein ift particles along the microtubules of ciliary axonemes ; ift cargoes are either transported on the ciliary membrane or in a narrow subplasmalemmal space between the ciliary membrane and axonemal microtubule doublets . anterograde and retrograde ift transport are powered by kinesin - ii and dynein 2 ( dhc1b/2 ) , respectively . the zebrafish ovl mutant , which has ift88 ( a key ift component ) disrupted , does not form a primitive cilium in postmitotic rods ( tsujikawa and malicki , 2004 ) . consistently , the oss of mouse rods with a hypomorphic ift88 mutation or a null kif3a ( a member of heterotrimeric kinesin - ii family ) allele are poorly differentiated and undergo degeneration ( marszalek et al . , 2000 ; pazour et al . , furthermore , kif17 ( a member of homodimeric kinesin - ii family ) is critical for rod os development in zebrafish ( insinna et al . , 2008 ) . kif17 is homologous to caenorhabditis elegans osm-3 ; osm-3 is required for the elongation of singlet microtubules in the distal segment of the amphid channel sensory cilium ( evans et al . , 2006 ) . two additional macromolecular complexes ( i.e. , nphp complex , bbsome ) associated with the ift complex are also important for early os development . mutations of each component in either of these complexes are linked to syndromic retinitis pigmentosa diseases , now collectively referred to as ciliopathies . retinal degeneration is a hallmark of many of the ciliopathies ( e.g. , senior locken syndrome , jourbet syndrome , bardet - biedl syndrome , alstrm syndrome ; katsanis , 2004 ; hildebrandt and zhou , 2007 ) . affected patients also exhibit several other overlapping phenotypes such as cystic kidney , mental retardation , and polydactyly . given the fact that a wide range of cell types are affected in patients with ciliopathies , the ift macromolecular complex clearly participates in a general function of cilia ( versus photoreceptor - specific function ) , such as the assembly and/or maintenance . consistent with this idea , nphp1 knockout mice have delocalized ift88 and severely disrupted os development mice mutant or null for the bbsome component , such as bbs1m390r knockin mice or bbs2 knockout mice , also exhibit poorly developed oss ( nishimura et al . , 2004 ; davis et al . , 2007 ) . however , it was found that the oss in mice null for bbs4 developed normally , despite rhodopsin being mislocalized ( abd - el - barr et al . , 2007 ) . this raises the interesting possibility that some of the bbsome subunits might have ift - independent roles . on the other hand , several additional animal models mimicking non - syndromic retinitis pigmentosa ( e.g. , mice with null or mutant alleles of rpgrip1 , rp1 , prominin 1 , or protocadherin 21 ) have developed elongated oss , but their discs are vertically or randomly oriented ( rattner et al . , 2001 ; zhao et al . , 2003 ; yang et al . , 2008 ; zacchigna et al . , 2009 ) . 3 b ) , suggesting that these mutant rods are arrested at the developmental stage when their discs are still disorganized . this further suggests that each of these molecules plays an important role in orienting the discs for stacking . among them , rpgrip1 is a structural component of the fibrous links between axonemal microtubules and the ciliary membrane ( zhao et al . , 2003 ) . rp1 is a photoreceptor - specific microtubule - associated protein with particular enrichment in the os portion of the ciliary axoneme ( gao et al . , 2002 ; rp1 can stabilize microtubules in vitro ; rp1 mutant rods have shorter axonemal microtubules with a kinked appearance . thus , we predict that a timely distal elongation of the os axoneme , likely involving rpgrip1 and/or rp1 , is critical to slant all the disorientated discs to one side of the os and/or anchor discs to the axonemal microtubules . finally , prominin 1 is a tetraspan membrane protein that binds to cholesterol , a specialized lipid that is concentrated on the apical - most is plasmalemma and calycal process ( fig . 2 b , green shade ; andrews and cohen , 1983 ; weigmann et al . , prominin 1 binds to protocadherin 21 and influences protocadherin 21 s distribution on the proximal basolateral os plasmalemma ( yang et al . , 2008 ) . these findings indicate that the specialized surface domains in the is os junction participate in the sculpting and/or maintenance of the topographic properties of the basal os , a step that may be important for the discs synthesized late in development to lay and stack . photoreceptors are highly susceptible to environmental insult because they constantly face a high influx of photons and free radicals . os disc stacking makes a scheduled daily repair feasible ; new discs are assembled at the base of the os , while aged discs at the tip are eliminated by neighboring rpe cells . complete renewal of the os takes 10 d in higher vertebrates and 69 wk for lower vertebrates . this cardinal feature of rod cells was first demonstrated by young in the 1960s using pulse - labeling and autoradiography ( young , 1967 ) . in these experiments , newly synthesized radioactive proteins appear as a band at the base of the os . the band is progressively displaced toward the tip of the os , eventually disappears from the os , and appears in the rpe . the distal disposition of the os is not constant , but follows a cyclic rhythm with a burst of activity peaking 2 h after light onset at dawn in all vertebrates studied ( lavail , 1976 ) . whether the rhythmic rpe phagocytosis is regulated by light or circadian rhythm is controversial , and may differ among species ( lavail , 1976 , 1980 ; besharse et al . , 1977 ; besharse and hollyfield , 1979 ; sung and tai , 2000 ) . it is now clear that rpe cells are professional phagocytes , among other duties ; each rodent rpe cell engulfs one tenth of the distal os discs of 30 rods every day ( fig . these cells serve as scavengers that degrade the protein / lipid components of ingested os fragments . considerable insight concerning the molecular machinery that underlies rpe phagocytosis has developed over the years . of particular interest , mutations in mer tyrosine kinase , a critical component for the phagocytic activity of rpe , are linked to retinitis pigmentosa in humans ( gal et al . , 2000 ) . this underscores the importance of timely os renewal for the health and survival of photoreceptors . based on a reconstruction of a series of high resolution electron micrographs , young proposed that the endmost os discs are actively shed in packets preceding rpe engulfment ( young and droz , 1968 ) . however , williams and fisher , who conducted studies on frogs , demonstrated that there are no shed discs in the subretinal space , and that shedding does not take place in the absence of rpe ( williams and fisher , 1987 ) . thus , they concluded that disc shedding and rpe phagocytosis should be considered as concomitant and inseparable events , at least under normal physiological conditions . to balance the apical loss , new discs and plasma membranes are assembled at the base of the os by incorporating proteins and lipids delivered from the is . an estimated 77 cm of disc membrane must be synthesized each day per rat retina ; this surface area is equivalent to over 50 times the outer surface area of the eyeball ( mayhew and astle , 1997 ) . how do rods achieve this extraordinary magnitude of membrane genesis , and how do they target the newly synthesized proteins to their respective sites with high fidelity ? these have been challenging questions to study because the disc renewal process is difficult to replicate in vitro . rods dissociated from the retina undergo drastic membrane remodeling , intersegmental fusion , and polarity loss ( townes - anderson , 1995 ) , making such investigations impractical . until recently , the dominant hypothesis for basal disc renewal has been a model proposed by steinberg et al . ( 1980 ) . based on an electron microscopic observation in which a few outfolded discs ( referred to as open discs ) were found at the basal os , these authors proposed that discs are formed by evagination of the basal os plasmalemma , which is subsequently pinched off by a bilateral fusion . although widely cited , no experimental data directly supports this model thus far . a conjectural piece of evidence in favor of the evagination model was an observation made by matsumoto and besharse ( 1985 ) . in studies of frogs , they found that a band of incorporated dye appears at the basal os of the rod shortly after a subretinal injection of lucifer yellow , and the resulting dye - containing discs migrate distally over time . this result was interpreted to mean that the extracellular dye is incorporated into open discs during their sealing . however , it is noted that no similar observation was found in any other mammals ( laties et al . , 1976 ) . rods of lower vertebrates ( e.g. , frog , zebrafish ) are a popular model system for photoreceptor studies because these cells are large and the procedure to generate transgenic animals is relatively easy . however , comparative studies of protein localization , reporter targeting assay , and os renewal in amphibians and mammals have resulted in inconsistent conclusions ( sung and tai , 2000 ; ding and naash , 2006 ; chuang et al . , 2007 ; baker et al . , 2008 ; kwok et al . , 2008 ) , indicating that the morphological differences between these dissimilar species might play an important role in their divergent strategies to adapt to their respective cellular physiologies and habitats . a recently proposed vesicular targeting model suggests that basal discs are assembled by the repeated fusion of rhodopsin vesicles ( chuang et al . , 2007 ) . in this model , rhodopsin vesicles at the basal os axonemes carry smad anchor for receptor activation ( sara ) and syntaxin 3 , and sara binds directly to both the c terminus of rhodopsin and syntaxin 3 ( fig . 4 c).using an in vivo retina transfection method , these authors showed that perturbation of the function or the expression of sara ( or syntaxin 3 ) in rods rendered targeting inefficient and led to aberrant accumulation of vesicles at the base of the os , the axonemal shaft , and the cc ( fig . 4 b ) . these results suggest the interaction between the fyve domain of sara ( on axonemal vesicles ) and phosphatidylinositol 3-phosphate ( pi3p ; on basal nascent discs ) primes the axonemal vesicles to discs for snare - mediated fusion ( fig . 4 c ) . these findings also provide convincing pieces of evidence that the precursors of the discs are membranous vesicles . vesicular targeting model explains how new discs are assembled at the base of the os . in contrast , sara ( green ) is specifically concentrated at the base of the os and especially enriched on the vesicles residing in the basal 3-m axonemal spaces . ( b ) electron micrograph reveals the aberrant vesicle accumulation at the basal os and at the cc shaft as a result of disruption of sara function ( arrows ) . ( c ) new discs at the base of the os are assembled and grow via sara- , pi3p- , and snare - mediated vesicular trafficking and membrane fusion . the fyve domain of sara tethers axonemal vesicles to nascent discs through its high - affinity interaction with pi3p located on the immature discs . the close proximity of these membranes then permits the snare - mediated fusion event to happen . the vesicular targeting model suggests that the disc incorporation of rhodopsin and the formation of nascent discs occur concomitantly . 4 a ) , syntaxin3 , and pi3p all display a gradient of expression along the proximal 38-m os , with the strongest signal toward the base . spatial restriction of these proteins could function as a programmed timer that determines both the proper size and the number of new discs to be generated per day . ( 2007 ) also showed that the basal os plasma membrane enwraps the entire set of disc stacks , with no open discs a similar conclusion can be drawn by using cryofixation techniques , namely , rapid freezing or high pressure freezing combined with freeze substitution ( obata and usukura , 1992 ) . thus , the open disc like structures are conceivable artifacts due to the histological damage of the basal os plasmalemma . rhodopsin has an autonomous os targeting signal located within its cytoplasmic c - terminal tail . this was first shown by the observation that the transgenically expressed retinitis pigmentosa rhodopsin mutant , which lacks the last five residues of the protein , loses its polarized os distribution ( sung et al . , 1994 ) . the c - terminal region of rhodopsin is highly conserved among species , and is a hot spot for human retinitis pigmentosa mutations ( sung and tai , 2000 ) . the sufficiency of rhodopsin s c terminus for os targeting was later demonstrated in transgenic frogs and zebrafish using a reporter assay ( tam et al . , 2000 ; the manner in which rhodopsin s c terminus confers its vectorial transport and polarized os targeting has been delineated by identifying proteins that interact with this region of rhodopsin . in addition to the aforementioned sara , which is critical for the final docking / fusion of rhodopsin onto discs , two additional molecules , arf4 ( adp ribosylation factor 4 ) and tctex-1 ( or dynlt1 ) , also interact with this region of rhodopsin ( tai et al . , 1999 ; mazelova et al . , the bar domain of asap1 facilitates membrane curving and , hence , budding from the trans - golgi network ( mazelova et al . , 2009 ) . the post - golgi rhodopsin vesicle is then transported on microtubules based on cytoplasmic dynein activity ( fig . tctex-1 , which is a cytoplasmic dynein light chain , serves as a cargo adaptor linking the rhodopsin vesicle with the dynein motor ( tai et al . , 1999 ) . the motor - driven vesicular translocation is especially important because the distance between the trans - golgi network and the distal is is quite far ; rods with cytoplasmic dynein ( dhc1 ) suppressed had aberrant post - golgi vesicle accumulation in the is ( insinna et al . , 2010 ) . several c - terminal retinitis pigmentosa mutant rhodopsins display a reduced affinity for tctex-1 , which may explain their mislocalization in rods ( tai et al . , 1999 ) . . both sets of microtubules have their minus ends anchored at the basal bodies ( troutt and burnside , 1988 ) . cytoplasmic dynein 1 transports post - golgi rhodopsin over long distances to reach the apical is region . at least two current working models have been proposed to explain how rhodopsin is transported through the cc and how this process is coupled with rhodopsin s disc incorporation . panel a depicts a model in which four or more distinctive cellular processes are involved ( sedmak and wolfrum , 2010 ) . step 1 : rhodopsin is fused with the apical is plasmalemma , then crosses a putative structure barrier and reaches the ciliary membrane . step 2 : rhodopsin is moved on the ciliary membrane using kinesin ii powered ift . panel b depicts a model in which rhodopsin vesicles , which are generated in the is , are delivered to the basal os axoneme through channeling via the ciliary axonemal shaft . these vesicles then undergo fusion to form nascent discs . in this scenario , post - golgi rhodopsin vesicles may traverse the endocytic compartments to recruit sara and other elements for subsequent translocation and/or fusion . besides rhodopsin , photoreceptor retinol dehydrogenase also uses a ( v / i)xpx motif for its os targeting ( luo et al . , 2004 ) . no other major os proteins are known to contain a similar motif , suggesting that a variety of os targeting signals and/or strategies must be operating in rods . for example , the piggyback / hitch - hiking model is likely to be a common strategy for os trafficking by other molecules simply interacting with rhodopsin or rhodopsin - bearing vesicles , which are abundant in rods ( concepcion et al . , 2002 ) . protein ( or protein lipid ) interactions . as an example , photoactivated rhodopsin snatches arrestin from its is localization upon illumination ( strissel et al . , 2004 ) . it was also shown that the os plasmalemma location of the cgmp - gated channel relies on its direct binding with a membrane skeletal protein ankryin - g ( kizhatil et al . , 2009 ) . it is plausible that many of these mechanisms occur redundantly and/or successively to ensure the fidelity of the targeting of these molecules to their respective os membrane domains . finally , a strategy completely independent of rhodopsin s targeting must be used for the disc rim targeting of peripherin-2 because no mislocalized peripherin-2 has been found in any mouse model in which rhodopsin is mislocalized ( hagstrom et al . , 2001 ; zhao et al . , 2003 ; abd - el - barr et al . , 2007 it was suggested that a checkpoint system selectively permits peripherin-2 prepacked as homotetramers or even higher oligomers , but not dimers , into the os ( loewen et al . , 2003 ) . the ability of peripherin-2 to further oligomerize with rom-1 and to interact with the cgmp - gated channel adjacent to the os may further promote and/or stabilize its disc rim distribution ( fig . one of the most pressing questions pertinent to rhodopsin trafficking is how rhodopsin passes through the bottleneck - shaped cc . this might be a consequence of several technical limitations , such as the high concentration of rhodopsin in the os or poor penetration of reagents into the cc , among other possibilities ( besharse and horst , 1990 ; liu et al . the presence of rhodopsin on the ciliary membrane has , however , been detected when a heavy - etching technique and a mixture of anti - rhodopsin antibodies were used in combination ( wolfrum and schmitt , 2000 ) . a study of shaker1 mice , in which the myosin viia gene is disrupted , found an increased rhodopsin signal on the cc membrane ( liu et al . the importance and direct nature of myosin viia on the cc s transport of rhodopsin remain unclear because rhodopsin was not detectably mislocalized in the is and other parts of the rods . furthermore , cc is largely devoid of microfilaments , although g - actin immunoreactivity is detected ( wolfrum and schmitt , 2000 ) . instead , the actin meshwork of rods is prominent at both the proximal and distal ends of the cc ( sung and tai , 2000 ) . many reviews have suggested that rhodopsin at the apical is plasmalemma is able to laterally diffuse and then traverse through the ciliary membrane by using kinesin - motored ift anterograde transport ( fig . 5 a ) . this proposition is analogous to a working model for the transmembrane protein that travels on primary cilia ( rosenbaum and witman , 2002 ) . rab8 gtpase has a proposed role in docking / fusing cargoes near the base of primary cilia to replenish membrane materials for cilia elongation ( nachury et al . , 2007 ; yoshimura et al . , 2007 ) . in agreement with this notion , transgenic frog rods that overexpress dominant - negative rab8 have aberrant vesicular accumulation at the base of the cc ( moritz et al . , 2001 ) . paradoxically , rhodopsin can not be efficiently targeted to the primary cilia in epithelial cultures ( chuang and sung , 1998 ) . rhodopsin is actually largely absent from the base of the primary cilium , a specialized lipid zone that prevents free diffusion between the apical surface and cilium ( vieira et al . , 2005 ) . to the best of our knowledge , rhodopsin has not been shown to be a cargo of ift . in addition , there is currently no evidence supporting the idea that rhodopsin is transported through ift . the improper rhodopsin distribution seen in the abnormally differentiated and rapidly degenerated hypomorphic ift88 and null kif3a rods should not be used to conclude ift s role in rhodopsin transport ( marszalek et al . , 2000 ; this is because rhodopsin is not completely polarized in the os until pn12 , and rhodopsin fails to integrate efficiently once the os is shortened and/or degenerated . a recent study using a different strain of rod - specific kif3a knockout that has a slower degeneration rate demonstrated that rhodopsin s os targeting is kif3a independent ( avasthi et al . , 2009 ) . the same study also showed that kif3a is not required for os plasmalemma localization of the cgmp - gated channel . thus , the nature of the membrane cargo(es ) transported by ift in photoreceptors remains to be identified . in this regard , a biochemical study showed that retinal guanylyl cyclase binds ( indirectly ) to ift88 , making it a potential ift cargo ( bhowmick et al . , 2009 ) . assuming that rhodopsin is transported on the ciliary membrane in addition to the evagination model discussed before , the pinching off of internalized ciliary membrane has also been proposed ( fig . 5 a ; obata and usukura , 1992 ; usukura and obata , 1995 ) . evidence for the latter is limited to studying fluid phase marker uptake performed in dissociated immature rods . an attractive alternative model is that rhodopsin vesicles are shipped directly from the is through the axonemal shaft ( fig . the sarasyntaxin3 axonemal vesicles then undergo fusion at the base of the os to produce new discs , as suggested by the vesicular targeting model ( fig . 4 c ) . this model is appealing because rods may have evolved from other ciliated cells to develop a means to effectively move cargo in bulk and quickly generate disc membranes . no ift retrograde transport is needed to return the os transmembrane proteins back to the cell body for degradation . however , three major signaling components ( i.e. , arrestin , transducin , and recoverin ) , which are all peripheral membrane proteins , shuttle back and forth between the is and os in a light - dependent manner . this is one remarkable mechanism that is unique to photoreceptors , and is used for light adaptation ( strissel et al . , 2004 ) . a parallel light - dependent translocation is also conserved in fly photoreceptors , in which the light - sensing organelles are actin - based microvilli called rhabdomeres . light - dependent protein transport in photoreceptors has been comprehensively reviewed elsewhere ( strissel et al . , 2004 ) . compared with other types of polarized cells , the high spatial and temporal resolution of photoreceptors has much to offer for those who are interested in cell polarity , vesicular trafficking , and organelle biogenesis . many discoveries and new working models described in this review provide a starting point for advancement . there is much more to be learned about protein transport and turnover in cone photoreceptors , which are also rich in membranes . the cell biology study of other neurons in the visual system is still in its infancy . for example , 20 and 30 types of ganglion cells and amacrine cells , respectively , have been identified based on their different shapes , molecular , and electrophysiological properties ( for review see masland , 2004 ) . each of these individual cell types appears to be specialized in distinct functions that are not completely understood . how are the processes of neurons that are involved in visual perception wired in such a complex yet remarkably precise manner ? how do retinal neurons undergo morphological adaptation in response to environmental cues ( e.g. , light , circadian ) , and what are their functional implications ( burnside , 1976 ; vollrath and spiwoks - becker , 1996 ; spiwoks - becker et al . , 2004 ) ? the recent completion of the inventory of all retinal neuron types ( wssle , 2004 ) and our increasing capability to target , manipulate , and visualize specific cell types in the visual system provide great promise for our deeper understanding of the cell biology of our vision system .

treatment of metastatic tumours of proximal femur usually used to be either palliative in the form of radiotherapy and chemotherapy or a very radical in form of hemipelvectomy and hip disarticulation . both forms of treatment were associated with dismal outcomes . now with the technological advancement and refinement in surgeries a custom made hip prosthesis offers a much better treatment option to the surgeon and a good quality life to the patient . we are presenting a case of metastatic adenocarcinoma of upper end of left femur with pathological fracture with a small primary in right lung treated with custom made hip prosthesis . patient received chemotherapy for primary lesion and is doing well at 11 months of follow up . this case is being presented on account of its unusual presentation and to give emphasis that in spite of metastatic disease , patient can be considered for limb salvage and megaprosthesis to improve his / her quality of life . this can be considered provided patient s general condition permits and if only a single solitary metastasis is present . a single space occupying mass in an adult is much more likely to be a focus of metastatic carcinoma . in females , the breasts and lungs are the most common primary disease sites ; approximately 80% of cancers that spread to bone arise in these locations . in males , cancers of the prostate and the remaining 20% of primary disease sites in patients of both sexes are the kidney , gastrointestinal tract and thyroid as well as sites of unknown origin . metastatic bone tumors are much more common than primary tumors and proximal femur is the most common site of involvement in the appendicular skeleton . pain , pathological fractures and hypercalcemia are the major sources of morbidity with bone metastasis . treatment goals aim to preserve function of the lower limb , eliminate pain and improve the quality of remaining life . an assessment of the risk of pathological fracture must be made by an experienced orthopaedic surgeon . lesions that do not represent a risk for fracture may be treated with radiation or by appropriate chemotherapy directed at the primary tumor . lesions that are regarded as a risk for pathologic fracture should be surgically stabilized on an elective basis before a fracture occurs . the goals of surgery are to preserve stability and function of the musculoskeletal system as well as to alleviate pain . patients who were candidates for extensive femoral resection because of malignant tumor were long considered a high - risk group for limb - sparing procedures because of the extent of bone and soft - tissue resection , as well as the use of adjuvant chemotherapy and radiation therapy . hip disarticulation or hemipelvectomy was therefore the classic treatment for patients with large lesions of the proximal or mid femur . the limb salvage surgery as a palliative treatment will provide more psychological benefit not only to the patient but also to relatives and will increase self confidence so that the quality of life is better for the expected duration of survival . a 65 years old female presented in september 2010 , to our department with chief complaints of severe pain and swelling in left thigh since last 2 years . she was unable to walk and had loss of appetite since 1 years . according to the patient she was apparently asymptomatic 2 years back when she developed pain in left thigh . it was constant in nature and was present even at rest , dull aching type aggravated by hip movements . it was also associated with swelling over the upper part of thigh . for the above complaints patient took some local treatment but was not relieved . after six months patient was unable to bear weight even partially and was completely bed ridden . she was not having any complaint of cough , fever , haemoptysis or hoarseness of voice , difficulty in swallowing for solids or liquids . patient was having a history of intermittent pain in right side of middle chest , which used to relieve on taking non steroidal antiinflammatory drugs . there was no history of any gastrointestinal upset or urinary problem , any breast lump , trauma syphilis , leprosy , diabetes and hypertension . on examination there was a 10 cm 5 cm swelling over antero - lateral aspect of upper part of left thigh . the swelling was diffuse , hard , localized to upper part of thigh , immobile , non - translucent , non - illuminant , non - fluctuant , non - pulsatile and fixed to the bone . plain radiographs of the affected part showed ill - defined osteolytic permeative pattern or moth eaten type of lesion with destruction of bone involving the diaphyseal and metaphyseal region of proximal femur and extension into the soft tissues ( fig . pre - operative radiograph of the patient showing permeative pattern or moth eaten type of lesion seen over the metadiaphyseal region of left femur with pathological fracture . there was pathological fracture of femur at the distal margin of the tumor lesion with no periosteal new bone formation . magnetic resonance imaging revealed a large expansile intramedullary osteogenic hypo intense vascular primary mitotic lesion of upper metadiaphyseal aspect of left femur with extra osseous extension of soft tissue in anterior and lateral myofascial compartment without any involvement of adjacent hip joint or neurovascular bundle . contrast enhanced computed tomography scan of thorax was done to know about the nature of ill - defined opacity and it revealed a lobulated soft tissue density mass lesion measuring 2630 mm noted in apical segment of right lower lobe . 2 ) . contrast enhanced ct scan of thorax - showing mass lesion in the apical segment of right lower lobe . fluoroscopic guided needle biopsy of the femoral lesion revealed it to be a metastatic adenocarcinoma . as patient was symptomatic due to metastatic lesion but not due to primary lesion so priority was given to metastatic site . the patient was planned for surgery , but as tumor was very vascular so to reduce the risk of bleeding at the time of surgery pre - operatively radiotherapy was planned . palliative radiotherapy was given at a dose of 30 gy in10 fractions in 2 weeks with cobalt 60 in department of radiotherapy of our institution to relive pain and to reduce vascularization of tumor . 3 weeks after the completion of radiotherapy , hip was exposed by the postero - lateral approach extending the incision more distally . 17 cm of the affected bone including the head of the femur was resected out ( fig . the cut muscles were tied at the ports at the upper end of the prosthesis . stitches were removed on 12th post - operative day and patient was allowed to walk with the help of walker . intraoperative specimen of tumour excision with wide local excision of the tumour done after operative procedure for bone lesion patient was planned for chemotherapy and radiotherapy for primary lung lesion . gemcitabine and cisplatin intravenous on day 1 and day 8 , q-3wks followed by radical dose of loco - regional radiotherapy ( 60 gy/30 fractions ) . she has completed 11 months of follow up and is totally asymptomatic , pain free and walks independently with support ( fig . typically multifocal but renal and thyroid carcinomas are notorious for producing only a solitary lesion . in our case patient presented with pathological fracture due to a solitary secondary bony lesion with incidental diagnosed lung primary . an assessment of the risk of pathological fracture must be made by an experienced orthopaedic surgeon . lesions without a risk for fracture should be treated with radiation or by appropriate chemotherapy directed at the tumour . lesions with a risk for pathologic fracture should be surgically stabilized before a fracture occurs . the goals of surgery are to preserve stability and function of the musculoskeletal system as well as alleviate pain . when any patient presents with metastatic disease our intent of treatment is changed from radical to palliative ; but in this case our intent of treatment was curative , because primary was a small lesion and only a single metastasis was present though patient was having pathological fracture but keeping in mind good general condition of the patient and no other metastatic lesion elsewhere , we started our treatment with radical intent . our patient had a good general condition and life expectancy ; she was only rendered immobile due to the pathological fracture . there are various possible constructive options to treat femoral bone loss are long - stem cemented or press - fit stems , impaction allografting , resection arthroplasty , allograft - prosthetic composite ( apc ) and proximal femoral mega prosthesis . most of patients with metastatic lesions to the proximal femur respond well to radiation therapy . of the 510% of these patients who require surgery , the most common reason is pathologic fracture , followed by tumor progression and intractable pain . hip disarticulation or hemipelvectomy was therefore the classic treatment for patients with large lesions of the proximal or mid femur . improved survival of patients with musculoskeletal malignancies , refinements in surgical technique and developments in bioengineering , has allowed the execution of limb - sparing surgeries in these extreme situations . as a result , proximal and total femur resection have become surgical options in the treatment of primary bone sarcomas and metastatic bone disease . expecting a favorable outcome and to improve the quality of life of the patient we went for a limb salvage surgery in form of custom made hip prosthesis despite of it being a metastatic tumor . the justification for using proximal femoral replacement surgery with a one year mortality of 65% is debatable . wedin et al reported 30% one year , 10% two years and 7% three years patient survival following surgery for proximal femoral metastases while chandrasekhar et al reported 35% , 20% and 10% as respective figures . in our case patient is fine at almost one year of follow - up and longer follow up will be needed to further comment of survival in long bones , the most common site for metastases is the proximal femur . for lesions involving this region , osteosynthetic devices frequently fail , and for this reason , endoprosthetic reconstruction may be the optimal choice for treatment . despite the metastatic lesion from lung primary limb salvage by using custom mega prosthesis is a good option in the management of these patients . although the survival rate remains grim , the patients can benefit from an improved quality of life . moreover , the psychosocial morbidity associated with disfiguring amputations can be avoided by extending the realms . high cost is a constraint a palliative megaprosthetic replacement is a good option in cases of pathological fractures secondary to metastatic adenocarcinoma . this will improve the patients quality of life for the remaining years , however cost is a constraint .

our institutional review board approved our retrospective study with a waiver of the informed consent from each patient . this was a retrospective study for patients with pulmonary cryptococcal infection who were seen in a single tertiary - referral hospital over the course of a 14-year period ( january 1995 to december 2008 ) and who underwent thoracic ct examinations . by using the electronic database of medical records , we could identify 23 patients , who had histopathologically - proven pulmonary cryptococcosis . over the same span of time the patient population consisted of 13 men and 10 women , with an age range from 32 years to 77 years ( median , 57 years ; mean age standard deviation [ sd ] , 56 12.4 years ) . if a patient had at least one of the following conditions : underlying malignancy , use of immunosuppressive drugs , uncontrolled diabetes mellitus , or liver cirrhosis , the patient was considered to be immunocompromised . even though a patient had a history of malignancy , the patient was considered to be immunocompetent when he or she was in a disease - free state for more than five years . thirteen patients had various underlying diseases including breast cancer in three patients , hepatocellular carcinoma in two patients , as well as colon cancer , cholangiocellular carcinoma , renal cell carcinoma , pancreatic cancer , diffuse large b - cell lymphoma , advanced gastric cancer , esophageal cancer , and herpes simplex encephalitis in one patient each . of the 12 patients with an underlying malignancy , three patients were in a disease - free state for more than five years . however , one of the three patients in the disease - free state had liver cirrhosis . 11 ( 10 patients with an underlying malignancy and one with herpex simplex encephalitis ) patients were considered to be immunocompromised and 12 patients were considered to be immunocompetent ( table 1 ) . the diagnosis of the pulmonary fungal infection was made with the aid of histopathological specimens . the specimens were obtained via a percutaneous gun ( core ) biopsy for lung lesions in eight patients , a wedge resection using video - assisted thoracoscopic surgery ( vats ) in 13 patients , and a right middle lobectomy performed by way of vats or wedge resection after an open thoracotomy , respectively for one patient for each method . the histopathological diagnoses were rendered by identifying encapsulated yeast forms within inflammatory lung tissue with the use of hematoxylin and eosin , mucicarmine , periodic acid - schiff , or gomori - methenamin - silver staining . a serum cryptococcal antigen test demonstrated positivity in only three ( 21% ) of 14 patients in which the test was performed . eleven patients had previously undergone ct scans ( scan interval ; range = 1 - 75 days , median time = 18 days , mean time = 21.7 days ) that had been obtained at outside institutions . pet ( n = 1 ) or pet / ct ( n = 9 ) scans were available for 10 patients . all chest ct examinations for patients at the time of presentation were performed using a single - detector ( two patients ; hispeed advantage scanner , ge healthcare , milwaukee , wi ) , 4-detector ( eight patients ; lightspeed qx / i , ge healthcare ) , 8-detector ( five patients ; lightspeed ultra , ge healthcare ) , 16-detector ( four patients ; lightspeed ultra or ultra16 , ge healthcare ) , or 64-detector ( four patients ; lightspeed vct xt , ge healthcare ) row scanners . helical ct scans ( 125 - 200 ma , 120 kvp ; 5-mm section thickness and a pitch of 1 for single - detector helical ct and beam width of 10 - 20 mm , beam pitch of 1.375 - 1.5 for multidetector ct ) were obtained from the lung apices to the level of the middle portion of both kidneys after an intravenous contrast medium injection of 80 ml iomeron 300 ( iomeprol ; bracco , milan , italy ) . the image data were reconstructed with a high - spatial algorithm for lung window images , a standard algorithm for mediastinal window images , a 5-mm section thickness for single - detector helical ct scans , and with a 2.5-mm section thickness for multidetector ct scans . all image data were directly interfaced with a picture archiving and communication systems ( pacs ) ( pathspeed , or centricity 2.0 ; ge healthcare , mt . prospect , il ) , which displayed all image data on two monitors ( 1,536 2,048 matrix , 8-bit viewable gray scale , and 60-ft - lambert luminescence ) . both mediastinal ( width , 400 hu ; level , 20 hu ) and lung ( width , 1,500 hu ; level , scans were assessed for the presence of lung abnormalities ( nodules , masses , consolidation , and ground - glass opacity ) and distribution ( laterality and lobar location , lingular division was classified as a separate lobe ) at the time of presentation . two chest radiologists performed the evaluations and decisions on the findings that were reached by consensus . nodules were defined as round or oval opacities with at least moderately well circumscribed margins that had a maximum diameter of 3 cm or less . if a rim of ground - glass opacity surrounded a nodule , the halo sign was considered present . when opacities were greater than 3 cm in diameter , the lesions were defined as masses . the criteria for consolidation were met when parenchymal non - nodular opacity obscured the underlying pulmonary architecture and often accompanied air bronchograms . ground - glass opacity was defined as hazy opacities through which the normal pulmonary architecture could be visualized . the presence of pleural effusion and lymphadenopathy ( when the short - axis diameter was greater than 10 mm ) were also recorded . after the assessment of lung parenchymal abnormalities , the lung lesions were further classified into five patterns : single nodular , multiple clustered nodular , multiple scattered nodular , mass - like , and bronchopneumonic patterns . single nodular and mass - like patterns were defined when the lung lesion consisted of a single nodule and a single mass , respectively . the multiple clustered nodular pattern was defined when the lesions consisted of multiple variable - sized nodules confined to one lobe , whereas the multiple scattered nodular pattern was defined when lesions consisted of multiple variable - sized nodules scattered throughout multiple lobes in a single lung or in both lungs . the bronchopneumonic pattern was defined as when lung lesions were comprised of areas of lobular , subsegmental , or segmental consolidation , ill - defined centrilobular small nodules ( measuring 4 to 10 mm in diameter and representing peribronchiolar consolidation ) or tree - in - bud ( small centrilobular nodules and branching nodules within the secondary pulmonary lobule ) opacities ( 18 ) . when lung lesions could not be classified into one of the five patterns , they were classified as unclassifiable . in 11 patients , where previous ct scans were available , the scans were also analyzed with the use of the above - mentioned methods and the findings were compared with those seen on ct scans at the time of presentation . details on imaging methods have been described in previous reports ( 19 , 20 ) . briefly , the peripheral blood glucose levels were 150 mg / dl in all patients . patients received an intravenous injection of 370 mbq ( 10 mci ) 18f - fluorodeoxyglucose ( fdg ) and were then allowed to rest for over 45 minutes prior to scanning . image acquisition was achieved by way of a pet ( advance , ge healthcare , milwaukee , wi ) or pet / ct device ( discovery ls , ge healthcare ) consisting of an advance nxi pet scanner and an 8-slice lightspeed plus ct scanner . pet or pet / ct examinations were performed as part of a metastatic workup in six patients because these patients had extra - thoracic malignant disease . in the remaining four patients , integrated pet / ct images were evaluated by a nuclear medicine physician who was unaware of the clinical or histopathological findings . the maximum fdg standardized uptake value ( msuv ) of lung lesions was measured for the lung abnormalities . the treatments administered were as follows : no specific treatment after the diagnosis of pulmonary cryptococcosis in one patient ; surgical resection only for both diagnosis and treatment as well as the use of vats or open thoracotomy in eight patients ; antifungal therapy ( fluconazole ; plunazole , daewoong pharm , seoul , korea ) following a diagnostic lung lesion resection in seven patients . the mean treatment duration of antifungal therapy in 14 patients was five months ( range , 2 - 12 months ) . follow - up imaging studies ( with ct in 16 patients and with chest radiographs in seven patients ) were obtained for all patients . the follow - up period ranged from two to 26 months ( median , 7 months ; mean , 9 months ) . this was a retrospective study for patients with pulmonary cryptococcal infection who were seen in a single tertiary - referral hospital over the course of a 14-year period ( january 1995 to december 2008 ) and who underwent thoracic ct examinations . by using the electronic database of medical records , we could identify 23 patients , who had histopathologically - proven pulmonary cryptococcosis . over the same span of time the patient population consisted of 13 men and 10 women , with an age range from 32 years to 77 years ( median , 57 years ; mean age standard deviation [ sd ] , 56 12.4 years ) . if a patient had at least one of the following conditions : underlying malignancy , use of immunosuppressive drugs , uncontrolled diabetes mellitus , or liver cirrhosis , the patient was considered to be immunocompromised . even though a patient had a history of malignancy , the patient was considered to be immunocompetent when he or she was in a disease - free state for more than five years . thirteen patients had various underlying diseases including breast cancer in three patients , hepatocellular carcinoma in two patients , as well as colon cancer , cholangiocellular carcinoma , renal cell carcinoma , pancreatic cancer , diffuse large b - cell lymphoma , advanced gastric cancer , esophageal cancer , and herpes simplex encephalitis in one patient each . of the 12 patients with an underlying malignancy , three patients were in a disease - free state for more than five years . however , one of the three patients in the disease - free state had liver cirrhosis . 11 ( 10 patients with an underlying malignancy and one with herpex simplex encephalitis ) patients were considered to be immunocompromised and 12 patients were considered to be immunocompetent ( table 1 ) . the diagnosis of the pulmonary fungal infection was made with the aid of histopathological specimens . the specimens were obtained via a percutaneous gun ( core ) biopsy for lung lesions in eight patients , a wedge resection using video - assisted thoracoscopic surgery ( vats ) in 13 patients , and a right middle lobectomy performed by way of vats or wedge resection after an open thoracotomy , respectively for one patient for each method . the histopathological diagnoses were rendered by identifying encapsulated yeast forms within inflammatory lung tissue with the use of hematoxylin and eosin , mucicarmine , periodic acid - schiff , or gomori - methenamin - silver staining . a serum cryptococcal antigen test demonstrated positivity in only three ( 21% ) of 14 patients in which the test was performed . the symptoms or signs of patients , if any , were recorded . in addition , eleven patients had previously undergone ct scans ( scan interval ; range = 1 - 75 days , median time = 18 days , mean time = 21.7 days ) that had been obtained at outside institutions . pet ( n = 1 ) or pet / ct ( n = 9 ) scans were available for 10 patients . all chest ct examinations for patients at the time of presentation were performed using a single - detector ( two patients ; hispeed advantage scanner , ge healthcare , milwaukee , wi ) , 4-detector ( eight patients ; lightspeed qx / i , ge healthcare ) , 8-detector ( five patients ; lightspeed ultra , ge healthcare ) , 16-detector ( four patients ; lightspeed ultra or ultra16 , ge healthcare ) , or 64-detector ( four patients ; lightspeed vct xt , ge healthcare ) row scanners . helical ct scans ( 125 - 200 ma , 120 kvp ; 5-mm section thickness and a pitch of 1 for single - detector helical ct and beam width of 10 - 20 mm , beam pitch of 1.375 - 1.5 for multidetector ct ) were obtained from the lung apices to the level of the middle portion of both kidneys after an intravenous contrast medium injection of 80 ml iomeron 300 ( iomeprol ; bracco , milan , italy ) . the image data were reconstructed with a high - spatial algorithm for lung window images , a standard algorithm for mediastinal window images , a 5-mm section thickness for single - detector helical ct scans , and with a 2.5-mm section thickness for multidetector ct scans . all image data were directly interfaced with a picture archiving and communication systems ( pacs ) ( pathspeed , or centricity 2.0 ; ge healthcare , mt . prospect , il ) , which displayed all image data on two monitors ( 1,536 2,048 matrix , 8-bit viewable gray scale , and 60-ft - lambert luminescence ) . both mediastinal ( width , 400 hu ; level , 20 hu ) and lung ( width , 1,500 hu ; level scans were assessed for the presence of lung abnormalities ( nodules , masses , consolidation , and ground - glass opacity ) and distribution ( laterality and lobar location , lingular division was classified as a separate lobe ) at the time of presentation . two chest radiologists performed the evaluations and decisions on the findings that were reached by consensus . nodules were defined as round or oval opacities with at least moderately well circumscribed margins that had a maximum diameter of 3 cm or less . if a rim of ground - glass opacity surrounded a nodule , the halo sign was considered present . when opacities were greater than 3 cm in diameter , the lesions were defined as masses . the criteria for consolidation were met when parenchymal non - nodular opacity obscured the underlying pulmonary architecture and often accompanied air bronchograms . ground - glass opacity was defined as hazy opacities through which the normal pulmonary architecture could be visualized . the presence of pleural effusion and lymphadenopathy ( when the short - axis diameter was greater than 10 mm ) were also recorded . after the assessment of lung parenchymal abnormalities , the lung lesions were further classified into five patterns : single nodular , multiple clustered nodular , multiple scattered nodular , mass - like , and bronchopneumonic patterns . single nodular and mass - like patterns were defined when the lung lesion consisted of a single nodule and a single mass , respectively . the multiple clustered nodular pattern was defined when the lesions consisted of multiple variable - sized nodules confined to one lobe , whereas the multiple scattered nodular pattern was defined when lesions consisted of multiple variable - sized nodules scattered throughout multiple lobes in a single lung or in both lungs . the bronchopneumonic pattern was defined as when lung lesions were comprised of areas of lobular , subsegmental , or segmental consolidation , ill - defined centrilobular small nodules ( measuring 4 to 10 mm in diameter and representing peribronchiolar consolidation ) or tree - in - bud ( small centrilobular nodules and branching nodules within the secondary pulmonary lobule ) opacities ( 18 ) . when lung lesions could not be classified into one of the five patterns , they were classified as unclassifiable . in 11 patients , where previous ct scans were available , the scans were also analyzed with the use of the above - mentioned methods and the findings details on imaging methods have been described in previous reports ( 19 , 20 ) . briefly , the peripheral blood glucose levels were 150 mg / dl in all patients . patients received an intravenous injection of 370 mbq ( 10 mci ) 18f - fluorodeoxyglucose ( fdg ) and were then allowed to rest for over 45 minutes prior to scanning . image acquisition was achieved by way of a pet ( advance , ge healthcare , milwaukee , wi ) or pet / ct device ( discovery ls , ge healthcare ) consisting of an advance nxi pet scanner and an 8-slice lightspeed plus ct scanner . pet or pet / ct examinations were performed as part of a metastatic workup in six patients because these patients had extra - thoracic malignant disease . in the remaining four patients , integrated pet / ct images were evaluated by a nuclear medicine physician who was unaware of the clinical or histopathological findings . the maximum fdg standardized uptake value ( msuv ) of lung lesions was measured for the lung abnormalities . all chest ct examinations for patients at the time of presentation were performed using a single - detector ( two patients ; hispeed advantage scanner , ge healthcare , milwaukee , wi ) , 4-detector ( eight patients ; lightspeed qx / i , ge healthcare ) , 8-detector ( five patients ; lightspeed ultra , ge healthcare ) , 16-detector ( four patients ; lightspeed ultra or ultra16 , ge healthcare ) , or 64-detector ( four patients ; lightspeed vct xt , ge healthcare ) row scanners . helical ct scans ( 125 - 200 ma , 120 kvp ; 5-mm section thickness and a pitch of 1 for single - detector helical ct and beam width of 10 - 20 mm , beam pitch of 1.375 - 1.5 for multidetector ct ) were obtained from the lung apices to the level of the middle portion of both kidneys after an intravenous contrast medium injection of 80 ml iomeron 300 ( iomeprol ; bracco , milan , italy ) . the image data were reconstructed with a high - spatial algorithm for lung window images , a standard algorithm for mediastinal window images , a 5-mm section thickness for single - detector helical ct scans , and with a 2.5-mm section thickness for multidetector ct scans . all image data were directly interfaced with a picture archiving and communication systems ( pacs ) ( pathspeed , or centricity 2.0 ; ge healthcare , mt . prospect , il ) , which displayed all image data on two monitors ( 1,536 2,048 matrix , 8-bit viewable gray scale , and 60-ft - lambert luminescence ) . both mediastinal ( width , 400 hu ; level , 20 hu ) and lung ( width , 1,500 hu ; level scans were assessed for the presence of lung abnormalities ( nodules , masses , consolidation , and ground - glass opacity ) and distribution ( laterality and lobar location , lingular division was classified as a separate lobe ) at the time of presentation . two chest radiologists performed the evaluations and decisions on the findings that were reached by consensus . nodules were defined as round or oval opacities with at least moderately well circumscribed margins that had a maximum diameter of 3 cm or less . if a rim of ground - glass opacity surrounded a nodule , the halo sign was considered present . when opacities were greater than 3 cm in diameter , the lesions were defined as masses . the criteria for consolidation were met when parenchymal non - nodular opacity obscured the underlying pulmonary architecture and often accompanied air bronchograms . ground - glass opacity was defined as hazy opacities through which the normal pulmonary architecture could be visualized . the presence of pleural effusion and lymphadenopathy ( when the short - axis diameter was greater than 10 mm ) were also recorded . after the assessment of lung parenchymal abnormalities , the lung lesions were further classified into five patterns : single nodular , multiple clustered nodular , multiple scattered nodular , mass - like , and bronchopneumonic patterns . single nodular and mass - like patterns were defined when the lung lesion consisted of a single nodule and a single mass , respectively . the multiple clustered nodular pattern was defined when the lesions consisted of multiple variable - sized nodules confined to one lobe , whereas the multiple scattered nodular pattern was defined when lesions consisted of multiple variable - sized nodules scattered throughout multiple lobes in a single lung or in both lungs . the bronchopneumonic pattern was defined as when lung lesions were comprised of areas of lobular , subsegmental , or segmental consolidation , ill - defined centrilobular small nodules ( measuring 4 to 10 mm in diameter and representing peribronchiolar consolidation ) or tree - in - bud ( small centrilobular nodules and branching nodules within the secondary pulmonary lobule ) opacities ( 18 ) . when lung lesions could not be classified into one of the five patterns , they were classified as unclassifiable . in 11 patients , where previous ct scans were available , the scans were also analyzed with the use of the above - mentioned methods and the findings details on imaging methods have been described in previous reports ( 19 , 20 ) . briefly , the peripheral blood glucose levels were 150 mg / dl in all patients . patients received an intravenous injection of 370 mbq ( 10 mci ) 18f - fluorodeoxyglucose ( fdg ) and were then allowed to rest for over 45 minutes prior to scanning . image acquisition was achieved by way of a pet ( advance , ge healthcare , milwaukee , wi ) or pet / ct device ( discovery ls , ge healthcare ) consisting of an advance nxi pet scanner and an 8-slice lightspeed plus ct scanner . pet or pet / ct examinations were performed as part of a metastatic workup in six patients because these patients had extra - thoracic malignant disease . in the remaining four patients , integrated pet / ct images were evaluated by a nuclear medicine physician who was unaware of the clinical or histopathological findings . the maximum fdg standardized uptake value ( msuv ) of lung lesions was measured for the lung abnormalities . the treatments administered were as follows : no specific treatment after the diagnosis of pulmonary cryptococcosis in one patient ; surgical resection only for both diagnosis and treatment as well as the use of vats or open thoracotomy in eight patients ; antifungal therapy ( fluconazole ; plunazole , daewoong pharm , seoul , korea ) following a diagnostic lung lesion resection in seven patients . the mean treatment duration of antifungal therapy in 14 patients was five months ( range , 2 - 12 months ) . follow - up imaging studies ( with ct in 16 patients and with chest radiographs in seven patients ) were obtained for all patients . the follow - up period ranged from two to 26 months ( median , 7 months ; mean , 9 months ) . of the 23 patients , 13 ( 57% ) had no symptoms or signs . in 10 ( 43% ) patients , symptoms including cough ( n = 6 ) , chest pain ( n = 4 ) , sputum ( n = 2 ) , and fever ( n = 2 ) were observed . before the definitive diagnoses of cryptococcosis had been determined , clinicoradiological diagnoses for the disease included pulmonary tuberculosis ( n = 9 ) , metastases from an extra - thoracic malignancy ( n = 6 ) , lung cancer ( n = 3 ) , organizing pneumonia ( n = 2 ) , pulmonary paragonimiasis ( n = 1 ) , lymphomatous involvement of the lung ( n = 1 ) , and pulmonary cryptococcosis ( n = 1 ) ( table 1 ) . of the 11 patients who had undergone previous ct scans ( nine of the 11 patients received empirical antibiotic treatment based on the assumption that the patients had community acquired pneumonia ) , seven ( 67% ) showed a progression of the same pattern of disease , whereas four ( 33% ) showed no change in the extent of the disease . none of the patients showed improvement in the course of the disease ( table 2 ) . of the nine patients , whose largest lesion 's maximum diameter was measurable in both previous and current ct scans , seven patients showed no change in the maximum diameter of the lesion within a 34 day follow - up period , however two patients demonstrated an interval increase ( 2.5 and 2.6 times ) in lesion diameters over 50 and 75 day follow - up period , respectively . a clustered nodular pattern ( fig . 1 ) of lung abnormalities was the most frequent pattern and was observed in 10 ( 43% ) patients . a solitary pulmonary nodular pattern ( n = 4 , 17% ) ( fig . 2 ) and scattered nodular pattern ( n = 3 , 13% ) ( fig . 3 ) were the next most common patterns for lung lesions . a bronchopneumonic pattern ( fig . 4 ) was noted in two ( 9% ) patients , and a single mass lesion ( fig . 5 ) was identified in one patient ( 4% ) . in three patients , lung lesions were unclassifiable : one patient had a mass and a nodule , another patient had an area of consolidation and multiple scattered nodules in the left lung , and the third patient had clustered masses and nodules in the bilateral lower lung zones ( table 2 ) . in immunocompetent patients ( n = 12 ) , a clustered nodular pattern ( n = 6 , 50% ) , scattered nodular pattern ( n = 2 , 17% ) , solitary pulmonary nodular pattern ( n = 1 , 8% ) , solitary mass ( n = 1 , 8% ) , and unclassifiable lesions ( n = 2 , 16% ) were observed . in immunocompromised patients ( n = 11 ) , a clustered nodular pattern ( n = 4 , 36% ) , solitary pulmonary nodular pattern ( n = 3 , 27% ) , bronchopneumonia pattern ( n = 2 , 18% ) , scattered nodular pattern ( n = 1 ) , and unclassifiable lesions ( n = 1 , 9% ) were observed . of the six lobes observed ( lingular division was considered as a separate lobe ) , the left lower lobe was most frequently involved ( nine cases ) . the right lower lobe was involved in seven cases , the left upper lobe and the lingular division were involved in six cases each , the right middle lobe was involved in five cases , and the right upper lobe was involved in four cases . a nodule with a halo sign was also observed in two ( 9% ) patients . pleural effusion was noted in one ( 4% ) patient , but pericardial effusion was not observed in any patient . of the 10 patients that underwent pet , six showed higher fdg uptake compared to the mediastinal blood pool , thus simulating malignant fdg uptake , whereas four patients demonstrated a benign type of fdg uptake . the msuvs for fdg uptake of lung parenchymal lesions ranged from 1.8 to 9.3 ( median , 5.3 ; mean , 5.4 ) ( table 2 ) . clinical or radiological improvement was identified in 22 ( 96% ) patients . in one patient ( 4% ) with underlying hepatocellular carcinoma and no specific treatment was given , the parenchymal lesions of clustered nodules showed disease progression over a five - month follow - up period ( fig . 1 ) . of the 22 patients treated , complete clearance of lung abnormalities was noted in 15 ( 65% ) patients including four patients who had solitary pulmonary nodular lesions . in one patient , lesions disappeared completely with antifungal therapy only ( patient 23 in tables 1 , 2 ) . fourteen ( 93% ) of the 15 patients with complete clearance underwent surgical resection for the diagnostic workup . in nine ( 64% ) of the 14 patients , lesions were relatively localized ( clustered nodules , solitary pulmonary nodule , or a mass and a nodule ) . therefore , a diagnostic surgical resection removed all lesions . after the surgical resection , new nodular lesions developed in one patient ( patient 14 in tables 1 , 2 ) on follow - up ct scans obtained two months later . this patient was treated with antifungal agents for five months and the new lesions disappeared after the treatment . in the remaining eight patients , there was no newly developed lesion on follow - up scans . in another five ( 36% ) therefore , a total of six patients , where complete lesion clearance was achieved , received antifungal therapy after the surgical resection . in these six patients , the mean treatment duration was 4.2 months ( range , 2 - 6 months ) . in seven ( 31% ) patients , although improvement of lung lesions with a decreased extent of abnormalities was observed , the remaining lung lesions persisted ( partial response ) during the median follow - up period of 11 months ( range , 5 - 26 months ; mean , 13 months ) ( fig . 4 ) ( table 2 ) . of seven patients who were treated with antifungal agents only , one patient ( patient 23 in tables 1 , 2 , treated with amphotericin and fluconazole ) showed complete clearance . in the remaining six patients , who were treated with fluconazole , a partial response was noted . the mean follow - up period was 14 months ( range , 5 - 26 months ) . in these six patients with remaining disease , symptoms such as a cough , sputum , fever , and chest pain disappeared within three or six months of the treatment outset . of the 11 patients who had undergone previous ct scans ( nine of the 11 patients received empirical antibiotic treatment based on the assumption that the patients had community acquired pneumonia ) , seven ( 67% ) showed a progression of the same pattern of disease , whereas four ( 33% ) showed no change in the extent of the disease . none of the patients showed improvement in the course of the disease ( table 2 ) . of the nine patients , whose largest lesion 's maximum diameter was measurable in both previous and current ct scans , seven patients showed no change in the maximum diameter of the lesion within a 34 day follow - up period , however two patients demonstrated an interval increase ( 2.5 and 2.6 times ) in lesion diameters over 50 and 75 day follow - up period , respectively . 1 ) of lung abnormalities was the most frequent pattern and was observed in 10 ( 43% ) patients . a solitary pulmonary nodular pattern ( n = 4 , 17% ) ( fig . 2 ) and scattered nodular pattern ( n = 3 , 13% ) ( fig . 3 ) were the next most common patterns for lung lesions . a bronchopneumonic pattern ( fig . 4 ) was noted in two ( 9% ) patients , and a single mass lesion ( fig . 5 ) was identified in one patient ( 4% ) . in three patients , lung lesions were unclassifiable : one patient had a mass and a nodule , another patient had an area of consolidation and multiple scattered nodules in the left lung , and the third patient had clustered masses and nodules in the bilateral lower lung zones ( table 2 ) . in immunocompetent patients ( n = 12 ) , a clustered nodular pattern ( n = 6 , 50% ) , scattered nodular pattern ( n = 2 , 17% ) , solitary pulmonary nodular pattern ( n = 1 , 8% ) , solitary mass ( n = 1 , 8% ) , and unclassifiable lesions ( n = 2 , 16% ) were observed . in immunocompromised patients ( n = 11 ) , a clustered nodular pattern ( n = 4 , 36% ) , solitary pulmonary nodular pattern ( n = 3 , 27% ) , bronchopneumonia pattern ( n = 2 , 18% ) , scattered nodular pattern ( n = 1 ) , and unclassifiable lesions ( n = 1 , 9% ) were observed . of the six lobes observed ( lingular division was considered as a separate lobe ) , the left lower lobe was most frequently involved ( nine cases ) . the right lower lobe was involved in seven cases , the left upper lobe and the lingular division were involved in six cases each , the right middle lobe was involved in five cases , and the right upper lobe was involved in four cases . a nodule with a halo sign was also observed in two ( 9% ) patients . pleural effusion was noted in one ( 4% ) patient , but pericardial effusion was not observed in any patient . of the 10 patients that underwent pet , six showed higher fdg uptake compared to the mediastinal blood pool , thus simulating malignant fdg uptake , whereas four patients demonstrated a benign type of fdg uptake . the msuvs for fdg uptake of lung parenchymal lesions ranged from 1.8 to 9.3 ( median , 5.3 ; mean , 5.4 ) ( table 2 ) . clinical or radiological improvement was identified in 22 ( 96% ) patients . in one patient ( 4% ) with underlying hepatocellular carcinoma and no specific treatment was given , the parenchymal lesions of clustered nodules showed disease progression over a five - month follow - up period ( fig . 1 ) . of the 22 patients treated , complete clearance of lung abnormalities was noted in 15 ( 65% ) patients including four patients who had solitary pulmonary nodular lesions . in one patient , lesions disappeared completely with antifungal therapy only ( patient 23 in tables 1 , 2 ) . fourteen ( 93% ) of the 15 patients with complete clearance underwent surgical resection for the diagnostic workup . in nine ( 64% ) of the 14 patients , lesions were relatively localized ( clustered nodules , solitary pulmonary nodule , or a mass and a nodule ) . therefore , a diagnostic surgical resection removed all lesions . after the surgical resection , new nodular lesions developed in one patient ( patient 14 in tables 1 , 2 ) on follow - up ct scans obtained two months later . this patient was treated with antifungal agents for five months and the new lesions disappeared after the treatment . in the remaining eight patients , there was no newly developed lesion on follow - up scans . in another five ( 36% ) patients , diagnostic surgical resection could not remove all lesions . therefore , a total of six patients , where complete lesion clearance was achieved , received antifungal therapy after the surgical resection . in these six patients , the mean treatment duration was 4.2 months ( range , 2 - 6 months ) . in seven ( 31% ) patients , although improvement of lung lesions with a decreased extent of abnormalities was observed , the remaining lung lesions persisted ( partial response ) during the median follow - up period of 11 months ( range , 5 - 26 months ; mean , 13 months ) ( fig . 4 ) ( table 2 ) . of seven patients who were treated with antifungal agents only , one patient ( patient 23 in tables 1 , 2 , treated with amphotericin and fluconazole ) showed complete clearance . in the remaining six patients , who were treated with fluconazole , a partial response was noted . the mean follow - up period was 14 months ( range , 5 - 26 months ) . in these six patients with remaining disease , symptoms such as a cough , sputum , fever , and chest pain disappeared within three or six months of the treatment outset . in our study , the most frequent pattern of lung abnormalities depicted on ct scans was clustered nodules , which was observed in 10 ( 43% ) patients . this pattern was followed by solitary pulmonary nodular ( n = 4 , 17% ) and scattered nodular ( n = 3 , 13% ) patterns . thus , nodular lesions localized to a lobe or scattered to lung(s ) accounted for 73% of lung parenchymal abnormalities . our results concur with findings of previous reports in which clustered nodules or a solitary pulmonary nodule was the most common pattern of lung abnormalities for pulmonary cryptococcosis ( 9 - 11 , 21 ) . of the 11 patients that underwent previous ct scans before presentation , all patients showed slow progression or no change with respect to the extent of the lung lesions . in particular , two patients , in which the lesions increased in size by more than two times the original diameter at approximately 50 days after the initial assessment . therefore , a specific diagnosis of cryptococcosis is mandatory for the management of this infection . on the other hand , the chronicity of lung lesions was noted after the diagnosis of the disease was confirmed . lung lesions were indolent and the lung lesions did not show a rapid response to antifungal therapy . in our study , 11 ( 48% ) of 23 patients were immunocompromised and 12 were immunocompetent . furthermore , none of the immunocompromised patients showed a disseminated disease pattern such as diffuse interstitial lung disease accompanied by extensive hilar and mediastinal lymphadenopathy . it is well known that active tuberculosis or tuberculoma , acute and chronic pneumonia , lung abscess , fungal infection , and parasitic infestation are frequent causes of increased fdg uptake ( 22 ) . for these conditions , the presence and activity of leukocytes account for the increased fdg uptake . activated macrophages and neutrophils in inflammatory tissue utilize glucose as an energy source for chemotaxis and phagocytosis , whereas fibroblasts utilize glucose for proliferation . in our study , six ( 60% ) of 10 patients that underwent pet or pet / ct scans showed high fdg uptake . pulmonary metastases could not be excluded in these five patients because of the presence of multiple pulmonary nodules with a high rate of fdg uptake were noted on the pet scans , even though the nodules showed clustering on ct scans , persisted for a quite amount of time . thus , even in patients with an underlying malignancy and lung nodules that demonstrate high fdg uptake , when nodules are clustered in a lobe , a histopathological diagnosis should be performed for tissue confirmation . of these 15 patients , surgical resection with or without subsequent antifungal therapy was needed for complete clearance in 14 patients . in the remaining patient , complete clearance was achieved with antifungal therapy only . in the seven patients that were administered antifungal therapy only , a partial response was noted in six patients . in these six patients , although clinical improvement was achieved , the lung lesions persisted after the treatment , as seen on serial imaging studies . in one patient that was not given a treatment , thus , lung lesions were indolent and they did not show a rapid response to antifungal therapy . actinomycosis , semi - invasive aspergillosis , and pulmonary tuberculosis are well - known representative causes of chronic pneumonias that usually show an indolent disease course , before and after treatment . these three diseases usually present as single or multiple nodule(s ) or mass or as a single area of dense consolidation ( 23 - 25 ) . therefore , for chronic indolent lung lesions of various patterns including pulmonary cryptococcosis , tuberculosis , actinomycosis , and semi - invasive aspergillosis should be considered for the differential diagnosis of chronic pneumonia . our study has several limitations ; first , our study was retrospective by design . a prospective study on the imaging diagnosis or treatment method should be performed . third , because of the limited number of patients with the disease , diverse ct findings of the disease and variable follow - up periods , we were not able to provide meaningful ct data or findings that help predict patient prognosis ( complete disappearance versus remaining disease ) . in conclusion , pulmonary cryptococcosis is an indolent lung disease in non - aids patients that is slowly progressive in nature , even without adequate treatment . moreover , it does not show a rapid resolution of the lung abnormalities even with antifungal therapy . the disease may appear with various patterns of lung lesions ; however , a multiple clustered - nodular pattern , localized to a lung lobe , is the most common abnormality . in half of the cases , the disease appeared in patients with underlying disease , in which most of the patients have an extra - thoracic malignant condition . therefore , when lung lesions show clustered or scattered nodules of an indolent nature , pulmonary cryptococcosis should be considered in the differential diagnosis , even for a patient with an extrathoracic malignancy . the lesions may show high fdg uptake and may thus simulate a malignant lung condition at pet . although clinical improvement can be achieved in all patients , radiological improvement is slow , even after antifungal therapy . lastly , lung lesions may persist for a long time , showing a divergence from the clinical response .

amyotrophic lateral sclerosis ( als ) is a fatal paralytic disorder caused by degeneration of motor neurons in the brain and spinal cord . one tenth of the total als cases occur in familial forms ( fals ) , while the other is sporadic with no known genetic components ( sals ) . the clinical phenotypes between fals and sals are usually indistinguishable ; therefore , the understanding of the genetic cause in fals will be also relevant in sals cases . in spite of tremendous numbers of clinical , pathological , and biochemical studies , , there was a milestone event in the studies on als ; mutations in sod1 gene were identified to be associated with fals [ 2 , 3 ] . together with the recent findings on the pathogenic mutations in c9orf72 gene [ 4 , 5 ] , the mutations in sod1 are now prevailed in fals ( ~20% of total familial cases ) , and more than a hundred mutations in sod1 have been found to be associated with fals ( alsod : http://alsod.iop.kcl.ac.uk/ ) . the sod1 gene encodes a protein , cu , zn - superoxide dismutase ( sod1 ) , which catalyzes the detoxification of superoxide anion by dismutation into oxygen and hydrogen peroxide . retardation of such sod1 activity with mutations had been initially expected to be pathogenic in fals ; however , knockout of sod1 gene in mice did not reproduce the als - like symptoms , and also , some of the fals - causing mutations did not alter the dismutation activity of sod1 . instead , the severe progressive neurodegeneration can be well reproduced in transgenic mice expressing human sod1 with als - causing mutations . how mutations in sod1 gene exert toxicity eventually causing the death of motor neurons remains obscure , but it has been widely accepted that an sod1 protein increases its propensity for insoluble aggregation by pathogenic mutations . indeed , the surviving motor neurons in spinal cords of sod1-related fals cases are characterized by the presence of lewy body - like hyaline inclusions ( lbhi ) and skein - like inclusions that are composed of misfolded forms of mutant sod1 proteins . notably , furthermore , several antibodies specifically recognizing misfolded sod1 have detected conformational abnormalities of wild - type sod1 in a subset of sals cases ( vide infra ) . understanding pathological or even pathogenic roles of wild - type sod1 in als may contribute to the etiology of sals , which occupies almost 90% of total als cases . regarding roles of sod1 mutations in the fals pathomechanism , tremendous numbers of in vitro and in vivo studies have been performed , and many excellent reviews have been published so far ( e.g. , [ 9 , 1317 ] ) . accordingly , in this paper article , i have summarized recent development on our understanding of roles of wild - type sod1 in als . structural stability as well as enzymatic activity of sod1 is controlled by the post - translational processes that include the binding of copper and zinc ions and the formation of a highly conserved intramolecular disulfide bond [ 18 , 19 ] . copper ion bound in sod1 serves as an active site for dismutation of superoxide anion , and the structural stability of sod1 is significantly increased upon binding of a zinc ion and the formation of a disulfide bond . indeed , holo - sod1 with a disulfide bond has been known as one of the most stable proteins with around 90c of the melting temperature ( tm ) , which decreases to as low as 43c upon the disulfide reduction and demetallation in sod1 . retardation of the post - translational processes , therefore , increases a chance for sod1 to be misfolded and aggregated . in normal healthy conditions , wild - type sod1 is correctly processed to acquire metal ions and a disulfide bond , which prevents sod1 from aggregation . importantly , however , it is notable that wild - type sod1 has been shown in vitro to form amyloid - like fibrillar aggregates in the disulfide - reduced and apo state [ 21 , 22 ] . this result implies that wild - type sod1 is also susceptible to aggregation and becomes pathogenic , when the post - translational processes are disrupted . recently , mutations in several genes other than sod1 have been identified in a subset of fals cases , which include genes encoding tdp-43 [ 2326 ] , fus [ 27 , 28 ] , and optineurin . these proteins with pathogenic mutations constitute pathological inclusions , but it is also important to note that immunoreactivities to tdp-43 , fus , and optineurin have been detected in inclusions in sals cases even without any mutations in those proteins [ 3033 ] . although it remains unclear what triggers the aggregation of those wild - type proteins in sals cases , these observations have implied the presence of a common pathomechanism converging familial and sporadic forms of als . in contrast , wild - type sod1 appears not to be involved in the formation of inclusions in sals cases ( vide infra ) , although fals cases with mutations in sod1 gene invariably exhibit sod1-immunoreactive inclusions . furthermore , these sod1-positive inclusions in sod1-fals cases are not immunostained with antibodies to tdp-43 [ 32 , 33 ] , fus , and optineurin , while some sod1-fals cases exhibit two types of mutually exclusive inclusions : sod1-positive and tdp-43-positive inclusions . distinct pathomechanisms would , therefore , exist between sod1-fals and the other als cases . despite this , it is important to consider that , even without mutations , wild - type sod1 exhibits pathological changes in a subset of sals cases . indeed , formation of tdp-43/fus - positive inclusions in sals as well as fals with fus mutations has been recently reported to be associated with misfolding of wild - type sod1 proteins . in addition , chronic overexpression of wild - type human sod1 in mice causes several neurodegenerative changes including mitochondrial vacuolization and loss of spinal motor neurons , implying that sod1 can be pathogenic even without fals - causing mutations . involvement of wild - type sod1 in the pathological inclusions has been first pointed out by shibata et al . [ 37 , 38 ] . they have found lbhis in 10 out of 20 sals cases , and some of those inclusions in anterior horn cells of spinal cord have shown intense immunoreactivity toward the rabbit antisera raised against human sod1 . interestingly , the proportion of lbhis with sod1 immunoreactivity varied from case to case ( 760% ) , which is in sharp contrast to the fals cases with mutations in sod1 gene ( 100% ) . they have , however , not verified whether their sals cases have mutations in sod1 gene . because mutations in sod1 gene have been found in less than 5% of total sals cases , care will be needed to interpret the sod1-immunoreactive inclusions in sals cases . watanabe et al . have also observed hyaline inclusions in 6 out of 17 sals cases , but those inclusions were not immunoreactive to a rabbit polyclonal antibody raised against a asp no description was again found in their paper on whether the sals cases had mutations in sod1 gene . despite this , it is interesting to note that skein - like inclusions were immunoreactive to a protein , ccs , in 1 out of 17 sals cases . ccs is a copper chaperone for sod1 , which specifically delivers a copper ion and also introduces a conserved disulfide bond in sod1 . recruitment of ccs into insoluble inclusions may thus increase the intracellular fraction of inactive sod1 and facilitate the formation of abnormal sod1 with pathological conformations . nonetheless , ccs immunoreactivity was not observed in the hyaline inclusions in sod1-related fals cases with a4v mutation , and knockout of ccs gene in a mouse did not produce any pathological changes as well as als - like symptoms . in contrast to the previous report by shibata et al . [ 37 , 38 ] , therefore , these observations have supported less contribution of wild - type sod1 and ccs to the pathologies in sals cases . native sod1 has been well known to exist as a tight dimer , and the monomerization is often considered to be involved in the misfolding / aggregation pathway of sod1 . to detect misfolded sod1 in affected tissues of als , it is quite reasonable to make an antibody that specifically recognizes monomeric sod1 . for that purpose , the sedi ( sod1-exposed - dimer - interface ) antibody was prepared by rabbit immunization with a arg ile peptide at the dimer interface of sod1 , which is buried and inaccessible in the dimeric state but becomes exposed upon monomerization . indeed , this sedi antibody has successfully immunostained hyaline inclusions in motor neurons of the fals cases with sod1 mutation ( a4v , a4 t , v14 m , g27/p28 , i113 t ) ; however , inclusions were not detected with the sedi antibody in all of 13 sals cases and 1 non - sod1 fals case , where no mutations in sod1 gene were confirmed . another antibody ( usod ) has also been produced by rabbit immunization with an sod1 fragment from leu to his , which constitutes an internal hydrophobic core of the native structure . this region ( leu his ) is supposed to become exposed only when sod1 is extensively misfolded ; therefore , the usod antibody specifically binds extensively misfolded sod1 but not native dimeric as well as folded monomeric states . similar to the sedi antibody , the usod antibody has detected pathological inclusions in fals cases with sod1 mutations ( a4v , g27/p28 ) but not in sals cases without sod1 mutations . despite this , these results would not be sufficient to conclude less contribution of wild - type sod1 to the disease pathologies , because wild - type sod1 in sals cases may adopt abnormal conformations that can not be recognized with the sod1 antibodies above . indeed , forsberg et al . have systematically prepared a series of rabbit polyclonal antibodies that are raised against the sod1 fragments corresponding to ala gly , his asp , glu arg , and asn gln , among which ala phe , cys gly , and asn gln antibodies , in particular , reacted strongly with chemically denatured sod1 but hardly at all with native sod1 . importantly , these antibodies detected small round inclusions in spinal motor neurons of all the 29 sporadic and 8 familial als cases lacking mutations in sod1 gene ; the abundance of such inclusions was much smaller in controls without neurological diseases . using cys gly and asn gln antibodies , furthermore , misfolded wild - type sod1 in the form of granular aggregates was regularly detected in the nuclei of astrocytes , microglia , and oligodendrocytes in als patients lacking sod1 mutations . these small granular inclusions in sals cases are distinct from the inclusions in fals with sod1 mutations , which are often characterized with large lewy body - like morphologies . in sals cases , therefore , wild - type sod1 would not participate in the formation of lewy body - like inclusions , but it is certain that wild - type sod1 undergoes some conformational changes under pathological conditions . there has been also an interesting antibody called c4f6 for detection of abnormal sod1 conformations , which is a mouse monoclonal antibody raised against recombinant apo - sod1 with g93a mutation . in in vitro experiments , an epitope of c4f6 was found to include specific conformations realized in sod1 but not wild - type sod1 . interestingly , however , the structure of wild - type sod1 was changed by treatment with h2o2 so that it became detectable with c4f6 . h2o2 has been found to primarily oxidize the free thiol group at cys into sulfonic acid , which also appears to occur even under physiological conditions . furthermore , such c4f6-reactive conformers of oxidized sod1 inhibits fast axonal transport to a degree reminiscent of that of mutant sod1 ; therefore , cys - oxidized sod1 will share important structural and toxic features with fals - causing mutant sod1 proteins . as expected , skein - like inclusions in spinal motor neurons of sod1-related fals cases ( sod1 ) were immunoreactive with c4f6 antibody . notably , positive c4f6 staining was also observed in 4 out of 9 sals cases , while no large skein - like and lewy body - like inclusions immunoreactive with c4f6 were reported in sals cases . rather , the diffused staining patterns of c4f6 antibody in sals cases suggested that the pathological forms of wild - type sod1 remain relatively soluble . indeed , biochemical analysis did not support elevated levels of insoluble wild - type sod1 in sals cases . recently , the diffused staining with c4f6 was reported to be seen not only in als cases , but also in motor neurons from patients dying with other neurological diseases and in non - neurological controls . replacement of the c4f6 antibody with normal mouse serum also resulted in diffused staining in some motor neurons of sals cases , implying the significant contributions of nonspecific background to the diffused staining with c4f6 . it thus requires further investigation to clarify whether c4f6 antibody detects misfolded wild - type sod1 in sals cases without sod1 mutations . a very few studies have been performed to characterize molecular signatures of wild - type sod1 purified from sals cases , but several biochemical approaches have been attempted to illuminate pathological conformers of wild - type sod1 in non - sod1 sals cases . one of such approaches is based upon the idea that different protein conformers will exhibit distinct accessibility toward chemical compounds . given that some of covalent modifications are well expected to magnify conformational differences of a protein molecule , gruzman et al . have first prepared sod1 from sals tissue samples and then covalently modified accessible lysine residues in sod1 with n - hydroxysulfosuccinimide - long chain - biotin ( sulfo - nhs - lc - biotin ) . after biotinylation , sod1 species with electrophoretic mobility corresponding to 32 kda of molecular weight became evident in sals as well as fals cases . such biotinylation - dependent 32-kda species of sod1 also existed in some of normal healthy controls and patients with other neurological diseases , which was , however , reported to be statistically insignificant . accordingly , a small fraction of wild - type as well as mutant sod1s would adopt such abnormal conformations that are common to all als cases , but it still remains elusive how sod1 changes its conformation under pathological conditions . as mentioned above , antibodies raised against glu val and cys gly of sod1 exhibit high immunoreactivity specifically to abnormal misfolded but not natively folded sod1 . by using elisa with those antibodies , zetterstrm et al . have attempted to quantify amounts of pathological forms of sod1 in als cases . in corticospinal fluid ( csf ) , approximately 0.11 ng / ml of misfolded sod1 was found to exist ; however , there was no difference in the amounts of misfolded sod1 between als patient groups ( 96 patients ) and the neurological controls ( 38 controls ) . given that misfolded sod1 has been immunohistochemically detected inside motor neurons , it is particularly interesting to test if their elisa can quantitatively detect significantly more amounts of misfolded sod1 in lysates of spinal motor neurons from non - sod1 sals cases than those of controls . regarding pathogenic conformations , if any , of sod1 in sals , it is notable that wild - type sod1 oxidized with h2o2 shares conformational epitopes to c4f6 antibody with fals - causing mutant sod1 . as mentioned above , a primary result of h2o2-oxidation on sod1 in vitro is the sulfonylation at cys , but it remains obscure how such oxidation affects the conformation of sod1 proteins . given that there has been no evidence to support the sulfonylation at cys of sod1 in sals cases , it will be first necessary in a future to examine the spinal cord tissues from sals patients by using an antibody recognizing sulfonylated cys of sod1 . in addition , several other types of oxidation - induced aggregation have been proposed in wild - type sod1 . for example , in a holo state , wild - type sod1 exhibits a bicarbonate anion - dependent peroxidase activity involving carbonate anion radical , which then oxidizes a unique trp residue in sod1 and induces aggregation with non - disulfide covalent cross - links . when zn - deficient form of sod1 is incubated with cucl2 and ascorbic acid , furthermore , metal - catalyzed oxidation occurs mainly at metal - binding his residues in sod1 and forms aggregates [ 44 , 57 ] . sod1 polypeptide in the disulfide - reduced apo state is also susceptible for oxidation ; either h2o2 or oxidized glutathione oxidizes free thiols at cys residues to form disulfide - linked multimers [ 18 , 19 , 58 ] . sod1 is thus considered to undergo conformational changes in oxidative conditions in vitro ; however , little evidence has been available on the presence of oxidized sod1 in als patients . in that sense , a recent study by guareschi and coworkers has provided valuable biochemical data supporting aberrant oxidation of sod1 under pathological conditions . to determine whether wild - type sod1 is indeed oxidized in sals cases , guareschi and coworkers have first immunoprecipitated sod1 from lymphoblasts derived from als patients and non - neurologic controls and then analyzed the presence of oxidized carbonyl groups in those immunoprecipitated sod1 by derivatization with 2,4-dinitorophenylhydrazine ( dnph ) . amounts of sod1 with oxidized carbonyl groups , which was called iper - oxidized sod1 , were found to be significantly higher in a subset of sals patients with bulbar onset compared with fals with sod1 mutations and controls . similar to mutant sod1 in fals cases , furthermore , iper - oxidized wild - type sod1 appeared to form inclusions in lymphoblasts of sals patients with bulbar onset . while it still remains unknown in a molecular level how sod1 is oxidized to form iper - oxidized species , this study will be particularly relevant to the extent that oxidation of wild - type sod1 is a pathological event describing a subset of sals cases . as described above , i have briefly reviewed increasing numbers of studies that focus upon roles of wild - type sod1 in pathogenesis of sals cases , but it still remains quite obscure whether sod1 is involved in a pathomechanism of the als cases without mutations in sod1 gene . nonetheless , wild - type sod1 may somehow mediate toxicity to degenerate motor neurons ; for example , astrocytes from both fals and sals patients are similarly toxic to motor neurons and that knockdown of sod1 gene in those astrocytes significantly attenuates the toxicity toward motor neurons . besides , wild - type sod1 seems to adopt abnormal conformations at least in a subset of sals cases . in order to clarify possible roles of wild - type sod1 in als pathologies , further development of new sod1 antibodies for that purpose , structural and biochemical characterization on a misfolding process of purified sod1 proteins in vitro is required . furthermore , experimental models for non - sod1 sals cases , which have not been established so far , will be an excellent platform for biochemical as well as immunocytochemical characterization of wild - type sod1 and definitely facilitate the understanding of pathogenic / pathological roles of wild - type sod1 in als cases .

untreated vertically acquired hiv infection is associated with high mortality rates with a 50% probability of dying by 2 years of age among african cohorts in the pre however , as hiv epidemics have matured , survival estimates have been successively revised upward , and a substantial number of perinatally infected children are presenting with hiv infection in later childhood or adolescence . it is estimated that a third of hiv - infected infants have slow - progressing disease with a median survival of at least 16 years . unlike children who have rapid disease progression and present with aids - defining illness in infancy , children with slow - progressing hiv are either paucisymptomatic or typically have a history of multiple , nonspecific complaints , including recurrent upper respiratory tract or skin infections that are also common among their hiv - uninfected peers . there is strong evidence that immediate initiation of art reduces mortality in infants , in particular those under 1 year of age . the who 2013 hiv treatment guidelines recommend immediate art initiation on diagnosis regardless of clinical or immune stage in all children aged under 5 years . for those over 5 years , who 2013 guidelines ( which were standard of care when this study was being conducted ) recommended that , as for adults , art is deferred until the clinical stage 3 or 4 hiv disease is apparent or if the cd4 count drops below 500 cells per millimeter . in 2015 , the who further revised hiv treatment guidelines recommending that art be commenced in all age groups regardless of clinical or immune status , although evidence for immediate art commencement is lacking in older children and adolescents . while the risk of aids - defining infections is low above a cd4 threshold of 500 cells per cubic millimeter , long - standing infection is associated with development of chronic complications , which may not fulfill the criteria for art initiation . for example , we have previously demonstrated a high prevalence of chronic respiratory symptoms among adolescents with vertically acquired hiv infection . however , objective measures of lung function were not performed , and the study included both art - naive and art - treated individuals . we investigated the prevalence of chronic symptoms , including a standardized assessment of growth and lung function and whether these were associated with immunological status among children aged 615 years at hiv diagnosis of hiv infection . a cross - sectional study was performed in 7 public sector primary health care clinics ( phcs ) in 7 high population density suburbs in southwest harare , zimbabwe between january 2013 and december 2014 . each suburb in harare is served by one main phc , termed polyclinic , which provides acute primary care , antenatal and postnatal care , mother and child health services , hiv testing and care . primary health care provision is nurse led , supported by weekly consultation visits by a general medical practitioner . children are managed using who integrated management of childhood illness protocols with referral to the local hospital where required . art and cotrimoxazole prophylaxis are provided free of charge , although each hiv consultation visit incurs a cost of us $ 1 . provider - initiated hiv testing and counseling ( pitc ) ie , offering hiv testing to all individuals attending health facilities regardless of the reason for presentation has been part of who and zimbabwean national guidelines since 2007 and testing is free of charge . nurse - led art initiation for children was introduced at the 7 phcs with supervision from a physician ( clinics having previously only provided art for those having been initiated on treatment in secondary health care facilities ) . nurses were trained on hiv counseling and management , and art was provided according to national guidelines . until february 2014 , participants were initiated on art if their cd4 was below 350 cells per cubic millimeter or had who stage 3 or 4 infection . from march 2014 , zimbabwe adopted the who 2013 consolidated guidelines , with the threshold for art initiation revised to 500 cells per millimeter . children aged between 6 and 15 years who tested hiv positive at the study phcs were offered enrollment into the study . children were excluded from the study if they resided outside harare , as follow - up may have been difficult due to distance to travel to attend clinical review . contact with health services , history of past illness , exposure to art including maternal art for prevention of mother - to - child hiv transmission ( pmtct ) , drug history , and acute and chronic symptoms were recorded , including respiratory and gastrointestinal symptoms , and problems with hearing , vision , speech , and gross motor function . a standardized physical examination was performed , including inspection of the skin for herpes zoster scarring , papular pruritic eruptions , planar warts , verrucous warts , molluscum contagiosum , fungal infection , and kaposi sarcoma . the oral cavity was examined for gingivitis , periodontitis , candidiasis , and kaposi sarcoma . the head circumference was determined by measuring the greatest occipitofrontal circumference , with the larger of 2 readings recorded . tanner pubertal staging was performed in children aged > 9 years . in females , breast and pubic hair development and age at menarche cardiorespiratory function was assessed by the medical research council dyspnea scale score and modified incremental shuttle walk test ( iswt ) with pretest and posttest recording of respiratory rate , heart rate , and peripheral oxygen saturations . iswt was not performed if baseline oxygen saturation was less than 88% , or if resting heart rate or respiratory rate exceeded 120 and 30 per minute , respectively . spirometry was performed by trained nurses using an easyone world spirometer ( ndd medical technologies inc . , after demonstration of the procedure , the participant performed forced exhalation maneuvers while seated until quality criteria had been reached or 8 trials had been completed . the trial with the highest forced expiratory volume at 1 second ( fev1 ) and forced vital capacity ( fvc ) was selected for interpretation . reversibility testing by repeat spirometry was performed 15 minutes after administration of 2.5 mg of nebulized salbutamol , if any abnormality ie , either obstruction as defined by fev1:fvc of less than 1.64 sd below the mean or restriction as defined by fvc < 1.64 sd below mean with normal fev1:fvc ratio , was present . cd4 count was measured using an alere pima cd4 ( waltham , ma ) machine . full blood count , renal , and liver function tests are not a prerequisite for starting art in national guidelines , and these were only performed if clinically indicated . participants who screened positive on the who tb screen were asked for a sputum sample . sputum was examined onsite by ziehl - nielsen smear microscopy and xpert tb ( cepheid , sunnyvale , ca ) . data were collected from paper forms by optical mark recognition ( cardiff teleform intelligent character , version 10.7 ) and analyzed using stata , version 12.1 ( stata corporation , college station , tx ) ) . z - scores for height - for - age , weight - for - age , and head circumference for - age were calculated using the 1990 british growth reference curves . the association between a priori defined variables and cd4 count was determined using logistic regression , adjusting for age and sex . a z - score of < 2 for height - for - age and weight - for - age was considered to represent stunting and wasting , respectively . pubertal delay was defined as girls not having reached tanner 2 breast development by age 12 years and boys not having reached tanner 2 testicular volume by age 14 years . an obstructive lung defect was defined as fev1 less than 1.64 sds below the mean and fev1:fvc of less than 1.64 sd below the mean . a reduced fvc ( which would be suggestive of restrictive defect ) was defined as an fvc below 1.64 sd below the mean with a normal or increased fev1:fvc ratio . reversibility of either obstructive or restrictive defect was defined as greater than or equal to 12% improvement in fev1 after repeat spirometric testing postadministration of salbutamol . written informed consent was obtained from all caregivers and written assent obtained from participants . ethical approval for the study was obtained from the medical research council of zimbabwe , the harare city health department ethics committee , the biomedical research and training institute institutional review board , and the london school of hygiene and tropical medicine ethics committee . a cross - sectional study was performed in 7 public sector primary health care clinics ( phcs ) in 7 high population density suburbs in southwest harare , zimbabwe between january 2013 and december 2014 . each suburb in harare is served by one main phc , termed polyclinic , which provides acute primary care , antenatal and postnatal care , mother and child health services , hiv testing and care . primary health care provision is nurse led , supported by weekly consultation visits by a general medical practitioner . children are managed using who integrated management of childhood illness protocols with referral to the local hospital where required . art and cotrimoxazole prophylaxis are provided free of charge , although each hiv consultation visit incurs a cost of us $ 1 . provider - initiated hiv testing and counseling ( pitc ) ie , offering hiv testing to all individuals attending health facilities regardless of the reason for presentation has been part of who and zimbabwean national guidelines since 2007 and testing is free of charge . nurse - led art initiation for children was introduced at the 7 phcs with supervision from a physician ( clinics having previously only provided art for those having been initiated on treatment in secondary health care facilities ) . nurses were trained on hiv counseling and management , and art was provided according to national guidelines . until february 2014 , participants were initiated on art if their cd4 was below 350 cells per cubic millimeter or had who stage 3 or 4 infection . from march 2014 , zimbabwe adopted the who 2013 consolidated guidelines , with the threshold for art initiation revised to 500 cells per millimeter . children aged between 6 and 15 years who tested hiv positive at the study phcs were offered enrollment into the study . children were excluded from the study if they resided outside harare , as follow - up may have been difficult due to distance to travel to attend clinical review . contact with health services , history of past illness , exposure to art including maternal art for prevention of mother - to - child hiv transmission ( pmtct ) , drug history , and acute and chronic symptoms were recorded , including respiratory and gastrointestinal symptoms , and problems with hearing , vision , speech , and gross motor function . a standardized physical examination was performed , including inspection of the skin for herpes zoster scarring , papular pruritic eruptions , planar warts , verrucous warts , molluscum contagiosum , fungal infection , and kaposi sarcoma . the oral cavity was examined for gingivitis , periodontitis , candidiasis , and kaposi sarcoma . the head circumference was determined by measuring the greatest occipitofrontal circumference , with the larger of 2 readings recorded . tanner pubertal staging was performed in children aged > 9 years . in females , breast and pubic hair development and age at menarche cardiorespiratory function was assessed by the medical research council dyspnea scale score and modified incremental shuttle walk test ( iswt ) with pretest and posttest recording of respiratory rate , heart rate , and peripheral oxygen saturations . iswt was not performed if baseline oxygen saturation was less than 88% , or if resting heart rate or respiratory rate exceeded 120 and 30 per minute , respectively . spirometry was performed by trained nurses using an easyone world spirometer ( ndd medical technologies inc . , after demonstration of the procedure , the participant performed forced exhalation maneuvers while seated until quality criteria had been reached or 8 trials had been completed . the trial with the highest forced expiratory volume at 1 second ( fev1 ) and forced vital capacity ( fvc ) was selected for interpretation . reversibility testing by repeat spirometry was performed 15 minutes after administration of 2.5 mg of nebulized salbutamol , if any abnormality ie , either obstruction as defined by fev1:fvc of less than 1.64 sd below the mean or restriction as defined by fvc < 1.64 sd below mean with normal fev1:fvc ratio , was present . cd4 count was measured using an alere pima cd4 ( waltham , ma ) machine . full blood count , renal , and liver function tests are not a prerequisite for starting art in national guidelines , and these were only performed if clinically indicated . participants who screened positive on the who tb screen were asked for a sputum sample . sputum was examined onsite by ziehl - nielsen smear microscopy and xpert tb ( cepheid , sunnyvale , ca ) . data were collected from paper forms by optical mark recognition ( cardiff teleform intelligent character , version 10.7 ) and analyzed using stata , version 12.1 ( stata corporation , college station , tx ) ) . z - scores for height - for - age , weight - for - age , and head circumference for - age were calculated using the 1990 british growth reference curves . the association between a priori defined variables and cd4 count was determined using logistic regression , adjusting for age and sex . a z - score of < 2 for height - for - age and weight - for - age was considered to represent stunting and wasting , respectively . pubertal delay was defined as girls not having reached tanner 2 breast development by age 12 years and boys not having reached tanner 2 testicular volume by age 14 years . an obstructive lung defect was defined as fev1 less than 1.64 sds below the mean and fev1:fvc of less than 1.64 sd below the mean . a reduced fvc ( which would be suggestive of restrictive defect ) was defined as an fvc below 1.64 sd below the mean with a normal or increased fev1:fvc ratio . reversibility of either obstructive or restrictive defect was defined as greater than or equal to 12% improvement in fev1 after repeat spirometric testing postadministration of salbutamol . written informed consent was obtained from all caregivers and written assent obtained from participants . ethical approval for the study was obtained from the medical research council of zimbabwe , the harare city health department ethics committee , the biomedical research and training institute institutional review board , and the london school of hygiene and tropical medicine ethics committee . during the study period , 9655 children were tested for hiv of whom 449 ( 4.6% ) tested hiv positive . an additional 21 participants were identified who had been diagnosed before study commencement but had not engaged in care and/or had not commenced art . in total , 385 ( 86% ) the remainder were not enrolled because of residence outside the study area ( n = 24 , 5% ) , declined consent ( n = 25 , 5.5% ) , care sought elsewhere ( n = 34 , 7.5% ) , and wrong age ( n = 2 , 0.4% ) . the median age at diagnosis was 11 years ( interquartile range ( iqr ) 813 ) , and 52% were female . most participants were infected through mother - to - child transmission based on a history of maternal or natural sibling hiv or death , and self - report of no sexual debut , blood transfusions or surgery , and less than 2% of mothers of participants had received art for pmtct . although 78% of participants had attended a phc in the past 6 months and/or been previously hospitalized , hiv testing had not been performed ( table 1 ) . baseline characteristics of participants at hiv diagnosis ( n = 385 ) more than half of participants rated their health in the past 3 months as poor ( table 2 ) . chronic respiratory symptom was frequent with 54% reporting cough of more than 1 month - duration and 16% reporting dyspnea . at rest , 12% had oxygen saturations < 88% and a further 10% dropped their oxygen saturations below 88% after exercise . of the 238 participants who underwent spirometry and were able to produce quality traces , 23 ( 10% ) had obstructive lung function defect with only 3 demonstrating reversibility with salbutamol , and 43 ( 18% ) had a reduced fvc . notably , despite 155 ( 40% ) screening positive for tb on the who screen , only 1 participant was found to have tb on genexpert . chronic morbidity in study participants the median height - for - age , weight - for - age , and head circumference for - age z - scores were 1.2 ( iqr 1.9 to 0.41 ) , 1.1 ( iqr 2.1 to 0.45 ) , and 1.4 ( iqr 2.4 to 0.66 ) , respectively . in addition , 27% of girls and 13% of boys were considered to have pubertal delay , and 24% of girls aged 15 years had not experienced menarche . of the 80 participants with who stage 4 disease , 66% were classified as such based on stunting alone . other chronic impairments included hearing difficulties self - reported by 12% , visual impairment by 6% , and speech impairment or gross motor defects by 2% . the median cd4 count was 375 cells per cubic millimeter ( iqr 215599 ) and 40% had who stage 3 or 4 hiv infection . using a cd4 count threshold of 350 cells per cubic millimeter and/or who stage 3/4 disease , 67% children were eligible for art , this figure increasing to 78% if the threshold was changed to 500 cells per cubic millimeter . using logistic regression analysis adjusted for age and sex , participant self - report of ill health in the past 3 months was associated with a cd4 count < 350 cells per cubic millimeter ( adjusted odds ratio 1.89 , 95% ci : 1.25 to 2.88 ) as was having a chronic skin condition ( adjusted odds ratio 1.65 , 95% ci : 1.02 to 2.69 ) . however , a cd4 count < 350 cells per cubic millimeter or < 500 cells per cubic millimeter was not associated with who stage , reduced fev1 or fvc z - score or growth parameters such as height - for - age , weight - for - age , or head circumference z - scores ( table 3 ) . the main finding of this study was the heavy burden of chronic morbidity among older children and adolescents at time of hiv diagnosis . consistent with other studies , a quarter of participants had stunting and 23% had pubertal delay . although catch - up growth can be achieved after initiation of art , children who begin treatment in later childhood are typically unable to regain their height potential . in addition , more than a third of participants had a head circumference for - age z - score less than 2 , which could partly be explained by suboptimal brain growth in early childhood . unlike the progressive encephalopathy , manifest as failure to attain or loss of developmental milestones or intellectual capacity and motor defects , that is typical in hiv - infected infants and young children , gross motor defects and speech impairment were rare among our participants with slow - progressive disease . however , studies have reported defects in seemingly asymptomatic hiv - infected children in fine motor function , memory , perceptual performance , quantitative abilities , and mental processing and language abilities . these deficits are subtle and are not easily identified on routine questionnaire , and therefore , without formative testing may have been an underrepresentation of degree of morbidity in relation to higher functioning capacity in our study . these findings have to be interpreted with caution ; however , as western reference ranges for head circumference were used because of a lack of normative data from african children , and head circumference does vary by ethnic group . chronic respiratory disease was common with cough , hypoxia , reduced exercise tolerance , and obstructive lung defects being the predominant features . other studies have also shown a high prevalence of obstructive lung defects , with little or no reversibility . a study which performed chest computed tomography in adolescents with long - standing , vertically acquired hiv infection showed that constrictive obliterative bronchiolitis was the predominant cause of chronic lung disease , with lymphoid interstitial pneumonitis ( the most commonly recognized cause of lung disease in hiv - infected children ) being a rare finding . obliterative bronchiolitis is a progressive , life - threatening condition and is well recognized as sequelae of respiratory tract infections , which were commonly reported by participants . although not life - threatening , these are commonly recognized as stigmata of hiv infection , may take long periods to resolve after art and for some conditions particularly planar warts , effective treatments are not available . importantly , we observed no association between cd4 count and who hiv disease stage , a finding also noted previously . there was also no association between cd4 count and chronic conditions , including stunting and poor lung function . taken together , this implies that cd4 count may not be an appropriate criterion for starting art in older children . based on the who 2013 hiv treatment guidelines , 12% of participants would not have been eligible for art . given the lack of evidence of the mortality benefit of immediate art in older children and the concern about drug toxicity and adherence , guidelines until recently have recommended deferring art in older children . recent trials in adults have demonstrated that early initiation of art reduces the risk of aids and non - aids events , but these trials excluded older children and adolescents . our findings demonstrate that children with slow - progressing disease may have preserved cd4 counts but do develop chronic complications such as poor growth and chronic lung disease . it is , thus , possible that immediate art may also prevent development of chronic complications in children . a randomized controlled trial would definitively establish whether immediate art would prevent development or progression of chronic complications , but this is not going to be possible given the recent change in who guidelines recommending immediate art in all adults and children . the scale - up of programs to pmtct has resulted in a substantial decline in the numbers of children infected with hiv , but coverage remains suboptimal in many high burden countries . the limited availability of hiv testing services for children and the low rates of early infant diagnosis mean that for many infected infants , hiv diagnosis occurs in late childhood or adolescence after many years of ill health . in this study , 78% of participants had previous contact with health facilities , including 27% having been hospitalized , but had not had hiv testing . despite recommendations that pitc should be offered as standard in health facilities in hiv high prevalence settings , in practice , hiv testing is often prompted only after presentation with typical hiv - related symptoms . children with slow - progressing disease may take years before they develop the well - recognized hiv indicator conditions that prompt an offer of hiv testing , by which time they develop chronic complications and organ damage which may not be reversible with art once established . to our knowledge , this is the first study to report the prevalence of morbidity at hiv diagnosis in children and adolescents with long - standing hiv infection . most children were vertically infected , implying living with hiv infection for up to 15 years without previous treatment . participants were diagnosed after optimized pitc of attendees regardless of cause of presentation , with 80% of all attendees with previously unknown hiv status undergoing hiv testing ( data not shown ) . the study was based in primary care facilities and therefore was not biased toward sicker children . there was no hiv - uninfected or an hiv - treated comparison group in our study . vision , hearing , neurocognitive , and musculoskeletal function were not formally assessed but relied on self - report . this was partly due to logistic reasons as respiratory assessment could not be performed at the initial assessment necessitating a second appointment within 2 weeks which some participants did not attend . in addition , 19 ( 5% ) participants were too ill to perform both spirometry and/or iswt , which may have led to an underestimation of degree of lung disease present among the participants . local reference ranges for lung function , puberty , and head circumference are not available . british reference ranges were used for height and weight z - score calculations because of a lack of who weight - for - age reference ranges for children over 9 years of age , which may not be appropriate for an african population . our study shows a substantial burden of chronic morbidity among hiv - infected children diagnosed in later childhood , even among those with preserved cd4 counts . recognition of this burden is needed to stimulate earlier diagnosis and improve access to hiv care for this age group . there is a pressing need to strengthen pitc and potentially provide other more effective services for hiv testing in this age group , and for timely institution of art . current recommendations of deferred art in children may put them at risk of developing chronic complications . the recent who guidelines recommending treatment of all hiv - infected individuals regardless of age and disease stage may reduce the risk of development of chronic complications . studies investigating the impact of immediate art on aids and non - aids events in children and the pathogenesis of chronic complications will inform development of optimum care provision for hiv - infected children .

the first patient is a 39-year - old male who complained of posterior neck pain and occipital headache on the right side after a rear - end collision , which occurred one month ago . at the time of the accident , he suffered from radiating pain in the right arm , but the radiating symptom subsided by the time of his first visit to the clinic . after confirmation of positive responses , the patient underwent pulsed radiofrequency of the right third occipital nerve under fluoroscopic control . a 22-gauge , 10-cm - long , 10-mm active tip rfk needle ( radionics inc . , burlington , ma , usa ) was used . symptom subsided , but 8 months later , the same symptom on the right occipital area and posterior neck pain recurred . another diagnostic block was performed under ultrasound control , and pain relief was achieved . with pain relief , . ton was founded as a hypoechoic oval shape encircled by a hyperechoic halo at c2 - 3 zygapophygeal joint line ( fig . c3 deep medial branch nerve was also founded at the middle of the articular pillar of c3 ( fig . the rfk needle used in previous pulsed radiofrequency was inserted to ton craniocaudally , using an in - plane approach ( fig . 2 ) . response to sensory stimulation was checked at 50 hz , 0.5 v , and pulsed radiofrequency was conducted twice for 120 seconds on 42. in order to confirm the exact location , we cross checked the image with fluoroscopic view ( fig . same manner of approach was used for c3 deep medial branch , and we terminated the procedure . four months after the procedure , patient 's pain is maintained at nrs 2 , and he is on a regular departmental outpatient follow up . the second patient is a 42-year - old male with right occipital headache , and posterior neck pain after artificial disc implantation at c4 - 5 and c6 - 7 levels . before his visit to our hospital , he received cervical epidural injections , neuroplasty , and physical therapy at other hospitals , but effects were minimal . two times of diagnostic ton blocks were performed as same as the first case and the patient showed positive responses to each blocks . one year after the procedure , patient does not show increase in nrs , and he is also on a regular follow up . there was a report in the mid-80 's , where ton block showed relief of headache in 70 - 80% of occipital headache patients . this report suggested c2 - 3 zygapophygeal joint as the main cause of cervicogenic headache . c2 - 3 zygapophygeal joint is mainly innervated by ton , c3 deep medial branch and c2 communicating branch also innervate c2 - 3 zygapophygeal joint . in this study , we performed pulsed radiofrequency on both ton as well as c3 deep medial branch . diagnostic block of cervical medial branch is the sole method of cervical zygapophygeal joint pain diagnosis . two individual blocks should be performed on a different day to reduce false positive response . considering the possible anatomical variations of ton , blocks on three target points are required for diagnostic block or rf neurotomy under fluoroscopic control . recently , there are several studies on an ultrasound anatomy of cervical zygapophygeal joints and cervical medial branches , and ultrasound - guided cervical medial branch blocks . also reported that they could find the correct level of c2 - 3 joint and were able to perform ton block on ultrasound guidance . according to their study and anatomy of ton , the nerve can be visualized better in a longitudinal view , rather than in a transverse one . in present cases , we were also able to easily visualize ton in a longitudinal view . in nerve block under ultrasound guidance , relatively large amount of injection is used , and ambiguous visualization of the target nerve is acceptable . however , if rf neurotomy is to be performed , accurate visualization of target nerve may be very crucial . there has been a report on ultrasound - guided cervical medial branch rf neurotomy , but no reports on ultrasound - guided ton radiofrequency . described rf neurotomy in the cervical spine . in their cases , zygapophygeal joint level and medial branch nerve were confirmed in the longitudinal view , once confirmed , transducer was rotated 90 degrees for a parallel introduction of the electrode to the target nerve with an in - plane technique . when performing rf neurotomy at the other levels , the waist of articular pillar was served as a bony landmark . however , in case of ton , they could not find appropriate bony landmark in transverse view for ultrasound - guidance radiofrequency lesioning therefore , rf neurotomy of ton could not be performed in their study . unlike the conventional rf neurotomy , it is believed that therapeutic effect of pulsed radiofrequency is obtained by delivering an electromagnetic field procuced by rf current . recent experimental studies show pulsed radiofrequency causing an increase in the c - fos expression and synaptic change in transmission . although , there is a lack of evidence for equal effectiveness compared to that of the conventional rf , pulsed radiofrequency is now performed with worldwide popularity in order to reduce thermal injury to the neural tissue . so when performing a pulsed radiofrequency , electrode should be placed perpendicular to the target nerve , whereas , in conventional rf , electrode is placed parallel to the nerve . while performing pulsed radiofrequency on ton , craniocaudal insertion of needle electrode with longitudinal view is expected to make relatively perpendicular placement of the electrode to ton . when pulsed radiofrequency is to be performed on a lateral decubitus position , needle handling is interferred by shoulder joint . in order to reduce such interference , we used craniocaudal approach , and to avoid c2 nerve root injury during needle insertion , we took careful attention to neurologic sign , such as parasthesia . it is difficult to perform with conventional method under fluoroscopic guidance . in order to accommodate a possible anatomical variation of ton , the conventional rf technique with fluoroscopy need to place needle electrode onto three target points . this multiple placements of the needle can lead to prolongation of the procedure time , causing excessive exposure to radiation . since the target nerve can be visualized , the needle electrode can be introduced directly onto the nerve in real - time . also , multiple needling can be reduced , and related complications can be minimized , such as bleeding , tissue injury , and infections . in this study , we suggest a new method of pulsed radiofrequency on ton with ultrasound guidance . due to physical characteristics of pulsed radiofrequency , parallel placement of active needle tip to target nerve is not necessary . therefore , ultrasound - guided pulsed radiofrequency attempt on other cervical medial branches can be made as in the same manner as our report , and further study is needed .

the ability of a biological organism to sense and react to a complex environment requires the development of an intricate sensory system . the adaptive immune system uses dna recombination to generate a large array of t - cell and b - cell receptors to sense potentially harmful entities in the environment . in contrast , natural killer ( nk ) cells of the innate immune system use a smaller group of receptors to survey the organism for loss or alteration of the class i major histocompatibility complex ( mhc ) proteins that are used by cells to present antigens to the immune system . since the mhc molecules are highly polymorphic , it is therefore necessary to generate specialized nk cell subsets that are able to sense changes in the expression of a particular mhc molecule . the receptors for class i mhc are expressed in a variegated manner on nk cells , such that the majority of nk cells ( ~80% ) express from 1 to 3 receptors per cell out of a total repertoire of 415 receptors depending on the genotype of the individual . the variegated , stochastic expression of these receptors is achieved through the use of probabilistic bidirectional promoter switches that generate either sense transcripts linked to gene activation or antisense transcripts that are associated with gene silencing . each stochastic switch possesses an intrinsic probability of transcribing in either the sense or antisense direction that is programmed by the relative binding affinity of competing transcription factor binding sites . this results in each receptor type being expressed on a predetermined percentage of cells within the population . evolution can therefore select for genes with different frequencies of receptor expression , based on the inherent usefulness of each receptor for survival of the organism . the human and mouse class i mhc receptor systems are separately evolved , and they use the noncoding rnas generated by the stochastic promoter switches in different ways ( figure 1 ) . the murine receptors are members of the c - type lectin related ly49 gene family ( originally named ly49a through ly49x , official name klra1-n ) , and they contain a distal bidirectional promoter ( pro1 ) located ~5 kb upstream of the ly49 promoter used to express the gene in mature nk cells ( pro2 ) . in this system , sense noncoding transcripts activate the downstream promoter , whereas antisense noncoding transcripts merely represent the off state of the switch . in contrast , antisense transcripts play an active role in gene silencing in the human system . the human kir genes are members of the immunoglobulin ( ig ) supergene family ( named according to the presence of 2 or 3 ig domains and short or long cytoplasmic tails , e.g. , kir2dl1 or kir3ds1 ) , and they possess a stochastic switch 60 bp 5 of the kir initiation codon . the antisense transcript from the proximal promoter switch produces a pirna that is associated with gene silencing ; however , the sense transcript in this case merely maintains the default on state of the gene . although the same probabilistic promoter mechanism has been adopted by both the human and mouse receptor systems to achieve variegated receptor expression , the mouse ly49 genes use sense lncrna to activate genes that are in a default closed state , whereas the human kir use an antisense lncrna to silence active genes . in both human and mouse , active loci are hypomethylated , suggesting that dna methylation plays a role in the maintenance of the chosen state ; however , histone acetylation patterns are distinct . all genes of the kir cluster have generally high levels of h3 and h4 acetylation regardless of their expression status , whereas inactive ly49 genes have low levels that increase upon gene activation . consistent with these observations , the dna methylation inhibitor 5-aza - cytidine alone can induce expression of silent kir genes , whereas ly49 gene activation requires both 5-aza - cytidine together with the histone deacetylase inhibitor trichostatin - a . analysis of ly49 transcripts in liver nk cells revealed the presence of a distal promoter that was active only in immature nk cells ( pro1 ) . in vitro analysis demonstrated that this element was in fact a bidirectional promoter containing two tata boxes with overlapping c / ebp - binding sites located ~100 bp apart . mutational analysis revealed that the competing c / ebp and tata elements determined the relative sense / antisense activity of the promoter . the switching activity of this element was demonstrated by placing it between two different fluorescent protein cdnas ( cfp and yfp ) and observing its behavior in real time . remarkably , the element acted as a stable switch , choosing transcription in a single direction and maintaining that choice until a new copy of the element was generated by dna replication . a cloned cell line containing a single copy of the two - color vector containing the ly49 g stochastic switch produced a variegated cell population composed of approximately equal numbers of cfp- or yfp - expressing cells , consistent with the nearly equivalent forward and reverse ly49 g switch promoter activity detected in vitro . time lapse imaging of the variegated cell population revealed that a dividing cell could express both yfp and cfp simultaneously prior to division and generate separate cfp- or yfp - expressing daughter cells . this result provides direct evidence that the choice of sense or antisense transcription is not controlled by the relative concentration of transcription factors in the nucleus , since the two copies of the switch element in a dividing cell are able to choose different transcriptional fates . the switch is therefore capable of making a probabilistic choice between the generation of a forward transcript containing the ly49-coding region or a reverse transcript that extends into the intergenic region and contains no identifiable coding region . it is also of interest to note that only the newly synthesized copy of the switch was capable of choosing to transcribe in the opposite direction , as sorted cells produced a 7525% mix after one cell division rather than the 5050% mix predicted if both copies had the ability to transcribe in either direction . this suggests that the tata - binding protein remains stably associated with the tata box , even during the process of dna replication . tata - binding protein has been shown to remain bound to condensed chromosomes during cell division , marking active promoters that resume transcription after cell division . analysis of the transcription properties of the switches contained within various ly49 genes revealed an association between the strength of the sense transcriptional activity and the frequency of nk cells expressing that gene . the switches thus display a programmed probability of gene activation that can be ascribed to the relative strength of sense versus antisense promoter elements . although the process of gene activation is stochastic , a bias toward gene activation or maintenance of the silent state is programmed by differences in switch characteristics , akin to loaded dice . a model of probabilistic gene activation was proposed wherein the choice of sense transcription led to the production of a forward nontranslated transcript that traversed the downstream ly49 promoter , releasing it from its default silent state . the requirement of this transcript for gene activation was demonstrated by the loss of gene expression in either transgenes or endogenous ly49 genes that lacked the switch element . the antisense switch transcript is a noncoding polyadenylated rna that presumably represents the off state since deletion of the pro1 element results in a silent gene , arguing against an active role of the antisense in gene silencing . the sense transcript of the switch element spans the entire coding region of the gene and produces a spliced , polyadenylation cdna that is identical to the mature ly49-coding mrna except for the addition of a long 5 noncoding region that prevents its efficient translation . the boundary between adjacent ly49 genes is marked by a pair of transcriptional termination elements . a large t / c tract ( > 200 nucleotides ) follows the polya addition site of the ly49 mrna , and ~350 bp downstream , a similar element is present on the other strand . this transcriptional insulator is likely present to prevent antisense lncrna from the downstream gene from interfering with the expression of the preceding gene . the search for a similar switch controlling the variegated expression of the human kir genes resulted in the surprising finding that the proximal promoter thought to be responsible for kir expression was in fact bidirectional . there is no significant homology between the ly49 and kir bidirectional promoters , and the only shared transcription factor there is a conserved bidirectional core element in most kir genes , and the strength of flanking 5-yy1 and 3-sp1binding sites modulates sense and antisense transcriptional activities in individual kir genes . sense transcripts from the proximal promoter are potentially translatable , leading to the production of kir protein . however , substantial levels of proximal sense transcripts from most kir genes can be detected in nk cells that are in the later stages of differentiation but do not express kir protein , suggesting that the sense transcripts from the switch in these cells are also lncrnas . this represents another parallel with the murine system : forward switch transcription does not result in protein expression . the lack of protein expression during the stochastic promoter phase allows for the generation of a variegated array of receptors that will not be subjected to selection until the nk cell matures . the percentage of nk cells expressing a given kir correlates with the strength of sense relative to antisense transcription from the switch in several genes as well as alleles of a single gene ( kir3dl1 ) . the presence or absence of cognate mhc ligands does have some effect on the percentage of nk cells expressing a given receptor , indicating that postexpression selection does occur , but the primary determinant of expression frequency lies within the kir gene itself . similar to the ly49 genes , a distal transcript is present in immature nk cells ; however , the distal kir promoter is unidirectional , and only produces sense transcripts that are associated with locus activation . the model for variegated kir expression proposes that distal transcripts are required for the initial activation of the proximal switch element , similar to the ly49 system . however , once activated , the proximal switch element will either transcribe in the sense direction , maintaining the active state , or produce a reverse transcript that leads to resilencing of the proximal promoter region . a search for small rnas generated from the kir antisense transcripts resulted in the identification of a 28 base pirna , and gene transduction studies demonstrated that the 28 base region of the antisense was required for kir gene silencing , indicating an autoregulatory role of kir antisense lncrna . an additional spliced kir antisense noncoding rna transcribed from a unidirectional antisense promoter in the second exon was discovered in the hek293 cell line , and this lncrna was subsequently found to be expressed in vivo only by cord blood progenitor cells . the exon 2 antisense lncrna overlaps with the switch antisense transcript , and it is also able to produce the 28 base pirna and silence kir loci . this suggests that the kir genes are silenced early in development by an active mechanism to ensure that they are not expressed prematurely . with the exception of the exon 2 antisense transcript found in progenitor cells , kir antisense transcripts are only present in nk cells just prior to their differentiation into mature kir - expressing nk cells , and this likely represents the probabilistic phase of kir gene activation where the stochastic promoter switch is active . the recent study of a rare , weakly expressed allele of the kir2dl1 gene has provided some insight into possible mechanisms preventing expression of kir protein in cells with an active proximal promoter switch . the weakly expressed variant of the kir2dl1 gene contained a distal promoter polymorphism that sharply decreased transcription from a previously unreported intermediate transcription start site located 270 bp upstream from the proximal switch promoter start site . the intermediate transcripts were shown to be translatable , and their levels paralleled kir protein expression in a series of individuals with differing genotypes . kir2dl1 alleles with decreased intermediate transcripts produced proximal transcripts that contained alternative exons with stop codons ( exon 2a or 2b ; figures 1 and 2 ) . alternative exon usage was not readily detectable in common kir2dl1 alleles with normal intermediate promoter activity , suggesting that intermediate transcription prevents the usage of the alternative exons . individuals with low levels of intermediate transcript and low kir protein expression had normal levels of proximal transcripts , suggesting that the novel intermediate promoter is required for protein expression in mature nk cells , and the primary role of the proximal switch is to control stochastic gene activation . the most definitive marker of switch activity is the production of proximal antisense transcripts , and these can only be detected in cells that lack surface kir expression , suggesting that sense switch transcripts are not translatable , consistent with the discovery of alternatively spliced mrnas containing stop codons that originate from the proximal switch element . however , additional mechanisms blocking translation of proximal transcripts must exist , since not all proximal transcripts contain alternative exons . taken together , the data suggests that there are three distinct phases of kir gene activation : a precursor phase in which the distal transcript activates the proximal switch region ; a probabilistic phase wherein the switch promoter determines if the gene will remain in an active state ; and a final stage where an intermediate promoter drives kir expression ( figure 2 ) . although the three promoter system used by human kir genes is more complex than the two promoter system used by mouse ly49 genes to achieve variegated gene expression , it is able to function in a much smaller kir intergenic space ( ~2 kb ) as opposed to the large ( ~20 kb ) intergenic interval found in the ly49 genes . some have reacted to the concept of random selection of receptors by recalling einstein 's famous quote god does not play dice , which symbolizes his dislike of heisenberg 's uncertainty principle . however , it is important to note that the phenotypic result of the action of stochastic switches is not random , but is in fact completely reproducible . in inbred strains of mice , individual ly49 genes are expressed on the same percentage of nk cells in every mouse with the same genotype . for example , ly49 g is present on 45% of splenic nk cells obtained from every c57bl/6 mouse , but it is only found on 18% of nk cells from nod mice . this difference can be attributed to weaker sense transcriptional activity of the ly49 g switch in nod mice . although one can not know the fate of a single nk cell , the laws of probability dictate the percentage of nk cells that will acquire a given receptor . thus , it is perhaps more appropriate to say that in the case of variegated gene expression , evolution takes advantage of probability in the design of complex systems . the probability of gene expression is controlled by the relative affinity of transcription factors for competing binding sites ; therefore , the phenotypic result can be programmed through variations in these binding sites . this is a powerful paradigm that can potentially explain some of the decision - making processes that occur during development of an organism . for example , imagine a hematopoietic stem cell that has to make one of several choices : remain as a stem cell ; differentiate into a t cell ; and differentiate into a b cell . if the lineage - defining transcription factors controlling either b - cell or t - cell fate were under the control of stochastic switches , then either differentiation fate would occur at a predefined frequency , and if neither t - cell nor b - cell defining factors were activated , the cell would remain a stem cell . the presence of programmed probabilistic switches governing cell fate choices would provide a mechanism for the generation of appropriate proportions of differentiated cell types required for proper functioning of specialized organ systems . a genome - wide evaluation of transcription start sites revealed that 11.8% of promoters are bidirectional with start sites separated by less than 1 kb . of these , 67% have start sites less than 300 bp apart and could thus represent switches . a recent study of rna expressed by human prefrontal cortex at different postnatal stages provides an indication of how many switches might be operating during the complex process of brain development . high - throughput strand - specific rna sequencing revealed the presence of a distinct class of bidirectional promoters with a downstream protein coding gene and a 5 antisense lncrna , similar to the kir bidirectional promoters . there were 273 promoters of this class , and they were associated with genes involved in neuronal development and enriched in binding sites for transcription factors associated with neurons , consistent with their potential function as switches controlling brain development . a key feature of a bidirectional promoter switch is the stable nature of the sense or antisense transcriptional state acquired by the element . although many bidirectional promoters have been characterized , only a few studies have examined the issue of stable transcriptional states . a careful study of the immediate early enhancer region of murine cytomegalovirus revealed that the divergent transcription of the flanking ie1/3 and ie2 genes was mutually exclusive , leading the authors to refer to this element as a genetic switch . a study of the sense and antisense transcripts generated from the expanded hexanucleotide repeats of the c9ord72 locus associated with amyotrophic lateral sclerosis revealed cells containing either sense or antisense rna foci , suggesting stable transcription in either the sense or antisense direction . looking forward , it will be of interest to closely examine the promoters of genes that are selectively activated during development . a lineage - defining transcription factor or any gene that is expressed in a variegated manner in a particular tissue would be a good candidate for this type of study . the recent appreciation of the importance of enhancer - derived rnas and the possibility that some enhancers might represent bidirectional promoters mandate reexamination of enhancers with this new perspective . it is also important to take note of an important lesson learned from the analysis of the mhc receptors : elements controlling differential gene activation may not be directly linked to gene expression , and they may be active prior to the onset of gene expression . it is therefore necessary to study rna transcripts in precursor cells that do not yet express the gene of interest , in order to identify lncrnas that may be setting the stage for future gene expression . a detailed analysis of the lncrnas present in a single precursor cell may reveal variegated expression of sense and antisense transcripts from a bidirectional promoter , leading to the identification of additional probabilistic switches governing developmental choices . application of this paradigm to additional genes in multiple cell types will undoubtedly reveal many more examples where lncrna determines the developmental fate of genes .

urinary incontinence is one of the major urinary symptoms in children and adolescents and can lead to major distress for the affected children and their parents . normal daytime control of bladder function matures between 2 and 3 years of age , whereas nighttime control is normally achieved between 3 and 7 years of age . in accordance with the definitions of the standardization committee of the international children 's continence society ( iccs ) , daytime urinary incontinence ( dui ) is uncontrollable leakage of urine during the day . daytime wetting ( also referred to as diurnal enuresis ) is also defined in the diagnostic and statistical manual for mental disorders , fourth edition , as an involuntary voiding of urine during the day , with a severity of at least twice a week , in children > 5 years of age in the absence of congenital or acquired defects of the central nervous system . the prevalence of daytime wetting ranges from 2% to 20% [ 1,4 - 7 ] . the aim of this study was to investigate the prevalence and associated risk factors of dui among primary school children living in denizli , which is a developing city of turkey , by use of a validated questionnaire . this cross - sectional study was performed between october and may 2005 in denizli and was approved by the ethics committee of pamukkale university school of medicine and denizli province directorate of national education . the target population for the survey was 2,353 primary school children who were attending grades 1 through 8 . the schools were randomly selected , 8 from denizli city center and 6 from the rural regions of denizli , by means of systemic sampling . we used the dysfunctional voiding and incontinence symptoms score questionnaire to collect information about the children 's voiding habits and a self - prepared questionnaire to get information about perinatal risk factors and sociodemographic and socioeconomic variables . the dysfunctional voiding and incontinence symptoms score questionnaire was validated by akbal et al . and contains 13 questions about daytime symptoms , nighttime symptoms , voiding habits , and bowel habits and 1 question about quality of life . at the beginning of the survey , all the schoolteachers and students were informed about the study by the residents of pamukkale university school of medicine department of urology and department of public health . an envelope that contained a written informed consent letter and the questionnaires were distributed to each child by the schoolteachers to reach the children 's parents . data were obtained by using these self - administered questionnaires , which were completed by the children and their parents . to maximize the response rate , each school was visited twice at weekly intervals by the same residents . dui was defined as episodes of involuntary leakage of urine with or without nighttime wetting in the 6 months before receipt of the survey . frequency , percentage , mean , and standard deviation were used as descriptive statistics and the chi - square test was used as an analytical statistical method . multiple logistic regression analysis ( backward lr ) was performed to identify the independent risk factors . a p - value < 0.05 was considered as statistically significant . we collected data from 2,164 children , 1,037 boys ( 47.9% ) and 1,127 girls ( 52.1% ) , for a response rate 91.9% . the mean age of the students was 10.1 years ( range , 7 to 14 years ; median , 10 years ) . of these children , 1,124 ( 51.9% ) were living in the urban regions and 1,040 ( 48.1% ) were living in the rural regions . a higher percentage of boys than girls seemed to experience daytime wetting ( 8.8% [ n=70 ] vs. 7.3% [ n=64 ] , respectively ) , but the difference was not statistically significant ( p=0.062 ) . without gender bias , the highest prevalence was predicted among children aged 7 years , and the prevalence decreased with increasing age ( fig . , 57.8% ( n=77 ) were wetting sometimes ( less than once a day ) , 26.6% ( n=36 ) were wetting 1 or 2 times per day , and 15.6% ( n=21 ) were wetting always ( more than twice a day ) . when we assessed the amount of dui , 40.1% of the children ( n=54 ) were wetting their underwear , 37.3% ( n=50 ) were wetting their pants only , and 22.5% ( n=30 ) were soaking wet their pants . urge incontinence was observed in 58.7% of the children ( n=79 ) with daytime wetting . twenty - six percent of the children ( n=35 ) with daytime wetting were wetting while laughing , sneezing , or coughing and 15.3% ( n=21 ) were wetting unconsciously . in most children , nighttime wetting accompanied the dui . of the children with daytime wetting , 33.2% ( n=45 ) had also wetting at nighttime . dui was significantly associated with nighttime wetting ( p=0.000 ) , increasing daytime frequency ( p=0.015 ) , history of urinary tract infection ( uti ) ( p=0.003 ) , constipation ( p=0.008 ) , hesitancy ( p<0.001 ) , straining ( p<0.001 ) , intermittency ( p<0.001 ) , feeling of incomplete emptying ( p<0.001 ) , holding maneuvers ( p<0.001 ) , low school success ( p=0.003 ) , absence of health insurance ( p<0.001 ) , low education level of the parents ( p<0.001 ) , low family income ( p<0.001 ) , and unemployment of the father ( p<0.001 ) . there was no relationship between dui and low birth weight , prematurity , or maternal unemployment ( tables 1 , 2 ) . after adjustment of the data for age , gender , maternal education level , family history of dui , family income , settlement , and history of urgency , constipation , uti , and daytime frequency , logistic regression analyses revealed that the risk factors associated with dui in our population were early age ( odds ratio [ or ] , 0.7 ; 95% confidence interval [ ci ] , 0.6 - 0.8 ; p=0.000 ) , low maternal education level ( or , 5.1 ; 95% ci , 1.2 - 21.1 ; p=0.026 ) , positive family history of dui ( or , 4.1 ; 95% ci , 2.3 - 7.3 ; p=0.000 ) , living in a rural region ( or , 2.3 ; 95% ci , 1.4 - 3.9 ; p=0.002 ) , presence of urgency ( or , 2.0 ; 95% ci , 1.1 - 3.3 ; p=0.013 ) , constipation ( or , 2.6 ; 95% ci , 1.3 - 5.1 ; p=0.005 ) , and history of uti ( or , 2.1 ; 95% ci , 1.1 - 4.1 ; p=0.026 ) ( table 3 ) . we collected data from 2,164 children , 1,037 boys ( 47.9% ) and 1,127 girls ( 52.1% ) , for a response rate 91.9% . the mean age of the students was 10.1 years ( range , 7 to 14 years ; median , 10 years ) . of these children , 1,124 ( 51.9% ) were living in the urban regions and 1,040 ( 48.1% ) were living in the rural regions . the overall prevalence of dui was 8.0% ( n=134 ) . a higher percentage of boys than girls seemed to experience daytime wetting ( 8.8% [ n=70 ] vs. 7.3% [ n=64 ] , respectively ) , but the difference was not statistically significant ( p=0.062 ) . without gender bias , the highest prevalence was predicted among children aged 7 years , and the prevalence decreased with increasing age ( fig . of the children with daytime wetting , 57.8% ( n=77 ) were wetting sometimes ( less than once a day ) , 26.6% ( n=36 ) were wetting 1 or 2 times per day , and 15.6% ( n=21 ) were wetting always ( more than twice a day ) . when we assessed the amount of dui , 40.1% of the children ( n=54 ) were wetting their underwear , 37.3% ( n=50 ) were wetting their pants only , and 22.5% ( n=30 ) were soaking wet their pants . urge incontinence was observed in 58.7% of the children ( n=79 ) with daytime wetting . twenty - six percent of the children ( n=35 ) with daytime wetting were wetting while laughing , sneezing , or coughing and 15.3% ( n=21 ) were wetting unconsciously . in most children , nighttime wetting accompanied the dui . of the children with daytime wetting , 33.2% ( n=45 ) had also wetting at nighttime . dui was significantly associated with nighttime wetting ( p=0.000 ) , increasing daytime frequency ( p=0.015 ) , history of urinary tract infection ( uti ) ( p=0.003 ) , constipation ( p=0.008 ) , hesitancy ( p<0.001 ) , straining ( p<0.001 ) , intermittency ( p<0.001 ) , feeling of incomplete emptying ( p<0.001 ) , holding maneuvers ( p<0.001 ) , low school success ( p=0.003 ) , absence of health insurance ( p<0.001 ) , low education level of the parents ( p<0.001 ) , low family income ( p<0.001 ) , and unemployment of the father ( p<0.001 ) . there was no relationship between dui and low birth weight , prematurity , or maternal unemployment ( tables 1 , 2 ) . after adjustment of the data for age , gender , maternal education level , family history of dui , family income , settlement , and history of urgency , constipation , uti , and daytime frequency , logistic regression analyses revealed that the risk factors associated with dui in our population were early age ( odds ratio [ or ] , 0.7 ; 95% confidence interval [ ci ] , 0.6 - 0.8 ; p=0.000 ) , low maternal education level ( or , 5.1 ; 95% ci , 1.2 - 21.1 ; p=0.026 ) , positive family history of dui ( or , 4.1 ; 95% ci , 2.3 - 7.3 ; p=0.000 ) , living in a rural region ( or , 2.3 ; 95% ci , 1.4 - 3.9 ; p=0.002 ) , presence of urgency ( or , 2.0 ; 95% ci , 1.1 - 3.3 ; p=0.013 ) , constipation ( or , 2.6 ; 95% ci , 1.3 - 5.1 ; p=0.005 ) , and history of uti ( or , 2.1 ; 95% ci , 1.1 - 4.1 ; p=0.026 ) ( table 3 ) . several questionnaires have been developed to help to diagnose behavioral problems , diuresis , and micturition patterns [ 9 - 11 ] . in this survey , we used the dysfunctional voiding and incontinence scoring system to collect information on voiding problems in children . this statistically validated functional voiding problems symptom score is composed of 14 items regarding daytime symptoms , nighttime symptoms , voiding habits , bowel habits , and quality of life . continuous incontinence means constant urine leakage associated with congenital malformations , such as ectopic ureter or iatrogenic damage of the external urethral sphincter . intermittent incontinence refers to discrete amounts of urine leakage that occur during the day or at night after 5 years of age . any type of wetting episode that occurs in discrete amounts during sleep is called enuresis . dui in children is thought to be one of the most common developmental disorders and also one of the most bothersome problems among affected children and their parents . previous studies from different countries about this problem have used various terminology and questionnaires , so that the prevalence range is very large . the overall prevalence of dui in primary school children was reported to be 4.4% to 19.2% in different european countries and 2.1% to 6.3% in different asian countries . in previous studies reported from different turkish provinces , the prevalence of dui was reported to be between 0.5% and 4.3% [ 14 - 18 ] . in our study , the overall prevalence of dui in the primary school children in denizli province was 8.0% . although the present study did not reflect the overall prevalence of the country because of the low sample size , it was worthwhile to determine the distribution of the disease in different parts of our country . in the present study , the prevalence of dui was higher in boys than in girls but this difference was not statistically significant . previous studies showed that the prevalence of dui is generally higher among girls than boys and declines with age . however , in japanese primary school children , the overall prevalence of dui was almost the same in the two sexes and gradually decreased with age . according to these studies , we can say that dui tends to resolve spontaneously in primary school children . therefore , physicians should consider follow - up as a choice of treatment before using medicines in this population . in our study , 58% of the children were wetting themselves once or twice per day and 40% of them were dampening their underwear . . showed that the degree of wetting clearly increases with the frequency of dui . investigated the disaggregated spectrum of dui by the frequency and amount of daytime incontinence , and the results indicated that there is poor overall concordance between frequency and amount of dui . however , we did not assess the relationship between the frequency and amount of dui . performed 1,000 video - urodynamic studies in children with nonneurogenic bladder sphincter dysfunction and found that urge syndrome was the most frequent urinary dysfunction ( 58% ) . another study showed that the prevalence of overactive bladder ( oab ) was 16.6% in 5- to 13-year - old korean children . urge incontinence is a result of detrusor overactivity ( do ) , and urodynamic study should be performed for the diagnosis of do . thus , when parents or teachers recognize urge incontinence in a child , they should follow - up with a urologist for the diagnosis and treatment of oab . stress incontinence is the leakage of small amounts of urine during exertion or with increased intraabdominal pressure caused by various reasons . . showed that 4.6% of all children with wetting were wetting themselves only during coughing , sneezing , or laughing without urgency . swithinbank et al . reported that 127 of 1,176 children ( 10.8% ) aged 11 to 12 years old had daytime wetting caused by coughing , laughing , or physical exercise . in our survey , , 26% of the children with dui had stress incontinence ( n=18 girls and n=17 boys , p=0.600 ) . recent studies have demonstrated that children with enuresis are known to void more often than do normal children , and increased daytime urinary frequency occurs in 20% to 30% of children with dui . . showed in their survey that children with dui voided significantly more often than did children without dui and frequent voiding was found in 26.8% of children with dui . however , hansen et al . did not find any correlation between frequency and daytime and nighttime wetting . however , the same study revealed that micturition symptoms ( does not reach toilet , hurry to toilet , prolonged voiding , poor stream , staccato urine flow , able to void again immediately , and straining ) in children with daytime wetting differed significantly from the symptoms of continent children . sureshkumar et al . found that holding postures , frequency , and urgency had an impact on dui . the genitourinary and gastrointestinal tracts share the same embryological origin ( endoderm ) , anatomical space ( pelvis ) , and innervation ( sacral pelvic plexus ) . koff et al . demonstrated that constipation and bowel distension may lead to deformation of the bladder , which in turn may lead to hyperactivity of the detrusor and thus to urinary incontinence , i.e. , the " dyselimination syndrome " . in our study , both the univariate and multivariate analyses showed that constipation was significantly related to dui . recent studies also reported that children with constipation had higher prevalence rates of urinary incontinence than did children without constipation . however , sureshkumar et al . did not find any relationship between constipation and dui . corresponding with the other studies , in the univariate analysis , the factors that were significantly related to dui were low school success of the child , having multiple siblings , absence of health insurance , low parenteral education level , paternal unemployment status , low family income , and positive family history for dui . in the multivariate analysis , early age , living in a rural region , low maternal education level , low family income , and positive family history for dui were independent risk factors for dui . the etiology of uti , especially recurrent uti , is often unknown ; however , urodynamic disturbances with high bladder pressure or emptying difficulties are predisposing factors . it is well known that in children with uti , especially in girls , there is a correlation with daytime wetting , which suggests that either daytime wetting is a consequence of the inflammation in the bladder or a primary dysfunction in the bladder predisposes to uti . our study showed that , in the univariate analysis , all the voiding symptoms and history of uti were significantly associated with dui , and in the multivariate analysis , history of urgency and uti were independent risk factors for dui . the prevalence of dui in turkish children has a concordance with recent reports in the literature . however , some of these children may have abnormal voiding and bowel habits . in an effort to increase awareness of voiding problems in children and risk factors for urinary dysfunction in the population , educational programs and larger school - based screening

over the past 10 to 15 years , new treatment paradigms in rheumatoid arthritis ( ra ) have been developed , including early diagnosis , intensive ( treat to target ) management using disease modifying antirheumatic drugs ( dmards ) alone or in combination , and the advent of targeted biologic therapies . these new paradigms have significantly improved patient outcomes , improving quality of life and reducing joint damage . tumour necrosis factor ( tnf ) inhibitors were the first biologic drugs to be developed and have been used for > 10 years . five tnf inhibitors now have marketing authorization for the treatment of ra : adalimumab ( ada ) , certolizumab pegol , etanercept ( etn ) , golimumab , and infliximab ( inf ) . it would be of clinical importance if one tnf inhibitor were to be more effective than the others , but there is a paucity of data about the relative effectiveness of these drugs there have been no head - to - head randomized controlled trials comparing two or more tnf inhibitors . it is possible that short - term effectiveness is similar with all tnf inhibitors , but that long - term safety and effectiveness may differ . furthermore , no reviews have been conducted to analyse drug survival rates of these biologic agents in real - world settings . to bridge this gap of knowledge , the present systematic review was conducted with an aim to assess the time on treatment ( drug survival and reasons for discontinuation ) with tnf inhibitors , from published european registry studies among patients with ra . this review restricted its scope to data from europe because of differences in clinical practice elsewhere ( e.g. , in the usa , there is much higher penetrance of tnf inhibitors in the market and a different system of reimbursement ) , ethnicity , or risk profile ( for instance in africa and asia , the prevalence of endemic serious infection is much higher ) . the cohort size , duration of follow - up , and datasets collected vary across the long - term observational studies . therefore , a systematic literature review methodology was adopted to investigate whether the currently available tnf inhibitors can be differentiated in terms of effectiveness or persistence on therapy . a search was conducted to identify reports from 16 registries of 13 european countries which include patients with ra and data on the time on treatment ( drug survival ) of licensed biologics in ra . the search strategy was designed to retrieve relevant data from the literature published up to 16 april 2012 . the electronic databases searched were medline ( including medline in - process ) , embase , the cochrane central register of controlled trials ( central ) , and the who 's international clinical trials registry platform search portal . the search strategy comprised search facets for registry names , disease , and treatment . additional information on the search strategy is provided as supplementary information ( table s1 in supplementary material available online at http://dx.doi.org/10.1155/2013/764518 ) . in addition , proceedings from three conferences held between 2010 and 2012 were hand - searched for relevant abstracts . these conferences were of the american college of rheumatology , the european league against rheumatism , and the british society of rheumatology . studies retrieved by the searches were downloaded into a systematic review database and were screened according to predefined eligibility criteria . study protocol listing the eligibility criteria for inclusion of studies in the review is provided as supplementary information ( table s2 ) . initial screening of the retrieved citations was conducted independently by two reviewers on the basis of the title and the abstract . the full - text publications of all citations of potential interest were then screened for inclusion by two reviewers , with all the disagreements reconciled by a third reviewer . registry studies assessing the licensed biologics in ra were included . however , the focus of the present publication is to assess the comparative effect of various tnf inhibitors ( etn , ada , inf , certolizumab pegol , and golimumab ) for the treatment of patients with ra . relevant data from all included studies were extracted in parallel by two independent reviewers , using a predefined extraction grid . reconciliation of any differences between the two reviewers was performed by a third independent reviewer . only one extraction dataset per study was compiled from all publications related to that study so as to avoid the error of double - counting patients in subsequent analyses . outcomes abstracted from included citations were drug survival and retention , discontinuations due to adverse events ( aes ) and inefficacy , and duration of drug survival . drug survival rate was defined as the number of patients remaining on drug therapy at a particular time point . in cases where drug survival rates were not explicitly reported , the same was estimated from the published kaplan - meir survival curves using the engauge software ( from http://digitizer.sourceforge.net/ ) . to assess the comparative effect of the tnf inhibitors , pooling methodology was used ; pooled proportions were the average of all individual study results , weighted for the sample sizes . the review was conducted and reported in line with preferred reporting items for systematic reviews and meta - analyses ( prisma ) guidelines . figure 1 outlines the selection process for studies throughout the review , in line with prisma guidelines . database searches yielded 2,304 studies and conference searching resulted in an additional 10 records . following the screening of abstracts against inclusion / exclusion criteria , a total of 209 studies were identified and full - text citations were obtained for detailed evaluation . of these 209 studies , 16 studies are reported in 18 publications from seven registries comparing the effect ( drug survival and discontinuations ) of different tnf inhibitors for the treatment of patients with ra were included ( table 1 ) . among these 16 included studies , drug survival rates were estimated using the kaplan - meir survival curves in eight studies [ 13 , 7 , 8 , 1214 ] . of the 16 studies , 11 studies included biologic - naive patients , and the remaining five studies included a mixed population of biologic pretreated and biologic nave patients . the studies with a mixed population predominantly included biologic - naive patients ( > 75% ) with no subgroup analyses reported according to biologic pretreatment status . the study duration within these 16 studies ranged from 6 months to 48 months , while the duration was not reported in nine included studies . the number of patients in these studies ranged from 66 to 6739 . among the 16 included studies , 12 studies assessed the comparative effectiveness of etn , ada , and inf [ 18 , 1215 ] , while the remaining four studies assessed the comparative effectiveness of etn and inf only [ 911 , 16 ] . none of the studies assessing certolizumab pegol and golimumab met the inclusion criteria of the review . eleven out of twelve studies comparing etn , ada , and inf treatment assessed the comparative drug survival rate . across all time points , higher short - term ( 6 months ) drug survival rates were reported with ada as compared to etn in the dream and scqm registries [ 6 , 7 , 12 ] , but the pooled drug survival rate was numerically higher with etn compared to ada at 6 months and beyond ( figure 2 ) . average drug survival rates at different time points show that approximately 7% more biologic - nave patients persisted on etn as compared to ada , between 12 months and 36 months of follow - up ( table 2 ) . in the mixed population , four studies assessed the comparative effect of etn and inf only and these did not report long - term follow - up data . in the short term , little difference was observed between etn and inf : the drug survival rates were 80.0% ( etn ) versus 79.4% ( inf ) after 6 months and 68.9% ( etn ) versus 67.8% ( inf ) after 12 months of treatment [ 911 , 16 ] . in an observational study , when tnf inhibitors were used in combination with methotrexate ( mtx ) , a benefit was observed in terms of longer drug survival compared to tnf inhibitors alone . hyrich and colleagues conducted a study to analyze the relative effectiveness of etn and inf as monotherapy as compared with combination of these agents with mtx . 78% of patients continued the therapy with etn alone , while 84% of patients continued with the combination of etn and mtx . in the inf group , after 6 months , 70% of patients continued the therapy with inf alone , while 79% of patients continued with the combination of inf and mtx . due to limited data and limited number of studies , comparison of the biologic - naive population and mixed ( biologic pretreated and biologic - naive ) population was not feasible . four studies reported the reasons for drug discontinuation ; qualitative assessment of discontinuation rates comparing etn , ada , and inf demonstrated numerically higher discontinuation rates with inf compared to etn and ada for both adverse events ( aes ) and inefficacy ( table 3 ) . due to limited data availability , comparative assessment of discontinuation rates ( due to aes or inefficacy ) among studies with biologic - naive patients and studies with mixed patients was not feasible . after 1 year , discontinuation rates for aes were numerically higher with inf than etn ( 18.7% versus 12.6% ) although discontinuation rates for inefficacy were similar ( 19.8% versus 18% ) [ 9 , 10 , 16 ] . there were differences in baseline characteristics of patients among different registries at baseline , in the study by pan and colleagues ( scqm register ) , patients had das28 score ranging from 4.14 to 4.27 but the das28 score ranged from 5.5 to 6.1 among patients included in the study by strangfeld and colleagues ( rabbit register ) . this may partly explain differences in rates of discontinuation , with fewer patients in the scqm cohort stopping therapy as compared to those in the rabbit register . none of the included studies comparing etn , ada , and inf reported the duration of drug survival . of the four studies comparing etn with inf , only one study reported data for duration of drug survival . in this study , the median duration of drug survival was higher with etn compared to inf ( 45 months versus 29 months , p = 0.04 ) . data obtained from this systematic review suggested a gradual increase in drug discontinuation over time with all tnf inhibitors mainly as a result of adverse events ( ae 's ) and inefficacy . drug survival with inf was numerically lower than with etn or ada , as a result of higher rates of ae and inefficacy . the explanations for this difference are speculative . in parts of europe , the dose and frequency of administration are constrained by health care purchasers to the licensed dose of 3 mg / kg/8 weeks . in the usa creep to 5 mg / kg/4 weeks is common and suggests that the licensed dose in europe may not be optimal for maintaining effectiveness . there were modest differences in drug survival rates with etn compared to ada , amounting to ~4%7% more patients continuing on etn over 1 year to 5 years of follow - up . there are many factors that contribute to discontinuation of therapy , including loss of effectiveness , immunogenicity , drug - related toxicity , infusion and systemic allergic reactions , and development of comorbidity [ 13 , 19 , 20 ] . further , when anti - tnf agents were used in combination with mtx , a benefit was observed in terms of longer drug survival compared to tnf inhibitor alone . the findings of the present systematic review are in line with the observations made in a previous network meta - analysis of updated cochrane systematic reviews based on randomized controlled trial ( rct ) data . the use of tnf inhibitors for the treatment of patients with ra has improved outcomes , but a significant proportion of patients discontinue therapy . gmez - reino and colleagues studied the rates and reasons for discontinuation of tnf inhibitors over the past decade ( 20002009 ) . the authors observed higher discontinuation rates with these agents in recent years than a decade ago , inefficacy being the main reason for the discontinuations and also the increasing availability of alternative treatment options . the authors speculate that clinicians and patients starting biological agents nowadays might have higher expectation regarding response to therapy . registry data affords some significant advantages when compared to rcts : typically , registries contain data from large numbers of patients followed up for longer periods of time and in a real - life setting ( i.e. without the exclusion criteria associated with most rcts ) . however , these registry data are also associated with some limitations in clinical practice , treatment decisions are not random but are dependent on many variables , such as disease severity , patient choice and adherence , concomitant medication , and comorbidities that may act as important confounders in analyses of efficacy and safety . the decision to stop therapy in a real - world setting due to inefficacy or ae was at the discretion of the rheumatologist and additionally , the studies included in the present review were not designed to compare the different tnf inhibitors ( none of the studies assessed statistical significance in drug survival between the tnf inhibitors ) , and a number of biases may have occurred . first , these three treatments became commercially available at different times ( first inf , followed by etn , and then ada ) , and the patients treated with inf had a significantly higher level of disease activity and disability at the start of therapy . universal screening for latent tb infection only became widespread once the risk of tb reactivation had been identified and might have led to higher rates of discontinuation due to tb reactivation in the early years of tnf inhibitor therapy . inf is administered via intravenous infusion , and when subcutaneous ( sc ) etn and ada became available , clinician and patient preference for this route of administration may have led to discontinuation of inf in favour of sc options . secondly , the likelihood of patients receiving concomitant mtx therapy may vary with the choice of drug : ada and etn have marketing authorisation for the use of monotherapy , whereas inf is only licensed for use in combination with mtx . one study from the bsrb register published in 2006 reported that in uk , 82% of 1453 patients treated with inf received mtx as a concomitant therapy , while this proportion was only 20% in etn group . thirdly , there is geographical variation in the use of individual tnf inhibitors which could also be related to the likelihood of developing aes or inefficacy . there may be other unidentified confounding factors ( e.g. physician preference ) that may be relevant to the outcomes in question . in spite of these facts and limitations , the results of the present systematic review provide useful insights into time and rate of survival of tnf inhibitors among the group of unselected community - based patients with severe , long - standing ra . approximately 50% of patients discontinue their tnf inhibitor over the first five years as a result of inefficacy or aes . there was a modest numerical increase in drug survival with etn compared to ada , but the clinical relevance of this difference needs to be interpreted within a global assessment of risk and benefit . assuming equal efficacy and safety , clinicians might regard even a small increase in drug survival rate as being of significance in daily practice . future research is needed to understand the underlying mechanisms leading to discontinuation of tnf inhibitor therapy . approximately 50% of patients discontinue their tnf inhibitor over the first five years as a result of inefficacy or aes . there was a modest numerical increase in drug survival with etn compared to ada , but the clinical relevance of this difference needs to be interpreted within a global assessment of risk and benefit . assuming equal efficacy and safety , clinicians might regard even a small increase in drug survival rate as being of significance in daily practice . future research is needed to understand the underlying mechanisms leading to discontinuation of tnf inhibitor therapy .

nanostructured titania particles are very attractive for several applications such as photocatalysis , coating , gas sensing , and photovoltaics [ 1 , 2 ] . the morphology and crystallinity of the titanium dioxide ( tio2 ) particles greatly influence the efficiencies in these applications [ 35 ] . the active sites on titania surface are controlled by the morphology of the titania films . moreover , charge carrier transfer rates are greatly influenced by morphology as it impacts carrier delocalization routes [ 68 ] . the electronic structure of tio2 is further controlled by its crystallinity . among three different crystallographic polymorphs of tio2anatase , rutile , and brookite anatase can be prepared as thermodynamically metastable nanocrystals with a wide band gap , 3.2 ev . the macroscopic homogeneity of the titania films over large areas is a crucial requirement for applications in photovoltaic devices . our group reported the preparation of titania nanoparticles with desired morphologies in a reproducible way [ 13 , 14 ] . an amphiphilic block copolymer , poly(styrene)-block - poly(ethylene oxide ) ( ps - b - peo ) , acting as template , was dissolved in toluene isopropanol mixture , and the titania precursor , titanium(iv ) tetraisopropoxide ( ttip ) , was subsequently incorporated into the micelles . gel was spin - coated , and after calcination at 450 c , anatase titania nanoparticles were obtained . a ternary phase diagram was mapped using a good poor solvent pair by changing the relative weight fractions between 1,4-dioxane , hydrochloric acid ( hcl ) , and ttip . a triblock copolymer of peo - ps - peo was also used as the templating agent in good poor solvent - induced phase separation via sol gel chemistry and resulted in macroporous anatase tio2 thin films . these ordered anatase titania thin films have potential application in dye - sensitized solar cell ( dssc ) devices . if the hybrid films are to be used as an alternative blocking layer , an additional insulation property has to be incorporated in between semiconducting anatase titania nanoparticles . when there is no insulation in between titania nanoparticles , the transparent fluorine - doped tin oxide / indium tin oxide substrate is in direct contact with the hole transport medium ; charge recombination is favored and intrinsically inefficient solar cells are obtained . in order to incorporate insulating parts in between titania nanoparticles , preparation of titania nanoparticles using an amphiphilic block copolymer as the templating agent by sol gel chemistry was extended with the help of a poly(dimethylsiloxane ) ( pdms)-containing amphiphilic block copolymer [ 1719 ] . pdms is one of polymeric precursors of the general formula ( rxsi(or)4 x ) containing si c bonds . c bond is present from the beginning in the sol gel process and preserved in glass structures . these silicon oxycarbide gels were heat - treated to intermediate temperatures to obtain silicon oxycarbide glasses . poly(ethylene oxide ) methyl ether methacrylate - block - poly(dimethylsiloxane)-block - poly(ethylene oxide ) methyl ether methacrylate [ ( peo)ma - pdms - ma(peo ) ] triblock copolymer was used as the templating agent . in previous works , ( peo)ma - pdms - ma(peo ) gel chemistry to prepare conductive anatase titania nanoparticles embedded in a polymer - derived ceramic using 1% by weight of the triblock copolymer , hcl , and titania precursor . in this paper , we investigate the effect of sol gel components on the prepared titania morphology and their photophysical properties when the conductive anatase titania nanoparticles are prepared in an insulating matrix . polymer in the rest of the text for simplicity ) , and titania precursor ( ttip)are varied individually as depicted in scheme 1 . isopropanol mixture in a ratio of 3:1 to achieve complete dissolution of pdms and ( peo)ma blocks , followed by successive addition of hcl and ttip within 2 min . thus , the interfacial energy between the pdms block and the solvents increases and leads to the formation of micelles in solution . ttip , also a poor solvent for pdms , incorporates into the hydrophilic peo domains via coordination bonds . a complex force balance between polymer chain stretching and polymer solvent interactions determines the morphologies [ 2124 ] . furthermore , the block copolymer concentration controls the resulting micellar morphologies in the sol gel . to understand how the changes in hcl , ttip , and block copolymer , i.e. , sol gel components , concentration control the morphology of titania structures moreover , microbeam grazing incidence small - angle x - ray scattering ( gisaxs ) experiments reveal information from the inside morphology that could not be obtained via microscopy techniques . in addition , photoluminescence ( pl ) spectroscopy gives information of the photoelectronic properties of particles prepared from a variation of the sol gel components after preparation and upon heating at 450 c . the increase in the titania precursor and the polymer amount result in smaller primary titania particles . this represents a promising preparation route for applications that require conductive titania particle sizes on the order of 1320 nm , namely photovoltaic applications . ttip ( aldrich , 99.9% ) , hydrochloric acid ( 37% , hcl , acros , geel , belgium ) , isopropanol ( acros ) , and tetrahydrofuran ( thf , extra dry from acros ) were used without further purification . sample solutions were prepared by dissolving 40.5 mg of ( peo)ma - pdms - ma(peo ) block copolymer in 3,004 mg thf and 1,008 mg isopropanol . forty - five milligrams titania precursor ( ttip ) and 47 mg hcl were added and stirred for 1 h at ambient temperature . these amounts were for 1% hcl , 1% ttip , and 1% block copolymer by weight over the total components . the amount of hcl was varied to 2% and 3% of the total amount . in a typical experiment , component amounts were 43.8 mg of ( peo)ma - pdms - ma(peo ) block copolymer , 3,007 mg thf , 1,004 mg isopropanol , 43.8 mg ttip , 84.6 mg hcl for 2% hcl and 42.4 mg of ( peo)ma - pdms - ma(peo ) block copolymer , 3,006 mg thf , 1,002 mg isopropanol , 45.5 mg ttip , 140.7 mg hcl for 3% hcl . block copolymer amount was also varied to 2% by weight : 92.6 mg of ( peo)ma - pdms - ma(peo ) block copolymer , 3,021 mg thf , 1,013 mg isopropanol , 42.2 mg ttip , 43.8 mg hcl . titania precursor amount was varied to 2% by weight : 40.2 mg of ( peo)ma - pdms - ma(peo ) block copolymer , 3,016 mg thf , 1,017 mg isopropanol , 82.6 mg ttip , 40 mg hcl . nanocomposite films were prepared on si(100 ) substrates by spin coating each sample solution for 60 s using a sss microtec delta 80 spin coater under ambient conditions ( temperature , 21 c ; relative humidity , 40 5% ; rotation speed of 2,000 rpm ; acceleration speed of 2,000 rpm / s ) . si wafers were cleaned prior to spin coating by heating to 80 c in the hydrogen peroxide ammonium water mixture for 15 min , followed by dilution with millipore water , 15 min ultrasonication in hydrochloric acid water mixture method , and dilution with millipore water . to uncover the surface of the titania particles , argon plasma treatment was applied by technics plasma - processor 200 - 6 at 300 w for 10 min . plasma - etched titania nanocomposite films were heated up to 450 c under nitrogen atmosphere with a heating rate of 6.25 c / min starting from room temperature and kept at 450 c for 4 h. after calcination , the samples were cooled to room temperature in a furnace . scanning electron microscopy ( sem ) images were obtained on field emission sem ( leo 1530 gemini ) at an accelerating voltage of 3 kv . gisaxs experiments were performed at the beamline bw4 , at desy hasylab in hamburg , where parabolic beryllium compound refractive lenses are used to obtain a moderately micro - focused x - ray beam . a beam size of 32 23 m ( height width ) , synchrotron radiation with a wavelength of 1.38 , and incident on the sample surface at 0.74 were used for the measurements . the sample detector distance for gisaxs was adjusted to 2.2 m. the setup included a movable specular beam stop and a diode beam stop for the detection of direct beam intensity . a 2d - mar ccd detector ( 2,048 2,048 pixels ) scanning force microscopy ( sfm ) images were recorded using a veeco dimension 3100 system ( veeco , santa barbara , usa ) in tapping mode equipped with si cantilevers ( olympus omcl - ac240ts , japan ) having spring constant ranging between 33.2 and 65.7 n / m and resonance frequency 370.4319.7 khz . pl spectra were recorded on a spex fluorolog ii ( 212 ) using a xenon discharge lamp at 400 w. the emission spectra were collected at an excitation wavelength of 350 nm . ttip ( aldrich , 99.9% ) , hydrochloric acid ( 37% , hcl , acros , geel , belgium ) , isopropanol ( acros ) , and tetrahydrofuran ( thf , extra dry from acros ) were used without further purification . sample solutions were prepared by dissolving 40.5 mg of ( peo)ma - pdms - ma(peo ) block copolymer in 3,004 mg thf and 1,008 mg isopropanol . forty - five milligrams titania precursor ( ttip ) and 47 mg hcl were added and stirred for 1 h at ambient temperature . these amounts were for 1% hcl , 1% ttip , and 1% block copolymer by weight over the total components . the amount of hcl was varied to 2% and 3% of the total amount . in a typical experiment , component amounts were 43.8 mg of ( peo)ma - pdms - ma(peo ) block copolymer , 3,007 mg thf , 1,004 mg isopropanol , 43.8 mg ttip , 84.6 mg hcl for 2% hcl and 42.4 mg of ( peo)ma - pdms - ma(peo ) block copolymer , 3,006 mg thf , 1,002 mg isopropanol , 45.5 mg ttip , 140.7 mg hcl for 3% hcl . block copolymer amount was also varied to 2% by weight : 92.6 mg of ( peo)ma - pdms - ma(peo ) block copolymer , 3,021 mg thf , 1,013 mg isopropanol , 42.2 mg ttip , 43.8 mg hcl . titania precursor amount was varied to 2% by weight : 40.2 mg of ( peo)ma - pdms - ma(peo ) block copolymer , 3,016 mg thf , 1,017 mg isopropanol , 82.6 mg ttip , 40 mg hcl . nanocomposite films were prepared on si(100 ) substrates by spin coating each sample solution for 60 s using a sss microtec delta 80 spin coater under ambient conditions ( temperature , 21 c ; relative humidity , 40 5% ; rotation speed of 2,000 rpm ; acceleration speed of 2,000 rpm / s ) . si wafers were cleaned prior to spin coating by heating to 80 c in the hydrogen peroxide ammonium water mixture for 15 min , followed by dilution with millipore water , 15 min ultrasonication in hydrochloric acid water mixture method , and dilution with millipore water . to uncover the surface of the titania particles , argon plasma treatment was applied by technics plasma - processor 200 - 6 at 300 w for 10 min . plasma - etched titania nanocomposite films were heated up to 450 c under nitrogen atmosphere with a heating rate of 6.25 c / min starting from room temperature and kept at 450 c for 4 h. after calcination , the samples were cooled to room temperature in a furnace . scanning electron microscopy ( sem ) images were obtained on field emission sem ( leo 1530 gemini ) at an accelerating voltage of 3 kv . gisaxs experiments were performed at the beamline bw4 , at desy hasylab in hamburg , where parabolic beryllium compound refractive lenses are used to obtain a moderately micro - focused x - ray beam . a beam size of 32 23 m ( height width ) , synchrotron radiation with a wavelength of 1.38 , and incident on the sample surface at 0.74 were used for the measurements . the sample detector distance for gisaxs was adjusted to 2.2 m. the setup included a movable specular beam stop and a diode beam stop for the detection of direct beam intensity . a 2d - mar ccd detector ( 2,048 2,048 pixels ) was used to record the scattered x - rays . scanning force microscopy ( sfm ) images were recorded using a veeco dimension 3100 system ( veeco , santa barbara , usa ) in tapping mode equipped with si cantilevers ( olympus omcl - ac240ts , japan ) having spring constant ranging between 33.2 and 65.7 n / m and resonance frequency 370.4319.7 khz . pl spectra were recorded on a spex fluorolog ii ( 212 ) using a xenon discharge lamp at 400 w. the emission spectra were collected at an excitation wavelength of 350 nm . the titania triblock copolymer nanocomposite films with varying sol gel compositions were prepared by spin coating on previously cleaned si wafers . the obtained morphologies of the nanocomposite films were characterized in real space with microscopy techniques . however , one has to keep in mind that due to the low electron density difference between ti and si , the obtainable magnification in sem images is low . the standard solution of 1% hcl , 1% ttip , and 1% polymer content sample is presented in fig . in previous work , this concentration was chosen as the standard one according to the phase diagram for titania nanoparticle preparation using ps - b - peo as the templating agent . in our system , based on the triblock copolymer [ ( peo)ma - pdms - ma(peo ) ] , the templating agent and the corresponding solvents are different . 1sfm height ( 1 ) , phase ( 2 ) , and sem ( 3 ) images of as - prepared samples : 2% ttip ( a ) , 2% polymer ( b ) , 1% hcl ( c ) , 2% hcl ( d ) , and 3% hcl ( e ) . height scales are 60 nm ( a1 ) , 50 nm ( b1 ) , 30 nm ( c1 ) , 50 nm ( d1 ) , 40 nm ( e1 ) with phase scales 40 ( a2 ) , 20 ( b2 ) , 3 ( c2 ) , 8 ( d2 ) , and 7 ( e2 ) . scale bars correspond to 1 m sfm height ( 1 ) , phase ( 2 ) , and sem ( 3 ) images of as - prepared samples : 2% ttip ( a ) , 2% polymer ( b ) , 1% hcl ( c ) , 2% hcl ( d ) , and 3% hcl ( e ) . height scales are 60 nm ( a1 ) , 50 nm ( b1 ) , 30 nm ( c1 ) , 50 nm ( d1 ) , 40 nm ( e1 ) with phase scales 40 ( a2 ) , 20 ( b2 ) , 3 ( c2 ) , 8 ( d2 ) , and 7 ( e2 ) . scale bars correspond to 1 m the triblock copolymer , ( peo)ma - pdms - ma(peo ) , is a gel at room temperature . therefore , tapping mode sfm images of as - prepared samples could be obtained on only 10-m sized areas . some circular pits ( made with red arrows on sfm and sem images in fig . 1 ) these pits are due to the liquid liquid miscibility gap which occurred during spin coating in the nanocomposite preparation step . increased titania precursor and hcl contents resulted in a similar morphology as compared to the standard solution ( see fig . a change in the overall film morphology was observed with an increased polymer content ( see fig . for the system containing ps - b - peo , the variation of the block copolymer amount from 0.25% to 4% by weight resulted in a morphological change from mesoporous structures to lamellae . the preparation of titania nanoparticles using a pdms containing amphiphilic block copolymer results in an insulating polymer - derived ceramic in between titania nanoparticles after heat treatment under inert atmosphere . inert atmosphere is required to prevent decomposition of the pdms before it turns into ceramic . with this preparation route , nanocomposite films composed of conducting anatase titania nanoparticles embedded in an insulating matrix were obtained . however , to avoid insulation on the titania surface , plasma treatment is required before heating . next , the preparation of the titania films was continued with argon plasma etching to uncover the titania surface from any polymer and to achieve a conduction from the titania surface to the substrate . this recipe results in a conductive titania network embedded in a polymer - derived insulating matrix . a removal of the ( peo)ma part of the block copolymer and the ceramization of pdms resulted in a nanoporous inorganic film on the substrate , thereby enabling higher magnification imaging with sem ( fig . 2 the circular pits that occurred during spin coating are observed again in these images . although the circular pits of some hundred nanometers could be seen via sem imaging , it remained difficult to image primary titania particles . 2sem images of plasma - treated and annealed at 450 c samples , 1% hcl ( a ) , 2% hcl ( b ) , 1% hcl ( c ) , 2% ttip ( d ) , and 2% polymer ( e ) . scale bars correspond to 200 nm sem images of plasma - treated and annealed at 450 c samples , 1% hcl ( a ) , 2% hcl ( b ) , 1% hcl ( c ) , 2% ttip ( d ) , and 2% polymer ( e ) . scale bars correspond to 200 nm the structural stability of the particles was investigated by increasing the heating temperature further to 1,000 c . the particle diameters , averaged from the sem images , are in the range of 1440 nm for the 1% hcl sample ( in fig . these high magnification images give information on the smallest structures ; however , the overall homogeneity of the film still remains unclear . for as - prepared films , microscopy did not provide much information since the softness of the polymer at room temperature and the low electron density difference between ti and si prevent high - resolution imaging . moreover , microscopy techniques are restricted to an investigation in the micrometer square range and to the sample surface . for investigating the lateral structure of titania particles inside the films ( thickness of 30 10 nm ) and the uniformity of the titania morphology in the nanocomposite film , we performed gisaxs measurements at the beamline bw4 in hasylab at desy , hamburg [ 26 , 30 ] . in general , gisaxs scattering patterns yield structural information averaged over the illuminated sample spots . in our case , this sample spot was of a size of 56,992 m ( 1,781 32 m ) . this is a consequence of the enlarged footprint at the chosen incident angle of 0.74. the out - of - plane cuts at an exit angle equal to the critical angle of titania , c = 0.28 , were selected to obtain an averaged structure information about the percolating titania structures in a range from several nanometers up to 190 nm . for a closer data analysis , the out - of - plane cuts were fitted according to the unified fit model [ 3133 ] . this model was successfully applied to various scattering experiments in transmission geometry for different applications [ 31 , 32 , 3438 ] . we used the unified fit model to investigate the morphology of our titania structures in our previous investigations already [ 17 , 39 , 40 ] . this model describes the structure of the material in terms of structural levels , ranging from single particles to clusters . each structural level contains a guinier regime which describes the size and a power law regime giving the integral properties of the structure . the porod regime provides information about the surface and mass fractality of the individual structure . thus , it is possible to differentiate between smooth and jagged primary particle structures and between crystal - like and disordered secondary cluster structures . figure 4 shows the out - of - plane cuts together with fits which are overlaid on experimental data for as - prepared , heated at 450 and 1,000 c , samples . 3sem images of plasma treated and annealed at 1,000 c samples for 1% hcl ( a ) , 2%hcl ( b ) , 3%hcl ( c ) , 2% ttip ( d ) , and 2% polymer composition ( e ) . arrows point the representative primary titania structures ( l1 ) in all images , and the cluster size ( l2 ) is depicted with a line in ( a)fig . 4double - logarithmic plots of the out - of - plane cuts of the 2d intensity as a function of the qy component of the scattering vector . for clarity colored lines are the fits , from unified fit model , for determining the prominent in - plane length scales , corresponding to the scattering data in black below them . from bottom to top , the curves correspond to samples from 2% ttip ( cyan ) , 2% bcp ( polymer , green ) , 1% hcl ( purple ) , 2% hcl ( blue ) , and 3%hcl ( red ) concentration compositions in each graph . upper graph ( a ) is for as - prepared , middle ( b ) is for heated at 450 c , bottom graph ( c ) is for heated at 1,000 c samples sem images of plasma treated and annealed at 1,000 c samples for 1% hcl ( a ) , 2%hcl ( b ) , 3%hcl ( c ) , 2% ttip ( d ) , and 2% polymer composition ( e ) . arrows point the representative primary titania structures ( l1 ) in all images , and the cluster size ( l2 ) is depicted with a line in ( a ) double - logarithmic plots of the out - of - plane cuts of the 2d intensity as a function of the qy component of the scattering vector . for clarity , colored lines are the fits , from unified fit model , for determining the prominent in - plane length scales , corresponding to the scattering data in black below them . from bottom to top , the curves correspond to samples from 2% ttip ( cyan ) , 2% bcp ( polymer , green ) , 1% hcl ( purple ) , 2% hcl ( blue ) , and 3%hcl ( red ) concentration compositions in each graph . upper graph ( a ) is for as - prepared , middle ( b ) is for heated at 450 c , bottom graph ( c ) is for heated at 1,000 c samples the progression of the gisaxs curves for different hcl concentrations is similar for the as - prepared nanocomposite films ( fig . the smallest structures , represented as level 1 ( l1 in table 1 ) , were obtained from the fits corresponding to the high - q region ( q > 0.005 nm ) . these small structures are comparable within the experimental errors for all samples , except the one with 2% hcl concentration which is 20% larger than the standard solution ( 1% hcl ) . an increase in the amount of polymer ( 2% bcp , green curve ) or titania precursor ( 2% ttip , cyan curve ) in the sol gel process results in a different slope as compared with the standard solution ( 1% hcl , purple curve ) and increased hcl concentrations ( 2% hcl , blue curve , and 3% hcl , red curve ) . this is reflected in a 9% reduction of the primary titania particle sizes compared to the particle size from the standard solution ( 1% hcl ) . the unified fit model gives information about the structure and packing of the structures from the porod regime . for example , smooth spherical particles scattering decays with q dependence result in a p value of 4 in the unified fit model and cylindrically symmetrical structures scattering decays with q dependence with a p of 3 . the packing of the smallest structures are similar as the p value is around 2 for all as - prepared samples . these smaller structures in as - prepared samples are amorphous after the hydrolysis of ttip in the sol gel on peo domains . therefore , low packing with a non - well - defined structure is expected after spin coating . the preparation of the anatase titania nanoparticles by the sol the fitted p value is around 4 for 2% ttip and 2% polymer samples after annealing at 450 c . table 1values obtained from unified fitted gisaxs data of as - prepared , heated at 450 c and 1,000 c samples , p and rg stand for packing density and radius of gyration , respectivelysampleas - preparedheated at 450 cheated at 1,000 cprg ( nm)prg ( nm)prg ( nm)3% hcll 12.3 0.36.7 0.92.4 0.27.9 0.53.8 2.57.8 0.1l 22.8 0.1160 1.22.3 0.12.1 0.52%hcll 11.9 0.19.5 0.82.6 0.19.4 0.73.8 0.56.2 0.1l 23.0 0.1152 0.91.9 0.12.1 0.3166 0.11%hcll 11.9 0.37.0 0.72.1 0.18.0 0.31.7 0.18 .0 0.5l 22.4 0.1170 1.72.3 0.11.7 0.1131 1.12%l 12.5 0.46.4 0.64.0 0.16.0 0.23.9 2.86.5 1.6polymerl 21.8 0.12.5 0.175 0.81.5 0.4171 112%ttipl 11.5 0.36.4 0.74.0 0.47.3 0.54.0 0.27.7 0.4l 22.4 0.52.6 0.11.9 0.4 values obtained from unified fitted gisaxs data of as - prepared , heated at 450 c and 1,000 c samples , p and rg stand for packing density and radius of gyration , respectively the high - resolution sem images obtained from samples annealed at 1,000 c ( fig . 3 ) can be used for an interpretation of our gisaxs results . in general , the corresponding unified fit rg values for primary titania structures ( structural level 1 , l1 ) of diameters ( 2rg ) 16 nm for 3% hcl , 13 nm for 2% hcl , 16 nm for 1% hcl , 13 nm for 2% polymer , and 15 nm for 2% ttip match the diameters ( 2rg ) of the structures shown in fig . . meanwhile , the triblock copolymer , the templating agent , which is present among the particles , decomposes . primary particles ( l1 ) stack over each other and build a titania network . in some parts , a few particles merge together , resulting in a larger titania cluster ; in some parts , more particles are joined together , resulting in a broad particle size distribution and increasing the polydispersity in particle size distribution . as observed from the sem images , the particle sizes are not identical but not very different at the same time with a low aspect ratio . this is the major reason why sharp peaks could not be observed via x - ray scattering . the cluster size ( l2 ) obtained from the fit for 1% hcl standard solution gives an rg value of 130 nm , resulting in a diameter ( 2rg ) of 260 nm . figure 3a shows circular pits of size 200 nm ( pointed with a red line over the pit diameter ) , which is in agreement with the fit value . structures with rg 190 nm ( 2rg > 380 nm ) are beyond the resolution limit of our gisaxs experiment . therefore , the values for clusters could not be obtained and left as blank rows for some samples in table 1 . the arrows in fig . 3 show the primary particles ( l1 ) in each image ; a cluster size ( l2 ) is pointed in fig the information obtained from sem images match the values obtained from the unified fit modeled gisaxs data . here , gisaxs helps us to understand the overall morphology of continuous titania structures inside the whole film . after proving that gisaxs measurement data with the unified fit model reveal the structural information about the titania particles morphology , we can discuss the structural changes of titania particles depending on the sol gel composition according to the values obtained from the unified fit model of gisaxs experiments . the structural stability of the titania structures upon elevated annealing temperature is observed by sem imaging in correlation with gisaxs experiments . however , the crystallinity of the particles changed from amorphous to anatase and moreover to rutile , as observed from the x - ray diffraction ( xrd ) experiment ( fig . typical anatase titania peaks are also depicted in fig . 5 beneath the xrd curves . 5a ) is amorphous and showed no peak . after heating at 450 c , typical anatase titania peaks were observed ( fig . further increase in heating temperature to 1,000 c resulted in additional rutile phase , as indicated by additional xrd peaks ( fig . heating temperature of 450 c is less costly and destructive to the substrate than treatment at 1,000 c . moreover , rutile phase which will act as an impurity among anatase particles was observed after heating to 1,000 c . 5xrd diffractograms of as - prepared ( a ) , heated at 450 c ( b ) , and heated at 1,000 c ( c ) 1%hcl samples ( standard sol gel ) . typical anatase titania peaks are shown at the bottom xrd diffractograms of as - prepared ( a ) , heated at 450 c ( b ) , and heated at 1,000 c ( c ) 1%hcl samples ( standard sol gel ) . typical anatase titania peaks are shown at the bottom figure 4-b shows the gisaxs experimental data ( black data points ) with overlaid fit results ( colored lines ) for plasma - treated and annealed at 450 c samples . the progression of 2% bcp ( polymer ) sample changes significantly from the as - prepared curve compared to the change between other compositions as - prepared ones . the slope of 2% bcp ( polymer ) changed and a broad peak in the medium - q range ( 0.5 nm ) appeared , indicating a different secondary structure than present in the as - prepared sample . this results in smaller secondary structures ( l2 ) with a diameter ( 2rg ) of 150 nm ( rg 75 nm obtained from the fit , l2 ) . as also seen from the high - resolution sem image in fig . 3e , large circular pits are absent , and this is the case for the whole sample giving a narrow size difference between clusters , allowing better packing of the particles . the size of the primary titania structures ( l1 ) did not change within the experimental errors compared to as - prepared samples . this indicates that plasma cleaning and heating steps do not affect the smallest primary structures . the organic material in between the titania structures changes during the heat treatment . since the material properties changed after the heating step , i.e. , pdms turned into silicon oxycarbide , organic polymer decomposed , amorphous titania turned into its anatase phase , and the scattering length density of the material changed . removal of the organic part of the nanocomposite films increased the distance between the particles . the packing of the primary particles ( l1 ) also increased and a p value of 4 , corresponding to densely packed spherical particles , was observed for both 2% ttip and 2% polymer contents . a hcl content variation resulted in p values of 22.5 , indicating less closely packed and amorphous , in terms of shape , cylindrical primary structures . larger cluster size for all hcl and 2% ttip samples were beyond the resolution limit of gisaxs measurements . this is shown by the correlation between sem images ( fig . 3 ) and the electro - optic and photoelectric properties of these morphologies were investigated via pl spectroscopy which depends on electronic excitations . pl is used to detect the surface defects occurring on titania nanoparticles , and a correlation between the titania morphology and electron active sites can be built . figure 6 illustrates the pl spectra of samples after preparation and after heating at 450 c under a 350-nm wavelength excitation source . except 2% hcl content , all as - prepared samples exhibit higher pl intensity than the samples heated at 450 c . as shown by xrd measurements , titania is in amorphous state after preparation and turns into its anatase polymorph after calcination at 450 c . higher surface defects and no crystallization in as - prepared samples result in higher pl intensity . as the amorphous titania nanoparticles turned into anatase phase , surface defects decreased and resulted in lower pl intensity . this also reveals that the photogenerated holes and electrons had the lowest recombination rate in samples heated at 450 c . also observed low emission intensity in pl measurements for anatase titania nanotubes which was due to good crystallization and fewer surface defects of the sample . the peak at 398 nm can be assigned to self - trapped excitons localized in tio6 octahedron , peaks at 469 nm to oxygen vacancies , and peaks at 435 and 510 nm to surface defects [ 43 , 4549 ] . 6photoluminescence spectra of as - prepared ( solid points ) and heated at 450 c ( open points ) samples photoluminescence spectra of as - prepared ( solid points ) and heated at 450 c ( open points ) samples the pl spectral peaks shifted to lower wavelengths after heating , and no peak at 510 nm could be observed . the photoluminescence observed from 2% polymer after heating at 450 c is mostly due to oxygen vacancies and self - trapped excitons . as the particle sizes become smaller , the oxygen vacancy content increases , resulting in higher probability of excitonic occurrence , thus higher excitonic pl signal . the smallest primary titania structures ( l1 ) were obtained by 2% polymer after heating to 450 c ( see table 1 , rg 6 nm ) . other samples did not show considerable photoluminescence after heating , except 2% hcl which exhibited higher pl than as - prepared ones contrary to the amorphous crystalline relation explained above . two percent polymer content resulted in the smallest anatase titania nanoparticles with less surface defects , high oxygen vacancies . closely packed spherical - shaped titania particles with a diameter of 1320 nm were obtained by varying the sol gel composition to 2% polymer . their pl measurements showed less surface defects with high pl due to oxygen deficiencies and self - trapped excitons . gel components : hcl , titania precursor ( ttip ) , and polymer ( peo)ma - pdms - ma(peo ) . the primary titania structure size decreased and their packing density increased with increasing the polymer or titania precursor contents . removal of the organic parts via plasma and subsequent heat treatments enabled to obtain higher magnification microscope images . sem images of 1,000 c annealed titania nanoparticles were in good agreement with the results obtained from the unified fit of gisaxs experiments , which further revealed information on the lateral structures of the particles irrespective of annealing . a 2% polymer sol gel concentration resulted in primary titania structure size on the order of 1320 nm with extra photoactive properties . the preparation of smaller sized primary titania structures will allow easier packing of several titania particles over each other to form a titania column inside the nanocomposite film , building a pathway for electrons in dssc applications .

tricuspid regurgitation ( tr ) after orthotopic heart transplantation ( oht ) is common , with reported prevalence that varies from 19% to 84% . the prevalence and severity of tr increase with the length of followup . in most cases tr is mild and asymptomatic , but some cases of moderate or severe tr are related to morbidity and mortality [ 15 ] . doppler echocardiography is the most common technique used for the detection and evaluation of severity of tr [ 6 , 7 ] . the etiology of tr after oht is unclear , and several variables have been reported to be related , including the surgical anastomosis technique employed ( biatrial versus bicaval ) [ 813 ] , iatrogenic damage due to endomyocardial biopsies ( embs ) [ 8 , 1418 ] , number of acute cellular rejection episodes ( acrs ) [ 8 , 14 ] , pretransplant pulmonary hypertension [ 8 , 19 , 20 ] , discordance between the size of the donor 's heart and the recipient 's pericardial cavity , and cardiac allograft vasculopathy ( cav ) . preventive measures mentioned in the literature include prophylactic tricuspid annuloplasty during oht [ 2224 ] , the use of a long bioptome sheath during emb , and the use of noninvasive methods to monitor for graft rejections . the aims of this study were to determine the short and long term prevalence of tr after oht , to examine the correlation between its development and the above - mentioned variables , and to determine its clinical outcomes . the study is a retrospective cohort study of all 163 patients who underwent oht between 1988 and 2009 and were followedup at the heart transplant clinic at the sheba medical center for a minimal period of 12 months . the data of 10 aditional patients who underwent heart transplantations in china between 2005 and 2007 was excluded in accordance with current ethical guidelines of transplantation societies and journals . patients were divided into two groups based on the severity of their postoperative tr at the end of the follow - up period at an average of 8.2 years : 140 patients with no tr or mild tr and 23 patients with significant ( at least mild to moderate ) tr . the two groups were compared regarding preoperative hemodynamic variables , surgical technique employed ( biatrial versus bicaval anastomosis ) , number of embs taken , number of acrs , incidence of cav , right heart failure , and clinical outcome . patients underwent routine echocardiographic follow - up examinations immediately after transplantation , at 3 months , 12 months , and annually thereafter . severity of tr was assessed by comparing the ratio of tr jet area to the right atrial area on color doppler and was scored from 0 to 3 : 0no tr , 1mild tr , 2moderate tr , and 3severe tr . mild to moderate tr was scored 1.5 and moderate to severe tr was scored 2.5 . additional echocardiographic parameters reviewed included left ventricular ejection fraction , right ventricular size and function , and estimated pulmonary arterial pressure . every patient underwent routine right heart catheterization before transplantation , one week after transplantation and annually thereafter in which mean pulmonary arterial pressure , pulmonary vascular resistance , and right atrial pressure were recorded . embs were performed weekly during the first month after transplantation , biweekly during the second and third months , at the fourth , fifth , sixth , ninth , and twelfth months after transplantation , and annually following the first year . biopsies were evaluated for rejection using the revised ishlt ( international society of heart and lung transplantation ) criteria . patient data were analyzed with the statistical program of social sciences ( spss version 19 ) . categorical data are expressed as percentages and continuous data are expressed as mean standard deviation . the prevalence of late irreversible tr and the survival difference between the two study groups were analysed according to the kaplan - meier method . univariate analyses were used to compare differences between variables obtained in the two groups of patients ( patients with no / mild tr versus patients with at least mild - moderate tr ) . we have conducted a nonparametric kolmogorov - smirnov test for normal distribution ; based on the results , we used independent t - test or mann - whitney test to compare continuous data ( number of embs , number of acrs , and preoperative hemodynamic variables ) between the two groups ; we presented median ( and range ) for variables which depart from normal distribution . categorical data ( cav , surgical anastomosis technique and mortality rates ) were compared by test . a multivariate analysis was performed by using the cox regression model to identify risk factors for tr . there were no statistically significant differences between the two groups in the following preoperative demographic or clinical characteristics : gender , age , etiology of heart failure , or incidence of previous heart surgery ( table 1 ) . of the total 163 patients , 55.8% underwent the transplant at the sheba medical center in israel and the rest in other countries , with a statistically significant difference between the two groups ( table 1 ) . the average total heart ischemic time during transplantation , as well as the average cardiopulmonary bypass time , was similar between the two groups ( table 1 ) . the average follow - up period was significantly longer in the group of patients with significant tr compared to the group of patients with insignificant tr ( table 1 ) . significant tr prevalence peaked at 34% immediately after transplantation ( average 14.0 11.8 days ) , decreased to a nadir of 6.4% after 3 years , and then increased gradually ( figure 1 ) . at the end of the followup , 23 patients ( 14.1% of the study population ) developed significant tr . the average length of time between transplantation and the development of significant irreversible tr was 6.8 4.8 years . a kaplan - meier analysis of freedom from late significant tr revealed that 10 years after transplant 85.2% were permanently free of significant tr ( figure 2 ) . univariate analysis of risk factors for early ( average 14.0 11.8 days ) development of significant tr ( table 2 ) yielded only higher values of pretransplant mean pulmonary arterial pressure . the relationship between early tr and pretransplant pulmonary vascular resistance was of borderline significance . the surgical technique biatrial or bicaval anastomosis did not have an impact on the development of early tr . univariate analysis of risk factors for the late development of significant tr at the end of the followup is depicted in table 3 . the average total number of embs taken during the follow - up period was significantly higher in the group that developed significant tr at the end of the follow - up period ; however the average number of embs taken prior to the development of significant tr was similar in both groups . the median of acr episodes with any grade equal or higher than ishlt grade 1r was similar in both groups , as well as the median of acr episodes with ishlt grade 2r or higher . hemodynamically , the significant tr group displayed higher pretransplant values of mean pulmonary arterial pressure and pulmonary vascular resistance compared with the no / mild tr group , and these differences were of borderline significance ( p = 0.064 and p = 0.070 , resp . ) . the bicaval surgical anastomosis technique was employed in 55.8% of the patients and the biatrial technique was employed in 35% ; in 9.2% of the patients ( all of them underwent oht in foreign countries ) the surgical technique employed could not be determined due to missing surgery reports . the proportion of patients who underwent oht by using the biatrial surgical technique was significantly higher in the significant tr group ( 65% compared with 34.4% in the no / mild tr group ) . during the follow - up period 60 patients of the study population ( 39.7% ) developed cav of any kind ( including insignificant disease of one or more coronary arteries ) . significant cav ( defined as significant stenosis of at least one coronary vessel ) was found in 48 patients ( 31.8% ) and two or three vessels cav was diagnosed in 36 patients ( 23.8% ) . the prevalence of cav in the significant tr group was higher compared with the no / mild tr group ( table 3 ) . in multivariate analysis none of the explored variables were found to be an independent risk factor for the development of late significant tr . the explored variables included total number of embs taken , total number of acrs with at least ishlt grade 1r , the surgical technique employed , and incidence of cav . the relationship between significant tr at the end of the follow - up period and clinical outcomes is depicted in table 4 . the total mortality rate over the follow - up period ( average 8.2 years ) was 31.3% . in univariate analysis , the mortality rate during the follow up period was higher in the significant tr group ( 47.8% ) compared with the no / mild tr group ( 28.6% ) , and this difference was of borderline significance ( p = 0.065 ) . a kaplan - meier survival analysis did not demonstrate a significant difference between groups ( figure 3 ) . no significant differences were observed between the two groups in the median serum creatinine level at the end of the followup ( table 4 ) . during the follow - up period 8 patients underwent repeat heart surgery : 6 patients in the significant tr group and two patients in the no / mild tr group . of the six patients in the significant tr group , one patient underwent tricuspid annuloplasty ( 8.7 months after oht ) , two patients underwent tricuspid valve replacement ( 1.0 and 13.4 years after oht ) , two patients underwent combined replacement of the tricuspid and mitral valves ( 5.3 and 8.8 years after oht ) , and one patient underwent superior vena cava thrombectomy . in the no / mild tr group one patient underwent implantation of biventricular assist device as bridge to retransplantation and one patient underwent coronary artery bypass grafting . the relationship between the development of significant tr at the end of the follow - up period and echocardiographic parameters ( as measured in the last echocardiographic exam ) is depicted in figure 4 . patients in the significant tr group showed significantly higher values of estimated systolic pulmonary artery pressure , lower left ventricular ejection fraction , increased right ventricular dilatation , and worse levels of right ventricular dysfunction compared to the no / mild tr group . tr after oht is a common problem , varying in prevalence between 5.5% and 54% ( table 5 ) . although comparing different series may be problematic because studies vary in the length of followup , in the definition of significant tr and in the technique used for tr diagnosis , all reported series except one demonstrated a higher prevalence of tr at the end of the followup in comparison to our study ( 14.1% ) . marelli et al . in a cohort of 670 patients found freedom from significant tr of 78% at 9 years . our analysis demonstrated a slightly higher rate of 85.2% at 10 years ( figure 2 ) , similar to the 85.8% at 10 years rate demonstrated by chan et al . . regardless of the incidence of its occurrence , all reported series [ 2 , 4 , 5 , 14 ] have demonstrated an increased mortality among patients who have developed postoperative significant tr , ranging from 15% to 62.5% . similarly , while the overall mortality rate during the follow - up period ( average 8.2 4.6 years ) in our study was 31.3% , similar to the reported ishlt registry data , the mortality rate in the significant tr group was higher compared with the no / mild tr group ( 47.8% versus 28.6% ) , and this difference was of borderline significance ( p = 0.065 ) ; the kaplan - meier survival analysis did not demonstrate a significant difference between the two groups in our study . moreover , the development of significant tr is associated with the significant morbidity of the right heart failure and with the increased necessity to undergo repeat operations to repair or replace the regurgitant tricuspid valve , as evident in our series . thus it is of paramount importance to identify the risk factors associated with this potentially lethal complication in order to try and avoid them . the etiology of postoperative tr after oht is no doubt multifactorial and several preoperative , intraoperative , and postoperative features have been implicated as potential causative factors . several studies have reported a correlation between high pretransplant pulmonary vascular resistance or pulmonary arterial pressure and development of tr [ 8 , 19 , 20 ] . the suggested mechanism is the postsurgical right ventricular dysfunction and dilatation due to increased afterload . our study has demonstrated a borderline significant correlation between high pretransplant values of pulmonary arterial pressure and pulmonary vascular resistance and the development of late tr ( table 3 ) ; we have also found a statistically significant correlation between high pretransplant values of pulmonary arterial pressure and early tr ( table 2 ) , implying that elevated pulmonary arterial pressure and resistance may be risk factors for developing early and late tr after oht . many studies have found a correlation between the biatrial surgical technique and the development of tr after oht [ 8 , 1013 ] . the suggested mechanism in this case is geometric distortion of the atrioventricular annular ring and malcoaptation of the valve leaflets . our study has also demonstrated this correlation with patients who underwent the biatrial anastomosis technique showing significantly higher incidence of late significant tr compared to patients who underwent the bicaval anastomosis ( table 3 ) . the lack of significant difference in our series in the incidence of significant tr between the two anastomosis techniques early after the operation could be attributed to the residual high pulmonary artery pressures and resistance in the immediate postoperative period which resolves over time . nguyen et al . reported a tr prevalence of 60% at the end of the followup among patients who underwent more than 31 embs compared to 0% among patients who underwent less than 18 embs and in a multivariate analysis found that only the total number of embs was an independent risk factor for tr severity . lo et al . have demonstrated correlation between embs number greater than 10 and iatrogenic damage to the tricuspid valve . our study has demonstrated no correlation between the average number of embs taken prior to the development of significant tr , and in fact this number was actually higher in the no / mild tr group ( table 2 ) . the increased total number of embs found in the significant tr group in our study simply reflects the longer follow - up period of the significant tr group . among our total study population , only two patients were found by echocardiography to have developed iatrogenic damage to the tricuspid valve during the follow - up period , as evident by flail tricuspid leaflet in both cases and only one of these patients developed significant tr . aziz et al . have shown a statistically significant relationship between acrs number greater than or equal to ishlt grade 2 and early and late tr . have demonstrated a correlation between tr and the number of acrs during the first postoperative year . in our study late tr was not found to be correlated with the number of acrs equal or greater than ishlt grade 1r , and there was also no difference in the number of acrs with grade 2r or higher among the two groups ( table 3 ) . the relationship between cav and the development of tr has not been reported in previous studies and only one study has found such a relationship . our study has demonstrated a strong link in univariate analysis between cav and late tr ( table 3 ) but no such link in multivariate analysis . as cav is a well - known complication of the long - term course after transplantation , it is unclear whether this link with late tr is causative or purely incidental and time dependent . at the end of the followup the measured left ventricular ejection fraction in our series was lower in the significant tr group compared to the group with no tr . this unexpected finding , together with the increased levels of right ventricular dilatation and dysfunction ( figure 4 ) , might hint to a common etiology of graft vasculopathy . the study is retrospective , and therefore some data regarding early postoperative parameters were missing , particularly for patients transplanted in foreign countries . the study population is heterogenous due to this retrospective design some patients underwent oht 20 years before other patients , so different patients were exposed to different treatment protocols . the grading of tr was assessed by measuring the size of regurgitant jet area on color doppler this technique , although used in other similar studies , is not quantitative . the average follow - up period of the significant tr group was significantly longer compared with the insignificant tr group , and as tr prevalence increases with time , this difference between groups can act as a confounder ; this difference can also explain the similar survival curves of both groups ( figure 3 ) despite the higher mortality rate among patients with significant tr . in conclusion , the results of our series have demonstrated that the development of tr after oht is probably related to pretransplantation increased pulmonary artery pressure and pulmonary vascular resistance , biatrial anastomosis technique , and maybe to the development of graft vasculopathy . it is probably not related to the total number of embs and the number of acrs . the development of tr is probably associated with increased mortality but definitely with the need for a repeat tricuspid surgery .

the deletion of the short arm of chromosome 18 is thought to be one of the rare chromosomal aberrations . here the proband is a five - and - a - half - year - old girl who has had phenotypes manifested mainly by ptosis , broad face , broad neck with low posterior hairline , mental retardation , short stature , and other malformations . phenotypical features were quite similar throughout other cases and in accordance with the usual phenotype of del(18p ) suggested within the same cases and among the del(18p ) cases described . the deletion of part or the entire short arm of chromosome 18 is a rare chromosomal aberration , which is estimated to affect ~1 in 50,000 live births , with a female to male ratio of 3:2.14 since its first description by jean de grouchy in 1963,5 > 150 cases have been reported . the clinical features of this syndrome vary from one patient to another , depending on the deletion size and specific breakpoints . the larger the deletion and the closer to the centromeric region of the chromosome , the more severe the anomalies.3 the clinical abnormalities include growth deficiency , mental retardation , facial deformity ( eg , ptosis , epicanthal folds , low nasal bridge , and large protruding ears ) , microcephaly , holoprosencephaly , and clinodactyly of the fifth finger . besides , the discrepancy between verbal and nonverbal performance , as well as dystonias , has also been reported.6,7 though there are diverse phenotypic manifestations , the diagnosis depends mostly on cytogenetic findings.4 two - thirds of del(18p ) cases were supposed to originate from de novo pure terminal deletion , while one - third of cases were caused by a de novo unbalanced translocation , malsegregation of a parental translocation or inversion , and a ring chromosome or isochromosome 18q.811 here , we report a girl with del(18p ) with variable clinical features , whose facial appearance improved after blepharoplasty . the consent form for the publication of this report and the accompanying images has been signed by the parents of the child . the proband was born with a birth weight of 2,200 g , following a normal gestation and delivery without complications , the first child of a healthy couple ( mother : 37 years , 152 cm ; father : 39 years , 170 cm ) . developmental milestones were retarded ; she can sit at 7 months , walk at 18 months , and speak at 27 months . at the age of five - and - a - half years , she could only count numbers within 10 and her height was 98 cm ( less than third centile ) , weight was 13.5 kg ( less than third centile ) , and head circumference was 46 cm ( less than third centile ) . the width of palpebral fissure was 78 mm in the right eye and 23 mm in the left eye when raising her eyebrows . the axial length was 19.89 mm in the right eye and 19.74 mm in the left eye . she was not cooperative when examining visual acuity , ocular movement , anterior segment , and fundus of the eyes . but both eyes had pupil size and light reaction were normal . other phenotypic manifestations were as followings ( figure 1a ) : rectangle face , epicanthal folds , low nasal bridge , broad neck with a low posterior hairline , and mental retardation ( intelligence within the level of 2-year - old child ) . neither epileptic seizure nor dystonia was noted . her cerebral imaging was performed and revealed no abnormalities . the results of laboratory evaluations , including complete blood count , electrolytes , liver function , renal function , blood level of thyroid hormone , and gonadal hormone , were all normal . chromosomal analysis of peripheral blood cells was carried out as follows : 0.3 ml of whole blood was used to inoculate each 5 ml cell culture fluid . then , 6869 hours after culture initiation , the blood culture was synchronized with colchicine and returned to the incubator for another 34 hours . then , the blood cells were separated , fixed , and dyed . the procedure was also performed on the proband s mother . the proband analysis revealed a 46 , xx , del ( 18 ) ( p11.2 ) complement ( figure 2 ) . blepharoplasty was performed because of ptosis in both eyes , and she had a good postoperative recovery , with the width of both palpebral fissures being 9 mm ( figure 1b ) . this patient has a major clone with deletion of part of the p - arm ( 18p11.2 ) , resulting in 18p deletion syndrome . tsukahara et al12 reported about a japanese child also bearing del ( 18p11.2 ) with an iq of 74 with significant speech delay , placing him on a borderline intellectual functioning level . maranda et al13 reported about a mother and her two daughters who had mild - to - moderate mental retardation , and all of them had the same chromosomal deletion : 46 , xx , del ( 18 ) ( p11.2 ) . peng et al14 studied a girl with mosaic 46 , xx , del ( 18 ) ( p11.2)/46 , xx , i ( 18q ) , and mild mental retardation and communication disorders were observed . epilepsy , together with mental retardation , commonly occurs in chromosomal aberrations.15 however , this girl has no history of epilepsy . grosso et al16 reported that the short arm of chromosome was less likely to be associated with epilepsy . hasi - zogaj et al17 reviewed 106 18p deletions and found that seizures were not particularly common . there were reports suggesting that growth hormone ( gh ) deficiency occurs with deletions of the distal region of 18p and is involved in the main clinical features of the syndrome.18 the growth delay of our patient could be the result of the region of deletion involved . though several cases of 18p monosomy with gh deficiency reported that the patients showed excellent catch - up growth after gh treatment;1920 however , there is no indication of gh treatment according to the guideline of us food and drug administration and growth hormone research society.21,22 additionally , there is controversy regarding gh treatment of patients with gene defects23 ; thus , after fully understanding the possible consequences of the gh application , the parents of our case are cautious and taking a wait - and - see approach . it commonly includes a microcephaly , ptosis , a broad , flat nose , a mouth , large , protruding ears , widely - spaced eyes , and/or other abnormalities . other neurologic findings and/or extremely variable midline facial defects include the presence of maxillary incisor , hypotelorism , an abnormal groove in the upper lip , cleft palate , and/or in severe cases , absence of the nose and/or cyclopia . for some of the abnormal appearances , plastic surgery might be an option . in our case , there are 19 genes related to this syndrome , contributing to the variable clinical pictures . usp 14 gene encodes a member of proteases , and mice with a mutation were retarded for growth.24 gripp et al25 reported that tgif1 links to nodal signal pathway to the bifurcation of the human forebrain and the establishment of ventral midline structures . this report presents a case deletion of part of the p - arm ( 18p11.2 ) . it is usually caused by spontaneous ( de novo ) errors very early in the development of the embryo that appear to occur randomly for unknown reasons . thus , further study is needed to clarify the etiology and the correlation between genes and symptoms . besides plastic surgery may be an option for some of the abnormalities to improve the appearance , as well as the life quality .

human cytomegalovirus ( hcmv ) is typical of human herpesviruses in that it has both a latent and a lytic phase of its life cycle , which are bridged by periodic reactivation events . in the immune competent , primary infection is rarely symptomatic , and following the establishment of latency it is now established that , in vivo , one site of hcmv latency is in bone marrow resident cd34 + myeloid progenitor cells as well as in their derivative cd14 + monocytes present in peripheral blood . whilst there is little consensus , likely due to differences in cell types analysed and models of latency used , in the spectrum of viral genes expressed during latent infection , it is clear that latency is associated with a much restricted virus gene transcription programme and , in general , an absence of expression of viral major lytic genes [ 15 ] . this is also true for cytomegalovirus infection in other species , although the mechanisms by which latency is established vary . a number of studies have demonstrated that murine cytomegalovirus ( mcmv ) establishes latency , which suggests that some parallels may be drawn between the two species [ 6 , 7 ] . this inhibition of lytic gene expression during latency is likely affected through repressive chromatin marks around the promoter of the viral major immediate early promoter ( miep ) . following differentiation of progenitor myeloid cells into terminally differentiated dendritic cells or macrophages , however , this repressive chromatin structure around the miep is relieved , resulting in changes in post - translational modifications of histones around the miep associated with transcriptional activation and concomitant induction of viral lytic immediately early ( ie ) gene expression [ 5 , 812 ] . these data imply that reactivation routinely occurs in vivo , but this is sub - clinical due to robust host immune responses and is supported by the recent observations that macrophages and dcs , in vivo , are sites of virus reactivation in the healthy carrier [ 13 , 14 ] . it is well established that the numerous hcmv - encoded genes expressed during lytic infection act in concert to exert profound effects on the infected cell , resulting in the modulation of a wide range of cell functions and their downstream effects . this includes modulation of cell metabolism , transcription , translation , cell cycle , cell signalling as well as the inhibition of immune surveillance , cell stress , and cell death [ 1530 ] ( fig . however , despite a much restricted transcription profile , a number of studies have also shown that latent infection is associated with a profound manipulation of host cell transcription and cell signalling and , again , the inhibition of host immune surveillance , cell stress , and cell death [ 4 , 5 , 3136 ] ( fig . thus , far from being silent , latent infection with hcmv also results in the viral - driven orchestration of cellular gene expression and cell functions , likely , to optimise the cell for latent carriage and reactivation . for example , a number of changes in total cellular mrnas have been shown to occur upon latent during experimentally latent infection of granulocyte macrophage progenitors ( gmps ) [ 37 , 38 ] resulting in changes in mhc class ii expression and secreted monocyte chemoattractant protein-1 ( mcp-1 ) also known as chemokine c c motif ligand-2 ( ccl2 ) . consistent with this , latent infection of myeloid progenitors also results in the regulation of mcp-1 as well as a large number of other secreted cell proteins . in addition to the regulation of secreted proteins during latency , an apoptome array shows that there are also a number of changes in levels of anti - apoptotic proteins during latent infection of cd34 + cells with hcmv ( fig . 2).fig . 1manipulation of host cell functions during latent hcmv infection , perhaps every bit as complex as lytic infection . infection of cells results in a wide range of changes to the infected cell . during lytic infection ( a ) , there are reported changes to the modulation of cell metabolism , transcription , translation , cell cycle , cell signalling as well as the inhibition of immune surveillance , cell stress , and cell death [ 1525 ] . similarly , during latent infection ( b ) , there are reported changes to the manipulation of host cell transcription and cell signalling and , again , the inhibition of host immune surveillance , cell stress , and cell death [ 4 , 5 , 3136]fig . 2a number of pro- and anti - apoptotic factors in the fas signalling pathway are altered during hcmv latency . either cd34 + cells were uninfected or hcmv latency was established for 10 days , and the cells were harvested for protein analysis ( a d ) . relative levels of proteins involved in fas - mediated and il-10 signalling were analysed by apoptosis array ( r&d systems ) ( a ) and highlighted are aa ( bcl2 ) , ab ( p53 phospho - serine-15 ) , and ac ( hsp70 ) . alternatively , cells were harvested for western blot analysis of total and phosphorylated stat3 ( antibodies from cell signalling ) relative to actin loading control ( antibody from abcam ) ( b ) and quantified by densitometry . data are represented as fold change during latency from representative western blots ( c ) . extrinsic fas - mediated apoptosis involves fadd , caspase 8 , pro - caspase 3 , and caspase 3 and leads to apoptosis [ 81 , 82 ] . intrinsic mitochondrial - mediated apoptosis involves bax , bid , voltage - dependent anion channel ( vdac ) , cytochrome c ( cyt c ) , pro - caspase 9 , and the apoptome [ 83 , 84 ] . additionally , anti - apoptotic il-10 signalling can involve stat3 phosphorylation , bcl2 , and hsp70 [ 59 , 61 , 62 ] . these anti - apoptotic factors are all positively regulated during hcmv latency . finally , the two isoforms of virally induced il-10 , cmvil-10 and lacmvil-10 , are shown in ( e ) , where grey boxes represent exons . lacmvil-10 is generated from alternative splicing , which does not express exon 3 manipulation of host cell functions during latent hcmv infection , perhaps every bit as complex as lytic infection . infection of cells results in a wide range of changes to the infected cell . during lytic infection ( a ) , there are reported changes to the modulation of cell metabolism , transcription , translation , cell cycle , cell signalling as well as the inhibition of immune surveillance , cell stress , and cell death [ 1525 ] . similarly , during latent infection ( b ) , there are reported changes to the manipulation of host cell transcription and cell signalling and , again , the inhibition of host immune surveillance , cell stress , and cell death [ 4 , 5 , 3136 ] a number of pro- and anti - apoptotic factors in the fas signalling pathway are altered during hcmv latency . either cd34 + cells were uninfected or hcmv latency was established for 10 days , and the cells were harvested for protein analysis ( a d ) . relative levels of proteins involved in fas - mediated and il-10 signalling were analysed by apoptosis array ( r&d systems ) ( a ) and highlighted are aa ( bcl2 ) , ab ( p53 phospho - serine-15 ) , and ac ( hsp70 ) . alternatively , cells were harvested for western blot analysis of total and phosphorylated stat3 ( antibodies from cell signalling ) relative to actin loading control ( antibody from abcam ) ( b ) and quantified by densitometry . data are represented as fold change during latency from representative western blots ( c ) . extrinsic fas - mediated apoptosis involves fadd , caspase 8 , pro - caspase 3 , and caspase 3 and leads to apoptosis [ 81 , 82 ] . intrinsic mitochondrial - mediated apoptosis involves bax , bid , voltage - dependent anion channel ( vdac ) , cytochrome c ( cyt c ) , pro - caspase 9 , and the apoptome [ 83 , 84 ] . additionally , anti - apoptotic il-10 signalling can involve stat3 phosphorylation , bcl2 , and hsp70 [ 59 , 61 , 62 ] . these anti - apoptotic factors are all positively regulated during hcmv latency . finally , the two isoforms of virally induced il-10 , cmvil-10 and lacmvil-10 , are shown in ( e ) , where grey boxes represent exons . lacmvil-10 is generated from alternative splicing , which does not express exon 3 given the relative paucity of viral genes expressed during hcmv latency [ 15 ] compared to lytic infection , it may initially seem surprising that such profound changes in the cell result from latent infection . however , another level of regulation of gene expression is via micrornas ( mirnas ) . these are highly conserved small ( approximately 21 nucleotides in length ) rna molecules encoded in the genomes of plants and animals , which generally regulate the expression of genes by binding to the 3-untranslated regions ( 3-utr ) of specific mrnas . although the first published description of an mirna was in 1993 , the understanding of the functions of many of these small non - coding rna molecules is still being elucidated and is complicated by the fact that each mirna is thought to be able to regulate multiple genes . this , coupled with the fact that there are hundreds of mirnas transcribed in the cells of higher eukaryotes [ 4143 ] , reflects the enormous complexity in levels of regulation of gene expression afforded by mirnas . various lines of research suggest that mirnas may act as key regulators of processes as diverse as early development , cell proliferation and cell death , apoptosis , and fat metabolism , as well as cell differentiation [ 4749 ] . there is also evidence to suggest that mirna expression is involved in the pathogenesis of a number of diseases , including cancer [ 50 , 51 ] and viral infection [ 31 , 5255 ] . it is interesting , therefore , that during hcmv latency , there are changes to a number of cellular mirnas ( and table 1 ) . consequently , it is possible that many of the changes in the latency - associated secretome as well as the observed changes in anti - apoptotic proteins during latent infection is due , at least in part , to the hcmv - mediated regulation of cellular mirnas as well as , possibly , expression of a number of viral mirnas .table 1hcmv - induced latency leads to changes in a number of cellular mirnasmicrornafold change during latency compared to mockhsa - mir - let-7a2.5hsa - mir - let-7b3.7hsa - mir-2062hsa - mir-296 3p2.6hsa - mir-2972.9hsa - mir-32*2hsa - mir-6082.4hsa - mir-92a2.5following the establishment of latency for 10 days in cd34 + cells , the cells were harvested for mirna analysis ( ncode , invitrogen ) , and data are presented as fold change over mock infected cells with probability values hcmv - induced latency leads to changes in a number of cellular mirnas following the establishment of latency for 10 days in cd34 + cells , the cells were harvested for mirna analysis ( ncode , invitrogen ) , and data are presented as fold change over mock infected cells with probability values one of the cellular mirnas which is known to be downregulated during latent infection of cd34 + progenitor cells is hsa - mir-92a ( and table 1 ) . predictive algorithms and biochemical analysis have shown that this mirna can target the myeloid transcription factor gata2 , and as predicted , during experimental hcmv latency , there is an increase in levels of this myeloid cellular transcription factor [ 31 , 34 ] . gata2 is a cellular transcription factor known to be important in the proliferation , lineage commitment , and survival of haematopoietic progenitor cells [ 5760 ] , and the virus targets this important myeloid transcription factor for a number of now well - established reasons . for instance , gata2 has also been found to regulate the transcription of the latency - associated viral gene product ul144 and may also play a role in the expression of other latency - associated viral gene products . gata2 not only regulates viral genes but is also known to regulate the expression of a number of cellular genes , including il-10 . consistent with this , increases in cellular il-10 ( cil-10 ) in the secretome of latently infected cd34 + cells have been shown to occur . detailed analysis of the mechanism by which latency - associated changes in hsa - mir-92a were linked to gata2 expression and subsequent regulation of cil-10 came from studies in kg1 cells , a cd34 + cell line which can be manipulated by transfection and recapitulate some aspects of hcmv latent infection , namely the expression of latency - associated genes such as ul138 in the absence of lytic immediate early gene expression . in these cells , transfection of an antagomir to hsa - mir-92a led to increased gata2 mrna expression and increased cil-10 . importantly , this induction of cil-10 by hsa - mir-92a antagomir did not occur if gata2 was depleted by rnai . taken together , these studies showed that latency - associated changes in hsa - mir-92a result in increased gata2 , which drives the expression of cil-10 during latent infection ( fig . following the establishment of latency in cd34 + cells for 10 days , there is an induction of cellular hsa - mirna-92a via lacmvil-10 [ 31 , 79 ] . gata2 can drive the transcription of the latency - associated viral products luna and ul144 [ 34 , 85 ] as well as driving transcription of the cellular cytokine gene il-10 . whether other mechanisms for the upregulation of gata2 during hcmv latency are also induced is not yet known . il-10 serves to create an immune suppressive environment as well as to lead to pro - life signalling to the latently infected cell . il-10 leads to stat3 phosphorylation and signals to anti - apoptotic factors bcl2 and hsp70 ( see fig . following the establishment of latency in cd34 + cells for 10 days , there is an induction of cellular hsa - mirna-92a via lacmvil-10 [ 31 , 79 ] . gata2 can drive the transcription of the latency - associated viral products luna and ul144 [ 34 , 85 ] as well as driving transcription of the cellular cytokine gene il-10 . whether other mechanisms for the upregulation of gata2 during hcmv latency are also induced is not yet known . il-10 serves to create an immune suppressive environment as well as to lead to pro - life signalling to the latently infected cell . il-10 leads to stat3 phosphorylation and signals to anti - apoptotic factors bcl2 and hsp70 ( see fig . 2 ) cellular il-10 is a secreted cytokine known to have immune modulatory properties as well as having pro - life effects on myeloid progenitors , such as cd34 + cells , by driving the expression of the anti - apoptotic factor bcl2 ( fig . cil-10 is upregulated , and for this reason , the specific functions of cil-10 in the latent secretome have been analysed . for example , consistent with this observation that cil-10 is known to play an anti - apoptotic role in cd34 + cells ( fig . 2d ) , [ 31 , 61 ] , antibody depletion of latency - associated secretion of cil-10 from the supernatants of latently infected cells results in increased cell death and loss of latent viral genome carriage . additionally , latency - associated secretion of cil-10 , together with virally induced increases in cellular tgf - beta , results in the establishment of an immune suppressive microenvironment around latently infected cells . this , in turn , inhibits cd4 + cytotoxic t - cell effector functions and thereby suppresses host immune surveillance of the latently infected cell . we know that latent infection of primary cd34 + progenitor cells by hcmv results in their increased survival in the face of pro - apoptotic signals , and this , at least in part , appears to involve the known latency - associated increase in the expression of cil-10 [ 31 , 59 ] . however , how cil-10 mediated this protection was unclear , but the changes in the latent apoptome would suggest that the cil-10 upregulated during latency modulates cil-10-mediated suppression of extrinsic and intrinsic pro - apoptotic signals ( fig . engagement of the cil-10 receptor by cil-10 is known to induce signalling via stat3 phosphorylation . this results in positive autoregulation of cil-10 expression as well as expression of intrinsic death - signalling pathway inhibitors such as bcl2 [ 31 , 59 ] and hsp70 . consistent with this , and the known increase in cil-10 during hcmv latent infection of cd34 + cells , latently infected cd34 + cells also showed extensive increases in stat3 phosphorylation ( fig . 2b , c ) and concomitant increases in the expression of bcl2 and hsp70 ( fig . hsp70 plays a role in the negative regulation of the intrinsic pathway due to the ability to target pro - caspase 3 [ 63 , 64 ] , present in the fas - mediated signalling pathway . thus , during latency , the fas - mediated signalling pathway is targeted at different stages of fas - mediated apoptosis via extrinsic apoptosis signalling ( fig . interestingly , hsp70 also plays a significant role as a potent inhibitor of the formation of the mitochondrial apoptome and the intrinsic pathway of programmed cell death ( fig . not all of the changes in proteins we have identified during hcmv latency are in pro - life factors . figure 2a , c shows that there was a 3.5-fold increase in levels of p53 phosphorylated at serine 15 . ser 15-phosphorylated p53 is known to have pro - apoptotic properties as it is able to upregulate the transcription of the pro - apoptotic factor bax and concomitantly decrease the expression of anti - apoptotic factor bcl2 . however , the expression of bcl2 clearly increased during hcmv latency in our studies ( see fig . consequently , our view is that other functions associated with latent infection also counter the transcriptional regulation of bcl2 by p53 . one possibility is that hsp70 increased during latent infection and can act to stimulate the expression of bcl2 via akt . therefore , the expression of hsp70 may be strong enough to overcome the repressive effects of phosphorylated p53 . therefore , it is likely that hsp70 works at multiple levels to help check and balance the levels of anti - apoptotic factors in the latently infected cell , although this needs to be formally addressed . it appears , then , that the changes in cellular mirna expression resulting from latent infection can have important downstream effects on both intrinsic cell survival and host immune evasion . however , until recently , the mechanism by which hcmv latent infection caused such changes in cellular mirnas expression was far from clear . there are a number of viral genes expressed during latency , which could potentially affect cellular mirna expression , although the latency - associated functions of many of these latency - associated genes are only just beginning to be unravelled . one of these is a viral cil-10 homologue , known as lacmvil-10 , encoded by the ul111a gene . it is interesting that although latent hcmv infection robustly induces the expression of cil-10 , as discussed above , the virus also expresses lacmvil-10 during this life cycle . these two isoforms of virus - encoded il-10 are generated by alternative splicing from the viral ul111a gene as depicted graphically in fig . one of these is a protein of 175 amino acids , termed cmvil-10 , which is expressed during lytic infection and has the expression kinetics of a late gene . the second isoform , predicted to consist of 139 amino acids and termed lacmvil-10 , has a c - terminal truncation and is expressed during both lytic and latent infection [ 6870 ] . an il-10 homologue encoded by the ul111a open reading frame ( orf ) has also been identified in rhesus macaque cmv ( rhcmv ) . although it has a slightly different gene structure than cmvil-10 , like cmvil-10 , it shows low amino acid identity to host cil-10 . the full - length cmvil-10 gene shares 27 % amino acid homology with cil-10 and has a number of functions in common with cil-10 : it forms homodimers and binds the cil-10 receptor [ 69 , 72 ] ; it triggers stat3 phosphorylation and activation of the jak / stat signalling pathway [ 73 , 74 ] ; it signals via the phosphoinositide-3-kinase pathway , contributing to cytokine suppression [ 7476 ] and cil-10-positive autoregulation ; and it shares the ability of cil-10 to prevent nf-b activity via inhibition of ikk [ 75 , 78 ] . although , like cil-10 and cmvil-10 , it can downregulate major histocompatibility complex ( mhc ) class ii in latently infected gmps , either it does not signal through the il-10 receptor ( il-10r ) or it engages the receptor in a different way than cil-10 and cmvil-10 . therefore , the mode of action and function during hcmv latency is uncertain . interestingly , analysis of viruses lacking the ul111a gene locus was found to be impaired in their ability to induce cil-10 upon latent infection . similarly , consistent with these observations , viruses lacking ul111a did not downregulate cellular hsa - mir-92a . furthermore , recombinant lacmvil-10 was found both to induce cil-10 and to cause the downregulation of hsa - mir-92a . taken together , then it appears that expression of lacmvil-10 during latent infection results in downregulation of cellular hsa - mir-92a , which in turn leads to the upregulation of the myeloid transcription factor gata2 . this increase in gata2 then drives the expression of cil-10 , which inhibits intrinsic cell death signals and aids immune evasion of the latently infected cell ( fig . it is also worth emphasising that gata2 is known to be involved in the hematopoiesis and myeloid cell differentiation . the extent to which latent infection of cd34 + cells , in itself , drives the latently infected progenitor cell down the myeloid lineage , rather than the lymphocyte lineage , is unclear . however , this could , in part , explain the fact that latent viral genomes have not been detected in t and b cells even though these presumably derived from the same cd34 + progenitor cells giving rise to cells of the myeloid lineage . the ramifications of latency - associated changes in a number of other cellular mirnas that have been identified during latent ( table 1 and ) infection are unclear . similarly , latent infection also results in changes in a number of other secreted cellular proteins , and the effects of these changes on the latently infected cell will be enlightening . regardless , it is now clear that latent infection imparts on the latently infected cells a plethora of phenotypic changes through an orchestrated manipulation of cell gene expression and cell functions . these are likely necessary for efficient carriage and reactivation of latent viral genomes , but they may also provide an achilles heel to allow the development of novel therapeutics to target and clear latent infection , at least in some clinical settings . it is well established that the numerous hcmv - encoded genes expressed during lytic infection act in concert to exert profound effects on the infected cell , resulting in the modulation of a wide range of cell functions and their downstream effects . this includes modulation of cell metabolism , transcription , translation , cell cycle , cell signalling as well as the inhibition of immune surveillance , cell stress , and cell death [ 1530 ] ( fig . however , despite a much restricted transcription profile , a number of studies have also shown that latent infection is associated with a profound manipulation of host cell transcription and cell signalling and , again , the inhibition of host immune surveillance , cell stress , and cell death [ 4 , 5 , 3136 ] ( fig . thus , far from being silent , latent infection with hcmv also results in the viral - driven orchestration of cellular gene expression and cell functions , likely , to optimise the cell for latent carriage and reactivation . for example , a number of changes in total cellular mrnas have been shown to occur upon latent during experimentally latent infection of granulocyte macrophage progenitors ( gmps ) [ 37 , 38 ] resulting in changes in mhc class ii expression and secreted monocyte chemoattractant protein-1 ( mcp-1 ) also known as chemokine c c motif ligand-2 ( ccl2 ) . consistent with this , latent infection of myeloid progenitors also results in the regulation of mcp-1 as well as a large number of other secreted cell proteins . in addition to the regulation of secreted proteins during latency , an apoptome array shows that there are also a number of changes in levels of anti - apoptotic proteins during latent infection of cd34 + cells with hcmv ( fig . 2).fig . 1manipulation of host cell functions during latent hcmv infection , perhaps every bit as complex as lytic infection . infection of cells results in a wide range of changes to the infected cell . during lytic infection ( a ) , there are reported changes to the modulation of cell metabolism , transcription , translation , cell cycle , cell signalling as well as the inhibition of immune surveillance , cell stress , and cell death [ 1525 ] . similarly , during latent infection ( b ) , there are reported changes to the manipulation of host cell transcription and cell signalling and , again , the inhibition of host immune surveillance , cell stress , and cell death [ 4 , 5 , 3136]fig . 2a number of pro- and anti - apoptotic factors in the fas signalling pathway are altered during hcmv latency . either cd34 + cells were uninfected or hcmv latency was established for 10 days , and the cells were harvested for protein analysis ( a d ) . relative levels of proteins involved in fas - mediated and il-10 signalling were analysed by apoptosis array ( r&d systems ) ( a ) and highlighted are aa ( bcl2 ) , ab ( p53 phospho - serine-15 ) , and ac ( hsp70 ) . alternatively , cells were harvested for western blot analysis of total and phosphorylated stat3 ( antibodies from cell signalling ) relative to actin loading control ( antibody from abcam ) ( b ) and quantified by densitometry . data are represented as fold change during latency from representative western blots ( c ) . extrinsic fas - mediated apoptosis involves fadd , caspase 8 , pro - caspase 3 , and caspase 3 and leads to apoptosis [ 81 , 82 ] . intrinsic mitochondrial - mediated apoptosis involves bax , bid , voltage - dependent anion channel ( vdac ) , cytochrome c ( cyt c ) , pro - caspase 9 , and the apoptome [ 83 , 84 ] . additionally , anti - apoptotic il-10 signalling can involve stat3 phosphorylation , bcl2 , and hsp70 [ 59 , 61 , 62 ] . these anti - apoptotic factors are all positively regulated during hcmv latency . finally , the two isoforms of virally induced il-10 , cmvil-10 and lacmvil-10 , are shown in ( e ) , where grey boxes represent exons . lacmvil-10 is generated from alternative splicing , which does not express exon 3 manipulation of host cell functions during latent hcmv infection , perhaps every bit as complex as lytic infection . infection of cells results in a wide range of changes to the infected cell . during lytic infection ( a ) , there are reported changes to the modulation of cell metabolism , transcription , translation , cell cycle , cell signalling as well as the inhibition of immune surveillance , cell stress , and cell death [ 1525 ] . similarly , during latent infection ( b ) , there are reported changes to the manipulation of host cell transcription and cell signalling and , again , the inhibition of host immune surveillance , cell stress , and cell death [ 4 , 5 , 3136 ] a number of pro- and anti - apoptotic factors in the fas signalling pathway are altered during hcmv latency . either cd34 + cells were uninfected or hcmv latency was established for 10 days , and the cells were harvested for protein analysis ( a d ) . relative levels of proteins involved in fas - mediated and il-10 signalling were analysed by apoptosis array ( r&d systems ) ( a ) and highlighted are aa ( bcl2 ) , ab ( p53 phospho - serine-15 ) , and ac ( hsp70 ) . alternatively , cells were harvested for western blot analysis of total and phosphorylated stat3 ( antibodies from cell signalling ) relative to actin loading control ( antibody from abcam ) ( b ) and quantified by densitometry . data are represented as fold change during latency from representative western blots ( c ) . extrinsic fas - mediated apoptosis involves fadd , caspase 8 , pro - caspase 3 , and caspase 3 and leads to apoptosis [ 81 , 82 ] . intrinsic mitochondrial - mediated apoptosis involves bax , bid , voltage - dependent anion channel ( vdac ) , cytochrome c ( cyt c ) , pro - caspase 9 , and the apoptome [ 83 , 84 ] . additionally , anti - apoptotic il-10 signalling can involve stat3 phosphorylation , bcl2 , and hsp70 [ 59 , 61 , 62 ] . these anti - apoptotic factors are all positively regulated during hcmv latency . finally , the two isoforms of virally induced il-10 , cmvil-10 and lacmvil-10 , are shown in ( e ) , where grey boxes represent exons . lacmvil-10 is generated from alternative splicing , which does not express exon 3 given the relative paucity of viral genes expressed during hcmv latency [ 15 ] compared to lytic infection , it may initially seem surprising that such profound changes in the cell result from latent infection . however , another level of regulation of gene expression is via micrornas ( mirnas ) . these are highly conserved small ( approximately 21 nucleotides in length ) rna molecules encoded in the genomes of plants and animals , which generally regulate the expression of genes by binding to the 3-untranslated regions ( 3-utr ) of specific mrnas . although the first published description of an mirna was in 1993 , the understanding of the functions of many of these small non - coding rna molecules is still being elucidated and is complicated by the fact that each mirna is thought to be able to regulate multiple genes . this , coupled with the fact that there are hundreds of mirnas transcribed in the cells of higher eukaryotes [ 4143 ] , reflects the enormous complexity in levels of regulation of gene expression afforded by mirnas . various lines of research suggest that mirnas may act as key regulators of processes as diverse as early development , cell proliferation and cell death , apoptosis , and fat metabolism , as well as cell differentiation [ 4749 ] . there is also evidence to suggest that mirna expression is involved in the pathogenesis of a number of diseases , including cancer [ 50 , 51 ] and viral infection [ 31 , 5255 ] . it is interesting , therefore , that during hcmv latency , there are changes to a number of cellular mirnas ( and table 1 ) . consequently , it is possible that many of the changes in the latency - associated secretome as well as the observed changes in anti - apoptotic proteins during latent infection is due , at least in part , to the hcmv - mediated regulation of cellular mirnas as well as , possibly , expression of a number of viral mirnas .table 1hcmv - induced latency leads to changes in a number of cellular mirnasmicrornafold change during latency compared to mockhsa - mir - let-7a2.5hsa - mir - let-7b3.7hsa - mir-2062hsa - mir-296 3p2.6hsa - mir-2972.9hsa - mir-32*2hsa - mir-6082.4hsa - mir-92a2.5following the establishment of latency for 10 days in cd34 + cells , the cells were harvested for mirna analysis ( ncode , invitrogen ) , and data are presented as fold change over mock infected cells with probability values hcmv - induced latency leads to changes in a number of cellular mirnas following the establishment of latency for 10 days in cd34 + cells , the cells were harvested for mirna analysis ( ncode , invitrogen ) , and data are presented as fold change over mock infected cells with probability values one of the cellular mirnas which is known to be downregulated during latent infection of cd34 + progenitor cells is hsa - mir-92a ( and table 1 ) . predictive algorithms and biochemical analysis have shown that this mirna can target the myeloid transcription factor gata2 , and as predicted , during experimental hcmv latency , there is an increase in levels of this myeloid cellular transcription factor [ 31 , 34 ] . gata2 is a cellular transcription factor known to be important in the proliferation , lineage commitment , and survival of haematopoietic progenitor cells [ 5760 ] , and the virus targets this important myeloid transcription factor for a number of now well - established reasons . for instance , gata2 has also been found to regulate the transcription of the latency - associated viral gene product ul144 and may also play a role in the expression of other latency - associated viral gene products . gata2 not only regulates viral genes but is also known to regulate the expression of a number of cellular genes , including il-10 . consistent with this , increases in cellular il-10 ( cil-10 ) in the secretome of latently infected cd34 + cells have been shown to occur . detailed analysis of the mechanism by which latency - associated changes in hsa - mir-92a were linked to gata2 expression and subsequent regulation of cil-10 came from studies in kg1 cells , a cd34 + cell line which can be manipulated by transfection and recapitulate some aspects of hcmv latent infection , namely the expression of latency - associated genes such as ul138 in the absence of lytic immediate early gene expression . in these cells , transfection of an antagomir to hsa - mir-92a led to increased gata2 mrna expression and increased cil-10 . importantly , this induction of cil-10 by hsa - mir-92a antagomir did not occur if gata2 was depleted by rnai . taken together , these studies showed that latency - associated changes in hsa - mir-92a result in increased gata2 , which drives the expression of cil-10 during latent infection ( fig . following the establishment of latency in cd34 + cells for 10 days , there is an induction of cellular hsa - mirna-92a via lacmvil-10 [ 31 , 79 ] . gata2 can drive the transcription of the latency - associated viral products luna and ul144 [ 34 , 85 ] as well as driving transcription of the cellular cytokine gene il-10 . whether other mechanisms for the upregulation of gata2 during hcmv latency are also induced is not yet known . il-10 serves to create an immune suppressive environment as well as to lead to pro - life signalling to the latently infected cell . il-10 leads to stat3 phosphorylation and signals to anti - apoptotic factors bcl2 and hsp70 ( see fig . following the establishment of latency in cd34 + cells for 10 days , there is an induction of cellular hsa - mirna-92a via lacmvil-10 [ 31 , 79 ] . gata2 can drive the transcription of the latency - associated viral products luna and ul144 [ 34 , 85 ] as well as driving transcription of the cellular cytokine gene il-10 . whether other mechanisms for the upregulation of gata2 during hcmv latency are also induced is not yet known . il-10 serves to create an immune suppressive environment as well as to lead to pro - life signalling to the latently infected cell . il-10 leads to stat3 phosphorylation and signals to anti - apoptotic factors bcl2 and hsp70 ( see fig . cellular il-10 is a secreted cytokine known to have immune modulatory properties as well as having pro - life effects on myeloid progenitors , such as cd34 + cells , by driving the expression of the anti - apoptotic factor bcl2 ( fig . cil-10 is upregulated , and for this reason , the specific functions of cil-10 in the latent secretome have been analysed . for example , consistent with this observation that cil-10 is known to play an anti - apoptotic role in cd34 + cells ( fig . 2d ) , [ 31 , 61 ] , antibody depletion of latency - associated secretion of cil-10 from the supernatants of latently infected cells results in increased cell death and loss of latent viral genome carriage . additionally , latency - associated secretion of cil-10 , together with virally induced increases in cellular tgf - beta , results in the establishment of an immune suppressive microenvironment around latently infected cells . this , in turn , inhibits cd4 + cytotoxic t - cell effector functions and thereby suppresses host immune surveillance of the latently infected cell . we know that latent infection of primary cd34 + progenitor cells by hcmv results in their increased survival in the face of pro - apoptotic signals , and this , at least in part , appears to involve the known latency - associated increase in the expression of cil-10 [ 31 , 59 ] . however , how cil-10 mediated this protection was unclear , but the changes in the latent apoptome would suggest that the cil-10 upregulated during latency modulates cil-10-mediated suppression of extrinsic and intrinsic pro - apoptotic signals ( fig . engagement of the cil-10 receptor by cil-10 is known to induce signalling via stat3 phosphorylation . this results in positive autoregulation of cil-10 expression as well as expression of intrinsic death - signalling pathway inhibitors such as bcl2 [ 31 , 59 ] and hsp70 . consistent with this , and the known increase in cil-10 during hcmv latent infection of cd34 + cells , latently infected cd34 + cells also showed extensive increases in stat3 phosphorylation ( fig . 2b , c ) and concomitant increases in the expression of bcl2 and hsp70 ( fig . hsp70 plays a role in the negative regulation of the intrinsic pathway due to the ability to target pro - caspase 3 [ 63 , 64 ] , present in the fas - mediated signalling pathway . thus , during latency , the fas - mediated signalling pathway is targeted at different stages of fas - mediated apoptosis via extrinsic apoptosis signalling ( fig . interestingly , hsp70 also plays a significant role as a potent inhibitor of the formation of the mitochondrial apoptome and the intrinsic pathway of programmed cell death ( fig . not all of the changes in proteins we have identified during hcmv latency are in pro - life factors . figure 2a , c shows that there was a 3.5-fold increase in levels of p53 phosphorylated at serine 15 . ser 15-phosphorylated p53 is known to have pro - apoptotic properties as it is able to upregulate the transcription of the pro - apoptotic factor bax and concomitantly decrease the expression of anti - apoptotic factor bcl2 . however , the expression of bcl2 clearly increased during hcmv latency in our studies ( see fig . consequently , our view is that other functions associated with latent infection also counter the transcriptional regulation of bcl2 by p53 . one possibility is that hsp70 increased during latent infection and can act to stimulate the expression of bcl2 via akt . therefore , the expression of hsp70 may be strong enough to overcome the repressive effects of phosphorylated p53 . therefore , it is likely that hsp70 works at multiple levels to help check and balance the levels of anti - apoptotic factors in the latently infected cell , although this needs to be formally addressed . it appears , then , that the changes in cellular mirna expression resulting from latent infection can have important downstream effects on both intrinsic cell survival and host immune evasion . however , until recently , the mechanism by which hcmv latent infection caused such changes in cellular mirnas expression was far from clear . there are a number of viral genes expressed during latency , which could potentially affect cellular mirna expression , although the latency - associated functions of many of these latency - associated genes are only just beginning to be unravelled . one of these is a viral cil-10 homologue , known as lacmvil-10 , encoded by the ul111a gene . it is interesting that although latent hcmv infection robustly induces the expression of cil-10 , as discussed above , the virus also expresses lacmvil-10 during this life cycle . these two isoforms of virus - encoded il-10 are generated by alternative splicing from the viral ul111a gene as depicted graphically in fig . one of these is a protein of 175 amino acids , termed cmvil-10 , which is expressed during lytic infection and has the expression kinetics of a late gene . the second isoform , predicted to consist of 139 amino acids and termed lacmvil-10 , has a c - terminal truncation and is expressed during both lytic and latent infection [ 6870 ] . an il-10 homologue encoded by the ul111a open reading frame ( orf ) has also been identified in rhesus macaque cmv ( rhcmv ) . although it has a slightly different gene structure than cmvil-10 , like cmvil-10 , it shows low amino acid identity to host cil-10 . the full - length cmvil-10 gene shares 27 % amino acid homology with cil-10 and has a number of functions in common with cil-10 : it forms homodimers and binds the cil-10 receptor [ 69 , 72 ] ; it triggers stat3 phosphorylation and activation of the jak / stat signalling pathway [ 73 , 74 ] ; it signals via the phosphoinositide-3-kinase pathway , contributing to cytokine suppression [ 7476 ] and cil-10-positive autoregulation ; and it shares the ability of cil-10 to prevent nf-b activity via inhibition of ikk [ 75 , 78 ] . although , like cil-10 and cmvil-10 , it can downregulate major histocompatibility complex ( mhc ) class ii in latently infected gmps , either it does not signal through the il-10 receptor ( il-10r ) or it engages the receptor in a different way than cil-10 and cmvil-10 . therefore , the mode of action and function during hcmv latency is uncertain . interestingly , analysis of viruses lacking the ul111a gene locus was found to be impaired in their ability to induce cil-10 upon latent infection . similarly , consistent with these observations , viruses lacking ul111a did not downregulate cellular hsa - mir-92a . furthermore , recombinant lacmvil-10 was found both to induce cil-10 and to cause the downregulation of hsa - mir-92a . taken together , then it appears that expression of lacmvil-10 during latent infection results in downregulation of cellular hsa - mir-92a , which in turn leads to the upregulation of the myeloid transcription factor gata2 . this increase in gata2 then drives the expression of cil-10 , which inhibits intrinsic cell death signals and aids immune evasion of the latently infected cell ( fig . it is also worth emphasising that gata2 is known to be involved in the hematopoiesis and myeloid cell differentiation . the extent to which latent infection of cd34 + cells , in itself , drives the latently infected progenitor cell down the myeloid lineage , rather than the lymphocyte lineage , is unclear . however , this could , in part , explain the fact that latent viral genomes have not been detected in t and b cells even though these presumably derived from the same cd34 + progenitor cells giving rise to cells of the myeloid lineage . the ramifications of latency - associated changes in a number of other cellular mirnas that have been identified during latent ( table 1 and ) infection are unclear . similarly , latent infection also results in changes in a number of other secreted cellular proteins , and the effects of these changes on the latently infected cell will be enlightening . regardless , it is now clear that latent infection imparts on the latently infected cells a plethora of phenotypic changes through an orchestrated manipulation of cell gene expression and cell functions . these are likely necessary for efficient carriage and reactivation of latent viral genomes , but they may also provide an achilles heel to allow the development of novel therapeutics to target and clear latent infection , at least in some clinical settings .

several lines of evidence suggest that abnormalities in the serotonin ( 5-ht ) system may be related to the pathophysiology of schizophrenia . among the various serotonin receptors , 5-ht2 receptors have received much attention because of their unique role in the therapeutic actions of clozapine and several other atypical antipsychotics . various studies have shown an association between the t102c polymorphism of the 5-ht2a receptor gene and schizophrenia . however , negative findings have also been reported . a recent meta - analysis demonstrated that the association between t102c polymorphism of the 5-ht2a receptor gene and schizophrenia is stronger in european than in east asian populations . in addition , there have been numerous studies of the association of t102c polymorphism with various clinical aspects of schizophrenia , including disease outcome , susceptibility to tardive dyskinesia , and more recently neurocognitive functioning . there is emerging evidence for the role of genes in cognition in schizophrenia . in this study , we compared the genotype distributions and allele frequencies of the t102c polymorphism of the 5-ht2a receptor gene between patients with schizophrenia and unrelated healthy controls of turkish descents . the patient sample was further characterized for certain clinical and neuropsychological features that might be potentially related to serotonin dysfunction . 76 biologically unrelated patients aged 18 - 60 meeting dsm - iv - tr diagnostic criteria for schizophrenia were included in the study . patients were recruited from the department of psychiatry , cerrahpaa medical faculty , istanbul , turkey . consensus diagnosis by at least two psychiatrists was made for each patient , according to dsm - iv criteria . patients with a history of alcohol and/or drug abuse , major medical illness that could affect brain functioning , clinically evident mental retardation , neurological disorder , a past head injury with loss of consciousness and a history of having received electroconvulsive therapy within the past year were excluded . the control subjects were selected among healthy volunteers , and none of them had a history of past and/or present psychiatric diagnosis . a total of 165 biologically unrelated controls were recruited from sources including people from the hospital staff , and medical and nursing students . patients clinical and neurocognitive functions were assessed following the extensive method used in a previous study . the severity of clinical symptoms in patients with schizophrenia was assessed by the positive and negative syndrome scale ( panss ) . this scale consists of 30 items , with the total score consisting of the sum of the seven positive items , seven negative items , and 16 general psychopathology items . the age of disease onset in individual patients was determined as the age when psychotic symptoms were first presented or of first contact with psychiatrist . history of violence was rated on a three - point scale : ( no ) indicated no physical violence and no significant verbal aggression ( mild ) referred to patients with significant and frequent verbal aggression or violence to object or mild physical aggression to person , and ( severe ) represented patients with physical violence to person resulting in medical consultation of the victims . absence or presence of a family history of mental illness was determined according to information gathered from patients and their family members . response to treatment was evaluated retrospectively over the course of an individual patient 's illness and was rated on a three - point scale . good response referred to complete symptom remission and return to the level of premorbid functioning . negligible response indicated persistent symptoms for more than 2 years despite optimal dosage of at least two different antipsychotic drugs for 6 weeks each . patients with treatment outcome between good and poor response were considered as the partial response . the age of disease onset of three patients , family history of mental illness of 14 patients , history of suicidal behavior of 12 patients , number of hospitalizations of 13 patients and violence of 13 patients could not be determined because the information was not documented in medical records , and/or the patients or their family members could not provide accurate information . the treatment response for 18 patients could not be assigned on the three - point scale because their duration of illness was less than 2 years or the available information was not sufficient . patients degree of formal education was determined by information from patients and their family members . each patient was asked to generate as many exemplars in the animal category as possible in 1 min . the motor coordination soft neurological signs examination extracted from the cambridge neurological inventory was administrated . it consisted of finger thumb opposition , finger thumb tapping , dysdiadochokinesia , fist - edge - palm test , and ozeretski test . the first color task required the patient to read the words of color names , which was printed in colors different from the meaning of the words . the second color - word task required the patient to read the printed color of the words . the color score and color - word score was calculated from the number of correct responses minus incorrect responses in the color task and the color - word task , respectively . 12 patients refused to be examined for verbal fluency and soft signs , and 17 patients refused to be examined for stroop tasks . the genomic dna extraction was performed by standard procedures . the polymerase chain reaction ( pcr ) the pcr was performed with 0.1 g genomic dna , 1.5 mg mgcl , 0.1 m of each primer in a total volume of 50 l . genotyping was done by means of restriction fragment length polymorphism assay with the restriction enzyme ( mspi ) . the genotype distributions of the t102c polymorphism of the 5-ht2a receptor gene in patients and controls were evaluated for deviation from the hardy weinberg equilibrium using the test . comparison between the patients and controls for the difference of genotype distributions , allele frequencies was analyzed by the test . further comparison of clinical profiles among patients with schizophrenia with different genotypes was carried out by one - way anova for continuous variables or the test for categorical variables . similarly , the neurocognitive function among patients with various genotypes was compared by using ancova controlled for age or degree of education as required . all the statistical tests were two - tailed with the significance level set at p < 0.05 . 76 biologically unrelated patients aged 18 - 60 meeting dsm - iv - tr diagnostic criteria for schizophrenia were included in the study . patients were recruited from the department of psychiatry , cerrahpaa medical faculty , istanbul , turkey . consensus diagnosis by at least two psychiatrists was made for each patient , according to dsm - iv criteria . patients with a history of alcohol and/or drug abuse , major medical illness that could affect brain functioning , clinically evident mental retardation , neurological disorder , a past head injury with loss of consciousness and a history of having received electroconvulsive therapy within the past year were excluded . the control subjects were selected among healthy volunteers , and none of them had a history of past and/or present psychiatric diagnosis . a total of 165 biologically unrelated controls were recruited from sources including people from the hospital staff , and medical and nursing students . patients clinical and neurocognitive functions were assessed following the extensive method used in a previous study . the severity of clinical symptoms in patients with schizophrenia was assessed by the positive and negative syndrome scale ( panss ) . this scale consists of 30 items , with the total score consisting of the sum of the seven positive items , seven negative items , and 16 general psychopathology items . the age of disease onset in individual patients was determined as the age when psychotic symptoms were first presented or of first contact with psychiatrist . history of violence was rated on a three - point scale : ( no ) indicated no physical violence and no significant verbal aggression ( mild ) referred to patients with significant and frequent verbal aggression or violence to object or mild physical aggression to person , and ( severe ) represented patients with physical violence to person resulting in medical consultation of the victims . absence or presence of a family history of mental illness was determined according to information gathered from patients and their family members . response to treatment was evaluated retrospectively over the course of an individual patient 's illness and was rated on a three - point scale . good response referred to complete symptom remission and return to the level of premorbid functioning . negligible response indicated persistent symptoms for more than 2 years despite optimal dosage of at least two different antipsychotic drugs for 6 weeks each . patients with treatment outcome between good and poor response were considered as the partial response . the age of disease onset of three patients , family history of mental illness of 14 patients , history of suicidal behavior of 12 patients , number of hospitalizations of 13 patients and violence of 13 patients could not be determined because the information was not documented in medical records , and/or the patients or their family members could not provide accurate information . the treatment response for 18 patients could not be assigned on the three - point scale because their duration of illness was less than 2 years or the available information was not sufficient . patients degree of formal education was determined by information from patients and their family members . each patient was asked to generate as many exemplars in the animal category as possible in 1 min . the motor coordination soft neurological signs examination extracted from the cambridge neurological inventory was administrated . it consisted of finger thumb opposition , finger thumb tapping , dysdiadochokinesia , fist - edge - palm test , and ozeretski test . color task required the patient to read the words of color names , which was printed in colors different from the meaning of the words . the second color - word task required the patient to read the printed color of the words . the color score and color - word score was calculated from the number of correct responses minus incorrect responses in the color task and the color - word task , respectively . 12 patients refused to be examined for verbal fluency and soft signs , and 17 patients refused to be examined for stroop tasks . the genomic dna extraction was performed by standard procedures . the polymerase chain reaction ( pcr ) amplification was carried out using oligonucleotide primers 5-tctgctacaagttctggctt-3 and 5-ctgcagctttttctctag gg-3 . the pcr was performed with 0.1 g genomic dna , 1.5 mg mgcl , 0.1 m of each primer in a total volume of 50 l . genotyping was done by means of restriction fragment length polymorphism assay with the restriction enzyme ( mspi ) . the genotype distributions of the t102c polymorphism of the 5-ht2a receptor gene in patients and controls were evaluated for deviation from the hardy weinberg equilibrium using the test . comparison between the patients and controls for the difference of genotype distributions , allele frequencies was analyzed by the test . further comparison of clinical profiles among patients with schizophrenia with different genotypes was carried out by one - way anova for continuous variables or the test for categorical variables . similarly , the neurocognitive function among patients with various genotypes was compared by using ancova controlled for age or degree of education as required . all the statistical tests were two - tailed with the significance level set at p < 0.05 . age and gender distributions ( male / female ) of patients were 37.8 10.2 and 43/33 . age and gender distributions ( male / female ) of controls were 42 13 and 78/87 . patients and controls were not significantly different for gender distribution . however , mean age in the control group was significantly higher compared with the patient group ( p = 0.009 ) . genotype distribution and allele frequencies of the t102c polymorphism of the ht2a receptor gene among patients and controls are shown in table 1 . the genotype frequencies did not significantly deviate from the hardy weinberg equilibrium in patients ( = 1.9 , df = 1 , p = 0.16 ) and controls ( = 0.05 , df = 1 , p = 0.8 ) . there was no significant difference in genotype distributions or allele frequencies between patients and controls . genotype distributions and allele frequencies of the t102c polymorphism of the 5ht2a receptor gene among schizophrenic patients and healthy controls the associations between the clinical profiles of schizophrenic patients and their genotype distributions are shown in table 2 . no significant association was found between the clinical profiles and the genotype distribution in co - dominant , dominant or recessive models of the gene ( statistics not presented ) . the genotype distributions in association with clinical profiles among schizophrenic patients ( n=76 ) table 3 shows the comparison of neurocognitive performance among patients with various genotypes . as stroop test and verbal fluency test scores ( i.e. mean color score and mean color word score ) were found to be related with education , ancova 's controlled for education were used in comparisons of these neurocognitive variables . soft neurological signs scores were related with subjects age , subsequently this variable was tested using ancova 's controlled for age . no statistically significant differences were observed between the three genotypes with respect to the scores for neurocognitive dysfunction . however , when the contrast of c / c versus c / t + t / t was examined in a recessive model of the c allele , patients with c / c genotype had significantly worse stroop test performance and more severe motor coordination soft neurological signs . age and gender distributions ( male / female ) of patients were 37.8 10.2 and 43/33 . age and gender distributions ( male / female ) of controls were 42 13 and 78/87 . patients and controls were not significantly different for gender distribution . however , mean age in the control group was significantly higher compared with the patient group ( p = 0.009 ) . genotype distribution and allele frequencies of the t102c polymorphism of the ht2a receptor gene among patients and controls are shown in table 1 . the genotype frequencies did not significantly deviate from the hardy weinberg equilibrium in patients ( = 1.9 , df = 1 , p = 0.16 ) and controls ( = 0.05 , df = 1 , p = 0.8 ) . there was no significant difference in genotype distributions or allele frequencies between patients and controls . genotype distributions and allele frequencies of the t102c polymorphism of the 5ht2a receptor gene among schizophrenic patients and healthy controls the associations between the clinical profiles of schizophrenic patients and their genotype distributions are shown in table 2 . no significant association was found between the clinical profiles and the genotype distribution in co - dominant , dominant or recessive models of the gene ( statistics not presented ) . table 3 shows the comparison of neurocognitive performance among patients with various genotypes . as stroop test and verbal fluency test scores ( i.e. mean color score and mean color word score ) were found to be related with education , ancova 's controlled for education were used in comparisons of these neurocognitive variables . soft neurological signs scores were related with subjects age , subsequently this variable was tested using ancova 's controlled for age . no statistically significant differences were observed between the three genotypes with respect to the scores for neurocognitive dysfunction . however , when the contrast of c / c versus c / t + t / t was examined in a recessive model of the c allele , patients with c / c genotype had significantly worse stroop test performance and more severe motor coordination soft neurological signs . this study found an association of t102c polymorphism of 5-ht2a receptor with executive cognitive and soft neurological motor functions in patients with schizophrenia . patients which were homozygous for the c allele as opposed to the patients carrying the t allele ( i.e. patients with ct and tt genotypes ) had significantly worse stroop test performance and more severe motor deficits . conversely , parameters of disease severity such as negative and positive symptom severity , age of disease onset , number of hospitalizations , history of suicide / violence , family history of psychosis , and degree of treatment response did not differ among t102c genotypes . relatively few studies have investigated the role of t102c polymorphism of serotonin receptor on cognitive functions in schizophrenia and normalcy . in one study from turkey , patients of schizophrenia with the heterogeneous genotype ( tc ) , compared to those who were genotype cc or tt did fairly worse in the wisconsin card sorting ( wcst ) and the continuous performance tests measuring sustained attention span and freedom from distractibility . researchers also reported that the t allele , as opposed to the c allele was associated with worse performance in several cognitive domains investigated in that study . however , in a recent study from russia with large sample sizes of patients and healthy controls it was reported in a combined cohort of patients with schizophrenia and healthy individuals that overall productivity and immediate reproduction processes of short - term memory were significantly worse in presence of the cc genotype . thus , our finding of a worse stroop test performance in cc genotype is largely in parallel with the findings of this latter study . an earlier and smaller study of the same group also demonstrated that male patients with schizophrenia of the cc genotype had lower verbal fluency than their counterparts . another study that investigated the effect of 5-ht2a t102c polymorphism on cognition was performed in chinese healthy individuals . this study reported that subjects with the tt genotype had the fewest perseverative errors , while subjects with tc had the poorest performances in wcst . overall , there is possibility that the effect of t102c polymorphism on cognitive performance is also observable in some healthy individuals with significant susceptibility to schizophrenia . early onset schizophrenia may be particularly informative as it is associated with higher genetic loading and also with generalized cognitive impairments across a broad array of neurocognitive functions . however , in a recently published study , vyas et al . investigated the association of the t102c polymorphism of the 5-ht2a receptor gene on visual sustained attention in patients with early onset schizophrenia and their nonpsychotic siblings . they found an association of the tc / cc genotype of the 5-ht2a t102c polymorphism with poor performance on sustained visual attention in probands with early onset psychosis , but not in healthy siblings . yet , it is a rare form schizophrenia which occurs in only % 5 of all schizophrenia cases . future studies with a larger sample in healthy people at risk for schizophrenia should investigate the association of c allelle with cognitive measures . we also found in our study that patients with the cc genotype had significantly more severe soft neurological ( motor ) signs than patients with the t allele . there is considerable evidence in the literature for a strong association between soft neurological signs and poor ( executive ) cognitive performance in schizophrenia . hence , our findings regarding the soft neurological signs and stroop test performances in patients correlates well with each other . this is , to the best of our knowledge , the first evidence of interaction between t102c polymorphism of serotonin receptor and soft neurological signs in a caucasian population . another single study that examined this issue have found less severe motor coordination soft neurological signs in patients with genotype tc and the most severe of these signs in the tt genotype , however in a population of chinese han patients . significant differences in the genotype distribution of the t102c polymorphism between the investigated populations ( turkish vs. chinese ) might be responsible for the above discrepancy . as mentioned above , a recent meta - analysis revealed different genotype distributions of the t102c polymorphism gene in schizophrenia and noncombinability of data between european and east asian populations . our above findings are in line with the recent evidence which indicates that t102c polymorphism located near the promoter region of 5-ht2a receptor gene might have regulatory effects on gene expression . for instance , 5-ht2a receptor expression was reported to be less in the presence of c allele as opposed to the t allele in normal individuals . there is also converging evidence which indicates that serotonin transmission , by interacting with the dopaminergic system plays an important role in prefrontal cognitive functions . in rats , 5-ht2a receptors have been reported to regulate prefrontal execution of primed responses and in healthy volunteers , 5-ht2a agonists impair the continuous performance task , which is mainly determined by prefrontal function . conversely , clozapine , a strong antagonist to the 5-ht2a receptor was found to improve cognitive functions including attention and verbal fluency in patients with schizophrenia . our study in addition to the few studies mentioned above provide clues for the involvement of t102c polymorphism of serotonin receptor gene on cognition in schizophrenia ; however a straightforward comparison between findings of these studies was not possible due to the fact that investigated subjects were from different ethnic origins and/or various cognitive tests had been used to assess their cognition . our study is limited by the relatively small sample size of the patients in which cognitive functions were assessed . another limitation of our study is that the possible effects of antipsychotics and anticholinergic agents on the cognitive function of the investigated patients can not be excluded . despite the above limitations , it seems reasonable in the future to determine the possible effects of t102c polymorphism of serotonin receptor gene on cognition in various psychiatric populations and healthy controls .

healthcare facilities are an ideal environment for the rapid spread of influenza and healthcare workers ( hcws ) have been identified as the primary vectors for spreading influenza virus within these facilities . , moreover , hcws often continue to care for their patients even after they develop flulike symptoms . , nosocomial influenza is also associated with excess absenteeism and disruption of healthcare services . hcws constitute an important group for targeted immunization programs because of their potential as carriers . recommendations for hcw vaccination are common in developed countries . both the usa advisory committee on immunisation practices and the australian technical advisory group on immunisation recommends influenza vaccination to healthcare providers because of their contact with those at risk of complications from influenza . , despite these recommendations , only 36% of hcws in the united states are vaccinated against influenza annually . other previous studies demonstrate a range of immunization rates for overseas doctors from 38% to 82% . , a recently published australian study in this area examined the extent of vaccination coverage across victorian public hospitals in 2005 . investigators reported that an overall average of 38% of staff was vaccinated , with the highest rates of vaccination being among allied health ( 45% ) and laboratory staff ( 42% ) . the study also demonstrated that among clinical staff , medical staff had the lowest vaccination rates ( 29% ) , followed by nursing ( 35% ) . a second study conducted in 2007 in a tertiary hospital in the northern territory found that only 28% of doctors received influenza vaccination in that year ; and of the 72% not immunized , only 44% had received vaccination prior to 2007 . physicians are generally more receptive to influenza vaccination than nursing staff or nonmedical employees . healthcare workers appear to have many of the same misconceptions about influenza and influenza vaccine as patients with the most prevailing belief that one can get influenzalike symptoms from influenza vaccination . over the last two decades , healthcare authorities have developed guidelines and programs to reduce nosocomial spread of infectious diseases and protect staff . , however , many of the intervention programs to date have had limited success in encouraging and maintaining hcw vaccination levels . those reporting success have used comprehensive campaigns aimed at promotion and increasing availability such as mobile carts . , , we choose to explore the attitudes and beliefs of a range of different hospital staff including doctors , nurses , allied health staff and ancillary staff because they all have the potential to introduce and spread influenza around the hospital . the study was conducted in two hospitals in sydney , nsw , australia , during the introduction of a state government policy directive mandating vaccination for healthcare workers . the study was broadly focused on three major areas : hcw pandemic influenza preparedness , attitudes to mandates and attitudes to seasonal influenza vaccination . between june 4 and october 19 , 2007 , we conducted a crosssectional survey in two major referral teaching hospitals ( one adult and one paediatric ) to determine hcws knowledge and attitudes towards seasonal influenza . we developed an anonymous twopage survey that assessed the following characteristics of participants : ( i ) demographic characteristics , family situation and specialty ; ( ii ) their attitudes towards the influenza vaccine ; and ( iii ) uptake of the influenza vaccine . the questionnaire was also available on the intranet , which was available to staff in the paediatric hospital only . access to the electronic questionnaire depended on the hospital staff ( from all four categories ) having access to the hospital computer system . four groups were surveyed : doctors ( staff specialists , registrars , medical students , etc . ) , nurses ( registered nurses , nurse unit managers , enrolled nurses , etc . ) , allied health personnel ( physiotherapists , occupational therapists , psychologists , etc . ) and ancillary staff ( domestic services , administration , computer specialists , etc . ) . the latter group also included any staff member who was deemed to not have direct patient contact including academic staff and other public health professional staff . the survey was distributed via wards and/or departments within each hospital where patients were considered to be at high risk for influenza or its effects . managers were asked to estimate the number of surveys needed to cover staff currently working in the ward / department . at each hospital , during the period of june to october , 2007 , 40 wards were approached with all agreeing to distribute the survey . a further 185 questionnaires were submitted electronically from staff at the paediatric hospital , resulting in a total of 1079 completed questionnaires . we received 559 surveys ( 52% ) from the paediatric and 520 surveys ( 48% ) from the adult hospital . respondents were categorized into four main groups by occupation : nurses ( 475% ( 512/1079 ) , doctors ( 260% , 281/1079 ) , allied ( 153% , 165/1079 ) and ancillary staff ( 112% , 121/1079 ) . demographic characteristics of healthcare workers in two nsw teaching hospitals according to selfreported influenza vaccination status in 2007 the group of other is made up of hospital research staff , technologists , pathology and laboratory staff and medical imaging staff . with regard to influenza vaccine uptake , 241/1079 ( 22% ) replied that they had received it the year the survey was conducted ( 2007 ) . doctors reported the highest levels ( or : 17 , ci 95 : 123234 , p = 005 ) , followed by the allied health staff ( or : 105 , ci 95 : 069158 , p = 08 ) , nurses ( or : 070 , ci 95 : 052095 , p = 001 ) and ancillary staff ( or : 075 , ci 95 : 045125 , p = 024 ) . low levels of vaccination were reported for staff members from highest risk patient areas ( neonatal : 15% and intensive care : 10% ) . when examining beliefs about the influenza vaccine , 81% ( 870/1079 ) felt it was safe and 68% thought it was effective ( 733/1079 ) . of the staff who stated they felt the influenza vaccine was safe and effective , only 235% ( 207/1079 ) and 239% ( 184/1079 ) , respectively , reported receiving it ( table 2 ) . doctors were more likely to agree that the vaccine was effective ( or : 268 , ci 95 : 163445 , p 001 ) , safe ( or : 409 , ci 95 : 182954 , p 001 ) and that it decreased time lost from work ( or : 346 , ci 95 : 229525 , p 001 ) , than nurses . the attitudes of staff towards influenza and vaccination by vaccination status are shown in table 2 . attitudes towards influenza and vaccination by vaccination status in two nsw teaching hospitals in 2007 * each selection was ranked separately by the participant . slightly more staff stated that it was important to get vaccinated against influenza for the protection of patients ( 74% , 796/1079 ) than family ( 68% , 730/1079 ) or for selfprotection ( 66% , 712/1079 ) . for staff who felt it was important to vaccinate for the protection of patients and family , only around 234% ( 186/798 ) and 24% ( 172/697 ) reported receiving the vaccine respectively . for participants who felt the vaccine was important for selfprotection , three quarters of respondents agreed that getting vaccinated would decrease time lost from work ( 59% , 636/1079 ) . thirty three per cent ( 359/1079 ) agreed with the statement i am at low risk of catching flu ; 52% ( 556/1079 ) agreed with the statement the flu vaccine can cause flu in some people ; whilst a further 20% ( 216/1079 ) were unsure and 28% ( 307/1079 ) disagreed . this pattern was not so clear for the next statement on whether the flu vaccine contains live virus with an equal number agreeing and disagreeing and a further 37% ( 402/1079 ) being unsure . nurses were significantly more likely to agree that the flu vaccine contains live virus then doctors ( or : 050 , ci 95 : 033076 , p 001 ) . 51% ( 62/121 ) of ancillary staff were unsure if the vaccine contains a live virus , while a further 42% ( 51/121 ) believed it did . 58% ( 297/512 ) of nurses and 58% ( 96/165 ) of allied health staff believed that the vaccine caused the flu in some people . of the respondents who replied from the two institutions , only 22% ( 241/1079 ) reported being vaccinated against influenza . like ours , most studies on attitudes of hcws towards influenza vaccination find many have misperceptions on vaccine effectiveness , side effects , protective value and the role of hcws in transmission of influenza to patients . , , , despite general perceptions of safety , false belief that the vaccine can cause influenza persisted among half of the respondents . this result is comparable to other studies that have reported frequencies from 30% to 45% . , in our study we found that only 13% of respondents perceived that the vaccine was ineffective , whereas in a study by goldstein et al . this may relate to the level of information available to the hcws in our hospitals . our study found that high percentages of participants agreed with the importance of getting vaccinated . to protect patients appeared to be the strongest motivation even amongst nonvaccinated individuals . this is in contrast to the results published in a literature review carried out by hofmann et al . that found selfprotection as the leading reason for hcw vaccination followed by protection of patients . healthcare workers who see personal protection as the main purpose of vaccination often do not consider the consequences for patients , thereby limiting the number of healthcare professionals willing to undertake annual vaccination . in our study , we found that nurses were consistently less certain about the vaccine s safety , efficacy and importance compared with than physicians and allied health professionals . nurses were also more likely to falsely believe that the vaccine could cause flu in people and that the vaccine contained live virus . in corroboration , a study from the united states also reported that concerns about becoming ill as a result of being vaccinated were cited as the second most common reason by hcws ( 23% of respondents ) for declining to undergo influenza vaccination . previous studies have also documented differences in the level of knowledge about the effectiveness of the vaccine and the recognition of the seriousness of influenza between nurses and physicians . in these previous studies , as with ours , nurses had lower uptake rates for the influenza vaccine . , nurses are also less likely ( compared with physicians ) to there are a number of limitations to this study including the sample and use of selfreport for immunization status . adults tend to overestimate their own influenza vaccination status with studies demonstrating a positive predictive value of between 63% and 88% , high sensitivity but lower specificity . , with regards the sample , we were unable to compare the demographics of the respondents versus nonrespondents to examine representativeness . however , based on manager estimates for each ward / department , we had a good response rate ( 894/1200 , 745% ) . there may also be limitations with generalizability since we included only two hospitals in a single australian city . nevertheless , this study provides baseline information at a key phase in the evolution of healthcare worker vaccination policy in nsw . it is clear that mere education on the benefits of vaccination is not sufficient to promote influenza vaccine uptake . as emphasized by ofstead et al . , the provision of education does not ensure comprehension studies agree that one can not rely on one method to increase influenza vaccination rates , instead a bundle strategy should be used , whereby they include various methods to improve vaccination rates , such as the provision of free and readily accessible vaccination , education with a focus on the patient safety aspect of hcw vaccination and regular assessment of the program . for our study population , there needs to be emphasis placed on the rational and logic for vaccination i.e. the necessity to be vaccinated to protect patients from nosocomial influenza infection and also for selfprotection . the next phase in the improvement of influenza vaccination rates among hcws involves making vaccination a requirement to some degree . the province of ontario , canada , introduced regulations in 2004 requiring annual influenza immunizations for workers in long term care . in the united states , there are at least four states which have policies required influenza immunizations of workers in hospitals , nursing homes or both , unless the workers has a medical , religious or philosophical reason for exemption . investigators from the cdc , recently concluded that requirements for vaccination that are properly implemented and enforced should be an effective tool in future efforts to reduce healthcareassociated infections and increase overall quality of care. however , they warned that these requirements are unlikely to be fully adopted without legal requirement . found that 56% of surveyed nurses stated that mandatory influenza vaccination was appropriate for hcws and 594% reported that they would support a policy required annual influenza vaccination for hcws ( with direct patient contact ) that allowed informed declination . in a second study , lester et al . reported that 44% of 670 physicians surveyed believed that influenza vaccination should be mandatory , including 29% of those who had chosen to not receive vaccination . recently , interest has focused on mandatory programs coupling a requirement for immunization and the use of a form to document the hcws decision to immunize or not . the use of a signed declination ( or refusal ) form has been promoted to ensure that hcws are appropriately informed about the rational for influenza vaccination . key facets of the declination form should include : ( i ) the message to which the hcw is attesting , ( ii ) the ramifications of failure to sign the declination and ( 3 ) the emphases and expectations of the surrounding institutional leadership . a survey of infectious diseases specialists noted that vaccination rates were significantly higher at institutions that required signed declination forms , compared with institutions that did not , although this was not the strongest predictor . it appears that in our study s context , institutional changes such as the use of a declination form , to ensure staffs receive vaccines may pave the way for increasing influenza vaccination uptake prospectively . our survey was undertaken at the commencement phase of a policy mandating immunization and screening for vaccines not including influenza . as 44% ( 474/1079 ) of respondents falsely believed influenza vaccination was incorporated within the mandatory requirements , it is possible that vaccination rates increased the following year when influenza vaccination was recommended ( march to june ) . three messages emerge from our data : ( i ) even though the staff feel the vaccine is safe and effective , the misconceptions that the vaccine causing the flu and that it contains live virus outweighs the positive response ; ( ii ) there is variation in responses across the different streams of staff which suggests a need to tailor an intervention program at different levels ; and ( iii ) state or institutional policies and practices are likely needed to increase employee uptake of this vaccine . different health professional groups require different approaches according to their professional culture and access to existing knowledge on influenza vaccination . julie leask is an investigator on a grant which is part funded by sanofi pasteur . c. raina macintyre receives funding from influenza vaccine manufacturers gsk and csl biotherapies for investigatordriven research . national centre for immunisation research and surveillance is supported by the australian government department of health and ageing , the nsw department of health and the children s hospital at westmead .

the prevalence of metabolic syndrome ( mets ) in patients with essential hypertension is very high , and has been estimated as being close to 50% . hypertensive patients with mets have a much higher cardiovascular ( cv ) risk than their counterparts without mets , and also have a particularly high risk of developing type 2 diabetes mellitus ( t2 dm ) . in addition , the choice of antihypertensive therapy can have a large impact on the risk of development of t2 dm . renin angiotensin system blockers , that is , angiotensin - converting enzyme inhibitors and angiotensin receptor blockers ( arbs ) , improve insulin sensitivity and reduce the risk of developing t2 dm compared with placebo , whereas calcium channel blockers ( ccbs ) have a neutral effect . therefore , the combination of an arb and a ccb might be particularly beneficial in patients with high metabolic risk . the present european guidelines for the management of hypertension acknowledge that most high - risk hypertensive patients require a combination of antihypertensive drugs . for patients with mets , the recommended combinations are renin angiotensin system blockers combined with low - dose thiazide diuretics or ccbs . in spite of the well - known effect of antihypertensive treatment on glucose and lipid metabolism in addition to decreased insulin sensitivity , a low circulating level of adiponectin is a central feature of mets and is strongly associated with the incidence of t2 dm . high circulating levels of inflammatory markers such as tumour necrosis factor- ( tnf- ) , c - reactive protein ( crp ) and interleukins-1 ( il-1 ) , il-6 and il-8 are also a feature of mets and increase the risk of developing t2 dm . the adhesion molecules , intercellular adhesion molecule-1 ( icam-1 ) and vascular cell adhesion molecule-1 ( vcam-1 ) are also strongly associated with certain features of mets , particularly postprandial triglyceride and insulin levels , and may therefore be implicated in the development of atherosclerosis and t2 dm . olmesartan is the latest arb to become available in clinical practice . a systematic review of the efficacy of arbs in studies that used 24-h ambulatory blood pressure ( bp ) monitoring revealed that olmesartan may achieve greater ambulatory bp reductions than other arbs , even though reductions in office bp were similar . fixed - dose combinations of olmesartan with amlodipine and with hydrochlorothiazide have recently become available . in addition to other ancillary actions , amlodipine has been shown to have a modest insulin - sensitising effect that is additive to the effect of an arb . the primary objective of this stand - alone study , olas ( olmesartan / amlodipine vs olmesartan / hydrochlorothiazide in metabolic syndrome ) , was to investigate the effects of olmesartan / amlodipine and olmesartan / hydrochlorothiazide combination therapy on inflammatory ( including tnf- , crp , il-1 , -6 and -8 , icam-1 and vcam-1 ) and metabolic parameters ( including insulin sensitivity and adiponectin ) , with new - onset t2 dm as a secondary outcome measure , in non - diabetic hypertensive patients with mets . the patients recruited for this study were all europid , aged 2575 years and had stage i and ii hypertension ( systolic bp ( sbp ) 140179 mm hg ) and mets , as defined by the international diabetes federation for europid populations ( waist circumference > 94 cm in men and > 80 cm in women , and at least two of the following criteria : triglycerides > 1.7 mmol l ; high - density lipoprotein - cholesterol < 1.03 mmol l in men and < 1.29 mmol l in women ; fasting blood glucose > 5.6 mmol l ; bp > 135/80 mm hg ) . previous antihypertensive therapy , if any , was withdrawn during a washout period of 35 weeks before inclusion . patients with diabetes mellitus were excluded from the study and , in order to unmask hidden diabetes , a standard oral glucose tolerance test was performed in patients with fasting blood glucose > 5.6 mmol l. patients were also excluded if they showed evidence of unstable angina , acute coronary syndrome , myocardial infarction , decompensated congestive heart failure , stroke or transient ischemic attack within the previous 6 months , left ventricular outflow obstruction , liver dysfunction ( serum bilirubin > 1.5 or plasma aminotransferases 2 the upper normal limit ) , renal insufficiency ( plasma creatinine > 133 mmol l in men and > 124 mmol l in women ) or overt proteinuria ( > 300 mg per day ) . patients with known hypersensitivity or a history of severe adverse effects with any arb , ccb , thiazide diuretic or -adrenergic blocker were excluded , as well as those with any contraindication for olmesartan , amlodipine , hydrochlorothiazide or doxazosin ( based on the prescribing information for each drug ) . pregnant women , nursing mothers , women of childbearing potential not using adequate contraceptive methods and patients with a history of mental illness or psychiatric disorders were also excluded . the study was conducted according to standard good clinical practice guidelines and approved by the local ethics committee of participating centres . , randomized , open - label , blinded end point design ( probe ) was used , and all measurements and procedures were performed by personnel blinded to the treatment allocation . after baseline measurements were taken , patients were randomized to receive olmesartan ( 20 mg)+ amlodipine ( 5 mg ) daily ( oa group ) , or olmesartan ( 20 mg ) + hydrochlorothiazide ( 12.5 mg ) daily ( oh group ) . after 132 , 262 , 392 and 782 weeks ( approximately 3 , 6 , 9 and 18 months ) all measurements were repeated . those patients not reaching the sbp target ( < 140 mm hg ) were successively uptitrated to a double dose of the initial treatment after 13 weeks , an additional 4 mg of doxazosin ( long - acting formulation ) after 26 weeks , and 8 mg of doxazosin after week 39 . additional visits were performed after 522 and 652 weeks ( 12 and 15 months ) but only bp , fasting blood glucose , compliance and tolerance data were obtained . patients who had already been uptitrated to the maximum treatment doses but still had sbp > 160 mm hg were removed from the study . in all patients with fasting glycaemia < 7 mmol l at any visit after the first , a standard oral glucose tolerance test was performed within the following 10 days . new - onset t2 dm was diagnosed in patients with fasting glycaemia 7 mmol l or 120 min post - load glycaemia > 11.1 mmol l , in the absence of clinical signs of type 1 or secondary diabetes mellitus , according to the current world health organization guidelines . weight , height , waist circumference , fasting plasma glucose and insulin , lipid profile ( that is , total cholesterol , high - density lipoprotein - cholesterol and triglycerides ) , creatinine , sodium , potassium , bilirubin , aminotransferases , high - sensitivity - crp , and urinary albumin and creatinine ( in early morning samples ) were measured by standard clinical procedures . heart rate and bp were measured according to current guidelines , using a validated semi - automatic device ( omron 705p ) , in the morning ( between 08:30 and 11:30 ) after 5 min of rest in a sitting position with the back supported ; patients were advised to avoid smoking and caffeinated drinks 30 min before the measurement . the values for bp and heart rate obtained at each visit were the average of two measurements separated by at least 2 min ; a third reading was obtained if there was a difference of 5 mm hg or 5 beats per minute between the two readings . plasma tnf- was measured using a commercial enzyme - linked immunosorbent assay ( arcus biologicals , modena , italy ) ; plasma adiponectin , icam-1 , vcam-1 and interleukins-1 , -6 and -8 were also measured with a commercial enzyme - linked immunosorbent assay ( linco research inc . the insulin resistance index ( iri ) was estimated by the homeostasis model assessment formula : iri = fasting plasma insulin fasting plasma glucose/135 , with insulin in pmol l ( 1 mu per l=6.00 pmol l ) and glucose in mmol l. compliance was assessed by returned pill counts and tolerance by questionnaire . an intention - to - treat analysis was performed in all patients who received at least one dose of study medication and had a subsequent efficacy observation . the sample size was calculated with the assumption ( based on a pilot trial ) of a 25% difference in the means between the groups for most of the main variables ( namely iri , adiponectin , tnf- , il-1 , il-6 , icam-1 , and vcam-1 ) , and a 40% variation coefficient within the groups , yielding 54 patients per group for a 90% statistical power with =0.05 . assuming a 10% patient loss , a sample size of 60 per group was required . however , the study could be underpowered for the secondary objective ( new - onset t2 dm ) , as we did not have enough information to calculate an adequate sample size . the data are presented as means.d . , with 95% confidence intervals for differences as appropriate . changes from baseline and between groups in bp , heart rate and laboratory parameters were evaluated using a student 's t - test for paired or unpaired data , or analysis of variance , as appropriate . categorical variables were compared using the or the fisher 's exact tests , as appropriate . the survival analysis for new - onset t2 dm was performed using the kaplan meier model followed by the log - rank test . all statistical tests were two - tailed and a p - value of < 0.05 was considered statistically significant . enrolment for this trial began in may 2005 , including a 6-month , 8-patient pilot trial to check for feasibility and to confirm the sample size calculation . a total of 256 patients were screened , of whom 120 were randomized . at baseline , the mean age was 59.38.1 years , 55% of patients were female , and the mean body mass index was 31.23.7 kg m. there were 60 patients in each group . of the 120 patients randomized , 31 ( 25.8% ) had received previous antihypertensive treatment ; 17 in the oa group and 14 in the oh group . none had received combination treatment and all had a sbp > 140 mm hg ; three had received a thiazide diuretic , two a -blocker , nine a ccb ( seven dihydropyridinic , two non - dihydropyridinic ) , nine an angiotensin - converting enzyme inhibitor , seven an arb and one a direct renin inhibitor . bp decreased significantly in each group vs baseline ( p<0.001 ) , but there were no significant differences in bp control between the groups ( analysis of variance , p=0.39 ) . the final sbp values were 126.59.0 and 129.910.9 mm hg for the oa and oh groups , respectively , and the final diastolic bp values were 84.97.3 and 86.38.6 mm hg . the mean differences between groups throughout the study were 1.5 mm hg for sbp ( 1.4 to 4.4 ) and 0.8 mm hg for diastolic bp ( 1.8 to 3.6 ) . in the oa group , 53.3% of patients required doubling of the initial drug doses , and 30.0% required the addition of doxazosin . the respective figures for the oh group were 53.3 and 31.7% . by week 26 , before the addition of doxazosin , 68.3% of patients in the oa group and 66.7% in the oh group had reached the target bp ; at the end of the study , the respective figures were 81.7 and 78.3% . the baseline values for all of the quantitative variables in both groups are presented in table 1 . for body mass index , waist circumference , fasting plasma glucose , sodium , potassium , creatinine , lipid profile , bilirubin and aminotransferases , no differences between the treatment groups were found throughout the study ; the final values are presented in table 2 . the albumin excretion rate decreased significantly in both groups ( p<0.01 ) , with no between - group differences . in the oa group , the percentage reductions were 34.1% at week 26 and 50.0% at week 78 ; in the oh group , the reductions were 36.2 and 53.7% , respectively . the 95% confidence intervals for the differences were , respectively , 7.5 to 11.8% and 5.9 to 13.4% . the iri and plasma fasting insulin were significantly reduced in the oa group ( by 24.1 and 25.0% , respectively , both p<0.01 ) , whereas adiponectin was increased by 16.3% ( p<0.01 ) . in the oh group , figure 4a shows the percentage changes in albuminuria , fasting insulin , iri and adiponectin ; the percentage changes in adiponectin showed an inverse correlation with the percentage changes in the iri ( pearson 's r test=0.54 , p<0.001 ) . of the inflammation markers studied , only crp was significantly reduced in both groups ( by 16.7 and 14.1% in the oa and oh groups , respectively , both p<0.05 ; 95% confidence intervals for the difference was 2.1 to 7.2% ) , with no significant difference between the two groups . the other inflammation markers were significantly reduced in the oa group only ( by 16.1% for tnf- , 18.5% for il-1 , 18.1% for il-6 , 12.8% for il-8 , 20.8% for icam-1 and 30.8% for vcam-1 ) ; the between - group differences were significant for all of these inflammation markers . a post hoc analysis was performed within each group in order to assess the effect of the addition of doxazosin ( after week 26 ) on the studied variables . with the exception of a significant reduction in sbp and diastolic bp ( similar for both groups ) , no differences could be found between the patients taking doxazosin and those not receiving doxazosin . after week 26 , the only variables that underwent significant changes were sbp and diastolic bp ( figure 3 ) , and new - onset t2 dm ( figure 5 ) . during the study , three patients ( 5.0% ) developed t2 dm in the oa group , compared with 11 ( 18.3% ) in the oh group ( odds ratio 4.24 for oa vs oh ; absolute risk reduction 13.3% ) . the kaplan meier survival analysis is plotted in figure 5 . the log - rank test showed a significant difference between the groups ( p=0.02 ) . a logistic regression modelling analysis determined that the predictors of t2 dm development ( after adjustement for gender and baseline values of age , body mass index , waist circumference and fasting plasma glucose ) were : the iri ( or 1.27 per 0.5 au increment , p=0.013 ) , oh treatment ( or 3.98 , p=0.023 ) and low adiponectin ( or 2.26 per 1 g ml decrement , p=0.043 ) . the compliance rate was high : 96.1% for the oa group up to week 26 and 92.7% at the end of the study ; the respective figures were 94.1 and 91.8% for the oh group . only one patient withdrew from the study because of side effects ( malleolar oedema , in the oa group ) but minor side effects were reported by low proportions of patients in the oa group ( oedema ( 8.3% ) , headache ( 6.7% ) and flushing or dizziness ( 1.7% ) ) and in the oh group ( oedema ( 3.3% ) , headache ( 5.0% ) and flushing or dizziness ( 5.0% ) ) . three patients ( 5.0% ) in each group were withdrawn from the study because of poor bp control , with sbp > 160 mm hg despite full treatment . there were no differences in the incidence of side effects between the groups ( fisher 's exact test ) . none of the patients had hypokalaemia during the study , and the correlation studies between potassium and insulin , glucose or iri were negative ( data not shown ) . olmesartan plus amlodipine and olmesartan plus hydrochlorothiazide are well tolerated and effective in non - diabetic hypertensive subjects with mets , and allow achievement of adequate bp control in the majority of patients using a simple treatment strategy . combination treatment has been shown to increase the efficacy of treatment and reduce adverse effects . a recent large meta - analysis has shown that the extra bp reduction that can be obtained with a combination of drugs from different classes is approximately five times greater than the bp reduction produced by doubling the dose of one drug . the olmesartan / amlodipine combination was factorially evaluated in the coach trial , a large , multicentre , randomized , double - blind , placebo - controlled study . each of these olmesartan - based combinations has been found to be well tolerated and effective . however , to the best of our knowledge , neither of the combinations has been studied specifically in patients with mets , and data on their effects in obese hypertensive patients are very scarce . most of our patients were obese , as expected in a group with mets ; moreover , the prevalence of obesity in our community is among the highest in europe . the validity of the mets concept has been recently challenged for cv risk prediction , but it remains a useful predictor of t2 dm development . in the present study , significant reductions in urinary albumin / creatinine quotient were also observed in both treatment arms . microalbuminuria is highly prevalent in non - diabetic hypertensive subjects with mets , and is a well - known marker of both renal and cv risk . the life trial , in hypertensive patients with left ventricular hypertrophy , showed that reductions in albumin excretion during treatment translate into a reduction in the risk of cv events . the olas study also shows that there are clear differences between the two olmesartan - based combinations with regard to metabolic and inflammatory markers . it has long been established that thiazide diuretics impair insulin sensitivity and increase the incidence of t2 dm . this adverse effect can only partially be explained by hypokalaemia ; a systematic review of the available evidence found that thiazides are diabetogenic even in the absence of changes in the plasma potassium level . thiazide diuretics have been shown to reduce hard cv endpoints in many large controlled trials , and are recommended as first - line treatment for hypertension in the current guidelines . however , most of these trials have been based on chlorthalidone or indapamide , whereas the currently recommended low doses ( up to 25 mg per day ) of hydrochlorothiazide have never been shown to reduce cv morbidity and mortality . nevertheless , hydrochlorothiazide is , by far , the most prescribed thiazide diuretic worldwide , and the one used in almost all of the available single - pill combinations containing a diuretic . the mechanisms for the diabetes preventing effect of candesartan ( medica ) study found that , compared with candesartan , hydrochlorothiazide increased insulin resistance in a manner that was not related to hypokalaemia , but was associated with fat redistribution , an increase in visceral adiposity , steatohepatitis and low - grade inflammation . the pharmacogenomic evaluation of antihypertensive responses study found that the adverse metabolic effects ( including new - onset t2 dm ) of hydrochlorothiazide , alone or associated with atenolol , were more frequent and severe in patients with abdominal obesity . the study of trandolapril / verapamil sr and insulin resistance ( star ) , showed that in non - diabetic hypertensive patients with mets , an angiotensin - converting enzyme inhibitor / ccb combination was associated with a much lower risk of developing diabetes than an arb / hydrochlorothiazide combination , despite similar reduction in bp ; a correlation with potassium levels was also excluded . our results regarding the development of t2 dm are comparable , and also ruled out thiazide - induced hypokalaemia as the cause . moreover , we were able to establish the predictive role of low adiponectin levels in this model , even independently of the changes in the insulin sensitivity index . in fact , low adiponectin is a powerful independent predictor of t2 dm . the clinical relevance of the changes in these metabolic parameters is unknown , although a higher incidence of t2 dm may not be trivial . the importance of new - onset t2 dm in hypertension trials has been challenged , as it does not seem to be associated with a higher risk of mortality or clinical events in the short term , and for some authors its possible occurrence should not influence the selection of antihypertensive drug . moreover , the star long - term extension trial showed that it is partially reversible . the risk associated with new - onset t2 dm may become apparent only in very long - term studies , except in very high - risk situations . in the valiant trial , after an acute myocardial infarction , patients with previously known or newly diagnosed diabetes mellitus had similarly increased risks of mortality and cv events , much higher than non - diabetic patients . recently , the avoiding cardiovascular events through combination therapy in patients living with systolic hypertension ( accomplish ) trial showed a 20% reduction in the risk of cv events and mortality with the use of a fixed - dose combination of benazepril / amlodipine , compared with a fixed - dose combination of benazepril / hydrochlorothiazide , despite similar reduction in bp . these results point to an , as yet , unknown bp - independent mechanism , although a reduction in central bp may also be implied . although an arb was prescribed instead of an angiotensin - converting enzyme inhibitor in the olas study , these treatment strategies are generally similar , and our results suggest that the different effects on inflammatory mediators could contribute to the results shown in accomplish . angiotensin system has anti - inflammatory actions and , in particular , olmesartan has been shown to reduce crp , tnf- , il-6 and monocyte chemotactic protein-1 in the european trial on olmesartan and pravastatin in inflammation and atherosclerosis ( eutopia ) . amlodipine also has anti - inflammatory properties , whereas hydrochlorothiazide elicits microinflammation and increases the circulating levels of crp . the probe design may introduce investigator bias but has been validated in many hypertension trials to date , and reflects usual clinical practice more closely than a randomized controlled design . another limitation of the present study is a small , not significant but consistent difference in blood pressure ( 1.5/0.8 mm hg lower in the oa group ) . however , a post hoc analysis did not find a significant correlation between this difference and the observed changes in metabolic and inflammation parameters . in conclusion , both the olmesartan / amlodipine and olmesartan / hydrochlorothiazide combinations were effective and well tolerated in this study , but the effects on metabolic and inflammatory markers and on new - onset t2 dm were possibly more favourable for the combination containing the ccb . the impressive results of the accomplish trial on hard cv endpoints have not been explained , but our study may be hypothesis - generating and stimulate further research that may eventually elucidate the bp - independent protection afforded by the renin

operating theatres ' cost constitutes a huge investment of healthcare resources , approximating one - third of total hospital budget [ 1 , 2 ] . thus , there is an increasing interest in providing an efficient anaesthetic and surgical service , to make operations the largest potential source of income [ 1 , 2 ] . however , case cancellations on the day of surgery , due to suboptimal utilization of theatre time [ 47 ] , is a well - recognized problem in hospitals , ranging from 10% to 40% across different health care systems worldwide , 60% of which could potentially be avoided [ 810 ] . delays and consequent cancellations of surgical procedures are arguably an issue of health care quality as well as a major cause of waste of health resources [ 2 , 10 ] . as a consequence , they prolong the duration of hospitalization causing anxiety , frustration , anger , emotional involvement , and inconvenience to patients and their families , quite apart from increasing the cost in terms of working days lost and disruption to daily life . the most common causes of cancellation are the patient being unfit for surgery and suboptimal utilization of theatre time [ 6 , 9 ] , with the latter leading to case delays . several studies have shown organizational issues to be the cause , such as a lack of sufficient theatre time , overrunning of lists , and poor coordination between staff [ 6 , 10 , 13 , 14 ] . despite the growing interest in utilization of hospital health care resources , only one study so far involving gynecological population has looked into each step of a patient 's journey through the operating theatre , in order to elucidate the factors which make this passage inefficient and lead to poor operating theatre utilization . thus , the purpose of the present study was to perform a thorough and step - by - step assessment of the utilization of operating theatre time by validating the time estimates of five typical stages of perioperative time management , in relation to some of the most ordinary operations in general surgery , with a view to assess the efficacy of our practice and to identify areas of further improvement . this study was conducted after the approval of scientific committee for medical research ethics . during a 12-month period , we retrospectively analyzed the operating room ( or ) database to retrieve only the cases involving six predetermined types of general surgery procedures , classified according to their surgical impact as minor ( inguinal hernia ) , moderate ( postop ventral incision hernia and laparoscopic cholecystectomy ) , and major ( total gastrectomy , total colectomy , and abdominoperineal colonic resection ) . these types of operations were selected on the basis of variability of duration or severity and the degree of patients ' vulnerability to perioperative complications . the inclusion criteria involved the exclusive fit to one of the six operations included in the study protocol , elective operations , and general anaesthesia with endotracheal intubation cases . the combination with epidural / spinal or nerve block was grounds for exclusion . for each individual , five different time intervals were collected from the or chart : induction to anaesthesia , preparation for surgery , duration of surgical procedure , recovery from anaesthesia , and transfer from or to the postanaesthesia care unit ( pacu ) or intensive care unit ( icu ) . ( t1 ) includes preparation of each patient by a qualified anaesthesia nurse , catheterization of peripheral or central vessels ( veins and arteries ) , and finally tracheal intubation , as appropriate . ( t2 ) includes proper positioning of the patient , insertion of urinary bladder catheter , possibly the need for adjustment of accessories to the operating table , patient disinfection , and draping and surgeon disinfection gowning and gloving . ( t3 ) is exclusively the time period between the initial cutting and the putting of a drape over the final stitches . ( t4 ) includes , for the minor and medium severity operations , the time from the last stitch to the patient extubation and adequate recovery from anaesthesia to the point of transfer to the pacu , while for major operations it includes the time from the last stitch to the time either the patient was extubated and had slightly recovered in or , or for clinical reasons , it has been decided in advance to be transferred intubated to the icu . finally , the time period referred to as patient taken from theatre ( t5 ) represents the time needed for the porter to come and to transfer the patient out of the or towards the pacu or icu . one - way analysis of variance ( anova ) with bonferroni correction was conducted to compare means of continuous variables and normal distributed data , while a nonparametric rank test , the kruskal - wallis test , was used to compare means in the case of nonnormally and noncontinuously distributed data . subgroup comparisons of categorical variables were assessed by a chi - square test . for all statistical procedures , data were analyzed using spss version 18.0 ( spss inc . , chicago , il , usa ) . data from a total of 548 patients were subtracted from the or database anonymously . according to the surgical impact classification described , 6.8% ( n = 37 ) of the patients were found to have undergone minor surgical procedures , 68.2% ( n = 374 ) medium surgical procedures , and 25% ( n = 137 ) major surgical procedures . detailed data regarding the total time that the patient remained in the or in the different group of operations are presented in table 1 . with the exception of duration of surgery , the remaining time intervals in each study group were comparable . only in major surgical impact cases the time spent for induction to anaesthesia presented a subtle augmentation regarding recovery from anesthesia and transfer to pacu or icu ( p = 0.034 and p = 0.018 , resp . ) . data obtained from the classification of the studied time intervals according to the surgical impact of the involved operations is presented in figure 1 . in the time spent for anaesthesia procedure there is a statistically significant difference ( p = 0.000 ) among the mean time spent for general anaesthesia preparation in minor or even medium surgical impact operations ( 16 - 17 min ) compared to major procedures ( 25 min ) . in this way we could empirically divide the time for anaesthesia into that for the basic needs ( peripheral vein insertion plus anaesthesia induction and endotracheal intubation ) and that used for applying extra catheterization ( central venous and arterial lines ) , estimated to be approximately 15 to 25 min , respectively . in the same manner , there is a statistically significant difference between time used for patients to be subjected to minor and medium operations compared to major surgery . in regard to the duration of operation , there is also a statistically significant difference ( p = 0.000 ) between minor and medium operations , as well as between medium and major surgery , both assessed either individually or as groups . concerning the time for anaesthesia recovery , the studied groups also differed significantly ( p = 0.000 ) . it is noteworthy that 2.4% ( n = 9 ) of the patients in medium and 32.8% ( n = 45 ) in major surgery were transferred intubated in icu , while all patients in minor operations were extubated in or ( p = 0.000 ) . finally , the time spent waiting for the transport personnel to transfer the patient out of or presented a statistically significant difference between minor surgery patients in relation to both medium and major surgery ( p = 0.006 ) . our data showed that in our teaching university hospital the time intervals of five typical stages of or time utilization concerning the most ordinary elective operations in general surgery ranged within acceptable limits and were comparable to the time estimates of published operating lists . with the exception of transportation to pacu or icu where the most outliers were recorded , excessive delays were not our case . delays of surgical procedures as well as cancellations due to overrunning of the lists and suboptimal utilization of theatre time are common occurrences throughout the world . there have been many reports to show that this results in wastage of or time and prolongation of patients ' hospitalization , leading to increased cost and emotional involvement . on the other hand , several reports aimed at identifying the causes of delays and constructing sophisticated models or simple algorithms for more accurate prediction of time needed for each individual intervention , to avoid overbooking and optimize the efficient use of or time [ 2 , 3 , 16 ] . however , many unpredictable factors have been found to interfere , leading finally to operation delay , despite the operation time itself being well estimated . in the present study we tried to analyze , in a step - by - step procedure , the time spent in surgical procedures with escalating surgical impact and , in order to keep a degree of similarity , we used only elective operations and only those performed under general anaesthesia , including tracheal intubation . therefore , we ensured that the time periods of anaesthesia and of operation are proportionally similar , enabling us to scrutinize the remaining three time periods ( preparation for surgery , recovery from anaesthesia , and transportation out of or ) for more obscure causes of delay . we deliberately omit a parameter studied by many others which is patients delay in entering the or . this was decided for two reasons : first because there is a standard practice the patient being transferred from the ward to wait in the or corridor , and second because the required time for transfer personnel to leave the or , go to the ward , and bring back the patient is not the same in the morning as for later cases ( unpublished data ) . in an effort to estimate the time needed for induction of anaesthesia , koenig et al . recorded a mean time of about 10 min needed for applying only a laryngeal mask , about 15 min for tracheal intubation only , and about 25 min for intubation plus arterial line ; the differences between the anaesthetic techniques regarding induction time are statistically significant , which are in line with our findings . in the same manner , in an audit of females subjected to gynaecology surgery , the time interval for induction of general anaesthesia ranged between 5 and 17 min in cases when anaesthesia was provided via only a peripheral vein . complex techniques involving nerve blocks or the placement of a central venous or an epidural catheter are likely to be more time consuming , which is why we excluded such cases from the study protocol . moreover , teaching or patient case mix might also influence the induction time , as does the individual anaesthetist 's performance level . even for experienced anaesthetists , it is often difficult to predict the duration of anaesthesia induction for a specific case . we should underline the fact that the time needed for induction to anesthesia was proportionally longer for simple compared to less simple procedures , which might be attributed to the involvement of younger , less experienced trainees in simple cases versus more skillful trainees for major surgery . additionally , in several cases , central venous or radial artery catheter insertion was carried out simultaneously following tracheal intubation , thus ensuring some minutes being saved over the total operation time . in any case , process time might be influenced by the performance level of the individual anaesthetist , or by other specific factors such as shortage of instruments or of staff . concerning time for surgery preparation , mazzei reported that surgical incision in an academic hospital was performed 21 to 49 min after the patient was brought into the or . this time interval is comprised of the time for induction to anaesthesia ( 8 to 32 min ) and the surgical preparation time required for the various surgical procedures , which is estimated to be about 20 min . delays in that time period could be mainly attributed to system deficiencies [ 3 , 10 ] , such as technical errors or equipment inefficiency , contamination of instruments or drapes required , failure in communication between members of the operating team , or defects in the staff performance [ 21 , 22 ] . it is of interest to comment that , in our material , the time needed for major surgery preparation was statistically longer , not proportionally analogous to the preparation needed for minor surgery . in other words , while it might be well accepted that the time needed for patient preparation for abdominoperineal colonic resection should be more than double compared to the time for inguinal hernia repair , this is not our case . it is an easy case ; let us relax a little , delay preparation of the or and the patient and to assistants who lose time in a similar way . these slightly odd findings have led us to suggest the existence of differences between the personnel involved , for instance , more capable and qualified nurses in major operations . saha et al . in gynecological procedures recorded a median interval of 148 min from transportation to or preoperatively up to pacu postoperatively , the performance of the surgery itself having taken up the largest slice of this time interval ( median 81 min ) . broadly speaking , teaching and university hospitals in general were found to have much higher cancellation rates , and the intervention of residents should be one of the main causes of or time prolongation and thus case cancellation . it is of interest to note the fact that the presence or participation of a resident physician was found to prolong the duration of surgery by up to 70% , with accordingly increased costs [ 23 , 24 ] , while the teaching of an anaesthesia resident seems to delay the anaesthesia procedure by 2 - 3 min [ 24 , 25 ] . our centre is a teaching hospital and the duration of operations might be influenced by the need to train , as the time of anaesthesia induction do . however , the performance time for each individual operation does not exceed the time reported by others , although this is not the topic of the present research . time for recovery from anaesthesia is a little obscure , since in the group of major interventions the complicated cases were moved to the icu for extubation ; thus the time spent in or was shorter , and consequently the difference between them and those of minor surgery appeared not to be as significant as it was expected . in a similar clinical setting and in accordance with our findings for minor and medium surgical impact operations , the reported wake - up times ranged between 5 and 11 min . however , in cases undergoing major surgery , the time for recovery from anesthesia was relatively prolonged , as the emersion of clinical implications necessitates the provision of a smoother and better - controlled reverse from anaesthesia . nevertheless , by leaving the patient to take his time for recovery , the available time for the following operation is considerably deteriorated , a situation which , in certain situations , entails possible cancellation of the remaining cases of the surgical list of the day . to deal with this issue several investigators suggested proper titration of anesthetic agents , guided by monitoring of depth of hypnosis , to thus minimize anesthesia - controlled time , as well as to apply a laryngeal airway mask instead of an endotracheal tube , as appropriate [ 24 , 26 ] . for further promoting the effective usage of or time , saha et al . proposed two anaesthetists to be available at the end of surgery ; one for the anaesthesia reverse and the other for the next anaesthesia induction , as well as a recovery area being available with sufficient capacity to accept postoperative patients without delay . nevertheless , existing data report that , by providing an extra anaesthetist and anaesthetic nurse , the midlist gap times are successfully reduced by 20% , but adding an extra case overruns the time by 118% more than greater gaps did . finally , transporting the patient from or to the pacu or icu takes about the same time as for recovery from anaesthesia , the shorter time attributed to minor surgical impact procedures . this may be partially explained by the fact that , in order to avoid waiting for the porter especially if the case is the last on the list , the assistants / residents move the patient by themselves . we can , here , underline the lack of transfer personnel , who may , sometimes , take up to half an hour to arrive , leading to a considerable or time waste between operations . extrapolate their results to a typical 4 h operating theatre session consisting of three to four procedures , reporting up to 60 min of the surgeons ' time being lost while waiting between cases . their results are to some extent consistent with the study by hopkins et al . involving patients undergoing ear - nose - throat surgery , concluding that almost one - third of the delay during surgical lists can be attributed to improper organized portering service . estimated that the cost of nursing and or attendants for each 10-minute delay approximated $ 18 , based on the current hourly pay rate for both , and for a mean rate of 135 delays per year this was translated to $ 2430 annually for a single or . by assuming that the other ors had a similar prevalence of delays , they extrapolated the cost to the entire surgical department , calculating a total cost because of delays of about $ 138 857 per year . firstly , our study population represents a specific study group limited to those undergoing elective general surgery procedures operated in a large teaching hospital . secondly , an established classification of the system delays is still lacking , which limits the comparable validation of our findings to those incorporated from similar clinical settings . albeit our study was performed in an teaching university hospital for both surgeons and anaesthetists , as well as for nurses , the time intervals of five typical stages of or time utilization concerning the most ordinary elective operations in general surgery ranged within acceptable limits , being comparable to the time estimates of published operating lists . special emphasis towards improvement of or time efficiency and outliers elimination should be paid on a sound organizational structure of transfer personnel service in conjunction to the augmented availability of anaesthesia providers and interdisciplinary collaboration .

although it is difficult for a pair of hematologists / oncologists to admit , cardiologists teamed with public health aficionados and pharmaceutical companies have made a huge dent in the death and disability rates induced by atherosclerosis and coronary artery disease ( cad ) . the relatively puny successes of our brethren in oncology pale by comparison ( although we have definitely turned the corner ) . in this month 's musings , much of the success in atherosclerosis and cad has derived from changes in life style that have been informed by increasing awareness of the risks of saturated fat and cholesterol in the diet and a better understanding of the hazards of diabetes , obesity , hypertension and smoking cancer incidence is only slightly influenced by diet and not all by hypertension , but obesity influences cancer incidence and over 30% of cancer incidence is due to tobacco use . furthermore , hypertensive heart disease , cad and cancer are particularly dangerous illnesses in african americans , which strongly supports a genetic basis for both diseases . although the role of cholesterol in the genesis of atherosclerosis and cad seems obvious today , the pathway to that recognition has been littered with obstacles . confusion about the primary ( and indeed uniquely essential ) role of plasma cholesterol levels in the genesis of cad stems from misinterpretation of the results of the framingham heart study . the overlap of cholesterol levels in individuals who did or did not have cad prompted william castelli , an experienced observer , to state : ' cholesterol levels by themselves reveal little about a patient 's coronary artery disease risk ' . although castelli recognized that almost every individual with a blood cholesterol level greater than 300 mg per deciliter did have cad , he failed to note that no individual in the framingham cohort with a cholesterol level lower than 140 mg per deciliter developed cad . clearly , the problem we face is quite simple ; we accept cholesterol levels that induce a high risk of cad as ' normal ' . in fact , if one plots cad risk as a function of cholesterol level , a near - linear relationship emerges : the lower the cholesterol level and the longer the low level is maintained , the lower the risk . it is frustrating to read accounts in major journals that other factors , for example vague indices of inflammation such as c - reactive protein [ 4 - 6 ] , might have any important primary role in the pathogenesis of heart disease . it is certainly true , as demonstrated years ago by ross and agius , that invasion of the intimal cells of arteries by cholesterol is associated with macrophage activation , and the release of damaging cytokines within the intima would certainly result in inflammation of the vessel wall . atherosclerosis , through activation of macrophages , can actually cause ulcerating lesions in the great vessels . so inflammation clearly has a role , but positing that it has a primary role in the disorder is not supported by the data . atherosclerosis is a chronic disease that often begins in childhood when excess plasma low density lipoprotein ( ldl ) particles , consisting predominantly of cholesterol esters and a protein called apob100 , accumulate in plasma and spill over into vessel walls . approximately 70% of cholesterol absorbed from the diet or synthesized in the liver by 3-hydroxyl-3-methylglutaryl coenzyme a reductase ( hmgcoa reductase , the target of statins ) is carried in the circulation on ldl particles . these circulating particles deliver lipids to cell membranes via ldl receptors that dump the particles into lysosomes in which the cholesterol esters are processed and from which the free cholesterol is transferred to cell membranes . a paucity of lipoproteins leads to cholesterol deficiency in the cell membrane and concomitant cell deformity and dysfunction , the bassen - kornzweig syndrome . an excess of ldl production or a deficiency of lipoprotein receptors leads to accumulation of ldl - cholesterol particles in the circulation . the process of atherosclerosis is thus initiated . appallingly , cad is readily detectable in a high proportion of otherwise ' healthy ' teenage american males on a high - salt , high - fat , meat diet , just as rabbits fed cholesterol rapidly develop the disease . the rate and extent of atherosclerosis is therefore influenced by diet , and both are markedly accelerated by inactivating mutations in ldl receptor genes and mutations in the apob genes that interfere with the binding of ldl to the ldl receptor . african americans have a higher incidence and severity of heart disease than caucasian americans , even when diabetes , obesity and smoking are taken into account . but african americans with inactivating mutations of pcsk9 , a gene whose product inhibits the synthesis of ldl receptors , have much lower rates of heart disease , as defined by myocardial infarction , sudden death or need for revascularization . this recent observation provides overwhelming evidence that ldl - cholesterol levels are the key to cad . evidence of inflammation , such as increased serum levels of c - reactive protein , are a secondary consequence of atherosclerosis and may be of some predictive value in particular circumstances , but these are epiphenomena and therefore relatively unimportant . the high incidence of cad in diabetes is not entirely understood , but it is certainly related , at least in part , to cholesterol levels , and is perhaps enhanced by elevated triglycerides . it is tempting to propose that glycosylation of endothelial cells and/or macrophages may also have a role and may enhance atherosclerosis at any level of ldl , but that is purely speculative . far less speculative is the remarkable cell biological and biochemical link between cancer incidence and diabetes ( and thus cad ) recently discovered by danial , walensky and their colleagues . these investigators have observed that bad , an apoptosis promoting protein that contributes to cancer development when it is inactivated , has a major role in insulin production . a chemically stabilized peptide derived from bad stimulates glucokinase and thus insulin production in type 2 diabetic rodents and normalizes their glucose tolerance curves . the same gene is used to prevent cancer and diabetes with its concomitant cad , three of the most important diseases of mankind . furthermore , the study demonstrates that the chemically stabilized peptide approach may turn non - receptor proteins into drug targets . although enormous progress has been made in the management of the cad epidemic that has plagued ' developed ' societies since the 20th century and although new avenues of research are regularly opening , we remain troubled by a vexing problem . if cad does not occur below an ldl cholesterol level of 140 mg / deciliter , why do we fail to maintain our citizens as close to that level as reasonable by diet if possible and with statins if not ? cad : coronary artery disease ; hmgcoa : 3-hydroxyl-3-methylglutaryl coenzyme a reductase ; ldl : low density lipoprotein . the authors are grateful to helen h hobbs and joseph l goldstein for their critique and assistance .

a 48-year - old presented to the emergency department with a 4-week history of inflamed scrotum . his scrotum was edematous and erythematous with well - delineated black necrotic areas ( fig.1 ) . the patient was given broad - spectrum antibiotics and iv fluids and referred to urology urgently . fournier gangrene is a rapidly progressive necrotizing infection of the perineal and genital fascia , often polymicrobial . in most infections a cutaneous , urethral or rectal source severity is increased in older patients , diabetics and the immunocompromised 1,2 . as in this case management options include resuscitative measures , broad - spectrum antibiotics , and surgical debridement 1,2 .

geriatric medicine or clinical gerontology , as a branch of medical sciences specifically deals with health problems as well as care and treatment of older people . becoming a prominent issue , this branch aims to improve function , overcome environmental problems and keep older adults healthy in normal activities . since the population of older adults is increasing even two to three fold during the first century of this millennium , attempts to improve the aspects of geriatric medicine is enhanced . geriatric patients are defined as a group of patients over 65 years , but frail with multiple comorbidities and various functional impairments . excessive decline in body mass , reduction in walking performance and presence of exhaustion as well as fatigue in addition to these conditions , geriatric persons also suffer from different chronic diseases that affect their life . as a natural and universal process , these changes encompass progressive decrease in physiological functions and increase in disabilities . this gradual decline affected by dietary , environment , life - style and genetic factors . accordingly various medications need to be considered for this period of age and also older adults are the major user group of medications . however , it should be noted that the medical approach can hardly help the elderly people alone and additionally other aspects of management are needed to be considered . therefore , complementary and integrative medical and pharmacological approaches can be beneficial in the improvement of geriatric medicine . various traditional and complementary systems of medicine such as unani , indian , chinese and persian have been contributed to the promotion of medical sciences . many documents containing information on geriatric medicine can be found from these systems of medicine . medical manuscripts authored by medieval persian practitioners , which are not only a summation of other traditional medical systems information , but also a collection of their own experiences involve beneficial findings about geriatric medicine . in this regard , present paper attempted to draw together medieval pharmacological information and those recommended treatments related to geriatric medicine from some of the most often manuscripts of traditional persian medicine ( tpm ) . the employed study method of the present paper was based on the investigation of the remaining manuscripts of persian medicine during 10 - 18 century ad . therefore , pharmacological information related to geriatric medicine was collected by searching through six important pharmacopeias of persian medicine . these manuscripts are liber continents by rhazes ( 9 and 10 centuries ) , alabnieh an haghaegh - ol - advieh by aboo mansour heravi ( 11 century ) , the canon of medicine by avicenna ( 10 and 11 centuries ) , ikhtiyarat - e - badiyee by zein al - din attar ansari shirazi ( 14 century ) , tohfat ol moemenin by mohammad tonkaboni ( 17 century ) and makhzan- ol - advieh by aghili - shirazi ( 18 century ) . in addition , some medical textbooks of medieval persian medicine were also studied to derive traditional important facts for older adults . other books such as matching the old medicinal plant names with scientific terminology , dictionary of medicinal plants , dictionary of iranian plant names , popular medicinal plants of iran , pharmacographia indica and indian medicinal plants were studied for nomenclature of medicinal plants . in persian medical manuscripts chapter related to geriatric medicine is generally mentioned under a subject namely tadbeer - e - mashayekh or elderly devise . there , the physiology of senescence is meticulously discussed in terms of principal fundamentals such as temperament , humors , spirits , faculties or forces and functions . accordingly , the last step is introduced as the old stage with is starting at the age of 60 . due to the fundamentals of humoral medicine , it was believed that people in the old ages have a cold and dry temperament and it bounds to change easily by extrinsic and intrinsic affecting factors . taken as a whole , persian practitioners believed that older adults should have light , easily digestible and a small amount of food at frequent intervals in their regimen . as constipation is more common and usual in the elderly , it was said that the bowels should be kept soft by the administration of mild laxative food or fruits such as chicken broth , honey , fig , plum and etc . , vegetables such as carrot and cabbage as well as fruits such as grapes and citruses have been also introduced beneficial . furthermore , boiled milk was defined as a proper meal for old people especially if it is associated with honey . in contrast fruits , food and additives such as eggplant , beef and vinegar should be used in low amounts . body massage , morning unctioning with popular oils such as olive , almond , lily and sesame oil as well as light exercise were highly recommended in persian manuscripts . in addition to these facts , persian scholars have recommended adequate sleep during the day and night for older adults . persian medieval scholars have recommended medicinal herbs in addition to routine dietary of an old patient . according to their recommendations , plants related to geriatric medicine are classified into tonic , anti - aging , appetizer , memory and mood enhancer , topical analgesic and laxative as well as health improvement agents . a total of 35 mentioned herbs regarding to twenty five plant families are derived from selected pharmacopeias of traditional medicine . the family rosaceae is the one which involves most cited medicinal plants related to geriatric medicine . applicable herbs of asteraceae , lamiaceae and fabaceae are cited subsequently [ table 1 ] . herbal geriatric remedies used in medieval persia it should be noted that a tremendous part related to geriatric medicine deals with preventive approaches . therefore , a large group of medications and supplements for the geriatric stage may be represented as anti - aging agents as well as health enhancers . according to the persian pharmaceutical manuscripts , cited medicinal plants are mostly mentioned to have anti - aging , health improvement and tonic effectiveness [ figure 1 ] . although the anti - aging activity of anti - oxidant agents are not well - accepted , but it is remarked that agents having antioxidant or immunomodulatory effects can be considered as anti - aging supplement . therefore , it seems that herbs , which were traditionally administered as anti - aging medicine or remarked to be a health improver [ table 1 ] may have antioxidant activity [ table 2 ] . in addition to anti - aging properties of antioxidant agent , they are also said to have memory enhancing as well as cholinesterase inhibitor properties . table 2 reports studies in line with clinical properties , which were traditionally introduced by persian practitioners as well . in this regard , most cited herbs exhibit antioxidant effects , which are followed by immunomodulatory and neuroprotective activity . meanwhile , most related investigations in contemporary medicine are carried out under an animal study method . only in two studies , therefore , further investigation is needed to be performed . pharmacological contribution of geriatric medicinal herbs reported by traditional persian medicine evaluation of herbs medieval properties using modern scientific methods obviously , there are many possible targets and available approaches related to tpm that might help to develop new and effective medical managements for geriatric medicine . as for other traditional systems of medicine , such information is based on centuries of experience in medieval persia and offers detailed explanations of the skillful approaches that show the importance of this field in medieval medicine . beside historical elucidation , this paper presents medical and pharmacological approaches that medieval persian practitioners applied to deal with geriatric complications . considering the hopeful results related to these medieval findings through scientific methods can help to carry out more comprehensive and effective investigations in the field of geriatric medicine .

lesions in the central area ( intracanal lesions ) have traditionally been managed through a standard interlaminar approach . lesions in the lateral area ( foraminal lesions ) occasionally involve the exiting ( upper ) nerve root within the neuroforamen and exposed through an extraspinal intertransverse approach6151618 ) . spinal stenosis or herniated nucleus pulposus ( hnp ) extending into both the intracanal and foraminal areas causes the development of biradicular symptoms , and several authors managed such conditions by performing a medial facetectomy or a total facetectomy47 ) . medial facetectomy has the drawback of controlling the neuroforamen on one side alone ; thus , the presence of disc remnants within or outside the foramen can not be excluded17 ) . additional partial facet removal in a lateral direction can lead to instability , and sometimes fusion surgery is required13 ) . therefore , several surgeons perform total facetectomy with fusion surgery for lesions existing in both the intracanal and foraminal areas as the proper treatment41216 ) . this sporadically reported approach has the advantage of allowing the foramen to be inspected on both sides , and of being a more time- and cost - saving procedure than total facetectomy with fusion surgery . in this study , we report our experience with a combined interlaminar and paraisthmic approach for lesions existing in both the intracanal and foraminal areas . the objective of this study was to describe the usefulness and outcome of the combined interlaminar and paraisthmic approach and to analyze the cause of poor outcome . between april 2009 and april 2014 , 78 patients ( 42 males and 36 females ) with intracanal and foraminal stenosis or herniated nucleus pulposus ( hnp ) were enrolled in this study ( table 1 ) . patients with a vacuum disc , spondylolisthesis , instability , or an isthmic defect on the preoperative dynamic view radiograph were excluded from this study . all patients underwent surgery through a combined interlaminar and paraisthmic approach for discectomy and decompression . the average age of the patients was 67 years ( range 33 - 82 years ) . advanced imaging evaluations such as computed tomography ( ct ) and magnetic resonance imaging ( mri ) were taken for the preoperative diagnosis of the intracanal and foraminal lesions . the ct images were reconstructed into parasagittal images of the foramen , and allowed the detection of bony encroachment into the foramen . the parasagittal and axial magnetic resonance images were evaluated for the presence of intracanal and foraminal lesions ( fig . a reduced size of the foramen and obliteration of epidural fat surrounding the exiting nerve root were considered as evidence of significant foraminal stenosis . postoperative serial dynamic view radiographs were taken to evaluate the development of instability or isthmic defect . the clinical outcome of surgery was evaluated and classified into excellent , good , fair , and poor , on the basis of modified odom 's criteria ( table 2 ) . the first step in the operation is the standard interlaminar approach to the intracanal lesions . a c - arm fluoroscope is used to verify the correct position of the incision . after the incision , the lumbodorsal fascia is detached bluntly from the attachment to the spinous process . erector spinae muscles at the involved level are dissected subperiosteally from the spinous process and lamina . after the application of a caspar microlumbar discectomy retractor , partial laminectomy and decompression of the intracanal area are performed . in the second part of the operation , the paravertebral muscle is retracted further laterally to visualize the lateral border of the isthmus and the upper portion of the facet joint . with a high - speed drill , the uppermost part of the facet joint and the lateral margin of the isthmus are drilled . then , the intertransverse and foraminal ligaments are excised to expose the lesion lateral to the foramen . sufficient nerve root decompression must be carefully confirmed by using a foraminal probe . with this combined approach , it is possible to maintain the integrity of the facet joint and obtain sufficient exploration and decompression of the foramen ( fig . the first step in the operation is the standard interlaminar approach to the intracanal lesions . a c - arm fluoroscope is used to verify the correct position of the incision . after the incision , the lumbodorsal fascia is detached bluntly from the attachment to the spinous process . erector spinae muscles at the involved level are dissected subperiosteally from the spinous process and lamina . after the application of a caspar microlumbar discectomy retractor , partial laminectomy and decompression of the intracanal area are performed . in the second part of the operation , the paravertebral muscle is retracted further laterally to visualize the lateral border of the isthmus and the upper portion of the facet joint . with a high - speed drill , the uppermost part of the facet joint and the lateral margin of the isthmus are drilled . then , the intertransverse and foraminal ligaments are excised to expose the lesion lateral to the foramen . sufficient nerve root decompression must be carefully confirmed by using a foraminal probe . with this combined approach , it is possible to maintain the integrity of the facet joint and obtain sufficient exploration and decompression of the foramen ( fig . all 78 patients complained severe radicular leg pain , and 55 patients had combined back pain . the levels involved in the operation were l2 - 3 ( 2 patients ) , l3 - 4 ( 10 patients ) , l4 - 5 ( 51 patients ) , and l5-s1 ( 15 patients ) ( table 3 ) . the outcomes based on modified odom 's criteria were excellent in 53 patients , good in 9 , fair in 6 , and poor in 10 during the follow - up ( table 4 ) . lumbar dynamic view radiography was performed in all patients at various times after the surgery , and instability was found in five patients and isthmus fracture was found in six patients . however , no patients required revision surgery for poor outcome . in the poor outcome group , three patients complained of early - onset relapsed pain ( < 1 month ) , and the cause of pain was a technical error related to insufficient foraminal decompression . another seven patients complained of delayed - onset pain ( 3 months after the operation ) , and the pain was due to recurrent herniated nucleus pulposus and adhesion . patients with early - onset pain underwent fusion surgery for a wider decompression , and four patients with delayed - onset relapsed pain underwent revision discectomy and adhesiolysis ; however , the remaining three patients did not return to our hospital for revision surgery ( table 5 ) . all seven patients who underwent revision surgery showed improvement at the last follow - up . lesions that extend to the intracanal and foraminal areas can cause double radicular compression17 ) . such lesions are difficult to treat with surgery . for lesions in the foraminal or the extraforaminal area , many authors perform decompression surgery with an extraspinal intertransverse approach ; however , this approach only allows the exiting nerve root to be decompressed1920 ) . some authors continue to perform surgery with the anatomically familiar posterior midline interlaminar approach to decompress the intracanal and intervertebral foramen157 ) . however , it is possible for unremoved disc fragments to remain within or outside the foramen , and if medial facetectomy is performed aggressively to have sufficient control over the foramen , it can cause instability4912 ) . although total facetectomy is recommended as an appropriate approach for foraminal decompression , revision fusion surgery is sometimes required because instability can occur47912 ) . even if facet joint destruction does not cause acute instability , total facetectomy can modify the axial loading path in the three columns of the spine , and cause postoperative lower - back pain due to degeneration in the adjacent disco - ligamentous structures9 ) . for this reason , some authors believe that fusion surgery is necessary when a total facetectomy is performed412 ) . however , fusion surgery costs more , results in a higher amount of blood loss , and requires a longer surgery time and hospital stay than decompression surgery23 ) . and it is well known that the fusion surgery may accelerate degenerative process in the adjacent disco - ligamentous structures14 ) . the combined - approach surgery makes it possible to completely control the neuroforamen and confirm the full extent of disc herniation in the surgical field of view1114 ) . additionally , this approach allows accessing the upper and lower nerve roots without destroying the facet joint or affecting spinal stability410111417 ) . in this combined - approach surgery , laminectomy is first performed with an interlaminar approach , and after the traversing nerve root is confirmed , the intracanal lesion is treated . in the process , the proximal portion of the exiting nerve root is confirmed during laminectomy , which can be helpful when the root is confirmed in the foramen17 ) . next , a paraisthmic approach is performed to access outside of foramen along the laminar , which provides the surgeon an anatomically familiar surgical field of view . when the lateral portion of the isthmus and the uppermost part of the facet joint are drilled , and the exposed intertransverse and foraminal ligaments are dissected , the exiting nerve root surrounded by adipose tissues can be confirmed , as well as the foraminal lesion . even in patients with severe foraminal stenosis , movement of the proximal portion of the exiting nerve root thus , when the surgeon moves the proximal portion of the exiting nerve root while observing the extraforaminal area , the surgeon can accurately ascertain the relation between the lesion and the root17 ) . in our study with a combined interlaminar and paraisthmic approach , the advantages of this surgical approach are that the facet joint is saved and instability is prevented . however , in 11 patients , we confirmed isthmus fracture or instability on postoperative dynamic view radiographs , and we think that this may be because the wide resection performed to achieve sufficient decompression could have weakened the facet joint or the isthmus . most patients were asymptomatic , and the problem did not require revision surgery in any of these cases . in 10 patients with poor outcome , the age , sex , or surgery level was not statistically significant . but follow - up ct or mri imaging showed a technical error such as insufficient foraminal decompression in three patients with early - onset relapsed pain ( < 1 month ) . of seven patients with delayed - onset pain , four had recurrent hnp or adhesion , and three were lost to follow - up . thus , to improve surgical outcomes , an effort should be made to reduce technical errors . although isthmus fracture or instability does not manifest in the first year , degenerative changes may occur with time and cause pain in the future . therefore , for an accurate prognosis , a larger number of patients and a longer followup would be needed . overall , we think that surgery with this approach may be useful if selectively performed on patients whose facet joint is relatively intact , and that it is worthy of consideration as an alternative to fusion surgery ; however , further studies are needed . the outcome of the combined interlaminar and paraisthmic approach was excellent to fair in 87%(68 of 78 ) patients in our study . it is a useful management method for select patients who have lesions that occur in both the intracanal and foraminal areas , and we think that it is a worthy alternative to total facetectomy with fusion surgery . the procedure allows sufficient foramen exploration with a minimally invasive approach , and preserves the integrity of the facet joint . we believe that improved surgical outcome can be attained if efforts are made to achieve sufficient foraminal decompression . a longer follow - up on a large series of patients is needed .

age - related macular degeneration ( amd ) is the leading cause of irreversible visual impairment and disability among the elderly worldwide , and amd currently affects almost two - thirds of the population over 80 years old [ 1 , 2 ] . moreover , amd is the main cause of blindness , and 1018% of individuals between 65 and 75 have lost some central vision as a result of amd . moreover , indeed , in the usa , it was estimated that a 50% increase in the number of affected individuals will be observed between 2004 and 2020 . the two major types of amd are exudative or neovascular ( wet ) form and nonexudative ( dry ) amd . although most patients with amd suffer from the dry , nonexudative form of the disease , approximately 1015% of the amd cases are the exudative type . the earliest clinical manifestation and pathological feature of amd is the development of extracellular deposits called drusen located inside bruch 's membrane ( bm ) and beneath the retinal pigment epithelium ( rpe ) . a few small drusen can be found in healthy individuals over age 50 , but the presence of large or numerous drusen is a risk for amd . the early stage of dry amd is also characterized by pigmentary abnormalities in the macula . in more advanced stages of dry amd , patients experience a loss in rpe and thinning of the photoreceptor layer in the macula , leading to retinal atrophy and surrounding tissue death in a process known as geographic atrophy ( ga ) . the wet form of amd is characterized by choroidal neovascularization ( cnv ) , which is the growth of abnormal blood vessels from the choroid underneath the macula . the abnormal blood vessels eventually result in a disciform scar , leading to permanent loss of central vision . despite intensive basic and clinical research , however , a growing body of evidence indicates that amd is likely a multifactorial , progressive disease that involves complex interactions between genetic and environmental factors . it is widely accepted that inflammatory and immunologic events might play a role in amd . during the last decade , convincing evidence has emerged implicating the complement system ( cs ) in amd pathogenesis . initially , several cs factors , their activators , and complement regulatory proteins were identified as cardinal constituents of drusen , the hallmark extracellular retinal deposits associated with early amd . moreover , genetic studies revealed statistically significant associations between amd and polymorphisms of several complement pathway - associated genes . finally , the abnormal concentrations of primary complement factors and their activated products have been observed in the circulation of amd patients . nevertheless , ultimate studies also demonstrate that the absence of complement components is deleterious to retinal homeostasis . thus , cs is increasingly recognized as mediating an important role in retinal biology . in this review , a short summary of the function of the complement system in retinal tissue will be followed by a discussion on the positive and detrimental roles of complement system in degenerative retina that considers how the diverse functions of cs may promote or inhibit amd disease . the complement system , an integral part of the humoral immune system , is involved in tissue inflammation , cell opsonization , and cytolysis , not only protecting against microorganisms but also mediating the clearance of exogenous and endogenous cellular debris from the host tissues . therefore , cs functionality is extremely important for the maintenance of cellular integrity , tissue homeostasis , and temporal modifications of the adaptive immune responses of the organism . all of the pathways ultimately end in the central cleavage of c3 factor and in the generation of its active fragments c3a and c3b . c3a is the anaphylatoxin that triggers a range of chemotactic and proinflammatory responses , such as recruitment of inflammatory cells and increased microvasculature permeability , whereas c3b is responsible for opsonization of foreign surfaces covalently attached to c3b ( see figure 1 ) . opsonization with activated c3 fragments ( c3b and ic3b ) fulfils three major functions : ( i ) cell debris elimination by phagocytic cells ( e.g. , macrophages or microglia ) and the stimulation of the adaptive immune system ( b and t cells ) ; ( ii ) amplification of complement activation via the formation of a surface - bound c3 convertase ; and ( iii ) assemblage of the c5 convertase . the latter event is responsible for c5 cleavage , which results in the formation of the cytolytic membrane attack complex ( mac ) capable of generating perforations in the cell membrane , thereby promoting cell lysis and the elimination of unnecessary cells . through all of these activities , the innate complement cascade supports and promotes the function of downstream mechanisms of the immune system that protect the integrity of the host tissue . overall , cs pathway activation results in a proinflammatory response , including mac generation , which mediates cell lysis , the release of chemokines to attract inflammatory cells to the site of damage , and the enhancement of capillary permeability to promote extravasation of infiltrating leukocytes . under physiological conditions , complement activation is effectively controlled by the coordinated action of soluble and membrane - associated complement regulatory molecules ( crms ) . soluble complement regulators , such as c1-inhibitor , anaphylatoxins inhibitor , c4b binding protein ( c4bp ) , complement factor h ( cfh ) , complement factor i ( cfi ) , clusterin , and vitronectin , restrict the action of complement in human tissues at multiple sites of the cascade reaction ( see figure 1 ) . in addition , each individual cell is protected against the attack of homologous complement by surface proteins , such as the complement receptor 1 ( cr1 , cd35 ) , the membrane cofactor protein ( cd46 ) , and glycosylphosphatidylinositol - anchored proteins , such as decay - accelerating factor ( cd55 ) or cd59 molecule . of note , host cells and tissues that are inadequately protected from complement attack might be subjected to bystander cell lysis . in recent times , the identification and characterization of the local complement system in the rpe - choroid - neurosensory retina complex empowered our knowledge regarding the biological complexity of the role of the complement system in ocular tissues , specifically in the retina . identification of the complement - related protein profile of different parts of the eye permits distinguishing the physiological and pathological features of the ocular tissues in case of disease development . the main components of the complement system , including c3 , c5 , and the mac complex , are normally present in the capillary vessels of the choroid and the vitreous of human eyes [ 1417 ] . interestingly , anderson et al . revealed that the predominant cellular source(s ) for most classical and alternative pathway components , including the shared c3 factor , reside(s ) in the choroid rather than in the rpe or neural retina . in addition , they also performed a detailed analysis of the localization in the neurosensory retina , rpe , and choroid of several crms important for prevention of excessive complement activation . accordingly , it was found that cfh immunolabelling was confined primarily to the choriocapillaris and intercapillary pillars and cd55 immunoreactivity was limited to the inner aspect of choroidal capillaries . in addition , cfb immunolabelling was localized throughout the choroid and was also associated with the luminal surfaces of choroidal endothelial cells . in contrast , cfi labelling was highest in the inner retina and relatively low in the choroid , and cfd labelling appeared to be diffusely distributed throughout the entire neural retina and choroid . with regard to the three terminal pathway inhibitors ( clusterin , vitronectin , and cd59 ) , their expression levels were similar in the choroid and rpe ; however , the neural retina displayed comparable levels of both clusterin and vitronectin but little detectable cd59 . anderson et al . also determined that the membrane - bound complement regulatory molecule cd46 , which is an inhibitor of the alternative pathway , displays the robust levels of transcription in the choroid , rpe , and neural retina . in addition , intense cd46 protein immunoreactivity was observed along the basolateral surface of the rpe cells and , to a lesser extent , on the luminal surface of choroidal endothelial cells . the authors of this complex and detailed study concluded that cs activators and inhibitors are abundantly expressed by resident cells of the choroid tissue , whereas the presence of cs activators and inhibitors in both neural retina and rpe is limited to a subset of particular inhibitors of the alternative ( cd46 , cd55 , cfh , and cfi ) and terminal ( clusterin , vitronectin , and cd59 ) pathways . in summary , the characteristic profile of retinal expression of selected crms may be relevant in regulating local inflammatory processes in different parts of retinal tissue . moreover , the pathological age - related changes in the expression of selected crms , especially in neural retina and rpe , may predispose to complement - mediated inflammation , and it might be an important factor for amd pathogenesis . in this notion , a great body of evidence suggests that complement activation is augmented in retinal tissue with age . in vivo , the increased expression of nine different cs factors was observed in rpe / choroid complexes collected from aged mice . moreover , the tissue localization of c3 was different in young and old animals , revealing possible disturbances in the functional integrity of rpe / bm complex as a result of aging . likewise , upon analysis of the transcriptome of human rpe collected from aged healthy subjects , it was found that the rpe highly expresses genes of the complement cascade ( e.g. , c3 , cfb , cfh , htra1 , cst3 , and fbln5 ) . it was also observed that basal cs activation in cultured rpe cells increases steadily with age . concurrently , this activation stimulates the age - induced response of augmented synthesis of endogenous crms , such as cfh [ 21 , 22 ] or cfb . moreover , kociok and joussen observed that human rpe cells that are stimulated to proliferate in culture conditions express crms , such as cfh and cfi , at the mrna and protein levels . interestingly , in cultured human and murine rpe cells , the membrane - bound crms , such as cd46 , cd55 , and cd59 , were also shown to be specifically upregulated by inflammatory cytokines , including ifn- , tnf- , and il-1 , as well as by repetitive nonlethal exposure to oxidative stress . this phenomenon seems to be especially important as protective mechanism in the natural aging of the retina as well as in retinal age - related diseases . moreover , analysis of expression levels of various crms indicated that cd59a mrna and protein were more abundant in the murine eyecups than in nonocular tissues , suggesting that cd59a may play an important role in protecting the mouse posterior segment from complement - mediated injury . similarly , the importance of retinal expression of cd59a has also been reported in the mouse model of laser - induced choroidal neovascularization . interestingly , recombinant cfh protein induced dose - dependent chemotactic migration of human rpe cells towards the increasing cfh concentration gradient . overall , the upregulation of complement inhibitors in retinal tissue observed in vivo and in vitro may indicate the body 's natural attempt to restore biological balance to the augmented immune responses in physiological mechanisms , such as aging . however , several of the regulatory mechanisms described above may be overwhelmed when the cs is improperly activated , resulting in tissue destruction and degenerative disease processes , such as amd . importantly , the pathological effects of cs are mediated by precisely the same mediators responsible for the cs 's well - known protective roles . therefore , we hypothesize that different cs components play dual roles , that is , positive , if they protect the tissue against injury , and negative , if they produce tissue damage due to local inflammatory reactions mediated by activated cs components and their products . for example , the mac complex is responsible for proteolysis of cellular debris , but it may injure other living cells if increased amounts of mac have been deposited in a particular tissue . on the other hand , the deposition of mac at sublytic concentrations has been associated with the inhibition of apoptosis through enhanced synthesis of bcl-2 and inhibition of caspase-3 activation . low concentrations of mac also induce prosurvival signals in schwann cells through phosphatidylinositol-3-kinase - mediated phosphorylation of bad or cell cycle activation in oligodendrocytes [ 27 , 28 ] . in conclusion , if unregulated , cs activation may directly damage host tissue and recruit immune cells to the vicinity of active complement cascade . therefore , the protection against complement is achieved through various crms that are widely expressed in and secreted to the retina . in particular , the choroid- and rpe - based regulation of the complement system activity play an important role in the eye . of note amd , a complex genetic disorder , is attributed to multiple genes and their modifications . single nucleotide polymorphic changes are considered normal variants of gene structure , which may protect or predispose to various conditions , including amd . the studies performed in american twins revealed that the heritability of amd , that is , the relative contribution of genetic and nongenetic factors to the phenotype , is estimated at a relatively high value of between 45% and 70% . it was also estimated that currently identified loci account for approximately 55% of amd heritability . recently , the international scientific group performed the multicenter meta - analysis involving more than 17 000 cases of amd and 60 000 control patients defining an association between amd and genetic variants in a total of 19 chromosomal regions . of note , it was observed that the same polymorphisms that are considered to be involved in the pathogenesis of early amd do not appear to influence the rate of progression of advanced amd , including cnv or ga . thus , the expression of certain genes may reveal both protective and detrimental characteristics , depending on the phase of the disease ( see table 1 ) . following the discovery that retinal drusen contain cs - related proteins , several reports appeared in 2005 and stated that the chromosomal region 1q31 that encodes cfh is a major susceptibility locus for amd according to whole - genome association analyses performed independently in three different cohorts [ 4547 ] . the cfhy402h allele ( rs1061170 , t > c ) in exon 9 of cfh confers a significantly increased risk of amd . c exhibited an increased risk of amd with an odds ratio ( or ) of 2.44.6 for a single copy and 3.37.4 for two copies of the variant allele . in general , this risk haplotype fails to recruit the inhibitory protein cfh to the sites where complement is activated by the accumulation of endogenous complement - activating compounds . recently , the r1210c cfh mutation has also been found to be associated with the early onset of amd . similarly , five different polymorphisms in the complement factor h - related gene 5 ( cfhr5 ) that encodes the inhibitory protein for c3b have been described and associated with an increased risk of amd . altogether , the complex gene family composed of cfh and cfhrs genes appears to be a genetic hotspot , where various genetic rearrangements have strong functional implications and result in the different disease - associated polymorphisms , including amd . this observation is attributed to the fact that the cfh and fhr proteins encoded by cfh and cfhrs genes closely collaborate to control complement activity in different cells and their deregulation induces tissue degeneration . in the following years , the selected candidate gene studies have also identified associations of complement - related genes with amd development and progression , including different variants of complement factor b ( cfb32q rs641153 ) , factor c3 ( c3102 g rs2230199 ) , factor cfi ( rs4698775 ) , or factors c4a or c4b , which both flank rs429608 locus [ 32 , 38 , 5759 ] . till now , the most consistent and significant association with amd risk was found in case of snp rs10490924 located in chromosome 10q26 , in the region of arms2 and htra1 genes . this risk variant is associated with a twofold increase in expressed htra1 protein , which activates both the alternative and classical complement pathways through elimination of several inhibitory crms . on the other hand , likewise , several studies provided a strong evidence for a protective role of selected haplotypes of complement factor h ( cfh ) characterized by a deletion of two additional members of the cfh gene family , such as the complement factor h - related genes 1 and 3 ( cfhr1 and cfhr3 ) [ 53 , 61 ] . moreover , cfhr1 appears to act downstream by modulating the activity of the c5 convertase and inhibiting mac formation . therefore , it has been proposed that the protective effect in amd conferred by the deletion of cfhr1/cfhr3 is mediated by removal of the c5a blockade and disinhibition of mac formation . this advantageous scenario potentially results in enhanced clearance of the cellular debris and drusen , which , if present , naturally promote the chronic local inflammatory state and subsequent atrophy of rpe in the macular area . this molecular finding suggests that the binding of various cfh - related fhr proteins and their capacity to regulate complement activity , directly or by competing with cfh , can be beneficial for neurosensory retina . of note additionally , the other cfh coding variant rs800292 ( i62v ) is also protective against amd . this snp is located in the second exon of cfh and results in the substitution of an isoleucine ( i ) amino acid instead of a valine ( v ) in the first domain of the protein . furthermore , the polymorphisms in other complement - related genes are also associated with decreased susceptibility to amd [ 34 , 37 , 64 ] . the good examples are complement factor b ( cfb ) and complement factor 2 ( c2 ) . although both of them aid in initiation of the alternative and the classical cs pathway , respectively , some specific haplotypes or individual snps in these genes showed a protective effect against amd . found that the r32q variant of cfb was significantly associated with protection from amd in the analyzed family - based data set . additionally , the same group found that three snps in c2 and cfb ( c2 e318d ; c2 rs547154 ; and cfb r32q ) were strongly associated with decreased risk of amd in the analyzed case - control data set . accordingly , a significant protective effect of genotype ct / tt in cfb r32q variant ( rs641153 ) for ga and a positive trend for reduced risk of cnv were observed when compared with cc genotype . similarly , an association of the cg / cc genotype ( versus gg ) in c2 e318d variant ( rs9332739 ) with protective effect against amd and ga development was reported . thus , several risk and protective haplotypes in the complement - related genes modify susceptibility to amd ; however , the detailed mechanisms by which different cs gene polymorphisms impact amd risk are not well known . moreover , numerous polymorphisms may act collectively , leading to local cs dysregulation resulting in pathological features in retinal tissue . thus , the performed genetic studies on selected cohorts of amd patients revealed that multiple genetic mutations are often required to induce the specific disease phenotype . nevertheless , the knowledge on the contribution of particular loci to amd genetic susceptibility is essential for understanding the potential biological mechanisms through which these variations modulate the development this complex retinal disease . interestingly , several genetically determined haplotypes identified in amd have specific patterns of complement activation and are associated with different plasma levels of individual complement components . for example , hecker et al . found that the high risk and neutral risk cfh locus haplotypes did not alter plasma levels of cs proteins , whereas the protective haplotype ( cfh402y ) decreases levels of ba and c3d components . similarly , the common risk haplotype spanning c2/cfb increased c3d levels , whereas the less common protective haplotypes decreased ba and c3d levels . finally , the nonsynonymous snp that is related to the high risk moreover , the extensive study of scholl et al . on systemic cs activation in amd patients showed that complement hyperactivation in the peripheral circulating blood provided increased prognostic predictive power compared with the simple genotypic analysis of the same patients . in conclusion , different complement - related genes and their variations displayed significantly strong associations with amd progression or a reduced risk of amd development . regarding the above findings , the complexities associated with amd genetics offer a challenging problem for understanding the molecular basis of amd and its subsequent management in patients . the complement system has been implicated in early amd pathogenesis based on the identification of cs components in drusen from eyes of amd patients . drusen are the focal deposits of extracellular debris located between the basal lamina of the rpe and bruch 's membrane ( bm ) . major drusen constituents include cellular debris , lipids , proteins , and lipoproteins [ 6870 ] . the structure and type of drusen significantly affect the rate of amd development and progression . in the last decade , multiple levels of significance have been ascribed to the molecules trapped or sequestered in drusen , including toxicity to the overlying rpe , extracellular enzymatic processing , impaired transport of molecules across the bm , induced extraretinal cellular invasion , and effectors of the pathological process affecting rpe survival and metabolism . in amd , at least 129 types of drusen - deposited proteins have been identified , including different apolipoprotein types ( e , b , or a - i ) , several amyloid peptides ( p , a , or sa-1 ) , timp-3 , serum albumin , and certain proteins associated with cellular function ( e.g. , atp synthase subunit , scavenger receptor b2 , and retinol dehydrogenase ) [ 69 , 72 ] . most importantly , amd - derived drusen also contain almost all of the complement proteins , including regulatory proteins ( cfh , vitronectin , and clusterin ) , the products of cs activation and degradation ( c1q , c3 , c3a , c3b , and c5a ) , and members of the terminal cs pathway comprising the mac components ( i.e. , 5 , 6 , 8 ( , , and ) , and 9 ) in the separated and complex form [ 14 , 69 ] . thus , one of the main hypotheses indicates that the accumulating drusen may activate the cs , trigger the local production of inflammatory mediators , and attract leukocytes that in turn augment the local inflammatory state . johnson et al . used a specific cell culture model of rpe cells to determine that exposure to human serum results in cs activation . this process is mediated by the classical cs pathway via binding of c1q to ligands in apolipoprotein e - rich deposits , thus triggering direct activation of complement by c1q with subsequent inflammatory sequelae . similarly , it was found that a deposits accumulated in drusen and colocalised with activated complement components . indeed , more than a decade ago , johnson et al . reported that the a is a potential activator of cs and contributes to atrophy of the retinal pigmented epithelium , drusen biogenesis , and amd pathogenesis . interestingly , c1q may have a potential role in the mechanism of drusen aggregation in the larger complexes , thus causing mechanical insult to the rpe as observed in amd - related ga . moreover , the direct treatment of arpe-19 cells with hydrogen peroxide , which strongly induces oxidative stress in vitro , reduces cell surface content of complement inhibitors , such as cd46 , cd55 , and cd59 . this finding suggests that rpe cells exposed to oxidative insult allow for complement activation on their surfaces . likewise , it was found that the cs components localized in drusen could induce inflammasome activation , thereby potentially promoting the negative cellular effects in the affected retinas . for example , doyle et al . found that c1q could activate the nlrp3 inflammasome locally in the retinas and activate tissue macrophages . these actions subsequently rupture lysosomes and release the proteolytic lysosomal content to the extracellular matrix , thereby damaging the surrounding normal cells . likewise , several studies have also identified the complement system as an important component of laser - induced cnv development [ 25 , 8083 ] . in particular , mac , the final product of the activated complement cascade , induces the release of growth factors , such as -fibroblast growth factor ( -fgf ) , vascular endothelial growth factor ( vegf ) , and platelet - derived growth factor ( pdgf ) , from various nucleated cells [ 80 , 84 ] . observed that systemic pharmacological blockade of the entire complement system as well as the selective complete depletion of c3 using c3/ knockout mice reduced the development of cnv ( from 98% in control mice to 35% in c3/ mice ) . the same group also observed strong mac deposition in the cnv complex exclusively in wild - type control mice ; in contrast , no mac staining in the laser spots was observed in whole complement - depleted mice or in c3/ mice . similarly , mice treated with an anti - c6 antibody that blocks the generation of mac complex displayed no visible mac complexes and a significantly reduced cnv process . moreover , bora and coworkers validated the neovascular role for mac in cnv formation in an in vivo study and revealed significant inhibition of cnv formation in c5-deficient mice ( c5/ ) . in addition , nozaki et al . found that c3a and c5a induce vegf expression in the mouse rpe in vitro and in vivo and thus may accelerate the model of neovascular amd . similarly , cashman et al . observed that the conditionally increased expression of c3 in rpe obtained by intraocular injection of an adenovirus - expressing murine c3 caused significant functional and anatomic changes in the retina , which reproduce many of the features characteristic of amd and other retinal diseases . in particular , exogenous expression of c3 induces both blood vessel leakiness and endothelial cell proliferation in the murine retina . finally , the c3-injected eyes displayed significantly reduced cone and rod function as measured by erg , and this reduction was consistent with the loss of photoreceptor segments . altogether , a growing body of evidence suggests that the cs pathways play a key role in the development of amd . complement system dysregulation in retina can lead to cell and tissue damage , which provokes the development of drusen acting as foci of chronic inflammation and subsequent cs activation . likewise , chronic inflammatory responses and cs activation play an unquestionable role in cnv development and vegf secretion . inflammation is often recalled in a negative light ; however , the inflammatory processes have evolved as an initial response to restore homeostasis after cellular injury , that is , to protect and promote a return to the status quo ante . therefore , the initial onset of inflammation is primarily beneficial to the host . in this condition , complement activation in retinal drusen appears to be a double - edged sword ; it can exacerbate tissue damage or promote cell survival and tissue remodeling by facilitating the rapid removal of dying cells and resulting cellular debris [ 86 , 87 ] . pisalyaput and tenner have recently reported that c1q , in the absence of other complement components , increases neuronal survival and neurite outgrowth compared with untreated neurons and protects against -amyloid - induced neurotoxicity in vitro . these researchers also identified the molecular mechanisms underlying the observed neuroprotective effects of c1q using microarray analysis . benoit and tenner found that c1q upregulates the expression of genes associated with neurite outgrowth ( stx3 ) and downregulates the expression of genes associated with inflammation as well as micrornas , including let-7c , microrna-410 , and microrna-497 , that specifically inhibit the expression of neurotrophic factors , such as nerve growth factor ( ngf ) and neurotrophin-3 ( nt-3 ) . thus , c1q , expressed by neurons in response to neurodegeneration or injury , may play a protective role by enhancing the clearance of apoptotic cells and providing direct protective effects on neurons . the demonstrated c1q - dependent neuroprotection suggests that c1q can induce a potent and novel neuroprotective mechanism in injured neurons . one potential neuroprotective activity of cs is indicated by the results of experiments performed on c3-deficient ( c3/ ) animals . maier et al . found that complete c3 deficiency leads to accelerated amyloid plaque deposition with animal aging and thus augments neurodegeneration . the authors conclude that the presence of c3 is potentially necessary for anti - inflammatory cytokine - mediated stimulated microglial phagocytosis of amyloid and other cellular debris . interestingly , recently published results indicate that deficiencies in the cs components ( such as c3 or cfh ) are deleterious to retinal physiologic state and function . kam et al . examined retinal function in 12-month - old ( c3/ ) mice compared with mice deficient in both c3 and cfh ( cfh/c3/ ) , only cfh ( cfh/ ) , and control wild - type mice . although all of the analyzed mutant mice displayed significant photoreceptor loss and thickening of bruch 's membrane compared with control mice , the c3/ strain presented significantly more a in bruch 's membrane , a reduced number of macrophages , and increased levels of retinal inflammation , including increased expression of inflammatory markers : tnf - alpha and calcitonin , compared with the other examined mice . importantly , the inflammatory process identified in the retinas of c3/ mice was even higher than that observed in cfh/ mice , which normally display uncontrolled c3 activation through the alternative cs pathway given the complete cfh deficiency . finally , the scanning electron microscope analysis revealed the excessive accumulation of fibrillary debris material on the photoreceptor outer segments . interestingly , abnormalities within neural retina ( e.g. , reduced electrophysiologic response , reduced photoreceptor number ) were significantly increased in mice with a combined deficiency of cfh and c3 than compared with mice with cfh or c3 deficiency alone . these data indicate that both cfh and c3 are required to maintain retinal physiological function and that active c3 protein mediates an important role in retinal biology . it is widely accepted that complement inhibition through c3ar blockade may be an effective mechanism for preventing or slowing amd progression [ 92 , 93 ] . however , various reports have demonstrated in vitro that c3a may act as an anti - inflammatory molecule by suppressing lps - induced secretion of tnf- , il-1 , and il-6 from human peripheral blood mononuclear cells and stimulated b lymphocytes as well as upregulate anti - inflammatory cytokine gene expression [ 94 , 95 ] . likewise , in nervous tissue , c3a induces substantial neuroprotective effects by inhibiting excitotoxicity - mediated neuronal death through astrocyte stimulation in mixed cultures of neurons and astrocytes [ 96 , 97 ] or stimulating microglia to produce neurotrophic growth factors . several groups postulate the c3a - dependent stimulation of microglial secretion of neurotrophins , such as ngf , that are involved in early stages of neuronal regeneration [ 97 , 98 ] . administration of c5a in vivo was also reported to protect against kainic acid - induced neuronal apoptosis . with regard to this notion , evidence suggests that c3ar and c5ar - induced signaling may be important for the normal retina to maintain its structure and function and may be involved in retinal repair and regeneration . c3ar and c5ar are the members of the class a subfamily 8 of g protein - coupled receptors ( gpcrs ) , and gpcrs signaling is highly important for cell growth , cell activity , and survival . although the gpcr signaling can vary across different cell types , the general physiologic outcome has prosurvival and antiapoptotic functions . indeed , the activation of c5ar in macrophages , dendritic cells , and neurons induces several important prosurvival pathways , such as mapk , pi3k - akt , nf-b , and camp response element - binding signaling [ 100102 ] . moreover , active c3ar induces the nf-b - dependent pathway in tubular epithelial cells and transcription factors activator protein-1 in glial cells . yu et al . recently reported that mice deficient in receptors for anaphylatoxins ( c3ar/ and/or c5ar/ ) presented abnormalities similar to c3/ mice , and they developed progressive retinal degeneration and retinal dysfunction . the erg a- and b - waves of c3ar/ and c3ar/c5ar/ mice were significantly reduced in 14-week - old animals , and this reduction progressed with increasing of age . furthermore , a progressive retinal cell loss of photoreceptors , bipolar cells , and horizontal cells was observed in c3ar/ mice . in particular , the number of rod bipolar cells was significantly decreased at 3 months and declined further at 14 months of age . it was proposed that apoptosis activation is primarily responsible for the retinal cell number decline as increased expression of activated caspase-3 and decreased nf-b activation were observed in retinal cells of c3ar/ and c3ar/c5ar/ mice . morphologic analysis by electron microscopy revealed that mice lacking c5ar or c3ar display shrunken rpe cell nuclei , clearly indicating intracellular rpe dysfunction in these mice . in addition , the normal structure of outer segment discs was lost in 6-month - old c3ar/c5ar/ mice . finally , based on performed biochemical studies , the authors indicate that c3ar may play an important role in protecting retinal cells from light - induced retinal degeneration through activation of the nf-b pathway . in light of the above findings , it is worth mentioning that the neuroprotective functions of c3a and c5a include protection against nmda- and glutamate - induced apoptosis via mapk - dependent inhibition of caspase 3 and regulation of glutamate receptor subunit-2 . this finding is an especially important concern in light of all the available data suggesting that mice lacking c3a and/or c5a signaling also display several abnormalities in nervous system and internal organ function , for example , anomalous susceptibility to neuroexcitotoxicity , abnormal differentiation and migration of neural progenitor cells , and abnormal neuron remyelination . with regard to the role of anaphylatoxins in neurogenesis , the receptors for c3a and c5a ( c3ar and c5ar , resp . ) mice treated with a nonspecific c3ar antagonist ( sb290157 ) displayed decreased formation of new neurons in areas of adult neurogenesis . altogether , the above results strongly indicate a continuous necessity for the active complement pathway in the normal maintenance of the neurosensory retina and robustly support the notion that disturbances in the physiological activation of cs may have detrimental effects for retinal biology . although deregulation or excessive activation of cs following neurodegenerative events has emerged as a major contributor to secondary tissue damage , numerous findings suggest that regular complement activation is a necessary part of normal physiological function of nervous tissue , including retinal cells . cs activation may possess a dual role in retinal structure and function as well as in the pathophysiology of retinal degenerative diseases , such as amd . to the best of our knowledge , this is the first comprehensive informative study that describes thoroughly the topic of dual role of cs in degeneration and protection of retinal tissue . on the one hand , the cs can have beneficial effects by facilitating phagocytosis and the removal of cellular debris and drusen components ; however , the cs can also be detrimental by causing bystander damage to surrounding cells and tissues . thus , it is very important to understand the roles of complement in tissue homeostasis and pathobiology of neural retina . given that cs is one of many important players in multifaceted configuration of cellular , humoral , and molecular factors regulating tissue homeostasis , its dual role in protecting and harming the retina depends on the entire pathophysiology accompanying amd development and progression . recently , strong progress has been made towards the translation of complement - based therapeutics into the clinic . the current complement therapies aim to inhibit complement activation to control inflammation ; however , the resulting concurrent loss of the nonclassical complement functions might be of great importance , particularly for degenerating neural retina . therefore , the complement inhibitors that advance to the clinic need to be carefully tailored and targeted to act only in those areas where complement activation needs to be controlled .

primary hypertension is the most common form of blood pressure elevation whose cause remains unknown . however , many factors have been implicated in its pathogenesis , such as the renin - angiotensin - aldosterone system and the sympathetic nervous system hyperactivation . in addition , changes in intracellular ions such as calcium , sodium , potassium , and magnesium have also been related to high blood pressure . in the last years , the prevalence of hypertension is around 2530% in developed countries , and several treatments have been proposed for the bp control and prevention of its onset . among the various studies concerning non - pharmacological treatments , there is need for lifestyle change with the inclusion of regular physical activity and healthy eating habits . observational studies have shown that a diet rich in potassium , magnesium , and calcium , present mainly in fruits and vegetables , is associated with lower incidence and mortality from cardiovascular disease . in particular , magnesium has been the target of many studies , considering that there is a significant inverse correlation between serum magnesium levels and incidence of cardiovascular diseases . in addition , hypertensive patients generally exhibit reduced intracellular concentrations of magnesium , while the contents of sodium and calcium are often increased compared to normotensive subjects [ 5 , 6 ] . the dietary recommendation ( recommended dietary allowances / rda ) for magnesium is 400 to 420 mg daily for adult men and 310 to 320 mg daily for adult women . however , consumption is far below this recommendation , and the high prevalence of this deficiency has been associated to several chronic diseases . leafy vegetables , nuts , whole grains , fruits , and legumes are considered as foods with high - magnesium concentrations . in order to gather more information about the association of magnesium with cardiovascular diseases , we performed a narrative review of the literature through the pubmed database with the following descriptor : magnesium , intracellular magnesium , hypertension , arterial stiffness , and endothelial function . we included narrative reviews , experimental protocols , and controlled studies in the last 15 years ( 19962011 ) , and case reports were excluded . the mineral magnesium is the second most abundant intracellular cation and is involved in several important biochemical reactions . it is known that magnesium has antiarrhythmic effect and can influence blood pressure levels by modulating vascular tone . changes in extracellular magnesium content are able to modify the production and release of nitric oxide ( no ) , resulting in the alteration of arterial smooth muscle tone by affecting calcium concentrations . , it has been suggested that magnesium deficiency or changes in its metabolism are related to the pathophysiology of hypertension , atherosclerosis , insulin resistance , and diabetes ( figure 1 ) . low intracellular magnesium concentrations stimulate inositol - trisphosphate-(ip3- ) mediated mobilization of intracellular calcium and reduce ca - atpase activity . thus , calcium efflux and sarcoplasmic reticular calcium reuptake are reduced , leading to cytosolic accumulation of calcium and increased intracellular calcium concentration , which is a crucial factor for vasoconstriction . the action of magnesium as a calcium channel blocker may also help to reduce the release of calcium and thus reducing vascular resistance . in addition , magnesium also activates the na - k atpase pump that controls the balance of these minerals contributing to the homeostasis of electrolytes in cells . smaller concentrations of magnesium seem to be associated with reduced serum hdl - cholesterol along with increased ldl - cholesterol and triglycerides levels . additionally , deficiency of this mineral has been previously related to oxidative stress , proinflammatory state , endothelial dysfunction , platelet aggregation , insulin resistance , and hyperglycemia . high levels of magnesium may increase production of adenosine triphosphate ( atp ) and intracellular glucose utilization , since magnesium acts as a cofactor of all reactions involving atp transfer . insulin seems to be one of the most important factors that regulate plasma and intracellular magnesium concentrations . it has been suggested that an atpase - dependent pump is involved in the mechanism by which insulin regulates the erythrocyte magnesium content . on the other hand , intracellular magnesium may play a role in modulating insulin - mediated glucose uptake and vascular tone . in fact , suppression of intracellular free magnesium concentrations is known to decrease cellular glucose utilization and thus to promote peripheral insulin resistance as a postreceptor defect . concerning insulin homeostasis , there is a hypothesis that there is increased secretion of insulin and adrenaline in hypomagnesemia in order to maintain magnesium and cellular camp ( 3,5-cyclic adenosine monophosphate ) concentration . furthermore , the intracellular concentration of magnesium appears to be dependent on the extracellular level , and its influx through calcium channel is voltage dependent . this inhibition does not occur when there is no magnesium in the extracellular space , resulting in higher insulin secretion . some studies suggest the possible role of intracellular magnesium on the activity as a regulator of the main communication channels of the cell membrane , suggesting that there may be an association between changes in intracellular content of ions induced by supplementation of magnesium and its antihypertensive effects . experimental models of hypertension have been associated with reduced serum and tissue levels of magnesium . in spontaneously hypertensive rats ( shrs ) , increase of blood pressure arises from the age of young adults , around 12 to 16 weeks of life , being attributed to a genetic component similar to human essential hypertension . in shr , and also in doca - salt model , reduced levels of intracellular magnesium have been noted in smooth muscle cells and cardiomyocytes . in fact , the effect of supplementation was only positive in younger animals , when started in the prehypertensive phase , preventing or at least attenuating the development of hypertension . this finding is highly suggestive of a more protective effect of supplemental magnesium , which may prevent or slow the rise in blood pressure at an early stage of hypertension . in other experimental studies , dietary magnesium deficiency was associated with increased blood pressure in previous normotensive animals , and magnesium supplementation was able to reverse this condition . however , clinical trials of magnesium supplementation in hypertensive patients show divergent results . some studies demonstrate low serum magnesium levels in hypertensive patients when compared with normotensive subjects , and blood pressure levels reduction after magnesium supplementation , for this reason , while adequate intake of magnesium through diet is recommended , supplementation of this mineral is not indicated as part of antihypertensive treatment [ 22 , 23 ] . experimental , clinical , and epidemiological studies have observed a close inverse relationship between dietary intake or supplementation of magnesium and blood pressure level , indicating the potential role of magnesium deficiency in the pathogenesis of essential hypertension , but the mechanism is unclear . the effects of magnesium on the smooth muscle cells growth and inflammation may be important . a relationship has also been reported between the rennin - angiotensin system , magnesium , and blood pressure . hypertensive patients with high renin activity have significantly lower serum magnesium levels than normotensive subjects , and plasma renin activity is inversely associated with serum magnesium . hatzistavri and colleagues have shown that magnesium supplementation was associated with slight reduction of 24 h blood pressure levels in patients with mild hypertension , which can be evaluated by ambulatory blood pressure monitoring . on the other hand , a study comparing the relationship between serum magnesium , vascular dysfunction , hypertension , and atherosclerosis has not shown enough results to support this association , indicating that low serum magnesium can not be considered a risk factor for development of these conditions . some studies have shown the independent prognostic role of arterial stiffness in cardiovascular events in hypertensive patients , which can be assessed by measurements of the pulse wave velocity ( pwv ) [ 3335 ] . however , there are a few studies showing the influence of magnesium in this condition so far . van laecke and colleagues have reported that serum hypomagnesemia associated with hypertension , endothelial dysfunction , dyslipidemia , and inflammation may affect vascular stiffness in patients who underwent kidney transplantation since the low serum magnesium was independently associated with pwv assessed by sphygmocor . in an experimental study evaluating the structure of the carotid artery in rats , magnesium deficiency was associated with hypertrophic vascular remodeling , which was attenuated by supplementation of this ion . these findings suggest that magnesium deficiency alters the vascular mechanical properties in young animals and may be a mechanism involved in the pathogenesis of hypertension , atherosclerosis , and other cardiovascular diseases . other possible mechanisms of magnesium action are anti - inflammation , antioxidion , and modulation of cell growth properties . in fact , the production of reactive oxygen species is usually increased in the vasculature of hypertensive patients , and the involvement of magnesium could occur through the reduction of inflammation and oxidative stress . magnesium has antioxidant properties that could attenuate detrimental effects of oxidative stress on the vasculature , thereby preventing increased vascular tone and contractility . endothelial dysfunction refers to an imbalance in the endothelial production of mediators that regulate vascular tone , platelet aggregation , coagulation , and fibrinolysis . there is a worsening in the endothelium - dependent relaxation , which can be caused by both loss of no bioavailability as changes in the production of other endothelium - derived vasoactive substances mainly endothelin-1 and angiotensin ii . indeed , it has been reported that magnesium modifies the vascular tone by regulating endothelium and smooth muscle cell functions along with an important role in the classical pathway of no release . experiments in animals have also showed increased production of prostacyclin and no by magnesium , promoting endothelium - independent and endothelium - dependent vasodilation . the peripheral vascular resistance may be modified by magnesium , also through the regulation of responses to vasoactive agents , particularly angiotensin ii , endothelin , and prostacyclin . animals deficient in magnesium have presented high levels of endothelin-1 , whose values have been reduced after supplementation of this mineral . a study that followed more than 90,000 postmenopausal women showed that dietary magnesium intake was inversely associated with plasma concentrations of inflammatory markers such as interleukin-6 , c - reactive protein ( crp ) , and tumor necrosis factor- . this same study emphasized that magnesium intake could improve endothelial dysfunction and inflammation and might play a role in preventing metabolic syndrome . there are a few studies demonstrating the relationship between magnesium supplementation , endothelial function , arterial stiffness , and carotid intima - media thickness . some reports point out beneficial effects of magnesium supplementation in improving endothelial function in the brachial artery in patients with coronary artery disease , heart failure , and diabetes mellitus , while others show favorable outcome of magnesium supplementation through improvement of insulin sensitivity [ 45 , 46 ] . magnesium can be supplemented in different ways , such as oxide , hydroxide , chelate , sulfate , and citrate . magnesium sulfate , for example , can be used as anticonvulsant therapy in preeclampsia due to its neuroprotective action and a possible role in regulating vascular tone . the administration of magnesium oxide ( 400 mg daily ) for eight weeks in patients with hypertension can reduce blood pressure levels , and this reduction has already been detected in office measurements and by ambulatory blood pressure monitoring . a study of 48 subjects has demonstrated that 600 mg of magnesium pidolate per day was able to reduce blood pressure levels in the supplemented patients when compared to the group with no supplementation . this same dosage of supplement was also associated with reduction of serum total cholesterol , ldl - cholesterol , and triglycerides and improvement of insulin resistance . haenni and colleagues reported positive effects of magnesium supplementation in order to confirm the relationship between the metabolism of this mineral and alteration of endothelial function by showing increased endothelium - dependent vasodilatation after magnesium infusion . furthermore , another study showed that chronic magnesium supplementation was able to improve endothelial function in patients with coronary artery disease . some positive and negative results after magnesium supplementation are shown in table 1 . a meta - analysis evidenced a weak causal correlation between magnesium supplementation and blood pressure reduction , and double - blind placebo controlled trials magnesium is a mineral with important functions in the body , and it is important that their levels are adequate . the conflicting results of studies evaluating the effects of magnesium supplements on blood pressure and other cardiovascular outcomes indicate that the action of magnesium in the vascular system is present but not yet established . certainly , the lack of definitive conclusions due to heterogeneity of study populations with different clinical profiles and severity of illness , lack of standardization of the type of supplement and the dose , and , finally , very short time of treatment , most often between one and three months , are factors that contribute to the difficulty to achieve the primary objectives . based on recent studies , although we can not make categorical statements , it appears that magnesium is more involved in the functional vascular changes , and also on local metabolic stability with no influence on the vascular structure . therefore , further studies are needed to evaluate the risk of magnesium deficiency and the effects to be considered in this mineral supplementation . possibly the most important point is to define a more homogeneous study population , considering the same gender and age range , dosage , and type of supplement , as well as a longer period for supplementation . after resolving these concerns , it will be possible to clarify the role of magnesium in the prevention and treatment of cardiovascular diseases .

tuberculosis ( tb ) is the most widespread human infection worldwide affecting over one billion people . amongst the extrapulmonary sites , breast and bones are infrequent sites of tb , with less than 1 percent of reported cases . it is more frequently encountered in developing countries like africa and asia where the disease is found to be endemic . however the disease is assuming significance even in developed countries due to preponderance of aids . primary mycobacterial infection of the sternum , leading to osteomyelitis , is an extremely rare condition . tuberculosis of bones and joints accounts for 1 - 3% of patients with the disease . however , no case of tuberculous osteomyelitis of sternum following primary tb mastitis has been reported in literature so far to the best of our knowledge . a 40-year old married female presented with lump in the upper and inner aspect of left breast present since one month . there was associated low - grade fever with night sweats and evening rise of temperature . on examination there was a soft fluctuant swelling in the upper inner quadrant of breast . fine needle aspiration cytology ( fnac ) of the swelling revealed it to be a tubercular cold abscess ( figure 1 ) . the pus sent for ziel nielsen ( zn ) staining was positive for acid fast bacilli ( afb ) . nondependent aspiration of the abscess was carried out and patient was started on four drug first line anti - kochs therapy ( akt ) viz . : isoniazid ( h ) , ethambutol ( e ) , rifampicin ( r ) and pyrazinamide ( z ) . the patient presented a month later with a sinus and swelling over the anterior chest wall overlying the sternum . x - ray chest with contrast injected through the sinus ( sinogram ) showed osteomyelitic changes in the sternum with a cavity ( figure 2 ) . incision along with debridement and curettage of osteomyelitic bone was performed leaving an ulcer ( figure 3 ) . the ulcer healed with daily dressings by secondary intention . patient completed 12 months of akt , which included 3 months of herz and 9 months of hr along with pyridoxine and antacids . it usually results either as an extension from hilar lymph nodes or as part of hematogenous or lymphatic dissemination of the disease from other sites . sternal tuberculosis has also been reported after bacillus calmette - gurin vaccination in the pediatric age group . sir astley cooper in 1829 first described breast tb as a scrofulous swelling at the bosom of young women suffering from enlargement of cervical glands . the incidence of tuberculosis of breast is less than 1% . the resistance to survival and multiplication of mycobacterium tuberculosis offered by the breast tissue might be a contributory factor in low incidence of tb mastitis reported in literature . it comprises of two types , primary being confined only to the breast , and secondary with coexisting tuberculous lesion elsewhere in the body . recently it has been reclassified into three categories namely nodular , disseminated and abscess varieties . it occurs more frequently in women predominantly in the reproductive age group ( 17 - 42 years ) . various ways of manifestation include painless unilateral breast mass , generalized breast edema and localized abscess with or without axillary involvement . tenderness and erythema may also be present . although any area of breast can be involved but due to proximity of axillary nodes , upper outer quadrant is the most frequently site involved . very rarely the primary foci of tuberculosis from the breast may invade the pectoral fascia and involve the sternum leading to sternal tubercular osteomyelitis as seen in the present case report . sternal tuberculosis presents with an insidious swelling and pain over the sternum and constitutional symptoms are usually fewer , whereas patients with pyogenic sternal infections will have a fulminant clinical course with severe systemic upset . fnac or trephine biopsy with histological and microbiological examination of sternal tissue for caseating granulomas and acid - fast bacilli are the methods of choice for a definite diagnosis . fnac can diagnose tb osteomyelitis on the basis of caseating granulomas of epitheloid histiocytes and multinucleate giant cells . khanna et al . reported 100% success rate of fnac , while kakkar et al . reported a success rate of 73 percent . in a study by fadari - agrahi et al no patient had positive stain for afb . however , pus was positive for afb in the present study . computed tomography scans can be used to determine anatomical localization , osseous destruction , and soft tissue abnormalities . early drainage and complete debridement of necrotic material from the lesions along with multi - drug anti - tubercular therapy has been seen to hasten recovery . rotational tissue flaps can be employed to cover the chest wall defect due to the extensive loss of soft tissue and bone integrity after debridement . . however , with the resurgence of the disease , more virulent strains are seen invading this fascia giving rise to such unusual presentations .

esophageal cancer is the sixth cause of death in the world , which kills about 386000 people each year . regarding diagnosis and the survival rate for these patients is very low and only 12% and 4% for female and male patients , respectively in caspian region . the highest number of outbreaks was reported in north parts of china ( average of 100 to 180 per 100,000 people ) . while in the usa diari et al . in 1975 in tehran university reported that the northern region of iran - including ardebil , gilan , mazandaran , golestan and north khorasan provinces is highest incidence region in iran , in this regions gilan province has the lowest incidence and north khorasan has the highest incidence . estimation of survival rate in patients with esophageal cancer can help improve the preventive and curative services and assess the effectiveness of new treatments . victim s quality of life is very important and we should pay more attention to this matter . many studies have been conducted in the past two decades in relation to survival rate of esophageal cancer in iran . this systematic review assesses all accessing electronic databases to determine valid estimation of survival rate among patients with esophageal cancer in different regions of iran . sources for the data the systematic review carried out about survival rate of esophageal cancer that required search all available sources and electronic databases related articles and dissertations as well as the meta - analysis . these databases include the reliable domestic databases such as iranmedex , medlib , magiran and sid as well as the foreign websites such as pubmed / medline , isi web of knowledge and scopus . we queried the articles and dissertations using sensitive keywords including cancer , esophagus , survival neoplasms and longevity and a combination of them . in order to prevent any bias , which evaluated the survival time and longevity of the esophageal cancer and published up to 2011 entered into the first step of study without any kind of limitations . after preliminary review , review articles about esophageal cancer without any evaluations on the survival time and papers with insufficient data were omitted from the study . in second step we evaluated 340 articles on esophageal cancer among them 40 ones were repetition , 145 ones irrelevant that omitted from study . finally 18 articles with proper quality were entered into the process of meta - analysis ( chart 1 at the bottom of the text ) . this form included sample size , study region , gender , 1 year to 5 year survival rate , histology type , as well as affected area of esophagus . in every article the one to five year survival rate was considered as the probability of a two - term distribution and its variance was calculated using two - term distribution . incongruity of the studies was determined using the q - test and i2 measure . due to the incongruity of the studies we used the random effect model for combining the results of them . the analysis in the sub - groups was carried out regarding the under - study region ( north , center , east and tehran ) . overall , 18 articles included according to inclusion criteria in the meta - analysis . looking for sample sizes , 2932 patients enrolled study . 11 articles ( 61% ) were performed in the northern parts of iran , 3 ones ( 16.6% ) were carried out in central parts ; one ( 5.5% ) was conducted in the eastern parts and 3 ones ( 16.6% ) were accomplished in tehran province . studies were published between 1 january 1989 and 31 august 2010 ( table 1 ) . according to results from meta - analysis , the one - five year survival rate for esophageal cancer in this study were 47% ( ci 95% : 34 - 61 ) , 31% ( ci 95% : 18 - 44 ) , 22% ( ci 95% : 13 - 31 ) , 21% ( ci 95% : 4 - 38 ) and 12% ( ci 95% : 8 - 16 ) , respectively ( table 2 ) . geographical variation results on survival rate in our study indicated the one year survival rate in northern region , with eight articles enrolled in meta - analysis was 45% ( ci 95% : 28 - 62 ) , in the northwest region , with one study was 68% ( ci 95% : 61 - 75 ) , in the central region , with one study was 55% ( ci 95% : 50 - 68 ) and in tehran was 33% ( ci 95% : 25 - 41 ) . the pooled rate one year survival rate according to result of meta - analysis was 47% ( ci 95% : 34 - 61 ) ( graph 1 ) . graph 2 shows the overall rate of five year survival according to meta - analysis was 12% ( ci 95% : 8 - 16 ) . in recent decades some success has been obtained in the management and cure of esophageal carcinoma . esophageal tumors are considered an endemic disease in iran particularly in the brinks of the caspian sea . in our study the five year survival rate is equal to 12% . in a study carried out in 2008 by agrawal et al , the survival rate in patients during the first five years after diagnosis is reported 13% that conforms to results of our study . in a study by bashash 2011 , which tries to compare the survival rate for stomach and esophageal cancers in ardebil in iran and british colombia in canada , the one year survival rate was estimated 17% in ardebil and 33% in british colombia . this significant difference shows a geographic variation in survival rate of esophageal cancer in different parts of the world perhaps due to differences in health and wellness of people in different areas . also in this study the mortality of esophageal cancer was more than the fatality of stomach cancer . in netherlands the five year survival rate for men and women was 12.8 % and 9.8 % , respectively . this study conforms to results of our study which shows the five year survival rate was 12% . in japan 2012 , by tamura et al the five year survival rate of esophageal cancer was estimated 42.9% and in similar article in usa 2012 blackmon et al . thus our result is considerably lower than developed countries such as japan and the usa . second some articles did not give the survival rate by year and just report the five - year survival rate . of the 18 final articles , 11 were performed in the northern reigns of the country including golestan , mazandaran , as well as gilan and ardebil provinces . the reason for this can be attributed to highest rate of esophageal cancer in northern regions in iran . in other regions so the survival rate in other regions of iran is not clear due to the lack of sufficient data and due to the scarcity of studies , the reported estimations do n't have sufficient accuracy . according to results of this study the one year survival rate ( 47% ) of esophageal cancer in iran is almost five times more than the five year survival rate ( 12% ) . hence , the early diagnosis of the disease is very important in order to prolong the survival of the patients . according to results of this study the one year survival rate ( 47% ) of esophageal cancer in iran is almost five times more than the five year survival rate ( 12% ) . hence , the early diagnosis of the disease is very important in order to prolong the survival of the patients .

methamphetamine is the most widely abused type of amphetamine , a class of stimulant drugs . uses have been more prevalent in east and south east asia , north america , south africa , new zealand , australia , and a number of european countries . individuals with methamphetamine use disorders had a higher mortality risk than those with diagnoses related to cannabis , cocaine , or alcohol . in a study , which evaluated the global prevalence of amphetamine dependence and the burden of disease attributable to these disorders there were significant differences between amphetamines in the geographic distribution of crude disability - adjusted life year ( daly ) . over half of amphetamine dependence , dalys were in asian regions ( 52% ) . in alabama , cocaine and methamphetamine among fetuses / also , at least 84% of deaths were violent or drug - related ( 12% suicides ) in sweden population . the data , presented for the dresden region , saxony , germany , demonstrate the escalation of ma - related crime and fatalities between 2005 and 2011 . methamphetamine has neurobiological effects on the nervous system ; some of which are transitory and some longer lasting . signs of toxicity include hot , flushed or very sweaty skin , headache , chest pain , changes in consciousness and mental status , tremor , spasm , agitation , difficulty breathing , seizures , and psychosis . most cases of methamphetamine toxicity can be managed supportively . in the case of a severe overdose , immediate supportive care , including airway control , oxygenation and ventilation support , and appropriate monitoring , is required . methamphetamine abuse and also poisoning seems to be increasingly common in iran , especially in our tertiary care poisoning referral center in the central part of iran . the aim of this study was to depict a better clinical and toxicoepidemiological picture of methamphetamine poisoning in the central part of iran and the factors , which are related to the outcome of therapy in these patients . this hospital - based , retrospective study was carried out from april 2012 to april 2013 in the department of clinical toxicology of noor and ali asghar ( pbuh ) university hospital ( affiliated with the isfahan university of medical sciences ) , which is the referral medical center for poisonings in the central part of iran and is facilitated , staffed , and designed for the management of poisoned patients , in which approximately 600 poisoned patients are admitted monthly . the study protocol was approved by the institutional board of human studies at the isfahan university of medical sciences . in addition , all of the patients personal details were not recorded or coded . we used the hospital poisoning registry to retrieve information on the incidence and management of methamphetamine overdoses using the 10 revision of the international statistical classification of diseases and related health problems , which is a medical classification published by the world health organization . medical records of all patients aged 18 to 65 years who were admitted with a positive and reliable history of acute methamphetamine poisoning and drug overdose was diagnosed clinically by an attending medical toxicologist and confirmed by laboratory methods , were abstracted and analyzed . collected information included patients gender , age , type of poisoning ( accidental or intentional ) , route of poisoning ( oral , inhalation , intravenous , intramuscular , subcutaneous , and mixed ) , clinical manifestations at the time of admission , duration of hospitalization , and clinical outcome ( survived with or without complication and death ) . data abstractor was a last - year pharmacy student ( pp ) who was trained for correct data abstraction of medical records details and supervised by a medical toxicologist ( nem ) . for reducing the abstraction errors to the possible minimum , in each session of data gathering only five medical records at least 20% of the abstracted records were re - abstracted by a qualified physician , and the consistency of the results was evaluated by calculating cohen 's kappa for each item of the abstracting form . since we have analyzed all the eligible patients who were admitted within the aforementioned time range , we have not calculated sample size and for the same reason have not used a sampling method . according to our previous study , more than 75% of the methamphetamine poisoned patients are directly referred to our poisoning patients emergency room , and this may reflect an acceptable picture of methamphetamine poisoning in isfahan city . the outcome of therapy was documented as survived without any complication ( including coma , mechanical ventilation , serious arrhythmia , refractory hypotention or hypertensive crisis , and altered mental status ) , or survived with complication or death . missing data of medical records was completed via direct contact with the corresponding patient and in case of conflicting data , documentation of a senior physician was recorded where appropriate . descriptive analysis of data was done on all baseline characteristics of the study patients . for continuous and quantitative variables , mean and standard deviation was calculated , and histograms were plotted to assess the distribution of these variables . in the case of categorical variables , frequencies were reported and tested . mean values of continuous quantitative variables were compared between the two groups of outcomes using the independent t - test . for categorical variables that had cell counts less than five , the fisher 's exact test was used . predictive factors for clinical outcome of treatment were evaluated by the binary logistic regression analysis , and results were reported as odds ratios ( ors ) with confidence intervals ( cis ) . all p values were based on two - sided tests and significance was set at p < 0.05 . data processing was performed using statistical package for the social sciences software ( spss inc . , during the study period ( 1-year ) , 129 eligible patients ( 86% male ) were presented to our medical center with the mean age of 30.70 0.93 ( mean standard error ) . about 18.6% had a previous history of psychiatric disorders and 10.1% had a previous history of suicidal attempt . forty cases used only methamphetamine and the others ( 89 cases ) ingested or inhaled other drugs with methamphetamine . time elapsed from overdose to the hospital admission was averagely 11.9 1.0 h. the mean length of hospital stay was 18.86 2.2 h. one hundred and fifteen patients finally survived and 14 patients were dead or survived with complications . the results comparing the different variables based on outcome has been shown in table 1 . patient 's history and clinical details and the outcome of treatment in patients with methamphetamine poisoning age ( or , 1.05 ; 95% ci 1.0061.099 ) , suicide history ( or , 30.33 ; 95% ci 3.11295.24 ) , route of poisoning ( [ ingestion : or , 0.21 ; 95% ci 0.050.87 ] [ inhalation : or , 0.19 ; 95% ci 0.040.78 ] ) , and pulmonary system manifestations ( or 1.84 ; 95% ci 1.152.93 ) were predictive in patients outcome ( p < 0.05 ) . coma , agitation , hypotension , tachycardia , bradycardia , and pulmonary manifestations were more prevalent in patients who died or survived with complications [ table 2 ] . there were no significant statistical differences in routine laboratory tests performed on admission between the two groups ( p > 0.05 ) . clinical manifestation of the study patients with methamphetamine poisoning and the outcome of treatment to find the predictive variables in patients outcome , the backward step binary regression was used . age , previous suicide history , route of poisoning , and pulmonary system manifestations had predictive values in the outcome of therapy for these patients [ table 3 ] . methamphetamine use varies geographically , but overall , amphetamine - type stimulants , which include methamphetamine , are the fastest rising drug of abuse worldwide . since methamphetamine poisoning has become more prevalent in our toxicological emergencies referral center in recent years , the main purpose of this study was to evaluate the predictive values of different related factors on the outcome of treatment in methamphetamine poisoning . in our study , most of the cases were young men which are consistent with many similar studies . in 42.6% of our patients , inhalation was the main route of exposure . routes of administration that produce rapid onset of the drug effects ( i.e. , smoking and injection ) are likely to lead to more medical and psychiatric effects . forty cases used only methamphetamine and the others ( 89 cases ) ingested other drugs with methamphetamine . although due to the methodological limitations of the present study , we could not find the difference between patients survival or death regarding the co - ingestion of other drugs ; co - ingestants increased the risk of morbidity and mortality . previous history of psychiatric disorder ( 35.7% ) and suicide ( 50% ) was observed in patients with the worse outcome . depression has been reported commonly among methamphetamine users and symptoms of depression may persist for weeks , months , or in some cases even several years after stopping methamphetamine use . chronic use of methamphetamine can produce significant neurological damage as well as damage to cardiovascular , pulmonary , and other organ systems . chronic exposure to methamphetamine may cause personality changes , psychotic syndrome , and ulcers of the lips and tongue . coma , agitation , hypotension , tachycardia , and pulmonary manifestations were more frequent in patients with the worse outcome as compared to patients survived without any complications . all clinical manifestations were compatible with methamphetamine poisoning , which has been reported in previous studies . methamphetamine hydrochloride poisoning may ultimately result in collapse , shock , systemic acidosis ( accumulation of acid in the body ) , coma , and convulsions . we could not find any significant difference in laboratory tests data between the two groups with respect to the outcome . however , hypokalemia due to the direct sympathomimetic effects of methamphetamine , and hyperkalemia related to hyperthermia , rhabdomyolysis , or renal failure after methamphetamine poisoning has been reported previously . age , past history of suicide , route of poisoning , and pulmonary manifestations on admission may be considered as important predictive factors in the outcome of treatment in these patients . pp , hp , and aj collected the data , and nem did the data analysis . all authors have assisted in the preparation of the manuscript and have read and approved the content of the manuscript and are accountable for all aspects of the work . authors would like to thank professor farzad gheshlaghi for his kind co - operation during the study period and mr . authors would like to thank professor farzad gheshlaghi for his kind co - operation during the study period and mr .

gaps in margin render the tooth susceptible to caries , pulpitis and periodontal disease [ 13 ] . all - ceramic restorations are in fast progression in properties and usage . in situations with high esthetic demands , these materials may be the material of choice . although adhesive resin cements are recommended for most of all - ceramics , and these luting agents have very low solubility , fitness is still important . the incidence of gingival inflammation increases around clinically deficient restorations , particularly those with rough surfaces , subgingival finish lines or poor marginal adaptation . factors affecting adaptation in all - ceramic restorations may be categorized into those influencing before cementation [ 57 ] and those influencing after cementation [ 812 ] and changes in marginal fitness after thermal or mechanical loading in the mouth [ 1317 ] these factors have influence before cementation : ceramic system ( polycrystalline based ceramics , glass - ceramics , glass infiltrated ceramics and feldspathics ) the manufacturing technique ( sintering , slip - casting , heat pressing , casting , cad / cam ) , fabrication stages,[1921 ] finish lines [ 6 , 7 , 22 ] core and veneering layer thermal mismatch . in techniques that a strong core is veneered by a layer ceramic , thermal mismatch between two materials can cause deflections during the fabrication process . in the study of castellani , thermal distortion of all - ceramic crowns the metal ceramic crowns stabilized after an initial loss of marginal precision , and the all - ceramic crowns continued to distort with each firing cycle . reported that the addition of porcelain to the copings caused a significant change in the marginal fit of the crowns made from conventional in - ceram , copy - milled in - ceram and copy - milled feldspathic crowns . both studies found significantly larger marginal discrepancies in the facial and lingual surfaces than mesial and distal . greater bulk of porcelain was explained as the probable reason for higher discrepancy in these surfaces . komine et al . reported , ceramic firing did not significantly affect either marginal or internal adaptation of the cercon , a zro2 ceramic . the difference between studies is possibly a result of the greater strength of zro2 core . the purpose of the present study was to investigate the influence of core and veneer thickness on marginal adaptation of ips e.max press ( ivoclar vivadent , schaan , liechtenstein ) crowns , during different stages of core fabrication , veneering and glazing . ips e.max press is a heat pressed lithium disilicate glass - ceramic , which is veneered by ips e.max ceram , a nano - fluorapatite glass - ceramic . this material is the last generation of pressed ceramics from ivoclar vivadent company , with improved strength and optical properties . it is indicated for anterior and posterior single crowns , for bridges anterior to second premolars and implant superstructures . the null hypothesis was that increasing the core thickness has no effect on marginal accuracy of this ceramic . three stainless steel dies were machined simulating a premolar , prepared for full coverage , with 7.5 mm height , 7 mm diameter , and 6 convergence angle ( fig 1 ) . the minimum framework thickness recommended by ivoclar vivadent was 0.8 mm and the maximum thickness for the veneering layer was 0.7 mm . so cores were fabricated on 0.8 mm ( group a ) and 1 mm shoulder dies ( group b ) , ten specimens for each group . special metal templates were machined to insure similar thickness for cores in each group and final crowns ( fig 1 ) . a groove , 4 mm long and 0.5 mm deep was inserted on dies for repeatable seating of samples and preventing their rotation . depressions were made on four sides of dies 0.5 mm below margins , pointing identical positions for measurements . , templates were placed on related dies and wax was injected in between . during removing wax patterns from metal dies , wax patterns were removed , sprued and invested in ips pressvest speed investment material ( ivoclar vivadent , schaan , liechtenstein ) . then rings were transferred to ivoclar ep600 press furnace ( ivoclar vivadent , schaan , liechtenstein ) and press filled with ips e.max press , [ k20768 ( ivoclar vivadent , schaan , liechtenstein ) ] ho ingots at 920 . then the cores were divested , sandblasted with glass polishing beads at 2 bar ( 30 psi ) pressure and cleaned by invex ( ivoclar vivadent , schaan , liechtenstein ) in ultrasonic bath to remove the reaction layer formed on them . each core was seated on the main die ( 1.5 shoulder ) and the assembly was placed in a device designed to keep them together and prevent their movement ( fig 2 ) . one end of the device was not fixed and could apply pressure on the core , to insure close adaptation of core to die . marginal fit was examined at 120 magnification by a stereomicroscope ( szx12 olympus , japan ) at four predetermined points . according to holmes definition for marginal gap , the distance between crown margin and the edge of die was measured . after this stage , all cores were reinserted on the 1.5 mm shoulder die and ips e.max ceram [ k3116 powder , k43221 liquid ( ivoclar vivadent , schaan , liechtenstein ) ] as the veneering layer was applied on them using a template to insure uniform thickness . each veneered crown was inserted on the main die and again the assembly was placed in the device and the fitness was examined under the stereomicroscope . all laboratory procedures were done by one technician and all examinations were done by one of the investigators . mean marginal gaps measured after core fabrication , veneer firing and glaze were 13.5 ( 1.4 ) m , 33.9 ( 2.3 ) m and 40.5 ( 1.7 ) m , respectively for group a and 14.9 ( 2.0 ) m , 35.5 ( 2.2 ) m and 41.3 ( 2.0 ) m , respectively for group b. there were no significant differences in marginal gap values between the two groups ( p>0.1 ) . significant increase in gap was observed after veneering stage in both groups ( p<0.05 ) , but no significant increase was detected after glazing in either of the two groups . this study was designed to evaluate the influence of core and veneer thicknesses on marginal adaptation of ips e.max press crowns during different stages of fabrication . the results showed 0.2 mm increase in core thickness had no effect on the marginal accuracy of crowns and the null hypothesis was confirmed . addition of the veneering layer significantly decreased marginal adaptation of the crowns ( p<0.05 ) . in this study , finish line was rounded shoulder that is suggested for all - ceramic full coverage crowns . core thicknesses were 0.8 and 1 mm , because the least thickness recommended by the manufacturer was 0.8 mm . die spacer was not used because crowns were not cemented ; further more , die spacer application might complicate uniform thickness of the samples and may affect crown fitness . the marginal 0.5 mm of cores was not veneered , because veneer material on the margin could lead to misleading results . the methods used for measurement of the marginal fit include : 1 ) direct view of the crown on a die , 2 ) cross - sectional view , 3 ) impression replica technique , and 4 ) clinical examination . the last three methods are suitable for measuring gaps after cementation and after loading in the mouth . in this study , uncemented , nonsectioned specimens were examined by direct view under the stereomicroscope . to reposition them repeatedly , grooves and depressions helped all examinations to be done in identical points . because of symmetrical contour in the specimens , only four measurement points per specimen were considered . the sample size of ten for each test group was for compensating minor variations in the fabrication process . in the present study , studied marginal adaptation of different types of all - ceramic partial coverage restorations after exposure to an artificial mouth . the result of the present study is in agreement with values reported for four cusps reduced group ( 50m ) before cementation . conrad et al . reviewed current literature for in vivo and in vitro marginal discrepancy evaluations . reported that the labial and palatal surfaces of the conventional and copy milled in - ceram crowns exhibited significantly larger marginal discrepancies than the other surfaces . the results are consistent with the findings of sulaiman et al . for procera , ips empress and in - ceram . their specimens were made on dies simulating prepared maxillary central incisor , with a wider shoulder and as a result , a greater mass of porcelain at the labial and palatal surfaces compared to the mesial and distal [ 19 , 20 ] . in the present study , there was no variation in shoulder width and veneer thickness inside one group . changing core and veneering layer thickness in different groups did not influence the fitness either . in this study , they indicated that addition of porcelain to the copings caused a significant change in the marginal fit of the crowns , but sulaiman et al . found no significant differences among the various stages of crown fabrication . low shrinkage of heat pressed cores may explain the difference . for heat pressed ceramics that use lost wax technique , 0.4% shrinkage of wax pattern and 0.2% shrinkage of ceramic coping can be compensated by 0.3% setting and 0.2% thermal expansion of investment material . because of inherent properties , large gaps are not expected in pressed copings . in the present study , their comparison between zro2 copings and crowns demonstrated that ceramic firing did not significantly affect marginal adaptation . they explained that the strength of zro2 copings prevent them from being affected by porcelain firing procedure . lithium disilicate glass - ceramics are not as strong as zro2 copings ( 400mpa compared with 900mpa ) . glaze had no significant effect on gap , similar to what balkaya et al . reported . the values for marginal gaps in both groups were in a clinically accepted range proposed by christensen , mclean and fraunhofer . ips e.max press crowns have an acceptable marginal fit . the comparison between the present study and previous studies indicate that variation in veneer thickness of one crown is more influential on marginal accuracy than uniform change in veneer or core thickness .

approximately 500,000 new cases of head and neck squamous cell carcinoma ( hnscc ) are diagnosed each year making hnscc the 6th most common cancer worldwide . the rate of hnscc has been increasing recently secondary to an epidemic of human papillomavirus- ( hpv- ) related oropharyngeal squamous cell cancer ( opscc ) . these trends , which have seen rates of opscc as much as double over the last three decades in some countries , have been associated with a shift in demographics to a younger population that is typically high functioning with lower rates of comorbid illness . combined with lower rates of smoking and alcohol abuse and an intrinsic improved response rate of hpv - related opscc to curative treatment regimens , the overall and disease - free survival rates in this patient group are significantly higher than previously observed . as such , long - term quality of life considerations have been made even more relevant to the multidisciplinary team coordinating the care of these patients . these new developments in the pathogenesis of hnscc , and in particular opscc , are occurring in the context of large - scale paradigm shifts over the past two decades towards organ preservation treatment protocols . the veterans affairs laryngeal cancer study published in 1991 began the era of organ preservation and led to the application of primary radiation approaches to other subsites such as the oropharynx . although a randomized controlled trial of primary radiation versus surgery for oropharyngeal cancer has not been carried out , several retrospective analyses have demonstrated less major complications and improved functional outcomes with radiation compared to traditional primary surgical approaches . these results have contributed to the widespread adoption of primary nonsurgical treatment in patients with opscc . minimally invasive surgery ( mis ) for hnscc continues to be extensively reported within the head and neck literature , driven by the desire to offer a less morbid alternative to chemoradiation . these techniques have included transoral laser microsurgery ( tlm ) and more recently , transoral robotic surgery ( tors ) . tors was first introduced into the literature by weinstein et al . in 2005 with their case report of a supraglottic laryngectomy performed in a canine model . the adaptation of this preexisting robotic technology to a new clinical application provided a watershed moment in the evolution of treatment options for the surgical management of head and neck aerodigestive tract pathology . since this early report , the development of tors in its various human applications has been steadily progressing with feasibility studies confirming the safety and usability of this technology in live human patients [ 5 , 6 ] . given the benefit of infield optics provided by the robot - mounted double video endoscope , line - of - sight issues associated with more traditional transoral techniques are overcome with the use of tors . this factor , combined with the valuable 3-dimensional imagery , tremor filtration and the resultant precision movements translated from the console to the robotic instruments at the operative site , allow for accurate dissection of tissue planes in a way not previously possible . various reports of the use of tors in benign disease processes have been published in the literature [ 710 ] , however , the majority of reports have concentrated on the application of tors in patients with mucosal malignancies , particularly of the larynx and oropharynx [ 1114 ] . emerging evidence suggests that effective primary surgical management of these malignancies may provide an opportunity for deintensification of adjuvant treatments with resultant improvements in patient 's posttreatment quality of life , without compromising oncologic outcomes . the aim of the current review is to provide an evaluation of the existing literature with regards to the oncologic and functional outcomes following treatment of opscc with minimally invasive surgery and in particular , tors . a literature search was conducted using pubmed and medline with search parameters including ( transoral[title ] and ( ( robotics[mesh terms ] or robotics[all fields ] or " robotic"[all fields ] ) or robot[all fields ] or telerobot[all fields ] or ( robotics[mesh terms ] or robotics[all fields ] or telerobotics[all fields ] ) or robot - assisted[title ] ) ) or tors[title ] . in addition , studies relating to the use of tlm were identified to facilitate a complete evaluation of the evidence base for the current role of mis in the management of opscc . only those studies dealing specifically with the management of patients with hnscc were included , with descriptions of tors for benign disease , nonmucosal malignancies of the upper aerodigestive tract , novel applications of tors and descriptions of cadaveric studies all being excluded . specifically , data relating to the evaluation of quality of life , oncologic and functional outcomes in the identified studies was reviewed . sixty - nine results were identified for review of which the references were further evaluated for potential inclusion in the analysis . of particular note , studies related to the use of transoral laser microsurgery were included for complete review of minimally invasive surgery in the treatment of opscc . sixteen studies were excluded as they were not related to the application of tors in patients with hnscc . forty studies addressed the role of tors in treatment of head and neck tumors and in particular , 17 studies commented directly on the use of tors in patients with opscc . six studies were identified that investigated quality of life and functional outcomes following tors for treatment of hnscc / opscc with a further seven discussing feasibility aspects including setup and operative times ( table 1 ) . the initiation of new tors programs , generally established in conjunction with robotic programs in other surgical specialties , has repeatedly demonstrated success in establishing safe and efficient robotic services for head and neck oncology units [ 1519 ] . generally , average setup times after preliminary experience within the tors team are under 30 minutes . further demonstration of the increased efficiency following the introduction of tors to a department is documented in the data from moore et al . who significantly improved the setup time after their initial experience , suggesting that the learning curve for operative efficiency is complete after approximately 10 patients . the average operative time across all 7 studies is just under 75 minutes . for patients who require free flap reconstruction of the ablative defect , feasibility studies and initial case series detailing free tissue transfers via minimally invasive surgical approaches and robotic - assisted microanastomotic techniques have also demonstrated reliable perioperative outcomes [ 17 , 2025 ] . in excess of 500 patients receiving tors to manage opscc a summary of the tors literature relating to the oncologic outcomes in patients with opscc is presented in table 2 . many reflect treatment of advanced stage disease by virtue of n - positivity with associated early t - classification : several trials report only on the treatment of t1 - 2 lesions with various stages of cervical disease [ 12 , 16 , 26 , 27 ] . nonetheless , preliminary data relating to local control , disease - specific survival , and overall survival using upfront tors is encouraging , with early overall survival rates at 1 year exceeding 90% with emerging 2-year survival data between 80% and 90% [ 13 , 20 , 28 , 29 ] . reported 1 and 2 year overall survival rates among a 50 patient cohort of 95.7% and 80.6% , respectively . thirty - nine patients had t1/t2 lesions ( 78% ) , 8 had t3 lesions ( 16% ) , and 3 had t4 lesions ( 6% ) , with this low primary tumor volume further demonstrated by the fact that only a single free tissue transfer was required for reconstruction of the ablative defect . ongoing efforts at other institutions have replicated these early survival results , with genden et al . demonstrating an overall survival of 90% amongst their cohort of 30 patients treated with primary tors for hnscc , whilst white et al . recorded a 86.5% 2 year overall survival for 71 patients undergoing tors as part of treatment for hnscc of all subsites ( 87% patients had opscc ) [ 20 , 29 ] . in both of these studies , a majority of patients again had advanced stage disease with early t - stage status and small volume nodal disease . these oncologic outcomes with tors largely mirror the experience reported in the tlm literature with patient populations again largely demonstrating early t - classification , deintensified adjuvant treatment recommendations based on pathological staging , and impressive oncologic control ( table 3 ) . steiner was one of the first to report on this in 2003 with a report on 48 patients treated for mostly advanced stage opscc involving the base of the tongue demonstrating a local control rate over 5 years of 85% . have published multicenter data on 204 patients treated with tlm adjuvant therapy for advanced stage opscc , with 2 and 5 year overall survival rates of 89% and 78% , respectively , and a local control of 97% . adjuvant treatment was avoided in 26% , with the remaining 150 patients receiving adjuvant treatment of which 33 required chemoradiotherapy . although adjuvant radiotherapy was associated with improved overall survival , the addition of chemotherapy did not significantly impact on survival . this potential to deintensify treatment based on successful surgical control of the primary tumor burden has led to retrospective analysis of the experience in some centers with single modality treatment of opscc . early t - stage opscc who did not receive adjuvant therapy ( 64% not indicated and 36% offered but declined ) . the 5-year overall survival rate was 86% with no patients requiring either tracheostomy of gastrostomy tube . it remains unclear whether a subset of patients with opscc can be treated with primary surgery in order to achieve superior functional results with deintensification of adjuvant treatment . following on from steiner 's early work the use of tlm has repeatedly demonstrated impressive functional outcomes with low rates of gastrostomy dependency , decannulation and high quality of life scores on questionnaire assessment . early tors data supports these impressive functional outcomes with most series reporting 1-year gastrostomy - tube rates under 10% and long - term rates of 0% for patients treated with upfront surgery higher rates of gastrostomy tube dependency have been reported in tors case series including all hnscc subsites with typically higher swallowing dysfunction observed in patients with laryngeal malignancies [ 1 , 2 ] . a further confounder in the management of opscc is the role of hpv in disease pathogenesis and significance as a prognostic factor , apparently irrespective of treatment modality [ 13 , 3436 ] . the exact incidence of hpv infection and its impact on patients with opscc is still being elucidated in prospective trials after having initially been appreciated in retrospective studies . ang et al . published their experience in the treatment of 323 patients with locally advanced opscc . the hpv - positive rate was 63.8% ( 206/323 ) ; hpv - positivity was associated with a significant relative reduction in the risk of death of 58% , translating to an 82.4% survival rate at 3 years compared to 57.1% in those patients hpv - negative . reporting on 68 patients with opscc , of whom 53 were found to be hpv - positive ( 78% ) . patients who were hpv - positive were 5 times less likely to develop recurrence and 60% less likely to die of disease when compared to their hpv - negative counterparts . weinstein et al . also reported on 50 patients treated for opscc with an hpv - positive rate of 74% ( 37/50 ) . in this series of patients treated with upfront tors , the disease - specific survival of patients with hpv - positive opscc at 1-year and 2-years was 97% and 90% , respectively . however , the hpv - negative cohort in this primary surgical series demonstrated equal oncologic control with disease - specific survival rates at both 1-year and 2-years of 100% . the management of patients with opscc continues to evolve with both advances in therapeutic regimens and evolution of our understanding of the underlying disease pathophysiology . early surgery - based treatment paradigms have been largely abandoned with the general adoption of nonsurgical regimens supported by an evidence base demonstrating superior functional outcomes whilst retaining comparable survival results [ 3941 ] . paralleling the improvements in surgical technique , the natural evolution of radiotherapy has resulted in a decrease in treatment - related morbidity . refinement of targeted 3d conformal radiotherapy methods such as intensity - modulated radiotherapy ( imrt ) has allowed increased precision in delivery of radiotherapy to patients with hnscc with associated decreases in adverse sequelae . tempering these benefits , however , has effects related to escalation of treatments in an effort to improve survival outcomes . meta - analysis data have demonstrated improved survival with altered fractionated regimens and/or the addition of chemotherapy , at the expense of significant increases in treatment related toxicities , particularly acute mucositis and long - term swallowing dysfunction [ 4346 ] . as the etiologic factors involved in the development of opscc continue to be elucidated one variable that has proven immensely significant is the role of human papillomavirus ( hpv ) . this hpv epidemic has interestingly occurred during the same period as the widespread adoption of chemoradiotherapy as standard of care treatment for advanced stage opscc . this has managed to blur the lines somewhat with respect to whether these improved outcomes are secondary to treatment modifications or reflective of a naturally improved survival rate in patients with hpv - positive disease . furthermore , the hpv - positive opscc patient has been defined as typically younger with lower rates of significant medical comorbidities . combined with improved rates of cure this young , high functioning population requires special consideration given that any treatment related side effects may need to be lived with for extended periods of time . oncologic outcomes in patients with hpv - positive opscc remain similar regardless of treatment approach . therefore , an appreciation of functional outcomes represents a significant and fundamental consideration when formulating management recommendations . transfacial and transmandibular surgical approaches to the oropharynx carry potential morbidity and have been demonstrated on retrospective analysis to be associated with poor functional outcomes when compared to radiotherapy [ 3941 ] . both tlm and tors facilitate surgical access to the lower subsites of the upper aerodigestive tract without need for traditional methods requiring open surgical approaches . repeatedly , these mis techniques have both demonstrated sound oncologic and functional / quality of life outcomes [ 14 , 28 , 4852 ] . potential benefits also exist with respect to adjuvant treatment deintensification and avoidance altogether in select circumstances [ 32 , 5355 ] . comparisons of outcomes after tors versus chemoradiotherapy across studies are hampered by differences in baseline patient populations , selection , and treatment technique . nonetheless , rates of gastrostomy tube dependency after chemoradiotherapy have typically been reported as between 9% to 39% in patients treated with chemoradiotherapy [ 5659 ] . critical analysis of the chemoradiotherapy literature reveals a patient population that typically differs from the recent mis literature with inclusion of patients with unresectable ( t4b ) and/or bulky primary disease ( greater than 4 cm ) , and typical exclusion of early primary disease such as in the series reported by the radiation therapy oncology group . the promising impact of tors on the quality of life and survival outcomes of opscc patients remains an important clinical question that requires higher levels of supporting evidence . a recent surgical consensus statement ( the ideal guidelines ) suggests that randomized comparisons be carried out wherever possible , once adequate pretrial data are available . through centres in london and ottawa , ontario , the orator study ( oropharyngeal cancer radiation versus tors ) is planned to open in early 2012 . this study will randomize opscc patients to curative intent treatment with either upfront tors adjuvant treatment versus nonsurgical treatment , with the primary endpoint being superior swallowing function at one year in the tors arm as determined by the md anderson dysphagia inventory ( mdadi ) . ultimately , orator aims to assist in the identification of opscc patients who might be best served by upfront surgery . adapting data from other head and neck subsites we understand that in a select group of surgical responders chemoradiotherapy represents a suboptimal treatment approach due to either lack of response in locoregional disease control or excessive treatment - related side effects and morbidity . further , defining the surgical responder in patients with opscc is perhaps even more important than other subsites such as the larynx given the relative lack of success with surgical salvage . combined with the work of others , orator can hopefully work to identify the ideal opscc patients for upfront tors , with the realization that chemoradiotherapy will still represent an excellent treatment option for the nonsurgical responder . ultimately , providing truly accurate risk assessment will require a clearer understanding of the underlying molecular genetics of hnscc . only then can patients be risk stratified with relative certainty utilizing both clinical and genetic evidence to guide treatment plans . recent high - throughput genetic sequencing publications in science by agrawal and stransky provide exciting insights into a future that promises genetically guided management to optimize survival and minimize treatment - related morbidity [ 61 , 62 ] . further , current vaccination programs aimed at reducing hpv transmission within the wider community provide an exciting opportunity to impact significantly on the incidence of opscc . the continued development of minimally invasive surgical techniques such as tors offers a significant opportunity to impact positively on patient quality of life and posttreatment function whilst retaining satisfactory oncologic control . initial feasibility and case series reports are encouraging but require further validation through well - designed randomized control trials prior to widespread shifts in accepted treatment paradigms .

lymphocytic interstitial pneumonitis ( lip ) is a morphological subdivision of interstitial lung disease which is considered by some authors to represent a premalignant lymphoproliferative disorder . lip is characterized as bilateral lower lobe infiltration and pleomorphic lymphohistiocytic infiltration within the pulmonary interstitium , ranging from widened septa to confluent masses . regarding its pathogenesis , lip results from defects in immune surveillance , viruses and/or delayed hypersensitivity mechanism . lip is commonly associated with human immunodeficiency virus , epstein - barr ( e - b ) virus , sjgren s syndrome and other autoimmune disorders . not only e - b virus but also hiv is occasionally associated with lymphoproliferative diseases such as lip , lymphomatoid granulomatosis ( lyg ) and non - hodgkin s lymphoma . therefore , differential diagnosis should be done with lyg associated with e - b virus and other lymphoproliferative disorders . we report a case of lip associated with e - b virus in systemic lupus erythematosus and sjgren s syndrome with a review of the literature . a 50-year - old woman was admitted due to high fever and progressive dyspnea for 20 days . for ten years , she suffered from arthritis which was treated irregularly , without specific evaluation , at a private clinic . eleven days before , she visited another hospital because of fever , cough , sputum and dyspnea with mild pleuritic chest pain . she was managed under the impression of tuberculous pleurisy , but she did not improve with anti - tuberculous medication . a chest radiography showed right pleural effusion with bilateral pulmonary infiltrations ( figure 1a ) . her body weight was 33 kg and her vital signs were as follows : temperature 38.6c ; heart rate 120/min ; and respiratory rate 28/min . at that time , she also had keratoconjunctivitis sicca and xerostomia . on physical examination , she had bibasilar crackling rales . pale conjunctiva , hepatomegaly by two fingers width below the costal margin and pretibial pitting edema were also discovered . a chest radiograph showed pneumonic infiltrations in both lower lung fields with pleural effusion ( figure 1b ) . laboratory studies revealed hemoglobin of 8.5 g / dl , hematocrit of 24% , white blood cell count of 3900/mm ( 13% of band form , 85% of segment form ) , platelet count of 148,000/mm and esr of 72 mm / hr . serum creatinine was 2.5 mg / dl , protein was 7.2 g / dl and albumin was 2.5 g / dl . antinuclear antibody was positive ( 1/640 , speckled pattern ) , but anti - dna antibody was negative . tests for anti - ro , anti - la and anti - rnp antibodies were positive . the level of c3 and c4 were decreased to 25 mg / dl ( normal 45100 mg / dl ) and 9 mg / dl ( normal 1040 mg / dl ) , respectively . c - reactive protein was 7.2 mg / dl ( normal < 0.5 ) and rheumatoid factor was 52 iu / ml ( normal < 20 ) . ziehl - neelson stains for acid - fast bacilli of her sputum were negative and cultures for m. tuberculosis were negative 3 consecutive times . on 24-hour urine collection , protein was 3.0 g / dl and creatinine clearance was decreased to 20 ml / min . a pleural fluid study disclosed that straw - colored fluid contained 127 leukocytes/l ( neutrophil 26% , lymphocyte 74% ) , protein 1.7 g / dl , lactic dehydrogenase 972 mg / dl and glucose 37 mg / dl and had a high likelihood of being an exudate . test for igm antibody to epstein - barr ( e - b ) virus was positive in the serum . antineutrophil cytoplasmic antibodies ( anca ) , human immunodeficient virus ( hiv ) and cytomegalovirus ( cmv ) assays were all negative . pulmonary function test showed normal ventilatory pattern with reduced diffusion capacity : forced vital capacity ( fvc ) 1.90 l ( 84% of predictive value ) , forced expiratory volume in one second ( fev1 ) 1.63 l ( 94% of predictive value ) , fev1/fvc 113% , total lung capacities ( tlc ) 2.78 l ( 88% of predictive value ) and diffusing capacity of the lung dlco ) 6.5 ml / min / mmhg ( 54% of predictive value ) . sialography of salivary gland showed multiple - sized ectatic changes in acina without dilatation and filling defect in the main duct ( figure 2 ) . on biopsy finding of the lower lip , hyperkeratosis and spongiosis were seen , and lymphocytes infiltrated the dermis with exocytosis to the epidermis which was compatible with sjgren s syndrome ( figure 3 ) . high - resolution computed tomography of the chest demonstrated bilateral consolidations in both lower lung zones , associated with bilateral pleural effusion and moderate amount of pericardial effusion ( figure 4 ) . there was dense lymphoplasmacytic infiltration in the interstitium of the lung parenchyme ( figure 5a ) and the pleura forming reactive lymphoid follicles with germinal centers ( figure 5b ) . multifocal areas of vasculitis ( figure 5c ) and interstitial fibrosis were shown without any fibroblastic plug or honeycombing cystic change . the immunohistochemical stains failed to reveal monoclonality of these lymphocytic infiltrations as below ; lca ( cd45rb ) ( + ) , cd3 ( + ) and l26 ( cd20 ) ( + ) . in situ hybridization of paraffin block tissue with anti - ebstein - barr virus antibody ( ncl - ebv - k , novocastra lab , uk ) was positive . the patient was treated with prednisolone of 1 mg / kg / day for one month . but , she had no improvement on radiologic finding and showed generalized edema as an adverse effect of steroids . with prednisolone tapering , she was also added oral cyclophosphamide 50 mg / day . following this therapy , her condition significantly improved in subjective symptoms , physical signs and objective pulmonary function and radiologic findings ( figure 1c ) . the inflammatory laboratory markers were still slightly increased , but pulmonary function test and chest radiograph were nearly normalized . lymphocytic interstitial pneumonitis ( lip ) , first described by carrigton and liebow in 1966 , is the term used to describe diffuse interstitial infiltrations of the lung , predominantly consisting of a polymorphic mixture of mature lymphocytes and plasma cells . it is characterized radiologically by bilateral lower lobe infiltrates , and histologically by a polymorphic lymphoplasma cell infiltration of the pulmonary interstitium . the cause of lip is unknown , yet various hypotheses have been suggested , including autoimmune phenomenon such as immune complex diseases ; a viral infection such as hiv and e - b virus ; chronic stimulation of the reticuloendothelial system by an unknown antigen and a delayed hypersensitivity reaction to an unknown stimulant . it may be idiopathic or associated with acquired or congenital abnormal immunologic responses , connective tissue disease ( especially systemic lupus erythematosus and sjgren s syndrome ) , allogenic bone marrow transplantation , primary biliary cirrhosis , hashimoto s thyroiditis and/or myasthenia gravis . some patients have been reported to have an associated monoclonal gammopathy , usually igm , but occasionally igg in type . although sle can occasionally be associated with usual interstitial pneumonia ( uip ) and various lymphomas , it is not usually known to coexist with lip . our patient developed sle characterized by fever , multiple arthritis , pericarditis , proteinuria and hemolytic anemia , and a positive ana test which was done according to the american college of rheumatology criteria for the diagnosis of sle . the hypothesis that e - b virus is related to the pathogenesis of lip seems quite logical , since this virus is known to provoke polyclonal lymphoid proliferations and has been demonstrated in the salivary glands of patients with sjgren s syndrome . some researchers have reported the finding of the e - b virus genome in the lungs of patients with lip , suggesting ebv may be the antigen that promotes the proliferation of b lymphocytes in the interstitium . nevertheless , it has not been determined whether e - b virus is essential in the development of non - aids associated lip . the observation of e - b virus as the only etiologic agent in lip , together with the variety of systemic disorders associated with lip , the diversity of the infiltrated cell populations and the variability of the clinical course is consistent with the view of lip as a morphological expression of a variety of different disease processes . further investigation will be required to determine whether ebv is indeed etiologic in a subset of lip ( for example , patients with sjgren s syndrome ) or its presence simply reflects polyclonal expansion of lymphocytes carrying a latent e - b virus infection . in this case , the presence of the e - b virus genome was detected by anti - e - b virus antibody using in situ hybridization technique . however , the pathogenesis of lip is unknown , although hiv rna or e - b virus dna has been demonstrated in some cases by in situ hybridization and polymerase chain reaction ( pcr ) . the age range of patients with lip varies and the median age of patients was 56 years . the most common symptoms of lip are cough , dyspnea and significant loss of weight . symptoms of fever , malaise and pleuritic chest pains occur less commonly . the chest radiographs of lip patients vary and most often reveal bibasilar diffuse infiltrates and sometimes nodular lesions . soft and fluffy alveolar densities though pleural effusion is infrequent , it suggests a complication of lymphoma or collagen vascular diseases . honeycombing and pulmonary hypertension are also late manifestations pulmonary function studies of lip have revealed both a restrictive defect and a low co diffusing capacity . a definite diagnosis of lip can be based on lung biopsy findings , especially in the early stage . microscopically , the lip lung shows a predominantly interstitial cellular infiltrate that diffusely involves the distal parenchyma . the infiltrate is composed of a mixture of mature small lymphocytes , plasma cells and histiocytes that widen the alveolar septa and surround small airways and vessels . interstitial lymphoid cells by immunohistochemical staining generally show up as t cells , except in the germinal centers where they stain as b cells . loose aggregates of epithelioid histiocytes and poorly formed sarcoid - like granulomas , often containing multinucleated giant cells can also be seen . a variable amount of fibrosis accompanies the cellular infiltrate , and type ii pneumocyte hyperplasia is usually prominent , but necrosis is absent . pseudolymphoma , hypersensitivity pneumonia , nonspecific interstitial pneumonia ( nsip ) and a number of lymphoproliferative disorders such as small lymphocytic lymphoma , chronic lymphocytic leukemia , plasma cell myeloma , angioimmunoblastic lymphadenopathy and lyphomatoid granulomatosis ( lyg ) enter the differential diagnosis of lip . pseudolymphoma of the lung is histologically similar to lip , but radiographically different because it causes isolated mass - like densities rather than diffuse infiltrate . lymphomatoid granulomatosis differs pathologically in that there is prominent vascular involvement , extensive parenchymal necrosis and the presence of atypical lymphoid cells . cross - country fashion rather than being confined to the intestitium . in this case , a condition with multifocal vasculitis is difficult to distinguish from lyg , but immunohistochemically , the possibility of lyg is decreased because monoclonality is not predominant . possible outcomes include resolution followed by corticosteroid therapy , progression to pulmonary fibrosis , superimposed lung infection , cor pulmonale or uncommonly lymphoma develop . those patients treated accordingly have shown a good response to corticosteroid treatment , which led to complete resolution of the lung infiltrates . in summary , we experienced a case of lymphocytic interstitial pneumonitis associated with the immunological expression of e - b virus in sle and sjgren s syndrome .

calculating nonsynonymous ( ka ) and synonymous ( ks ) substitution rates is a useful way for evaluating sequence variations for protein orthologs across different species or taxonomical lineages with unknown evolutionary status . furthermore , it is often important to recognize positively selected sites and to identify genes with selective hotspots . there have been numerous methods and software tools developed for such purposes in the public domain , including paml ( 1 ) , mega ( 2 ) , dnasp ( 3 ) , hyphy ( 4 ) and certain modules from bioperl ( 5 ) . however , after careful simulations and real data analysis , we believe that a single method will not be readily identified to be used under all circumstances 6 , 7 , therefore we created the version of the kaks_calculator 1.0 ( 8) , which adopted model - selected and model - averaged techniques to compute ka / ks values by means of a group of existing nucleotide substitution models . since the majority of dna sequence sites are considered to be invariable due to functional restraints and evolutionary distances , the selective pressure varies among different sites in a sequence , thus ka / ks calculations only based on the entire gene are not enough to detect the individual sites subjected to adaptive selection . to conquer this problem , a sliding window strategy has been introduced to several web servers such as swapsc ( 9 ) and wspmaker ( 10 ) , while these tools adopted fewer ( mostly one ) models for ka and ks calculations . here we provide an updated version of kaks_calculator , which solves these two questions in a simple way . , unlike the existent ka / ks algorithms , the new software can take the variable mutation rates across sequence sites into account , which contain vital information for molecular evolutionary studies . we created seven related methods namely -ng , -lwl , -mlwl , -lpb , -mlpb , -yn and -myn by introducing gamma distribution to model the mutation rates ; the importance of the new methods has been demonstrated as the ignorance gives rise to biased computational results 11 , 12 . we therefore implemented these new methods into the updated core tool of version 2.0 , whose core toolset has seventeen algorithms including seven original approximate methods , seven gamma - series methods , one maximum likelihood method ( gy ) , and two expanding methods ( model selected and model averaged ) . the methods provide not only the values of ka , ks and ka / ks , but also other key information from paired orthologous sequences , including the number of synonymous / nonsynonymous sites , substitutions , divergence time , substitution - rate - ratio , gc content , and aicc . split , plot , dpss to evaluate adaptive selection at the gene sequence level . as an expanding toolset , they adopt a sliding window with user s definition on window length and step length . split is responsible for the division of the raw paired orthologous sequences into portions on the basis of dynamic windows in the positive direction . plot deals with the outcome of the core toolset after the nucleotide sequences from split have been computed , resulting in a massive collection of figures illustrating ka , ks and ka / ks ( omega ) in intervals . third , it should be emphasized that all above - mentioned processes are capable of handling massive data in a timely fashion . in particular , all transferrable data including sequences and resulting information are contained in a single file . we provide executable files as well as source codes for the package and tested all programs on both windows 2000/xp / vista and linux ( red hat 3.4.6 - 8 ) platforms . the toolkit is freely available ( licensed under gplv3 ) online at https://sourceforge.net / projects / kakscalculator2/. in order to conveniently update the algorithm and to friendly communicate with users , we implement the new version with a therefore , the integrated software is divided into two essential parts to better serve for different functionality : the core toolset that calculates ka and ks , and the expanding toolset that is responsible for additional computation activities based on the ka and ks calculation ( e.g. , with a sliding window strategy ) ( figure 1 ) . in the core toolset , we design the gui with visual c++ s mfc ( microsoft foundation classes ) that manages documents and allows users to view the objects , and the entire program is object - oriented . each main method has its own class in the code and the multi - thread operations among them use the cpu time allocations very efficiently . we adopt java-6 to program the expanding toolset because of its advantages across different platforms . we choose r language ( http://www.r-project.org/ ) to draw high - level graphics from inputting data . to call for the r function from java , we employ a package named rserve ( http://www.rforge.net/rserve/index.html ) , which is a program responding to requests from clients based on the tcp / ip protocol . in details , we use java to invoke the jrclient suite and connect it after rserve starts on r environment ; under this circumstance each connection has its workspace and directory . moreover , the server allows many clients to plot their data simultaneously . in consideration of the running speed , it is so fast that a graph covering thousands of data points can be plotted in a few seconds . we have evaluated the performance of the gamma - series methods in ka / ks calculations in previous studies 11 , 12 . in the process of identifying positively selected sites , we have also successfully applied the toolbox to two real cases , including the animal alpha - defensin genes investigated in lynn et al . ( 13 ) and the tas1r3 ( taste receptor type 1 member 3 ) genes reported to be responsible for the ability to recognize the sweetness ( 14 ) ( figure 2 ) . it is important to combine the gamma - series methods with a sliding window strategy ; the former represents the variation of raw mutation across sites and the latter reveals if each site is driven by different selective pressure based on the assumption that the omega ( ka / ks ) values are not equal across orthologous gene sequences . in particular , when window slices become dense enough , it approaches the site models ( 1 ) , similar to the thought of integral definition in mathematics . we believe that the software provides an excellent choice when one calculates for positively selected sites . a final note is that we will construct ancestral sequences for the measurement of lineage - specific selective strength in our next update . zz supplied several bug reports and modified schemes in the previous version of the software . zz supplied several bug reports and modified schemes in the previous version of the software .

a 23-year - old female was accidentally exposed to a q - switched nd : yag laser operating at 1064 nm in october 2002 . the laser fired inadvertently while the patient was adjusting target without the use of her protective goggles . immediately after the exposure , she experienced a bright flash of light followed by a sudden loss of vision in her right eye . pulse duration and energy density fundoscopic examination of the right eye revealed a macular laser burn and vitreous hemorrhage ( fig . corticosteroids , in the form of 60 mg prednisolone , were administered orally with a 10 mg per week taper . the following day , her visual acuity remained 20/100 od , and fluorescein angiography revealed a round area of hypofluorescence with early and late macular hyperfluorescence ( fig . nineteen days following the exposure , visual acuity remained at 20/100 od and fundoscopic examination revealed a small amount of vitreous hemorrhage and a distinct epiretinal membrane ( fig . seven weeks later , the epiretinal membrane had extended and the retinal folds became more prominent , though there was no change in visual acuity . six months later , the patient continued to have a visual acuity of 20/100 od and fundoscopic examination at that time revealed spontaneous regression of the epiretinal membrane and a prominent chorioretinal scar with central pigmentation at the site of injury ( fig . 4 ) . visual acuity assessment and fundoscipic photography were performed at three month intervals , but did not reveal significant changes . six years later , the patient 's visual acuity remained at 20/100 od and fundoscopic examination demonstrated the continued presence of a chorioretinal scar with more prominent central pigmentation compared to previous visits ( fig . 5 ) . at six years q - switched nd : yag laser injuries result in disruption of the choriocapillaris , bruch 's membrane , and the retinal pigment epithelium . the presence of subretinal and vitreous blood suggests that the major site of injury is the choriocapillaris . previous cases of accidental nd : yag laser injuries include several common features such as retinal and vitreous hemorrhage.4,5 here , we describe a case of nd : yag laser injury with six year follow - up . the exposure resulted in the presence of vitreous hemorrhage , which likely acts as a stimulant for fibroglial proliferation , resulting in an epiretinal membrane . the ensuing retinopathy is based on the development of a contractile membrane on either the internal or external surface of the retina . in the present case , a previous report described the presence of striae resulting from contraction of the laser scar in lieu of a membrane.3 at 20 months follow - up , our patient demonstrated spontaneous regression of the epiretinal membrane by slit lamp ophthalmoscopy using a 78d lens rather than by optical coherence tomography . in contrast to previously reported cases,4 - 7 the best corrected visual acuity failed to recover , even after spontaneous resolution of the epiretinal membrane . in addition , the patient did not experience macular hole or cyst formation , though they are common findings in nd : yag laser injuries.4 - 7 furthermore , we were unable to identify any choroidal neovascularization within the 6 year follow - up period , which is known to occur by intense laser photocoagulation breaking the retinal pigment epithelium - bruch 's membrane - choroid complex.8 a systemic corticosteroid was administered orally in an attempt to decrease the extent of injury by reducing the cellular response . corticosteroids remain the most widely employed treatment for laser injuries.9 laser devices are playing an increasingly large role in modern industry , research and medicine . this has led to a concomitant increase in laser - induced injuries , particularly ocular injuries as energy focuses on the retina . gabel et al.10 have reported cases of unnoticed laser burns on routine eye examination in workers using laser devices . further research is required to better define the mechanisms of tissue damage and improve existing therapy and protection to meet the demands of the increasing threat due to expanding laser application .

a nasolabial cyst is an uncommon lesion that occurs in the soft tissue of the midface ( 1 , 2 ) . nasolabial cysts are non - odontogenic cyst and develop lateral to the midline of the maxillary lip and alar base ( 3 ) . they usually present as a swelling in the nasolabial fold , causing alar nose elevation and upper lip projection ( 4 ) . many reports hold that surgical removal through a sublabial approach is the standard treatment of nasolabial cysts ( 3 , 5 , 6 ) . although the surgical outcome of this method is generally successful , complications associated with the procedure include facial swelling , gingival numbness , decreased sensation of the teeth , and wound infection ( 4 , 7 ) . in 1999 , transnasal marsupialization was proposed as an alternative treatment method , and this technique has demonstrated several benefits compared to the conventional sublabial approach ( 4 , 8) . however , no prospective study had compared these two techniques . thus , we compared the surgical procedure , operating time , postoperative pain , complications , and recurrence rate between the two surgical methods . this prospective study examined patients who were diagnosed with a unilateral nasolabial cyst between january 2002 and december 2007 . the diagnosis was based on the clinical presentation , anatomical location , and computed tomography ( ct ) findings . the patients were allocated randomly into two groups according to the surgical technique . for patients in the sublabial approach group ( 10 cases ) , the cysts were excised completely through a sublabial incision , while for patients in the transnasal marsupialization group ( 10 cases ) , the cysts were marsupialized transnasally under the guidance of nasal endoscopes . informed consent was obtained from all of the patients , and the study was approved by the institutional review board . in the sublabial approach group , the surgical procedure was performed under local or general anesthesia according to the patient 's preference ( 3 and 7 patients , respectively ) . the upper gingivobuccal sulcus was incised just below the pyriform aperture , and the tissues were dissected until the smooth , well circumscribed cystic lesion was exposed . in each case , the cyst was completely extraosseous with no adhesion to the underlying bone ( fig . although the cyst was easily removed from surrounding soft tissues in some cases , tearing or rupture of the cyst occurred in other patients and part of the nasal floor mucosa was removed with the cyst because of difficult dissection between them . however , the cyst was completely removed without remnant cystic wall or epithelium in all of the cases and defect of the nasal floor mucosa was not a serious problem because the bleeding was easily controlled and the nasal mucosa rapidly healed by re - epithelialization . the incision was closed with 4.0 vicryl ( ethicon , somerville , nj , usa ) and a compression dressing was applied to reduce soft tissue swelling . the nasal cavity was anesthetized topically and decongested using cotton pledgets soaked in a solution of 2% lidocaine and 0.1% epinephrine . the anterior nasal cavity , vestibular area , and mucosal surface over the cyst were infiltrated locally with 2% lidocaine containing 1:100,000 epinephrine . 2 ) . under the guidance of rigid , straight , 4-mm diameter 0 and 30 nasal endoscopes ( karl storz , tuttlingen , germany ) , the opening of the cyst was widened with a microdebrider ( medtronic xomed , jacksonville , fl ) to at least 1010 mm in size ( fig . nasal packing was not necessary because the bleeding was easily controlled with bosmin ( jeil pharmaceutical co. , seoul , korea ) gauze and the patients were discharged after several hours of observation . the patients of each group were scheduled for follow - up once a week for 4 weeks , then the patients visited the office at 3 , 6 , and 12 months after the procedure . no patient was dropped out of the study during the 1-year follow - up period . the pure operating time was measured excluding the anesthetic induction and recovery times . patients in each group were asked about the severity of postoperative pain using a visual analog scale ( vas ) in which a score of zero indicated no pain , while a score of 10 indicated extreme pain . during the follow - up period , the patients were asked whether they experienced any of the following symptoms after the procedure : cheek swelling , facial pain , facial bruising , facial tingling , facial numbness , numbness of the teeth or gingiva , and nasal bleeding . recurrence was evaluated according to the patient symptoms and postoperative ct findings performed at 1 yr after the procedure . 12.0 ( spss inc . , chicago , il , usa ) , and statistical significance was defined as p<0.05 . this prospective study examined patients who were diagnosed with a unilateral nasolabial cyst between january 2002 and december 2007 . the diagnosis was based on the clinical presentation , anatomical location , and computed tomography ( ct ) findings . the patients were allocated randomly into two groups according to the surgical technique . for patients in the sublabial approach group ( 10 cases ) , the cysts were excised completely through a sublabial incision , while for patients in the transnasal marsupialization group ( 10 cases ) , the cysts were marsupialized transnasally under the guidance of nasal endoscopes . informed consent was obtained from all of the patients , and the study was approved by the institutional review board . in the sublabial approach group , the surgical procedure was performed under local or general anesthesia according to the patient 's preference ( 3 and 7 patients , respectively ) . the upper gingivobuccal sulcus was incised just below the pyriform aperture , and the tissues were dissected until the smooth , well circumscribed cystic lesion was exposed . in each case , the cyst was completely extraosseous with no adhesion to the underlying bone ( fig . although the cyst was easily removed from surrounding soft tissues in some cases , tearing or rupture of the cyst occurred in other patients and part of the nasal floor mucosa was removed with the cyst because of difficult dissection between them . however , the cyst was completely removed without remnant cystic wall or epithelium in all of the cases and defect of the nasal floor mucosa was not a serious problem because the bleeding was easily controlled and the nasal mucosa rapidly healed by re - epithelialization . the incision was closed with 4.0 vicryl ( ethicon , somerville , nj , usa ) and a compression dressing was applied to reduce soft tissue swelling . the nasal cavity was anesthetized topically and decongested using cotton pledgets soaked in a solution of 2% lidocaine and 0.1% epinephrine . the anterior nasal cavity , vestibular area , and mucosal surface over the cyst were infiltrated locally with 2% lidocaine containing 1:100,000 epinephrine . 2 ) . under the guidance of rigid , straight , 4-mm diameter 0 and 30 nasal endoscopes ( karl storz , tuttlingen , germany ) , the opening of the cyst was widened with a microdebrider ( medtronic xomed , jacksonville , fl ) to at least 1010 mm in size ( fig . 3 ) , and the cyst margins were trimmed to make smooth surface . nasal packing was not necessary because the bleeding was easily controlled with bosmin ( jeil pharmaceutical co. , seoul , korea ) gauze and the patients were discharged after several hours of observation . the patients of each group were scheduled for follow - up once a week for 4 weeks , then the patients visited the office at 3 , 6 , and 12 months after the procedure . no patient was dropped out of the study during the 1-year follow - up period . patients in each group were asked about the severity of postoperative pain using a visual analog scale ( vas ) in which a score of zero indicated no pain , while a score of 10 indicated extreme pain . during the follow - up period , the patients were asked whether they experienced any of the following symptoms after the procedure : cheek swelling , facial pain , facial bruising , facial tingling , facial numbness , numbness of the teeth or gingiva , and nasal bleeding . recurrence was evaluated according to the patient symptoms and postoperative ct findings performed at 1 yr after the procedure . , chicago , il , usa ) , and statistical significance was defined as p<0.05 . the most common presenting symptom was swelling around the nose ( 10 patients , 50% ) , followed by pain ( 6 patients , 30% ) , and nasal obstruction ( 4 patients , 20% ) . when we explained the surgical technique , many patients in the sublabial approach group were fearful of the procedure and chose general anesthesia , while most of the patients in the transnasal marsupialization group agreed to local anesthesia . the mean operating time in minutes was 46.45.1 in the sublabial approach group and 18.34.2 in the transnasal marsupialization group , which differed significantly ( p=0.002 , mann - whitney u - test ) . the vas of postoperative pain was 6.11.2 and 3.50.8 in the sublabial approach and transnasal marsupialization groups , respectively ( p=0.01 , mann - whitney u - test ) . during the follow - up period , eight patients in the sublabial approach group experienced one or more complications , including facial swelling , facial pain , facial bruising , and gingival and teeth numbness . all of these complications resolved spontaneously within 4 weeks after the procedure and no permanent complications occurred . no patients had other adverse effects , including facial tingling sensation , nasal bleeding , hematoma , or wound infection . after a 1-yr follow - up period , physical , endoscopic , and ct evaluations revealed no recurrent lesion or obstruction of the marsupialized cyst opening in either group . generally , excision through a sublabial approach has been accepted as the treatment of choice for nasolabial cysts ( 3 , 5 , 6 ) . however , su et al . ( 4 ) performed a new transnasal marsupialization method in 17 cases , which resulted in no recurrences , and other study has reported case series using this technique ( 2 ) . chen et al . ( 8) have recently reported microdebrider - assisted endoscopic marsupialization for the nasolabial cyst . they compared three types of surgical procedures including the sublabial approach ( 10 cases ) , conventional transnasal marsupialization ( 13 cases ) , and microdebrider - assisted marsupialization ( 8 cases ) . however , their study was conducted as a retrospective manner and no randomization was performed , which would be a limitation of the study . although transnasal marsupialization has been reported to have advantages over the conventional approach by some authors , no prospective study had directly compared these two surgical techniques . in terms of the surgical procedure and operating time , transnasal marsupialization was much easier and quicker than the sublabial approach because it took time to elevate the gingival flap and dissect the cyst from the surrounding structures . in contrast , transnasal marsupialization required only sufficient widening of the cyst roof using a microdebrider under direct endoscopic vision , and the bleeding from the mucosal surface was controlled easily with bosmin gauze . moreover , most of the patients in the transnasal marsupialization group did not require hospitalization because the surgery was performed under local anesthesia in an outpatient setting . the postoperative pain measured using the vas was also superior in the transnasal marsupialization group . in the sublabial approach group , the mucosal incision and retraction of the upper lip during the operation could cause more pain and soft tissue swelling than transnasal marsupialization . eight patients in the sublabial approach group also experienced one or more complications , such as facial swelling , facial pain , facial bruising , and gingival and teeth numbness . although these side effects resolved within 4 weeks in all cases , some patients complained of great discomfort and expressed concern that the symptoms would persist permanently , especially those with numbness of the gingiva . in the transnasal marsupialization group , three patients had mild cheek swelling that resolved within 1 to 2 weeks after the procedure . therefore , both the sublabial approach and transnasal marsupialization are effective methods for treating nasolabial cysts in terms of the surgical outcome . after marsupialization , rapid epithelialization and a persistent opening were obtained because the cut edges of the nasal mucous membrane and the cyst lining were matched closely ( 4 ) . however , if too small a window is made in the cyst , the annular scar surrounding the ostium will shrink rapidly and may be soon followed by mucus accumulation in the pocket or recurrence of the cyst . therefore , a wide opening should be made to avoid recurrence ( 2 , 4 ) . in this study , although the size of the marsupialized cyst and opening decreased during the follow - up period in patients of the transnasal marsupialization group , no obstruction of the opening was observed in any of the patients ( fig . histopathologically , a nasolabial cyst is a true cyst with an inner lining of ciliated respiratory epithelium ( 3 - 5 , 9 , 10 ) . marsupialization is believed to convert a nasolabial cyst into an air - containing sinus covered with ciliated respiratory epithelium similar to the mucosa of the paranasal sinuses and nasal cavity . it may act like a normal paranasal sinus with ventilation and drainage functions , resulting in the absence of mucus accumulation ( 4 ) . in our series , mucus accumulation and recurrence of the cyst , which are potential complications of transnasal marsupialization , were not observed during the follow - up period . although both methods had successful surgical outcomes , we believe that transnasal marsupialization is a more useful procedure for the treatment of nasolabial cysts than the conventional sublabial approach because it has the benefits of a shorter operating time , no hospitalization , less postoperative pain , and low complication rate . a limitation of our study was the small number of patients included in each group . nasolabial cysts are relatively rare and account for only 0.7% of all maxillary and mandibular cysts ( 3 ) . since no other prospective study has compared the effectiveness of transnasal marsupialization with the conventional sublabial approach , we believe that our report has value in demonstrating the benefits of transnasal marsupialization in the random prospective manner . it is easily and safely performed under local anesthesia in an outpatient setting . in addition , the shorter operating time , reduced postoperative pain , and low complication rate are advantages of this technique . therefore , we propose that transnasal marsupialization be the treatment of choice for nasolabial cyst , replacing the conventional sublabial approach .

many disorders may show signs of meningeal irritation and increased icp including the infectious causes of meningitis either bacterial , viral , rheumatic diseases , hemorrhage and malignancies . among these causes infectious causes of meningitis are still an important cause of morbidity and mortality in children worldwide , so high index of suspicion , prompt diagnosis , and aggressive management are essential to reduce mortality and morbidity . routine analysis of cerebrospinal fluid ( csf ) is not always efficient for distinguishing bacterial from a bacterial meningitis . the use of biological markers , especially cytokines and acute phase proteins , has been proposed to facilitate the accuracy of the initial diagnosis of meningitis but the results were conflicting and none of them are used in clinical routine . several serum biomarkers have been identified in recent years that have the potential to help diagnose local and systemic infections , differentiate bacterial and fungal infections from viral syndromes or noninfectious conditions , prognosticate , and ultimately guide management , particularly of antibiotic therapy . among these numerous studies have investigated the potential roles of procalcitonin in diagnosing and managing local and systemic infections . there is some evidence that procalcitonin is more specific for bacterial infections , with serum levels rising at the onset of infection and falling rapidly as the infection resolves , as compared with other markers . in contrast to most classical pro inflammatory cytokines which increase only briefly and intermittently in severe bacterial infections such as ; c - reactive protein ( crp ) that reaches its maximum serum levels only 2448 hours after the onset of infections , serum procalcitonin ( pct ) levels increase early ( within 4 hours ) after injection of bacterial endotoxins and it is stable with long half - life . experimental studies revealed that pct acts as a modulator of the inflammatory , immunologic host reaction and the treatment with pct - reactive antiserum increased the survival of septic animals . pct is more than just a marker in bacterial infection ; it might offer a new hope for more effective treatment options in sepsis . a prospective study of forty five patients with clinical suspicion of acute meningitis ( 26 males and 19 females ; age range 1 to 60 months ) . all patients were admitted to al - zahra teaching hospital in al - najaf city in the period from april to october 2013 for suspicion of acute meningitis . patients with evidence of other systemic or local infection or evidence of thyroid or parathyroid disorders were excluded . taking clinical history and thorough physical examination was done in all patients by senior house officer resident doctor . lumbar puncture was done using sterile needles and the csf sample analyzed for glucose , protein and cytology . 2 ml of blood was collected from each patient in an edta tube and sent for complete blood count analyzer ( sysmex automated hematology analyzer , kx-21n , japan ) , another 5 ml of blood was collected in a plan serum tube and sent for crp level using ( enzymatic heterogeneous sandwich immunoassay ) and 2 ml of blood for procalcitonin level using an immunoluminometric assay eliza m6 , usa in which the serum was separated and frozen to 20 centigrade until the time of measurement ( not more than 3 months ) when dissolved and analyzed . depending on the clinical history and physical examination ( fever , abnormal movement , irritability , bulging fontanel , meningeal irritation signs ) and findings of csf ( increased protein > 0.2g / l , decreased glucose ratio < 0.4 , leukocyte count > 150010/l and polymorph nuclear leukocyte domination ) , 29 patients were included in the suspicious of bacterial meningitis group and 16 patients with none of the above findings were regarded as nonbacterial meningitis group . due to relatively high rate of false negative csf cultures in our hospital s laboratory and delay in maintaining results , the csf culture was not regarded as parameter in differentiating the cases in both groups . all patients with suspicion of meningitis admitted to pediatric ward were treated with the standard management and followed until discharge . parents of eligible newborns were approached for participation in the study and informed consent was obtained from them . study was approved by ethical and scientific committee of the hospital and college of medicine , university of kufa . primary outcome was to evaluate the procalcitonin as a marker for diagnosis of bacterial meningitis , secondary outcome to compare and assess procalcitonin sensitivity and specificity . statistical analysis was done using spss version 20.0 ( statistical package for the social sciences , chicago , il ) . data were expressed as number and percentage for qualitative variables , meanstandard deviation for quantitative ones , chi square test and student t test were used to compare and roc curve used for the sensitivity and specificity . from the 45 patients enrolled in this study , 26 patients were clinically diagnosed as bacterial meningitis and 19 patients with no evidence of bacterial causes of meningitis . the mean age of the studied population was ( 17.717.6 ) months and 58% were females . the most common clinical presentations were fever ( 97.7% ) , vomiting ( 93.3% ) and convulsions ( 73.3% ) , as shown in table 1 . characteristics and clinical features of all studied groups the csf neutrophil cell count and protein were higher in bacterial meningitis group than in nonbacterial ( p<0.05 ) and glucose level was lower ( p<0.05 ) . the total white blood cell ( wbc ) the procalcitonon serum level was significantly higher in bacterial group as well as crp positive cases ( p=0.001 ) as shown in table 2 . procalcitonin test has higher sensitivity , specificity ( 79% , 81% ) and positive and negative predictive values than crp and wbc count for diagnosis of bacterial meningitis as shown in table 3 . serum procalcitonin has more area in roc curve than wbc count and crp ( 0.769 , 95%ci : 0.62 - 0.91 ) , as shown in fig . laboratory findings of csf and blood tests in all studied groups wbc : white blood cell ; crp : c - reactive protein validity of procalcitonin , crp and wbc in diagnosis of bacterial meningitis wbc : white blood cell ; crp : c - reactive protein roc curve for wbc : white blood cell , crp : c - reactive protein and serum procalcitonin in this prospective analytic study of a group of pediatric patients with clinical diagnosis of meningitis , it is confirmed that a high serum pct level is the best biological predictor for distinguishing between bacterial and aseptic meningitis in children presenting to ed . clinical criteria are unable to distinguish between bacterial and aseptic meningitis with high sensitivity . gram - stain and bacterial antigen testing of cerebrospinal fluid ( csf ) is highly specific , but not 100% sensitive biologic markers in blood ( c - reactive protein [ crp ] , white blood cell [ wbc ] count , neutrophil count ) or csf ( protein , glucose , wbcs , and neutrophils ) may improve sensitivity for the etiologic diagnosis . serum procalcitonin ( pct ) appears to have sensitive and specific early predictive value for bacterial infection . we assessed the value of biologic tests in predicting the etiology of meningitis in children with clinical acute meningitis and csf pleocytosis . the results of roc curve comparisons and univariate and multivariate analyses of potential biologic tests identify serum pct cut off ( 500 pg / dl ) , and it would be necessary to lower the threshold of pct to ( 200 pg / dl ) to get 100% sensitivity for the diagnosis of bacterial meningitis . all studies on procalcitonin in children with sepsis , septic shock , or meningitis report that procalcitonin is an excellent marker of severe bacterial infection and that it has a diagnostic performance significantly greater than that of crp concentration and leucocyte count . sensitivity and specificity of procalcitonin varied from 83% to 100% and from 70% to 100% , respectively . for crp , sensitivity and specificity were in a lower range ( 7388% and 5089% , respectively ) which is in agreement with results in this study ( sensitivity 79.3% , specificity 81.2% , roc 0.769 , 95% ci 0.624 - 0.915 , p=0.003 ) , all more than crp , and wbc count . the diagnostic value of procalcitonin was excellent , both for discriminating between viral and bacterial infections and between invasive and localized bacterial infections . although pct level is probably the best biological predictor currently available to distinguish between bacterial and aseptic meningitis , it can not be used alone with 100% sensitivity and good specificity regardless of the threshold chosen . some rare pediatric and adult patients with bacterial meningitis may have an initially low pct level and some investigators have not found the pct level to be this sensitive , especially in adult populations . the use of a recently developed and more sensitive pct assay ( kryptor ; brahms diagnostica ) and a follow - up measurement ( within hours after admission ) may increase the sensitivity of the pct level . another way to increase the sensitivity of a diagnosis tool while retaining high specificity might be the combination of pct level at admission with other predictors in a clinical decision rule . the introduction of the pct in a modified - bms might enhance sensitivity while maintaining high specificity . this study has a limitation , we could nt use a strong evidence to confirm bacterial meningitis like csf culture or pcr . the csf culture had high rate of false negative results in our situation and also it was a late method to confirm bacterial meningitis which did not go with our goal to find out an early diagnostic method for bacterial infection and also it was a known fact that negative culture does not rule out bacterial infection . we recommend to use pcr as a confirmatory parameter for bacterial meningitis in a future study for more evaluation of procalcitonin as an early marker for bacterial meningitis . serum pct assay might be considered as a simple , easy , sensitive and specific marker for an early diagnosis of acute bacterial meningitis . radhi : data collection and writing and data analysis all author approved final version of the manuscript .

emissary veins traverse emissary foramina of the skull and connect venous sinuses to extracranial veins . although they are valveless and blood may flow in both directions , flow is usually away from the brain . in ordinary usage , emissary foramina an occipital emissary foramen has been traditionally described as a solitary foramen occasionally present in the squamous part of the occipital bone at the occipital protuberance . it transmits the occipital emissary vein that connects the confluence of sinuses with the occipital vein . the emissary vein may also receive the occipital diploic vein [ 2 , 3 ] . this traditional view has now been challenged as the foramen has in the recent studies been found more often near the foramen magnum than the external occipital protuberance [ 46 ] . the present study was done to ascertain the incidence of the foramen in unsexed adult modern human skulls of south indian origin . the position of the foramen was also determined as a comparison of the study with the traditional and existing literature was done . the findings of the study were then correlated to possible clinical manifestations that may arise due to the position and number of emissary foramina if seen on the skull . the study was done on 221 south indian adult modern human skulls of unknown sex in the department of anatomy , st john 's medical college , bangalore . the squamous part of occipital bone was studied for the presence of occipital emissary foramina . the anatomical landmarks used in the study wereexternal occipital crest ( eoc);external occipital protuberance ( eop ) ; posterior border of foramen magnum ( fm ) . external occipital crest ( eoc ) ; external occipital protuberance ( eop ) ; posterior border of foramen magnum ( fm ) . the position and number of foramina were noted . the majority of the foramina were not seen on the eop ( as traditionally described ) . hence they were classified as present to the right , to the left , or on the eoc . a horizontal line was drawn midway between the eop and the posterior margin of fm . the foramina were then classified as near the fm or near the eop depending upon their distance from the midline ( figure 1 ) . a foramen was said to be present only if it transmitted a copper wire of 0.5 mm diameter and went through the bone into the skull . out of the 221 skulls studied , the foramen was observed in 21/221 ( 9.50% ) skulls , 6/21 ( 28.57% ) to the right of , 10/21 ( 47.61% ) to the left of , and 2/21 ( 9.52% ) on the eoc . of these two cases , one single large foramen was observed on the left side of eoc near the eop and the second foramen on the eoc near the fm . in 3 skulls ( 14.28% ) all were near the posterior margin of fm except the one case where a single large foramen was observed on the left side of eoc near the eop . emissary foramina are a byproduct of selection of bipedalism by extant humans . as an upright posture necessitated delivery of blood from the brain to the vertebral veins , venous channels like the enlarged occipital / marginal sinus system , multiple hypoglossal canals , and emissary foramina that conduct the emissary veins developed . these are considered to be epigenetic adaptations for delivering blood preferentially to the vertebral plexus of veins . the occipital foramen occurs at low frequencies throughout the hominid record and is generally seen near the inion . in our study this is higher if we compare it to other studies done in indian population ( table 1 ) . in studies done on north indian skulls , the incidence has varied from a single case in 214 skulls , that is , 0.46% to 2.07% [ 4 , 8 ] . in anatolian skulls the incidence is 2.6% and in bangladeshi skulls it is 14% [ 5 , 6 ] . the foramen in these studies is located near the posterior margin of fm . in a study done by boyd , the incidence of the foramen is 1.6% and is seen near the eop in all cases . in our study , all but one foramen are seen near the fm . in only a single case , the foramen has been observed near the eop ( table 2 ) , ( figure 2(a ) ) . based on the location , the occipital emissary foramen connects : confluence of sinuses with the occipital vein if seen on the eoc near the eop ( 1 case in the present study);marginal sinuses to the occipital vein if seen on either side of fm ( 16 unilateral and 3 bilateral in the study ) ( figure 2(b));occipital sinus to occipital vein if seen on the eoc near the fm ( 1 case in the present study ) , ( figure 2(c));it may also receive the occipital diploic vein . confluence of sinuses with the occipital vein if seen on the eoc near the eop ( 1 case in the present study ) ; marginal sinuses to the occipital vein if seen on either side of fm ( 16 unilateral and 3 bilateral in the study ) ( figure 2(b ) ) ; occipital sinus to occipital vein if seen on the eoc near the fm ( 1 case in the present study ) , ( figure 2(c ) ) ; it may also receive the occipital diploic vein . but in our study , we have found bilateral foramina in 3 cases , all near the foramen magnum ( figure 2(d ) ) . this implies that instead of a single vein , there may be two emissary veins connecting the occipital veins to the occipital sinus or to the marginal sinuses near the foramen magnum . these veins serve to link the vertebral venous plexus with intracranial sinuses above and vertebral , brachiocephalic , and intercostal veins below . due to such rich venous connections , chances of spread of intracranial infections on the other hand , procedures such as radical neck dissections that involve the ligation of internal jugular veins may benefit as now intracranial venous drainage will be assured to the exterior of skull . the position of the foramen is more important than its incidence especially in suboccipital exposure as this procedure is one of the commonest neurological practices for the management of pathologies involving the posterior cranial fossa . these procedures always include the posterior edge of foramen magnum which is either removed en bloc or piecemeal and then replaced . in adults , the dura is tightly adherent to the skull and since it can not be stripped easily at this location , operators have to pay particular attention to avoid tearing walls of occipital sinus . due to the adherence of dura , during the procedure , intermittent massive bleeding from the bone or underlying dura or the sinus is expected and taken care of . but since the majority of the foramina lie near the foramen magnum ( as seen in most of the recent studies and our study as against the traditional view ) , knowledge of their presence and position is essential to rule out unexpected bleeding that may occur when such findings are missed during initial investigations .

japan already has a super - aging society , where 1 in every 5 people is aged 65 years or older . in such an aging population , the issue of pelvic organ prolapse ( pop ) is an increasing concern . japanese gynecologists have traditionally performed curative surgical procedures such as vaginal hysterectomy ( vh ) , anterior and posterior colpoplasty , and circumferential suture of the levator ani muscles for pop and especially for uterine prolapse . however , following reports by a french group of gynecologists of a tension - free vaginal mesh ( tvm ) surgery for the repair of pop using mesh without hysterectomy that has a favorable cure rate and low frequency of complications [ 1 , 2 ] , many japanese gynecologists have switched to using this technique . in certain hospitals , this surgical procedure has replaced vh as the first - line surgical option for pop . pop is attributed to vulnerability of the pelvic floor and often adversely affects quality of life and sexual function [ 3 , 4 ] . it can also distort the lower urinary tract , resulting in stress urinary incontinence ( sui ) and other voiding dysfunctions . the aim of treatment for pop should , therefore , not only aim at anatomical restoration but also at maintaining or improving patients ' quality of life . as many pop patients present with lower urinary symptoms , it is vital that voiding function is evaluated preoperatively . it should also be evaluated postoperatively on followup because several studies have demonstrated that applying transvaginal mesh for anterior vaginal prolapse increases the risk of de novo sui [ 6 , 7 ] . in addition , other complications such as mesh erosion , de novo dyspareunia , and recurrent prolapse have been reported in women who have undergone tvm . at the department of obstetrics and gynecology , shimane university school of medicine , we have employed tvm surgery as the first - line surgical treatment for pop . we report here the clinical outcome of 105 patients with pop who underwent tvm surgery , focusing on the occurrence of pre- and postoperative sui and examining the correlation between pelvic organ prolapse quantification ( pop - q ) stage , predominant prolapsed organ , and residual urine volume . between september 2009 and september 2012 , 105 women with pop underwent the tvm procedure at our department . mean age at surgery was 69.4 8.20 years ; 15 women were 59 years , 37 were 6069 years , 41 were 7079 years , and 12 were 80 years . those women with pop - q stage 2 who provided written informed consent were scheduled for tvm surgery . the presence of preoperative sui was confirmed at the time of surgery and patients were designated into two groups : with and without preoperative sui . in 48 patients , briefly , a monofilament polypropylene mesh ( 25 25 cm , gynemesh ps ; ethicon , somerville , nj ) is cut into a similar shape as that used in the prolift system ( ethicon , somerville , nj ) . a full - thickness incision of the vaginal wall is made following sufficient fluid separation with epinephrine diluted 4 10-fold . the mesh arm on each side is passed into the paravesical region using a modified emmet needle . the anterior subvesical strap into the arcus tendineus fasciae pelvis and the posterior subvesical strap is inserted into the arcus tendineus 1 cm from the sciatic spine . for the p - tvm to correct rectocele and/or uterine prolapse , a posterior colpotomy is performed longitudinally , and the mesh is placed under the vaginal wall . on each side , the mesh strap is passed into the pararectal space through the sacrosciatic ligament to become exteriorized in incisions located outside and below the anus . for total tvm ( t - tvm ) in patients with vaginal stump prolapse following hysterectomy , a one - piece prosthetic mesh consisting of two parts connected to each other is inserted into the anterior and posterior walls . after cystoscopy and digital examination of the rectum , the colpotomy is closed with a 2 - 0 pds running suture without additional colpectomy . patients were discharged 3 days after surgery and monitored for postoperative complications on an outpatient basis at 1 , 3 , 6 , and 12 months postoperatively . postoperative sui was defined as even one episode of a period of increased intra - abdominal pressure that sui patients reported at the 1- and 3-month followups . those patients without preoperative sui who reported experiencing an episode of sui after tvm for the first time were designated as having de novo postoperative sui . for analysis of pop - q stage by age distribution , patients were divided into 4 groups : < 60 years , 6069 years , 7079 years , and 80 years . for the analysis of predominant prolapsed organ by age distribution , we divided the predominant prolapsed organ into cystocele , uterine prolapse , rectocele , and vaginal vault prolapse . statistical analysis was performed using the chi - square test with p < 0.05 taken to indicate statistical significance . the characteristics of the 105 patients who underwent tvm surgery between september 2009 and september 2012 are shown in table 1 . stage iii was most commonly diagnosed pop - q stage ( n = 73 ) , followed by stage ii ( n = 23 ) and stage iv ( n = 9 ) . no significant difference in the degree of pop progression was found for age distribution . in regard to the predominant prolapsed organ , the most common was cystocele in 63 patients ( 60% ) , uterine prolapse in 29 ( 27.6% ) , vault prolapse in 7 ( 6.7% ) , and rectocele in 6 ( 5.7% ) . no significant difference was found between the pop primary lesion and age distribution , as shown in table 2 . almost half of the 105 patients who underwent tvm surgery had preoperative sui ( n = 50 ) . no significant difference in the frequency of preoperative sui was seen between the age groups . in addition , irrespectively of pop - q stage or predominant prolapsed organ , there was no significant relationship observed with the presence of preoperative sui ( table 3 ) . analysis of the occurrence of postoperative sui revealed that from the 55 patients who did not have preoperative sui , 28 ( 50.9% ) did not have sui postoperatively ; the remaining 26 ( 47.3% ) had de novo postoperative sui . no differences were observed in the postoperative sui incidence rate due to differences in the predominant prolapsed organ or when investigated by pop - q classification ( data not shown ) . of the 50 patients with preoperative sui , 14 ( 28.0% ) reported no postoperative sui and the remaining 35 ( 70% ) observed the same degree of sui as they had preoperatively ( table 4 ) . from among the 26 patients with de novo postoperative sui , of these 23 patients , 5 ( 21.7% ) reported the resolution of sui and 8 ( 34.7% ) reported that symptoms were milder despite still being present . these 13 patients who experienced resolution or alleviation comprised half of those in whom de novo sui appeared postoperatively following tvm . anticholinergics were prescribed for the 4 patients whose symptoms did not improve , and of these , 1 patient underwent incontinence surgery using tension - free vaginal tape ( tvt surgery ) ( table 5 ) . when the 35 patients with preoperative sui and in whom sui persisted after tvm were asked about the course of their symptoms at the 3-month followup , 25 ( 71.4% ) reported that sui was the same as preoperatively and 10 patients ( 28.6% ) reported that it had worsened . of these , 4 patients ( 11.4% ) were prescribed medication ( table 6 ) . residual urine volume measurements taken in 48 patients prior to tvm surgery were investigated with relation to sui . when the number of patients with a preoperative residual urine volume 50 ml and those with volume < 50 ml was compared according to pop - q stage , no relationship was observed between them . there was also no relationship observed between the presence of preoperative sui and preoperative residual urine volume ( table 7 ) or between preoperative residual urine volume and the presence of postoperative sui ( table 8) . de novo sui is one of the complications of pop surgery in patients without preoperative sui [ 10 , 11 ] . in the present study , patients who underwent pop surgery at shimane university hospital in the past 3 years were studied retrospectively to investigate the relationship between sui and pop . firstly , the pop - q stages of 105 patients who underwent tvm surgery were classified by age , but there were no significant differences in terms of the degree of pop progression and age distribution . in addition , even when pop was classified according to a report by delancey , where injury at stage i leads to uterine and vault prolapse , and injury at stage ii leads to cystocele and rectocele formation , no difference was observed between the age groups when predominant prolapsed organ was compared . these results do not show that pop itself progresses as age increases but rather that there are no differences between the age groups when the main site of injury is compared . pelvic organ prolapse not only consists of the symptoms of organ descent but also causes a high rate of lower urinary tract symptoms , including difficulty in voiding , dysuria , and incontinence . in the present study , the presence of preoperative sui in 105 patients who underwent mesh surgery was investigated . there was no difference in the presence of sui between patients with and without preoperative sui , regardless of whether the presence of sui was investigated by age , pop - q stage , or by predominant prolapsed organ . this is consistent with a report by araki et al . stating that the detrusor muscle function is widely distributed in pop patients . postoperative sui is a well - known complication of pop surgery , but even in our study , 47.3% of the 55 patients without preoperative sui experienced de novo postoperative sui . this implies that de novo sui is a result of the resolution of urethral obstruction by anatomical reconstruction . therefore , the fact that approximately half of the patients without preoperative sui will develop it postoperatively needs to be the subject of informed consent . meanwhile , although a third of the 50 patients with preoperative sui reported resolution postoperatively , 70% still had symptoms of sui . tvm surgery did improve sui in some cases , but even still , we suggest it would be better for patients if their expectations regarding sui improvement by tvm surgery are not too high . after tvm surgery , approximately half of the patients developed de novo sui , but of those approximately half reported that sui was resolved within 6 months or it had subsided to the extent that did no longer bothered them . conversely , for 17% , it became a problem that affected their everyday lives and medication was prescribed ; incontinence surgery was performed for only one patient ( 4.3% ) . even if postoperative sui appears only transiently , a small number of serious cases may require surgery . thus , even if postoperative sui appeared only transiently in our patients , we considered whether or not surgical treatment should be expedited , keeping in mind the possibility of relieving the symptoms . no association was observed between the preoperative residual urine volume and presence of preoperative sui , so predicting the onset of sui postoperatively is considered difficult . as stated earlier , gynecologists should routinely make a detailed evaluation of voiding function as a basic minimum when pop surgery is scheduled . it has previously been suggested that preoperative evaluation of detrusor function or urethral function might help predict urinary outcome in patients with pop [ 14 , 15 ] . since tvm is associated with the risk of inducing sui , a condition not usually treated by obstetricians and gynecologists , such professionals should improve their understanding of the pathogenesis of various types of urinary incontinence and specific tests , such as urodynamic study , as well as cooperating with urologists in treating pop . as the number of obstetricians and gynecologists adopting tvm for the treatment of pop is expected to increase , surgeons should know that sufficient informed consent with regards to the onset of postoperative sui is required . tvm surgery is a useful surgical method that can replace traditional methods for treating pop , but sufficient informed consent with regards to the onset of postoperative sui is required .

recent studies highlighted the increasing dramatically rates of overweight and obesity and their related range of adverse health outcomes especially in children and adolescences . in this regard , it is noticeable that healthy lifestyles including appropriate physical activity mainly established during the early years of this period . moreover , the physical health outcomes , physical activity contribute to growth and development of psychological health of adolescences . it provides opportunities to improve emotional well - being , self - steam , and new social skills . unfortunately , despite the benefits of regular physical activity , most of the children in growing period do not meet the related recommendation programs . similar to most other countries , the results of studies reveal the alarming evidence for insufficient levels of physical activity in iranian children and adolescents . at the same time , moreover the basic information of the problem , it is important to understand the determinants of proper interventions to increase physical activity in different population . the demographic changes have been led to higher levels of inactivity and lower levels of physical activity that is likely associated with some important population attributable risks and a higher rate of mortality . physical activity is a complex behavior influenced by numerous different environmental , psycho - social , cultural , and cognitive factors . understanding the opinions of adolescents and key informants in the health - related fields lights the road map of designing the effective interventions . in this regard , comprehensive studies are limited , and most of them are related to some specific group . qualitative researches may be allowed for greater understanding of the reasons behind the adolescences physical activity - related behaviors . such approaches elicit target groups views regarding preferable preventive programs on environmental and social aspect of deliverables models . aim to provide evidence - based information for adolescences health promotion ; we conducted a quantitative study to elicit the adolescents and key informants opinion regarding the situation and promotion of adolescents physical activity . present study is a qualitative research on adolescents and key informants opinion regarding the adolescents physical activity needs assessment and the social and environmental barriers of adolescents physical activity . the details of the study are described previously and here , we refer to some points in brief . to obtain views , three factors were applied to adolescents focus group discussions ( fgds ) designing ; age , sex , and educational level . therefore , we organized 8 groups and 16 fgd sessions ( 2 sessions for each group ) with up to seven participants . after presentation of the project in several interactive local meeting , through participatory approach , 98 participants were selected as fgd session invited , from volunteered adolescent ( aged 1019 years ) volunteers . we also designed 9 interview sessions with informants who were invited from the health professionals and experts in the field of adolescents health . interviews and fgds were implemented using a semi - structured interview conductor . the interview guide comprised of open - ended questions to allow respondents to explain their own opinions . focus group questions were conducted for the present study to specify the adolescents and key informants opinion regarding the needs and social and environmental barriers of adolescents physical activity . using a standardized protocol , 10 trained moderators led the focus group sessions . for more coordination , prior to conducting actual focus groups , all of the research team members attended a training workshop on a practical qualitative research outlined based on the standardized protocol of this specific study . moreover , for more accuracy , during the procedures , all of the sessions were exactly observed by experts . method used for data collection was in - depth interview for informants including experts , professionals in adolescent medicine and community representatives and fgds in volunteer groups . two guides questioning have been designed for individual interviews and fgds based on related literature review and goal of the study . each guide questioning consisted of main questions that covered the study objectives including : impact of physical exercise on health , present situation of adolescence physical activity , main facilities / barriers for adolescents daily physical activities , limitations , and suggestions for public physical exercise / adolescence physical activity . in the pilot study , validity and reliability of instruments the sessions lasted about 11.5 h. the sessions were conducted in private rooms ( e.g. classrooms ) . in each of them , discussions were followed to reach data saturation . the recorded 16 fgds and 9 in - depth interview sessions were recorded and transcribed exactly . to assess the credibility , for conformability , we shared summarized interview of findings with the participants of the discussion session ( respondent validation ) . exact detailed methods during data collection , analysis , added quotes , and meaning units have been used for transferability . for dependability , peer checking by an experienced colleague to re - analyze , some of the data were performed . data analysis was designed manually based on content analysis through which simultaneously open coding , main concepts were extracted . during the next step in axial coding similar concerts categorized , comparison and integration of similar codes led to novel comments , suggestion , and ideas . before the coding of the transcripts , a coding scheme was created to identify and categorize themes related to our predefined objectives . the reliability of finding was controlled through the assessment of similarity between our findings with extracted results of independent another expert . after introduction of project and before each session , informed consent was obtained from all of the participants . all information was collected and analyzed anonymously , and the results would be used only for research purposes . to obtain views , three factors were applied to adolescents focus group discussions ( fgds ) designing ; age , sex , and educational level . therefore , we organized 8 groups and 16 fgd sessions ( 2 sessions for each group ) with up to seven participants . after presentation of the project in several interactive local meeting , through participatory approach , 98 participants were selected as fgd session invited , from volunteered adolescent ( aged 1019 years ) volunteers . we also designed 9 interview sessions with informants who were invited from the health professionals and experts in the field of adolescents health . interviews and fgds were implemented using a semi - structured interview conductor . the interview guide comprised of open - ended questions to allow respondents to explain their own opinions . focus group questions were conducted for the present study to specify the adolescents and key informants opinion regarding the needs and social and environmental barriers of adolescents physical activity . using a standardized protocol , 10 trained moderators led the focus group sessions . for more coordination , prior to conducting actual focus groups , all of the research team members attended a training workshop on a practical qualitative research outlined based on the standardized protocol of this specific study . moreover , for more accuracy , during the procedures , all of the sessions were exactly observed by experts . method used for data collection was in - depth interview for informants including experts , professionals in adolescent medicine and community representatives and fgds in volunteer groups . two guides questioning have been designed for individual interviews and fgds based on related literature review and goal of the study . each guide questioning consisted of main questions that covered the study objectives including : impact of physical exercise on health , present situation of adolescence physical activity , main facilities / barriers for adolescents daily physical activities , limitations , and suggestions for public physical exercise / adolescence physical activity . in the pilot study , validity and reliability of instruments the sessions lasted about 11.5 h. the sessions were conducted in private rooms ( e.g. classrooms ) . in each of them , discussions were followed to reach data saturation . the recorded 16 fgds and 9 in - depth interview sessions were recorded and transcribed exactly . to assess the credibility , participants invited from different groups of adolescents and key informants . for conformability , we shared summarized interview of findings with the participants of the discussion session ( respondent validation ) . exact detailed methods during data collection , analysis , added quotes , and meaning units have been used for transferability . for dependability , peer checking by an experienced colleague to re - analyze , some of the data were performed . data analysis was designed manually based on content analysis through which simultaneously open coding , main concepts were extracted . during the next step in axial coding similar concerts categorized , comparison and integration of similar codes led to novel comments , suggestion , and ideas . before the coding of the transcripts , a coding scheme was created to identify and categorize themes related to our predefined objectives . the reliability of finding was controlled through the assessment of similarity between our findings with extracted results of independent another expert . after introduction of project and before each session , informed consent was obtained from all of the participants . all information was collected and analyzed anonymously , and the results would be used only for research purposes . following the sampling procedures and obtaining informed consent , 98 adolescents , aged 1019 years , participated in the study . they consisted of 45 ( 45.92% ) girls and mean standard deviation of age of 15.5 2.46 years . using content analysis , data analysis was performed for 5 main axial categories including : the impact of physical exercise on health ; the present situation of adolescence physical activity ; main facilities / barriers for their daily physical activities ; limitations and suggestions for public physical exercise ; suggested strategies for improving adolescence participation in physical activity programs . according to the goals of the study , from about 16 themes , 126 codes were extracted . findings of adolescences fgds and key informants in - depth interviews have been concluded under the following major domains . daily habits and the important role of physical activity in healthy life were the first and the most emphasized topics , nearly noted by all of the participants . regarding the effect of physical activity on the health of adolescents , nearly all of the female and male participants believed appropriate regular physical activity is very effective for health and inactivity habits result in reversed health outcomes . one of the female adolescents emphasized that : the healthy body is the foundation of all aspect of our life . on the other hand , most of the participants in both female and male groups mentioned that curricular activities and educational home works were the first time - consuming priority of their life . one of the boy participants said we all know that this is one of the most important health issues but due to the stress and fear of the future academic and professional situation , you can not do anything . the informants believed that most of the adolescents have appropriate knowledge about the importance effect of physical activity on their health . majority of the adolescent believed that girls and boys differ in their sport choices ; they expressed that because girls wanted to maintain their figures , therefore , they try to go on a diet , and they choose to weight loosing activities . based on the consensus of the male participants , most of the adolescents in this group preferred to participate in competitive sports like football . most of the female participants stated the level of total physical activity is lower in girls than in boys . similarly , we found that most of our participants and their peers ignored even minimal recommended level of regular physical activity . the majority of adolescents mentioned that they do not meet the daily or even weekly regular programs for their physical activities . some girls and boys with low self - esteem were less likely to participate in group activities . on the other hand , a few stated that they have the regular physical activity programs . similarly , key informants point to in adequate programming for at least recommended physical activities . almost all female participants believed that there is a great difference in the physical activity facilities between girls and boys . they said boys have more facilities and most of the environment is safe for them , for the reason that they are more active , and so are less likely to become obese . most of the study participants , especially in female groups , pointed to the lack of a safe environment for physical activity . moreover , they emphasized on high cost of professional sport places . with regards to the reason for such differences ; majority of adolescents from both sex believed that girls need more policy attention . in both sex discussion groups ; pressures of school homework along with the fear of time losing were the main barriers for their daily physical activities . at the same time , some cases such as ; laziness , lack of effective attitude , self - confidence , and personal habits were the other concepts developed in this context , by number of individuals of different groups . one of the male participants said : honestly , laziness is the main nonobvious barrier for our daily physical activity . the key informants totally agreed upon the important role of family when the dietary personal habits forming during childhood . they opinions totally focused on machinery life patterns and a vast tendency to the facilitating and accelerating the daily life process . this was frequently repeated by many of fgds participant and informants that : changes in attitude for appropriate dietary physical activities are very effective . most of the participants in female group discussion pointed to the lack of safe and easy - access place for physical activity . they revealed that there is a progressively need to create and promote the safe environment for women exercise . in this regard , they citing to some success cases such as women 's specific parks . another main concept in this area was inadequate public knowledge about physical activity advantages , which was discussed in both female and male fgds . according to the consensus results ; if the public advocacy programs simultaneously address all of the family members , they will provide the best situation for maximum involving of target groups . it is important to note that some key informants expressed that daily physical activity should be considered as a part of public 's recreation . it was an attractive discussion in which most of the points express as proposed suggestions . most of the young girls and boys believed that important subjects such as knowledge promotion ; vast public advocacy ; age - specific environmental facilities ; incentive programs ; and spending cist for sport instruments should be considered for wide national public planning . in recognition , the opinions of adolescents on the improving adolescence engagement in physical activity programs , comments showed that they are requesting for comprehensive attention of families and community especially for their interests . beside the informants mentioned that there is an increasing requirement for more evidence - based physical activity guidelines . moreover according to some opinions ; enjoyment as the one of the most effective factors for continuing participation in physical activity should be considered specifically . one of key informant said that : this needs a rapid step by step intervention through which each program would be set based on the participant of target groups . daily habits and the important role of physical activity in healthy life were the first and the most emphasized topics , nearly noted by all of the participants . regarding the effect of physical activity on the health of adolescents , nearly all of the female and male participants believed appropriate regular physical activity is very effective for health and inactivity habits result in reversed health outcomes . one of the female adolescents emphasized that : the healthy body is the foundation of all aspect of our life . on the other hand , most of the participants in both female and male groups mentioned that curricular activities and educational home works were the first time - consuming priority of their life . one of the boy participants said we all know that this is one of the most important health issues but due to the stress and fear of the future academic and professional situation , you can not do anything . the informants believed that most of the adolescents have appropriate knowledge about the importance effect of physical activity on their health . majority of the adolescent believed that girls and boys differ in their sport choices ; they expressed that because girls wanted to maintain their figures , therefore , they try to go on a diet , and they choose to weight loosing activities . based on the consensus of the male participants , most of the adolescents in this group preferred to participate in competitive sports like football . most of the female participants stated the level of total physical activity is lower in girls than in boys . similarly , we found that most of our participants and their peers ignored even minimal recommended level of regular physical activity . the majority of adolescents mentioned that they do not meet the daily or even weekly regular programs for their physical activities . some girls and boys with low self - esteem were less likely to participate in group activities . on the other hand , a few stated that they have the regular physical activity programs . similarly , key informants point to in adequate programming for at least recommended physical activities . almost all female participants believed that there is a great difference in the physical activity facilities between girls and boys . they said boys have more facilities and most of the environment is safe for them , for the reason that they are more active , and so are less likely to become obese . most of the study participants , especially in female groups , pointed to the lack of a safe environment for physical activity . moreover , they emphasized on high cost of professional sport places . with regards to the reason for such differences ; majority of adolescents from both sex believed that girls need more policy attention . in both sex discussion groups ; pressures of school homework along with the fear of time losing were the main barriers for their daily physical activities . at the same time , some cases such as ; laziness , lack of effective attitude , self - confidence , and personal habits were the other concepts developed in this context , by number of individuals of different groups . one of the male participants said : honestly , laziness is the main nonobvious barrier for our daily physical activity . the key informants totally agreed upon the important role of family when the dietary personal habits forming during childhood . they opinions totally focused on machinery life patterns and a vast tendency to the facilitating and accelerating the daily life process . this was frequently repeated by many of fgds participant and informants that : changes in attitude for appropriate dietary physical activities are very effective . most of the participants in female group discussion pointed to the lack of safe and easy - access place for physical activity . they revealed that there is a progressively need to create and promote the safe environment for women exercise . in this regard , they citing to some success cases such as women 's specific parks . another main concept in this area was inadequate public knowledge about physical activity advantages , which was discussed in both female and male fgds . according to the consensus results ; if the public advocacy programs simultaneously address all of the family members , they will provide the best situation for maximum involving of target groups . it is important to note that some key informants expressed that daily physical activity should be considered as a part of public 's recreation . it was an attractive discussion in which most of the points express as proposed suggestions . most of the young girls and boys believed that important subjects such as knowledge promotion ; vast public advocacy ; age - specific environmental facilities ; incentive programs ; and spending cist for sport instruments should be considered for wide national public planning . in recognition , the opinions of adolescents on the improving adolescence engagement in physical activity programs , comments showed that they are requesting for comprehensive attention of families and community especially for their interests . beside the informants mentioned that there is an increasing requirement for more evidence - based physical activity guidelines . moreover according to some opinions ; enjoyment as the one of the most effective factors for continuing participation in physical activity should be considered specifically . one of key informant said that : this needs a rapid step by step intervention through which each program would be set based on the participant of target groups . available results emphasize that there is a progressive need for providing the adolescence health programs , based on their own real specific needs and preference . to design more effective interventions , we need to understand more about the factors that influence youth attitudes and behaviors . considering the results of group discussions , it is evident that the majority of adolescents are agreed with the important role of regular physical activity in their healthy life . on the other hand , the lack of essential motivation and the pressure of educational assignments remove it from the daily program priorities . similarly , the results of related studies show most of the teens do not meet the regular physical activity programs . they tend to become less physically active , and female adolescents have been found to engage in less physical activity than male adolescents . some related studies on adolescences health mentioned that although health - related behaviors are very essential , but most of the times due to some problems and barriers , their important has been ignored . lack of a safe environment for girls physical activity and high cost of professional sports were two first mentioned barriers . moreover , lack of appropriate daily program and laziness were the other pointed in this area . a related study on the main individual and environmental barriers of the children and adolescents physical activity have emphasized in the educational program and the family expectations on their children 's school performance . show an unfit body , lacking of self - confidence ; the influence of unsafe neighborhoods ; social status and competence in core skills were others reported barriers to physical activity participation . studies documented that adolescent girls physical activity participation is strongly affected by social influences , peers pressure , and perceived societal norms . weight management , enjoyment , and social interaction were the most common reasons for their participation in sport and physical activity . consistent promotion of public health programs including physical activity is the core to population prevention programs for childhood obesity . they emphasized that such limitations are the main causes that why majority of adolescence do not adhere to the proper physical activity . in this regard , some studies pointed to importance of providing a social support network specially through peer groups . there is a general consensus that more information about different aspects of health programs target groups help to provide better evidence - based preventive strategies for more appropriate interventions . considering the fact that appropriate interventions have resulted in altitude improvement and the healthy behaviors promotion , we asked about preferable strategies . similar to some other research experiences , this study suggests that future interventions should focus on improving parents engagement and their direct participation in physical activities with their adolescents . consistent with other studies , our findings suggest design considerations for encourage physical activity for user group . simple strategies on promote physical activity via the friendship peer groups neighborhood interventions to increase safe environment situation , more evidence - based physical activity age - specific guidelines efforts on facilitating an active lifestyle for children , and considering the views of target participant , are the other concepts developed in this context . during the study , we faced to some limitations such as : lack of cooperation of some invited participants , variation of participant 's perception , and limitation in generalization of the results . considering above , designing and evaluation of participatory strategies for adolescent 's physical activity promotion aim to that , more reviews on determinants of physical inactivity among children and adolescents in different populations are recommended . considering these findings and other studies suggestions , we proposed the participatory strategies for adolescent 's physical activity promotion . in such condition , target groups especially adolescents and their families through interactive process during the designing , development , and implementation of health programs meet the researchers , health policymakers , and other stakeholders evidentiary gaps .

as society develops and lifestyles change , diabetes mellitus has become prevalent , threatening to reduce life expectancy for humans around the global . globally , there were a total of 415 million patients aged 20 to 79 with diabetes in 2015 , and 90% of those patients had type 2 diabetes mellitus ( t2 dm ) . as well as , recent studies have found that there were 109.6 million persons with diabetes in china in 2015 , which have topped the world , following by india ( 69.2 million ) , u.s . ( 29.3 million ) , brazil ( 14.3 million ) , and russian federation ( 12.1 million ) . in addition , prevalence rate of diabetes was 8.8% around the world in 2015 ( table 1 ) . the overall prevalence of diabetes was estimated to be 11.6% in the chinese adult population in 2010 , which is considerably higher than its prevalence of less than 1% in 1980 . different regions ranked by age - adjusted prevalence ( % ) of diabetes ( 2079 years ) 2015 at this point in time , t2 dm is mainly treated medically , including diet restrictions , strengthening exercises , oral hypoglycemic drugs , and insulin injections . however , there is no way to completely control the disease and its complications , and lifelong use of medications and insulin injections result in poor compliance among patients . a follow - up study by mingrone et al in the lancet found that surgery is more effective than medical treatment for the long - term control of t2 dm in obese patients . their study involved a randomized controlled trial that compared conventional medical treatment with laparoscopic roux - en - y gastric bypass ( lrygb ) or biliopancreatic diversion with duodenal switch in terms of their outcomes at 5 years in 60 obese patients with t2 dm . their results indicated that bariatric surgery was a viable option since surgery achieved a partial remission in 19 ( 50% ) of the 38 patients at 5 years while medical treatment failed to achieve a partial remission in any of the 15 patients who were treated medically . mingrone et al noted that neither treatment achieved a complete remission in either group at 5 years according to the american diabetes association ( ada ) definition . hyperglycemia recurred in 15 ( 44% ) of the 34 patients who underwent surgery that achieved a remission at 2 years . our study presents follow - up data at 2 years to compare 80 patients with t2 dm who underwent laparoscopic sleeve gastrectomy ( lsg ) or lrygb . partial remission and complete remission were determined , weight loss , the body mass index ( bmi ) , changes in abdominal circumference , cholesterol , and triglycerides were measured , and diabetes - related complications were assessed . on the basis of clinical observations , the cost - effectiveness of medical treatment , lsg , and lrygb for patients with t2 dm was estimated with a markov simulation model . a 2-group randomized controlled trial was conducted at diabetes surgery centre , beijing shijitan hospital in beijing , china . inclusion criteria were : the patients ages 65 years ; bmi 28 kg / m ; duration of t2 dm 15 years , in accordance with the ada definition for t2 dm : fasting plasma glucose ( fpg ) 7.0 mmol / l or greater , diagnosis , or use of a glucose - lowering drug ; and ability to understand and comply with the study protocol . in addition , the cost - effectiveness of each type of treatment was analyzed with a markov simulation model . the markov model has been used in health fields since the 1980s to depict the development of chronic disease . the model divides a disease into a number of different markov states depending on their relationship to health , and it then simulates the development of that disease governed by the probability of a transition between states at a certain time . the model uses loop computations to estimate the outcomes and gains or losses of disease development . markov states of t2 dm in the current study were well , t2 dm , and death . the mortality rate ( used in well state ) , prevalence rate , case fatality rate ( used in t2 dm state ) , and relevant parameters of t2 dm are collected in china health and family planning statistical year - book , 2013 to 2015 , and the remission rates for the 2 surgeries are based on the aforementioned data from research results . the total costs include direct health expenditures ( outpatient costs , hospitalization costs , surgical fees , and drug costs ) , direct nonhealth expenditures ( hiring caregivers , commercial medical insurance , board expenses , transportation , and health care products ) , and indirect expenses with data based on theoretical values and prices at beijing shijitan hospital ( table 2 ) . the costs of type 2 diabetes mellitus used in the markov model in china ( $ ) eighty patients were randomly assigned ( 1:1 ) to undergo either lsg ( n = 40 ) or lrygb ( n = 40 ) between february 3 , 2011 and october 31 , 2013 . of those patients , 72 ( 90% ) were available at follow - up at 2 years . these patients included 34 ( 85% ) who underwent lsg and 38 ( 95% ) who underwent lrygb ( figure 1 ) . there were no statistically significant differences in baseline values of the lsg group and the lrygb group ( table 3 ) . eighty patients were randomly assigned ( 1:1 ) to undergo either lsg ( n = 40 ) or lrygb ( n = 40 ) between february 3 , 2011 and october 31 , 2013 . of those patients , 72 ( 90% ) these patients included 34 ( 85% ) who underwent lsg and 38 ( 95% ) who underwent lrygb . lrygb = laparoscopic roux - en - y gastric bypass , lsg = laparoscopic sleeve gastrectomy . baseline values for patients in the lsg group and the lrygb group the primary endpoint was the rate of partial remission and complete remission by t2 dm at 2 years . according to the criteria recommended by the ada : partial remission is defined as an fpg concentration of 6.9 mmol / l or less and a hemoglobin a1c ( hba1c ) concentration of 6.5% or less ( 47.5 mmol / mol ) without active pharmacological treatment for at least 1 year while complete remission is defined as hba1c < 6.0% and fpg < 5.6 mmol / l for at least 1 year without any medical or surgical treatment . the following variables were assessed as secondary outcomes : fpg , hba1c , changes in bodyweight , bmi , abdominal circumference , plasma total cholesterol , hdl cholesterol , ldl cholesterol , and triglycerides . markov model outcomes included quality - adjusted life - years ( qalys ) and costs . a test was used to compare the remission of t2 dm in the lsg group and the lrygb group . all of the secondary outcomes , which were expressed in absolute values and in proportion to baseline values , were tested with a t test . all of the outcomes were analyzed with spss ( version 16.0 ) , and p < 0.05 was considered statistically significant for all tests . a markov model was built and analyzed with treeage pro ( version 2011 ) to compare the cost - effectiveness of treatments . a 2-group randomized controlled trial was conducted at diabetes surgery centre , beijing shijitan hospital in beijing , china . inclusion criteria were : the patients ages 65 years ; bmi 28 kg / m ; duration of t2 dm 15 years , in accordance with the ada definition for t2 dm : fasting plasma glucose ( fpg ) 7.0 mmol / l or greater , diagnosis , or use of a glucose - lowering drug ; and ability to understand and comply with the study protocol . in addition , the cost - effectiveness of each type of treatment was analyzed with a markov simulation model . the markov model has been used in health fields since the 1980s to depict the development of chronic disease . the model divides a disease into a number of different markov states depending on their relationship to health , and it then simulates the development of that disease governed by the probability of a transition between states at a certain time . the model uses loop computations to estimate the outcomes and gains or losses of disease development . markov states of t2 dm in the current study were well , t2 dm , and death . the mortality rate ( used in well state ) , prevalence rate , case fatality rate ( used in t2 dm state ) , and relevant parameters of t2 dm are collected in china health and family planning statistical year - book , 2013 to 2015 , and the remission rates for the 2 surgeries are based on the aforementioned data from research results . the total costs include direct health expenditures ( outpatient costs , hospitalization costs , surgical fees , and drug costs ) , direct nonhealth expenditures ( hiring caregivers , commercial medical insurance , board expenses , transportation , and health care products ) , and indirect expenses with data based on theoretical values and prices at beijing shijitan hospital ( table 2 ) . the costs of type 2 diabetes mellitus used in the markov model in china ( $ ) eighty patients were randomly assigned ( 1:1 ) to undergo either lsg ( n = 40 ) or lrygb ( n = 40 ) between february 3 , 2011 and october 31 , 2013 . of those patients , 72 ( 90% ) these patients included 34 ( 85% ) who underwent lsg and 38 ( 95% ) who underwent lrygb ( figure 1 ) . there were no statistically significant differences in baseline values of the lsg group and the lrygb group ( table 3 ) . trial profile . eighty patients were randomly assigned ( 1:1 ) to undergo either lsg ( n = 40 ) or lrygb ( n = 40 ) between february 3 , 2011 and october 31 , 2013 . of those patients , 72 ( 90% ) these patients included 34 ( 85% ) who underwent lsg and 38 ( 95% ) who underwent lrygb . lrygb = laparoscopic roux - en - y gastric bypass , lsg = laparoscopic sleeve gastrectomy . the primary endpoint was the rate of partial remission and complete remission by t2 dm at 2 years . according to the criteria recommended by the ada : partial remission is defined as an fpg concentration of 6.9 mmol / l or less and a hemoglobin a1c ( hba1c ) concentration of 6.5% or less ( 47.5 mmol / mol ) without active pharmacological treatment for at least 1 year while complete remission is defined as hba1c < 6.0% and fpg < 5.6 mmol / l for at least 1 year without any medical or surgical treatment . the following variables were assessed as secondary outcomes : fpg , hba1c , changes in bodyweight , bmi , abdominal circumference , plasma total cholesterol , hdl cholesterol , ldl cholesterol , and triglycerides . markov model outcomes included quality - adjusted life - years ( qalys ) and costs . a test was used to compare the remission of t2 dm in the lsg group and the lrygb group . all of the secondary outcomes , which were expressed in absolute values and in proportion to baseline values , were tested with a t test . all of the outcomes were analyzed with spss ( version 16.0 ) , and p < 0.05 was considered statistically significant for all tests . a markov model was built and analyzed with treeage pro ( version 2011 ) to compare the cost - effectiveness of treatments . eighty patients were randomly assigned ( 1:1 ) to undergo either lsg ( n = 40 ) or lrygb ( n = 40 ) between february 3 , 2011 and october 31 , 2013 . of those patients , 72 ( 90% ) these patients included 34 ( 85% ) who underwent lsg and 38 ( 95% ) who underwent lrygb . at 2 years , a partial remission was achieved in 26 ( 76.5% ) in the lsg group and 22 ( 57.9% ) in the lrygb group . a total of 17 ( 50.0% ) in the lsg group and 14 ( 36.8% ) in the lrygb group had met the standard of hba1c < 6.0% and fpg < 5.6 mmol / l without glucose - lowering drugs , which indicates a complete remission . similarly , 29 ( 85.3% ) in the lsg group and 27 ( 71.1% ) in the lrygb group had hba1c 6.5% with or without glucose - lowering drugs ( table 4 ) . there were no significant differences in the results of the 2 groups ( p > 0.05 ) , which indicates that the 2 surgeries did not differ in terms of the remission of t2 dm and glycemic control . type 2 diabetes mellitus remission and glycemic control at the follow - up at 2 years secondary outcome measures included fpg , hba1c , changes in bodyweight , bmi , abdominal circumference , plasma total cholesterol , hdl cholesterol , ldl cholesterol , and triglycerides . data on these measures are presented as the absolute change and percent change at 2 years from the baseline ( table 5 ) . mean fpg and hba1c concentrations at 2 years were slightly lower in the lsg group than in the lrygb group . the 2 surgeries both caused weight loss and changes in bmi and abdominal circumference , and these measures did not differ significantly between the 2 groups . the absolute change and percent change in these secondary outcome measures at 2 years did not differ significantly between the 2 groups . the 2 surgeries both had a substantial effect on the reduction of fpg , hba1c , and bodyweight in patients with t2 dm . moreover , outcomes of obesity comorbidities and diabetes complications for the lsg group and lrygb group also be revealed ( table 6 ) . secondary outcome measures for the lsg group and the lrygb group outcomes of obesity comorbidities and diabetes complications for the lsg group and lrygb group given the similar outcomes of the surgeries , the question is then which is more cost - effective . costs and qalys were discounted at an annual rate of 5% in accordance with china 's consumer price index . there were 3 markov states of t2 dm : well , t2 dm , and death . each state has different parameters and a probability of a transition between the states for the 3 treatments . the total costs per capita for patients with t2 dm include direct health expenditures , direct nonhealth expenditures , and indirect expenses , and the total cost of medical treatment was 1937.83 dollars per year , that of lsg was 8510.27 dollars , and that of lrygb was 10,084.11 dollars . clearly , the lowest cost treatment is medical treatment since surgical fees are a one - time fee option , and surgery is more expensive than basic medicines such as acarbose tablets , gliquidone tablets , and novolin . the relative cost of medical treatment was 37,183 dollars , that of lsg was 42,795 dollars , and that of lrygb was 49,646 dollars . the qalys were 23.4 years for medical treatment , 41.59 years for lsg , and 41.46 years for lrygb . the cost - effectiveness ratio was 1589.02 dollars per qaly for medical treatment , 1028.97 dollars per qaly for lsg , and 1197.44 dollars per qaly for lrygb ( table 7 ) . accordingly , lsg yielded the greatest benefit at the lowest cost for patients with t2 dm ( figure 3 ) . tree diagram of a markov model . indicates a decision node , indicates a chance node , indicates a terminal node , and life - years gained and cost - effectiveness ratios for medical treatment and two surgical procedures cost - effectiveness analysis of medical treatment , lsg , and lrygb . cef = cost - effective frontier , lrygb = laparoscopic roux - en - y gastric bypass , lsg = laparoscopic sleeve gastrectomy . sensitivity analysis was performed and tornado diagrams were constructed to determine the robustness of the current model and to identify key factors affecting the cost - effectiveness ratio . the 95% confidence interval of the remission rate was used to determine lower and upper values to enter into the model , and the cost values were halved or doubled since confidence intervals were unavailable.figure 4 shows the effect of varying each parameter on the cost - effectiveness ratio in tornado analyses . doubling the cost leads to a lower cost - effectiveness ratio , and halving the cost leads to a higher cost - effectiveness ratio . tornado diagrams of each treatment : ( a ) medical treatment versus lsg ; ( b ) medical treatment versus lrygb ; ( c ) lsg versus lrygb . c_m means the cost of medical treatment , c_lsg means the cost of lsg ; c_lrygb means the cost of lrygb , r_m means the remission rate for medical treatment , r_lsg means the remission rate for lsg , and r _ lrygb means the remission rate for lrygb . when , as an example , c_m in ( a ) is halved , an increased cost leads to a lower cost - effectiveness ratio . when c_m in ( a ) is doubled , a reduced cost leads to a higher cost - effectiveness ratio . lrygb = laparoscopic roux - en - y gastric bypass , lsg = laparoscopic sleeve gastrectomy . at the current time , there were few studies about the therapeutic effect and cost - effectiveness of bariatric surgery in asia . bariatric surgeries were performed in china but only in clinical trials until 2012 , when the country began to recognize the appropriateness and validity of bariatric surgery . the chinese society for metabolic & bariatric surgery was established in 2012 . japan has a similar society , the japanese society for the surgery of obesity and metabolic disorders , but bariatric surgeries were still seldom performed in japan . as well , the economic aspects of conventional treatment and surgery have seldom been investigated in china . western studies have found that surgery leads to greater gains in qalys and is less costly than medical treatment for patients with t2 dm over the long term . however , these studies mostly focused on lrygb and biliopancreatic diversion with duodenal switch and did not include a comparison to lsg . moreover , the homeostasis model assessment of insulin resistance differs in populations in different countries . given china 's diabetic population and the particularities of the asian physique , this study will facilitate and guide cost - effective bariatric surgery for china specifically but for the rest of asia as well . on the baseline data of this study , the enrollment rate in the current trial was 100% because of the strict inclusion criteria . the follow - up rate was 90% and the reasons for drop - outs were : patients did not have time to complete a follow - up ; follow - up examination was too expensive ; and some patients viewed bariatric surgery as plastic surgery , so they were less amenable to the procedure . in addition , the study population was relatively young and the age variation was minimal which was mainly from the small sample size . however , annual report ( 2014 ) and diabetes atlas ( 2015 ) of international diabetes federation both indicated that nearly half diabetes patients aged between 40 and 59 years in the world , with the chinese patients being younger . besides , for duration of t2 dm 15 years of the inclusion criteria in the study , the younger patients were more acceptable for the surgery , while elder patients tend to maintain the medical control , which was similar with several studies . moreover , the standard deviations of bmis were relatively low , which was also mainly due to the small sample size . however , based on the different inclusion criteria of bmi between the guidelines of china and ada , we can find diagnostic criteria of obesity also different in china , europe , and america . the boundary of adult overweight is 24 of bmi , and adult obesity is 28 of bmi in china , so that the inclusion criteria were adjusted by changing a bmi 35 to a bmi 28 , which better accommodated the requirements of this study . and there are several studies that conduct the comparison between the lsg and lrygb group with bmi measured by 40 or over and low standard deviations . the current results indicated that lsg and lrygb were both remarkably effective at long - term control of hyperglycaemia and improving the metabolic profile , allowing significant reductions in medication use and use of glucose - lowing drugs shown in table 4 . this study used the standard defined by ada , which is stricter than general standards , so the partial remission and complete remission that were achieved are relatively ideal . a point worth noting the results of this study basically agree with those of other studies , that is to say the surgeries are reasonable approaches to treating diabetes . although , as a trend to more diabetes remission in the lrygb group , there was still no statistical difference between the 2 groups with the partial remission and complete remission , which was similar with western studies . this is because the baseline data in our study show the mean of bmi in lsg group is larger than the one in lrygb group , which means that the prognosis effect of lsg is better because the curable effect of the patients were better for obese patients . besides , lrygb appears to have a better effect on ldl and total cholesterol while hdl and triglycerids are not different , which also mainly because of the mean of weight and bmi in lrygb group are smaller than the one in lsg group , and obese patients are more suitable for lsg surgery . several studies show that a few secondary outcomes , such as ldl cholesterol , hdl cholesterol , or triglycerids , have statistical differences between the 2 groups . however , it is inadequate to prove the difference of clinical effect between the 2 groups only based on this individual or exceptional index , which may because of the small sample . several studies commonly used the excessive weight loss to assess the clinical effect of surgery , which was calculated as the difference between the weight at the time of implantation and the ideal body weight corresponding to a bmi of 25 kg / m , reaching the value of 50% means the effective results of weight loss at 1 year after surgery . the result of our study achieved the 61.1% , which is similar with other asian research ( table 5 ) . furthermore , there were only 4 cases occurred the mild postoperative complication which were cured after conservative treatment , which manifested as mild nausea , pain , emesis , and bleeding . determining which surgery is more cost - effective is another important issue in this study . first , what warrants special attention is whether different medications will affect the total costs for the medically treated group . medications of t2 dm patients in china according to the guideline are basically metformin , sulfonylurea , and insulin . this is the first one of the considered 4 conventional treatment strategies by yuanhui zhang et al , which includes metformin , sulfonylurea , and insulin ; metformin , a dipeptidyl peptidase-4 inhibitor , and insulin ; metformin , a glucagon - like peptide-1 agonist , and insulin ; and metformin and insulin , proving different ways of drug use little impact on the cost . therefore , different medications have no effect on our cost - effectiveness analysis . according to the model , lsg and lrygb appear to be relatively cost - effective treatments for diabetics , with cost - effectiveness ratios ranging from $ 1028.97 to $ 1197.44/qaly , as compared to $ 1589.02/qaly for medical treatment . therefore , the one - off charge of surgeries is high , but they lead to greater gains in qalys and are less costly than medical treatment for patients with t2 dm over the long term . relatively , lsg is as effective as lrygb and is slightly more cost - effective than lrygb , so that lsg therapy appears to be the cost - effective option for managing patients with t2 dm . the current study has several limitations . second , the current authors are cognizant of the lack of data on medical treatment in contrast to data on surgery . however , the patients who included in this study were all under medication more than 2 years with no remission and the primary endpoint of our study was conducted as 2 years , so that they accepted surgical treatment and had drug withdrawal after surgery . third , limited data on the long - term effects of bariatric surgery are available , which means the follow - up in this study was only 2 years , so a consistent remission as defined by the ada was not evident . in conclusion , bariatric surgery is not a cost - saving way to control t2 dm since the one - time fee is prohibitive for some patients , but the increased costs of that surgery come with greater benefits . from an economic perspective the hope is that estimates of the cost - effectiveness of bariatric surgery will become more systematic , helping to facilitate and guide future policy decisions regarding the treatment of diabetes .

animals consuming a diet restricted in some , as of yet , unidentified component but with adequate nutrients so as to avoid malnutrition , typically show extended lifespan ( 13 ) , improved health ( 4 ) and delayed aging ( 5 ) . this treatment , termed dietary restriction ( dr ) , has been shown to increase longevity across a broad range of species ( 6 ) . however , despite over seventy years of research , the mechanisms underlying this process are poorly understood . whilst dr 's life extending properties have often been attributed to caloric restriction ( cr ) ( 79 ) , accumulating research shows that , in some species , a limited intake of specific nutrients is necessary and sufficient to increase lifespan ( 3,1012 ) . for example , diets restricted in either yeast or sugar increased longevity and decreased mortality rate in drosophila melanogaster , despite these effects being unrelated to the calorific content of the diet ( 3 ) . protein restriction has been reported to both extend ( 13 ) and reduce ( 5 ) lifespan in rodents . the magnitude of the response of longevity , and/or of oxidative stress to methionine restriction varies across species relative to the responses induced by cr ( 10,14 ) , whether this extreme dietary manipulation operates via the same mechanisms as more mild dr treatments is unclear . furthermore , there is debate regarding whether dr slows the rate of ageing or only delays its onset , with support for either hypothesis derived from studies of a number of different species ( reviewed in ( 15 ) ) . whilst dr protocols should be flexible , devised in each laboratory on the basis of the diet optimal for fecundity and lifespan of the species or specific population being examined ( 16 ) , it will remain unclear whether divergent responses reflect species specific idiosyncrasies or differences in methodologies until a robust practical framework can be applied that allows across species comparisons . in contrast to the positive effects of dr on lifespan , reproductive output is often greatly reduced by dr . life - history theory predicts that if reproduction is costly , it should be traded against longevity ( 17 ) . thus , a decrease in reproductive effort with dr may occur if longevity is prioritised over reproduction ( 18,19 ) . however , the effect of dr may differ between the sexes due to different nutritional requirements ( 20 ) and variation in the nature of any trade - offs between reproduction and longevity . females require greater protein for egg production , whilst males need more carbohydrates to fuel sexual display ( 21 ) . if these macronutrients differentially affect longevity , restriction of either will influence reproduction and/or lifespan differently in each sex and set the stage for intersexual conflict over optimal diet ( 22 ) . many studies have documented associations between reproductive effort , nutrition and senescence , yet no general consensus has been reached as to the mechanisms underlying the interactions between these factors ( 23 ) . one of the main issues concerns whether the effects of dr on longevity are primarily artefacts of laboratory environments . foremost , given that there is little data available on food consumption patterns of animals in the wild , the beneficial effects of dr may simply reflect the adverse effects of overfeeding in the lab ( 24,25 ) . methodological limitations also pose problems . empirically uncoupling the effects of calories from those of the nutrients from which they are derived perhaps as a consequence of this , dr studies often apply too few dietary treatments and therefore , only explore a limited nutritional landscape ( 25 ) . in addition , it is difficult to accurately quantify food consumption in lower organisms , especially where liquid diets are used and restriction is accomplished via nutrient dilution . without precise measurements of dietary consumption it may not be possible to detect compensatory feeding ( 24,26 ) ; where animals consume greater quantities of diluted nutrients so as to regulate intake ( 25 ) and inadvertently mitigate the effects of dr . studies seldom address assimilation efficiency , which may not be constant across an organism 's lifetime . moreover , animals are often housed in mixed sex groups where sexual activity and reproductive investment are not controlled ( 26,27 ) . even in studies where reproductive effort has been measured , it is often measured with greater precision ( and more frequently ) in females than in males ( 2832 ) . this is possibly due to the relative ease with which female reproductive effort can be quantified in laboratory model organisms ( counting eggs ) compared with measuring lifetime investment by males in sexual signalling . two recent studies on insects have overcome many of these limitations via the application of nutritional geometry ( ng ) . the progress made with this technique not only advances our understanding of the link between dr and ageing but also provides a practical framework that promises to further progress research on this topic . the ng protocol is detailed elsewhere ( 33,34 ) and the benefits of this technique specific to ageing research are comprehensively reviewed by simpson and raubenheimer ( 35 ) . using ng performance and behaviour can be investigated in a multidimensional nutritional framework , which aims to differentiate between nutrient intake and utilisation . essentially , ng entails varying the concentrations and ratios of nutrients in the diet and then accurately measuring their intake in a series of feeding trials . quantifying the intake for each unique nutrient combination allows the construction of a fine - scale nutritional surface with as many dimensions as there are nutrients being examined . on this surface , performance traits ( such as lifespan or rates of ageing ) can be mapped ( see figure 1 ) . this enables powerful statistical analysis using response surface methodologies to examine both the independent effect of and the interaction between the different dietary components on the performance trait to be examined . feeding trials where individuals are given the choice between two diets can then be used to examine the behavioural rules that govern dietary intake and to identify the intake target or nutritional point to which an animal feeds . this intake target may be static , i.e. a point integrated over time , or dynamic , in which case it is possible to track its trajectory as an animal grows , develops , reproduces or senesces . with respect to ageing , this means that the effects of dr can be examined relative to these intake targets rather than laboratory standards . diets that vary in the ratio and concentration of nutrients a and b have been provided along nutritional rails ( beige lines ) . full , black lines are fitness contours and colours illustrate how longevity decreases with distance from optimal lifespan ( red peak ) and the diet that optimises longevity ( blue line ) . in this case fitness costs are approximately linear and the optimal strategy is to consume high levels of nutrient b relative to nutrient a. the effect of diet on longevity is independent of calories , as illustrated by there being no relationship between fitness contours and the isocaloric line . liquid diet of varying protein and carbohydrate ratio and concentration was provided in microcapillary tubes and consumption measured according to a scale bar . longevity was greatest at a low protein - carbohydrate ratio ( p : c ) of 1:16 , in both their empirical study and associated meta - analysis . the long life observed under low protein consumption was attributed to a reduction in initial mortality and retarded acceleration of age - dependent mortality . other studies of drosophila have found only initial mortality rate to be affected by dr ( 20 ) . this discrepancy may be because yeast , which features in dietary treatments used in this paper as well as many others examining drosophila , has uncharacterised odorants known to affect longevity ( 36 ) . in drosophila , restoration of chemosensory signals completely reverses the reduction of initial mortality rate seen in dr animals but not that attributable to a reduced rate of age dependent acceleration ( 36 ) . yen and mobbs ( 36 ) propose that the relative roles of reduced initial mortality versus retardation of the subsequent trajectory of mortality depend on the relative contributions of chemosensory and metabolic mechanisms . given these findings , it is clear that future studies should place greater emphasis on partitioning the effects of chemosensory stimuli from consumption . ( 25 ) found that the fecundity of mated females was optimized under higher protein : the rate of egg production peaked at a p : c of 1:2 and lifetime egg production at a p : c of 1:4 . the difference in optimal p : c for longevity and fecundity suggests a trade - off , however , it appears that the interplay between reproduction and lifespan is not integral to determining how the latter responds to dr , as suggested by past research ( 37,38 ) . since the p : c contour lines ran almost perpendicularly to the isocaloric line on the nutrient surface that traverses diets composed of equal caloric value , it reveals that calories per se did not have a significant influence on any of the investigated life history attributes . there was evidence of compensatory feeding and active regulation of nutrient intake , with flies consuming a p : c ratio corresponding to that which maximises lifetime reproductive success across a range of nutrient concentrations . ( 21 ) used similar methods to investigate senescence in the australian field cricket , teleogryllus commodus . male t. commodus call to attract females ; this energetic sexual advertisement is associated with a four - fold increase in metabolic rate ( 39 ) and is under strong selection through female choice ( 40 ) . in a no - choice test , 24 powdered diets were provided in excess and intake measured by weighing the dried food every 3 days throughout the cricket 's lifetimes . male calling effort was monitored using an acoustic call chamber and the fecundity of mated females quantified by counting the number of eggs produced . two choice experiments were also conducted : the first provided isocaloric diets that differed in their p : c ratio and the second a choice between three pairs of foods that varied in both their p : c ratio and energetic content . as was the case for d. melanogaster , lifespan was maximised on a low p : c ratio . however , in t. commodus male longevity declined with high carbohydrate consumption , whilst , in either sex , as the p : c intake ratio increased , longevity decreased . this study provides the first , clear evidence that there is potential for sexual conflict over optimal diet . this contradicts past work suggesting that male reproductive effort in t. commodus trades - off with longevity ( 19 ) . conversely , in females , greater dietary protein increases fecundity but decreases longevity ( 21 ) . this trade - off between female reproductive fitness and long life does not manifest itself in a female 's choice of diet : whilst there is evidence of active regulation of diet influenced , in part , by total nutrient value , and females consume slightly more protein than males , there is little sexual dimorphism in diet . whilst neither sex apparently chooses the diet that maximises lifetime reproductive success in the laboratory conditions in which they were tested , female fecundity is highly compromised by their choice of diet . these studies add to a growing body of evidence that protein restriction , not cr per se , is primarily responsible for longevity extension under dr regimes in insect species . whilst there is evidence for a reproduction - longevity trade - off , with sex and species specific differences in its magnitude , ( 21 ) , which highlights the potential for intersexual conflict over diet choice , provides scope for research examining the genetic basis of such conflict , its prevalence and resolution . for example , the free radical theory ( 41 ) , which attempts to explain the mechanistic basis of ageing , proposes that accumulation of oxidative damage induced by ros causes the functional decline that characterises senescence . mapping ros- induced oxidative damage onto the geometric framework may provide a further , and potentially more powerful , test of this theory . ng requires a large number of experimental animals and is therefore both costly and labour intensive to implement . there is strong evidence that dr operates differently in mammals and insects ( reviewed in 15 ) , and so the application of this conceptual framework across taxa is likely to prove informative . it has been postulated that this is due to disruption of either carbohydrate ( 35 ) or protein ( 15 ) metabolism . simpson and raubenheimer ( 35 ) suggest that ng may enable the interaction between these nutrients to be assessed and these alternate hypotheses addressed . moreover , they propose this may be feasible in mammals were the nutritional surface investigated first restricted on the basis of preliminary trials . given that other research has drawn similar conclusions regarding the role of specific nutrients in influencing longevity ( e.g. 3 ) to those of lee and colleagues ( 25 ) and maklakov et al . obviously where only one nutrient is being investigated , application of this technique is excessive . however , while other has approaches have made qualitatively similar conclusions , ng has more accurately quantified the relationship between calories , specific nutrients , longevity and sex . protocols previously employed for investigating the contributions of specific nutrients to longevity extension under dr , have commonly varied the concentration of one nutrient at a time , whilst holding all others constant ( e.g. 10 ) , this does not allow interactions between nutrients to be assessed . authors have recently stressed the importance of a multidisciplinary approach to ageing research ( 22 , 42 , 43 ) . ng aims to integrate physiology , behaviour and life - history parameters within a comprehensive nutritional framework and , in doing so , provides a robust platform on which to build such a research approach .

healthy volunteers and diabetic participants with mild npdr were recruited from casey eye institute of oregon health and science university ( ohsu ) . eyes with nondiabetic macular pathology , media opacity , or other significant eye disease were excluded . informed consent was obtained , and the study was approved by the institutional review board of ohsu . the study complied with the declaration of helsinki and health insurance portability and accountability act . two 3 3 mm scans with 2-mm depth were obtained in one eye of each participants within a visit using a commercial spectral - domain oct system ( rtvue - xr ; optovue , fremont , ca , usa ) with a center wavelength of 840 nm , a full - width half maximum bandwidth of 45 nm , and an axial scan rate of 70 khz . in the fast transverse scanning direction , two repeated b - scans were captured at a fixed position before proceeding to the next location . a total of 304 locations along a 3-mm distance in the slow transverse direction were sampled to form a three - dimensional data cube . all 608 b - scans in each data cube were acquired in 2.9 seconds . based on the volumetric oct reflectance signal , the scanning software computed a signal strength index ( ssi ) , which is often used as an indicator of scan quality . for each scan , one x - fast scan and one y - fast scan were registered and merged through an orthogonal registration algorithm to remove motion artifacts . a directional graph search algorithm identified structural boundaries : the inner limiting membrane ( ilm ) , inner plexiform layer ( ipl ) , inner nuclear layer ( inl ) , outer plexiform layer ( opl ) , and outer nuclear layer ( onl ) . the superficial plexus was defined as the slab within the inner 80% of the ganglion cell complex ( gcc ) and minimum thickness of 61 m . the intermediate plexus was defined as vessels in the outer 20% of gcc and inner 50% of inl . the deep plexus was defined as vessels in the remaining slab internal to the opl and minimum thickness of 37 m . we chose a proportional rather than fixed segmentation scheme because the three plexuses merge at the edge of the foveal avascular zone ( faz ) , and a fixed segmentation scheme can result in arbitrary and meaningless differences in faz size between the vascular plexuses . in the normal eye , this scheme shows each plexus reaching the edge of the faz and avoids differences in the measurement of faz of three plexuses caused solely by the segmentation method ( campbell jp , zhang m , hwang ts , et al . , these three plexuses have been well characterized histologically in nonhuman primates and recently in human cadaveric eyes . top view , maximum decorrelation projection of each slab created en face octa of each plexus . a combined angiogram showing the more superficial plexuses placed on top with different color showed the relationship between the plexuses . the image processing strategy developed in this work for nonperfusion quantification is mainly composed of three steps : preprocessing ; vessel distance transform ; and morphologic operations . first , the original angiogram ( figs . 2a , 3a ) was first enhanced using a two - scale ( = 1 and 2 pixels ) frangi vesselness filter ( step 1 in figs . 1 , 2b , 3b ) . this filter enhances vessels by obtaining vesselness measure on the basis of eigenvalues of the second - order local structure of the angiogram ( hessian ) and suppresses background noise . reflectance - adjusted thresholding on a normal eye with a low signal strength region ( yellow circle ) , caused by a vitreous opacity . the low signal region seen on the original angiogram ( a ) persists with vessel filter ( b ) and binary filter with fixed threshold ( c ) , falsely simulating capillary dropout . an en face map of the gcl and ipl reflectance amplitude map ( d ) is filtered and scaled to create the reflectance - adjusted threshold ( e ) . applying this , the binary vessel mask ( f ) does not show an area of false capillary drop out in the low reflectance area . the original angiogram ( a ) is enhanced by a vesselness filter ( b ) and processed with a binary vessel mask with reflectance - adjusted thresholding ( c ) , which is used to create a vessel distance map ( d ) by applying distance transform . then morphologic operations removed regions with vessel distance less than four pixels ( 40 m ) ( e ) and then they eroded by a five - pixel - wide square kernel and threw away areas with minimum area smaller than eight pixels or a minor axis smaller than two pixels ( f ) . then remaining regions were dilated by seven - pixel - wide square kernel pixels ( g ) . ( h ) resulting avascular area ( light blue ) overlaid on the enhanced angiogram . to distinguish flow signal from the background noise , we previously used a fixed threshold . however , the flow noise floor depends on the oct reflectance signal , which may vary among scans and even within a single scan . consequently , with the fixed cutoff , signal strength instability can cause within - visit variation , leading to false detection of capillary dropout from the locally reduced signal ( e.g. , by vitreous opacity ; fig . 2c ) . in this study , we established a reflectance - adjusted threshold using en face structural oct of the ganglion cell layer ( gcl ) and ipl , which have moderate reflectance and are nearly free of cysts and exudates , making them good reference layers . 2d ) was taken as logarithm ( s ) and filtered with a 15 15 pixel gaussian operator g , with an sd of 8 pixels and scaled ( step 2 in fig . the scaling parameters a and b were trained from scans from two control eyes with in - scan signal variation and two npdr eyes , identifying maximum avascular area in npdr while only identifying the faz as an avascular area in control eyes . in this study , a was 8 10 and b was 8 10 . a relatively high threshold ( maximum of t ) was assigned to the 0.6-mm - diameter central area to facilitate a noise suppression in faz ( fig . was then compared with the enhanced angiogram to determine capillary and static tissue from the enhanced angiogram , generating a binary vessel mask by thresholding the angiogram adaptively ( step 3 in figs . 1 , 2f , 3c ) figure 2 shows that false detection of capillary nonperfusion can be avoided by this reflectance - adjusted threshold ( fig . next , a vessel distance map was obtained by applying euclidean distance transform to the binary vessel mask ( fig . euclidean distance transforms of a binary image assign a number that is the distance between that pixel and the nearest nonzero pixel of the binary image the value in the vessel distance map represents the distance of a given pixel ( x , y ) to its nearest vessel ( x , y ) . this strategy does not give disproportionate value to larger vessels like the vessel density map , allowing more accurate detection of capillary nonperfusion . this method ignores the physiologic capillary - free area along the large vessels in normal eyes , which had been frequently detected as a nonperfusion area with our previous simple thresholding method . finally , the nonperfusion map was acquired by thresholding the vessel distance map ( dt > 4 ; fig . the morphologic operations included ( 1 ) an erosion by a five - pixel - wide square kernel , ( 2 ) elimination of areas smaller than eight pixels or whose minor axis length was smaller than two pixels ( fig . 3f ) , and ( 3 ) dilation by a seven - pixel - wide square kernel ( fig these parameters were empirically determined so that these operations limit aa to relatively large , smooth contiguous areas and avoid detecting nonphysiologic areas as aa . the total aa ( taa ) and the extrafoveal aa ( eaa ) , defined as the aa outside the 1-mm central circle , were separately tabulated to minimize the contribution of normal variations in foveal avascular zone size . these values were corrected for magnification variation associated with axial length variation as previously described . the mann - whitney u - test was used to compare the detected aa between the patients with npdr and the healthy controls . the diagnostic accuracy of each parameter was assessed by sensitivity with a fixed specificity and the area under the receiver operating characteristic curve ( aroc ) . repeatability of the detected aa was assessed by evaluating the pooled sd for eyes that had two scans with an ssi greater than 54 . all statistical tests were done using spss , version 20 ( ibm , armonk , ny , usa ) . the aa in healthy controls identified by the automated procedure was compared with manual grading for detection accuracy . the manual results were delineated by using the free selection tool in gimp 2.8 ( https://www.gimp.org ; provided in the public domain by the gimp team ) . the jaccard coefficient , defined as the area of intersection divided by the area of union , measured the similarity between the automated result and manual result . healthy volunteers and diabetic participants with mild npdr were recruited from casey eye institute of oregon health and science university ( ohsu ) . eyes with nondiabetic macular pathology , media opacity , or other significant eye disease were excluded . informed consent was obtained , and the study was approved by the institutional review board of ohsu . the study complied with the declaration of helsinki and health insurance portability and accountability act . two 3 3 mm scans with 2-mm depth were obtained in one eye of each participants within a visit using a commercial spectral - domain oct system ( rtvue - xr ; optovue , fremont , ca , usa ) with a center wavelength of 840 nm , a full - width half maximum bandwidth of 45 nm , and an axial scan rate of 70 khz . in the fast transverse scanning direction , two repeated b - scans were captured at a fixed position before proceeding to the next location . a total of 304 locations along a 3-mm distance in the slow transverse direction were sampled to form a three - dimensional data cube . all 608 b - scans in each data cube were acquired in 2.9 seconds . based on the volumetric oct reflectance signal , the scanning software computed a signal strength index ( ssi ) , which is often used as an indicator of scan quality . for each scan , one x - fast scan and one y - fast scan were registered and merged through an orthogonal registration algorithm to remove motion artifacts . a directional graph search algorithm identified structural boundaries : the inner limiting membrane ( ilm ) , inner plexiform layer ( ipl ) , inner nuclear layer ( inl ) , outer plexiform layer ( opl ) , and outer nuclear layer ( onl ) . the superficial plexus was defined as the slab within the inner 80% of the ganglion cell complex ( gcc ) and minimum thickness of 61 m . the intermediate plexus was defined as vessels in the outer 20% of gcc and inner 50% of inl . the deep plexus was defined as vessels in the remaining slab internal to the opl and minimum thickness of 37 m . we chose a proportional rather than fixed segmentation scheme because the three plexuses merge at the edge of the foveal avascular zone ( faz ) , and a fixed segmentation scheme can result in arbitrary and meaningless differences in faz size between the vascular plexuses . in the normal eye , this scheme shows each plexus reaching the edge of the faz and avoids differences in the measurement of faz of three plexuses caused solely by the segmentation method ( campbell jp , zhang m , hwang ts , et al . these three plexuses have been well characterized histologically in nonhuman primates and recently in human cadaveric eyes . top view , maximum decorrelation projection of each slab created en face octa of each plexus . a combined angiogram showing the more superficial plexuses placed on top with different color showed the relationship between the plexuses . the image processing strategy developed in this work for nonperfusion quantification is mainly composed of three steps : preprocessing ; vessel distance transform ; and morphologic operations . 2a , 3a ) was first enhanced using a two - scale ( = 1 and 2 pixels ) frangi vesselness filter ( step 1 in figs . 1 , 2b , 3b ) . this filter enhances vessels by obtaining vesselness measure on the basis of eigenvalues of the second - order local structure of the angiogram ( hessian ) and suppresses background noise . reflectance - adjusted thresholding on a normal eye with a low signal strength region ( yellow circle ) , caused by a vitreous opacity . the low signal region seen on the original angiogram ( a ) persists with vessel filter ( b ) and binary filter with fixed threshold ( c ) , falsely simulating capillary dropout . an en face map of the gcl and ipl reflectance amplitude map ( d ) is filtered and scaled to create the reflectance - adjusted threshold ( e ) . applying this , the binary vessel mask ( f ) does not show an area of false capillary drop out in the low reflectance area . the original angiogram ( a ) is enhanced by a vesselness filter ( b ) and processed with a binary vessel mask with reflectance - adjusted thresholding ( c ) , which is used to create a vessel distance map ( d ) by applying distance transform . then morphologic operations removed regions with vessel distance less than four pixels ( 40 m ) ( e ) and then they eroded by a five - pixel - wide square kernel and threw away areas with minimum area smaller than eight pixels or a minor axis smaller than two pixels ( f ) . then remaining regions were dilated by seven - pixel - wide square kernel pixels ( g ) . ( h ) resulting avascular area ( light blue ) overlaid on the enhanced angiogram . to distinguish flow signal from the background noise , we previously used a fixed threshold . however , the flow noise floor depends on the oct reflectance signal , which may vary among scans and even within a single scan . consequently , with the fixed cutoff , signal strength instability can cause within - visit variation , leading to false detection of capillary dropout from the locally reduced signal ( e.g. , by vitreous opacity ; fig . , we established a reflectance - adjusted threshold using en face structural oct of the ganglion cell layer ( gcl ) and ipl , which have moderate reflectance and are nearly free of cysts and exudates , making them good reference layers . 2d ) was taken as logarithm ( s ) and filtered with a 15 15 pixel gaussian operator g , with an sd of 8 pixels and scaled ( step 2 in fig . the scaling parameters a and b were trained from scans from two control eyes with in - scan signal variation and two npdr eyes , identifying maximum avascular area in npdr while only identifying the faz as an avascular area in control eyes . in this study , a was 8 10 and b was 8 10 . a relatively high threshold ( maximum of t ) was assigned to the 0.6-mm - diameter central area to facilitate a noise suppression in faz ( fig . was then compared with the enhanced angiogram to determine capillary and static tissue from the enhanced angiogram , generating a binary vessel mask by thresholding the angiogram adaptively ( step 3 in figs . 1 , 2f , 3c ) figure 2 shows that false detection of capillary nonperfusion can be avoided by this reflectance - adjusted threshold ( fig . next , a vessel distance map was obtained by applying euclidean distance transform to the binary vessel mask ( fig . euclidean distance transforms of a binary image assign a number that is the distance between that pixel and the nearest nonzero pixel of the binary image the value in the vessel distance map represents the distance of a given pixel ( x , y ) to its nearest vessel ( x , y ) . this strategy does not give disproportionate value to larger vessels like the vessel density map , allowing more accurate detection of capillary nonperfusion . this method ignores the physiologic capillary - free area along the large vessels in normal eyes , which had been frequently detected as a nonperfusion area with our previous simple thresholding method . finally , the nonperfusion map was acquired by thresholding the vessel distance map ( dt > 4 ; fig . the morphologic operations included ( 1 ) an erosion by a five - pixel - wide square kernel , ( 2 ) elimination of areas smaller than eight pixels or whose minor axis length was smaller than two pixels ( fig . 3f ) , and ( 3 ) dilation by a seven - pixel - wide square kernel ( fig these parameters were empirically determined so that these operations limit aa to relatively large , smooth contiguous areas and avoid detecting nonphysiologic areas as aa . the total aa ( taa ) and the extrafoveal aa ( eaa ) , defined as the aa outside the 1-mm central circle , were separately tabulated to minimize the contribution of normal variations in foveal avascular zone size . these values were corrected for magnification variation associated with axial length variation as previously described . the mann - whitney u - test was used to compare the detected aa between the patients with npdr and the healthy controls . the diagnostic accuracy of each parameter was assessed by sensitivity with a fixed specificity and the area under the receiver operating characteristic curve ( aroc ) . repeatability of the detected aa was assessed by evaluating the pooled sd for eyes that had two scans with an ssi greater than 54 . all statistical tests were done using spss , version 20 ( ibm , armonk , ny , usa ) . the aa in healthy controls identified by the automated procedure was compared with manual grading for detection accuracy . the manual results were delineated by using the free selection tool in gimp 2.8 ( https://www.gimp.org ; provided in the public domain by the gimp team ) . the jaccard coefficient , defined as the area of intersection divided by the area of union , measured the similarity between the automated result and manual result . eyes from 13 healthy volunteers ( mean [ sd ] age : 43 years , 10 women ) and 13 participants with mild npdr ( mean [ sd ] age : 59 years , 7 women ) were imaged , and one eye from each participant was randomly chosen for inclusion in the study . the ssi of the control group ranged from 59 to 88 and in the npdr group from 54 to 81 . no eye in the study had cysts in the inner retina . in the control group , the automated algorithm detected aa only inside the central 1-mm circle in combined one - layer or three - layer angiograms ( fig . 4 ) , with the exception of one eye that had an extrafoveal aa of 0.01 mm . the aa in normal controls detected by automated algorithm agreed with manual grading with jaccard indices of 0.85 , 0.82 , and 0.81 for superficial , intermediate , and deep angiograms , respectively ( table 1 ) , and was independent of signal strength variation between or within scans ( fig . the aa is limited to the foveal avascular zone and is similar in size and shape in all scans whether in individual plexuses or combined inner retinal angiogram . agreement between automated detection and manual delineation of the macular aa in normal controls two normal control eyes with relatively low ssi scans in individual plexuses and combined inner retinal angiogram . no avascular area outside the foveal avascular zone is detected . in the npdr group , the automated algorithm identified aa that was frequently incongruent between the three plexuses . as a result , it sometimes failed to detect any aa outside the faz when applied to the combined inner retinal angiogram in eyes with aa in individual plexuses ( fig . the aa in the superficial and deep plexuses tended to be larger than in the intermediate plexus ( table 2 ) . individual plexuses show incongruent areas of capillary nonperfusion that are not detected with combined inner retinal angiogram . avascular area in diabetic retinopathy and control eyes there was no significant difference in eaa or taa between the control and npdr groups when the algorithm was applied to the combined one - layer angiogram . when three plexuses were individually evaluated , the eaa and taa in each of the three plexuses were significantly larger in the npdr group compared with the control group ( table 2 ) . holding the specificity at 95% , the three plexuses showed that the sum of eaa was the most sensitive with the best diagnostic accuracy at an aroc of 0.99 ( table 2 ) . was assessed using eyes with two scans in the same visit with an ssi greater than 54 ( table 3 ) . twenty - two eyes from control participants and 17 eyes from npdr participants had two scans with adequate signal strength . the pooled sd of aa ranged from 0.000 to 0.024 mm in controls and from 0.035 to 0.051 mm in npdr patients ( table 3 ) . for parameters with a statistical difference between the npdr and control group , for all other parameters , the pooled sds were smaller than the population sds ( comparing table 2 and table 3 ) . within - visit repeatability of aa measurements the participants in the npdr group were older than the control group . the correlation coefficients of superficial , intermediate , and deep plexuses for eaa and participant age were 0.129 ( p = 0.674 ) , 0.033 ( p = 0.915 ) , and 0.19 ( p = 0.534 ) , respectively . the correlation coefficients of superficial , intermediate , and deep plexuses for taa were 0.179 ( p = 0.558 ) , 0.051 ( p = 0.868 ) , and 0.233 ( p = 0.443 ) . we improved the method for automated quantification of nonperfusion using octa by combining several image processing techniques . projection - resolved octa allowed visualization of three distinct retinal plexuses and detection of capillary abnormalities not visible in combined inner retinal angiograms . a vesselness filter removed the spurious pixels that can interfere with the detection of actual gaps between vessels . the use of a vessel distance map minimized disproportionate contribution of large vessels in determining vessel density abnormality and eliminated the undesirable detection of a normal avascular area along large vessels of the superficial plexus as aa . by using local reflectance signal strength as a reference for separating flow signal and background noise , false - positive detection of nonperfusion morphologic operations further reduce false - positive detection of aa . by applying these techniques to eyes with mild npdr , the total nonperfusion area outside the central 1-mm circle could distinguish npdr from control eyes with high diagnostic accuracy , even in eyes where the combined inner retinal angiogram did not reveal any nonperfusion . this study confirms the potential of automatically quantified aa using octa as a biomarker in dr , even in less severe disease . the faz is known to have significant variability in normal and diabetic patients . with segmentation into individual plexuses , exclusion of the central 1-mm circle factored out this normal variation of faz and allowed good diagnostic accuracy of aa quantification . in this cohort of mild npdr patients , the eaa was larger in superficial and deep plexuses compared with the intermediate plexus , suggesting that nonperfusion in the intermediate plexus may occur later in the disease process of dr . however , we did not observe a significant age effect in the measured aa in any vascular plexus . more advanced techniques may be required to generalize this method to eyes with macular edema . also , the study had a limited field of view of 3 3 mm area . although this approach had excellent sensitivity and specificity for detecting dr , a wider field of view with faster machines is likely necessary to further improve the utility of octa and its biomarkers in the management of dr .

self - assembly is a widely used technique in the field of nanotechnology to access ordered macroscopic 1d , 2d , or 3d structures from simple building blocks such as nanorods and/or nanoparticles ( np ) . recently , the attention paid to one - dimensional ( 1d ) nanomaterials has been increasing significantly because of the need to fabricate alternative functional 1d nanostructures for applications in the fields of nanoelectronics and nanobiotechnology . the appeal of 1d nanostructures derives from their intrinsic properties : these are the smallest structures capable of efficiently transporting electrical carriers and can therefore be used both as wiring or device elements in the design of the new generation of miniaturized devices . from the family of 1d nanostructures , organic , organometallic , and organic inorganic hybrid structures are particularly attractive because of their chemically tunable properties and facilities for solution processing . this technique permits the fabrication of fibers from natural or synthetic polymer fibers as well as from ceramics and metals down to a few nanometers in diameter . these nanofibers can be loaded with various agents such as chromophores , and nanoparticles offering the advantages of bringing new functionalities to the organic matrix . the structural properties of the nanofibers , such as shape and diameter , depend on a variety of chemical parameters including molecular weight , solubility , glass transition temperature ( tg ) of the polymer , and concentration , viscosity or surface tension of the polymer solution , as well as processing parameters such as feed rate of the solution or geometry of the electrodes . fabrication of nanofibers requires therefore the optimization of these parameters , often leading to a narrow operating window . consequently , the concept is complex to implement and the diameters of the obtained nanofibers are seldom uniform . another approach to obtain 1d arrays is via the self - assembly of anisotropic particles . in the case of spherical nanoparticles , controlling the surface chemistry of the fabricated nanoparticles allows the creation of an anisotropic ligand organization . this facilitates the orientation of specific interactions in one direction , which helps directing the self - assembly into 1d arrays . this concept was successfully exploited by stellaci and co - workers who introduced anisotropic properties on ligand stabilized aunps . the ligands situated at the poles of a particle are less stabilized by intermolecular interactions than their neighbors and are therefore the first to be replaced during ligand - exchange reactions . these pole - modified nps were then employed as building blocks to generate nanoparticle chains ( npc ) . the self - assembly of the nps into a well - defined 1d array is also influenced by interparticle chemical bonding , hydrogen bonding , van der waals interactions , electrostatic forces , or any combination of these forces . for instance , wang and co - workers demonstrated that in the case of negatively charged thioglycolic acid capped nanoparticles , the electrostatic repulsion experienced by a particle attaching to the end of a particle chain is weaker than for a side of chain attachment . however , the self - assembly process is limited by the stability of the nanoparticles in solution since particles at the nanoscale level have a high tendency to undergo self - aggregation . therefore , the self - assembly of uncharged nanoparticles with size below 5 nm in solution is difficult to achieve . gold nanoparticles ( aunps ) have been intensively investigated over the past few years with respect to their synthesis and self - assembly . the specific properties of aunps make them of utmost interest for applications in electronics , optics , catalysis , or medicine . aunps can be synthesized through various methodologies , the most common one being the citrate reduction of haucl4 in water , introduced by turkevich et al . in 1951 . the use of citrate permits a controlled ligand exchange of the ions adsorbed on the surface . schiffrin method , using thiol ligands that strongly bind to gold to stabilize the particles . the obtained particles can in this case be isolated and redissolved in organic solvents , enabling further functionalization through conventional organic chemistry . moreover , the particle size and polydispersity can easily be controlled by varying the thiol to gold ratio or the reduction conditions . it has already been reported that citrate decorated gold - nanoparticles could assemble into nanofibers after partial ligand exchange of the adsorbed citrate ions by mercaptoethanol ( mea ) or thioglycolic acid . this spontaneous assembly is attributed to the electric dipole formed by the anisotropic organization of the ligands on the surface of the np . however , to our knowledge , self - assembly of in situ synthesized nanoparticles in nonaqueous medium employing a one - pot methodology and using only commercially available compounds has not yet been reported . herein , we investigate several commercially available thiol building blocks to direct the assembly of in situ synthesized gold nps into 1d nanoparticles chains ( npc ) via a cost - effective one step self - assembly process . moreover , the effect of critical parameters such as molar ratio , ph , temperature , and solvent on the npc formation is examined . the npc systems were characterized by means of atomic force microscopy ( afm ) , transmission electron microscopy ( tem ) , high resolution tem , and attenuated total reflection fourier transformed infrared spectrometry ( atr - ftir ) . dimethylformamide ( dmf ) and dimethyl sulfoxide ( dmso ) were purchased from fisher scientific . hydrogen tetraaurochlorate ( haucl4 ) ( 99.9% ) , 2-mercaptoethanol ( mea ) ( 99.0% ) , 3-mercaptopropionic acid ( mpa ) ( > 99% ) , and 11-mercapto-1-undecanol ( mu ) ( 99% ) were purchased from sigma - aldrich . tem measurements were performed using a tecnai biotwin ( fei ltd . ) at 100 kev to determine the size and size distribution of particles . the instrument was operated at low beam intensities to prevent electron damage of the polymer samples . hybrid materials solutions were deposited on carbon - coated copper grids ( 400 meshes , agar scientific ) . atomic force microscopy ( afm ) ( digital instruments dimension 3100 nanoscope ) with si cantilevers ( nanoworld point probe cantilevers , f = 315 khz , k = 40 n / m ) was used to investigate the film morphology of the samples . the measurements were performed in tapping mode to minimize any damage to the sample surface . vis spectra were recorded using a varian cary 50 photospectrometer ( varian inc . ) with the monochromator slit width of 5 mm . spin - coating was performed on a delta 10 tt spincoater ( sss microtec lithography gmbh ) at 2500 rpm for 10 s , deposing one drop of solution on the substrate ( 0.5 1 cm ) . plasma etching was performed in a plasma system femto ( diener electronic ) under oxygen atmosphere for 20 min . an attenuated total reflection fourier transform infrared instrument from bruker ( model tensor 27 ) was used at ambient temperature in the spectral range from 4000 to 550 cm . the wafers were immersed in a h2so4/h2o2 ( 4:1 ) solution at 70 c for 15 min , rinsed with water , and immersed again in a h2o2/nh3/h2o ( 1:1:1 ) solution at 60 c for 15 min . warning : piranha solution reacts strongly with organic compounds and should be handled with extreme care . a solution of thiol ligands was prepared at 1 mg / ml in dmf . hydrogen tetraaurochlorate ( 0.2 equiv to thiol ligand ) was added to the solution and stirred overnight . the gold precursor was then reduced to form gold nanoparticles using sodium borohydride ( 10 equiv to haucl4 , in water ) , resulting in a color change of the solution from slightly yellow to dark red . the formation of nanofibers via the self - assembly of aunps is usually performed in two steps : synthesis of aunps followed by ligand exchange to induce the self - assembly . in this section , a novel concept is proposed to synthesize and in situ self - assemble aunps into well - defined 1d nanostrutures via a one - pot chemical process . the method relies on the synthesis of aunps in a one - phase system in the presence of thiols . in this study , the potential of several commercial thiols to direct the in situ assembly of aunps into nanofibers is investigated . the thiol monomers were chosen to evaluate the influence of several parameters on the formation of fibers such as the nature of the functional groups , the length of the alkyl backbones , and the introduction of branching . the investigation was based on linear hydroxyl terminated thiols , 2-mercaptoethanol ( mea ) and 11-mercapto-1-undecanol ( mu ) , as well as a dihydroxyl terminated thiol , 2,2-bis(hydroxymethyl)-2-mercaptoethylpropanoate ( bmp ) . the presence of the hydroxyl group was expected to favor the self - assembly via the formation of hydrogen bonds . mu was selected for its longer carbon chain which allows crystallization of the ligands . an amine and a carboxylic acid functional thiol , cysteamine and 3-mercaptopropionic acid ( mpa ) , respectively , were used to extend the study since both groups can potentially be charged and/or participate in the formation of hydrogen bonds . from the obtained results , a mechanism explaining the formation of npcs is proposed and confirmed by the evaluation of important parameters such as molar ratio of thiol to gold precursor , solvent , temperature , and ph . aunps were prepared from hydrogen tetraaurochlorate ( haucl4 ) precursor in a one - phase system using dmf as solvent . the polar dmf was chosen because of its ability to efficiently solubilize both the gold precursor and the ligands . initially , the thiol ligand was dissolved in dmf followed by the addition of haucl4 gold precursor in a molar ratio of 5 mol of thiols for 1 mol of gold precursor . the inorganic precursor dissociates in solution , resulting in [ aucl4 ] complexes that thereafter react with the thiol molecules . the formation of gold nanoparticles is obtained through the addition of a reducing agent ( nabh4 dissolved in water ) to reduce au to au . interestingly , when using 2-mercaptoethanol ( mea ) as a ligand , 1d nanostructures with high aspect ratio were observed on the solid si / siox substrate before ( figure 1a ) and after ( figure 1b ) the reduction of aunps . afm evaluation revealed the formation of 1d nanoarrays in the presence of au - precursor and mea , having a diameter of 70 nm with a height of 24 nm . however , after reduction of the gold precursor by nabh4 in solution , large aggregates were generated . these aggregates probably result from the folding of the 1d arrays from a linear to a globular shape because of disruption of specific interactions between the gold particles and the surrounding solvent . the solution after reduction of the gold precursor was analyzed by uv vis spectroscopy and showed a maximum absorption at 525 nm , confirming the presence of large gold particles.this value can be attributed to the aggregates , since it has been reported that no plasmon band is observed for aunps with core diameter smaller than 2 nm . ( a ) afm height image and surface profile of mea / haucl4 ( molar ratio of 5 to 1 ) . ( b ) afm height image and surface profile of mea / haucl4 ( molar ratio of 5 to 1 ) after reduction by nabh4 . ( c ) afm height image and surface profile of mea / haucl4 ( molar ratio of 5 to 1 ) after oxygen plasma etching . to determine whether the 1d nanostructures resulted from the self - assembly of aunps , a substrate coated with the fabricated nanostructures was treated by oxygen plasma etching for 20 min . this treatment permits a selective etching of the organic thiol ligand and reduction of the gold precursor , leaving only the metallic aunps on the solid substrate . the afm height image of the sample after plasma - etching reveals the alignment of particles within the 1d arrays ( figure 1c , white arrows ) , thus supporting the self - assembly theory of aunps into npcs . the size and size distribution of the particles were determined by transmission electron microscopy ( tem ) measurements on a mea / haucl4 solution deposited on a copper grid . the emission of electrons during the tem measurement permits the reduction of the gold precursor . the nanoparticles are observed as dark spots because of their higher density as compared to the organic ligand . the tem micrographs show the formation of long npcs with little branching , consisting of monodispersed particles ( figure 2a ) . the nanoparticles are well - defined with an average diameter of 1.5 nm ( figure 2b ) . high resolution tem measurements were conducted to assess the crystalline structure of the particles , as presented in figure 2c . the characteristic fringes observed via htrem confirm the monocrystallinity of the particles reduced by the tem electron beam . the interparticle distance was estimated to 24 nm in the linear fibers . however , after reduction of the gold precursor by nabh4 in solution , the npcs tended to aggregate and form large particles , as observed in figure 2d . ( a ) tem micrograph of gold nanoparticles obtained from mea / haucl4 ( molar ratio of 5 to 1 ) . ( b ) size distribution of the gold nanoparticles , obtained from tem from a solution of mea / haucl4 ( molar ratio of 5 to 1 ) . ( c ) high resolution tem micrograph of gold nanoparticles obtained from mea / haucl4 ( molar ratio of 5 to 1 ) . ( d ) tem micrograph of gold nanoparticles obtained from mea / haucl4 ( molar ratio of 5 to 1 ) after reduction by nabh4 . in order to better understand the nature of the interactions involved in the npcs formation , attenuated total reflection fourier - transform ir spectroscopy analyses were conducted on pure mea and a mea / haucl4 system , before reduction of the gold precursor ( see the supporting information ) . the disappearance of the signal at 2554.3 cm , corresponding to the vibration of the thiol , after addition of gold precursor confirms the formation of an au s bond in the system . moreover , the appearance of a new signal at 3648 cm and the shift observed for the oh vibration frequency reveal the presence of hydrogen bonds in the fibers . the results obtained suggest that the self - assembly of the nanoparticles into 1d nanoarrays is due to the formation of hydrogen bonds between mea molecules on one side and between mea and dmf molecules on the other side . a model is presented in scheme 1 to explain the formation of nanofibers in solution . h groups interact with gold precursor in solution . upon addition of mea , gold complexes aggregate to form a gold cluster composed of a gold core surrounded by a thiol ligand shell . at this stage , upon addition of a 5 times excess of thiol to the gold precursor , the surface of the gold cluster is saturated by ligands . the clusters can therefore self - assemble via the formation of hydrogen bonds between the hydroxyl groups of the mea monomers . the cluster assembly is directed into 1d arrays due to the competitive formation of hydrogen bonds between the hydroxyl group of the mea and the nitrogen atom of the dmf molecules . therefore , controlling these two types of interactions is crucial for the formation of 1d nanoarrays . tem observation and plasma etching of the npcs reveal the nature of the fibers : the discrete gold nanoparticles self - assemble into a 1d array with a constant interparticle distance . some irregularities in the spacing are observed when a disulfide bond is formed by oxidation of the mea , resulting in intercalation between the particles . in dmf , some of the free mea molecules are oxidized to dihydroxyethyl - disulfide , as confirmed by the appearance of a band at 577 cm in the ftir spectra ( see the supporting information ) . this disulfide forms hydrogen bonds with the hydroxyl groups of two mea - capped aunps and increases the spacing between the au nanoparticles . when the gold is reduced in solution by nabh4 , some of the fibers fold to form aggregates . the introduction of water into the system disrupts the formation of specific hydrogen bonds between the capped aunps . changing the complementary functional group or the structure of the thiol ligand disrupts the formation of fibers , which indicates the narrow window of potential ligands able to direct the self - assembly of the aunps into npcs . because of the formation of aggregates after addition of nabh4 , all the following studies were performed on the ligand / precursor solution in dmf , before reduction of the gold precursor with nabh4 . when using the other ligands ( mpa , mu , bmp , and cysteamine ) , no npcs were formed in solution ( see the supporting information ) . the results presented above suggest that the self - assembly of the nanoparticles into 1d nanoarrays is due to the formation of hydrogen bonds between mea molecules on one side and between mea and dmf molecules on the other side . in the case of mpa , the carboxylic acid is more susceptible to form hydrogen bonds with the dmf , and therefore the equilibrium between the two types of interaction is displaced toward the formation of dmf - mpa hydrogen bonds instead of mpa - mpa hydrogen bonds . as a consequence , the particles are surrounded by a dmf shell , preventing the formation of npcs . concerning cysteamine , both the amine and the thiol group have a strong affinity to gold . therefore , the absence of fibers could be due to the adsorption of both the amino groups and the thiol on the gold surface , making the formation of hydrogen bonds impossible . , the amine group of the cysteamine could be protonated , which would result in an electrostatic repulsion of the particles . to confirm this hypothesis , the ph of the solution was altered by addition of aqueous sodium hydroxide to obtain the noncharged form of the amine . however , since the main solvent is dmf , no exact value of the ph could be obtained . no npcs were obtained at the higher ph , which could be because the amines preferentially form hydrogen bonds with the dmf . moreover , the introduction of water in the system could lead to extra hydrogen bonds between the amine and the water molecules , disrupting the formation of the npcs . in the case of mu , the longer carbon chain increases the hydrophobicity of the aunps and allows crystallization of the ligands surrounding the aunps , which results in disordered aggregation of the aunps . concerning bmp , even though the molecule contains a higher number of hydroxyl groups , no npcs were observed by afm . in this case , the introduction of branching in the molecule affects the formation of hydrogen bonds . the wedge shaped of the bmp ligand as compared to mea fills the space at the periphery of the gold cluster more tightly . the higher number of hydroxyl groups per molecule and their closest proximity favors the formation of hydrogen bonds between the ligands of a single particle and therefore prevents the assembly of nanoparticles . the self - assembly of nanoparticles can be controlled by several types of interaction such as hydrogen bonding , electrostatic interactions , van der waals interactions , chemical bonding and/or a combination of these forces . these forces are affected by a wide range of parameters such as the surface charge of the particle , the chemical structure of the ligands or the temperature of the system to name a few . in the model described above , the formation of npcs was attributed to the formation of hydrogen bonds between the hydroxyl groups of the ligands on the one hand and between the hydroxyl groups of the ligands and the solvent on the other hand . to confirm this model , the effects of molar ratio of thiol to gold precursor , temperature , ph , and solvent on the formation of npcs have been evaluated . samples were prepared from an equimolar ratio to up to 50 times excess of thiol . afm images of thiol / haucl4 solutions spin - coated on silicon substrates are presented in figure 3 . no fibers were observed when an equimolar ratio of thiol to gold precursor was used ( figure 3a ) , while increasing the amount of thiol up to a 20 times excess resulted in the formation of npcs ( figure 3 ) . increasing the amount of thiol even more , up to a 50 times excess , interestingly , the thickness of the fibers is independent of the molar ratio between thiol and gold precursor . for instance , fibers of 50100 nm in thickness are observed for molar ratios of 3:1 , 5:1 , 10:1 , or 20:1 thiol to gold precursor . raman spectroscopy investigations have shown that the conformation of chemisorbed mea on gold changes from a gauche conformation to a trans conformation upon addition of thiol , scheme 2 . at low concentrations , the density of mea molecules adsorbed on the gold surface is low and the molecules can adopt a gauche conformation , lying on the surface . when the concentration of mea increases , more molecules get adsorbed on the surface and they adapt a linear trans conformation , which makes the hydroxyl groups more available for hydrogen bonding . the obtained results suggest that an excess of thiols is crucial to densely cover the gold nanoclusters and therefore to direct their self - assembly into npcs . however , the introduction of a large excess of thiols disrupt the npcs formation . the large excess of thiols competes in the formation of hydrogen bonds , hence resulting in the formation of aggregates . afm height images and surface profiles of thiol / haucl4 at different thiol to gold precursor ratios . ( a ) 1 to 1 , ( b ) 3 to 1 , ( c ) 10 to 1 , and ( d ) 20 to 1 . the effect of temperature on the npcs stability is an important study related to the hydrogen bond formation between the hybrid building blocks . a closed vial containing npcs obtained from the self - assembly of mea stabilized aunps in dmf was heated under stirring at either 50 or 100 c for 1 h. afm measurements were conducted on samples prepared from the solution directly after heating and after cooling for 24 h. the afm height images taken from the sample heated at 50 c are presented in figure 4 . after heating the npcs at 50 c for 1 h , the formation of small dots was observed among the particle chains . these dots have the same thickness and height as the npcs , suggesting that they consist of fragments of npcs ( figure 4a ) . after cooling , the dots disappeared and thin ( 50100 nm thick ) and thick npcs ( up to 200 nm thick ) were formed ( figure 4b ) . on the other hand , afm measurements performed after heating the solution at 100 c for 1 h revealed a smooth surface both before and after cooling . no npcs or dots were observed on the solid substrate at this temperature . these observations suggest that heating the solution at 50 c brings enough energy to partially break the hydrogen bonds which are holding the hybrid building blocks ( nanoparticles ) together . after cooling , thicker npcs are formed due to aggregation between fragments of npcs via new sets of hydrogen bond . in contrast , heating the solution at 100 c brings enough energy to completely break the assembly . these results demonstrate that temperature disturbs the formation of npcs , probably not only by breaking the hydrogen bonds but also by changing the structure of the hybrid building blocks to inhibit the unidirectional morphology . raman spectroscopy studies have shown that temperature affects the conformation of the adsorbed mea on a gold surface : higher temperature increases the proportion of gauche mea . therefore , the availability of the hydroxyl groups decreases upon heating , which explains the breaking of the fibers . after cooling , the molecules go back to a trans conformation and some new hydrogen bonds can be formed . moreover , elevated temperature could promote the oxidative cleavage of the c s bond , resulting in thiolated nanoparticles . to validate this hypothesis , ir spectroscopy was performed on the mea / haucl4 system before and after heating at 100 c for 1 h ( see the supporting information ) . after heating the solution , the signal at 3648 cm corresponding to the formation of hydrogen bonds disappears , confirming the disruption of the hydrogen bonds . this study further strengthens the presence of hydrogen bonds between the aunps and suggests that the npcs thickness could be tailored by varying the temperature of the npcs solution ( figure 4b ) . afm height images and surface profiles of thiol + haucl4 ( molar ratio of 5 to 1 ) after heating for 1 h at 50 c before ( a ) and after ( b ) cooling . the effect of the acidity of the solution on the stability of the fibers was also evaluated . even though the ph of a dmf solution can not be accurately determined with a ph meter , the thiol and gold precursor solution ( molar ratio of 5 to 1 ) in dmf had a ph of 2.2 . the relative acidity of the initial solution is due to the dissociation of the gold precursor into h and [ aucl4 ] . the ph was increased to ph 7 , 10 , and 14 by addition of an aqueous naoh solution . afm measurements were conducted on the different solutions and revealed that npcs were stable only in acidic ph ( ph = 2.2 ) . upon addition of aqueous naoh to the solution , the hydroxyl group of the mea is partly deprotonated , resulting in a heterogeneous charge distribution . the electrostatic repulsion between the negatively charged particles is causing the disassembly of the npcs . these results indicate that switching the surface charges of the hybrid nanoparticles via tuning the ph significantly influences the npcs formation . interestingly , decreasing the ph of the solution back to its initial value does not permit the reformation of npcs . one explanation is the introduction of water in the system that can compete in the formation of hydrogen bonds and prevent the alignment of the aunps . the effect of different solvents on the stability of the fibers was also examined . mea was dissolved in ethanol , water , and dmso as an alternative to dmf . in water and ethanol , precipitates were formed upon addition of gold precursor , revealing that the particles were not stabilized efficiently by the ligands . in dmso , the formation of aggregates was observed ( figure 5 ) . a major difference between dmf and dmso is the presence of a lone electron pair on the nitrogen atom of the dmf which can participate in hydrogen bonds . therefore , hydrogen bond formation between the polar solvent and the hybrid building blocks contributes to stabilize and direct the self - assembly of the hybrid building blocks into 1d arrays . the formation of hydrogen bonds between the dmf and the hydroxyl group of the ligand prevent the agglomeration of particles . in the case of dmso , the hydroxyl groups of the mea are free to interact with each other and consequently aggregates are formed ( figure 5 ) . ( a ) afm height images of mea+haucl4 ( molar ratio of 5 to 1 ) in dmso . ( b ) scheme showing the absence of h - bond between the mea and dmso and the formation of h - bond between mea and dmf . a simple and cost - efficient concept to fabricate npcs based on gold nanoparticles has been presented . the gold particles were prepared in situ by reduction of hydrogen tetraaurochlorate as gold precursor in the presence of the commercially available mercaptoethanol . combining both materials leads to the spontaneous self - assembly of aunps into npcs with well - defined interparticle distance . the formation of hydrogen bonds between the hydroxyl groups of the ligands and between a hydroxyl group of a ligand and the nitrogen atom of the dimethylformamide seem to be key parameters for the direction of the self - assembly into monodimensional arrays . therefore , the choice of the solvent and the structure of the ligand are of critical importance . to our knowledge , this is a unique single step method reporting the formation of 1d arrays consisting of discrete gold nanoparticles . this approach could be applied to fabricate a wide range of functional hybrid npcs from different types of metallic , magnetic , and semiconductor nanoparticles leading to a broad spectrum of applications including nanoelectronics , catalysis , nanomedicine , and filtrations .

this study is a part of a project on obesity and lifestyle among adolescents in bahrain and the united arab emirates . the project is divided into three parts : anthropometric measurements and obesity , factors associated with obesity , and lifestyle of adolescents . the current study covered the third part , which related to lifestyle in this age group in bahrain . this was a descriptive cross - sectional study consisting of male and female grade 13 secondary school students selected from government schools from all the governorates of bahrain . the sample was calculated with the assumption of prevalence of 50% of unhealthy dietary habits , 90% confidence interval , and perception of 0.03 . students have been selected using a multi - stage stratified and clustered random sampling technique according to the gender , governorates , and grades . the final study sample size was 735 , aged between 15 and 18 years ( 339 males and 396 females ) . the kingdom of bahrain is divided into five governorates : capital , al - muharaq , north , central , and south . each governorate is served by a number of schools , which is proportional to the population density of a given governorate . the total number of secondary public schools was 30 ( 17 school for females and 13 for males ) at the time of the study ( 2006 ) . separate lists for males and females were used to obtain the sample ; stratified by gender , governorate , and grade ; and clustered on schools and class . the number of students chosen from each governorate was proportional to the student population density in that governorate . the objectives of the study as well as the questions in the questionnaire were explained to the students . then the students were asked to fill in the questionnaire , which was self - administrated . all the students attending the cho sen classes at the time of collecting the data participated in the study and therefore there were no non - responders . permission to conduct this research was obtained from the education and development research committee in the ministry of education , which in turn informed the principals of the schools , teachers , and students before conducting the study . the questionnaire for this study was modified from a previously validated questionnaire ( 12).the current questionnaire was reviewed by nutrition specialists at bahrain center for studies and research and ministry of health in order to check it in terms of the extent to which the items reflect the concept of identifying the dietary habits of adolescents . the content validity of the tool was then tested by five experts in the field of nutrition , public health , and epidemiology from the ministry of health , arabian gulf university , and bahrain center for studies and research to ensure that the items in the questionnaire represent the objectives and provide adequate coverage of the purpose of the study . they all generally agreed about the content and some changes were incorporated according to their suggestions . the comparison between the results of the first and the second questionnaire was obtained by computing pearson correlation , the result showed the value of 0.87 for pearson correlation , which indicates that the questionnaire used in the study was reliable . forty - eight students ( 22 male and 26 female students , one class from the male and the female secondary school ) were employed in the pilot study by completing the questionnaire after obtaining their permission and explaining the objectives of the study . the pilot study assessed the items where the participants were reluctant to answer any questions . the final draft of the questionnaire had been modified based on the feedback received from the students . the two schools participating in the pilot study were excluded from the selected schools for the study . the instrument selected to measure the identified variables ( dietary habits , lifestyle , and physical activities ) is a structured , self - administered questionnaire . the questionnaire was divided into two parts : the first part relates to socio - demographic data including age , sex , and educational status of parents . parent 's level of education was defined as low ( illiterate , those who can read , write , and have primary school education ) , middle ( intermediate and secondary school education ) , and high ( university education ) . information related to physical activity such as frequency of playing sports inside and outside the school and participation in physical education classes was obtained through self - reported questions . all the questionnaires were reviewed for completion immediately after administering them to the students in the schools . computer printouts of the data were reviewed for any information that was out of range . the statistical analysis was undertaken using the statistical package social sciences ( spss ) , version 12 relevant descriptive statistics , as well as inferential statistics were compiled . chi - square tests were used to determine the presence of association between the variables . this was a descriptive cross - sectional study consisting of male and female grade 13 secondary school students selected from government schools from all the governorates of bahrain . the sample was calculated with the assumption of prevalence of 50% of unhealthy dietary habits , 90% confidence interval , and perception of 0.03 . students have been selected using a multi - stage stratified and clustered random sampling technique according to the gender , governorates , and grades . the final study sample size was 735 , aged between 15 and 18 years ( 339 males and 396 females ) . the kingdom of bahrain is divided into five governorates : capital , al - muharaq , north , central , and south . each governorate is served by a number of schools , which is proportional to the population density of a given governorate . the total number of secondary public schools was 30 ( 17 school for females and 13 for males ) at the time of the study ( 2006 ) . separate lists for males and females were used to obtain the sample ; stratified by gender , governorate , and grade ; and clustered on schools and class . the number of students chosen from each governorate was proportional to the student population density in that governorate . the objectives of the study as well as the questions in the questionnaire were explained to the students . then the students were asked to fill in the questionnaire , which was self - administrated . all the students attending the cho sen classes at the time of collecting the data participated in the study and therefore there were no non - responders . permission to conduct this research was obtained from the education and development research committee in the ministry of education , which in turn informed the principals of the schools , teachers , and students before conducting the study . the questionnaire for this study was modified from a previously validated questionnaire ( 12).the current questionnaire was reviewed by nutrition specialists at bahrain center for studies and research and ministry of health in order to check it in terms of the extent to which the items reflect the concept of identifying the dietary habits of adolescents . the content validity of the tool was then tested by five experts in the field of nutrition , public health , and epidemiology from the ministry of health , arabian gulf university , and bahrain center for studies and research to ensure that the items in the questionnaire represent the objectives and provide adequate coverage of the purpose of the study . they all generally agreed about the content and some changes were incorporated according to their suggestions . the comparison between the results of the first and the second questionnaire was obtained by computing pearson correlation , the result showed the value of 0.87 for pearson correlation , which indicates that the questionnaire used in the study was reliable . forty - eight students ( 22 male and 26 female students , one class from the male and the female secondary school ) were employed in the pilot study by completing the questionnaire after obtaining their permission and explaining the objectives of the study . the pilot study assessed the items where the participants were reluctant to answer any questions . the final draft of the questionnaire had been modified based on the feedback received from the students . the two schools participating in the pilot study were excluded from the selected schools for the study . the instrument selected to measure the identified variables ( dietary habits , lifestyle , and physical activities ) is a structured , self - administered questionnaire . the questionnaire was divided into two parts : the first part relates to socio - demographic data including age , sex , and educational status of parents . parent 's level of education was defined as low ( illiterate , those who can read , write , and have primary school education ) , middle ( intermediate and secondary school education ) , and high ( university education ) . information related to physical activity such as frequency of playing sports inside and outside the school and participation in physical education classes was obtained through self - reported questions . all the questionnaires were reviewed for completion immediately after administering them to the students in the schools . computer printouts of the data were reviewed for any information that was out of range . the statistical analysis was undertaken using the statistical package social sciences ( spss ) , version 12 relevant descriptive statistics , as well as inferential statistics were compiled . chi - square tests were used to determine the presence of association between the variables . socio - demographic characteristics of the adolescents that participated in the study are given in table 1 . about 22% of the adolescents fathers and 32% of their mothers had low educational level . a higher level of education for fathers ( 31.2% ) was observed as compared with that of the mothers ( 25.2% ) . socio - demographic characteristic of bahraini adolescents chi - square test , the p - value indicates the comparison between males and females . the food consumption and snacking patterns of the bahraini adolescents are shown in table 2 . about 56% of the adolescents did not consume breakfast regularly , the proportion of females was nearly double ( 62.8% ) than the males ( 37.2% ) , and the difference was statistically significant ( p<0.01 ) . similarly , the proportion of females who did not consume a regular lunch and supper ( 68.3 and 66.5% , respectively ) was twice that of the males ( 31.7 and 33.5% , respectively ) and the gender difference for both lunch and supper was statistically significant ( p<0.01 ) . food consumption and snacking patterns of bahraini adolescents chi - square test , the p - value indicates the comparison between males and females . on the whole most of them ( 70.7% ) ate from the school canteen , while 34.4% ate food brought from home but with no significant gender difference . supper was less likely to be eaten regularly ( 73.6% ) than lunch ( 83.3% ) . males were more likely to eat lunch and supper on a regular basis than females . the type and frequency of food consumed by bahraini adolescents are presented in table 3 . about 25% of the respondents reported eating fruit daily , while 27.7% consumed fruit rarely . of those who rarely ate fruit , 33.5% were males and 66.5% were females . in general , males were more prone to consume fruit than females ( p<0.001 ) . in addition , the proportion of respondents who rarely consumed vegetables was higher ( 38.1% ) than those who consumed vegetables everyday ( 26% ) . reverse trends were observed concerning the consumption of milk and other dairy products , where 37% consumed these products daily with the proportion of females ( 52.7% ) more than males ( 47.3% ; p<0.02 ) . the gender difference was also significant with meat consumption ( p<0.001 ) , as males were more likely to consume meat than females . type and frequency of food consumed by bahraini adolescents chi - square test , the p - value indicates the comparison between males and females . only 6.9% of the participants consumed fish on a daily basis , while a relatively high proportion ( 38.9% ) did so rarely . chicken was more popular among the study group , with 18.2% of the respondents consuming chicken every day , while lentils were less preferred ( 4.1% ) . a similar preference was observed for nuts ( 7.6% ate nuts daily ) and canned fruit juice ( 23.9% consumed daily ) . the size and frequency of the intake of fast food and sweets by bahraini adolescents are seen in table 4 . there was no significant difference between gender and frequency of eating fast foods per week . in general , males were more likely to eat fast foods outside their home than females ( p<0.001 ) , whereas females preferred to eat fast foods inside the home ( p<0.01 ) . a small percentage ( 8.4% ) of adolescents reported not eating burgers and a majority of respondents ( 68.8% ) preferred regular size burgers . however , the tendency to eat large size burgers was more pronounced among males than females ( p<0.001 ) . a regular portion size of potato chips was preferred by 63.3% of the adolescents , among them 58.9% were females and 41.1% were males ( p<0.002 ) . there was a wide range of preferences for soft drinks with 42.2% of participants consuming them every day and 27.8% consuming them rarely . females showed a higher rate in the consumption of small and medium size soft drinks ( 57.8 and 56.3% , respectively ) compared to males ( 42.2 and 43.7% , respectively ) ( p<0.05 ) . females were more prone to consume sweets ( p<0.01 ) and chocolates ( p<0.001 ) than males . fast food intake of bahraini adolescents chi - square test , the p - value indicates the comparison between males and females . only a negligible percentage ( 5.3% ) did not watch television ( tv ) daily . of the adolescents , 41.8% always consumed food while watching tv while only 18.0% did not . more than 50% of adolescents browsed the internet for 1 to 2 hours per day and 17.7% browsed for 3 to 4 hours a day . a very small proportion of adolescents ( 6.6% ) ate while browsing the internet , of whom 68.6% were males and 31.4% were females . lifestyle habits amongst bahraini adolescents chi - square test , the p - value indicates the comparison between males and females . over a quarter ( 26.5% ) of the respondents never participated in any sporting activity , with a greater proportion being females ( 79.5% ) compared to males ( 20.5% ) . about 69.2% of males practiced sports daily as against 30.8% of females ( p<0.001 ) . participation in sports activities in school was high ( 79.9% ) while only 6.1% never took part in school sports . amongst the adolescent participants who always engage in sports activities outside school , the majority were males ( 81.6% ) while only 18.4% were females . in general , males significantly participated in more sport activity either at school ( p<0.01 ) or outside school ( p<0.001 ) than females . this study indicates unfavorable dietary habits and lifestyle by a high proportion of bahraini adolescents . a previous study in bahrain reported that about 19 and 22% of school males and females skipped breakfast , respectively ( 11 ) . however , it is difficult to compare these findings with the results of this study due to the differences in age group and the way the questions were phrased . a similar tendency for skipping breakfast has been reported among swedish ( 13 ) and turkish ( 14 ) adolescents , where female adolescents were more likely to display abnormal eating attitudes and dieting behaviors than males . for females , skipping breakfast may be connected in some way to feelings about body shape and it may also be a method of dieting . for males , however , skipping breakfast may be associated with lack of time or accessibility ( 15 ) . skipping breakfast may be related to risk for obesity and cardio - metabolic health . in a longitudinal study , smith et al . ( 16 ) found that participants who skipped breakfast in both childhood and adulthood had a larger waist circumference and higher fasting insulin , total cholesterol , and ldl cholesterol concentrations than those who ate breakfast regularly . in addition , regular breakfast intake has a positive association with attention - concentration , memory , and school achievement among school children ( 17 ) . although breakfast was often skipped , we found that lunch and dinner were consumed regularly by most of the adolescents . a similar pattern of food intake has been reported amongst adolescents in nordic countries ( 13 ) where the skipping of breakfast was reported , but about 80% of the adolescents consumed a regular afternoon meal and dinner . it has been documented that boys and girls with irregular breakfast intake had received a high percentage of their energy needs from in - between meals ( 18 ) . ( 19 ) reported that some foods commonly provided by school canteens in bahrain have a greater caloric value . in addition , in a study describing the contribution of school meals to nutrient intake amongst english primary and secondary schools , it was reported that school meals often failed to make good the shortfalls in the daily intake of essential nutrients ( 20 ) . the finding that a greater proportion of adolescents consumed snacks is similar to findings amongst syrian adolescents , where snacking and light meal consumption was very common ( 21 ) . the present study showed that about 25% of total adolescent consumed fruit and vegetables daily . low intake of fruit and vegetables is associated with several chronic diseases at adulthood ( 22 ) . in the united states krebs - smith et al . ( 23 ) found that among children aged 218 years , mean consumption of fruit and vegetables was 3.5 servings per day with consumption increasing in older males ( 4.3 servings per day ) , but remaining the same among females regardless of age . in general , although the proportion of males who consumed fruit was higher than females , vegetable consumption was higher amongst females . studies on fruit and vegetable consumption among children indicate that some of the determinants that influence consumption are gender , parental intake , and home availability / accessibility ( 24 ) . fast food has become a prominent feature of the diet of children throughout the world ( 25 ) . this is especially true when we compare our findings with those previously reported by musaiger and gregory ( 11 ) where none of the school children mentioned that they consumed fast foods . studies in arab gulf countries ( 57 ) have shown that fast foods are now becoming an integral part of the lifestyle of school children . the fact that girls consume fast foods more at home than the boys could be due to cultural restrictions on travel and ease of home delivery from fast food restaurants that have become very popular in bahrain in the past few years , especially among the younger generation . the preference of males for larger portions of burgers and potato chips is similar to that reported amongst kuwaiti adolescents , where males were more likely than females to consume larger size portions of fast foods ( 26 ) . while watching television tv has profoundly changed the use of leisure time in many countries , there is evidence that it is associated with negative outcomes such as poor dietary habits ( 27 ) . in addition , in recent years , computers have begun to play a vital role in today 's generation as the need for information has increased ( 28 ) . there is mounting evidence that excessive tvviewing among children and adolescents can seriously challenge young people 's emotional and physical well - being ( 29 ) . our study indicates that a good number of adolescents spend a substantial portion of their time watching tv or surfing the internet every day . while there are potential benefits from watching some tv programs and using the internet , studies amongst preschoolers indicate that greater exposure to tv and videos may influence the consumption of unhealthy foods ( 30 ) . although the proportion of adolescents who eat while using the internet in this study was low , snacking while watching tv especially amongst girls was high . snacking , but not necessarily eating meals , while watching tv is associated with increased overall caloric intake and calories from fat ( 31 ) . it was found that overweight and obesity among school children are directly related to the amount of time spent in front of a tv set or personal computer ( p<0.01 ) ( 32 ) . in children and adolescents alike , maintaining an optimal level of physical activity is particularly important as it not only reduces the risk of overweight but also improves body composition and the growth pattern ( 33 ) . in this study we found that the greater proportion of adolescents who did not participate in sports was females , while a considerable percentage of males participated in physical activity . the exact nature and duration of activity could not be ascertained owing to the fact that students encountered difficulties in describing the activity correctly . gender difference was significant with regard to practicing sports during school hours and also outside school ; however , females were less active than males . one of the main reasons for girls not participating in sports can be social and religious norms and restrictions that may preclude female students from engaging in public sports ( 36 ) . this cultural drawback further contributes toward the rising epidemic of overweight and obesity prevalent in the arabian gulf countries . in conclusion , adolescents in bahrain seem to be moving toward unhealthy eating habits in conjunction with a diet high in saturated fats , sugar , and refined foods but low in fiber often termed the this may increase the risk factors for chronic non - communicable diseases in a later age such as coronary heart disease , diabetes , hypertension , and cancer . these diseases have become the main public health problems in most of the countries in the middle east ( 38 ) . nutrition education among both school children and their parents should emphasize the importance of following dietary guidelines recently developed for the arab countries ( 39 ) . regular interaction between parents , adolescents , school authorities , and health personnel is required to emphasize the connection between health , healthy food choices , and lifestyle habits . the authors have not received any funding or benefits from industry or elsewhere to conduct this study

somatostatin ( som ) is a 14 amino acid neuropeptide originally identified as somatotropin release - inhibiting factor in the hypothalamus ( brazeau et al . , 1973 ) . it is distributed widely in the brain and is coreleased with amino acid neurotransmitters . under normal conditions , som is exclusively expressed in cortical gabaergic interneurons ( somogyi et al . , 1984 ) . in the hippocampal ca1 area , at least five distinct neuron types express som ( baude et al . , 1993 ; chittajallu et al . , 2013 ; katona et al . , 1999 ; klausberger et al . , 2004 ) and some som - expressing gabaergic cell types also project to extrahippocampal areas ( gulys et al . , 2003 ; including the entorhinal cortex in the mouse ( melzer et al . , 2012 ) . all of these neurons probably release som and gaba within the dendritic domain of pyramidal cells and also innervate other interneurons ( gulys et al . some interneurons , including the bistratified cells , also express neuropeptide tyrosine ( npy ) , a powerful inhibitor of glutamate release ( colmers et al . , 1985 ) . taken together , it appears that the primary role of som - expressing interneurons is the regulation of dendritic inputs and signal integration . indeed , the bistratified cell was recently shown to be a key controller of pyramidal cell output in vitro ( lovett - barron et al . , 2012 , 2014 ) . the som - expressing bistratified and o - lm cell types in the ca1 area have nonoverlapping axonal arbors and are each selectively associated with one of the major glutamatergic inputs to pyramidal cells . bistratified cells innervate the dendritic zones of pyramidal cells receiving input from the ca3 area ( buhl et al . , 1994 ) , whereas o - lm cells innervate the entorhinal input zone ( mcbain et al . , 1994 ) . both cell types coexpress parvalbumin ( pv ) , a calcium - binding protein that is also expressed by axoaxonic cells and one type of basket cell ( klausberger et al . , 2003 , 2004 ) . axoaxonic cells exclusively target axon initial segments and pv+ basket cells target proximal dendrites and somata ; both release gaba but do not express som or npy . the firing patterns of hippocampal interneurons are highly dependent on the network state , such as theta oscillations during movement or large - amplitude irregular network activity during sleep ( buzski , 2006 ; ego - stengel and wilson , 2007 ; okeefe and conway , 1978 ; ranck , 1973 ) . drug - free behavior - dependent firing patterns of some identified cell types have been determined recently in freely moving rats ( ivy cells , pv+ basket cells ; lapray et al . , 2012 ) and in head - fixed mice ( o - lm cells , pv+ basket cells ; varga et al . , 2012 we have recorded the firing of two distinct types of dendrite - targeting neuron in freely moving rats to test the hypothesis that differences in the axonal terminations of som - expressing cells are associated with different firing patterns under natural awake behavior and sleep . this required the recording and labeling of som - expressing interneurons in freely moving rats using the juxtacellular labeling technique to identify the cells and enabled us to quantitatively dissect the firing dynamics of these cells and compare them to pv+ basket cells ( lapray et al . , 2012 ) , which target a different subcellular domain of pyramidal cells . we have recorded the firing patterns of single interneurons using a glass electrode during periods of sleep , movement , and quiet wakefulness . then , we either moved the electrode into a juxtacellular position or sometimes the cells spontaneously drifted close to the electrode , which made it possible to attempt labeling the cells with neurobiotin for identification of cell types . the labeled cells were assessed by immunofluorescence microscopy and tested for the presence of various molecules , including som and npy . nine identified interneurons ( n = 9 rats , one cell each ) were immunopositive for som , npy , or both when tested by immunofluorescence microscopy and showed dendritic and axonal arborizations similar to previously described bistratified and o - lm cells ( buhl et al . , 1994 ; the recording sites were distributed over an area of 1.7 1.4 mm along the rostrocaudal and mediolateral axes ( figure s1a available online ) . somata of bistratified cells ( n = 4/5 recovered ) were located in the vicinity of pyramidal cell somata ( figures 1a and s1a and s1c ) , had mainly radially oriented dendritic trees ( n = 3/5 recovered ; see exception figure s1c ) , and axon collaterals distributed in strata oriens and radiatum ( n = 3/5 recovered ) . the axonal extent of a well - labeled cell was large ( figure 1a ) , reaching 2.4 mm mediolaterally and 1.7 mm rostrocaudally , confirming previous results obtained in vivo ( klausberger et al . , 2004 ) . somata ( n = 4/4 tested ) were immunopositive for npy ( figures 1b and s1e ) and parvalbumin ( pv ) , the latter also expressed in dendrites and axon ( figures 1c and s1d ; table 1 ) . from the fifth interneuron ( tv30d ) , we have only recovered some pv - immunopositive dendrites and the axon , which showed the characteristic bistratified distribution . somata were immunopositive for som ( n = 3/4 tested ; figure 1b ) ( klausberger et al . , 2004 ) , the metabotropic glutamate receptor type 1 alpha ( mglur1 ; n = 1/2 tested ) , and one expressed the transcription factor satb1 ( n = 1/3 tested ; table 1 ) . all three tested bistratified neurons had somatic and dendritic membranes enriched in tyrosine - protein kinase receptor erbb4 ( figure 1d ) . cell bodies and horizontal spiny dendrites of recorded o - lm cells were in stratum oriens ( n = 4/4 recovered ; figures 2a and s1a ) . the main axons ( n = 3/4 recovered ) originated from dendrites and projected into stratum lacunosum moleculare branching into a dense plexus ( figure 2a ) . from one o - lm cell ( lk01ab ) , somata ( n = 4/4 tested ) were immunopositive for som ( figure 2b ) , and dendritic and somatic membranes were enriched in mglur1 ( figure 2d ) and decorated by metabotropic glutamate receptor type 7a ( mglur7a)-immunopositive boutons ( 4/4 tested ; table 1 ) . three out of four tested o - lm cells were immunopositive for pv ( figure 2c ) , and three were immunopositive for the zinc finger protein transcription factor fog-2 ( figure 2e ) . two o - lm cells tested for extracellular leucine - rich repeat fibronectin - containing protein type 1 ( elfn1 ) were immunopositive ( figure 2f ) . none of the tested o - lm cells expressed calbindin or npy ( table 1 ) . the axon of one reconstructed o - lm cell ( figure 2a ) had a mediolateral extent of 0.6 mm and a rostrocaudal extent of 1.1 mm . although the horizontal axonal extent of o - lm and bistratified cells are similar , their transmitter - releasing terminals are nearly completely separated in different layers , suggesting interactions with different glutamatergic inputs to pyramidal cells on segregated membrane domains . in order to compare their firing ( table 2 ) , we segmented the spike time series according to different behavioral states based on quantitative parameters ( lapray et al . , 2012 ) . these were extracted from motion tracking and local field potential ( lfp ) measurements in the cortex and in the hippocampus ( figures 1e , 1f , 2 g , and 2h ) . for o - lm cells , which are known to generate dendritic spikes we have analyzed the activity of pv+ and neuropeptide - expressing bistratified and o - lm cells in relation to the reported activity of pv+ basket cells ( lapray et al . , 2012 ) , which do not express any known neuropeptide . in particular , our aim was to compare the spike timing of these three cell types and the influence of movement and sleep ( tables 3 and s3 ) . we have found that behavioral states have differential effects on the firing rates of bistratified ( n = 5 ) , o - lm ( n = 4 ) , and pv+ basket ( n = 5 ; lapray et al . , 2012 ) cells ( repeated - measures anova , f2,10 = 4.81 , p = 0.0343 for the interaction between the factors cell type and behavioral state ; figure 3a and tables 2 and 3 ) . during sleep , the mean firing rate of bistratified and pv+ basket cells was significantly higher by 16.9 and 19.2 hz , respectively , than that of o - lm cells ( t(10 ) = 2.35 , p = 0.0407 , for bistratified cells ; t(10 ) = 2.75 , p = 0.0204 , for pv+ basket cells ) . as confirmed by their interspike interval ( isi ) distributions ( figures 3b and s3 ) , bistratified cells fired most frequently with high instantaneous frequency ( if ) ( 512 hz , 7.5% ; 1230 hz , 11.9% ; 30100 hz , 36.4% ; 100250 hz , 35.1% ) , in contrast to o - lm cells , which showed ifs more often in the theta and beta ranges ( 512 hz , 25.5% ; 1230 hz , 25.3% ; 30100 hz , 29.9% ; 100250 hz , 8.8% ) . during movement ( figures 3b and s3 ) , the largest proportion of isis of both bistratified ( 42.2% ) and o - lm ( 50.4% ) cells corresponded to the gamma frequency range of firing ( 30100 hz ) . bistratified cells ( 29.2% ) , but not o - lm cells ( 5.2% ) , frequently fired with isis shorter than 10 ms ( if > 100 hz ) . furthermore , the mean firing rate of bistratified and o - lm cells was higher during movement as compared to sleep , by 25.1% and 75.6% , respectively . in contrast , the mean firing rate of pv+ basket cells was lower by 22.9% during movement as compared to sleep . however , none of these apparent differences in firing rates within cell types between movement and sleep states were statistically significant ( table 3 , repeated - measures anova , post hoc pairwise comparisons , p > 0.05 ) due to the large cell - to - cell variability in the data . there was no difference in the mean firing rates between the three cell types during movement ( figure 3a ) or during quiet wakefulness ( table s1 ) . we have segmented our lfp measurements into epochs of distinct oscillatory network states during different behaviors . we have detected theta oscillations ( 512 hz ; figures 1e and 2 g ) during movement , sharp wave - associated ripples ( swrs ; 130230 hz ; figures 1f , 2h , 5a , and 5b ) during sleep and wakefulness , and low oscillatory periods ( losc ) , which are often associated with state transitions ( lapray et al . , 2012 ) . bistratified ( n = 5 ) , o - lm ( n = 4 ) , and pv+ basket cells ( n = 5 ; lapray et al . , 2012 ) fired with variable rates during theta oscillations , swrs , and losc ( repeated - measures anova , f4,21 = 22.27 , p < 0.0001 for the interaction between the factors cell type and network oscillatory state ; figure 4a and tables 2 and 3 ) . during swrs , the mean firing rates of bistratified and pv+ basket cells were higher by 94.6 hz and 109.6 hz , respectively , than that of o - lm cells ( t(21 ) = 8.75 , p < 0.0001 , for bistratified cells ; t(21 ) = 10.14 , p < 0.0001 , for pv+ basket cells ) . during swrs , bistratified cells mostly fired above 100 hz discharging with isis ( 67.0% of n = 1,486 ) of 4 to 10 ms ( figure 4c ) , whereas a much smaller proportion ( 33.8% ) of o - lm cell isis ( n = 86 ) corresponded to the > 100 hz frequency range . during theta oscillations ( figure 4c ) , both bistratified and o - lm cells fired frequently ( 41.4% and 44.2% , respectively ) within the gamma frequency range corresponding to isis of 10 to 33 ms . this resulted in a significant ( 73.3% ) drop in the mean firing rate of bistratified cells ( t(21 ) = 7.45 , p < 0.0001 ) , and a 55.7% increase in the firing rate of o - lm cells , as compared to firing rates during swrs . the firing rates of both cell types were similar during losc ( figure 4c ) to their respective rates during theta oscillations . no differences were found in mean firing rates between cell types during theta periods or during losc ( table 3 ; repeated - measures anova , post hoc pairwise comparisons ) . as a potential predictor of neuropeptide release , we have detected action potential burst patterns by bistratified ( n = 5 ) and o - lm cells ( n = 4 ) , defined as at least three consecutive action potentials of isis , each 12 ms occurring during individual swrs or individual theta oscillatory cycles . bistratified cells fired such bursts ( figures 1e , 1f , and 5a ) during 55.2% 4.7% of events ( mean sem ) overall , significantly more ( repeated - measures anova , f1,7 = 56.24 , p = 0.0001 , for the factor cell type ) than o - lm cells ( figures 2 g , 2h , and 5b ) , which rarely emitted such bursts ( 2.7% 5.2% ) . this difference in the probability of bursting between bistratified and o - lm cells was independent of the network oscillatory event ( see tables 3 and s1 ) . similar differences were also revealed when testing for the occurrence of four consecutive action potentials , each isi 12 ms . additionally , bistratified cells fired such bursts of three action potentials more frequently ( 2.8 0.7 hz ; mean sem ) than o - lm cells ( 0.4 0.7 hz ) during both movement and sleep ( repeated - measures anova , f1,7 = 5.90 , p = 0.0455 for the factor cell type ; table 3 and figure s2 ) , suggesting that bistratified cells are more likely to release neuropeptides than o - lm cells during both movement and sleep . thus , o - lm cells may be more selective in their release of som compared to bistratified cells during different behaviors . the spike timing of interneurons relative to the phase of ongoing theta cycles is informative of their postsynaptic effects on pyramidal cells , which fire with highest probability , on average , at the trough of theta oscillations ( buzski , 2006 ) . we observed that the two som - expressing interneurons also fired strongly phase - coupled to the trough of theta oscillations recorded in strata pyramidale or oriens ( figure 4b and table 2 ) . the mean theta phases of bistratified ( 2.4 19.4 , mean angle angular deviation ; n = 5 ) and o - lm ( 341.6 10.1 ; n = 4 ) cells did not differ ( p = 0.1508 , permutation test [ tukker et al . , 2007 ] , difference 20.8 ) . the mean strength of phase coupling ( r = 0.33 , for both ) was also similarly high ( p = 1 , permutation test , difference 0.0009 ) for the two cell types ( figure 4b and table 2 ) . moreover , the pooled phase angle and coupling strength of bistratified and o - lm interneurons differed ( permutation tests , mean phase difference , 64.4 ; p = 0.005 ; mean strength of phase coupling difference 0.1685 , p = 0.0315 ) from those reported for pv+ basket cells ( n = 5 ; mean angle = 288.5 44.4 , mean r = 0.15 ; figure 4b ; lapray et al . , 2012 ) . next , we have investigated the firing dynamics of bistratified and o - lm cells during swrs recorded either during sleep or wakefulness . bistratified cells increased their firing rate strongly during swrs ( figures 5a and 5d ) . in contrast , o - lm cells were mostly silent during swrs ( figures 5b and 5e ) . repeated - measures anova ( f1,5 = 7.64 , p = 0.0396 for the interaction between the factors cell type and behavioral state ) showed that bistratified cells ( n = 5 ) fired significantly more spikes per swr than o - lm cells ( n = 4 ) ( figure 5c and tables 2 and 3 ) during both sleep ( t(5 ) = 7.0 , p = 0.0009 , mean difference 4.6 ) and wakefulness ( t(5 ) = 5.62 , p = 0.0025 , mean difference 3.4 ) . moreover , o - lm , but not bistratified , cells had higher swr - related spike counts during wakefulness compared to sleep ( t(5 ) = 3.62 , p = 0.0152 , mean difference 1.3 , for o - lm cells ; t(5 ) = 0.5 , p = 0.6410 , mean difference 0.9 , for bistratified cells ; see also tables 3 and s1 ) . the firing probability of bistratified cells was higher during swrs than during periods of 0.5 s before and after swrs ( figure 5d ) . the firing rate during swrs was two to six times higher ( cumulative distribution functions , cdfs , p < 0.05 for n = 4 cells during sleep ; p < 0.05 for n = 4 cells during wakefulness ; figures 5f and s4a and table 2 ) than expected from the activity outside swr time periods . in contrast , o - lm cells did not change their average firing probability during swrs ( figure 5e ) . however , we have observed decreased or rarely increased firing rates during individual swrs ; and individual o - lm cells also slightly but significantly changed firing rates during swrs in either direction ( e.g. , lk13k ) . during wakefulness , the firing rate during swrs was significantly lower for one o - lm cell and higher for the other three cells than during sleep - swrs ( cdfs p < 0.05 for n = 4 cells ; figures 5 g and s4b and table 2 ) . during sleep - swrs , the mean rates were significantly decreased for two cells and increased for one cell ( cdfs , p < 0.05 for n = 3 cells ; figures 5 g and s4b and table 2 ) . our results demonstrate that som and gaba are released to distinct dendritic zones of ca1 pyramidal cells during sleep and awake states by bistratified and o - lm cells , differentially coordinating inputs from ca3 and entorhinal cortex , respectively . both cell types activate postsynaptic gabaa receptors on pyramidal cell dendrites ( buhl et al . dendritic integration in pyramidal cell dendrites is nonlinear and involves voltage - dependent conductances ( losonczy and magee , 2006 ; spruston , 2008 ; takahashi and magee , 2009 ) . the synergistic effects of som released by o - lm and bistratified cells and npy released by bistratified cells are likely to regulate dendritic electrogenesis via pre- and postsynaptic receptors at a slower timescale than gaba . as peptide release is facilitated by high - frequency firing ( van den pol , 2012 ) the much higher frequency of burst firing by bistratified compared to o - lm cells , during movement and sleep , suggests that the ca3 input is under stronger peptidergic inhibition than the entorhinal input . indeed , som ( tallent and siggins , 1997 ) and npy ( colmers et al . , 1985 ) inhibit excitatory currents evoked by schaffer collaterals ( boehm and betz , 1997 ; tallent and siggins , 1997 ) , and y2 receptors are negatively coupled to n - type calcium channels on ca3 pyramidal cell terminals ( stani et al . , 2006 ) . the calcium - dependent som release mechanism from o - lm cells probably requires fewer spikes and at lower frequencies compared to bistratified cells , as o - lm cells burst less frequently . somatostatin receptors sst2r , sst3r , and sst4r are highly expressed by hippocampal and entorhinal glutamatergic neurons ( breder et al . in the entorhinal termination zone , sst2r immunoreactivity was described on terminals ( dournaud et al . , 1996 ) , possibly mediating the presynaptic inhibitory effect of o - lm cells . the sst3r knockout mice show impaired object - recognition memories ( einstein et al . , 2010 ) . somatostatin can augment the voltage - sensitive noninactivating k+ m - current ( i - m ) ( moore et al . , 1988 ) and increase a k+ leak current ( schweitzer et al . , 1998 ) mediated by sst4r ( qiu et al . , 2008 ) . bistratified cells are likely candidates for the activation of sst3r ( einstein et al . , 2010 ) and sst4r ( schreff et al . , 2000 ) due to their location on pyramidal cell dendrites . activating the m1 muscarinic ach receptor can inhibit the m - current ( dasari and gulledge , 2011 ; halliwell and adams , 1982 ) ; hence , during theta oscillations when cholinergic tone is increased , levels of i - m activation are likely to be dominated by ach - mediated suppression , and the augmentation by som may differ between active and inactive pyramidal cells due to the voltage sensitivity of the current . during swrs , when som release from bistratified cells increases and cholinergic tone is low , augmentation of i - m may dominate and contribute synergistically with presynaptic y2 receptor activation to the termination of swrs . ; schulz et al . , 2000 ) and gabab receptors are unlikely to block glutamate release ; instead , they reduce release probability , thereby preserving presynaptic potency over periods of high presynaptic firing rates . during swrs generated in ca3 ( buzski , 2006 ) , single pyramidal cells rarely fire more than one to two action potentials , which individually would only have a weak effect on o - lm cells ( ali and thomson , 1998 ) but stronger effects on bistratified cells ( ali et al . , 1998 ) . this is consistent with the strong activation of bistratified cells by simultaneous inputs from ca1 and ca3 . the firing of bistratified cells ( klausberger et al . , 2004 ) coupled to swrs rarely dropped below 80 hz , providing entrainment of the innervated small pyramidal cell dendrites in cooperation with pv+ basket cells that innervate the soma and proximal dendrites ( lapray et al . , 2012 ; varga et al . , 2012 ) . however , all o - lm cells were silent during at least some swrs , and on average also decreased their firing , which indicates that some inhibitory input , activated during swrs , contributes to their silencing . the o - lm cells are known to be innervated by vasoactive intestinal polypeptide - expressing , gabaergic interneuron - specific is - iii cells ( acsdy et al . , 1996 ; chamberland et al . , 1990 ) , which participate in their inhibition ( chamberland et al . , 2010 ) . unfortunately , the activity patterns of neither of these gabaergic inputs are known in vivo . in any case , the withdrawal of gaba and som released by o - lm cells from the most distal dendrites in ca1 may enable the return input from the entorhinal cortex and a reverberation between ca1 and the entorhinal cortex during closely timed repeated ripples ( davidson et al . , 2009 ) . in the mouse , o - lm cells fired at higher rates in vitro during swr - like bursts in ca1 ( pangalos et al . , 2013 ) and ca3 ( hjos et al . , 2013 ) or during awake immobility in vivo ( varga et al . , 2012 ) . the difference between these reports and our results could be due to species differences , loss of some of the inhibitory circuits in vitro , and higher firing rates during swrs in awake compared to sleep states . the o - lm cells reported here fired significantly more during awake - swrs than during swrs in sleep . during theta oscillations , the pyramidal cell input to o - lm and bistratified cells may account for the firing of both cell types maximally around the theta trough , when pyramidal cells fire at highest probability in ca1 . this was also predicted from tetrode recordings of pyramidal layer interneurons ( czurk et al . , 2011 ) . however , the two cell types differ in that bistratified , but not o - lm , cells ( kim et al . , 2012 ) receive input from ca3 . moreover , septal cholinergic input selectively activates o - lm cells via nicotinic acetylcholine receptors in arousal ( leo et al . , 2012 ; both cell types are also likely to receive septal gabaergic innervation ( gulys et al . , 1990 ) , which may include a population of pv - expressing medial septal neurons that discharge at the peak of theta in anesthetized rats ( borhegyi et al . , 2004 ) and temporally lead hippocampal theta ( hangya et al . , 2009 ) the sharp tuning and deep modulation by the theta rhythm of both cell types point to their collaborative role in the theta phase - dependent encoding and retrieval of spatial memories . 2002 ) posits that encoding of new sensory information is driven around the peak of the theta cycle , corresponding to the entorhinal cortical input , and retrieval of stored contextual associations is strongest around the theta trough , which corresponds to the ca3 input . when an animal enters a place field , the place cell begins to fire around the theta peak , when both o - lm and bistratified cells are minimally active . this may enable encoding in place cell dendrites via long - term potentiation ( ltp ) at both ca3 and entorhinal synapses . indeed , ltp is most easily evoked on the peak of theta oscillations ( hlscher et al . , 1997 ) . coincident with a waning entorhinal input and an increasing ca3 input on the descending theta phase toward the trough , bistratified cell firing increases , enabling retrieval of stored associations undergoing modification from ca3 in place cell dendrites in strata radiatum and oriens of ca1 . at the same phase , the increased o - lm cell activity probably plays a role in the removal of spurious entorhinal cortical input interfering with the recalled ca3 spatial context pattern ( hasselmo et al . , 2002 ) . other gabaergic cell types that target the soma ( klausberger et al . , 2005 ; lapray et al . 2012 ) and axon initial segment ( viney et al . , 2013 ) rather than dendrites provide different contributions to the temporal ordering and synchronization of pyramidal cell firing . the sharp theta phase tuning of som - expressing neurons indicates that there was little phase precession under our conditions . unidentified interneurons show phase precession ( maurer et al . , 2006 ) , and some of them were suggested to be bistratified cells ( ego - stengel and wilson , 2007 ) . the apparent lack of phase precession in our sample of interneurons may be due to the animals slow movement ( ego - stengel and wilson , 2007 ) . pyramidal cells in ca1 can fire complex spikes , bursts of action potentials of decreasing amplitude riding on a slower dendritic calcium spike , often followed by a plateau potential ( epsztein et al . , 2011 ; kandel and spencer , 1961 ; pissadaki et al . , 2010 ; takahashi and magee , 2009 ; wong and prince , 1978 ) . inhibition of som - expressing gabaergic neurons that innervate dendrites of neocortical pyramidal cells is necessary for such burst firing and calcium spikes evoked by sensory stimuli ( gentet et al . , 2012 ) . further , in the hippocampus , inhibition of som - expressing interneurons in vivo promotes burst firing ( royer et al . , 2012 ) and their activation in vitro greatly reduces the generation of calcium plateau potentials in pyramidal cells ( lovett - barron et al . , 2012 ) . this suggests that dendrite - targeting o - lm and bistratified cells may reduce calcium spike generation of pyramidal cells in ca1 . extracellular recordings showed that the highest probability of burst firing in many , but not all , place cells occurs during entry at the periphery of the place field ( harris et al . , 2001 ) , probably coinciding with the peak of the theta cycle . in contrast , whole - cell recordings in vivo suggested that the highest probability of calcium and plateau potentials is in the middle or throughout the place field , coinciding with the highest firing rate ( epsztein et al . , 2011 ) . the highest number of action potentials per theta cycle occurs at the trough in ca1 pyramidal cells ( mizuseki et al . , 2009 ) , usually corresponding to the middle of the place field . to reconcile the coincidence of the highest firing probability of active pyramidal cells , o - lm , and bistratified interneurons at the theta trough , we hypothesize a reduced effectiveness of the interneurons in inhibiting the calcium spike generation of active place cells , while inhibiting most silent pyramidal cells . the increasing firing rate of active place cells was proposed to be partly due to the suppression of gabaergic input specifically to active cells , via increased postsynaptic calcium - dependent cb1 receptor - mediated retrograde signaling ( freund and hjos , 2003 ) . interneurons expressing cb1 receptors fire on the ascending phase of theta cycles under anesthesia ( klausberger et al . , 2005 ) , which corresponds to the onset of place cell firing . since som - expressing interneurons do not express cb1 receptors , gaba release may be suppressed at their terminals through other calcium - dependent retrograde signaling mechanisms , such as postsynaptic release of nitric oxide ( no ) ( kaplan et al . , 2013 ; mcbain and kauer , 2009 ) , directly from the active place cells . indeed , the calcium / calmodulin - dependent enzyme nnos ( szabadits et al . , 2007 ) and calcium - permeable nmdars ( szabadits et al . , 2011 ) furthermore , no - sensitive guanylyl cyclase ( nosgc ) is present in gabaergic terminals ( szabadits et al . , 2007 ) , with the majority of pv - expressing and one - third of som - expressing interneurons expressing nosgc subunits . therefore , o - lm and bistratified cells may have the required molecular machinery for sensitivity to retrograde no signaling . activation of nnos in pyramidal cell dendrites requires increases in local calcium concentrations via nmdars and voltage - gated calcium channels in small - diameter dendrites innervated by the o - lm and bistratified cells . therefore , active place cells may produce no and selectively suppress gaba and som release presynaptically from connected o - lm and bistratified cells while simultaneously allowing the same interneurons to inhibit electrogenic processes in inactive pyramidal cells not participating in the current cell assembly . this selective reduction of inhibition to active cells may serve to increase the contrast between place cells and silent cells , facilitating dendritic calcium entry and synaptic plasticity in the active place cells . this scenario is consistent with the conversion of silent cells into place cells upon depolarization through an electrode ( lee et al . , 2012 ) . our results obtained on the in vivo firing patterns of identified bistratified and o - lm cells , taken together with results on pv+ basket ( lapray et al . , 2012 ; varga et al . , 2012 ) and axoaxonic cells ( viney et al . , 2013 ) demonstrate that , on average , during each cycle of the theta oscillations , inhibition is redistributed from the axon initial segment through the soma to the progressively more distal dendrites of pyramidal cells , thus governing the repeated cycles of mnemonic processing such as memory encoding and retrieval in the hippocampal chronocircuit ( cutsuridis and hasselmo , 2012 ; dupret et al . , 2013 ; hasselmo et al . , 2002 ) . we hypothesize that the effect of these interneurons will be different on repeatedly firing versus silent pyramidal cells . similarly , during swrs , inhibition is redistributed by increased gaba release to the soma and ca3-innervated parts of the dendritic tree , while it is withdrawn from the axon initial segment ( viney et al . , 2013 ) and the entorhinal input zone of the dendrites , as shown here . all procedures on animals were approved by the uk home office and by the animal care and use committees of the university of oxford and of the medical university , vienna . data reported are from nine male sprague - dawley rats ( 375565 g ; 2.85.3 months ) recorded between 8 a.m. and 6 p.m. ( see supplemental information ) . implantations of the head - mounted recording setup , craniotomies , and duratomies were performed using analgesic and antibiotic treatments as reported in lapray et al . one hour after recovery , recordings commenced using a glass electrode ( figure s1b ) filled with neurobiotin ( 1.5% or 3% , w / v , in 0.5 m nacl ) . after recording and juxtacellularly labeling a cell , the rat was deeply anesthetized and perfusion fixed 13 hr later ( see supplemental information ) . following the criteria defined in lapray et al . ( 2012 ) ( figure 4 ) , recording sessions have been segmented according to movement , sleep , and quiet wakefulness . we have detected and analyzed theta oscillatory epochs ( 512 hz ) , swrs ( 130230 hz ) , and losc using spike2 and matlab ( wavelet toolbox , v7.9-r2009b , mathworks ) . for a given cell type , we quantified the mean depth of theta modulation and the preferential mean theta phase of firing ( circular mean circular sd ) from individual cells using circular statistics and compared the preferred theta phase angles of different types of interneurons ( see supplemental information ) . we have developed an analysis in order to reveal the variability ( e.g. , cells being silent on some swrs but firing with rates above average on others ) in firing of single neurons during individual swrs . previous methods mostly used time - normalized averaging of firing during swrs , or simply averaging aligned on swr - peaks . our approach captures quantitatively over the entire range of firing frequencies any differences in swr - related spike rates compared to those expected from outside - swr periods . firing rates were calculated for the n - detected swrs and their distribution displayed as a cumulative distribution function ( cdf ) ( figures 5f , 5 g , s4a , and s4b ) . next , a population of 1,000 n surrogate time windows ( surrogate swrs ) was created as follows . ( 1 ) periods of movement and of detected swrs were excluded from the total recording time . the resulting sleep or rest states ( 2 ) random numbers were generated to mark time points within these periods when surrogate swrs ( 3 ) intervals of detected single swr - lengths were placed , one by one , at the marked time points over the recorded spike train . ( 4 ) after creating a surrogate for each detected swr , individual firing rates were calculated and their distribution displayed as a cdf . these four steps were repeated 1,000 times , resulting in 1,000 cdfs ( gray ) representing the spiking of a given neuron outside detected swrs . swrs was computed as the median value ( solid black line ) at each frequency bin . finally , for each neuron , the detected and derived firing rate distributions were compared using a two - sample kolmogorov - smirnov ( ks ) test . a probability of 0.05 indicates a significantly different firing rate distribution during detected swrs from that calculated during outside swr periods . a shift to the left or right of the measured firing rate distribution relative to the mean of the surrogate sets indicated a decreased or increased firing probability . the mean firing rate of a given neuron during the detected n swrs was calculated by summing all spikes during the n swrs and dividing this by the sum of durations of the n swrs . swrs was generated as above and the mean firing rate of each surrogate set was calculated , representing the spiking of a given neuron outside detected swrs . in each sweep , spikes during n surrogate swrs were counted and divided by the sum of time lengths of n swrs . the cdf of the 1,000 surrogate mean firing rates was compared with the real mean firing rate during detected swrs ( insets in figures 5f , 5 g , s4a , and s4b ) . the crossing between the two lines shows the probability of the measured mean firing rate falling within or outside the population of surrogate rates obtained outside detected swrs . if the probability was 0.05 , then the mean firing rate of a given neuron during swrs was considered significantly different from the firing rate during periods outside swrs . repeated - measures anova analyses were performed in order to account for possible correlations between measurements from the same cell during different behavioral and network oscillatory states . in order to fit the model consistently , the total number of cells was included in all cases , even when for a given cell either the behavioral states or the network oscillatory states were incomplete ( lk20p , sleep data missing ; tv21f losc data missing ) . we fitted a linear mixed effects model with restricted maximum likelihood estimation using the proc mixed procedure in sas ( v9.3)yijk=+i+j+()ij+ijk , where yijk is the observed firing rate or swr - related spike count of cell k of cell type i during within - factor behavioral / network oscillatory state , j ; is the overall mean firing rate or overall mean spike count , i is the effect of cell type , i ; j is the effect of within - factor behavioral / network oscillatory state , j ; ( )ij is the interaction effect between cell - type and within - factor behavioral / network oscillatory state , and ijk is random noise ; all units are in hz or counts . for simplicity , we defined the mixed model with compound symmetry as the correlation structure . this assumes similar variability between different cell types and equal correlation between different behavioral / network oscillatory states . for post hoc pairwise comparisons within the same model , differences of least - squares means of cell types were calculated for each level of within - factors , the behavioral / network oscillatory states , and vice versa , and the statistical significances were assessed . for all statistical methods used in this paper , p values and confidence intervals were calculated according to = 0.05 . note that swr - related spike counts ( countx ) were normalized using the following calculation : log10(1 + countx ) . when performed using median number of action potentials per swr , the model did not result in significantly different conclusions from those given by mean spike counts , which we report . we confirmed the predictions of the model using one - way anova and kruskal wallis tests ( table s1 ) . one to three hours after cell labeling , cardiac perfusion with saline was followed by 20 min fixation ( 4% paraformaldehyde w / v , 15% saturated picric acid v / v , and 0.05% glutaraldehyde w / v in 0.1 m phosphate buffer at ph 7.2 ) . all procedures , including transmitted light and fluorescence microscopic analyses were performed as reported in lapray et al . ( 2012 ) . immunoreactivity in the recorded cells was assessed visually and compared to neighboring cells not labeled by neurobiotin . a positive signal in the recorded cell was accepted if the subcellular location ( e.g. , plasma membrane ) , pattern , and strength of the signal were similar to that in nonrecorded cells . none of the molecules that were located in the recorded cells are known to be expressed by pyramidal neurons , which provided a within - section negative control . pyramidal cells express mglur7a in a uniquely high level in their terminals innervating o - lm cells , a signal that is unmistakable . two bistratified cells ( lk20p , lk27d ) and one o - lm cell ( lk06ah ) were selected for reconstruction ( see supplemental information ) .

human societies have recently experienced striking declines in mortality and fertility rates . while this demographic transition has received attention from demographers [ 4 , 5 ] , economists [ 6 , 7 ] , and evolutionary biologists , little effort has been put into investigating its evolutionary consequences . the evolutionary dynamics of a population encountering demographic change are interesting for at least two reasons . first , as fertility and mortality decline , the total variance in relative fitness [ 914 ] and thus the opportunity for selection both change [ 9 , 15 ] . this change in opportunity for selection can significantly affect the strength of total selection on other traits . furthermore , changes in the relative contributions of fertility and mortality to fitness can also change the net selection gradient , making predictions of evolutionary change difficult . second , shifts in the selection gradient may occur as biological relationships between traits and fitness are modified by the profound social , cultural , medical , and economic changes ( hereafter referred as environment ) that are associated with demographic transitions but are not directly related to changes in survival and fertility rates . in population genetic terms [ 16 , 17 ] , demographic transitions can influence selection because ( 1 ) the variance in fitness can constrain the covariance between traits and fitness and ( 2 ) environmental changes independently shape the covariance between traits and fitness . here we investigate and disentangle these two distinct effects of the demographic transition on selection . using individual - based data collected on women by the medical research council ( mrc ) over a 55 year period from two rural villages in the west kiang district of gambia [ 3 , 18 ] , we present here a detailed investigation of the role of rapid demographic change in influencing the strength and direction of selection on traits in humans . specifically , we first investigate how changes in survival and fertility rates ( i.e. , vital rates ) across the demographic transition translate into changes in variance of relative fitness and fitness components ; second , we study changes in directional selection on height and body mass index ( bmi ) ; and third , we assess how changes in selection on these anthropometric traits are explained by both change in fitness variance and the net effect on trait - fitness covariance associated with secular changes over this period , largely as a result of alterations to nutrition , infrastructure , and health provision . first , the period of data collection coincides with significant shifts in population vital rates , starting with the high mortality and fertility rates characteristic of most preindustrial societies , and more recently exhibiting much lower mortality and fertility rates ( see below ) . a clinic was established in 1974 to provide free medical care to residents of the villages and the surrounding area . second , because the data collected include records of individual reproductive events and deaths together with anthropometric data ( height and weight ) [ 19 , 20 ] , we had the unique opportunity to measure how the strength of selection on traits varies across the demographic transition . third , the mrc staff focused on collecting data on women s reproductive history and the health of neonates , which strongly limits the selective disappearance of individuals that biases most selection studies performed in natural populations . this started at the beginning of the study when regular surveys were carried out under the supervision of sir ian mcgregor and continued after the establishment of the clinic . first , the changes that we observed in variance in relative fitness and its components over the study period follow patterns similar to those documented for most other demographic transitions [ 914 , 21 ] ( figures 1a1c ) . because the period under study is recent and therefore many individuals have not yet completed their lifetime reproductive success , we used an annual measure of fitness that represents the contribution of each individual to the population in the next calendar year [ 2224 ] ( see the supplemental experimental procedures available online ) to extract the maximal amount of information from our data . while precluding a self - consistent demographic analysis like that carried out by moorad , this approach did allow us to capture rapid changes in selective pressures with time that may not have been detectable using a lifetime measure of fitness and to reduce potential biases triggered by nonrandom emigration . from those annual fitness measures , we derived variance in relative fitness , which is qualitatively similar to the opportunity for selection derived from lifetime fitness measures that is traditionally used to estimate the upper limit for selection [ 9 , 15 ] ( for a formal relationship , see ) . variance in total relative fitness declined steeply over time ( average up to 1974 , 10.5 10 ; 1975 onward , 7.34 10 ; overall spearman s correlation , = 0.75 ; p < 0.001 ; figure 1a ) , indicating that the opportunity for selection declined . this result contrasts with a recent study showing a marked increase in opportunity for selection observed across the 19 century in the utah population , where the demographic transition co - occurred with the settlement of pioneers . although mortality and fertility rates declined in both of these populations , the growth rate of the utah population decreased with time , which could explain differences between the studies . overall , a decrease in variance in relative fitness across the transition has been documented for most populations studied [ 911 , 13 , 14 , 21 ] , including the united states ( as a whole ) , italy , finland , sweden , and india , suggesting that it is a general feature of demographic transitions . we analyzed variance in relative fitness mediated by early survival and by adult fertility separately , as did other demographic studies involving lifetime fitness measurements [ 1014 , 25 ] . the decline in variance in relative fitness was mostly explained by the decrease in variance in relative child survival ( up to 1974 , 5.20 10 ; 1975 onward , 8.15 10 ; = 0.84 ; p < 0.001 ; figure 1b ) , itself the result of the decrease in mean child mortality ( figure s1 ) . annual survival rates for individuals under 15 years old averaged before and after the establishment of the clinic in 1974 increased from 0.951 to 0.992 , respectively . ( accumulated over 15 years , such rates would represent a transition from 47% to 89% survival at 15 years . the real value may differ slightly since this estimate neglects the variation of survival rates with age ; however , the estimate is consistent with lifetime - based estimates . ) in contrast , we did not find that survival of adults changed over the course of the study period ( = 0.18 , p = 0.19 , figure s1 ) , which is not surprising since the adult survival rate was already relatively high in the early years . although reductions in prereproductive mortality drove the decline in variance in relative total fitness , we observed an increase in the variance of relative fertility ( up to 1974 , 5.57 ; 1975 onward , 6.32 ; = + 0.49 ; p < 0.001 ; figure 1c ) , a pattern that also marks the first stages of other demographic transitions [ 2 , 10 , 13 ] . the variance in relative fertility corresponds to the variance in absolute fertility divided by the mean fertility squared ( see the supplemental experimental procedures ) . we measured decreases in both absolute variance ( = 0.50 , p < 0.001 ) and mean fertility ( = 0.49 , p < 0.001 , figure s1 ) , which combine here to produce the observed increase in the variance of relative fertility . thus , although both villages underwent rapid demographic change , analyzing annual fitness allowed us to detect the changes in variance in relative fitness and fitness components in a manner equivalent to other studies of the demographic transition that used lifetime fitness measures and were carried out over a longer temporal and a larger spatial scale [ 2 , 10 , 11 , 13 , 14 ] . second , we measured how selection on height and bmi changed across the demographic transition . throughout the study period we focused on height and bmi ( weight / height ) because those traits were most reliably sampled and because previous studies have shown them to be associated with lifetime survival and reproductive success in this population [ 19 , 20 ] . although bmi is a function of height , those two traits are weakly correlated at the phenotypic level in contrast to height and weight , making bmi a better alternative for statistical analyses than weight . because traits were measured at different ages within and across individuals , we derived for each individual a unique index for each trait that represents their relative lifetime height / bmi . this method assumes parallel growth curves and is as independent as possible from age and cohort effects ( see the supplemental experimental procedures ) . selection gradients were then calculated for each year of the study period to allow us to determine how they changed with time [ 27 , 28 ] . because selection gradients were built with annual fitness measures , whereas height / bmi indices applied across the lifetime of each individual , our analysis does not achieve the fine - tuned characterization of change in selection within the life of individuals that would be possible with annual measurements of anthropometrics for each individual . we were still able to decompose the trends in selection into changes in selection caused by early survival per se ( survival to age 15 ) and changes in selection caused by fertility variation among adults , which therefore captures the likely main contribution of age structure to the evolutionary consequences of the demographic transition ( see also ) . we observed a shift across the demographic transition from negative to positive selection on height coupled with a shift from positive to negative selection on bmi . the change in total selection on height was due to a shift from a negative to a positive relationship between height and adult fertility , which ran counter to a slight decrease in the positive relationship between height and early survival ( see table 1 for details ) . for bmi , the change in total linear selection was also triggered by the shift in selection mediated by adult fertility , but here selection shifted from positive to negative . as for height , positive linear selection on bmi mediated by child survival decreased only slightly , on average , but absolute values of selection gradients became much closer to zero from 1975 onward for both traits ( figures 1e and 1h ) . to summarize , whereas at the start of the study period selection favored short females with high bmi values ( i.e. , approximately < 157 cm and > 21 kg / m for adults up to 1974 ) , this changed so that selection now favors tall females with low bmi values ( i.e. , approximately > 158 cm and < 21 kg / m for adults from 1975 onward ) . changes in selection on traits ( i.e. , the covariance between trait and relative fitness ) may occur independently of changes in opportunity for selection ( i.e. the variance in relative fitness ) ( cf . we therefore studied the extent to which temporal changes in selection could be accounted for by temporal trends in variance in relative total fitness or its components ( demographic factors per se ) versus temporal trends due to changing biological relationships between traits and fitness triggered by environmental change not directly related to changes in vital rates . to do this , we built linear models in which annual selection gradients were predicted from both the variance in relative fitness ( or its components ) and from time as such and estimated temporal trends independently from changes in fitness variance and vice versa ( table 2 ) . accounted for 10% of interannual variation in total linear selection on height with only 2%4% explained by each factor separately ( controlling for the other , i.e. , partial correlation ) . the respective values for selection on bmi were 19% ( combined ) , 3% ( relative fitness only ) , and 2% ( time only ) . hence , changes in fitness variance and direct change in covariance between traits and fitness only weakly predicted changes in selection when their respective effects were partitioned but captured a nonnegligible part of variation in selection across the demographic transition when they were combined . in addition , decomposing the analysis of the determinants of changes in selection revealed important differences between trends in selection mediated by early mortality versus fertility . variation in selection mediated by early mortality was particularly well explained by variance in relative survival and by linear trends in time , with 20% and 32% of variation explained for height and bmi , respectively ( table 2 ) . in both of these cases , more was explained by variance alone than by time alone ( 9% versus 2% and 17% versus 6% , respectively ) , indicating that temporal changes in selection mediated by survival were mainly due to changes in the variance in relative survival rather than other environmental effects on the selection gradient . figure 1a shows that a sudden drop in variance in early survival occurred in the early 1970s . because this date corresponds to increased medical care delivered by the establishment of the clinic , our results suggest that this may be responsible for the large co - occurring drop in selective pressures mediated by early mortality on height and bmi . variation in linear selection mediated by fertility was less explained by time and variance in relative fertility and reached 10% and 14% for height and bmi , respectively . in contrast to selection mediated by early survival , variation in the linear selection gradients were less explained by variance in fertility than by time alone ( 3% versus 8% and 2% versus 11% ) , indicating that temporal linear trends in the selection gradients were not accounted for by changes in the variance in relative fertility alone . thus , the temporal change in fertility - mediated selection on height from negative to positive , or on bmi from positive to negative , could not have been predicted from the study of demographic processes alone . these changes in selection may also be due to health care improvements that affect how health relates to height and bmi and thus indirectly to women s fecundability . our findings speak to the relevance of studies using fitness variance to study selection [ 33 , 34 ] and to the concerns raised by critics [ 2932 ] . moorad and wade recently showed how the proportion of changes in fitness variances triggered by selection on traits could be measured ; here , we chose the reciprocal approach of measuring the proportion of change in selection on traits triggered by changes in fitness variances . selection on traits necessarily shapes fitness variance , which in turn can impose constraints on selection . both approaches are useful , and the choice that is made between them depends on whether one wants to put the emphasis on change in fitness or change in other traits . taking the standard phenotypic selection standpoint , we show that changes in phenotypic fitness variance can predict changes in selection . this increases the credibility of studies that have only measured the opportunity for selection , by indicating that such an approach does have predictive power in the context of understanding selection . on the other hand , our results also show changes in selection that occurred independently of changes in total fitness variance , suggesting that measuring fitness variance is insufficient to fully understand temporal changes in selection on morphological traits . the fact that the change in fitness variance was more important in modifying selection mediated by survival , whereas other temporal trends were more influential in modifying selection mediated by fertility , may or may not be generalizable to other populations that undergo similar demographic trends . in this study investigating the evolutionary consequences of demographic transition in a contemporary human population , we have , for two morphological traits , documented several types of changes in selection . we found cases in which such changes can and can not be predicted by the change in fitness variance alone . we also linked environmental change ( sensu lato , i.e. , including sociocultural effects ) to trait selection . our results are important because the majority of human populations have either recently undergone or are currently undergoing a demographic transition from high to low fertility and mortality rates . thus the temporal dynamics of the evolutionary processes revealed here may reflect the shifts in evolutionary pressures being experienced by human societies generally . a major implication is that , given the known heritability of the traits involved , such shifts in selection can be expected to be influencing genetic evolution . knowledge of how human phenotypes and genotypes respond to these sorts of environmental changes helps us to predict how human biology will interact with changing environments in the future , with implications for global public health and predictions of demographic change . in particular , the relaxation of early mortality selection triggered by improved health is likely to lead to an increase in maladaptations , some of which are known to be of medical importance . that the duration of demographic transitions is particularly reduced in populations from the emerging world potentially brings novel challenges for those populations . importantly , we did not find evidence for the decline in overall selective pressures across the demographic transition that could be expected from observing the decline in variance in relative total fitness with time . human evolution did not stop with the advent of agriculture [ 3741 ] , nor do we expect that it will stop after demographic transitions have been completed . changes in the strength and character of natural selection are likely to be the major component of such evolutionary change , and those changes are , in humans , increasingly driven by changes in culture , in particular by medical practice and public health measures .

the patient population undergoing carotid endarterectomy ( cea ) typically possesses numerous co - morbidities , such as arterial hypertension , diabetes , coronary heart disease , etc . thus there is a significant risk of myocardial infarction and ipsilateral ischemic stroke during surgery of the internal carotid - artery . during surgery , shunts can be used to protect the brain from stroke during low cerebral blood flow in the carotid cross - clamping phase , but they damage the arterial wall and this can result in cerebral embolism . as such , the surgeon needs to conduct intra - operative neurological monitoring to assess the cerebral perfusion and make a decision on shunt insertion in cases of clinically relevant cerebral hypoperfusion . the known methods of neurological monitoring during general anesthesia show poor sensitivity and specificity , compared with the awake patient , in terms of the requirement for shunt placement [ 2 , 3 ] . therefore , regional anesthesia has become the favored technique for cea , as it allows direct neurological monitoring and provides effective pain relief with a high postoperative patient satisfaction . carotid surgery requires blockade of the cervical nerves c2 - 4 and this can be achieved using a cervical plexus block . due to a lack of muscle response as a result of the use of a neurostimulator , the cervical plexus block is essentially a blind injection guided by orientation with anatomical landmarks . there are associated risks as the needle can damage vulnerable structures , e.g. arterial punctures ( to the vertebral or carotid artery ) resulting in hematoma , or intravascular injection with associated anesthetic toxicity , phrenic - nerve paralysis and subsequent respiratory problems , and intrathecal injection resulting in total spinal anesthesia [ 4 , 6 ] . visualization of the carotid artery may reduce the incidence of these accidental punctures , consequently reducing the incidence of complications the total amount of local anesthetic used , and probably leading to a more predictable block . the aim of this case series is to show the spread of injected local anesthetic after ultrasound - guided carotid sheath blockade in a three - dimensional computed tomography ( ct ) scan . we also examined whether the spread of the local anesthetic in vivo totally enclosed the carotid artery and if this ring formation is necessary for a successful anesthesia of the operation area . after approval by the institutional ethics committee ( kantonale ethik - kommission des kantons luzern , protocol number 708 ) and written informed consent from all patients , 15 american society of anesthesiologists class ii - iii patients undergoing elective cea were enrolled in the study . exclusion criteria included : known bleeding disorder , history of allergy to local anesthetics or to iodized x - ray contrast mediums , local sepsis , acute cardiac - decompensation , severe respiratory insufficiency and known diaphragmatic motion abnormalities . after routine monitoring of five - lead electrocardiography , non - invasive blood pressure , pulse oximetry and peripheral insertion of an 18 g intravenous cannula , a 20 g cannula was placed in the contralateral radial artery for a continuous blood pressure monitoring . regional anesthesia was performed by a senior anesthesiologist , with the patient in the supine position and the head turned slightly away . an ultrasound transducer was wrapped in a sterile cover and placed ( after skin disinfection with red - dyed chlorhexidine , 2% ) on the level of c4-c6 , at the horizontal projection of the cricoid cartilage on the line connecting the angle of mandible and the jugular notch of the manubrium sterni ( figure 1 ) . anatomical landmarks for performing ultrasound - guided carotid sheath block : the line connecting the angle of mandible , a ) , and the jugular notch of the manubrium sterni , b ) . two subcutaneous local anesthetic skin - injections : on the level of c5/c6 at the horizontal projection of the cricoid cartilage for the subcutaneous local anesthesia wall for the surgical incision line and the drainage tube area , c ) , and the puncture site of the peripheral nerve block needle , d ) . after finding the base of the carotid artery bifurcation with the ultrasound transducer and skin anesthesia with1 - 2 ml lidocaine ( 1% ) , an atraumatic needle for peripheral nerve blocks ( stimuplex d 23 g x 70 mm , b. braun , melsungen , germany ) was inserted using the in - plane technique . we administered a mixture of 7.5 ml ropivacaine ( 0.75% ) , 7.5 ml prilocaine ( 1% ) , and 3 ml iopromidum ( a triiodized , non - ionic , water - soluble x - ray contrast medium with an iodine concentration of 300 mg / ml ) on the ventral side of the carotid artery bifurcation area ( figure 2 ) . spread of the local anesthetic ( yellow lines ) . ca = carotid artery ; d = dorsal ; l = lateral ; m = medial ; v = ventral . after completion of the block , an additional 15 ml of the local anesthetic mixture with 3 ml iopromidum was subcutaneously administered along the line connecting the angle of mandible and the jugular notch of the manubrium sterni . the maximum amount of local anesthetics applied was 3 - 4mg / kg for ropivacaine and 7 - 10 mg / kg for prilocaine . we administered 15ml ropivacaine 0.75% ( 112.5 mg ) and 15ml prilocaine 1% ( 150 mg ) . with this amount of anesthetic , systemic toxicity is not expected for patients heavier than 15 - 20 kg for prilocaine and 28 - 37 kg for ropivacaine . twenty till thirty minutes later , a ct scan of the head , neck region and upper thorax was completed to evaluate the distribution of the injectate in a three - dimensional reconstruction ( figures 3 and 4 ) . axial native ct image of the right - sided contrast media / anesthetic injection at the submandibular level of the neck . no ring - like union of the contrast media around the carotid artery ( red arrow ) was achieved in this case . three - dimensional image of the right - sided contrast media / anesthetic injection from the left oblique anterior angle . the yellow arrow indicated the contrast media distribution of the skin - incisional infiltration and the red arrow indicated the distribution of the carotid sheath block . after return from the ct room , again twenty till thirty minutes later , the operation started . the twenty till thirty minutes delay of surgery through the ct scan has no influence on the quality of the block because ropivacaine has duration of action of about six hours . during the procedure , from the beginning , all patients had a remifentanyl drip of 0.02 - 0.2 g / kg / min for comfort ( mild sedation but easy to awake ) . pain during the operation was treated with local anesthetic ( lidocaine 1% ) administered by the surgeon . neurological monitoring was provided by spontaneous communication and periodic requests to squeeze a rubber duckling . in scanographic sequential cross section we analyzed the craniocaudal spread of the injectate in relation to the spine , its volume of distribution , its maximal contrast spread ( craniocaudal , dorsoventral , and coronal ) , its distance to the apex of the mastoid and to the end of the medial clavicula , its contact with the circumference of the carotid artery , and its center of contact with the carotid artery . the carotid bifurcation was identified preoperatively by duplex ultrasound and marked on the skin to keep the oblique incision at the ventral margin of the sternocleidomastoid muscle as short as possible . dissection of the common , external and internal carotid artery was carried out beyond the diseased segments respectively . the preparation of internal carotid artery was at first performed only in the distal , non - diseased section to avoid embolization from the plaque . during dissection and before clamping , heparin was given intravenously ( 50 iu / kg ) and systolic blood pressure was raised to 150 - 160 mmhg and kept at that level until blood flow was restored . after clamping , the neurological status was assessed regarding consciousness and motoric and sensoric function for 2 - 3 minutes , during which dissection of the stenotic carotid segment was completed . in case of unremarkably neurology , eversion endarterectomy was performed with a standardized technique after oblique transection of the internal carotid artery at the bifurcation . in case of a neurological abnormality , shunting ( argyle carotid artery shunt , covidien ) and conventional endarterectomy with patch plasty ( periguard bovine pericardium patch , synovis ) biplanar completion angiography by retrograde puncture of the common carotid artery was performed routinely to evaluate the technical quality of the arterial reconstruction before wound closure and drainage . statistical analysis was done using the commercially available software package ms - excel xp 2003 ( microsoft corporation , redmond , wa 98052 usa ) . from july 2010 to february 2012 , we included 15 consecutive patients with a mean age of 764 years , and 274 kg / m body mass index . surgical time and carotid clamping time are listed in table 1 . demographic and surgical data . bmi = body mass index ; f = female ; m = male ; sd = standard deviation . the volume of distribution of the contrast medium was 9713 ml ( mean sd ) , with a maximal craniocaudal spread of 13819 mm from the upper edge of the vertebral body of c1 to the lower edge of the vertebral body of t3 ( table 2 ) . cvb = cervical vertebral body ; tvb = thoracic vertebral body ; sd= standard deviation . in the dorsoventral plane there was a mean medium distribution of 578 mm , and in the coronal plane , 538 mm . the mean distance to the apex of the mastoid was 2410 mm , and to the medial clavicula , 94 mm . the carotid artery circumference contact had a mean of 25277. the center of the carotid artery contact of the injectate was placed at 47% ventral , 40% lateral , and 13% dorsal . in four of the 15 patients ( 27% ) the amount of local anesthetic ( lidocaine , 1% ) supplemented by the surgeon varied between 0 and 12 ml ( table 1 ) , although 10 of the 15 patients ( 67% ) needed only 0 - 4 ml . the area where the local anesthetic supplementation was necessary included : 1 - 3 ml for the glomus caroticum , 7 - 10 ml for the skin incision , and 7 - 10 ml for the area of the redon s suction drainage placement . in the current case series , we demonstrated the spread of injected local anesthetic after standardized ultrasound - guided carotid sheath blockade , using a three - dimensional ct scan reconstruction of the injectate . a complete ring formation of local anesthetic around the artery does not seem necessary for a successful anesthesia of the operation area . blockade of the cervical nerves with conventional techniques as intermediate cervical plexus block [ also called superficial cervical plexus block but anatomically correct so called due to the needle - perforation of the investing fascia of the neck [ 6 , 9 ] ] or deep cervical plexus block ( so called due to the needle - perforation of the deep cervical fascia ) are associated with potentially serious complications , such as injection of the local anesthetic epidurally , subarachnoidally , or into the vertebral artery . ultrasound - guided blocks improve efficacy ( with faster onset and longer duration of the block ) , facilitate performance ( less time is required ) , and reduce the risk of complications ( vascular puncture ) . in addition , the local anesthetic requirements to produce an effective block are reduced with ultrasound - guidance . the reduced risk of vascular puncture is very important for carotid surgery , as nearly all patients are under anticoagulation and a hematoma in the operation field can make the surgical procedure more difficult . ultrasound - guidance remains the only reliable control tool when performing a cervical plexus block , this is because motor responses following nerve stimulation are frequently unreliable due to atrophy in the platysma muscle in this typically older patient population , and because the contact of a stimulation needle with a nerve does not necessarily provoke a motor response . ultrasound - guidance allows a precise injection of the local anesthetic to the carotid artery , the place of the operation . so , we called the block carotid sheath block instead of cervical plexus block because we did not look for the nerve roots of the plexus cervicalis , nor for its nerve fibers , located posteriorly to the sternocleidomastoid muscle . the technique of the ultrasound - guidance block is established but the designation varies between different papers : rssel et al . named the block perivascular regional anesthesia of the internal carotid artery and martusevicius et al . the administered volume of local anesthetic in our study appears to coincide with the literature where the most common volume reported is between 20 and 40 ml , [ 4 , 8 , 12,13,14,15,16,17,18,19 ] with a range between 10 and 80 ml . patients with a higher dose may benefit in terms of post - operative analgesia . we administered 15 ml of local anesthetic to the base of the carotid artery bifurcation . a further 15 ml of local anesthetic was administered subcutaneously along the line of the angle of mandible and the jugular notch of the manubrium sterni , starting at the level c5/c6 . this additional local anesthetic volume should cover the surgical incision line and the area where the surgeons insert the drainage tube from the operation field . although we administered the local anesthetic under ultrasound - guidance to the carotid artery , we did not move the needle around the artery . we have to anesthetize the area of the sinus caroticus ( baroreceptors at the beginning of internal carotid artery ) and the glomus caroticum ( paraganglioma with chemoreceptors at the carotid artery bifurcation area ) , as well as the ventral region of the carotid artery , the surgical incision region . nevertheless we found that in 27% of our patients the local anesthetic had enclosed the full circumference of the carotid artery . interestingly , we found cases without local anesthetic circumferences of the carotid artery that needed no further local anesthetic supplementation by the surgeons . of the four patients with total circumference of the carotid artery , one needed no supplementation by the surgeons , two needed only supplementation for the drainage tube insertion and one needed 2 ml of lidocaine 1% to the glomus caroticum area . so , ring formation of the local anesthetic around the carotid artery seems not obligatory . the requirement to locally infiltrate the operation field during arterial adventitia preparation by the surgeons could be necessary due to pain triggered by afferent nerve fibers accompanying the sympathetic innervations of the vessels . we noticed that the requirement for local anesthetic supplementation by the surgeon was less obvious when we introduced an ultrasound - guided carotid sheath block as opposed to a cervical plexus block performed without ultrasound . in a former study , we performed a case series with 14 patients for cea with intermediate cervical plexus block without ultrasound - guidance . in that previous series we observed a mean local anesthetic supplementation by the surgeons of 73 ml , similar to the case series presented here ( 55 ml ) however , in the previous series every patient required supplementary anesthetic , and only two of the 14 ( 14% ) had 0 - 3 ml supplementary local anesthetic . in comparison , in the current series six patients of 16 ( 38% ) had no supplementary anesthetic and nine of the 16 ( 56% ) patients who had ultrasound - guidance had only 0 - 3 ml supplementary anesthetic ( data not published ) . we would like to point out that our case series was designed to show the spread of the local anesthetic by use of a three - dimensional ct - scan reconstruction of the injectate , and not to evaluate the effectiveness of the ultrasound - guided carotid sheath blockade . this has already been done in previous investigations [ 8 , 12 ] . as such , we did not record a visual analog scale ( vas ) during surgery as the surgeons wanted to avoid disturbing the patients during the operation . additionally , a remifentanyl drip was being administered to the patient for comfort ; nevertheless they were still responsive during the operation . the two cea - performing surgeons in our institution were satisfied with the ultrasound - guided carotid sheath block , as it minimized their additional local anesthetic application . it seems possible that with the targeted ultrasound - guided carotid sheath block with administration of the local anesthetic around the carotid artery the local anesthetic volume can be reduced . further studies are needed to assess whether such a reduction in local anesthetic volume will have the same success as the currently used 20 - 40 ml , also bearing in mind the post - operative analgesia . in conclusion , we have shown the in vivo spread of local anesthetic after ultrasound - guided carotid sheath blockade using a three - dimensional ct scan reconstruction . a complete ring formation of local anesthetic around the carotid artery does not seem necessary for a successful anesthesia of the operation area . an ultrasound - guided carotid sheath blockade can be performed rapidly , it is sufficient for surgery and it provides an alternative approach with a lower complication rate compared with current methods of injection that use orientation to anatomical landmarks or with nerve stimulation .

cervical cancer still remains the third most commonly diagnosed cancer type in women worldwide , particularly in developing countries , with over 500,000 estimated new cases and over 250,000 estimated deaths . the main cause of cervical cancer development is infection with human papilloma viruses ( hpvs ) , that are small dna viruses with oncogenic properties [ 35 ] . there are over 100 different hpv types , but only around 40 have been found in cervical epithelium and about 20 have been considered as high - risk factors for cancer development [ 6 , 7 ] . even though , persistent infection with oncogenic human papillomavirus ( hpv ) types is considered the most important risk factor for cervical cancer development , less than 5% of women with hpv will eventually develop cervical cancer , supporting the notion that other molecular events cocontribute in cervical carcinogenesis . inactivation of tumor suppressor genes has been shown to be a critical step in tumor development . apart from well - monitored suppression mechanisms as mutational inactivation , chromosome deletions , and loss of heterozygosity , epigenetic inactivation of tumor suppressor genes is a more recent discovery , where promoter methylation of a tumor suppressor gene abolishes its expression . a significant amount of studies have provided evidence that promoter methylation of tumor suppressor genes is linked with cervical carcinogenesis [ 1113 ] and even with specific severity of lesions . methylation - specific pcr ( msp ) is a sensitive technique widely used to identify promoter methylation , mainly due to its low cost . with msp , promoter methylation has been discovered in various tumor suppressor genes connected with cell cycle regulation as p16 and dna repair mechanisms as human mutl homolog 1 ( hmlh1 ) and o6-methylguanine dna methyl transferase ( mgmt ) [ 11 , 13 , 16 , 17 ] . p16 is a protein shown to be overexpressed in high - grade lesions as a result of hpv oncoprotein over - expression , while inhibition of dna repair mechanisms has been shown to occur in many types of carcinomas [ 4 , 5 , 9 , 13 ] . in this study we used msp to identify promoter methylation of the three above referred tumor suppressor genes in normal and pathological cervical liquid - based cytology samples , in order to evaluate their use in identifying lesions . next we assessed the relation of promoter methylation to hpv presence , mrna expression , p16 protein expression , and clinicopathological features , in order to clarify whether methylation is correlated with hpv presence and lesion progression . samples were part of a larger pool of samples from primary screening for cervical cancer in greece . a total of 403 liquid - based cytological ( lbc ) smears from women that underwent colposcopy were included in the present study . these consisted of 340 histologically confirmed samples and 63 samples with normal cytology that were added in order to increase the number of cytologically negative samples and have a better baseline of promoter methylation in normal samples . the study population consisted of women with a mean of 36.8 years of age ( min max : 1881 ) , a start of sexual intercourse at 18.9 years of age ( 1330 ) , and with a mean of 3.9 sexual partners ( 116 ) . cytology smears were collected in liquid - based media ( thinprep , hologic , marlborough , usa ) , a single - layer smear was prepared by automated means ( tp2000 processor ) , stained according to papanikolaou , and diagnosis was set according to the bethesda system by a skilled cytopathologist . histology diagnosis was set by a skilled histopathologist and for statistical purposes cin - i were classified as lsil , while cinii and ciniii were classified as hsils . a commercially available kit for bisulfate conversion and pcr amplification was used ( amplicolon , bird srl , siena , italy ) to identify promoter methylation of p16 , hmlh1 , and mgmt . pcr products were analyzed in a 2% agarose gel , stained with ethidium bromide and visualized under uv light . if a pcr product was detected only in the unmethylated reaction , sample was characterized as unmethylated , while presence of a pcr product in the methylated reaction characterized the sample as methylated , regardless of the result of the unmethylated reaction . absence of a product from both reactions characterized the sample as invalid . an unmethylated dna control is included in the kit , while a methylated dna control was created after treatment of the unmethylated control with sssi methyltransferase ( neb , massachusetts , usa ) ( see figure 1 ) . dna hpv typing was performed using a commercially available kit ( clart hpv2 , genomica , madrid , spain ) , according to manufacturer 's instructions . the kit can identify 35 different hpv types , that are categorized as low risk ( hpvs 6 , 11 , 40 , 42 , 43 , 44 , 54 , 61 , 62 , 71 , 72 , 81 , 83 , 84 , and 89 ) and high risk ( hpvs 16 , 18 , 26 , 31 , 33 , 35 , 39 , 45 , 51 , 52 , 53 , 56 , 58 , 59 , 66 , 68 , 70 , 73 , 82 , and 85 ) based on their epidemiology in specific grade of lesions . e6/e7 mrna expression was identified using the commercially available nuclisens easyq hpv kit ( biomerieux sa , marcy l'etoile , france ) , that is , able to detect mrna of five high - risk hpv types ( hpv16 , hpv18 , hpv31 , hpv33 , and hpv45 ) . positive and no template controls were included in all experiments . protein expression of p16 was identified by immunocytochemistry using a commercial kit according to the manufacturer 's instructions ( cintec cytology , mtm laboratories ag , heidelberg , germany ) . all statistic tests were performed using ibm statistics spss 19 ( ibm corporation , ny , usa ) using analysis , two - paired t - test and bivariate correlation analysis . overall accuracy was estimated by roc analysis using histology ( hsil+ ) as the golden standard . promoter methylation status was successfully analyzed for 403 samples for mgmt , 372 samples for hmlh1 and 290 samples for p16 . p16 protein expression was available for 358 samples , hpv dna typing for 398 samples and mrna expression for 355 samples . cytological , colposcopical , and histological findings were well correlated as indicated by the area under the curve ( auc ) values of both cytology ( 0.863 ) and colposcopy ( 0.861 ) compared to histology . mgmt methylation was the most aberrant methylated gene , followed by p16 and finally by hmlh1 . mgmt methylation increased statistically significant with lesion severity as determined by either cytological ( p < .0001 ) , colposcopical ( p < .0001 ) , or histological ( p < .0001 ) findings . hmlh1 methylation , on the other hand , displayed a significant increase with lesion severity only with cytological ( p = .0173 ) and colposcopical ( p = .0489 ) findings , while p16 methylation showed no significant difference . any of the three genes was statistically more often methylated in more severe lesions , as determined by either cytological ( p < .0001 ) , colposcopical ( p = .0002 ) , or histological ( p = .0031 ) findings . positivity of p16 protein expression increased with mgmt and p16 methylation ( p = .001 and p = .013 ) . methylation of mgmt increased with hpv dna positivity ( p = .021 ) , overall mrna positivity ( p = .017 ) , expression of hpv16 mrna ( p = .001 ) , and dna positivity for hpv16 , hpv18 , and hpv68 ( p < .01 ) . hmlh1 methylation increased with positivity for low - risk hpv dna ( p = .001 ) , hpv16 mrna ( p = .035 ) and dna positivity for hpv40 , hpv51 , and hpv61 ( p < 0.01 ) . methylation of p16 increased with overall mrna positivity ( p = .046 ) , expression of hpv16 mrna ( p = .05 ) , hpv33 mrna ( p = .036 ) hpv16 , hpv43 , and hpv85 dna positivity . presence of either hpv16 , hpv45 , hpv53 , hpv61 , hpv68 dna positivity or hpv16 and hpv45 mrna positivity was correlated with an increase of the number of methylated genes ( p < .01 ) . severity of the lesion , whether determined by cytology , colposcopy , or histology , was statistically higher with p16 protein expression , mrna expression , and presence of hpv dna of high - risk types ( p < .001 ) . hpv dna positivity could either be only from high - risk types or mixed with low - risk types . presence of low - risk hpv dna was only correlated with low grade lesions ( p < .01 ) . hpv dna positivity was more common in younger women ( 35.5 versus 39.3 , p = .003 ) with more sex partners ( 4.3 versus 2.8 , p = .039 ) , while p16 protein expression was more common in older women ( 39.6 versus 36.8 , p = .04 ) with earlier sex life initiation ( 17.8 versus 19.5 , p = .019 ) . promoter methylation has been proposed to be a significant cofactor in carcinogenesis , especially in nonhereditary carcinomas . its role in epigenetic inactivation of tumor suppressor genes has been shown to be common in many types of carcinomas , while recent evidence supports its contribution in cancer development in the cervix [ 1014 ] . findings of this study , as far as promoter methylation increase during lesion progression is concerned , are partially consistent with previous studies [ 11 , 12 , 14 , 19 ] . the main difference with the present study is the significantly larger amount of samples that are included in our study and the significantly higher positivity rate of methylation in our study . as far as diagnostic or screening utility of promoter methylation , none of the genes displayed an auc of over 0.6 when plotted against histology , with hsil as the cutoff , ranking it as an ancillary technique with more data needed to identify the exact value of methylation status in cervical carcinogenesis . as expected hpv dna testing displayed high sensitivity with low specificity depicted in the roc curve ( figure 2 , auc 0.641 ) , while mrna higher specificity with lower sensitivity ( auc 0.767 ) . p16 protein expression showed displayed better specificity than mrna testing , but worse sensitivity ( auc 0.694 ) . the above findings are consistent with previous studies , that have shown the use of these techniques in triaging women [ 6 , 7 , 2023 ] . presence of both p16 protein expression and promoter methylation was identified in both hsils and carcinomas . due to the heterogeneity of cytological samples this could reflect different pathways that are activated in specific types of cells or could be due to the partial methylation that can be identified with msp but is not enough to abolish protein expression . mgmt methylation was correlated with previously reported risk factors for severe lesions [ 7 , 20 , 21 , 25 ] , while interestingly enough hmlh1 methylation was correlated with low - risk hpv types especially when co - infection of a low - risk with a high - risk was identified . aberrant dna promoter methylation of mgmt , hmlh1 , and p16 is a common finding in liquid - based cytology samples of the cervix . even though , there is a statistically significant increase of dna methylation as the severity of the lesion increases , either for a single gene , or for the total number of methylated genes , the accuracy of promoter dna methylation in identifying severe lesions is low . as a result wide use in screening programs is not recommended , since more studies with larger methylation panels should be performed before the exact significance of methylation in cervical carcinogenesis is elucidated .

diet modification is recommended by the third report of the national cholesterol education program ( atp3 ) as the initial treatment to lower blood cholesterol . it is the physician 's responsibility , according the atp3 , to encourage patients with elevated cholesterol to initiate a therapeutic lifestyle changes diet ( tlc ) . the tlc diet recommends a range for the percent of calories from various sources including saturated fat ( < 7 ) , total fat ( 2535 ) , and carbohydrate ( 5060 ) . physicians ' ability to effectively counsel patients to adopt a tlc diet , however , has never been examined . one of the major changes to atp3 ( v. atp2 ) is to advocate lowering triglycerides , as a secondary target to lowering ldl , for persons with triglycerides ( tg ) > 200 mg / dl . in this study , we set out to examine physician 's understanding of basic nutritional physiology underlying recommendations in the tlc diet , particularly those recommendations specific to triglycerides , as triglycerides are a new prevention treatment target . a random sampling mailing list of 6000 physicians licensed in the united states stratified to include physicians licensed in either internal medicine or cardiology was purchased from buckley dement ( ridgewood , nj ) in april 1998 . a brief questionnaire , nine items total , questions were designed by two of the authors ( mf , kv ) , a ph.d . the remaining 5 items were based on dietary recommendation strategies that are no longer consistent with the atp3 , so they are not reported here . a cover letter indicated that the survey was anonymous and a postage paid return envelope was provided . the response to dietary knowledge questions for the total group ( a : n = 639 ) , cardiologists only ( b : n = 120 ) and general internists only ( c : n = 517 ) . * reflects significant differences between percentage of internists and cardiologists answering each question correctly . sixty - six percent were internists ( n = 419 ) , 19% were cardiologists ( n = 120 ) , 7% identified themselves as " other " and 8% did not indicate a specialty . the responses to these questions are in table 1 for the total group and by cardiologist and general internist . half of all those responding did not know that canola oil and 26% did not know olive oil were good sources of monounsaturated fat . thirty percent mistakenly thought safflower , a highly polyunsaturated fat oil , was a good source of monounsaturated fat . ninety - three percent ( 84% of cardiologists vs. 96% of internists ; p < 0.001 ) did not know that a low - fat diet , in general , would increase blood triglycerides . approximately three - quarters ( 70% of cardiologists vs. 77% of internists ; p < 0.01 ) did not know a low - fat diet would decrease hdl - c and almost half ( 45% ) thought that a low - fat diet would not change hdl - c . about one - half ( 47% ) ( 22% of cardiologists vs. 53% of internists ; p < 0.001 ) did not know carbohydrate was the diet component most likely to raise triglycerides . the main finding in this study was that physicians might be lacking adequate nutrition knowledge to counsel their patients accurately about tlc diets , a diet recommended for all patients with high blood cholesterol . physicians showed a poor understanding of the effects of changing the relative intake of carbohydrates and fats on triglycerides and hdl . only half of physicians identified canola oil as a good source of monounsaturated fatty acids and few physicians understood the relationship of changes in dietary fat with either triglycerides or hdl levels . on average , cardiologists in our study had a better understanding of nutrition than general internists , which we expected given their additional training and the fact that cardiologists often receive referrals to manage elevated cholesterol levels . these findings agree with kushner and colleagues , who found that primary care physicians often note a lack of knowledge , in addition to a lack of time and physician confidence , as main barriers to diet counseling . . additional training may well be an important component , as cardiologists in our sample had a much better understanding of the effects of dietary changes on triglycerides and hdl than their general internist counterparts . first , the response rate of 16% raises the possibility of a significant response bias among physicians responding to the survey . as we did not evaluate a sample of non - responders to examine differences between responders and those who did not respond , the possibility of non - response bias remains . we believe , however , that this risk is minimal . as the survey was clearly to measure nutrition knowledge , we presume that biases inherent in a physicians desire to be knowledgeable about medical issues would increase the likelihood that the responding physicians were more knowledgeable about nutrition . no studies to our knowledge have attempted to measure nutrition knowledge of practicing physicians , so it is impossible to examine the comparative validity of these findings . other studies are needed to understand whether or not these findings generalize to other groups of physicians ( e.g. , family physicians ) or to other nutritional issues ( e.g. dietary fiber ) . second , we did not examine other aspects ( e.g. , sources of dietary fiber ) of a physicians ' nutrition knowledge . the rationale for the study grew out of conversations with physicians and a continuing education seminar by one of the investigators ( mf ) for physicians , which identified a lack of understanding of the dietary aspects of cholesterol management . there are many other aspects of nutrition in medical practice and it is possible , though unlikely , that physicians have an excellent knowledge in these other areas . third , the term " low fat " was not defined , so it is left open to interpretation , which may not have been consistent across physicians . we chose not to define the term because , as it is frequently used without being defined , we wanted to assess the response of physicians using their working definitions of low fat diets and not impose a definition . this is in keeping with standard practice as a study of over 6000 adults with hypercholesterolemia revealed that 65% had been instructed by a physician to follow a " low - fat diet " without further defining the term . physicians showed a poor understanding of the effect of common dietary modifications used in tlc diets . given the level of importance assigned to lifestyle changes in the tlc diet from the atp3 report , it may prove more useful to develop counseling services from allied health care providers . this is the standard of care for patients with diabetes , as the american diabetes association recommends yearly counseling with a nutritionist for all patients with diabetes . enhancing physician training about nutrition , in medical school , residency and beyond , may also be a reasonable approach , though modifying medical student curricula and changing physician practice are both important but notoriously resistant to change . while recommendations have been made to increase nutrition counseling by physicians , physicians may not be receiving adequate training in nutrition . the national nutrition monitoring and related research act of 1990 , recommended " that students enrolled in united states medical schools and physicians practicing in the united states have access to adequate training in the field of nutrition and its relation to human health " , yet the number of medical schools that require , or even offer courses in nutrition was declining as of 1994 . as physicians are viewed as reliable sources of information , including nutrition , and their nutrition counseling responsibilities have greatly increased in the atp 's tlc diet , it is imperative that physicians become more knowledgeable about nutrition . hdl : high density lipoprotein ldl : low density lipoprotein atp3 : third report of the national cholesterol education program tlc : therapeutic lifestyle changes diet mary flynn : study design , data collection , data analysis , manuscript preparation christopher sciamanna : data analysis , manuscript preparation kevin vigilante : study design , data collection , data analysis , manuscript preparation

abpa is a rare complication of asthma in children ; only a few case reports and small series have been published . severe asthma is known to cause cor pulmonale in adults , but rarely described in pediatric age group . further , pulmonary thrombo - embolism ( pte ) in children with asthma and cor pulmonale has been described only at autopsy . we describe a child who developed abpa with pulmonary thrombo - embolism and cor pulmonale as a complication of poorly - controlled asthma . a 9-year - old boy presented with bluish discoloration of the nails and lips since last one year andanasarca ( generalized swelling ) , worsening cough , respiratory distress , and periumbilical pain abdomen since 20 days previously . he had past history suggestive of asthma ( recurrent episodes of cough and respiratory distress since the first year of life ) , for which he had received irregular treatment . patient found to have central cyanosis , tachycardia , marked respiratory distress with normal blood pressure . g / l , total leukocyte count 12.8 10/l with neutrophils 80% , lymphocytes 18% , monocytes 1% , and eosinophils 1% . arterial blood gas analysis on 100% oxygen showed ph of 7.36 , pco2 59.5 mm of hg , po2 116 mm of hg , hco3 32.6 mmol / l , base excess 5.2 and oxygen saturation 98.3% , suggesting chronic respiratory acidosis . hrct chest showed central bronchiectasis [ figure 1a ] , minimal right pleural and pericardial effusion , and gross cardiomegaly . chest angiography revealed dilated main pulmonary artery and filling defect in right branch of pulmonary artery [ figure 1b ] . echocardiography finding were : dilated right - sided heart , right ventricular dysfunction , severe pulmonary artery hypertension , and right atrial clot . serum ige levels were 1100 iu / ml ( normal 50 - 100 iu / ml ) . coagulogram revealedpprothrombin time index of 82% , aptt 33 seconds , inr 1.2 and presence of fibrin degradation products . ( a ) hrct chest showing central bronchiectasis ; ( b ) ct angiography showing thrombus in right pulmonary artery ( arrow head ) the patient was managed with salbutamol ( 0.15 mg / kg / dose ) and ipratropium bromide ( 0.5 mg / dose ) nebulization and intravenous hydrocortisone ( 10 mg / kg stat followed by 2 mg / kg every 6 hourly ) for exacerbation of asthma . for congestive heart failure , digoxin ( 3 g / kg / day ) and furosamide ( 2 mg / kg / day ) was given . he received injection ceftriaxone ( 100 mg / kg / day ) for 14 days . low molecular weight heparin ( 1.0 mg / kg 12 hourly for 5 days ) followed by warfarin ( 0.1 mg / kg / day ) was administered for thrombo - embolism after chest angiography . he improved and was discharged on request on warfarin , home oxygen therapy , oral steroids ( prednisolone 2 mg / kg / day ) , and inhaled steroids ( budesonide 400 g / day ) after three weeks of admission . he did nt return for follow - up , and on enquiry , we came to know that he expired after few days of discharge . the criteria for diagnosis of abpa were fulfilled by standard criteria ( asthma , central bronchiectesis , raised serum ige , immediate cutaneous hypersenstivity to a. fumigatus ) , and by severity , the abpa was of the fifth stage ( cyanosis , severe dyspnea , raised ige , central bronchiectesis ) . further work - up of the case revealed features of cor pulmonale and pulmonary thrombo - embolism ( pte ) . in adults , cor pulmonale is well - known in poorly - controlled asthma . in a study from ethopia , its rarity in developed countries might be because of better asthma management as compared to resource - poor countries . in children , of cor pulmonale in poorly - controlled asthma . better management of asthma in children with time might have decreased cases of cor pulmonale in asthma . although cor pulmonale is rare in children with asthma , the tissue doppler echocardiography has shown subclinical right ventricular dysfunction positively correlating with the severity of asthma in children . cor pulmonale as a presenting feature of abpa without asthma had also been reported in adult . as both poorly - controlled asthma and abpa have been associated with cor pulmonale independently , the presence of both in our case may have resulted in cor pulmonale at an early age . to the best of our knowledge , pte had never been reported ante - mortem in asthmatic children with abpa and cor pulmonale . possible underlying mechanism of pte in such cases may be chamber hypokinesia ( due to cor pulmonale ) and polycythemia ( due to chronic hypoxia ) . the hemoglobin was 15 gm% in our case , and echo showed poor right ventricular function . although the diagnosis of asthma is not in doubt ( recurrent cough and respiratory distress , history of asthma in sibling and good response to bronchodilators and steroids ) , we could not rule out cystic fibrosis completely ( second sweat chloride , delta 508 mutation , and cystic fibrosis transmembrane conductance regulator ( cftr ) genes could not be performed ) . both cystic fibrosis and asthma may co - exist in same patient . such combination of complications rarely occurs , even if both cystic fibrosis and asthma co - exist . to conclude , in a poorly - controlled asthma , abpa should be excluded even in children and if present , should be treated aggressively to prevent complications .

descriptions of epilepsy patients dying unexpectedly after seizures have existed since the 19 century , but only recently has it been recognized that sudden unexplained death in epilepsy ( sudep ) is the leading cause of premature death ( 10 - 50% ) in epilepsy patients ( shorvon and tomson , 2011 , tomson et al . , 2008 , the observations in patients dying of sudep in epilepsy monitoring units suggest that a postictal breakdown of central autonomic control characterized by a severe alteration of the respiratory and cardiac function that leads to a generalized eeg suppression and finally to a terminal cardio - respiratory arrest might play a major role ( bateman et al . this raises the question to what degree epilepsy associated structural alterations in brain structures involved in central autonomic control could contribute to such a breakdown . one is the brainstem / medulla system that responds typically to non - conscious stimuli from internal sensors , i.e. , baro- and chemoreceptors , etc , and encompasses the nuclei ( ncl . ) of the solitary tract , ambiguous ncl , dorsal vagal ncl , pre - btzinger / btzinger complex , parabrachial and klliker - fuse ncl , the rostral and caudal ventral respiratory group , the serotoninergic raphe and the mesencephalic periaqueductal gray / reticular formation . the other is the cortical and subcortical autonomic system which responds conscious stimuli , e.g. , fear or anxiety caused by external stimuli , by initiating the appropriate response via the brainstem / medulla system . its main components are the hypothalamus and thalamus , particularly the ventral posterior medial and lateral nuclei and the mesial prefrontal cortex and the insular cortex . animal studies but also human clinical studies suggest that the posterior insula might play a prominent role in cortical and cortical / brainstem autonomic integration ( nagai et al . , 2010 ) . the progress in quantitative image analyses in recent years has led to the insight that even well defined epilepsy types , e.g. , temporal lobe epilepsy ( tle ) with mesial temporal sclerosis ( mts ) , are associated with brain structural abnormalities beyond the epileptogenic focus that encompass remote but anatomically connected cortical and subcortical regions and most importantly regions belonging to the central autonomic system , e.g. prefrontal mesial cortex , insula ( scanlon et al . , 2013 ; mueller et al . , 2009 ; bernhardt et al . , 2008 ) . to our knowledge there is no study that investigated if there are also structural abnormalities in brainstem structures in tle . the first objective of this study was therefore to investigate if tle with ( tle - mts ) and without mts ( tle - no ) is associated with volume losses in the brainstem and to compare the findings in these two groups with those in two tle patients who had been studied with the same mr protocol but had later died under circumstances consistent with sudep . it was hypothesized that a subset of tle - mts and tle - no patients would have regional brainstem atrophy as would the two sudep patients but that the atrophic changes in the latter would be more severe . the fact that abnormalities in the cortical autonomic control system are apparent at the level of group analyses indicates that they are probably fairly common at the single subject level . this suggests that structural abnormalities within the autonomic control system per se are eventually not enough to cause serious disturbances of the autonomic control but that they need to fulfill very specific characteristics , e.g. , to be particularly severe or to encompass very specific regions , to become critical . the second objective was therefore to use graph analysis and a new measure , the atrophy similarity index ( cf . methods for details ) that was designed to capture differences in the severity and the spatial extent of atrophic changes to further characterize brainstem volume losses in tle and sudep tle . it was hypothesized that sudep tle patients would have a different pattern of graph analytical abnormalities than tle - mts or tle - no that would be consistent with a reduced interaction between atrophic brain regions . the committees of human research at the university of california san francisco ( ucsf ) , california pacific medical center , san francisco ( cpmc ) and va medical center , san francisco approved the study , and written informed consent was obtained from each subject according to the declaration of helsinki . seventeen were controls ( mean age : 39.0 13.9 years , female / male : 11/6 , no current neurological or other condition affecting brain function or structure , no history of epilepsy or other neurological or psychiatric diseases , normal mri reads by a board certified neuroradiologist ) . sixteen were patients suffering from tle with mesial temporal seizure origin and ipsilateral mesial - temporal sclerosis ( tle - mts ) ( mean age : 41.1 11.0 years , female / male : 8/8 , left / right / bilateral onset : 10/5/1 , mean age at onset : 7.9 6.6 years , mean epilepsy duration : 33.1 12.3 years ) and 14 were patients suffering from tle with unilateral mesial - temporal seizure origin and normal mri ( tle - no ) ( mean age : 34.6 11.4 years , female / male : 10/4 , left / right onset : 9/5 , mean age at onset : 23.3 11.6 years , mean epilepsy duration : 12.1 9.7 years ) . finally , there were two tle patients who later died under circumstances consistent with probable sudep . one of them was a 48 years old male tle - no patient ( bilateral onset , age at onset 40 years , duration 8 years ) , and the other one a 39 years old male tle - mts patient ( left onset , age at onset 25 years , duration 14 years ) . the identification of the epileptogenic focus was based on seizure semiology and prolonged ictal and interictal video / eeg / telemetry ( vet ) in all patients . the presence / absence of mts in tle was based on a visual inspection of a t2 weighted high resolution image of the hippocampal formation and confirmed by subfield volumetry ( mueller et al . , 2009 ) . tle - mts were significantly younger at onset and had longer duration of their epilepsy than tle - no ( p < 0.05 ) . all patients reported having been seizure free for at least 24 h before the 4 t study . all studies were performed on a bruker medspec 4 t system controlled by a siemens trio console and equipped with a u.s.a . the following sequences , which were part of a larger research imaging and spectroscopy protocol , were acquired : 1 ) t1-weighted whole brain gradient echo mri tr / te / ti = 2300/3/950 ms , 1.0 1.0 1.0 mm resolution , acquisition time : 5.1 min . 2 ) 3d t2-weighted turbo spin - echo sequence , tr / te = 3500/356 ms , 1.0 1.0 1.0 mm resolution ( for calculation of intracranial volume ) , acquisition time : 3.4 min . 3 ) high resolution t2 weighted fast spin echo sequence for hippocampal subfield volumetry ( tr / te : 3500/19 ms , 0.4 0.4 mm in plane resolution , 2 mm slice thickness , 24 interleaved slices , angulated perpendicular to the long axis of the hippocampal formation , acquisition time : 7.30 min . the processing / analysis procedures are depicted as a flow chart in supplementary fig . 1 . the labels cerebellum gray and white , brainstem , left and right diencephalon , left and right thalamus that are produced in the freesurfer subcortical segmentation stream ( fischl et al . , 2002 ) were used to generate a brainstem mask for each subject that encompassed the brainstem , the cerebellum and the diencephalon including the thalami . this mask was used to generate a t1 brainstem image by extracting the corresponding regions from each subject s gray scale image . as implemented in spm8 ( http://www.fil.ion.ucl.ac.uk/spm/ ) and running matlab ( version 8.1.0.604 ) was used to generate a brainstem template from the t1 brainstem images of the control group . each subjects t1 brainstem image was warped onto this template using the high dimensional warping algorithm of the dartel toolbox and the jacobian determinants calculated from the resulting transformation matrices . the resulting jacobian determinant maps ( jdm ) were masked to suppress the background and corrected for differences of head size using the intracranial volume that had been calculated from the skull - stripped t2 images . the jdm were converted into z - score maps using the following formula : z - score = ( jdmsubject mean jdmcontrols / standard deviation of jdmcontrols ) . the resulting z - score maps were processed in two ways : avoxel - wise atrophy whole brainstem analysis : atrophy maps were generated for each subject by thresholding them at z - score 2 . subjects with more than 504 subthreshold voxels ( 504 = mean subthreshold voxelscontrols + 2 standard deviation controls ) were considered to have pathological z - score maps ( crawford and howell , 1998).bdefinition of autonomic system for graph analysis : a 5 5 5 voxel grid was overlaid on each z - score map to divide it into equally sized cubes . brainstem nuclei / regions involved in the autonomic control are not distinguishable on in vivo 4 t t1 . therefore macroscopic landmarks based on the atlas of histological and 9.4 t high resolution sections of the brainstem / medulla by naidich et al . ( 2009 ) were used to identify altogether 16 cubes of interest ( coi ) with a high probability to encompass the following structures : cois 14 : caudal autonomic region with a ventral ( cav ) and a dorsal ( cad ) aspect that contain the caudal parts of ambiguous , solitary tract and dorsal vagal nuclei . cois 5,6 : caudal respiratory ( cr ) region that contains the pre - btzinger and btzinger complex . cois 7,8 : rostral autonomic ( ra ) region that encompasses the rostral parts of the ambiguous nucleus . cois 912 : rostral respiratory ( rr ) region which encompass the parabrachial and klliker - fuse nuclei and a section of the reticular formation ( lateral tegmental field ) and cois 1316 : periaqueductal gray ( periaqc ) that encompasses the periaqueductal gray and parts of the raphe nuclei . individual mean z - scores were calculated for each of these 16 cois ( cf . voxel - wise atrophy whole brainstem analysis : atrophy maps were generated for each subject by thresholding them at z - score 2 . subjects with more than 504 subthreshold voxels ( 504 = mean subthreshold voxelscontrols + 2 standard deviation controls ) were considered to have pathological z - score maps ( crawford and howell , 1998 ) . definition of autonomic system for graph analysis : a 5 5 5 voxel grid was overlaid on each z - score map to divide it into equally sized cubes . brainstem nuclei / regions involved in the autonomic control are not distinguishable on in vivo 4 t t1 . therefore macroscopic landmarks based on the atlas of histological and 9.4 t high resolution sections of the brainstem / medulla by naidich et al . ( 2009 ) were used to identify altogether 16 cubes of interest ( coi ) with a high probability to encompass the following structures : cois 14 : caudal autonomic region with a ventral ( cav ) and a dorsal ( cad ) aspect that contain the caudal parts of ambiguous , solitary tract and dorsal vagal nuclei . cois 5,6 : caudal respiratory ( cr ) region that contains the pre - btzinger and btzinger complex . cois 7,8 : rostral autonomic ( ra ) region that encompasses the rostral parts of the ambiguous nucleus . cois 912 : rostral respiratory ( rr ) region which encompass the parabrachial and klliker - fuse nuclei and a section of the reticular formation ( lateral tegmental field ) and cois 1316 : periaqueductal gray ( periaqc ) that encompasses the periaqueductal gray and parts of the raphe nuclei . individual mean z - scores were calculated for each of these 16 cois ( cf . previous studies have shown evidence for a structural morphological connectivity ( he and evans , 2010 ) in the human brain , i.e. , evidence for an anatomically plausible robust correlation between volumetric features derived from t1 images , for example , cortical thickness or gray matter volumes , of different brain areas . the nature of the correlation of these measures across regions is not clear and several potential factors , e.g. common afferent / efferent pathways , genetic , maturational / developmental influences , and experience related plasticity alone or in combination have been discussed in this context ( alexander - bloch et al . , 2013 ; carlo et al . , 2013 ; we used a variant of the just described structural morphological connectivity , the atrophy similarity index ( asi ) , that connects regions with similar degree of atrophy . the asi is based on the assumption that a pathological process causing neuronal loss / atrophy in one region leads to deafferentation and consequently atrophic changes of similar severity in neighboring and remote regions connected to this region . the asi between regions a and b is defined as follows : raw asi = ( ( z - score of the region with the lower score of the two)/(absolute difference between z - score in region a and region b ) ) . this definition of the denominator would result in an infinite number in the unlikely event that two different cois have exactly the same z - scores or in a very small value and consequently a very large asi if the z - scores of two different cois are very close . to control for this , the minimal possible difference between two coi was set to be 0.00001 even for coi pairs with smaller differences . the raw asi is converted into the final asi by multiplying it with a normalization term n defined as n = ( 1/ ( range of all raw asi in subject ) ) . based on that formula , severe atrophy due to the same process and thus of similar severity in a and b ( homogeneous atrophy ) results in a positive asi close to 1 . if b is not in the immediate neighborhood of a but in a remote region that receives input from a , the loss of this input produces a mild atrophy in b and a lower but positive asi with a. if b is not atrophied because it is neither directly nor indirectly affected by the pathological process in a , the asi will be negative . if there is a second pathological process ( heterogeneous atrophy ) that affects mostly a region c but indirectly also b that receives input from c , the relationship between a and b is weakened and the asi between them lowered . in contrast to the traditional measures of structural connectivity using volumetric measures , e.g. regional cortical thickness , that are based on correlations of this measure between two regions across multiple subjects , the asi has the advantage that it can be calculated for individual subjects . graph theory provides a theoretical framework to characterize the connectivity of a network and is increasingly being used to describe the functional and structural connectivity of healthy and diseased brains ( sporns et al . , 2000 ) . it describes a network as a system of nodes and edges that connect nodes with similar properties . in terms of in vivo imaging nodes typically represent brain regions for which the property of interest , e.g. cortical thickness , time course of the bold signal or in the case of this study the z - score , is known and the edges represent the strength of the relationship of this measure between any two regions . in this study , the strength of the relationship corresponds to the magnitude of the asi . the result is a matrix that describes this relationship for every possible combination of regions . in this study this relationship is described by the 16 16 asi matrix that has been calculated from the mean z - scores of the 16 cois or nodes encompassing brainstem structures involved in autonomic control . the routines provided by the brain connectivity toolbox ( https://sites.google.com/site/bctnet/ ) were used to extract network measures from these matrices . graph analysis usually requires a thresholding step to remove weak and thus probably physiologically meaning less connections . this can be done by either standardizing the number of edges ( cost threshold ) or by standardizing the number of nodes ( density threshold ) across individual networks . the former approach often leads to networks with a different number of nodes across subjects while the latter generates networks with different numbers of edges . for the purpose of this study , the asi matrices were thresholded at minimal density ( density is defined as the fraction of present edges to all possible edges and minimal density is the threshold below which some of the cois or nodes are no longer included in the network , i.e. , the network is no longer fully connected ) because this allows for a better description of the whole range of atrophy than thresholding by cost that would have only captured the most atrophied regions . graph analysis based on the asi matrices was used to further characterize the type of brainstem atrophy , i.e. , to distinguish between homogeneous and heterogeneous atrophy . nodal degree which is defined as the number of edges that an individual node shares with other nodes . given the definition of the asi , it was expected that nodes in regions with severe homogeneous atrophy have a high nodal degree and nodes in regions with heterogeneous atrophy a lower nodal degree . nodal efficiency which is a measure of the path length or number of edges that are necessary to connect this node with each of the other nodes . a high nodal efficiency indicates that most of these connections are direct , i.e. one edge . in the context of the asi , it was assumed that the nodal efficiency will be high in subjects with homogeneous but also heterogeneous atrophy but low in subjects with mild or no atrophy . nodal betweenness centrality corresponds to the fraction of all shortest paths in the network that include this node . given the definition of the asi , it can be expected that a node in a region with heterogeneous atrophy tends to have a higher nodal betweenness centrality than regions with homogeneous atrophy . modules are groups of nodes that are highly interconnected while having comparatively few connections with nodes in other modules . the participation coefficient is a measure of the diversity of the intermodular connections of node , i.e. is low in nodes that mostly interact with nodes within the same module . in the context of the asi , nodes from cois with homogeneous atrophy are likely to belong to the same module while nodes from cois of heterogeneous atrophy are more likely to be in different modules . the number of modules is increased in homogeneous and heterogeneous atrophy but more so in the latter . the participation coefficient was expected to be higher in regions with homogeneous atrophy indicating an interaction between the nodes of different modules and low in regions with heterogeneous atrophy indicating a breakdown of these interactions . spm8 was used to identify regions with significant volume loss in the brainstem / diencephalon / thalamus region in tle - mts and tle - no compared to controls ( t - test , p < 0.05 fdr to correct for multiple comparisons ) . multiple t - tests ( p < 0.05 fdr to correct for multiple comparisons ) were used to compare the mean z - scores of the 16 cois of the two patient groups with those of the control group . accounting for the fact that the graph analytical measures were not normally distributed , two - sided mann whitney tests were used to compare the nodal degree , nodal efficiency , modularity and participation coefficients between the patient groups and the controls . given the a priori hypotheses outlined in the introduction and the methods section ( graph analysis ) , no correction for multiple comparisons was applied . the non - parametric bootstrap algorithm provided by matlab and the bias corrected and accelerated percentile method for the calculation of confidence intervals were used to calculate the 95% confidence interval of the medians in the control group for the measures nodal degree , local efficiency and nodal betweenness centrality . cois or nodes with measures outside these confidence intervals and in accordance with the a priori hypotheses consistent with the pattern of heterogenous atrophy were considered to be a modification of this procedure ( all subjects ( controls , tle - mts or tle - no with at least 3 modules ) was used to determine nodes with an abnormal participation coefficient in the two sudep cases . this modification was necessary to account for the fact that the participation coefficient is influenced by the number of modules . fig . 2 shows a significant volume loss in the mesencephalon of tle - mts compared to controls that is maximal in the regions of the inferior and superior colliculi and periaqueductal gray / mesencephalic reticular formation and extends into the region of the raphe and reticular nuclei and medial and inferior thalamus / diencephalon bilaterally . based on the number of sub - threshold voxels in their z - score map , 1 control , 8 tle - mts and 3 tle - no were considered to have pathological z - score maps . the finding of the single subject analysis suggests that brainstem abnormalities occur in tle - mts and tle - no but that they are less common in the latter group and thus not necessarily detectable in group comparisons . tle - mts with pathological maps did not differ from tle - mts with normal maps regarding age at onset ( 9.3 8.6 vs 6.8 4.9 years ) or epilepsy duration ( 34.7 15.8 vs 31.9 9.6 years ) nor did tle - no with pathological maps differ from tle - no with normal maps ( age at onset : 18.2 4.5 vs 24.9 12.8 years , duration of epilepsy : 9.5 4.1 vs 12.9 10.9 ) ( all p > 0.05 with wilcoxon test ) . 54.5 percent of the tle with pathological maps had secondarily generalized seizures compared to 36.8% of the tle with normal maps . both sudep tle patients had pathological z - score maps with 25,591 and 7624 sub - threshold voxels respectively , which corresponded to the highest and third highest number of sub - threshold voxels in the patient population ( cf . as expected based on the definition of the asi most of the group differences were found in cois with significant volume losses . tle - mts were characterized by increased nodal degree and efficiency in cois / nodes from the periaqueductal gray and superior / inferior colliculi . nodal betweenness centrality and the participation coefficient were also increased but the differences did not reach significance . similar changes were found in the tle - no group but did not reach significance . controls had on average 2.47 ( 1.18 ) brainstem modules while tle - mts had 3.31 ( 1.3 ) and tle - no 2.57 ( 1.28 ) brainstem modules . despite the severe , widespread brainstem atrophy the graph analytical measures in the two sudep tle subjects did not just show a more exaggerated version of the changes seen in the tle - mts group . even in cois or nodes from regions with pronounced atrophy , nodal degree tended to be lower and local efficiency was clearly higher compared to the tle - mts . nodal betweenness centrality was increased in both sudep cases compared to controls but also compared to tle . compared to the control group and tle - mts the participation coefficients were low even in cois or nodes from regions with prominent atrophy . this is particular striking in the sudep tle - no patient in whom 3 brainstem modules were identified but all nodes had a participation coefficient of 0 . the sudep tle - mts patient had 5 brainstem modules and also comparatively low participation coefficients even when accounting for the number of modules ( cf . tle - mts and to a lesser degree tle - no is associated with volume loss in the dorsal mesencephalon that is most prominent in the region of the periaqueductal gray , colliculi , raphe and reticular formation and extends into the diencephalon particularly the medial posterior thalamus . 2 . graph analysis based on a measure that favored the interaction between regions with a similar degree of atrophy was used to characterize the impact of the mesencephalic volume loss on brainstem regions containing nuclei involved in the central autonomic controls . nodal degree and local efficiency were increased in regions with volume loss in tle - mts compared controls . a similar pattern of graph analytical abnormalities was found in the mesencephalic nodes of tle - no but these abnormalities did not reach significance . in contrast to the two tle groups though , this volume loss was not only more severe but in the case of the sudep tle - mts patient also more widespread , i.e. extended into the dorsal section of the pons and even upper medulla oblongata . the graph analytical signature of these abnormalities was different from that observed in tle , i.e. was characterized by comparatively decreased nodal degree and nodal participation coefficients but increased local efficiency and nodal betweenness centrality . taken together , we found evidence for volume loss / atrophy in brainstem regions involved in the autonomic control in tle . these changes were not only more pronounced in the two sudep cases but also associated with graph analytical abnormalities that indicated an impaired interaction between those regions . the following paragraphs will discuss these findings and propose a scenario how the observed brainstem abnormalities might lead to sudep . the refinement of quantitative image analysis methods in the recent years has led to the insight that even epilepsy types with well - defined epileptic focus such as tle - mts are associated with widespread structural abnormalities beyond the epileptogenic focus ( mueller et al . the current study adds the dorsal mesencephalon to the list of regions showing volume loss in tle . the brainstem has a very complex anatomy with a great number of tightly packed structures . many structures are not well defined though and in vivo mri at 4 t does not even resolve those that are easily recognizable in histological preparations . this impacts the precision by which deformation based morphometry can localize volume losses in the brainstem and constitutes an important limitation that has to be kept in mind in the following discussions . the regions with the most pronounced atrophy encompass the mesencephalic periaqueductal gray , the mesencephalic raphe and reticular formation and the monoaminergic cell groups in these regions . this region is part of a larger brainstem region that interacts via the dorsal longitudinal fascicle and medial forebrain bundle with the hypothalamus , thalamus , amygdala , hippocampus and mesial prefrontal cortex ( nieuwenhuys et al . , 1988 - 1989 ) , i.e. regions that are typically atrophied in tle . one possible explanation for this mesencephalic volume loss is therefore loss of afferent input from forebrain regions that are atrophied in tle . an alternative explanation is neuronal cell loss due to excitotoxic effects of tle seizures propagating into the mesencephalon . the graph analytical abnormalities in both tle groups were restricted to the regions with the most pronounced atrophy and were consistent with the pattern of homogeneous atrophy or a single mechanism causing the atrophy . the two sudep tle patients had volume losses in the dorsal mesencephalon that had a similar pattern as that observed in the single subject analysis of the tle - mts and tle - no cases . however , the volume losses were more severe and in the case of the sudep tle - mts expanded into pontine and even medullary regions . furthermore , the pattern of the graph analytical abnormalities in these two patients was consistent with heterogeneous atrophy , i.e. , more than one mechanism contributing to the volume loss . given the similarities with the tle group , it is reasonable to assume that the same mechanisms that were discussed for tle , i.e. , deafferentation or excitotoxic effects of propagating seizure activity also caused the volume losses in that region in the two sudep tle patients ( mechanism 1 ) . for example , electrical or chemical stimulation of the colliculi or the mesencephalic periaqueductal gray in genetically epilepsy prone rats can cause brainstem seizures that can spread to the forebrain with repeated stimulation ( redgrave et al . , 1992 ; merrill et al . , 2003 , peterson et al . , 2000 ) . based on that , it could be hypothesized that a volume loss in these regions could predispose patients to suffer longer lasting and/or more severe seizures with increased risk for secondary generalization ( magdaleno - madrigal et al . , 2002 ; faingold , 2012 ) . more important in the context of sudep however is that several structures in the most severely affected region , e.g. the periaqueductal gray and the cuneiform nucleus , belong to a network of brainstem structures involved the cardio - vascular control ( pelosi et al . structural abnormalities in these regions could therefore impair the autonomic control in the interictal state ( surges et al . , 2009 ) and cause critical autonomic disturbances , e.g. , cardiac arrhythmias and respiratory impairment severe enough to result in hypoxemia , during the ictal and immediately postictal period ( ryvlin et al . , 2013 ) . in situations of heightened demand due to seizures ( blumenfeld et al . , 2004 ) , even relatively short phases of hypoxemia could then lead to additional damage in vulnerable regions , e.g. the watershed area that encompasses the solitary tract nucleus ( jaster et al . , 2008 ; de caro et al . , 2000 ; lorin de la grandmaison et al . , 2001 ; sarnat et al . , 2004 ) , and so not only aggravate the existing damage but also cause additional damage in hitherto unaffected brainstem regions ( mechanism 2 ) . over time the damage caused by such seizure - related hypoxic episodes could accumulate and ultimately become severe enough to lead to the type of complete breakdown of the autonomic control in a situation of heightened demand that seems to be the hallmark of sudep ( jaster et al . this scenario indicates that this seizure related lesion in the dorsal mesencephalon , if it affects structures involved in autonomic control , could be sufficient to pose a risk factor for sudep . however , as mentioned previously , the autonomic control system has also a cortical representation and these regions can be affected in tle as well . therefore it can not be excluded that cortical lesions in the autonomic control system also play a role in sudep , either alone or in a combination with a brainstem lesion . a preliminary investigation of this question in the two sudep patients reported here , showed that the sudep tle - no patient had regions of severe gray matter loss in the posterior insula bilaterally ( z - score 2 ) but that the sudep tle - mts patient had only relatively mild ( z - score 1.0 > -2.0 ) gray matter losses in those regions . further studies that investigate the impact of cortical and brainstem lesions on autonomic control in the interictal and ictal state will be necessary to understand the potential contribution of these two regions to sudep . , the contrast properties and resolution of an in vivo mri are not sufficient to delineate even histologically well defined brainstem structures which reduces the accuracy by which the region of maximal volume loss can be localized . however special care was taken to ensure that the same upper and lower brainstem boundaries were applied to each extracted brainstem and so the localization of the volume loss along the rostral - causal axis should be accurate . 2 . the network used for graph analysis consisted of only 16 nodes that had been identified as having high probability to include crucial autonomic structures based on macroscopic landmarks . this is a relatively small network and it can not be excluded that its size might have influenced the findings . the rationale behind this strategy was to restrict the analysis to regions belonging to the autonomic network and to exclude input from regions not involved into the autonomic control that could have obscured the disturbances within the autonomic control system . the sample size of this study was small and the findings need to be confirmed in a larger population of tle and sudep tle but also in other epilepsy types . in conclusion , tle can be associated with atrophic changes in brainstem regions involved in central autonomic control that could be responsible for interictal and ictal autonomic disturbances which can aggravate the damage to critical parts of the autonomic control system and thus potentially increase the risk for sudep . the preliminary findings in this study suggest that deformation - based morphometry using a standard mri exam in combination with advanced graph analysis does not only detect this volume loss but might also be able to identify features that indicate that the volume loss is severe enough to critically impair the autonomic system making a life threatening breakdown of the autonomic control during a seizure possible . if these findings are confirmed , brainstem deformation - based morphometry combined with graph analysis could be used to identify patients at risk in whom an intensive surveillance and aggressive seizure control are warranted ( ryvlin et al . , 2013b ) .

catheter - associated urinary tract infection ( cauti ) is an important cause of morbidity and mortality in indian subjects , affecting all age groups . bacteriuria or candiduria is almost inevitable in nearly half of the patients who require an indwelling urinary catheter for more than 5 days . asymptomatic bacteriuria constitutes a major pool of the antibiotic - resistant strains of pathogens in any hospital , with critical care units ( ccus ) accounting for the majority of them . cauti is also a major cause of hospital - acquired bacteremia , and even asymptomatic bacteriuria may be associated with enhanced in - hospital mortality rates . patients in critical care units are often febrile due to causes which may be infectious or non - infectious . these patients by their very nature and the surroundings that they are in , are at a high risk of developing infections . the importance of utis in the ccu lies in the fact that distinguishing urosepsis from inconsequential bacteriuria with fever from other causes can be difficult . therefore , it is always tempting to initiate antibiotic therapy on the basis of a positive urine culture . the current review highlights the important issues in the management of patients with uti in the ccu . we performed a medline search using combinations of keywords such as urinary tract infection , critical care unit and indwelling urinary catheter . between 1966 to march 2013 , the search yielded over 100 papers . in an attempt to provide a review of comprehensive management of patients with uti in the ccu , we selected 76 relevant publications with some important cross - references from the list of publications . barring hematogenous seeding , almost exclusively , of staphylococcus aureus , causing pyelonephritis , almost all micro - organisms implicated in endemic cauti are either part of the patient 's colonic or perineal flora , or derived from the hands of medical and paramedical personnel during insertion of indwelling catheters or improper handling of the collection system . extraluminal ascending infection may be caused either during the time of indwelling catheter insertion , or later on by organisms from the perineal areas moving upward by capillary action in the thin mucous film that coats the external surface of the catheter . intraluminal infection is caused by organisms gaining access to the lumen of the catheter either from failure of closed drainage or the urine in the collecting bag getting contaminated . while extraluminal ascension of micro - organisms may be the more common means of causation of cautis , both routes are important . urine sampling for microbiological workup needs to be done carefully avoiding contamination , either routinely once a week , or at the beginning of a new episode of sepsis . cauti is usually deemed present if there are at least 10 colony - forming units ( cfu)/ml of 1 or 2 micro - organisms identified by urine culture . while ' significant bacteriuria is defined as > 10 cfu / ml , once micro - organisms are detected in the urine , in the absence of anti - microbials , it is almost inevitable to reach the 10 cfu / ml level quite rapidly , which is why the level of 10 cfu / ml is believed to be indicative of true cauti . an icu - acquired uti refers to those patients who develop a positive urine culture first identified on icu day 3 ( 48 h ) or later . patients developing positive urine cultures within 48 h of being discharged from an icu , could also be defined as having icu - acquired uti . the centers for disease control and prevention ( cdc ) defines cauti for those patients who have an indwelling catheter in place for 48 h or more . for diagnosing uti , the cdc requires that the patient should be manifesting symptoms such as fever or chills , new onset of burning pain , urgency or frequency if not catheterized at that point of time , change in urine character , flank or suprapubic pain or tenderness or change or decrease in mental or functional status in patients older than 65 years . in patients who do not have compelling laboratory evidence such as positive urine culture , the cdc gives credence to a positive dipstick test for leucocyte esterase and/or nitrate , pyuria and visualization of organisms on gram stain of unspun urine , if these are associated with two or more clinical symptoms of uti . the cdc guidelines therefore , help distinguish asymptomatic catheter - associated bacteriuria or candiduria , which are rarely associated with adverse outcomes and generally do not require treatment with antimicrobials , from true cauti . multiple factors have been identified as potential risk factors for cauti [ table 1 ] . many of them are relevant for patients managed in ccus including prolonged catheterization , use of systemic antibiotics , other active sites of infection , diabetes mellitus , and elevated creatinine . females have much higher risk compared to males , and pre - existing conditions such as malnutrition also put the patient at increased risk . insertion of the indwelling catheter outside the protected environs of the operating room , ureteric stenting and assiduous monitoring of urine output using the catheter are all independent risk factors for cauti . a most important and potentially modifiable risk factor is the duration of catheterization , and hence indwelling urinary catheters need to be used for the shortest periods of time feasible . by the 30 day of catheterization , infection rates are about 100% . closed drainage , dependent drainage including proper positioning of the drainage tubing and collection bag and protection of the drainage port could go a long way in reducing the burden of cauti . antimicrobial drug therapy , while protective for short - duration catheterizations , carries the risk of selective colonization with multi - drug - resistant organisms such as pseudomonas aeruginosa , other resistant gram - negative bacilli , enterococci and yeasts . ccu - acquired cauti was not found to be an independent risk factor of in - hospital death , although it contributes to significant morbidity . the single most important manoeuvre which can reduce the incidence of cauti is to use indwelling urinary catheters only when justified . it should never be used for management of urinary incontinence , and alternatives to urethral catheterization should be explored for such situations . pre - connected closed drainage systems might reduce the risk of disconnection of the closed system , although there is no conclusive data that these can reduce the incidence of cauti . the collection system should always be placed below the level of the bladder and not be allowed to touch the floor . aseptic techniques should be employed for emptying the drainage system , and the same collection system should never be used for more than one patient . other preventive practices include removal of the catheter as soon as possible , avoiding opening the system , encouraging fluid intake and avoiding irrigation of the bladder . anti - infective catheters can be employed if indicated , in patients who are judged to be at a high risk for development of cauti . recent studies have shown the effectiveness of the implementation of multidimensional urinary tract infection prevention strategies and bundles in critical care units . such approaches include a specific bundle of interventions for cauti prevention , education , outcome surveillance , process surveillance , feedback of cauti rates and performance indices of infection control practices . these multidimensional infection control programs for cauti prevention have shown reduction in the cauti rates of ccus , which were associated with improvement in hand hygiene , as an integral component of a multi - faceted strategy , and as a result of providing education and training on cauti prevention measures by means of introducing bundles of interventions . thus , improvements in processes of care can lead to a reduction n in the risk of cauti , and their adverse consequences , especially in ccus of resource - limited countries like india . the choice of anti - infective catheters is between antiseptic- and antimicrobial - coated urinary catheters , both of which have been widely studied for prevention of catheter - associated bacteriuria . presently marketed antiseptic - coated catheters are coated with silver alloy , as silver oxide - coated catheters which were tried a few years back , did not demonstrate significant efficacy in preventing cauti . antimicrobial - coated catheters include those coated with nitrofurazone , rifampicin or minocycline . a meta - analysis in which the benefits of using silver alloy coated catheters was investigated , demonstrated a decreased incidence of catheter - associated asymptomatic bacteriuria with the use of these catheters , compared to standard latex catheters , in patients who had indwelling catheters for less than 7 days duration . antimicrobial - coated catheters also reduced the occurrence of asymptomatic bacteriuria in patients catheterized for less than 7 days . however , for duration of catheterization exceeding 7 days , the results from use of antiseptic - impregnated catheters were not as impressive , while antimicrobial - coated catheters failed to demonstrate any benefit in this group . further , although several studies report reduced incidence of asymptomatic bacteriuria , use of anti - infective catheters has not been demonstrably associated with prevention of cauti , reduced incidence of bacteremia resulting out of urosepsis or decreased mortality rates therefrom , and hence their routine use in ccus can not at present be recommended . however , use of anti - infective urinary catheters could be considered in patients deemed to be at high risk for development of cauti or if all other preventive measures fail to bring down cauti rates in a ccu . similarly , use of systemic antimicrobials for prophylaxis of cauti is also not recommended , based on available evidence . thus , the prevention of cauti remains an area of active and ongoing research , and updated guidelines should always be referred to when establishing protocols for critical care units with regard to the same .

in the united states , the 2010 civilian workforce accounted for 139 million people who spend up to a quarter of their lifetime and half of their waking lives at work . with changes in the global market , particularly with the rise of biotechnology , new occupational hazards have emerged . approximately , 200 biotic ( organisms or particles of viral , prokaryote , or eukaryote origin ) and an even greater number of abiotic ( physical and chemical ) agents have been associated with adverse health outcomes . in certain occupational settings , particularly those engaged in handling purified microbial proteins in baking and manufacturing sectors , workers are at increased risk of becoming sensitized and developing respiratory disease . occupational asthma ( oa ) is the most common respiratory disease reported in the workplace [ 38 ] . oa has been defined as either irritant induced or immune mediated [ 6 , 7 ] . immunologically mediated oa accounts for approximately 90% of cases , but the severity of disease is dependent on the concentration , route , agent of exposure , and the latency period [ 6 , 7 ] . both high- and low - molecular - weight antigens can induce oa , but the immunological mechanisms are distinctly different . high - molecular - weight allergens are generally proteins that are greater than 5 kda , and production of immunoglobulin e ( ige ) results in the release of mediators from mast cells and eosinophils [ 6 , 7 ] . more than 250 high - molecular - weight allergens that induce oa have been identified [ 4 , 6 , 7 ] . many are derived from animals or plants , and exposure usually involves mixtures of many proteins [ 4 , 6 ] . occupations where high - molecular - weight allergens have been characterized include seafood processing ( tropomysin ) , dairy , poultry , citrus , greenhouse , baking , healthcare ( latex ) , pharmaceutical ( drugs ) , and detergent manufacturing ( fungal enzymes ) . some of the best examples of high - molecular - weight occupational allergens are the fungal enzymes . they are particularly suited for study because they are often used as purified preparations in baking , food , detergent , textile , and pharmaceutical industries [ 6 , 10 ] . in this paper , we will focus on the fungal enzymes as model high - molecular - weight allergens in industrial settings and describe the main enzymes that have been associated with occupational sensitization and asthma . identification of emerging fungal enzymes in manufacturing and biotechnology industries is discussed as well as new methods to detect and quantify fungal enzymes in the occupational environment . the industrial utility of fungi has been well known since antiquity . in addition to the role of fungi as saprophytes in the environment , many species have commercial use , for example , mushrooms as food sources , ingredients in food preparation ( cheese flavoring penicillium roqueforti ) , alcoholic fermentation , and the conversion of sugars in bread dough to carbon dioxide ( saccharomyces cerevisiae ) . in asia , aspergillus oryzae is an essential ingredient for the production of soy sauce and the fermented drink , sake . secrete a wide variety of enzymes including cellulolytic , proteolytic , lipolytic , and pectinolytic enzymes that are used in the production of various foods such as tempe from indonesia . other fungi such as yarrowia lipolytica have more recent applications in the biodegradation of industrial products . advances in industrial enzymology following world war ii have enabled researchers to identify and utilize various enzymes and proteases that fungi produce to break down carbohydrate and lignin containing plant material in the environment . to date , close to 200 fungal enzymes have been purified from fungal cultures and the biochemical and catalytic properties characterized [ 10 , 50 ] . these enzymes have great utility in pharmaceutical , agricultural , food , paper , detergent , textile , waste treatment , and the petroleum industries . industrial fungal enzymes are high - molecular - weight proteins that are catalysts [ 10 , 49 ] . a description of the common enzymes used in various industries is presented in table 1 . the most widely used enzymes of occupational importance are derived from the genus aspergillus and include -amylase , xylanase , and cellulase . a summary of the proteomic and immunologic properties of these enzymes is presented in table 2 . other enzymes are also utilized from rhizosphere fungal species belonging to the genera rhizopus and humicola ( table 2 ) . it is uncommon for individuals in the general population to be exposed and sensitized to these antigens . in fact , in the general population , the prevalence of sensitization to fungal enzymes has been reported to be as low as 1% and as high as 15% [ 22 , 51 ] . however , in the occupational environment , workers that handle purified fungal enzymes are at an increased risk of becoming sensitized to enzymes [ 10 , 23 , 24 , 42 , 5256 ] . this is especially the case for workers whose occupation requires debagging , sieving , weighing , dispensing , and mixing enzymes [ 24 , 5356 ] . eight - hour time - weighted average exposures demonstrate that occupations weighing the enzyme preparations have the lowest average exposure compared to those workers that sieve . these workers are often exposed to levels of dust that exceed 4 mg m , the threshold limit value ( tlv ) for inhalable dust . for other industrial environments that use lipase and cellulose in production , occupational exposure is highest in production areas and laboratories . adverse health effects associated with enzyme exposure are well characterized in the baking industry . in some countries , bakery exposures to enzymes fungal enzymes are commonly used as baking additives to improve the dough , increase shelf life , and decrease production time [ 19 , 49 , 59 ] . airborne concentrations ranging from 5.3 ng m to 200 ng m have been reported in occupational environments [ 12 , 59 , 60 ] . later , baur et al . demonstrated ige sensitization in workers handling these products . since the original study , fungal enzymes have been identified as potent allergens in the occupational environment [ 25 , 26 ] . prevalence of sensitization to aspergillus enzymes ranges from 8% for glucoamylase , 11% for xylanase , 13% for cellulase , and up to 34% for -amylase sensitization to -amylase in bakery workers results in decreased peak expiratory flow [ 6366 ] and oa [ 20 , 28 , 67 ] . in one report , workers exposed to fungal enzymes induced an immediate bronchospastic reaction . in the united states , the prevalence of work - related wheeze , runny nose , frequent sneezing , and specific ige to fungal enzymes was significantly higher among highly exposed workers . however , other irritant - induced mechanisms associated with high total dust levels have also been reported in a cohort of british bakers [ 29 , 56 ] . to date , atopy has been hypothesized to be an important risk factor for oa to fungal enzymes . occupational exposure to enzymes has been demonstrated in other industries including manufacturing [ 41 , 53 , 69 ] , pharmaceutical [ 25 , 38 ] , food processing , animal feed , and biotechnology . like in baking environments , workers handling or in direct contact with fungal enzymes and with a history of atopy are at increased risk of becoming sensitized [ 10 , 23 , 24 , 42 , 5256 ] . sensitization to proteolytic enzymes has also been demonstrated in the manufacture of detergents [ 53 , 71 ] . in the future , recent examples include the use of -amylase and glucoamylase for the production of ethanol in the biofuel industry [ 72 , 73 ] . if proper methods of exposure prevention are not followed and exposure is not monitored in these industries , it is possible that new groups of workers will suffer adverse health outcomes and become sensitized to enzymes . in the following sections we describe the major fungal enzymes , prevalence of sensitization , and occupational environment that they are most likely to be encountered fungal amylase is the most well - characterized fungal enzyme used in the occupational environment . originally discovered by takamine in 1884 , bakers have used -amylase as a supplement to cereal flour to improve carbohydrate fermentation by yeasts and ultimately the quality of the bread . -amylase cleaves long - chain carbohydrates into simpler sugars including maltose . derived from a. oryzae , -amylase is a 478 amino acid glycoprotein with a molecular weight of 53 kda ( table 2 ; ) . occupational sensitization to -amylase was first reported by flindt and has subsequently been identified as an allergen in baking , pharmaceutical , animal feed , and biotechnology industries . the allergen was originally designated asp o 2 by the international union of immunological societies ( iuis ) allergen nomenclature subcommittee but now has been redesignated asp o 21 . since this preliminary work , -amylase has been identified as one of the principle sensitizers in large - scale bakeries [ 24 , 56 ] . the prevalence of sensitization among bakers is variable and ranges from 0.9% to 34% [ 13 , 18 , 19 , 21 , 23 , 24 , 2735 , 54 , 66 , 67 , 75 ] . concentrations as high as 40 ng m have been reported in baking environments ; however , -amylase concentrations in the low ng m range have been associated with an increased frequency of sensitization . the most common tasks associated with -amylase exposure involve dispensing , sieving , weighing and mixing [ 55 , 56 , 60 ] . exposures that exceed the maximum exposure limit for flour dust in the united kingdom were identified in mixing , weighing , and dispensing operations . the prevalence of sensitization to -amylase is 9.9 times greater among workers in high - exposure categories compared to those workers in low - exposure categories . aerosolized particle size distribution analysis in baking environments demonstrated that workers are exposed to -amylase particles within the inhalable size fraction . after bronchial provocation with -amylase , between 16 and 100% of sensitized workers were found to give a positive immediate response depending on the study [ 25 , 35 , 49 ] . nasal provocation with -amylase in skin prick test ( spt ) positive workers also induced rhinitis . furthermore , positive associations between -amylase spt and work - related respiratory symptoms have been identified . interestingly , heating -amylase has been shown to reduce enzymatic and allergenic activity of the enzyme . potential sensitization of bakers ' family members due to -amylase associated with clothes , shoes , and bakery textiles has also been reported by vissers . -amylase or glucoamylase is primarily obtained from a. niger , a. awamori , and r. delemar . glucoamylase is used as a dough additive by bakers , often in association with -amylase . glucoamylase has a molecular weight of 68 kda ( table 2 ) and can remain functionally active at elevated ph . glucoamylase exposure has been primarily reported in baking occupations [ 10 , 13 , 18 ] ; however , occupational exposure has also been reported in fruit and salad processing . . demonstrated that three workers with shortness of breath , chest tightness , and wheeze had specific ige to glucoamylase . . also demonstrated positive spt to glucoamylase in all tested subjects ( n = 4 ) ; however , only three of the four patients elicited an early asthmatic response following bronchial provocation . airborne glucoamylase was shown in 9% of air samples from a bakery , and median levels were 10.3 ng m. moderate allergenic cross - reactivity has also been reported between glucoamylase and -amylase . cellulases are enzymes that hydrolize cellulose into glucose and are primarily used in the pharmaceutical , baking , detergent , and textile industries [ 6 , 78 ] . cellulase has been purified from several rhizosphere fungi including a. niger and trichoderma viride , as well as humicola insolens . the molecular weight of cellulases ranges from 22 to 45 kda ( table 2 ) . cellulases derived from these fungi are used in baking to break up roughage in dough and as a digestive aid in the food industry [ 13 , 79 , 80 ] . the first case of oa caused by cellulase was reported in 1981 in a plant pathologist [ 49 , 81 ] , and later these findings were confirmed in two pharmaceutical workers , four laboratory workers , and two bakers . in each of these studies , the workers had specific ige to the cellulase antigens . airborne concentrations of cellulase have been quantified using a modified dot blot technique and were < 180 ng m in a flour mill , crisp bread factory , and a bakery . oa has also been reported to cellulase in the baking industry as well as from h. insolens used in the detergent industry . endo 1 , 4-beta - d - xylanase and beta - xylosidase are major enzymes involved in xylan hydrolysis . collectively termed xylanases , these enzymes are a type of hemicellulase that breaks down hemicelluloses , a major component in plant cell walls . besides -amylase , xylanases are the next most frequently used enzymes in the baking industry to remove pentosans from bread and increase bread volume [ 13 , 49 ] . the prevalence of ige sensitization to hemicellulase was reported to be 8% and 11% for xylanase . sander and colleagues found that 7 of 8 bakers had serum ige to a 105 kda protein in a xylanase ingredient . this protein was identified using mass spectrometry to be beta - xylosidase derived from a. niger . the allergen was designated asp n 14 by the iuis allergen nomenclature subcommittee ( table 2 ) . airborne concentrations of xylanase have been reported to be < 40 ng m in a flourmill and crisp bread factory . concentrations as high as 200 ng m were also reported in a bakery , but these values were associated with the natural xylanase activity of wheat . case reports have verified xylanase sensitization and the presence of an ige mechanism in respiratory disease [ 15 , 79 ] . oa has also been reported to xylanase in the baking industry , and in a case report , a baker had an immediate asthmatic response following inhalation challenge . cross - reactivity between cellulase and xylanase has been reported to be in the range of 8090% but no cross - reactivity has been shown with -amylase [ 13 , 14 ] . similarly , workers can also be monosensitized to cellulase and xylanase without concomitant sensitization to -amylase . a. oryzae lactase is a high - molecular - weight protein that is involved in the hydrolysis of the disaccharide , lactose . lactase is used in the pharmaceutical industry to develop dietary aids for patients intolerant to lactose . in a cross - sectional study of united states pharmaceutical workers , bernstein and colleagues identified 29% of lactase - exposed workers to have positive spt response to lactase . workers with a positive spt were nine times more likely to have respiratory symptoms than workers with a negative spt . occupational sensitization to lactase has been reported in workers formulating and packaging gastrointestinal consumer products . in inhalational challenge studies conducted by laukkanin and colleagues , a. oryzae and r. oryzae lipase are used because of low extraction costs , thermal and ph stability , substrate specificity , and activity in organic solvents . lipase is predominantly used in the manufacture of laundry detergents and in baking ; however , other newer applications have been developed . for example , candida antarctica lipase has recently been used as a biocatalyst for the biofuel industry . the incidence of occupational sensitization to lipase , in industrial settings is understudied . in a preliminary analysis of detergent manufacturing workers , 3 workers were found to be sensitized to lipase and bronchial provocation tests provoked a reproducible asthmatic response . a recent case study of a pharmaceutical manufacturing worker also demonstrated sensitization to fungal lipase derived from r. oryzae but not a. oryzae-amylase . a. niger and r. oligosporus produce phosphatase that catalyzes the hydrolysis of phytate to lower - order phosphate esters . termed phytase , this enzyme enhances phosphate bioavailability in the digestive tract and has been utilized in the animal feed industry during the last two decades . 3-phytase b derived from a. niger is an 84 kda protein that has been designated asp n 25 by the iuis allergen nomenclature subcommittee ( table 2 ) . allergic sensitization to phytase has been reported in animal feed factory workers ( 790% ) , and sensitization is highest at sites where phytase is handled in powdered form [ 16 , 17 , 69 , 85 ] . in a cross - sectional study of 53 technical center workers that produced a. niger phytase , 52% of workers in the high - exposure group and only 10% in the low - exposure group were sensitized to phytase . personal exposure to phytase has been shown to exacerbate oa , and inhalation challenge tests produced immediate asthmatic response . it has been proposed that phytase is highly sensitizing and that direct contact should be avoided in this industry . fungal enzymes derived from a. niger are used in powdered form with other enzyme extracts by pharmacists to prepare digestive powders . biodiastase and flaviastase are two examples of fungal enzymes that have been associated with sensitization in hospital workers and pharmaceutical workers handling these products [ 10 , 1221 , 2335 , 3844 , 5188 ] . the aspartic proteases produced by rhizomucor miehei and cryphonectria parasitica are utilized in almost half of the cheese production operations throughout the world . the proteases assist in milk clotting and facilitate a change in cheese properties by hydrolyzing certain peptide bonds . occupational exposure to these proteases specifically 29% and 6% of workers had a positive skin prick test ( spt ) to r. miehei and c. parasitica aspartic protease extracts , respectively . the enzyme was isolated from dry - cured hams and was found to have a broad range of applications in industries that produce dry - cured meat products . although no occupational sensitization has been reported to this enzyme , it demonstrates that the introduction of any new enzyme could potentially represent an occupational hazard . the utility of fungal enzymes to degrade xenobiotics and organic compounds in the industrial sector continues to be recognized . fungal enzymes are now being used for a variety of purposes across many different industries . improved biochemical and molecular technologies have enabled the production of other potentially allergenic proteins . according to baur , more than 186 commercial enzymes were produced in the european union in 2001 , and many of these were produced by recombinant technology or had been genetically engineered . table 1 provides a summary of the major fungal enzymes that are utilized in industrial settings . all of the aforementioned enzymes that are listed in table 1 have been identified to be potent allergens in the workplace ; however , the ability of the other listed enzymes to cause adverse health outcomes following occupational exposure remains unclear . several of the enzymes presented in table 1 , not identified as occupational allergens , have been identified as allergens associated with environmental bioaerosols . catalase , a fungal enzyme utilized in hygiene products , pharmaceuticals , and textiles , has been identified as an allergen in the entomopathogenic fungus , metarhizium anisopliae . pectinase is used in brewing and wine production , food processing , and paper industries and allergy to pectinase has been associated with occupational exposure . esterase has been identified as an allergen in hevea brasiliensis ( natural rubber latex ) . beta - glucanase is used to improve the nutritional yield of animal feeds , and occupational exposure has been shown in a case study to significantly reduce forced vital capacity and forced expired volume in 1 second ( fev1 ) . the worker in this case study was also spt positive and had specific ige to beta - glucanase . in the biotechnology and pharmaceutical industries , glutathione - s - transferase ( gst ) has a number of applications . gst is an approximately 26 kda protein that has been identified as a major alternaria alternata allergen and is highly conserved across fungi [ 45 , 93 , 94 ] . the iuis allergen nomenclature subcommittee has designated this allergen alt a 13 [ 93 , 94 ] . interestingly , alpha - galactosidase has been associated with delayed anaphylaxis , angioedema , or urticaria in sensitized patients following the ingestion of beef , pork , or lamb . although the role of alpha - galactosidase and these other enzymes following occupational exposure remains unclear , these studies provide preliminary insight into the possible potency of these allergens in industrial environments . occupational allergic sensitization to fungal enzymes is diagnosed clinically using available in vivo spt reagents , or in vitro assays such as phadia immunocap . however , spt reagents for most of the fungal enzymes used in industrial settings are not commercially available and have to be either custom ordered or prepared individually by the investigator . methods for spt extract preparation that are used by investigators in the field have been previously described by quirce et al . . in vitro diagnostic tools that can quantify the amount of specific ige to an occupational allergen are not readily available except in research laboratories where investigators prepare their own inhibition or radioallergosorbent enzyme - linked immunosorbent assay ( elisa ) to quantify specific ige [ 36 , 49 ] . to date , -amylase ( k87 ) is the only fungal enzyme available on the phadia immunocap testing panel . to confirm oa caused by fungal enzymes , bronchial provocation tests can be undertaken to document immediate or late - phase responses to fungal enzymes [ 36 , 49 ] . positive immediate response criteria used in workers exposed to enzymes include a greater than 20% fall in fev1 , whereas a late - phase response has been considered positive when there is a 30% or greater fall in peak expiratory flow rate . however , there are several limitations with bronchial provocation tests that should be considered ; these are discussed in detail by peden and reed . in order to better understand the relationships between occupational fungal enzyme exposure and clinical symptomology , accurate information on the distribution and quantity of the fungal enzyme in the occupational environment will be required . immunodiagnostic methods that utilize antibodies could provide standardized methods for quantifying fungal enzyme biomarkers in a variety of occupational environments . following validation and interlaboratory comparison , the assays could be used for exposure assessment to determine the existence of exposure - response relationships [ 58 , 96 ] . this information is critical for the development of future threshold limit values ( tlvs ) and other occupational standards . several antibodies and immunodiagnostic methods have been produced to detect industrial fungal enzymes , in particular -amylase . these methods have been employed in field investigations and used to quantify the concentration of the enzyme from collected air samples . used an enzyme immunoassay with a sensitivity of 25 pg / ml to quantify -amylase in airborne and surface dust samples collected from five bakeries . in the same study , a lateral flow immunoassay for -amylase the sensitivity of the lateral flow assay was 110 ng / ml , and extracts with > 5 ng / ml allergen were positive in the lateral flow assay . in a study of 507 personal air samples , houba and colleagues used a rabbit igg capture immunoassay to quantify -amylase in specific baking job category . concentrations of -amylase up to 40 ng m were quantified , and workers directly involved with dough preparation had the highest exposures . using the same rabbit igg sandwich assay , nieuwenhuijsen et al . identified dispensing and mixing areas to have the highest -amylase exposure in british bakeries and flour mills . two monoclonal antibody- ( mab- ) based elisas have been developed for the detection of -amylase in the occupational environment . assay sensitivities ranged from 0.2 ng / ml to 0.6 ng / ml . a quantitative mab - mediated dot blot assay has also been previously described for cellulase and xylase ; the detection limits reported were 20 ng m and 2 ng m , respectively . mabs to other fungal enzymes , such as xylanase have been produced and reported in the literature . similarly , the detergent industry has produced antibodies and immunoassays for several common fungal enzymes and these have been utilized in industrial hygiene safety programs to mitigate worker exposures [ 101103 ] . unfortunately , for many other fungal enzymes presented in table 1 , there are no commercially available antibodies to enable quantification in the occupational environment . the development of fungal enzyme - specific mabs in combination with immunodiagnostic techniques will further our knowledge of the exposure - response relationships in occupational environments . using these methods will also help enable the development of standards and focus on the prevention of sensitization in heavily contaminated work environments . exposure to fungal enzymes , in particular -amylase , is a considerable health risk in a number of industries . cross - sectional studies have shown that processing workers in high - exposure categories who handled fungal enzymes are up to ten times more likely to be sensitized to fungal enzymes than workers in the low - exposure category . highest concentrations of enzymes in the inhalable fraction were encountered among workers located in dispensing , mixing , weighing , and sieving occupations [ 5456 , 60 ] . airborne concentrations as high as 40 ng m and in some cases even higher ( 200 ng m ) have been reported for sensitized workers located in these handling areas [ 12 , 55 , 60 ] . concentrations in the low ng m range have been associated with an increased frequency of sensitization . for other fungal enzymes , such as phytase , similar findings have been reported . the continued utilization of other previously overlooked enzymes as well as new genetically engineered enzymes in various industries will continue to provide diagnostic challenges , even for the most seasoned occupational medicine professional . it is likely that new cases of occupational allergic disease will emerge following exposure to fungal industrial enzymes during the next decade . in response , identification of exposure - response relationships will be critical for the development of tlvs and occupational exposure levels . however , this will depend on the development of suitable diagnostic antibodies and immunoassays . currently , subtilisin , a sereine endopeptidase derived from bacillus subtilis , is the only enzyme for which the american conference of governmental industrial hygienists ( acgih ) has established a tlv value ( 60 ng m ) . the european union directive also classifies the fungal enzymes cellulase and -amylase with the risk phrase r42 ( may cause sensitization by inhalation ) . there are currently no consensus standards for other industrially utilized fungal enzymes . as a precautionary measure , it has been concluded that all enzymes should be regarded as an allergen that can exacerbate respiratory sensitization in susceptible populations [ 10 , 59 ] . baur has further proposed that all enzymes should be classified as r42 according to the european union directive criteria . although intervention in the bakery industry has had little to no effect , installation of engineering controls and implementation of personal protective equipment programs in animal feed workers exposed to phytase was shown to result in the immediate cessation of hypersensitivity symptoms . improvements in biotechnology have also included the encapsulation of some enzymes [ 105 , 106 ] and proteins . these engineering controls have been proposed to reduce occupational exposure to enzymes ; however , encapsulation alone may not completely prevent enzyme - induced allergy and oa [ 108 , 109 ] . to date , the detergent industry has implemented a derived minimal effect level ( dmel ) of 60 ng m for pure enzyme proteins . although this dmel was provided as guidance by the acgih , other manufacturers have implemented their own occupational exposure guidelines ( oegs ) for fungal enzymes such as -amylase ( 515 ng m ) , lipase ( 520 ng m ) , and cellulase ( 820 ng m ) . in addition , the detergent industry has developed a medical surveillance program to identify and correct elevated exposures before occupational illnesses occur [ 101103 , 111 ] . as a result reducing worker exposure to fungal enzymes in industry by the implementation of engineering controls and other allergen avoidance strategies will continue to mitigate personal exposure and further reduce the occupational health risk .

intrahepatic bile duct adenoma ( bda ) is a rare benign liver tumor originated from the epithelium of the bile ducts . the incidence of bda was reported 1.3% of primary liver tumors.1 most of bdas are less than 2 cm and lack of symptom . several imaging modalities such as computed tomography ( ct ) and magnetic resonance imaging ( mri ) are used to detect bda . histopathologically , bda is a kind of aggregation of proliferative noncystic bile ductules in background of connective tissue stroma with variable degrees of fibrosis and inflammation.2 we report a case of bda with elevated alpha - fetoprotein ( afp ) in a patient with chronic hepatitis b ( chb ) assessed by various imaging modalities including contrast - enhanced ultrasonography ( us ) . to our knowledge , this is the first case of bda with elevated afp mimicking hepatocellular carcinoma ( hcc ) on contrast - enhanced us in a patient with chb . a 51-year - old male patient was referred to our hospital due to a liver nodule which was incidentally detected under abdominal us screening at a local clinic . he had been diagnosed as hepatitis b virus carrier 20 years ago but he had not received any check - up for hepatitis b or surveillance for hcc . he had no symptom and physical exam was non remarkable . on laboratory exam , aspartate aminotransferase ( ast ) and alanine aminotransferase ( alt ) were elevated by 113 and 151 iu / l . on viral marker examination , hbsag was positive , anti - hbs negative , anti - hcv negative , hbeag positive , anti - hbe negative , hbv dna more than 170,000,000 iu / ml . on tumor markers , afp was slightly elevated by 23 ng / ml but proteins induced by vitamin k absence / antagonist - ii was within normal range . on liver dynamic ct , about 1 we performed gadolinium - enhanced liver mri to rule out the possibility of small hcc . on the mri , about 0.8 cm nodular lesion on segment 4 showed low signal intensity on t1-weighted images , enhancement during hepatic arterial phase ( fig . 1d ) , and high signal intensity on diffusion - weighted images ( dwi ) ( fig . 1e ) and heavily t2-weighted images ( fig . he started taking entecavir 0.5 mg per day for the treatment of immune reactive chb . although he had underlying disease of chb and the rise of afp , we decided to follow - up for the liver nodule because its size was small and dynamic imaging did not show typical features of hcc . a new imaging modality , contrast - enhanced liver us , was performed 1 month later . about 1 cm low echogenic nodule showing bull 's eye pattern was found on segment 4 and it was confirmed by imaging fusion with volume navigation that the nodule on us was the same lesion observed on mri ( fig . on contrast - enhanced us with microbubble contrast agent ( sono - vue ) , it was well enhanced during arterial phase ( fig . . moreover afp was increased by 268 ng / ml after 1 month even though both ast and alt were decreased after taking anti - viral agent . he was clinically presumptively diagnosed as hcc with the reasons that contrast enhanced us showed typical features of hcc , afp was increased to over 200 ng / ml , and he had underlying disease of chb . then he underwent liver resection ( s4 segmentectomy ) for the purpose of both histological diagnosis and treatment . gross findings of the specimen showed an 1 cm well - circumscribed , non - capsulated , round yellowish nodule ( fig . microscopically , it was a kind of proliferation of well - formed bile tubular ducts without cell atypia or mitotic activity in the background of connective tissue stroma ( fig . follow - up afp was decreased to 44 ng / ml 1 week after the surgery , and within normal range by 4.5 ng / ml 6 months after the surgery . intrahepatic bda is a rare benign liver tumor originated from the epithelium of the bile ducts . bda was usually found incidentally during autopsy or laparotomy.1234 the incidence of bda was reported 1.3% of primary liver tumors.1 most of bdas were ranged from 1 mm to 20 mm and had limitation on growth potential . also they showed benign nature in follow - up period and no symptom.25 although the pathogenesis of bda has been still unclear , previous studies suggested that bda is a peribiliary gland hamartoma6 or a result of reactive process to the focal injury.2 macroscopically , bda is a sub - capsular , well - demarcated , firm , and yellowish nodule.2 histopathologically , bdas consist of highly proliferative bile ductules in background of connective tissue stroma with variable degrees of fibrosis and inflammation without cell atypia or mitotic activity.7 our case also showed asymptomatic bda less than 2 cm . however our case was the first case of bda accompanied by the elevation of afp . although afp could be elevated in patients with chb , there are two points which support that bda induces afp elevation . one point is that follow - up afp was more increased even though ast and alt were decreased after starting antiviral therapy . recently several imaging modalities such as dynamic ct and mri are used to detect bda . most cases of bdas showed hypervascular characteristics with prolonged enhancement on dynamic ct , mri , and angiography because of the fibrous tissues within the tumor whereas hcc usually shows definite washout during delayed phase.8 however it is difficult to differentiate between small hcc and bda because small hcc less than 2 cm frequently shows atypical finding on imaging . our case showed prolonged enhancement on dynamic ct and mri , consistent with previously reported cases of bdas . there have been just a few of reports regarding these image findings up to recently.3910 an et al.11 reported a case of bda using dwi for the first time in 2013 . our case undertook contrast - enhanced us as follow - up imaging modality 1 month later . to our knowledge , it was the first case to use this imaging modality for bda . our case showed early enhancement during arterial phase and wash - out during delayed phase suggesting hcc on contrast - enhanced us . this difference probably occurred because the contrast enhanced us used microbubble as contrast agent and microbubble could be ruptured during delayed phase.12 thus , bda probably could show delayed washout on contrast - enhanced us whereas it showed prolonged enhancement on dynamic ct and mri . in summary , we experienced a case of bda with elevated afp in a patient with chb assessed by various imaging modalities including contrast - enhanced us . in our case , definite washout was observed on contrast - enhanced us whereas other imaging modalities showed prolonged enhancement . to our knowledge , this is the first case of bda that undertook contrast - enhanced us and showed highly elevated afp . further cases of its diagnostic use with bda are required to establish the image findings on contrast - enhanced us .

proficient meditative practices help to integrate the brain functions , regulate various physiological mechanisms resulting in a state of mental and physical well being . studies of long term transcendental meditation ( tm ) practitioners have shown that tm helped to achieve a state of restful alertness a state of deep physiological rest which was associated with periods of respiratory suspension without compensatory hyperventilation , decreased heart rate , heightened galvanic skin response along with enhanced wakefulness ( wallace , 1970 ) . this restful alertness and hypometabolic state were believed to be the outcome of physiological and biochemical changes brought about by meditation practices ( young and taylor , 1998 ) . the main objective was to evaluate the neurophysiological correlates of the higher states of consciousness during sleep . the study reported that the senior meditators spent more time in the slow wave sleep ( sws ) with higher theta alpha power with background delta activity , together with reduced electromyogram ( emg ) . the rapid eye movement ( rem ) sleep was also found to be enhanced . alpha pattern observed during sleep was considered as an electrophysiological correlate of a stabilized state of higher consciousness in sleep . further , the study opened up new avenues to explore the influence of meditation on sleep . ( 2010 ) demonstrated the differences in sleep architecture in practitioners of vipassana meditation ( mindfulness meditation ) . the sleep architecture of senior practitioners of vipassana meditation was endowed with enhanced states of sws and rem sleep compared to that of non - meditating control group . vipassana meditators showed 17.95 , 11.3 , and 10.63% of sws among younger ( 3039 years ) , middle ( 4049 years ) , and older ( 5060 years ) age groups respectively . on the other hand , the corresponding non - meditating controls showed a significant reduction of sws with increasing age , i.e. , 11.29 , 6.65 , and 3.94% . vipassana meditators from all age groups showed more number of sleep cycles , indicating quality sleep . the study suggested that the older meditators could retain the sleep pattern of younger non - meditating controls . aging is known to reduce the activity of the slow wave resonating mechanism either by actual loss of neurons or reduced activation of thalamo - cortical pathways ( feinberg et al . , 1967 ; mourtazaev et al . , 1995 ) and also by reduced spindle generation during nrem sleep stage 2 ( nicolas et al . , 2001 ) . vipassana meditation appears to preserve the sws , suggesting that meditation could prevent the age associated changes in the slow wave generating mechanisms . meditation practices are reported to enhance the amplitude of gamma synchrony , strengthen the thalamo - cortical and cortico - cortical interactions ( lutz et al . , 2004 ) . these mechanisms brought about stronger network synchronization and altered the neural structure and functions ( lazar et al . , 2005 ; pagnoni and cekic , 2007 ) . based on the above observations , the changes in sleep architecture in the vipassana meditation practitioners could be attributed to the neural plasticity events associated with meditation . changes in autonomic activity had been reported with respect to specific sleep states with predominant parasympathetic activity in sws and sympathetic activity during rem sleep ( pivik et al . , 1996 ; otzenberger et al . , 1997 ; trinder et al . aging alters autonomic flexibility leading to an overall increase in sympathetic activity along with reduced parasympathetic activity , thereby bringing about autonomic arousal and decrease in sleep quality . reduced parasympathetic activity along with inefficient baroreflex mechanisms during rem sleep have been reported to cause unfavorable cardiac events ( somers et al . meditation practices help to bring about sympatho - vagal balance with parasympathetic predominance among experienced meditators and also in novice meditators with less practice ( wu and lo , 2008 ; zeidan et al . , 2010 ) . vipassana meditation practices help to retain the flexibility of autonomic activity during different stages of sleep . further , heart rate variability evaluation during rem sleep showed higher sympathetic activity in meditators than in controls . this higher sympathetic activity in meditators was effectively buffered by parasympathetic activity unlike the non - meditating controls ( unpublished data ) . these studies have demonstrated a greater insight into the modulatory effect of meditation practices on autonomic functions during sleep . meditation practices are associated with enhanced frontal midline theta activity ( aftanas and golocheikine , 2001 ; travis and shear , 2010 ) . the frontal midline theta activity originates from the anterior cingulate cortex and controls the parasympathetic activity ( tang et al . , 2009 ) . vipassana meditation practices would have activated the anterior cingulate cortex and hence modulated the parasympathetic activity during sleep . these reports are suggestive of a positive modulatory role of meditation in sleep through autonomic functions . meditation practices were reported to regulate the hypothalamo pituitary adrenal ( hpa ) axis and thereby the cortisol and catecholamine levels ( jevning et al . , 1978a ; infante et al . , 2001 ) . further , meditation techniques were also known to increase dehydroepiandrosterone ( glaser et al . , 1992 ) , anterior pituitary hormones like growth hormone , thyroid stimulating hormone ( tsh ) , prolactin ( jevning et al . 1997 ) , and melatonin levels ( massion et al . , 1995 ; tooley et al . , 2000 melatonin plays a vital role in the physiological regulation of sleep in both blind and normal individuals ( pandi - perumal et al . , 2006 ) . melatonin rhythm follows a raising and falling phase with corresponding alterations in sleep propensity ( dijk and cajochen , 1997 ; dijk et al . , 1997 ) . melatonin exerts its hypnotic effect by acute inhibition of suprachiasmatic nucleus ( von gall et al . , 2002 ) and also by facilitating hypothermic response through peripheral vasodilatation ( krauchi et al . , 1997 ) . melatonin is widely used in the management of sleep rhythm disorders due to jetlag , shiftwork , and insomnia ( martinez and lenz , 2010 ) . in addition to its role in sleep , melatonin acts as an antioxidant and immunomodulator ( maestroni , 2001 ) , oncostatic , antiaging agent , and helps in bringing sense of wellbeing ( armstrong and redman , 1991 ; reiter , 1995 ; maestroni , 2001 ; guerrero and reiter , 2002 ; pandi - perumal et al . , 2006 ) . aging attenuates the melatonin secretion ( sack et al . , 1986 ) and hence affect the sleep quality in aged population . meditation practices are reported to enhance the melatonin levels ( tooley et al . , 2000 ) , the precursors of melatonin especially the serotonin ( bujatti and riederer , 1976 ) and noradrenalin ( lang et al . , 1979 ) . meditation increases melatonin concentration by slowing its hepatic metabolism or augmenting the synthesis in the pineal gland ( massion et al . , 1995 ) . diurnal melatonin levels were found to be significantly high in vipassana meditators ( approximately 300 pg ml ) than non - meditating controls ( 65 pg ml ; unpublished data ) . by considering the role of melatonin in sleep maintenance , it might be concluded that meditation practices enhance melatonin levels and hence quality of sleep . sleep is reported to be associated with reduced heart rate , blood pressure , respiratory rate , and rhythm , oxygen consumption , anxiety or arousal , and an overall decrease in basal metabolic levels leading to a hypometabolic state . this phenomenon of sleep induced hypometabolic state is a natural and spontaneous outcome necessary for biological survival ( young and taylor , 1998 ) . imaging studies have shown that during nrem sleep the blood flow to areas associated with executive functions such as frontal and parietal cortex , thalamus , basal ganglia , and cerebellum has been reduced and bringing about the feeling of hypnogogic effect during sleep ( kajimura et al . , 1999 ; meditation also brings a sustained hypometabolic state termed as relaxation response by herbert benson and helps in sleep initiation ( wallace et al . , 1971 ) . similarly , meditation techniques help to regulate the blood flow to the executive regions of the brain during sleep ( lou et al . , 1999 ) . meditation practices down regulate hpa axis reducing the stress , prolactin , tsh levels ( jevning et al . , 1978a ) ; bring about alterations in the intermediary metabolism favoring an anabolic state . thus , meditation helps to maintain a wakeful hypometabolic state with parasympathetic predominance ( young and taylor , 1998 ) . both the state and trait characteristics of meditation practices provide an advantage that it continually resets the metabolic functioning despite varying levels of stress . this internal metabolic resetting form the baseline trait characteristics necessary for all potential changes brought about by meditation practices . thus meditation is shown to have a greater potential to influence many physiological and behavioral states including sleep ( carlson et al . , 2007 ; ong et al . , 2008 ; sibinga et al . , it has been hypothesized that meditation practices activate prefrontal cortex , fronto - limbic , fronto - parietal neural networks and limbic and paralimbic cortices associated with sympathetic arousal . meditation practices activate structures like insula , anterior cingulate , and hypothalamus and bring about autonomic and humoral changes ( newberg and iversen , 2003 ) . meditation thus produces a continuum of global regulatory changes at various behavioral levels favoring quality sleep . it is evident from the literature cited that practice of meditation brings about global changes . many of these alterations in physiological functions have great similarities to the changes that are happening during sleep . it has been proposed that sleep is an autoregulatory global phenomenon ( kumar , 2010 ) . meditation , with its global effects on body and brain functions helps to establish a body and mind harmony . thus meditation practices as an autoregulatory integrated global phenomenon , opens a wider scope for understanding the unique aspects of human sleep and consciousness . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

multiple sclerosis ( ms ) is the most common autoimmune disease of the central nervous system ( cns ) among young adults and it is more common in women than men [ 1 , 2 ] . it is widely held that there are different four patterns including relapsing - remitting multiple sclerosis ( rrms ) , primary progressive multiple sclerosis ( ppms ) , secondary progressive multiple sclerosis ( spms ) , and primary - relapsing multiple sclerosis ( prms ) . although the etiology and pathogenesis of ms remain unknown , several lines of evidence support that the increased migration of autoreactive lymphocytes across the blood - brain barrier ( bbb ) may be responsible for axonal demyelination of neurons . it has been demonstrated that autoreactive t cells including ifn--producing th1 cells and il-17-producing th17 cells may mediate autoimmune in cns leading to axonal degeneration , demyelination , and ultimately irreversible tissue damage of patients with ms [ 4 , 5 ] . treg cells that prevent damage to the host by limiting the immune response to pathogens are impaired in ms [ 6 , 7 ] . moreover , ms pathology and pathogenesis have been concentrated on extensive demyelination and formation of sclerosis plaques in cerebral cortex and spinal cord , which contribute to irreversible neurological injury . activated macrophages and microglia both extensive accumulation of macrophages and activation of microglia are common occurrences following neurological injury [ 913 ] . eae is a mouse model of the human disease multiple sclerosis , characterized by autoimmune inflammation of the cns associated with microglia activation and infiltration of encephalitogenic t cells and leukocytes from the periphery [ 14 , 15 ] . micrornas ( mirnas ) are small , usually 1924 nucleotides in length , noncoding rnas that regulate gene expression at the posttranscriptional level . several recent studies have detected the involvement of circulating mirnas in physiological and pathological processes and identified them as potential biomarkers , therapeutic agents , or drug targets . in ms , a number of mirna species were found to be differentially expressed in patients with ms compared with controls and to have the potential to be used as diagnostic biomarkers or drug - response . t cell subsets such as th1 and th17 accumulate in periphery tissues and mediate adaptive immune response . it is generally believed that th1 and th17 cells are key proinflammatory mediators of cellular immunity that are responsible for crucial events during development of eae . the th1 lineage cytokine can help th17 cells invade the brain and spinal , thus triggering eae . several recent studies have examined the involvement of mir-155 in eae . besides sustaining inflammatory response by promoting the development of inflammatory th1 and th17 cells , mir-155 is critical for the acquisition of phenotypic and functional properties of mature dcs ( figure 1 ) . it is demonstrated that mir-155 modulates ifn expression through a mechanism involving repression of ship1 , which promotes ifn level in th1 cells . an early research reported that mir-155 might block c - maf , a promoter of th2 cell development , and enhance th17 cell differentiation . recently , mir-155 has been implicated in inhibiting the protein suppressor of cytokine signaling 1 ( socs1 ) in activated cd4 t cells , which promotes treg / th17 cells differentiation and th17 function by activating il-2/stat5 and il-6/stat3 signaling pathways . mir-155/mice is associated with a decrease in il-17 and ifn- , contributing to a delayed course , decreased eae clinical severity , and less inflammation in the peripheral lymphoid organs and cns [ 20 , 21 ] . reported that mir155 is required for dc maturation and the ability of dcs to promote antigen - specific cd4 t cell activation by inhibiting c - fos expression which could dampen tnf- , il-12p70 , il-6 , ifn- , and il-12p40 secretion by mature bm - dcs . in mir155/mices , overexpression of arg2 in dcs resulted in a selective depletion of arginine which can inhibit t cell responses . mir-146a is highly expressed in tregs and suppresses interferon ( ifn)-dependent th1 responses and inflammation by inhibition of its gene expression signal transducer and activator of transcription ( stat-1 ) . the deletion of mir-146a in tregs may increase the production of ifn- and develop severe th1-mediate lesions . further , mirna-146a was reported to modulate the signaling proteins involved in the innate immune and inflammatory response , such as complement factor h ( cfh ) and irak-1 , and both of them were deficient in ms [ 2528 ] . overexpression of mir-132 in cd4 t cells from eae mice downregulated il-17 , ifn- , and t cell proliferation . mir-26a was demonstrated to downregulate th17 and to upregulate treg cell function through targeting il-6 . in eae , inhibition of mir26a may result in high level of th17-related cytokines and aggravate clinical signs of eae . on the contrary , treg cell specific transcription factor , foxp3 , was detected to be positively correlated with mir26a expression , contributing to a milder form of eae . a very recent report has shown that mir-21 promoted th17 differentiation by decreasing smad-7 , a negative regulator of tgf- signaling . treatment of wild type mice with anti - mir-21 oligonucleotide diminished eae clinical severity along with decreased th17 cells . guan et al . have reported that upregulation of let-7e leads to promote the development of th1 and th17 cells and aggravate eae . since , overexpression of let-7e repressed il-13 and il-10 production and augmented ifn- production . inhibition of let-7e may shift the immune response to a th2 profile and attenuates the severity of the disease . mir-29ab1 was presented to regulate the th1 differentiation to affect eae development by targeting t - bet and ifn- . steiner et al . also found that mir-29 repressed ifn- production by direct targeting of both t - bet and eomes , two transcription factors known to induce ifn- production . these results demonstrate that the level of mir-29 can modulate th1 cell differentiation and reflect the disease severity . a very recent study elucidates that interleukin 6 ( il-6 ) and rela ( nf-b subunit ) are target genes of mir-291a-3p . downregulation of mir-291a-3p may indicate oxidative stress at the preonset stage of eae and upregulation of il-6 and nf-b activation to induce proinflammatory pathways by targeting il-6 and rela . mir-20b has been reported as a decreased mirna in blood cells of ms patients . as a negative regulator of eae , mir-20b suppresses th17 differentiation in vitro and in vivo and attenuates eae by targeting rort and stat3 . apart from mir-20b , mir-326 , mir-301a , and mir-23b are found to be involved in th17-mediated pathogenesis of eae by targeting ets-1 , a negative regulator of th17 cell differentiation , il-6/23stat3 pathway , and tab2 , tab3 , and ikk - a , respectively . in conclusion , these evidences strongly suggest that circulating mirnas can be utilized as potential clinical biomarkers that reflect the disease activity and severity in ms ( figure 2 ) . disruption and immune activation of the blood - brain barrier ( bbb ) are central and early features of ms [ 4042 ] , with the characteristic of the increased bbb permeability . previous studies have shown that bbb breakdown is a fundamental event during the course of ms and that the level of the neurovascular dysfunction in eae may play an important role in the neurological severity of the disease . in recent years , there are increasing evidences to support that mirnas may play an important role in neuroinflammatory disorders . several reports have demonstrated that the interendothelial junctional complex ( ijc ) and integrin focal adhesion ( fa ) complexes [ 4446 ] are probably associated with altered expression of tight junction ( tj ) proteins in response to proinflammatory cytokines , such as tnf- and ifn-. these cytokines may contribute to increase of brain endothelial cell ( bec ) permeability by modulation of its gene expression . mir-155 is reported as a novel negative regulator of bbb function by modulating bec cell - to - cell and cell - to - matrix interactions , which contributes to bbb dysfunction in ms . lopez - ramirez et al . reported that the putative target genes of mir-155 modulate the alterations in fa and ijc organization that might change the permeability of bec . there are 4 target genes for mir-155 that have been verified , including 2 components of fas , dock-1 and sdcbp , and 2 components of ijcs , anxa-2 and cldn-1 , which may modulate bec permeability and potentially mediate mir-155-induced bbb breakdown during inflammation . during ms , increased permeability and expression of cell - adhesion molecules on the brain endothelium facilitate encephalitogenic t cells and circulating leukocytes infiltrating into the cns , leading to demyelination and axonal loss [ 8 , 48 ] . it was recently found that mir-125a-5p may significantly increase bec barrier function by forming thicker and more continuous junctional complexes of ve - cadherin and zona occludens-1 . overexpression of mir-125a-5p in the brain endothelial cells downregulates tnf--mediated icam-1 expression , a cell - adhesion molecule involved in vascular permeability and leukocyte infiltration , and reduces the transmigration of monocyte through the brain endothelial cell barrier . therefore , upregulation of mir-125a-5p could reestablish normal function of the brain vasculature in endothelial cell - based neurological diseases , particularly in ms . mir-101 has been shown to downregulate claudin-5 expression by targeting of ve - cadherin , which demonstrates a new mechanism for the regulation of barrier permeability though posttranscriptional regulation of ve - cadherin . wu et al . investigated that an increasing level of mir-146a expressed on hcmec / d3 cells diminished cytokine - stimulated adhesion of t cells to endothelial cells , nuclear translocation of nf-b , and expression of adhesion molecules . in summary , the mechanism of action of mirna in the inflamed bbb has still not been systematically studied . it is believed that mirnas such as mir-125a-5p , mir-155 , mir-101 , and mir-146a can potentially be regarded as novel biomarkers or therapeutic targets for effective treatment of ms ( figure 2 ) . several recent studies have examined the involvement of circulating mirnas in microglia activation and demyelination . mir-873 induced by il-17 is reported to facilitate the production of inflammatory cytokine and aggravate demyelination in eae through the a20/nf-b pathway . inhibiting mir-873 or a20 , respectively , decreased or increased the production of inflammatory cytokines and attenuated or aggravated the cns damage of eae mice , both in vitro and in vivo . the serum concentration of mir-572 was lowest in ppms and it was significantly increased in spms . since a putative target for mir-572 is the neuronal cell - adhesion molecule ( ncam ) , a protein involved in the maturation of the nervous system , the decreased level of mir-572 can promote remyelination in cns . it has been generally accepted that the capacity of microglia to phagocytose degenerated myelin can be altered by environmental inflammatory mediators , such as ifn- , tnf- , il-4 , and il-10 . tnf- was shown to increase the phagocytic activity of microglia . il-4 and il-10 exerted a role of upregulating phagocytosis in macrophages / microglia , while accompanied by a reduction of inflammatory response . it can target anti - inflammatory proteins in microglia , such as the suppressor of socs-1 , leading to the upregulation of several inflammatory cytokines , including the inducible nitrogen synthase ( inos ) , il-6 , and tnf- related to the m1 phenotype . as a feedback mechanism to control the immune response , it can also upregulate ifn- which increase the expression of socs-1 and il-10 , two important anti - inflammatory mediators [ 56 , 57 ] . in addition , mir-155 can also target m2-associated genes , such as smad2 , a protein involved in the tgf- pathway and cebp , a transcription factor critical for the expression of il-10 , arginase-1 , and cd206 . therefore , mir-155 has a positive effect in promoting inflammatory response and upregulating phagocytosis in microglia . ark1c1 and ark1c2 are different isoforms of an enzyme encoding a 3--hydroxysteroid dehydrogenase activity that is necessary to the synthesis of neurosteroids in the brain . these genes are experimentally validated to be downregulated by mir-155 and mir-338 , which can reduce the production of neurosteroids synthesis [ 60 , 61 ] . miller and streit recently demonstrated that decreasing cd47 which is regarded as a protein that inhibits macrophage phagocytosis may promote phagocytosis of myelin in a sirp--dependent mechanism . besides , mir-155-mediated downregulation of cd47 is thought to release macrophages inhibition and thereby promote myelin breakdown . the overexpression of mir-101 responses to several tlr ligands in macrophages will downregulate mapk phosphatase 1 ( mpk-1 ) , promoting the activation of mapk and the level of m1-associated proinflammatory cytokines , such as il-6 , tnf- , and il-1 . chaudhuri and colleagues reported an increased mir-125b in m1 macrophage activation , with upregulation of mhc class ii , cd40 , cd80 , and cd86 . the potential reason is that interferon regulatory factor 4 ( irf4 ) is targeted by mir-125b and makes macrophages polarize to m1 cytotoxic phenotype . reported that mir-146a - mediated downregulation of irak1 is associated with the reinforcement of irak2-induced activation of nf- and a sustained inflammatory response in human astroglial cells . interestingly , significant amounts of mirna-146a that have been found in glial cells are responsible for axonal myelination [ 6668 ] . in inactive ms lesions , the enzyme elovl7 regulated by mir-219 is essential for myelin maintenance and axonal integrity in the adult mouse cns . in recent years , there are increasing evidences to support that some mirnas are engaged in building beneficial environment for remyelination and axon regeneration . for instance , two studies described that mir-214 is upregulated in oligodendrocytes during differentiation and mir-23a overexpression promotes oligodendrocyte differentiation by downregulating lamin b. the increased level of mir-214 and mir-23a in ms lesions may reflect ongoing remyelination [ 70 , 71 ] . the microglia in cns are the main macrophages participating in phagocytosis in the early stage of demyelination , while in the late stage , a number of infiltrated blood - borne macrophages contribute to axon debris clearance . mir-124 is reported as a key regulator of microglia quiescence in the cns and as a new modulator of monocyte and macrophage activation in the periphery during eae . mir-124 has been reported to contribute to the m2 phenotype of macrophages and microglia , since its overexpression led to the downregulation of m1-associated markers , such as il-6 , tnf- , and inos , and an increase of proteins associated with the m2 phenotype , such as tgf- , arginase-1 , and fizz1 , which are crucial for the suppression of eae . in eae , zhu et al . have experimentally validated tab2 , tab3 , and ikk- as mir-23b targets . these genes are upregulated during eae and modulate il-17 , tnf- , and il-1 induced activation of nf-. these findings indicate that mir-23b overexpression can delay the onset of eae and alleviates disease severity ( figure 2 ) . natalizumab is a recombinant humanized monoclonal antibody which binds to 41 and 47 integrins and suppresses their interaction with vascular cell - adhesion molecules-1 ( vcam-1 ) so as to impair leucocyte adhesion and transmigrate across the bbb into the central nervous system , with a reduction of proinflammatory cytokines . reported that five mirnas ( mir-18a , mir-20b , mir-29a , mir-103 , and mir-326 ) were regulated by natalizumab , which were the opposite of the mirna results in ms patients prior to natalizumab therapy compared to healthy controls . four of them ( mir-18a , mir-20b , mir-29a , and mir-103 ) were upregulated , while mir-326b is downregulated after natalizumab treatment . as mentioned above , the targets of mir-20b and mir-326 , including rort , stat3 , vegfa , and ets-1 [ 37 , 7476 ] , play an important role in regulating th17 immune responses and bbb breakdown [ 77 , 78 ] . petrocca et al . demonstrated that natalizumab may downregulate mir-17 expression and upregulate the level of mir-106b . both mir-106b and mir-17 have been identified as important modulators of tgf- signaling and have been found to regulate cd4 t cell immune responses by targeting tgfbr2 . inhibition of tgfbr2 resulted in severe inflammatory responses associated with t cell activation and differentiation in mice . in line with decreased mir-17 in natalizumab treated patients , we found an increase in pten mrna , which plays an important role in the regulation of t cell homeostasis and self - tolerance [ 83 , 84 ] . in addition , downregulation of mir-17 was associated with upregulation of a proapoptotic member of the bcl-2 family , bim , the cyclin - dependent kinase inhibitor 1 , p21 , and a transcription factor controlling the g1-s transition , e2f1 . these targets reverted by natalizumab therapy may alter peripheral immune cells during eae and negatively associate with disease severity . so the influences of natalizumab on the expression of mirna can help us to understand long - term effects of natalizumab and functions in the process of ms pathogenesis . interferon - beta ( ifn- ) therapy is widely used in patients with ms . besides its effects on immunomodulatory system and metalloproteinase 9 , it has been shown to have an effect on neuroprotection against the toxicity induced by activated microglia and inhibiting the production of glutamate and superoxide by activated microglia [ 86 , 87 ] . it has been reported that the expression level of mir-26a-5p was significantly changed in response to inf- treatment in ms patients during different stages . it was much higher in ifn- treated rrms patients at 3 months ' treatment and kept stable at 6 months ' treatments in all patients . in contrast , postsynaptic density protein 95 ( dlg4 ) , a key player in neuronal signaling , decreased after 3 months ' treatment , showing an inverse relation to mir-26a-5p expression . moreover , it has been reported that 20 mirnas may play an important role in the mechanisms of therapy of ifn-. interestingly , seven of them , including mir-16 - 5p , mir-342 - 5p , mir-346 , mir-518b , mir-760 , let-7a-5p , and let-7b-5p , were increased , whereas 13 mirnas , including mir-27a-5p , mir-29a-3p , mir-29b-1 - 5p , mir-29c-3p , mir-95 , mir-149 - 5p , mir-181c-3p , mir-193a-3p , mir-193 - 5p , mir-423 - 5p , mir-532 - 5p , mir-708 - 5p , and mir-874 , were decreased in pbmcs from ms patients in response to ifn- treatment . particularly , some of the 20 mirnas , such as members of the mir-29 family , are associated with apoptosis and are involved in ifn signaling feedback loops and others like hsa - mir-532 - 5p and hsa - mir-16 - 5p are demonstrated to have relations with ifn - responsive genes . this information can be served as a novel biomarker to predict the effects of ifn - beta therapy and be applied to develop a novel therapy for ms patients . glatiramer acetate ( ga ) , an immunomodulation drug , was approved as a first - line therapy in ms . ga treatment may downregulate mir-146a and mir-142 - 3p level in the pbmcs of ms patients . the mechanisms by which ga influences the expression of mir-142 - 3p may attribute to an expansion of t regulatory cells and changes in the composition of the t cell compartment . downregulation of mir-146a in the glatiramer acetate treatment group may improve disease status of ms patients by inducing a th1 to th2 shift and inhibiting monocyte reactivity [ 9193 ] . the gsk3 inhibitors were shown as beneficial drugs in preclinical trials in stroke and huntington 's and amyotrophic lateral sclerosis , with functions of increasing bbb tightness under physiologic conditions , decreasing inflammatory factors secreted in brain microvascular endothelial cells and protecting against bbb disruption by reducing monocyte adhesion to / migration across the bbb [ 94 , 95 ] . so as to attenuate leukocyte adhesion / migration into the bbb and diminished bbb permeability in both in vitro and in vivo models . overexpression of mir-98 and let-7 g in brain endothelium may also contribute to inhibiting expression of proinflammatory mediators , such as ccl2 and ccl5 . different patterns of patients with ms undergo several disease processes including periphery inflammation and blood - brain barrier damage and cns lesions . without timely and adequate treatment , these patients will suffer chronic demyelination and axonal loss , for unclear reasons , leading to irreversible disability . the current mirna profiles offer an opportunity to indicate disease progression and the therapeutic effect . some of the biomarkers are related to an altered biological process and a treatment targeting this process . understanding the complexity of mirna network may open up a new vista to find individual biomarkers in clinical diagnosis and monitor the efficacy of therapy .

the recent introduction of vasopressin - receptor antagonists makes it imperative to revisit hyponatraemia and the syndrome of inappropriate antidiuretic hormone secretion ( siadh ) . vaptans , represent the first targeted therapy for siadh , which is one of the most common causes of hyponatraemia . the various compounds are in different stages of development and include mozavaptan lixivaptan , satavaptan and tolvaptan . tolvaptan has recently been approved by the european medicines agency for the treatment of hyponatraemia secondary to siadh . when new drugs become available , the excitement about their possibilities sometimes overshadows the disorder for which they will be used . because hyponatraemia is such a heterogeneous and complex disorder , and because tolvaptan has been approved only for the treatment of hyponatraemia secondary to siadh , a rational use of vasopressin - receptor antagonists first requires a proper diagnosis of siadh . therefore , may we suggest that in addition to reading the package insert of these new drugs , read this article , in which we will review hyponatraemia and siadh and discuss the potential role of vasopressin - receptor antagonists . finally , on a more semantic note , it was recently proposed that siadh should be called the syndrome of inappropriate antidiuresis ( siad ) , because vasopressin ( antidiuretic hormone ) is not always elevated , for example in patients with reset osmostat or with an activating mutation of the vasopressin v2-receptor . however , in this article we will use the traditional term siadh , because we focus on disorders with elevated vasopressin . the more obvious answers as to why hyponatraemia is clinically relevant used to be because of cerebral oedema and the osmotic demyelination syndrome ( ods ) . although relatively rare , these two neurological conditions represent the two most severe complications of hyponatraemia and its treatment . both can occur with any cause of hyponatraemia , including siadh . cerebral oedema usually occurs in acute hyponatraemia of moderate or severe degree ( drop in serum sodium [ sna ] 125 setting , brain cells do not have time to adapt to extracellular hypotonicity and cell swelling . it is a medical emergency that , if left untreated , can lead to herniation of the brain stem into the foramen magnum and permanent brain damage . the term refers to the neurological sequelae ( e.g. sudden para or quadraparesis , dysphagia , dysarthria , diplopia and loss of consciousness ) that can develop when chronic hyponatraemia is corrected too fast . because the brain damage in ods is often irreversible , iatrogenic and preventable , it remains a concern in the management of hyponatraemia . ods can usually be prevented , however , by adhering to the recommended maximal correction rates of 12 mmol / l/24 h and 18 mmol / l/48 h in chronic hyponatraemia . if chronic hyponatraemia is associated with other risk factors for ods ( hypokalaemia , malnutrition , alcoholism ) , the limit should be adjusted more towards 8 mmol / l/24 h . if the duration of hyponatraemia is in doubt ( acute versus chronic ) , computed tomography or magnetic resonance imaging of the brain may sometimes help to diagnose cerebral oedema , suggesting acute hyponatraemia . are there any other reasons why hyponatraemia matters ? below , in the section entitled current management of hyponatraemia is inadequate , we will review three recent studies in which the clinical reality of the management of hyponatraemia was studied . euphemistically speaking for instance , the causes of hyponatraemia were poorly studied , hyponatraemia was undertreated , not treated at all or all of the above . the second less obvious answer to why hyponatraemia matters relates to a landmark study by renneboog and colleagues . they demonstrated that chronic and apparently asymptomatic mild - to - moderate hyponatraemia is not as innocent as it seems . we shall address these issues later in this article ( section asymptomatic hyponatraemia is not asymptomatic the new concept ) . they infuse hypertonic saline in a patient with acute hyponatraemia who has a seizure , and hypotonic saline in a patient with chronic hyponatraemia whose sna is rising too fast . therefore , it is probably this much larger group of patients with mild - to - moderate chronic hyponatraemia and subtle neurological symptoms who receive suboptimal care . to talk about improving the management of hyponatraemia , we first need to know where we stand at present . three recent studies of hyponatraemia , including in patients with siadh , give a clear albeit worrisome picture . gill and colleagues conducted a prospective case - control study in 104 patients who had a sna < 125 mmol / l . cases had longer hospital stays ( 16 12 versus 13 11 days ) and a higher mortality rate ( 28% versus 9% ) . in terms of underlying diseases , cases more often had pneumonia , alcohol abuse , neurological disease and renal insufficiency , or were on therapies including thiazides , loop diuretics and selective serotonin reuptake inhibitors . half of the cases had a further drop in sna in the course of the hospital treatment . these patients with hospital - aggravated hyponatraemia more often were on diuretics ( 18% versus 2% ) . they also had a higher mortality rate ( 34% versus 16% ) compared to hyponatraemic patients without a further decrease in sna . in some of these cases , iatrogenic factors ( hypotonic intravenous fluids ) or missed diagnoses ( primary adrenal insufficiency ) no plausible explanation for hyponatraemia had been documented in the charts . the study did not report details of any treatment of hyponatraemia , but the average discharge sna was reported to be 131 7 mmol / l , suggesting that hyponatraemia was not corrected fully in a sizeable portion of patients . in a second study , clayton and colleagues performed a retrospective analysis of 108 patients with a sna 125 mmol / l . neurological symptoms , including unsteadiness of gait and falls , were found to be present upon admission in 36% of patients . the majority of patients ( 75.3% ) had a multifactorial cause of hyponatraemia , of which diuretics , congestive heart failure and liver cirrhosis were the most common . the high mortality rate ( 20% during hospital stay , 45% after a follow - up of years ) was mainly ascribed to the severity of the underlying diseases ( usually heart and liver failure ) . serum glucose was ordered in 70% , serum osmolality in 61% , urine osmolality in 47% , urine sodium in 40% , thyroid function in 49% and adrenal function in 15% . none of the 48% of patients in whom siadh was suspected met established diagnostic criteria , usually because insufficient tests were ordered . why these parameters are important in the diagnosis of hyponatraemia and siadh will be discussed in more detail in the next section ( how to diagnose siadh reliably ? ) . mmol / l ) were compared to 36 patients who developed hyponatraemia in the hospital ( sna 133 5 to 122 4 mmol/ l in 7 days ) . neurological symptoms ( e.g. sensorium changes , seizures ) were frequent in all ( in 40% of admission hyponatraemia and in 33% of hospital - acquired hyponatraemia ) . , hyponatraemia was often multifactorial . in patients with hospital - acquired hyponatraemia , the number of factors predisposing to hyponatraemia was increased from 1.7 1.5 to 3.3 1.6 during hospitalization , suggesting that these patients were sicker . the factors included thiazides , surgery , hypotonic intravenous fluids and vasopressin - stimulating drugs . ( 18.2 11.5 days ) , but patients with hospital - acquired hyponatraemia were hospitalized for longer ( 30.7 23.4 days ) . it was also found that hyponatraemia was frequently not documented in the charts ( in 42% of admission hyponatraemia , and in 69% of hospital - acquired hyponatraemia ) . in cases where treatment was given for hospital - acquired hyponatraemia , therapy was delayed . patients who did not receive therapy for hyponatraemia had significantly higher mortality rates ( 37 versus 13% ) . together the diagnostic work - up for patients with hyponatraemia is often insufficient and risking misdiagnosis and subsequent mismanagement . patients whose hyponatraemia develops or worsens in hospital have poorer outcomes , and there is a possibility that hyponatraemia contributed to the outcome . the generally accepted criteria for siadh include a number of essential and supplemental criteria ( table 1 ) . for siadh , but also for hyponatraemia in general , it is important to first establish that one is truly dealing with hypotonic hyponatraemia by finding a low serum tonicity . effective osmolality is the measured osmolality minus serum urea ( and alcohol if present ) . pseudohyponatraemia still exists , even after the introduction of ion - selective electrodes and may occur in the setting of high triglycerides , total protein or cholesterol . hyperglycaemia - induced hyponatraemia ( often mistakenly called pseudohyponatraemia ) is the other condition to consider ( sna drops 3 mmol / l for every 10 mmol / l rise in glycaemia ) . it would be wise to always order serum osmolality and glucose together in patients with hyponatraemia . diagnostic criteria for siadh adapted from schwartz et al . , janicic and verbalis and ellison and berl . during hyponatraemia , a measurable vasopressin level should be interpreted as too high , because under normal circumstances vasopressin should be suppressed . once hypotonic hyponatraemia has been established and the patient has a relatively high urine sodium ( > 40 mmol / l ) and osmolality ( > 100 mosm / kg , but usually > serum osmolality ) siadh should be considered ( tables 1 and 2 ) . euvolaemia is an essential requirement , but the clinical assessment of the extracellular fluid volume has been shown to present frequent difficulty . the assessment of fluid volume status is easy in patients who are frankly hyper- or hypovolaemic . hypovolaemia means extracellular fluid volume contraction and may occur after vomiting , diarrhoea or overly ambitious use of diuretics , for example in essential hypertension . it is characterized by orthostatic hypotension , tachycardia , a flat jugular venous pressure and often a low urinary sodium concentration ( < 10 20 patients with hypervolaemic hyponatraemia usually present with peripheral oedema or ascites , low normal or low blood pressure , and a low urinary sodium concentration ( < 1020 mmol / l in the absence of diuretics ) and typically have a compatible history of congestive heart failure or liver cirrhosis . however , in doubtful cases , we believe that the bedside assessment of the extracellular fluid volume should not be a decisive parameter , as is unfortunately still the case in the majority of clinical diagnostic algorithms . how to diagnose siadh ? according to the criteria ( table 1 ) , diuretic use ( especially thiazides ) , hypothyroidism and adrenal insufficiency should be excluded prior to diagnosing siadh . a recent study indicates that it is possible to diagnose siadh in patients on diuretics ( thiazides or loop diuretics ) . in such a setting the use of the fractional uric acid excretion ( 12% ) was of particular help to the authors in diagnosing siadh and this did not apply in the same manner to the serum uric acid . for calculating the fractional uric acid excretion , uric acid and creatinine should be measured in serum and a spot urine sample , both collected at around the same time . the fractional uric acid excretion is then calculated as ( urine uric acid serum creatinine)/(serum uric acid urine creatinine ) 100 . the relationship between hypothyroidism and hyponatraemia was recently dismissed as an old wives tale . although warner et al . showed a statistical association between hyponatraemia and hypothyroidism ( for every 10 mu / l rise in thyroid - stimulating hormone , sna decreased 0.14 mmol / l ) , the clinical relevance of this association is obviously minute . if the relationship does exist , it probably applies to severe myxoedema in which a low cardiac output and/or a low glomerular filtration rate may contribute to hyponatraemia . although siadh is more common than adrenal insufficiency , the consequences can be grave when adrenal insufficiency is missed . adrenal insufficiency can have an atypical presentation and soule proposed to add addison 's disease to the list of great mimickers in medicine . indeed , we recently reported two patients with primary adrenal insufficiency who had severe hyponatraemia , but no hyperkalaemia , orthostatic hypotension , metabolic acidosis , hypoglycaemia , anaemia or eosinophilia . diagnosed as siadh , and only after fluid restriction and isotonic saline - produced little response , adrenal function tests were carried out . therefore , the response to a high ( 250 g ) or low ( 1 g/1.73 m ) dose of synthetic adrenocorticotropic hormone ( acth ) is a superior test . there should be a low threshold for performing this test in patients with hyponatraemia and a high urine sodium ( > 40 mmol / l ) and osmolality ( > 100 mosm / kg , usually > serum osmolality ) . the measurement of acth is also useful ( high in primary adrenal insufficiency , low in secondary or tertiary adrenal insufficiency ) , but it is usually not available rapidly . in practice , it is often worthwhile to use the response to a common approach is to assess the response in sna to isotonic saline , which should rise in hypovolaemic hyponatraemia . first , isotonic saline may aggravate siadh , especially when the tonicity of the urine is much larger than the infusate . secondly , in hypovolaemic hyponatraemia , sna may rise uncontrollably when the hypovolaemic stimulus for vasopressin release abates . if siadh is established , but its pathophysiology remains unclear and there is little or no response to fluid restriction , a water - loading test could be of use . namely , if > 80% of a water load ( 20 ml / kg ) is excreted within 4 h after administration , a reset osmostat may be present . we recently used this approach to diagnose reset osmostat in a patient with chronic hyponatraemia and dementia with lewy bodies . however , one should be extremely cautious to give a water load in other forms of siadh , because it may aggravate hyponatraemia . the causes of siadh are usually classified into five major categories , including pulmonary disorders , malignancy , central nervous system disorders , drugs and a miscellaneous category , which includes idiopathic , transient and hereditary causes ( table 3 ) . a more physiological classification is based on the level of vasopressin and its response to osmolality ( figure 1 ) . type a is characterized by unregulated secretion of vasopressin , type b by elevated basal secretion of vasopressin despite normal regulation by osmolality , type c by a reset osmostat and type d by undetectable vasopressin levels ( these patients may have a gain of function mutation of the v2-receptor ) . especially for types c and d , the term syndrome of inappropriate antidiuresis may be more appropriate . according to present understanding the shaded area represents the normal response showing a rise in vasopressin secretion with increasing serum sodium concentrations . adapted and reprinted from , copyright 2006 , with permission from elsevier . aids , acquired immunodeficiency syndrome ; avp , arginine vasopressin ; cns , central nervous system ; cva , cerebrovascular accident ; gi , gastrointestinal ; mdma , 3,4-methylenedioxymethamphetamine ; ssri , selective serotonin reuptake inhibitors . in 2006 , renneboog and colleagues published a landmark study on the neurological symptoms in elderly patients with chronic and supposedly asymptomatic hyponatraemia . they conducted a matched case - control study in which 122 patients with chronic hyponatraemia ( sna 126 5 patients with congestive heart failure , liver cirrhosis and nephrotic syndrome as well as patients with acute hyponatraemia ( polydipsia and/or seizures ) were excluded from the study . the pathogenesis of hyponatraemia , as assessed by the response to 2 l of isotonic saline , was siadh ( approximately half of the patients ) , diuretic - induced hyponatraemia and salt depletion . hyponatraemic cases had had falls approximately four times more often than controls ( 21% versus 5% ) . however , they did not have more acute illnesses , chronic conditions , polypharmacy , central nervous system drugs , or vasodilators . surprisingly , the frequency of falls was similar in patients with mild hyponatraemia ( 19% with sna 130132 mmol / l ) compared to those with more severe hyponatraemia ( 22% with sna 115117 mmol / l ) . to analyse the mechanism of the falls , 16 similar elderly patients with hyponatraemia ( sna 128 3 mmol / l ) were subjected to formal neurocognitive testing ( the tandem eyes open test and eight visual and auditory attention tests ) during hyponatraemia and normonatraemia . these tests were also performed in healthy volunteers with and without the consumption of alcohol ( blood alcohol concentration 0.6 0.2 the degree of unsteadiness of the gait ( as measured by a pressure - sensitive calibrated platform ) was significantly greater in patients while hyponatraemic as compared to normonatraemic ( figure 2 ) . with regard to attention tests , both the mean response latency and the total number of errors were significantly greater during hyponatraemia than in normonatraemia . a blood alcohol level of 0.6 g / l induced similar but lesser changes than hyponatraemia . in a follow - up study , it was demonstrated that mild hyponatraemia ( sna 131 3 tandem gait parameters were analysed with a pressure - sensitive calibrated platform that evaluates the patient 's balance performance on the basis of the recorded displacement of the centre of pressure ( i.e. the projection of the centre of gravity on the ground ) . adapted and reprinted from , copyright 2006 , with permission from elsevier . currently , chronic hyponatraemia , which is often due to siadh , is accepted as a possible harmless complication of the underlying disease or treatment . the possibility to relieve subtle but important neurological symptoms by avoidance of hyponatraemia warrants consideration . falls and fractures are a public health concern , and the potential to prevent these could have a great impact on morbidity and mortality . similar reasoning would apply to an increased error rate in these patients ( e.g. being confused about one 's medication , switching the gas off in the kitchen or leaving the door open when going out of the house ) . the good news is that the neurological signs in the renneboog - study were reversible after correction of hyponatraemia . this report demonstrated a phenomenon of nerve conduction slowing , which was present during hyponatraemia and resolved thereafter . the authors speculate that the extracellular sodium concentration plays a role in nerve impulse generation . hyponatraemia would then lead to a lower electrochemical gradient of sodium , and thus to a weaker sodium current during depolarization . when formulating strategies to improve the management of hyponatraemia , a number of common sense options come to mind first . to name a few : better adherence to guidelines , more precise application of the criteria for siadh , better analysis which predisposing factors for hyponatraemia are present , earlier recognition of hospital - acquired hyponatraemia , implementation of hospital warning systems and physician education [ 6,8,1113,19,35 ] . a sound diagnostic approach to hyponatraemia in general is important to identify patients with definite siadh , who may then be suitable for the appropriate treatment . we suggest that currently only siadh patients with chronic hyponatraemia in the range of 120132 mmol / l are to be considered potential candidates for vasopressin - receptor antagonists . mmol / l , whereas sna between 133 and 135 mmol / l is often not reproducible or represents a lab error mortality will probably be a difficult parameter to use , because the highest mortality rates are seen in patients with hyponatraemia due to advanced heart or liver disease and are usually ascribed to the severity of the disease . a complicating factor is that few studies have looked at siadh only the majority studied a mix of hyponatraemic disorders . other outcome parameters of morbidity may be more achievable , including a reduction in the length of hospital stay , neurological improvement and quality of life once fluid restriction has been lifted . this will probably also lead to a change of perspective for physicians , who often see chronic hyponatraemia as benign . physicians should begin to envision a hyponatraemic patient to have a mental status that is like that of a normal person who ingested a considerable amount of alcohol . the fact that attention deficits in patients with hyponatraemia were identified only recently suggests that we generally overlook the mental impairments caused by hyponatraemia in our patients , even though they are clearly important in everyday life . the question remains whether vasopressin - receptor antagonists are superior to the traditional therapies for siadh . this may require head - to - head trials ( for more details , see the next article by zietse et al . ) . our case studies in the final article of this supplement illustrate some of the current challenges of siadh ( van der lubbe et al . ) . most physicians will agree that fluid restriction , the usual treatment for siadh , is cumbersome and stressful for both patient and physician . continuous fluid restriction in patients who have a tendency to develop hyponatraemia due to chronic conditions or lifelong drug therapy is difficult to maintain . in addition , these patients have a permanent risk of worsening hyponatraemia , for example when they do drink more , or when a second insult occurs ( vomiting , diarrhoea , new drug , pneumonia ) . similarly , as was illustrated by the studies on hyponatraemia , hospitalization introduces many factors ( e.g. , pain , nausea , drugs ) that increase vasopressin , some of which are unavoidable . these situations , in combination with the insight that chronic hyponatraemia is not benign , may suggest more stringent indications for treatment of hyponatraemia , including with vasopressin - receptor antagonists . now that the vasopressin - receptor antagonists are out there , it will be interesting to see how popular they will become in the management of hyponatraemia secondary to siadh .

1,4-naphthoquinones like vitamin k , doxorubicin , mitomycin , lapachol , plumbagin [ 5 , 6 ] , and others [ 710 ] are among the examples of this vast class of chemicals used in the treatment of bleeding , lymphoma , carcinoma , and so forth . only one sulfurated naphthoquinone was found in nature , but many were synthesized and proved to be potent inhibitors of staphylococcus aureus , better in vitro antibacterial agents than gentamycin against staphylococcus aureus and markedly in vitro antifungal against cryptococcus neoformans , sporothrix schenckii , and trichophyton mentagrophytes , when compared with fluconazole . furthermore , several thionaphthoquinones have been recently synthesized because of their interesting spectroscopic properties and also as attractive organic dyes due to their high solubility in organic solvents . their red color in the solid state also leads to applications as organic nonlinear optical materials . here , we describe some newly prepared thionaphthoquinones , to be used as additives for interacting with lipids normally present in cell membranes , and their influence on the structural behavior of the lipid matrix . attached to the quinonoid ring of the newly prepared thionaphthoquinones , there is one ( anq / anhq ; scheme 1 ) or two ( banq / banhq ; scheme 1 ) sc16h33 chains , similar to those present in the lipids used . the lipids were selected for having different polarities ( popc , low and pope , high ) in water solution . generally , all chemicals , commercially available , were of pure grade and used without further purification . lipids popc ( 1-palmitoyl-2-oleoyl - sn - glycero-3-phosphocholine ) and pope ( 1-palmitoyl-2-oleoyl - sn - glycero-3-phosphoethanolamine ) were acquired from avanti polar lipids ( alabaster , al , usa ) . to a stirred solution of 1,4-naphthoquinone ( 6.3 mmol ) in etoh ( 50 ml ) , hexadecanethiol ( 12.0 mmol ) was added . after stirring for 1 h at r.t . , a solution of fe(no3)3 ( 5 mmol in 5 ml of water ) was added . the solid was filtered and recrystallized from hexane / etoh ( 20 : 1 ) yielding 76% of yellow crystals ( 4.8 mmol ) ; m.p . 103105c ; h - nmr ( 200 mhz ; cdcl3 ; tms ) : = 0.88 ( t ; 3h ; j = 6.6 hz ) , 1.181.81 ( m ; 28h ) , 2.83 ( t ; 2h ; j = 7.4 hz ) , 6.61 ( s ; 1h ) , 7.29 ( m ; 2h ) , and 8.10 ( m ; 2h ) ; i.r . ( kbr ) : = 1650 , 1669 cm ; elemental analysis ( % ) calculated for c26h38o2s : c 75.3 ; h 9.3 ; found c 75.2 ; h 9.6 . to a stirred solution of anq ( 1.2 mmol ) in etoh ( 2 ml ) , hexadecanethiol ( 1.5 mmol ) was added , followed by et3n ( 3.0 mmol ) . a red solid was obtained in 28% yield ( 0.34 mmol ) , after crystallization from hexane ; m.p . 8385c ; h - nmr ( 200 mhz ; cdcl3 ; tms ) : = 1.151.72 ( m ; 62h ) , 3.29 ( m ; 4h ) , 7.69 ( m ; 2h ) , and 8.05 ( m ; 2h ) ; i.r . ( kbr ) : = 1657 cm ; elemental analysis ( % ) calculated for c42h70o2s2 : c 75.1 ; h 10.5 ; found c 74.9 ; h 10.7 . anq ( 0.30 mmol ) was dissolved in acoh ( 5 ml ; 60% ) and treated with zn ( dust ) until colour fading . water ( 10 ml ) was added and the mixture was extracted with ch2cl2 . the extract was dried ( mgso4 ) and concentrated under vacuum , yielding a white solid ( 0.13 mmol ; 43% ) that becomes yellow when exposed to air . h - nmr ( 200 mhz ; cdcl3 ; tms ) : = 0.841.76 ( m , 31h ) , 2.73 ( t ; 2h ; j = 7.0 hz ) , 6.86 ( s ; 1h ) , 7.54 ( m ; 2h ) , 8.09 ( m ; 1h ) , and 8.20 ( m ; 1h ) . banq ( 0.12 mmol ) was dissolved in a mixture of acetone / ch2cl2 ( 10 ml ; 1 : 1 ) , and , under vigorous stirring , a saturated aqueous solution of na2s2o4 was slowly added until color fading . ch2cl2 ( 10 ml ) was added and the organic layer was separated and dried ( mgso4 ) . after concentration under vacuum , a white solid ( 0.092 mmol ; 77% ) , that becomes red when exposed to air , was obtained . h - nmr ( 200 mhz ; cdcl3 ; tms ) : = 0.752.10 ( m ; 62h ) , 2.82 ( t ; 4h ; j = 7.0 hz ) , 7.57 ( m ; 2h ) , and 8.21 ( m ; 2h ) . samples were prepared by mixing solutions ( in ch2cl2 ) of additive and lipid and producing an homogeneous mixture , prior to removing the solvent under vacuum . after hydration , samples were left at least 5 minutes at each set temperature prior to exposure to the synchrotron radiation . x - rays scattering ( saxs ) measurements were conducted at beamline saxs of lnls , campinas , brazil , equipped with a mar 165 ccd detector , and using a thermostated sample holder . the structural behavior of mixtures was investigated by small - angle x - rays diffraction upon heating samples of different compositions . the peaks positions are related to the interplanar distances , d , of each structure by the relationship q = 2s = 2/d , where q is associated with the scattering angle . the results were grouped according to lipid / additive interaction at variable conditions : molar ratio ( mr ) , ph , and temperature ( t ; in c ) . highly complex diffraction patterns , different from those of fully hydrated pure popc lipid ( inlet in figure 1 ) , are obtained . at temperatures below t = 40 , there is a set of ill - defined broad peaks suggesting the coexistence of multiphases , including two lamellar ones . figure 1 illustrates a series of patterns , for mr = 50 and ph = 4 . at t = 25 , peaks can be attributed to different layered structures q1 = 0.93 and q2 = 1.16 nm ( d1 = 6.79 and d2 = 5.42 nm ) , assigned as lamellar , l , and induced gel phases , respectively , together with the onset peak of the hexagonal phase at q = 1.01 nm ( d = 6.22 nm ) . heating ( 45 < t 70 ) leads to a well - defined hexagonal phase ( d ~ 6.3 nm ) accompanied by several low - intensity broad peaks , at q < 0.9 nm values . for these broad peaks , = 100(ph = 4 ; t = 30 ) , a less well - defined lamellar ( d = 5.94 nm ) and hexagonal ( d = 6.91 nm ) structures , that vanish upon heating , are observed ( figure 2 ) . it is interesting to note that in acidic medium anq induces curvature of the lipid matrix , promoting the formation of hexagonal and cubic phases . however , only at mr = 50 peaks at low q values , related to cubic phases , become present , indicating a stronger interaction between lipid and anq at the head group region of the matrix . comparing the lamellar phases , l , of this system , as the amount of anq increases , the sample shows two small and broad peaks over the whole range of temperatures studied , that is , from 25 t 70 . they can not be related to a single phase and possibly are associated with lamellar microsegregated phases , containing different amounts of anq . at t = 25 therefore , we can infer that the head group interactions are not the dominant factor determining the kind of preferred lattice . in this case , the interactions between the lipid and anq , taking place at the hydrophobic region , prevail over the head group interactions and , therefore , determine the overall structure . in these cases , these mixtures proved to be the most sensitive to variations in mr , ph , and t. figure 3 shows patterns from mr = 100 and ph = 4 . at t = 30 , a well - defined lamellar phase ( d = 5.12 nm ) together with weak peaks related to a hexagonal phase ( d = 6.99 nm ) is observed . the system evolves to more complex structures upon heating that causes a decrease in both lattices and promotes the formation of a cubic phase with onset at t = 60 , compatible with pn3 m ( q ) . for t > 70 , the hexagonal phase is no longer seen and only a minor peak of the lamellar phase remains . for mr = 50(t = 30 ) , only a lamellar phase can be seen with q = 1.18 nm ( d = 5.33 nm ) . slow melting of this phase is completed at t = 65 , while a hexagonal phase , with onset for 40 < t < 50 , shows well - defined and intense peaks up to t = 70 . the lattice parameter of the hexagonal structure decreases upon heating , going from q = 0.98 nm ( d = 6.41 nm ) at t = 50 to q = 1.02 nm ( d = 6.16 nm ) at t = 70 . interestingly , together with the hexagonal phase , one also sees several weak and broad peaks at q 1 that are compatible with a cubic phase , however , of the pm3n group ( q ) . also to be noted is the larger lamellar lattice at higher anq content , as compared to the sample containing less additive ( mr = 100 ; t = 30 ) , probably due to the higher hydration of the quinone carbonyl groups . moreover , the head - group interactions can be partially screened , hindering the formation of the hexagonal phase . changing to basic medium , ph = 9 and mr = 50 , only lamellar structures are seen , but , upon heating , the saxs patterns split into two , giving an inverted y shape to the sequence ( figure 4 ) . , in the waxs region of the scattering patterns of fully hydrated dhpe , where they identified an ordered metastable phase in phosphatidylethanolamine ( y - transition ) , whose splitting was observed at t < 12 upon cooling from the gel phase , with a lattice size of 6.08 nm . prior to the splitting , their waxs patterns showed a peak corresponding to 0.417 nm , characteristic for a hexagonal chain arrangement . although the phase transition is of similar shape , the dimensions observed in the saxs are at least one order of magnitude larger than on waxs . therefore , the y shape must have different origins for each system . in our mixture , at t = 30 , above the l > l phase transition of pure pope , two sets of peaks are observed . they are compatible with microsegregation into lamellar phases , one poor and one rich in anq . the poor one ( d = 5.92 nm ) resembles the l phase of pure hydrated pope ( t = 25 ) but with enhanced thermal sensitivity , considering that anq has a significant hydration shell but not with tightly bound water molecules . moreover , the separation between anq molecules should be significant and , therefore , the interaction weak , making the overall structure prone to non - linear expansion upon t increase . this indicates a liquid - like behavior in the core of each bilayer that forms the lamellar structure . the richer one in anq ( d = 5.76 nm ) , that is more insensitive to thermal variations , can be compared to the gel structure of pure hydrated pope at t < 25 , with tight interactions between lipid and naphthoquinone molecules , and contracts linearly upon heating ( inlet in figure 4 ) . in order to evaluate the influence of increasing hydrophobicity of the additive , we performed measurements with banq ( scheme 1 ) . for popc / banq ( mr = 100 ; ph = 4 ) , at room temperature , a lamellar lattice is observed ( d = 5.43 nm ) , decreasing to d = 5.24 nm , at t = 50 . for mr = 50 ( figure 5 ) , low - definition patterns made difficult unequivocal indexing , but at t = 25 , multiphases are seen and at least a lamellar structure ( d = 7.00 nm ) is identified . at ph = 9 , the mixture shows very similar patterns but with an expanded lamellar structure ( d = 7.55 mm ) . it becomes evident that the second - sc16h33 chain in banq alters the interactions between the popc layers , leading to the formation of structures with limited long - range order in their lattices . for these samples , a much more complex behavior is shown as compared to popc , producing systems with a higher degree of organization , illustrating the effect of such additives in promoting the formation of structures with higher surface curvature . for mr = 100(ph = 4 ) , a clear lamellar phase at t = 30(d = 5.55 nm ) , and a hexagonal phase at t > 60(d = 6.44 nm ) can be seen . for t > 60 , weak and broad peaks at smaller q values are associated with a cubic structure , probably p4332 ( q ) , which has been observed in a previous study using additives of similar structure . in the case of mr = 50 and t = 25 ( figure 6 ) , a well - defined lamellar structure ( d = 5.24 nm ) is seen together with traces of a hexagonal phase ( d = 7.00 nm ) . heating causes the lamellar phase to melt , and the hexagonal phase prevails for > 40(d = 5.96 nm ) . very interesting is the observation that the cubic phase is suppressed and only the extinction of the lamellar structure for t > 40 is observed . at ph = 9 , the y shape sequence of patterns mentioned before ( for pope / anq , mr = 100 ; ph = 9 ) is again observed . heating ( 25 < t < 60 ) causes the initially single broad diffraction peak , observed at d = 5.91 nm , to split into two ; one of them moves slightly towards larger q values while the second one decreases its position linearly ( d = 5.40 and 9.02 nm at t = 60 , resp . ) . for t < 35 , second - order peaks the smaller structure is almost identical to the one observed using anq as additive to the lipid matrix ( inlet in figure 4 ) , thus supporting the assignment that it is a pope - rich structure . for the equivalent reduced forms of naphthoquinones anq and banq , mixtures of anhq and banhq , with the same lipids , lead to results following a common trend , that is , destabilizing the lipid bilayer , mostly by inducing curvature . these additives have not necessarily the same chemical stability of the naphthoquinones equivalents , and we can not exclude the possibility of a small degree of oxidation , due to the combination of factors such as ph , variation of temperature , and exposure to strong x - rays radiation . the overall characteristic of this group of samples is the low definition of the scattering patterns , showing very broad and weak signals that can not be assigned to a unique structure . a mixture of mr = 50 , at ph = 4 , provides the temperature scan seen in figure 7 . it is composed of complex patterns that indicate the coexistence of different structures , which can be attributed to phases containing different amounts of anhq incorporated into the lipid matrix . this is supported by the observation of an additional small diffraction peak ( q = 1.58 nm , d = 3.98 nm ) related to a cluster of insoluble anhq . increasing mr to 100 , at ph = 4 , leads to similar scattering patterns , with even lower resolution , precluding structural identification , with no indication of insoluble anhq in the sample . changing to ph = 9 , the mixture of mr = 50 shows a thermal scattering profile similar to the ones observed at ph = 4 , but with lower resolution . a large lamellar structure can be identified at low temperature d = 7.48 nm at t = 25 . the signal associated with this phase shows also a broad profile extending to lower q values . for t > 40 , the intensity of the peaks decreases significantly leading to profiles of no conclusive structure , indicating a melting of the structures , reflecting a weaker interaction between the components of the mixture . a very weak signal associated with insoluble anhq is observed at t < 40 . the mixture pope / anhq at ph = 4 and mr = 50 shows , at t = 25 , two phases consisting of a well - defined lamellar ( d = 5.32 nm ) containing traces of hexagonal ( figure 8) . above t = 45 , only a single hexagonal structure can be detected , slightly decreasing its lattice upon heating ( d = 6.21 nm at t = 65 ) . the lamellae in this system have a smaller lattice than the pope / anq mixture at the same conditions ( d = 5.93 nm ) , while in the hexagonal phase ( e.g. , at t = 60 ) are equivalent . increasing mr to 100 , at the same ph , a similar sequence of patterns and an increased phase transition temperature are shown . we observe a larger lamellar lattice with well - defined first- and second - order diffraction peaks ( q = 1.15 nm , d = 5.46 nm at t = 25 ) and above t = 50 a hexagonal structure of similar dimensions as for mr = 50 ( q = 1.02 nm , d = 6.28 nm at t = 65 ) . heating causes shifting of the peaks from the lamellar structure towards larger q values , indicating contraction of this phase while the peak , attributed to insoluble anhq ( q = 1.58 nm , d = 3.97 nm ) , remains at a constant position until it vanishes above t = 60 , coinciding with the onset of the hexagonal phase ( figure 9 ) . at t = 75 , smaller s - value peaks , of low intensity and resolution , can be attributed to a pn3 m cubic phase that grows epitaxially with the hexagonal phase . at this temperature , lamellar , hexagonal , and cubic phases coexist , despite of the much higher intensity of the hexagonal one . this is a clear illustration that the system has slow dynamics for its phase transitions , which suggests strong interactions between the lipid and additive molecules under these conditions . in basic conditions , ph = 9 and mr = 50 , the mixture shows further changes . again the y shape sequence of diffraction patterns is observed , evolving from a lamellar phase with two diffraction orders at t = 25 , whose lattice has q = 1.08 nm , and d = 5.82 nm . as the temperature increases , the peaks shift and their intensities decrease . the peak moving towards larger q values do it linearly , while the one shifting towards smaller qs moves exponentially , evidencing that the corresponding phase is very temperature sensitive . the scan sequence is very similar to the one shown in figure 4 , with the difference that , at t > 45 , other peaks at q < 0.5 nm , of rather weak intensity , that can be seen in the vicinity of the beam stop , are shifting towards smaller q values as the temperature increases . no conclusive structure can be assigned to them , apart from learning that they correspond to an unusually large lattice ( figure 10 ) . however , this suggests very weak interactions destabilizing long - range order in the system . for the sample of mr = 100 , at ph = 4 , two broad signals q = 0.89 and 1.04 nm that drift to larger q values as the temperature is raised , are observed while simultaneous broadening occurs . they most likely arise from lamellar structures , but their profile is not sufficient to allow for a conclusive assignment . in this system , the mixtures show clearly identifiable structures , indicating much stronger interactions between their components . for the mixture of mr = 50 at ph = 4 , we identify a lamellar phase at t = 25 , with lattice parameter d = 5.32 nm . heating leads to the transition to hexagonal phase above t = 35 , with the first peak at q = 0.99 nm , d = 6.35 nm , at this temperature . however , above t = 50 , weak and broad peaks are seen at q < 0.94 nm that , although can be compatible with a cubic phase , do not have enough resolution to allow for unequivocal structure identification . changing to mr = 100 , at ph = 4 , we observe a similar sequence of structures ( figure 11 ) . we note the absence of signals at low q at high temperatures . moreover , the lamellar phase coexists with the hexagonal one even at higher temperature . the peak that characterizes the hexagonal phase splits into two that shift to larger qs as the temperature increases . although we do not explain such splitting , we speculate on inhomogeneous distribution of banhq among the rods , leading to lattices of slightly different dimensions . the mixture pope / banhq ( mr = 50 ; ph = 9 ) shows patterns containing only two small and broad signals that shift to larger qs as the temperature increases . at t = 25 , we observe a signal at q = 0.65 nm , d = 9.62 nm and q = 1.05 nm , d = 5.98 nm that , due to their corresponding dimensions , can be speculatively assigned to cubic and lamellar phases , respectively . previous results obtained with similar mixtures of the same lipids with both 2-hexadecylthio-3,6-dimethylbenzene-1,4,diol ( 2,5-ath ) and 2,6-bis(hexadecylthio-3,5-dimethylbenzene-1,4,diol ) ( 2,6-bath ) show small but interesting differences on the overall structures organization , or phases formed . in a qualitative way , the differences between 2,5-ath and 2,6-bath and the additives employed in this work are as follows : the extra aromatic ring present on the quinone ring of anq , anhq , banq , and banhq;the relative position of the second hydrophobic chain ; using a classical nomenclature : meta for bath and ortho in banq;the higher oxidation degree of quinones anq and banq employed in this work as compared to hydroquinones 2,5-ath and 2,6-bath . the extra aromatic ring present on the quinone ring of anq , anhq , banq , and banhq ; the relative position of the second hydrophobic chain ; using a classical nomenclature : meta for bath and ortho in banq ; the higher oxidation degree of quinones anq and banq employed in this work as compared to hydroquinones 2,5-ath and 2,6-bath . the overall observation about the influence of all these additives over the lipid matrices is that they do modify them in a similar way , that is , promoting curvature and therefore destabilizing the lipid bilayer . these effects can be inferred from the observation that our mixtures form structures that contain a high degree of curvature in their mesogenic units , for example , hexagonal and cubic phases . it should be noted that fully hydrated popc does not show such phases over the temperature range studied . the phase transition from lamellar l to hexagonal phase in pope - based mixtures , containing any of these additives , takes place at significantly lower temperatures . finally , it is noteworthy to mention that the peaks on saxs patterns show low resolution , indicating that the additives studied here generally promote structures with much shorter long - range order . sulfurated naphthoquinones anq or banq alter the phospholipid bilayer significantly , due to strong interactions between both entities depending , more or less on the effective polarity of the lipid head group . in acidic conditions ( ph = 4 ) , popc forms , at low temperature , a structure compatible with a gel phase that , upon heating , induces curvature as seen by the formation of hexagonal and cubic phases . pope - based mixtures form different cubic structures . in basic medium ( ph = 9 ) and lower mr , microsegregation and tendency towards lamellae supersede the promotion of curvature in pope . in this case , the interactions at the region of the head - groups give place to others in the hydrophobic core that become strong enough to determine the structural behavior . the scattering patterns showing complex mixtures of phases , cubic in most cases , present limited resolution disabling us to assign a set of diffraction peaks to a unique structure . therefore , we conclude that the overall balance of interactions between the components of these mixtures is not strong , leading to structures containing only limited long - range order .

the benefits of exercise have been widely recognized , indeed the physical activity is reported as the better nonpharmacological treatment for cardiovascular , metabolic , and bone diseases [ 1 , 2 ] . however , for long time , the molecular mechanisms by which exercise exerts its healthful effects remained mostly unknown . a successful deal for researchers and clinicians should be to reveal these mechanisms , encouraging practicing physical activity and promoting the development of exercise - mimetic drugs . recently , several lines of evidence are suggesting that skeletal muscle is crucial in the regulation of energy homeostasis . therefore , the skeletal muscle is now considered an endocrine organ that secretes a number of myokines including the newly identified irisin . in this work , bostrm and colleagues have reported that physical exercise activity induces an increase of the transcriptional regulator peroxisome proliferator - activated receptor- coactivator 1 ( pgc-1 ) in the skeletal muscle , which in turn drives the production of the membrane protein fibronectin type iii domain - containing protein 5 ( fndc5 ) . this is subsequently cleaved as the myokine irisin , which acts on white adipose tissue ( wat ) , stimulating uncoupling protein 1 ( ucp1 ) expression , one of the master genes of brown adipose tissue ( bat ) , and activating the browning response . the authors showed that , after 3 weeks of free wheel running , plasma irisin levels in mice were increased by 65% and , in healthy humans , plasma irisin levels were found to double after 10 weeks of endurance exercise . these results opened new frontiers for searching the involvement of irisin in a broader network , suggesting the intriguing feasibility that this myokine might represent an endocrine molecule that could target other organs besides the adipose tissue . indeed , the hypothesis that muscle supports bone mass is confirmed by studies of microgravity and bed rest , as well as results showing the associated development of sarcopenia and osteoporosis at the same time . for instance , the exercise strengthens bones , given the evidence that tennis players develop high bone mass in the playing arm compared to the nonplaying arm . on the other hand , the absence of physical exercise or , even worse , the complete disuse of muscles , ensuing by severe pathological conditions , leads to a likewise severe bone loss . for instance , child growing with congenital neuromuscular diseases develop fragile long bones with reduced periosteal circumference . furthermore , long bones in a paralyzed limb do not achieve their normal ossification and show delay of mineralization in newly laid - down bone matrix . consequently , this paralytic phenotype , associated with decreased bone mass , is prone to severe fractures as frequently occurs in progressive disease such as spina bifida . moreover , the propensity of sarcopenic patients to falls can often degenerate into an osteoporotic hip fracture . this event may reduce the life expectancy of up to two years and this corresponds to increased mortality of 2025% in the first year after the fracture . for this reason , the onset of simultaneous sarcopenia and osteoporosis , also described as the hazardous duet , has been defined as one of the most devastating threats during old age . although this tight relationship between skeletal muscle and bone is well recognized , it has hitherto been mainly explained concerning mechanical loading , as overall effect . therefore , the description of bone response to mechanical load is currently defined as the ability of bone cells to perceive paracrine signals produced by mechanical stimulus . hence , it could be extremely useful to deepen the understanding of the molecular mechanism involved , revealing the identity of all these signalling - paracrine molecules able to affect bone metabolism . for this reason , we propose a model where exercise induces muscle to release myokines , which regulate mechanotransduction in bone , basing on the physical proximity of these two tissues . noteworthy , we postulated that the protective effect of muscles on bone could be dependent on the paracrine action of the myokine irisin . to validate the potential role of irisin on bone metabolism , we investigated whether irisin targets bone cells directly , demonstrating its ability to increase the differentiation of bone marrow stromal cells into mature osteoblasts . the relevance of these findings opens new frontiers in searching the irisin mechanism of action on bone metabolism . the in vivo data , confidently obtained in future , could further correlate the well - known beneficial effects of physical exercise with bone recovery and improvements . antibody anti - fndc5 ( irisin cleaved form ) was from abcam ; antibody anti - collagen i and -actin were from santa cruz , antibody anti- -tubulin was from origene technologies . ascorbic acid , b - glicerophosphate and alkaline phosphatase ( alp ) staining kit were from sigma aldrich . primers for qpcr are alp / s - aaacccagacacaagcattcc ; alp / as - tccaccagcaagaagaagcc ; coll i / s - ggctcctgctcctcttag ; coll i / as - acagtccagttcttcattgc . 2-month - old c57bl/6 male mice were subjected to 3 weeks of rest activity or free wheel running activity , as described previously . the rest activity was performed isolating each mouse in one cage , in order to avoid their tendency to fight with cage mates , preventing any exercise - mimetic activity . the wheel mice were individually housed , in order to avoid that the dominant mouse in the cage inhibited other mice in the free use of wheel . primary myoblasts were obtained from digestion of vastus lateralis specimens with a solution of trypsin , collagenase , and cacl2 . the isolated cells were preplated on an uncoated petri dish for 1 hour to remove fibroblasts and then transferred on tissue culture plate and cultured with -mem/10% fcs . cells were then cultured for 14 days until multinucleated , spontaneously contracting myotubes were formed . then , cm were purified by centrifugation at 13 k rmp to eliminate debris . bone marrow stromal cells , obtained by flushing bone marrow of 2-month - old c57bl/6 mice , were cultured to induce osteoblast differentiation with -mem/5% fcs in the presence of 50 g / ml ascorbic acid and 10 m -glycerophosphate or with 1/2 cm from primary myoblast + 1/2-mem/10% fcs in the presence of 50 g / ml ascorbic acid and 10 m -glycerophosphate . qpcr was carried out after rna extraction using spin columns ( rnasy , qiagen ) according to the manufacturer 's instruction . by using superscript first - strand synthesis system kit ( invitrogen ) , the resulting cdna ( 20 ng ) was subjected to quantitative pcr and , thereafter , to itaq sybr green supermix with rox kit ( bio - rad ) on an icycler iq5 cromo4 ( biorad ) . each transcript was assayed 3 times , and cdna was normalized to murine gapdh , 18s or -actin and quantitative measures were obtained using the ct method . analyses were performed using unpaired student 's t - tests ( excel ) for significant differences at p < 0.05 . protein amounts from all samples were assessed using the bca - kit ( biorad ) followed by protein concentration normalization before all western blot experiments . the blots were probed using primary antibodies , described in materials section , and irdye - labeled secondary antibodies ( 680/800 cw ) ( li - cor biosciences ) . for immunodetection , therefore , we confirmed the effects of exercise on fndc5 expression in our exercise regimen , based on 3 weeks of voluntary free wheel running . by qpcr analysis , we detected a 2-fold increase in fndc5 mrna of wheel myoblasts ( figure 1(a ) ) . this result was confirmed by the analysis of fndc5/irisin protein expression ( figure 1(b ) ) . indeed , we were able to detect a stronger band , corresponding to fndc5/irisin , in cell lysates of myoblasts from wheel mice compared with those from rest mice ( figure 1(b ) ) . these data are , according to previous observations , showing an increase of about 65% in muscle of mice subjected to three weeks of voluntary exercise . it should be further noted that fndc5/irisin is slightly detectable also in rest myoblasts , suggesting a constitutive expression of this myokine even in nonexercised state that might be related to a basal metabolism . in the last years , accumulating evidences have shown that skeletal muscle release hormone - like substances . . our model of primary murine skeletal muscle cells allowed us to recapitulate in vitro what occurs in vivo when muscle is subjected to exercise and releases these circulating myokines . the conditioned medium ( cm ) collected from these myoblasts , which likely contained several released myokines , was used to evaluate its ability in regulating maturation of undifferentiated bone marrow stromal cells toward osteoblast differentiation . our result shows that the cm obtained from wheel myoblasts increased by 2.5-fold the number of alkaline phosphatase ( alp ) positive colonies compared to control medium ( figure 2 ) . this assay , based on a histochemical staining for alp , is the first evidence of osteoblast differentiation , since the alp enzyme is established as the osteoblastogenesis relevant marker . the result suggests , for the first time , that muscles could exert a direct anabolic effect on osteoblasts through the paracrine action of released myokines , rather than the solely mechanotransduction action on osteocytes , the mechanosensor cells of bone . given the ability of cm from wheel myoblasts to enhance osteoblast differentiation , we investigated which bone proteins were upregulated . by qpcr analysis , we demonstrated that osteoblasts treated for 3 days with cm from wheel myoblasts have an increased expression of alp and collagen i mrna ( figure 3 ) . these data , further confirming the previously shown increased number of alp positive colonies ( figure 2 ) , is supported by an enhanced expression of alp mrna , the marker gene of osteoblasts . moreover , the upregulation of collagen i , the most abundant bone protein , greatly corroborates the beneficial effect on osteoblasts exerted by molecules released from the exercised muscle . subsequently , our effort has been to obtain evidence about the involved myokine , present in cm , responsible for such a great effect on osteoblast differentiation . given the increased expression of fndc5/irisin seen in myoblasts from wheel mice ( figures 1(a ) and 1(b ) ) , we choose irisin as candidate myokine . for this challenge , we cultured osteoblasts with cm from myoblasts in presence of a neutralizing antibody direct against irisin . we showed that the increase in collagen i and alp was completely reversed by neutralizing irisin in wheel cm used to treat osteoblasts ( figures 4(a ) and 4(b ) ) . this finding demonstrated that the enhanced osteoblastogenesis , induced by exercised muscle , is irisin - dependent . it should be noted that the molecular weight of the secreted form of fndc5/irisin has remained for long time controversial . now it is well ascertained that the sequence of mouse fndc5 is cleaved from aa 29 to aa 151 to give its released form , as irisin . being aware of this , we used an anti - fndc5/irisin antibody ( amino acids 50150 from abcam ) directed against the predicted irisin cleaved form . bostrm and colleagues have recently reported that physical exercise activity induces the release , from skeletal muscle to bloodstream , of the myokine irisin which was so called ( from iris , the messenger goddess ) to highlight its role as positive messenger which targets an endocrine signal from skeletal muscle to adipose tissue ( wat ) . irisin induces browning of wat ( i.e. , conversion from wat to bat ) , that is a well - known new avenue for its great therapeutic potential in diabetes and obesity . in the present study , we show that mature exercised primary myoblasts and myotubes secrete factor(s ) , which increase osteoblast differentiation in vitro . we also establish that this enhanced osteoblastogenesis , induced by exercised muscle , is mediated through irisin . these results presented here add new insights in the complex relationship between muscle and bone tissue , indeed the mechanical influence of skeletal muscle on bone has long been documented but the molecular mechanisms involved remain still poorly understood . skeletal muscle and bone are tightly connected : they have a common origin , share the same integrated system that provides shape and physical function , and display significant changes across the lifespan . in elderly , the severe decline of skeletal muscle function , known as sarcopenia , is associated with impaired function of bone ( osteopenia ) . these two simultaneous losses of function lead to increased risk of falls and bone fractures . therefore , developing a better understanding of the complex relationship between these important components of the musculoskeletal system may reveal new strategies for early identification , prevention , and treatment of sarcopenia and osteopenia , as well as their consequences [ 2 , 8 , 17 , 18 ] . currently , the most effective measure to counteract both diseases is exercise , but not all patients can perform a physical exercise program ; thus , our evidence that exercise - induced irisin could account for this effect greatly improves the chances of achieving this goal . we show here that irisin directly targets osteoblasts , enhancing their differentiation in vitro , proving that myokines , produced by exercised muscle , might be among the molecules regulating mechanotransduction in bone . in our system , mice subjected to three weeks of voluntary exercise showed an increased expression of irisin / fndc5 in skeletal muscles . this result confirms previously published data demonstrating that endurance exercise training for 10 weeks increased plasma irisin levels in healthy adult . conversely , timmons et al . were not able to confirm fndc5 gene activation by aerobic exercise in younger subjects . these discrepancies have been explained by another study , which demonstrated that irisin levels increase only when more energy is needed , such as in circumstances where atp concentration in muscle is strongly decreased . moreover , we achieved evidence that conditioned medium from primary culture of myoblasts and myotubes , obtained from exercised muscles , were able to enhance the number of alkaline phosphatase ( alp ) positive colonies in culture of undifferentiated bone marrow stromal cells . noteworthy , this is the first study showing the osteogenic potential of irisin released from exercised skeletal muscle . from a physiological point of view , this result adds another explanation of the tightly connection between muscle and bone , which share a common fate even in positive scenarios , like in this concomitant gain of mass . the effects of physical exercise are systemic and , obviously , can not be solely related to the energy expenditure in muscle . reported a new mechanism that explains how the total body energy expenditure is increased by muscle activity , elucidating the molecular circuit triggered by exercised muscle . analysis of subcutaneous fat tissue depots , in mice overexpressing the muscle - specific pgc-1 , revealed that white adipocytes displayed signatures of brown fat cells . delineating muscle genes activated by pgc-1 , authors identified the myokine irisin , able to drive the white - to - brown adipocyte transdifferentiation [ 3 , 22 ] . by considering the tight relationship between skeletal metabolism and energy homeostasis , clinical and experimental results are giving great importance to the role of bat on bone metabolism . due to the evidence that an inducible form of bat exists during adulthood and given the importance of its ability to dissipate the stored energy with thermogenesis [ 2326 ] , bat induction is becoming a significant promise for the treatment of obesity and metabolic syndrome . a cross - sectional study , carried on 15 young women , has shown a positive correlation between the amount of bat and bone mineral density ( bmd ) . data derived from experimental mice model showed that , foxc2(ad)(+/tg ) mice , overexpressing foxc2 as well - established model for induction of bat have high bone mass due to increased bone formation associated with high bone turnover . on the contrary , mice named misty ( m / m ) , carrying a very low amount of bat , albeit partially functional , have accelerated age - related trabecular bone loss and impaired brown fat function , such as reduced temperature and lower expression of pgc-1 . this growing body of evidences suggests a functional fat - bone axis , but the discovery of irisin , together with our new findings , add a new protagonist to this axis , allowing enlarging it as the muscle - fat - bone axis ( figure 5 ) . based on the scenario described , in which both muscle and bat affect bone metabolism , it might be questioning whether the effect of physical activity on the skeleton could also be mediated by bat , which in turn has been affected by irisin . this would imply double , direct and indirect , irisin action on bone in vivo . in our hands the irisin - dependent action on osteoblasts is further supported by the increase of alp and collagen i expression , observed in osteoblasts cultured in the presence of cm from muscle cells of wheel mice . the irisin involvement was proved by the fact that the cm - induced upregulation of alp and collagen i was abolished when cells were treated with cm containing anti - irisin antibody . this suggests that irisin does not target only adipocytes but also other body compartments , according to recent data demonstrating that irisin could play a role in the central nervous system . in this context , recent studies revealed that cerebellar purkinje cells of rat and mice express irisin , which is also required for the proper neural differentiation of mouse embryonic stem cells . hence , given that physical activity improves neurogenesis , by reducing risk of neurodegenerative diseases such as alzheimer and parkinson [ 33 , 34 ] , irisin could represent the molecular link between exercise and healthy brain . in conclusion , we showed a novel role of irisin , adding new evidence to the complex muscle - fat - bone axis ( figure 5 ) . this seems remarkably promising , considering the aforementioned tight relationships between skeletal muscle and bone . our future efforts will focus on a deepen analysis of the molecular signalling triggered by its action and , in particular , on the overall effect of irisin in the bone context . moreover , the characterization of its receptor will allow a more clear understanding of irisin - induced signalling . in this respect , we would also elucidate whether this myokine affects osteoclasts , the bone resorbing cells . this might better explain the global regulation of skeletal homeostasis exerted by physical exercise or , conversely , by lack of mechanical loading . future studies could reveal whether expectations on the potential role of irisin as pharmacological treatment will be confirmed . hopefully , with regard to the skeleton , irisin could represent a new anabolic therapy to gain bone mass in osteopenia caused by muscle - disabling diseases , such as sarcopenia , tumor - associated cachexia , neuromuscular disease , or situations with forced lack of mechanical loading , such as absence of gravity which astronauts undergo .

integration of ayurveda with biomedicine has been a contentious issue since the colonial period when biomedicine was first introduced in the indian subcontinent . this paper argues that the idea of integrative medicine is problematic and spells out what the problems are . pure ayurveda or an attempt to resist change , but it is about the direction of change . the notion of integrative medicine has come up several times earlier and is not new ; besides there is already considerable integration of biomedicine into ayurveda today . accepting that ayurvedic knowledge should be strengthened by new approaches and improved diagnostic and curative ability , this paper advocates selective assimilation under medical pluralism rather than integrative medicine . in the following sections we address some of the issues in this regard . the transformation of ayurveda in the past two centuries may be understood in terms of three phases : one spearheaded by vaidyas till the 1950s , the second ushered by the government of independent india , and lately , the third phase lead by biotech pharmaceuticals and commercial lobbies in the global health care industry . the early interventions in ayurveda in the 19 century were largely institutional and were brought about by the vaidya community in order to strengthen their system against the colonial policy of promoting western medicine . ayurvedic education moved from guru shishya relation to the college as an institution ; medicinal production shifted from the household of the vaidya to bulk production . historical evidence points to the fact that during the cholera epidemic of early 20 century , ayurveda vaidyas and hakims successfully treated patients in different regions without forced mass quarantine . there was keen interest on studying how ayurveda could address contemporary health problems and compete with allopathy on its own terms , rather than adopt biomedical terminologies and methods of verification . in the 1960s and 1970s in post independent india , the issue of integration was raised repeatedly when curricular change in traditional medicine was attempted . there was a huge demand for biomedical subjects in ayurveda courses from middle - class , urban students who were now entering ayurveda[i ] . familiarity with anatomy , nosology , etiology therapy , and biomedical pharmacology was necessary for ayurveda to be able to coexist with biomedicine in the public institutions and the extent of biomedical subjects in ayurvedic courses varied from 50% to 75% in the regional colleges . a large section of the urban entrants to ayurveda degree courses saw it as a backdoor entry into the modern medical profession . research in government ayurveda institutions almost exclusively followed the laboratory protocols . despite these changes , the integrity of ayurveda practiced by traditional vaidyas and hakims was not seriously threatened as testified by anthropological studies till the 1990s.[612 ] in fact , in the private sector , people preferred vaidyas with a family tradition in medicine rather than a degree holder without the backing of tradition ; the numbers of non institutional ism practitioners was growing till the 1990s after which it is trailing . the third phase in the trajectory of modern ayurveda , however , is a cause for worry because of developments that seem to dismantle ayurveda systemically . in the past few decades there is a boom in the number of ayurveda colleges such that in the 20-year period from 1980 to 2000 , 186 private ayurveda colleges have mushroomed , producing about 20,000 graduates in total per year ( only 10,000 less than biomedicine ) . this spurt in numbers , however , is not necessarily the outcome of strengthening of ayurvedic medicine , rather of the growth in the employment potential of ayurveda graduates in delivering allopathic services on ad hoc appointments in the private and government sector[ii ] . it is found that 20% of bams graduates take hospital jobs , 10% go into private practice of ayurveda , and 70% practice allopathic medicine . a grey area in which there is no specification of the extent to which ayurvedic practitioners may practice biomedicine has been created ; what is worse is that this is endorsed by the state governments[iii ] , which are desperate to get some medical professionals to work in postings that biomedical professionals avoid . the history of biomedicine in the nineteenth century , shows that there were foundational debates between professionals supporting social medicine which stressed on improvements in nutrition , housing and sanitation as crucial health status and those favoring clinical medicine , or , which highlighted the importance of drugs and surgical procedures[iv ] . in 18 and 19 century india , vaids and hakims engaged in fierce debates with allopaths and administrators on public health issues and this was a crucial reason for the survival of indigenous systems of medicine . but there is no debate in the ism sector today ; ayurveda graduates are uncritically inducted into the existing system . under these circumstances , the call for integrative medicine in the past decade is a response to the process of globalization in which the changes are neither commanded by the vaidyas nor by the government , but by the global market forces for herbal products in which the ayurvedic professionals and the government[v ] will play a compliant role.[1418 ] there is a huge growth in the export of ayurvedic medicines in the past 10 years and this is expected to grow with the burgeoning demand for herbal products worldwide . subsidies for the export of raw herbs , digitalization of plant resources , standardization of ayurvedic formulas , and integrative research on herbal ingredients are all measures meant to enhance the safety of herbal drugs for the western consumers ; they have little to do with indian consumers for whom accessibility and availability is the criterion . the adverse impact of integrative pharmaceutical research and standardization is that it involves dismantling of ayurvedic formulas into few active ingredients that will be fashioned into herbal products and neutraceuticals . they become hugely profitable when sold as over - the - counter products . there is hence a gradual appropriation of classical formulations to create general natural products for the health market and pharmaceutical research of this kind does not contribute to ayurveda as a system of medicine . this is because in integrative research its concepts , terminology , theories , formulas , and diagnostic techniques are all transformed . such a conflation of objects of enquiry and methods of verification under integrative medicine without strengthening of ayurvedic education and protocols could lead to the erosion of ayurveda . in philosophy of science , a knowledge system is characterized by 4 core features : objects of enquiry , norms of verification , conceptual architecture , and strategies of delineating its themes of study . objects of enquiry are entities or group of elements that a knowledge system defines singularly according to specified rules and analyzes them consistently within a commonly accepted conceptual framework . the doshas , dhatus , and malas are thus some of the objects of analysis in the ayurvedic approach to the body . norms of verification refer to the accepted manner of making statements and substantiating them , either experimentally or theoretically . in the case of clinical medicine , observation and interrogation of the patient , conducting tests and deciphering them , recording the results and taking decisions , all constitute the basis of statements made . conceptual architecture refers to the consistent use of well - defined concepts within a community of experts . the articulation of stable rules by which certain themes of study or research questions are included within the body of knowledge is the fourth characteristic . all the 4 features have to be mutually consistent and governed by a standard body of rules for all statements made , for them to be regarded as a valid body of knowledge . lack of consistency in the objects analyzed , incompatible modes of verification and prevalence of multiple conceptual frameworks are markers of incoherence and lack of rigor . such discourses may even be termed as pseudosciences because the criterion of science does not lie in randomized controlled trials ( rcts ) per se , but the prevalence of internally consistent and rigorous rules of defining objects of study and methods of studying them among a community of experts . if we examine the situation of contemporary ayurveda in terms of these features , we find that there is no disciplinary boundary or stability in its rules of verification . the objects of ayurvedic research are not always the doshas , dhatus , and mala , but biomedical disease categories . there is no doubt that the training in biomedical sciences as part of their curriculum enables ayurvedic physicians to see measurable parameters of the doshas or of the physiology of drug action . a physician could learn another system of medicine and it is like learning more than one language ; in the sense that one could be bilingual . for instance , the pharmacologist researcher dahanukar commissioned a study to understand the concept of rasayana . her question was , how was it possible for one plant , with its usual array of photochemicals , to produce such a variety of effects like delaying ageing , improving mental functions and giving freedom from several diseases including those caused by infection ? so she carried out a study to clarify the principles behind the multiple actions of a single herb in rasayana therapy ; the herbal preparations based on the texts were examined on animal and human subjects under controlled laboratory conditions . the report reads like this : the outcome of these experiments was that we could demonstrate that rasayanas increase nonspecific resistance against stressors by activating res and the other components of the immune system nonspecifically ; we could also document that those rasayanas which have madhura vipaka were immunostimulants , those having katu vipaka were not . besides the resultant drug preparation , was found to be effective in reducing the mortality rates and the incidence of infections for tuberculosis and obstructive jaundice during clinical evaluation . in dahanukar 's view , this kind of bilingualism and the use of controlled trials endorse and explain what is already stated in classical ayurvedic texts . similar observations have been made in the case of traditional chinese medicine ( tcm ) as well . for example , some chronic bronchitis , bronchial asthma , hydronephrosis , recessive addison 's disease patients may all be diagnosed as experiencing insufficiency of the kidney. kidney insufficiency can be treated utilizing the principle of nourishing the kidney while warming up yang , often with very satisfactory results . laboratory examinations have shown that these patients diagnosed so differently in western medicine reveal a common defect , that is , low excretion of 17-hydroxi - corticosteroid , indicating hypofunction of the adrenal cortex . however , the treatment principle mentioned above , when administered , returns adrenal function to a normal level and cures these patients of their various diseases with one common principle . studies like this find that laboratory trials corroborate the statements given in classical medical texts . it is hence said that the application of biomedical norms of verification and concepts as a reference point improves the understanding of the tcm practitioner . but while this kind of bilingualism could be one of the several ways of learning at the level of individual researcher , it certainly can not be the approach of an entire system of medicine . invoking kuhn 's model of language again , it is possible for someone to learn and speak more than one language , like the ayurvedic professional today who speaks ayurvedic and biochemical language . grounded in one language , it is also possible to translate , compare and assimilate from another into one 's own . for instance , in the first medical colleges of 19 century , allopathy was taught through vernacular medium and medical textbooks in some regional languages were written . similarly , regional and sanskritic medical texts have been translated to english to facilitate collegiate education in ayurveda . there is common / neutral language into which two theories of the body , ayurvedic and biomedical , conceived of as sets of sentences may be translated without major loss to one . that is , while it may be possible to assimilate requisite inputs from another system as and when needed , the idea of integrative medicine is an anomaly , especially when the 4 core features of ayurveda and biomedicine are radically different . but integrative medicine creates a condition in which ayurveda has to live by translation alone ; we know that a language can not sustain only on translation . further integrative medicine involves not mere translation but interpretation and establishing correspondences between two sets of categories , something that dahanukar 's characterization above does not explain . adams and fei - fei li 's study of integrative medicine at lhasa 's traditional tibetan medical hospital , mentsikhang , shows the confusion in matching definitions of disease and determining treatment outcomes in integrative practice . for instance , in a study of the efficacy of tibetan medicine on hepatitis , tibetan treatment was judged inefficacious even though patients reported 83%100% relief from all the eight clinical symptoms designated for evaluation , as well as nonrecurrence of symptoms in a 5-month follow - up study . this was because the definition of hepatitis in terms of viral load adopted by the biomedical experts did not match with the tibetan medical definition of the liver disorder . the authors found several such mismatches in concept and diagnosis in which biomedical decision was accepted even though patients reported improvement . as their confidence in their own system dropped with such test results , the hallmark of integrative medicine is a constant reclassification of ayurvedic disease terminologies in terms of biomedical disease terminology and translation of its pharmacological action in biochemical language . when this is incorporated into a larger drug research by an interdisciplinary team , the input from ayurveda becomes prescientific data . it then gets validated in the laboratory and transformed into biochemical knowledge of drug action expressed and reported in scientific terminology[vi ] will this lead to the incremental growth of ayurvedic knowledge or merely lead to its pharmaceuticalization ? if research findings in ayurveda are always discussed in biochemical and anatomical terminology , how far would such research enhance the understanding of doshas and dhatus ? ayurveda practitioners have to speak the language of biomedicine in order to enter into a dialogue with the existing system . the bams training of the ayurveda practitioner facilitates the dialogue , but in an interdisciplinary team , the ayurveda professional has little control over the end result of the dialog . kim also notes how the scientific community in an international conference did not even acknowledge the concepts and methods of korean medicine even when translated into scientific language . in such an asymmetrical relationship , prolonged subjection of ayurveda to the language of the laboratory would erode its integrity , as testified by the experience of other asian systems of medicine . there are many more crucial unsettled questions about integrative medical research : whether separating composite drug formulations and multimodal treatments of ayurveda into monomodal protocols for the sake of controlled trials is the right thing to do and whether animal experiment would be a valid epistemological method according to ayurveda . uncritical import of the rcts into traditional medicines has been found to eliminate their nuanced therapeutic approach , reduce them to few internal medicines while separating external treatments and hijacking them to the spa . the issues raised here are therefore : cross - system learning could be wholesome to the ayurvedic professional only when there is a strong foundation in ayurvedic theory and pharmacological principles . when ayurvedic diagnosis and treatment protocols have not been evolved for several disease conditions , it would not help to talk about integrative protocols . currently , the bams and md curriculum includes 50%70% biomedical subjects and studies show that at all india level 70% of ayurveda practitioners prescribe allopathic medicines ( it is 80% in punjab and mysore and 12% in kerala . other recent studies[vii ] also corroborate the fact that a sizeable section of college - educated ayurveda doctors do deliver biomedical treatment . the term integrative medicine may legitimize such crossover and reduce ayurveda to a mere degree devoid of knowledge base . in the absence of professional associations of ayurveda to harness effective clinical practices and innovations and to regulate entry of nonayurvedic professionals into ayurvedic research , there is no closure around this medical system . the history of biomedicine shows that it gained legitimacy through the emergence of strong professional associations much before its scientific achievements and the new drug discoveries . the concept of one pivotal system around which integrative medicine will work is a good idea , but may not be practical in the organizational setup of scientific research today , when the pivot is not strong . the demand for transdisciplinary protocols in the absence of disciplinary protocols for ayurveda , therefore , is a serious problem . one of the key reasons for the worldwide shift to complementary and alternative medicine ( cam ) in the past few decades has been due to specific problems of biomedicine emerging from laboratory - tested drugs and procedures . it is , therefore , unwise to import the hi - tech and enormously expensive technologies of biomedicine into ayurveda when they have not helped biomedicine to offer effective and less - expensive remedies for chronic ailments . archibald cochrane in his work , effectiveness and efficiency : random reflections on health services, first suggested the term " evidence - based medicine " for biomedicine because he found that the benefits of many sophisticated and expensive procedures of biomedicine had not been adequately evaluated . the idea of evidence - based medicine , then was accepting biomedical treatment protocols only if evidence of their effectiveness in real life is proven . this shows that efficacy of a drug / procedure in a controlled trial is no guarantee of its effectiveness under live conditions . this is testified by the huge menace of clinical iatrogenesis , which refers to the fatal damages to the patient caused by the so - called sound and laboratory - tested medical interventions . based on review and close reading of medical peer - review journals and government health statistics , null et al . show that the number of people having in - hospital , adverse drug reactions ( adr ) to prescribed medicine in the us is 2.2 million per year . the most stunning statistic , however , is that the total number of deaths caused by conventional biomedicine is 783,936 per year , far higher than the number of deaths attributable to heart disease in 2001 that was 699,697 , and cancer that was 553,251 . in india , neither do we have any statistics of damages caused by medicine , nor a procedure to record damages due to medical errors and iatrogenic effects . the point here is not to attribute malafide intention to medical experts , rather to foreground the problems of a medical system whose therapeutics is based only on verification under controlled laboratory conditions but causing damages in real life . further most of these problems have been identified and discussed by a section of medical professionals themselves . unlike homeopathy and ayurveda , biomedicine does not have a theory of individualized body constitution that helps understand the effect of medication . the suffering on account of medication / treatment is therefore attributed to individual variation and transferred to the patient . legal rights to sue for damages are available to an aggrieved patient only after the damage has occurred . the separation of medical functions among pharmaceuticals , hospitals , and research institutes may have produced large amount of expert knowledge , but as pointed out in earlier , excessive expert knowledge has had iatrogenetic effects . this is because the patient 's welfare is often compromised in the process by which knowledge is transferred from the laboratory to real life . controlled trials themselves depend on interpretation of evidence based on previously confirmed medical beliefs and contradictory evidence may be bypassed by finding fault with the experimental protocol . controlled trials have little to do with the patients experience of the drug in real life unless large number of patients are affected in one location . hence rct is not necessarily the only and the best method for validation of therapeutic efficacy . the laboratory indeed was a progressive factor in the growth of modern science in the 17th and 18th centuries , but in the 21st century it is embedded in sponsored research by huge pharmaceutical industries that have all the stakes in medicine today . today the doctor - patient dyad is but a small fragment in the fag end of this flow of capital and technology both in pharmaceutical research and corporatized health care in the hospital . several professional societies of biomedics and socially conscious scientists themselves are worried about increasing commercialization of the profession in which they are reduced to service providers in a field commanded by big firms . within biomedicine , there is a call for return to clinical methods that are not based on expensive diagnostic technologies , to observe and relate to the patient and to make rational prescriptions . there are movements to strengthen the rights of lay people against the domination of biomedical experts and the medicalization of health . when biomedicine is plagued by the ills of capital intensive laboratory trials , the call for integrative medicine and the consequent privileging of laboratory research is likely to subject ayurveda to the same problems that haunt biomedicine . already studies show that ayurveda doctors spend only as much or , lesser time with patients than allopaths . the separation of the expertise of traditional vaidyas from college education in ayurveda and elimination of simple , skill - based techniques[viii ] is already making it a costly option without its own benefits of holism or humanism . alternative paradigms in which a clinical database may be established by herbalists through clinical audit of herbal therapies have been suggested . this does not mean ayurvedic remedies should not be verified under laboratory conditions or that it should not use modern tools , but that this should be subordinate to the distinct clinical methods of ayurveda and the protection of the doctor it is highly doubtful if this will be possible under a regime of integrative medicine in which ayurvedic professionals will be co - opted into the bandwagon of hi - tech medicine . some of the strengths of ayurveda come from its broad - based knowledge , which has an expert component in skill - based diagnosis and complicated therapeutic procedures as well as a nonexpert component . the rich knowledge base of health practices , principles of diet and eating habits , care for infants , lifestyle regulation , and adaptation to seasonal patterns constitutes the nonexpert medical knowledge . the symbiotic relationship between the two components has led to accumulation of the huge corpus of medical knowledge enshrined in the vernacular medical compendiums in various regions of the subcontinent . besides the medical lore at the household level has been a crucial resource for prevention and early treatment of diseases . the fading of this kind of non - expert knowledge at the household level renders families and parents ignorant of the physiological effects of food substances and work patterns leading to dependence on chemical and synthetic drugs for minor ailments . a structural and biochemical approach to food substances such as the one followed by the modern science of nutrition can not tell us for instance , why citrus fruit juices and curds are not wholesome and nutritious for every one ; besides it requires access to a laboratory technology and an expert to examine and tell us the biochemical constituents of substances . ayurveda provides the pancabhautic parameters by which even an informed lay person could study the effects of food stuffs on one 's own metabolism without any technical apparatus . the foundataion for the revitalization of local health traditions ( frlht ) has been the one and only institution that has single - handedly addressed the relevance of local health traditions and devoted to the cause of strengthening them . the protocols for the documentation of local health traditions developed by frlht have been enormously important not only to ayurveda but to indigenous systems across the world . the next step would be to link sound local health tradition to the ayush facilities and to achieve capacity build up to address dire public health challenges facing the regions . integrative medicine will gradually eliminate the crucial role of non - expert , folk medical knowledge in ayurveda , which has been an important layer of health security . in the past 5 decades , the government research institutes for ayush systems have always carried out integrative research . this integrative research has only contributed to the herbal drug industry that caters to the global demand for herbal products and food supplements[ix ] . more and more research into single and two herbal ingredients mined from classical texts adds to the new pharmacoepic inventories for herbal products with global reach for high - end customers . many of these herbal ingredients are used for wellbeing therapies , not for curative purpose . a large majority of demand for complementary medicine and herbal therapies in the west is from upper middle - class women with more leisure and resources . in india , on the other hand , ayush services are used by lower middle - class people and the poor for major diseases and for obstetric care . the nationwide survey of national rural health mission on the utilization of government ayush institutions indicates high attendance in standalone facilities and in well - established co - located facilities . the point is not that knowledge should not be diffused but is one of priorities in resource allocation . a survey of ayurvedic institutions in delhi[x ] also shows that rickshaw pullers and other working class people turn to ayurveda for several chronic ailments , such as skin diseases , gastrointestinal disorders , liver diseases , arthritis , gynecological problems , and some acute ailments . the main problem in this situation is the dearth in the supply of medicines to ayush hospitals and dispensaries . in addition , there are no ayurvedic protocols for pre- and neonatal care and for conducting deliveries in the ayurveda maternity wards in government institutions . first , although the idea of integration was always there , in socialist china , traditional medicine was promoted and strengthened in the public health system since 1950s before its globalization . the budgetary allocation for tcm and allopathy was almost equal : there were 24,12,362 hospital beds for tcm by 1984 , while the budget for ayurveda in india as late as 2008 is so tiny with bed strength of 64,770[xi ] . the modernization of chinese medicine was coterminous with the evolution of its own diagnostic and therapeutic protocols alongside familiarity with biomedicine . it was possible for government institutions to develop innovative , less expensive therapeutic techniques drawing on classical principles in the 1950s , introduce them in the public health system and propagate them over the decades . second , even after such a strong foundation , integrative approach in tcm only seems to have made it more costly and commodified since 1991 , pushing it from mainstream to marginal position in the formal sector , although the use of home remedies and dietary regimens continue in rural china . as for its global presence , specific aspects of chinese medicine have been picked up and grafted onto existing systems , such as the use of acupuncture anesthesia in biomedical surgeries in france and the use of certain chinese herbs in herbal medicine and herbal teas in naturopathy . tcm is also introduced as alternative medicine in the government health services in some european countries . so integrative approach even with good foundation , does not necessarily enhance the curative ability of traditional medicine at home or its capacity to address current epidemics , such as bird flu , rather allows the disaggregation and dissipation of the system of medicine and its selective assimilation into other existing therapeutic methods . as mentioned earlier , there are several leads in the work of vaidyas and hakims of the 19th and early 20th century as to how to develop ayurveda without integrative approach . the need of the hour is not integration with biomedicine , but integration of the knowledge , skills , and techniques within isms in different regions of the indian subcontinent . the emphasis of efforts in ayurveda should therefore be separate entrance test for bams course instead of recruiting from the cet pool those who wanted to enter mbbs but could not because of poor scores ; there is a need to create ayurvedic professionals who seek to enter ayurveda for its own value and respect their own system of medicine.standardizing ayurvedic diagnostic and treatment protocols by in situ studies and documentation of clinical practices.creating centers of excellence for naadi pariksha , marma chikitsa , visha chikitsa treatment of paralysis , medicinal preparation , and other special methods of ayurvedaincluding these protocols to strengthen the ayurvedic component in bams and md degree courses . linking skilled traditional vaidyas and hakims with the college education systemcreating regional ayurvedic protocols for the public health system , including prenatal and postnatal care and maternal healthsustainable manufacture and supply of quality drugs for public healthgreater research into new food stuffs in the market , contemporary dietary habits and lifestyle and their effect of body constitution and dosha dhatu satmya as measured in various regions , rather than single - drug research for exportnation level forum for serious debate and discussion among ayurvedic professionals about the role of rcts and multinationals in ayurveda and for the creation of pan indian protocols for strengthening professional boundariesregulatory mechanism to specify to what extent can ayurvedic graduates perform biomedical interventions and whether biochemists / biomedical specialists are competent to carry out research on ayurveda without formal training in ayurvedic pharmacology . separate entrance test for bams course instead of recruiting from the cet pool those who wanted to enter mbbs but could not because of poor scores ; there is a need to create ayurvedic professionals who seek to enter ayurveda for its own value and respect their own system of medicine . standardizing ayurvedic diagnostic and treatment protocols by in situ studies and documentation of clinical practices . creating centers of excellence for naadi pariksha , marma chikitsa , visha chikitsa treatment of paralysis , medicinal preparation , and other special methods of ayurveda including these protocols to strengthen the ayurvedic component in bams and md degree courses . linking skilled traditional vaidyas and hakims with the college education system creating regional ayurvedic protocols for the public health system , including prenatal and postnatal care and maternal health sustainable manufacture and supply of quality drugs for public health greater research into new food stuffs in the market , contemporary dietary habits and lifestyle and their effect of body constitution and dosha dhatu satmya as measured in various regions , rather than single - drug research for export nation level forum for serious debate and discussion among ayurvedic professionals about the role of rcts and multinationals in ayurveda and for the creation of pan indian protocols for strengthening professional boundaries regulatory mechanism to specify to what extent can ayurvedic graduates perform biomedical interventions and whether biochemists / biomedical specialists are competent to carry out research on ayurveda without formal training in ayurvedic pharmacology . if our aim is to develop ayurveda to solve the major nutritional problems and chronic diseases of the people in this country at lower costs , integrative research and transdisciplinary protocols are not the focal points . there have been instances in the regions where the government has successfully used ayurvedic experts in their own terms to solve public health problems for the needy . for instance , the government of tamil nadu undertook a project around the year 2000 to solve the problem of maternal anemia through ayurvedic preparations . over a period of 1 year , a team of ayurvedic and siddha experts designed a package of ayurvedic lehyams and churnams ; they were then produced by tampcol ( tamil nadu medicinal plant farms and herbal medicine corporation ltd ) and finally delivered by the anms to rural women in the target group . the anms were also given a kit of 50 ayurvedic medicaments for common ailments that were well received by health seekers in rural areas . similarly , there are reports of the successful use of ayurveda for chikungunya epidemic ( identified as sandhi jwara ) in gujarat and kerala[xiii ] . the application of panchakarma and ayurvedic toxicology for bhopal gas victims at sambhavna clinic is yet another instance of in situ clinical use of ayurveda[xiv ] . intensive documentation of the currently available ayurvedic treatments practiced in different regions in the country and their standardization is more important than the standardization of drugs . the former would contribute to consolidation of ayurvedic clinical experience and improvement of expertise of the ayurvedic professional and the latter will help the pharmaceutical industry more . if , we wish to export ayurvedic recipes , integrative medicine becomes necessary ; but this is likely to create an ayurveda without any roots , at the mercy of herbal products industry . as a system of medicine that has already seen three millennia , ayurveda is going through major transformation . a lot of research has been done in the past five decades by sociologists and anthropologists on the changes in traditional asian medicine . these studies show how physicians of traditional medicine aspire to be like biomedical doctors or , are under pressure to prove themselves in an asymmetrical relationship to laboratory science . medical professionals and social scientists are placed in an institutional setup where they face similar challenges . a culture of dialogue between social and medical sciences will be fruitful to gain mutual understanding and for a socially relevant professional practice .

chronic myeloid leukemia ( cml ) is a clonal myeloproliferative disorder of the primitive hematopoietic stem cell and is characterized by the presence of unique translocation , i.e. , bcr / abl1 known as philadelphia chromosome . in pre imatinib era , cml was treated primarily with radiotherapy , bulsulphan , hydroxyurea , interferon alpha , cytarabine or later with allogeneic hematopoietic stem cell transplantation . however , at that time also , it was a known fact that the bcr / abl1 , a fusion oncoprotein which is consitutively active tyrosine kinase , plays the central role in the pathogenesis of cml and its suppression can lead to halt in disease progression . this fact led to the advent of imatinib , tyrosine kinase inhibitor ( tki ) , which inhibits the leukemogenic kinase activity of bcr - abl1 oncoprotein . imatinib was then evaluated by the famous international randomized study of interferon versus sti571 trial , initiated in the year 2000 . in this trial , newly diagnoised chronic phase cml patients were randomized to be either treated with imatinib 400mg / day or interferon plus cytarabine . the results of this study , as we know , completely changed the therapeutic landscape for philadelphia chromosome positive cml patients ( as shown in table 1 ) . showing changing trends in survival of cml patients over the years a decade later , since the advent of imatinib , the changing trends in the treatment and the introduction of new tkis have shed light on various aspects of cml . in this era of 2 and 3 generation tki , it is important to understand the basic trends of cml disease , tolerability of the drug , drug resistance and need of transplant in our indian patients . the fact that there is scarcity of the data from india on cml and on the changing trends in the treatment of cml in india , a meeting was conceived to share the in - depth views and clinical data of cml patients from all over india as shown in figure 1 . indian evidence of cml - mylestone was held on 24 and 25 july 2010 . kumar prabhash , associate professor , tmh mumbai in collaboration with indian cooperative oncology network . in this meeting 18 oncology centers also submitted their manuscripts and in this article we are presenting the summary of the collaborated data from the submitted manuscripts . it is imperative to say that this data is retrospective and has its limitations ; however , at the same time it gives useful insight to the presentation , treatment modalities and its outcome in an indian patient with cml . map of india showing location of 22 oncology centers represented at myelstone chronic myeloid leukemia meeting july 2010 another important fact that needs to be mentioned is that with the presence of various patient assisted programs such as gipap , gleevec have been made available to hundreds of non - affording patients and has played a pertinent role in the improvement of the overall outcome of cml patients in india . there were total 6677 patients from 18 centers and the total number of patients from each individual center is shown in figure 2 . number of patients from various oncology centers represented at myelstone chronic myeloid leukemia meeting july 2010 incidence : as stated in various cancer registries , cml is one of the commonest adult leukemia in indian population accounting for 30% to 60% of all adult leukemias . the data presented at cml meeting showed that the incidence of cml cases varied from 70% of all leukemia cases at igims , rcc , patna to 16.6% gcri , gujaratthis huge difference in incidence of cml cases at two different centres is difficult to explain , as these are not population based registries and may be because of different cancer populations they cater to.sex ratio : there is male preponderance . the male to female sex ratio varied from 1:08 ( sterlings , gujarat ) to 3:1 ( tmh , mumbai).median age : the median age of the population varied from minimum 32 years ( nizam institute of medical sciences , hyderabad , south india ) to maximum 42 years ( ashirwad center , mumbai , southwest india ) . this decade younger population was the most consistent fact presented in almost all studies confirming that in india , median age at presentation is a decade younger compared with the age presented in european ( median age 55years)as well as in american ( median age 66 years ) literature.symptoms at presentation : the most common symptom was splenomegaly ranging from 100% ( wia , chennai ) to 81% ( igims , patna ) followed by hepatomegaly , fatigue , weakness , dragging pain , pallor or sometimes asymptomatic seen in 30% cases ( hcg , bio , bangalore ) . no organomegaly was seen in 5.4% patients ( ihtm , kolkata)in comparison to western data where approximately 40% of patients are asymptomatic and diagnosed on the basis of abnormal counts , majority of indian patients are symptomatic and mostly present with dull aching pain in the left hypochondriac region secondary to splenomegaly.blood counts at presentation : the median hemoglobin ( hb ) ranged from 9 g / dl ( igims , patna ) to 11 g / dl ( aiims , india ) ; the median white blood cell count ranged from 0.46 10/cumm ( rgci , delhi ) to 1.86 10/cumm ( wia , chennai ) . cml is a myeloproliferative disease , but it can present with as low counts as 0.18 10/cumm ( pgi , chandigarh).cml phase at presentation : the percentage of patients presenting in chronic phase varied from 85% ( pgi , chandigarh ) to 97% ( igims , patna ) with a median of 89.5% as shown in figure 3 , while in european data , the presentation of cml in chronic phase has been reported to be as high as 96.8% . figure 3chronic myeloid leukemia phase at the time of diagnosis sokal risk category : the sokal risk category data being retrospective is not complete . however , few centers have presented their data and it seems the majority of patients are in intermediate risk category ranging from 27% to 47% , while low risk category range from 25% to 55% and high risk category range from 12% to 28% of patients as shown in figure 4 . figure 4sokal risk category at the time of chronic myeloid leukemia diagnosis incidence : as stated in various cancer registries , cml is one of the commonest adult leukemia in indian population accounting for 30% to 60% of all adult leukemias . the data presented at cml meeting showed that the incidence of cml cases varied from 70% of all leukemia cases at igims , rcc , patna to 16.6% gcri , gujaratthis huge difference in incidence of cml cases at two different centres is difficult to explain , as these are not population based registries and may be because of different cancer populations they cater to . the male to female sex ratio varied from 1:08 ( sterlings , gujarat ) to 3:1 ( tmh , mumbai ) . median age : the median age of the population varied from minimum 32 years ( nizam institute of medical sciences , hyderabad , south india ) to maximum 42 years ( ashirwad center , mumbai , southwest india ) . this decade younger population was the most consistent fact presented in almost all studies confirming that in india , median age at presentation is a decade younger compared with the age presented in european ( median age 55years)as well as in american ( median age 66 years ) literature . symptoms at presentation : the most common symptom was splenomegaly ranging from 100% ( wia , chennai ) to 81% ( igims , patna ) followed by hepatomegaly , fatigue , weakness , dragging pain , pallor or sometimes asymptomatic seen in 30% cases ( hcg , bio , bangalore ) . no organomegaly was seen in 5.4% patients ( ihtm , kolkata)in comparison to western data where approximately 40% of patients are asymptomatic and diagnosed on the basis of abnormal counts , majority of indian patients are symptomatic and mostly present with dull aching pain in the left hypochondriac region secondary to splenomegaly . blood counts at presentation : the median hemoglobin ( hb ) ranged from 9 g / dl ( igims , patna ) to 11 g / dl ( aiims , india ) ; the median white blood cell count ranged from 0.46 10/cumm ( rgci , delhi ) to 1.86 10/cumm ( wia , chennai ) . cml is a myeloproliferative disease , but it can present with as low counts as 0.18 10/cumm ( pgi , chandigarh ) . cml phase at presentation : the percentage of patients presenting in chronic phase varied from 85% ( pgi , chandigarh ) to 97% ( igims , patna ) with a median of 89.5% as shown in figure 3 , while in european data , the presentation of cml in chronic phase has been reported to be as high as 96.8% . figure 3chronic myeloid leukemia phase at the time of diagnosis chronic myeloid leukemia phase at the time of diagnosis sokal risk category : the sokal risk category data being retrospective is not complete . however , few centers have presented their data and it seems the majority of patients are in intermediate risk category ranging from 27% to 47% , while low risk category range from 25% to 55% and high risk category range from 12% to 28% of patients as shown in figure 4 . figure 4sokal risk category at the time of chronic myeloid leukemia diagnosis sokal risk category at the time of chronic myeloid leukemia diagnosis it is difficult to interpret the treatment response from various centers . as the time taken for response varies and also the treated population is quite heterogeneous . the most of the centers there is no mention of early chronic phase ( ecp ) or late chronic phase ( lcp ) at presentation . in many of the centers patients were treated with hydroxyurea , interferon at first and then shifted to imatinib . the primary resistance to imatinib in newly diagnosed patients can vary from 0.1% ( omega , hyderabad ) to 3% ( aio , raheja ) . the treatment response of patients at various centers ( ecp ) versus lcp : tmh mumbai data shows that there was 60% complete cytogenetic response ( ccyr ) in lcp compared with 80% in ecp patients . data from aio , raheja , mumbai shows that primary resistance was more common in lcp patients , i.e. , 21% versus 3% in ecp patients . ashirwad , mumbai also reported similar findings with 80% ccyr in ecp and 43% in lcp patients.glivec versus generic : in sms jaipur , 137 ( 64% ) patients were on glivec while 76 ( 36% ) were on generic i m . the complete hematological response ( chr ) was 88% in glivec arm while it was 96% in generic arm . another study from tmh mumbai showed similar findings with 72% ccyr in glivec arm and 75% ccyr in generic arm.safety of imatinib in pregnancy : from searoc , jaipur , three patients conceived and all babies born did not have any congenital anomaly . aiims study showed that 10 female became pregnant while on imatinib , but only three stopped the drug as per instructions . however , there were uneventful outcomes except one baby had meningocele.mutation data : from searoc , jaipur , imatinib mutation analysis was performed in five patients in accelerated phase , but none showed any known mutation . in kidwai bangalore , mutation analysis was done in 101 patients showing poor response , in 73% there were no known mutation . ( ecp ) versus lcp : tmh mumbai data shows that there was 60% complete cytogenetic response ( ccyr ) in lcp compared with 80% in ecp patients . data from aio , raheja , mumbai shows that primary resistance was more common in lcp patients , i.e. , 21% versus 3% in ecp patients . ashirwad , mumbai also reported similar findings with 80% ccyr in ecp and 43% in lcp patients . glivec versus generic : in sms jaipur , 137 ( 64% ) patients were on glivec while 76 ( 36% ) were on generic i m . the complete hematological response ( chr ) was 88% in glivec arm while it was 96% in generic arm . another study from tmh mumbai showed similar findings with 72% ccyr in glivec arm and 75% ccyr in generic arm . safety of imatinib in pregnancy : from searoc , jaipur , three patients conceived and all babies born did not have any congenital anomaly . aiims study showed that 10 female became pregnant while on imatinib , but only three stopped the drug as per instructions . mutation data : from searoc , jaipur , imatinib mutation analysis was performed in five patients in accelerated phase , but none showed any known mutation . in kidwai bangalore , mutation analysis was done in 101 patients showing poor response , in 73% there were no known mutation . the most common non - hematological toxicity seen was changes in skin pigmentation followed by weight gain , edema , diarrhea , myalgias , arthralgias and transaminitis . some have reported ototoxicity , decrease in vision also ( rcc , patna ) and second malignancies ( aio , raheja , mumbai ) . among non - hematological toxicity most common were anemia and thrombocytopenia . grade iii / iv toxicity requiring intervention was seen less than 1% ( gcri , gujarat ) and was reported up to 16% by ashirwad , mumbai . toxicity profile of imatinib drug as reported from various centers the survival varies from 81% to 100% in various studies as shown in table 4 . it is difficult to interpret the treatment response from various centers . as the time taken for response varies and the most of the centers there is no mention of early chronic phase ( ecp ) or late chronic phase ( lcp ) at presentation . in many of the centers patients were treated with hydroxyurea , interferon at first and then shifted to imatinib . the primary resistance to imatinib in newly diagnosed patients can vary from 0.1% ( omega , hyderabad ) to 3% ( aio , raheja ) . ( ecp ) versus lcp : tmh mumbai data shows that there was 60% complete cytogenetic response ( ccyr ) in lcp compared with 80% in ecp patients . data from aio , raheja , mumbai shows that primary resistance was more common in lcp patients , i.e. , 21% versus 3% in ecp patients . ashirwad , mumbai also reported similar findings with 80% ccyr in ecp and 43% in lcp patients.glivec versus generic : in sms jaipur , 137 ( 64% ) patients were on glivec while 76 ( 36% ) were on generic i m . the complete hematological response ( chr ) was 88% in glivec arm while it was 96% in generic arm . another study from tmh mumbai showed similar findings with 72% ccyr in glivec arm and 75% ccyr in generic arm.safety of imatinib in pregnancy : from searoc , jaipur , three patients conceived and all babies born did not have any congenital anomaly . aiims study showed that 10 female became pregnant while on imatinib , but only three stopped the drug as per instructions . however , there were uneventful outcomes except one baby had meningocele.mutation data : from searoc , jaipur , imatinib mutation analysis was performed in five patients in accelerated phase , but none showed any known mutation . in kidwai bangalore , mutation analysis was done in 101 patients showing poor response , in 73% there were no known mutation . ( ecp ) versus lcp : tmh mumbai data shows that there was 60% complete cytogenetic response ( ccyr ) in lcp compared with 80% in ecp patients . data from aio , raheja , mumbai shows that primary resistance was more common in lcp patients , i.e. , 21% versus 3% in ecp patients . ashirwad , mumbai also reported similar findings with 80% ccyr in ecp and 43% in lcp patients . glivec versus generic : in sms jaipur , 137 ( 64% ) patients were on glivec while 76 ( 36% ) were on generic i m . the complete hematological response ( chr ) was 88% in glivec arm while it was 96% in generic arm . another study from tmh mumbai showed similar findings with 72% ccyr in glivec arm and 75% ccyr in generic arm . safety of imatinib in pregnancy : from searoc , jaipur , three patients conceived and all babies born did not have any congenital anomaly . aiims study showed that 10 female became pregnant while on imatinib , but only three stopped the drug as per instructions . mutation data : from searoc , jaipur , imatinib mutation analysis was performed in five patients in accelerated phase , but none showed any known mutation . in kidwai bangalore , mutation analysis was done in 101 patients showing poor response , in 73% there were no known mutation . the most common mutation seen was t315i ( 4 patients ) and m351 t ( 4 patients ) . the most common non - hematological toxicity seen was changes in skin pigmentation followed by weight gain , edema , diarrhea , myalgias , arthralgias and transaminitis . some have reported ototoxicity , decrease in vision also ( rcc , patna ) and second malignancies ( aio , raheja , mumbai ) . among non - hematological toxicity most common were anemia and thrombocytopenia . grade iii / iv toxicity requiring intervention was seen less than 1% ( gcri , gujarat ) and was reported up to 16% by ashirwad , mumbai . the survival varies from 81% to 100% in various studies as shown in table 4 . various studies confirm that age at presentation is a decade younger and majority presents in chronic phase . few reports have studied the factors responsible for response and survival of patients with cml . one such study from ashirwad mumbai shows that on cox regression analysis , age under 40 years , low sokal score , chr and ccyr were significant predictive factors for event free survival event free survival while on multivariate analysis , low sokal score and early chronic phase were the significant predictive factors for ccyr . similarly from aio , raheja also reiterated that early chronic phase , better tolerability to the drug , no primary resistance are significant indicators of better survival of patients with cml . socio - economic ( se ) status of patients also had an impact on the response to imatinib . study by sms , jaipur shows that patients with upper se status had 100% chr while le status had 90.3% chr , also le patients with increased disease burden with 25% having high sokal scores compared with only 6% in upper se patients . another important finding documented by data from tmh , mumbai is regarding the compliance of the drug . patients who had more than 4 weeks of gap had only 57% ccyr compared with 80% ccyr in patients taken less than 4 weeks of gap in their treatment . most important limitation of the retrospective data was uniformity and consistency in the response evaluation . however , most studies have regularly followed patients with blood counts , other modalities such as cytogenetic response ; molecular response and mutation analysis have been done onlyat few centres . the main limitation is financial constraints and the second argument is non - availability of better options than imatinib again due to financial reasons . however , this collective data gives us some insight into patient presentation , tolerability , response and outcome of cml patients in indian settings .

over the past decades , superparamagnetic ( sp ) nanostructures of spinel ferrites ( mfe2o4 : m = fe , co , cu , zn , etc . ) have drawn intense scientific and technological interests because they possess a wide range of applications in magnetic fluid [ 1 - 3 ] , magnetic resonance imaging ( mri ) , and drug delivery technology [ 6 - 8 ] . recently , spinel cobalt ferrite ( cofe2o4 ) nanostructure materials have been extensively studied because they form a magnetic system which is an ideal candidate toward understanding and controlling magnetic properties at the atomic level through chemical manipulation . based on different techniques , sp cofe2o4 nano - scale particles have been synthesized by several research groups [ 10 - 13 ] . unfortunately , these small nanoparticles , especially those with sizes below 10 nm , have poor magnetic response abilities . the low magnetization properties caused by small size limit their usage in a number of practical applications since they can not be effectively manipulated by using moderate magnetic fields . in order to obtain a high saturation magnetization ( ms ) , simply making particles larger can not be an option at all , resulting in a strong aggregation due to the non - sp ferromagnetic attraction . recently , much effort has been focused on the preparation of large - size sp particles with high ms using simple composites . for example , lee et al . reported the fabrication of highly uniform sp mesoporous spheres with sub - micrometer scale , composed of silica and cofe2o4 achieved a high magnetization value . similar efforts were done by bao et al . in which controlled growth of sp nanostructures of spherical and rod - like cofe2o4 nanocrystals . however , their high ms required a high reaction temperature and expensive high - boiling point toxic solvents , which are disadvantages for their biological applicability . moreover , such composite nanostructures are incompatible with low expense of preparing procedure . herein , we report a single - step process for high - performance monodisperse sp cofe2o4 mss at low temperature ( at only 180c ) . as a consequence of the low - temperature synthesis , the as - obtained samples possess a high ms ( over 55 emu / g ) and biocompatibility . cobalt acetate [ co(ch3coo)2 4h2o ] , anhydrous ethanol(ch3ch2oh ) , iron(iii ) nitrate nonahydrate [ fe(no3)3 9h2o ] , and poly(vinyl pyrrolidone ) ( pvp , k30 ) are of analytic grade reagents and purchased without further treatment . in a typical reaction , 2 mmol co(ch3coo)2 4h2o and 4 mmol fe(no3)3 9h2o were dissolved in 35 ml ch3ch2oh forming a reddish brown solution , after which 0.2 g pvp was added . the mixture was stirred vigorously for 30 min and then sealed in a teflon - lined stainless steel autoclave ( 50 ml capacity ) . the autoclave was heated to and maintained at 180c for 1224 h and then was allowed to cool to room temperature . the dark products were subjected to magnetic decantation , followed by repeated washing with distilled water , ethanol , and acetone . the final products were dried in a vacuum oven at 60c for 8 h. phase and composition analyses of the products were performed by x - ray diffraction / photoelectron spectroscopy [ xrd / xps ( philips x pert prodiffractometer with cu k ( = 1.54056 ) radiation)/(axis ultra xps , al k ) ] . the size and morphology of the as - synthesized mss were investigated by using scanning / transmission electron microscopy ( sem / tem , jsm5600lv / jeol100cx - ii ) . figure 1a shows a typical xrd pattern of the as - fabricated sample ( reaction for 24 h ) . all diffraction peaks can be indexed to a simple cubic lattice ( fcc ) , and the positions along with relative intensity of peaks match well with standard cofe2o4 powder diffraction database ( jcpds file no . 22 - 1086 ) , indicating that the as - obtained products have an fd3 m cubic spinel structure . according to the scherrer equation , the average crystallite size which is calculated based on the xrd pattern ( 311 ) is approximately 8 nm . in fact , the xrd patterns of the others ( reaction for 12 and 36 h ) are similar to it ( not shown ) . figure 1b and 1c show the high - resolution xps spectra of 2p co and fe , respectively . the peak at 780.8 ev is from co2p3/2 , with a shake up satellite at 785.9 ev , while the peak at 797.2 ev is caused by co2p1/2 , with a satellite peak at 803.0 ev . the presence of those two peaks and the highly intense satellites near them is consistent with the presence of co in the high - spin state . all the fe2p spectra generally show a main peak at a binding energy ( be ) of around 710.3 ev , accompanied by a satellite line visible at a be of around 718.3 ev , only indicative of the presence of fe cations . further quantitative analysis finds that the atomic ratio between co and fe is about 1:2 , which is compatible with the data of xrd . the as - synthesized cofe2o4 mss for a xrd pattern , and xps spectra b co2p and c fe2p the sem images of the as - synthesized samples obtained at different reaction times are illustrated in fig . the average size of the cofe2o4 mss is ~220 nm [ solvothermal treated for 12 h ( fig . however , when extending the reaction time to 24 h , the average size increases to ~330 nm ( as revealed in fig . 2c and 2d , these micrometer - sized cofe2o4 spheres [ ~220 nm ( fig . 2c ) and ~330 nm ( fig . 2d ) in diameter , respectively ] can clearly be seen . additionally , an individual sphere is not a single microparticle but the assemblies of small cofe2o4 nanoparticles ( the diameter of ~8 nm ) , in which the size of primary nanoparticles is in excellent agreement with the xrd results . sem / tem images of products prepared at different reaction time : a / c 12 h , b / d 24 h to obtain a better understanding of the formation and evolution of cofe2o4 mss along with the reaction time , that the reaction duration was further extended to 36 h was carried out . the mss were evacuated resulting in octahedral - shaped cofe2o4 particles , which are confirmed by the sem image ( fig . 3b ) . as a consequence , a proposed mechanism of formation and evolution of the cofe2o4 mss it is well known that pvp can selectively absorb on a certain crystal facet of the as - prepared primary building blocks such as nanoparticles , nanosheets , nanoplates , nanorods , and so on [ 20 - 23 ] . in our experimental system , pvp surfactant contributes not only to preventing these primary building blocks from entropy - driven random aggregation but also to controlling the formation of the regular geometry . the formation and evolution of mss seems to be as follows : at first , this cofe2o4 phase undergoes consequent nucleation and growth around the entire surface stabilized by pvp . in the subsequent process , driven by the minimization of the total energy of the system , the small primary cofe2o4 nanoparticles aggregated together to form three - dimensional ( 3d ) spheres . ostwald ripening occurred under solvothermal conditions , resulting in the formation of cofe2o4 spheres from small grows into larger due to isotropic growth . the octahedral shape of the product obtained by reaction for 36 h may be explained by combination of thermodynamic aspects of crystal growth and the selective adsorption model of surfactants on different crystallographic facets . moreover , the structures may be deduced that development of the ( 111 ) facets was handicapped by the adsorbed pvp surfactant on these facets . a sem / b tem images of studied samples with 36 h reaction time schematic illustration of the formation and evolution of cofe2o4 mss along with the reaction time the magnetic behavior of cofe2o4 mss is very important for practical applications . 5a , 5b ) display the two relatively high ms values of 41.2 ( taken from 220 nm ) and 55.2 emu / g ( 330 nm ) , respectively . both values are , however , somewhat lower than the bulk value ( 71.2 emu / g ) . the hysteresis loop shows essentially no coercivity ( hc ) for the smaller size samples ( 220 nm ) and negligible value of 27 oe ( larger size specimens , a diameter of 330 nm ) , suggesting that improved coalescence of the crystallites in the nanostructures results in increased magnetic coupling and higher magnetization . according to the results of xrd and tem observations , the average size of primary crystals is about 8 nm , smaller than the sp critical size of cofe2o4 . so it is reasonable that the self - assembled cobalt ferrite mss reveal sp behavior even though their sphere size exceeds 200 nm . the stabilization of the mss in distilled water thanks to the surfaces capped of hydrophilic pvp . slight agitation can bring the mss to back into the aqueous solution when the magnet is removed ( fig . 5c ) although these magnetic mss can be completely separated from the solution when the solution is subjected to an external magnetic field within minutes , as shown in fig . it can be obviously seen that the cofe2o4 mss have rapid magnetic response ability at room temperature , as well as , highly monodispersed , and biocompatible . rt magnetization curves for the of cofe2o4 mss with different reaction time : a 12 h , b 24 h ( the inset shows enlarged magnetic hysteresis loops at low applied fields ) ; photographs of cofe2o4 mss dispersion in a vial , c without magnetic field , d with magnetic field for 1 min in summary , sp cofe2o4 mss have been synthesized through a simple surfactants - assisted solvothermal method at a relatively low temperature . all of the reactants are common reagents and inexpensive , as well as environment benign . the as - prepared mss , composed of about 8-nm cofe2o4 nanoparticles , have uniform sizes ( diameters up to several hundred nanometers ) , high ms and well water - dispersible make them good candidates for not only in advanced magnetic materials and ferrofluid technology , but also in biomedical fields such as biomolecular separations , targeted drug delivery , as well as magnetic resonance imaging . this work was partially supported by the program for science & technology innovation talents in universities of henan province ( no . 2008 hastit002 ) , innovation scientists and technicians troop construction projects of henan province ( no . 094100510015 ) , and by the natural science foundation of china under grant no . 20971036 . this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and source are credited . this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and source are credited .

radiographs are an important component of dental and periodontal examination and are essential in establishing periodontal diagnosis . despite their value in diagnosing periodontal diseases , they have several limitations as a diagnostic tool , one being underestimation of the amount of periodontal destruction in a tooth . aggressive periodontitis ( agp ) is defined as a destructive periodontal disease primarily affecting the younger age group . it is a rapidly progressing form of periodontitis that frequently starts at an early age . according to the 1999 international classification of periodontal diseases , agp is rare and displays a severe phenotype of periodontitis characterized by rapid bone destruction and loss of attachment in the absence of any systemic disease , often with familial aggregation . progression of agp is so rapid that , if not treated , supporting tissue around the teeth may be lost early in life , along with severe bone loss . detection of periodontal bone loss in a patient with agp is mandatory for proper treatment planning . the current diagnostic methods , including clinical probing and intraoral radiography have shown several limitations in their reliability . clinical probing is dependent on the probing force , shape and the size of probe tip , direction of penetration and resistence of the tissue , while periapical or bitewings may over- or underestimate the amount of bone loss due to projection errors . one of the main drawbacks of intraoral radiography is the overlap of anatomical structures and lack of three - dimensional ( 3d ) information . this often hinders an exact distinction between the buccal and lingual cortical plate and complicates the evaluation of periodontal bone defects , especially the infrabony lesions , such as craters , furcation involvements , and walled defects . several efforts for optimizing these diagnostic tools such as use of electronic probes and digital subtraction radiography have been made over the past few years . unfortunately , electronic probes have not demonstrated significant advantages over manual probing and direct digital radiography ( ddr ) lacks information of the 3d nature , thus emphasizing the need for further improvement in the early diagnosis of agp . cone beam computed tomography ( cbct ) , also called dental ct , is a recently developed imaging modality which when compared with 2d radiography reduces considerably patient 's exposure to radiation and is also a more accurate diagnostic tool . although there have been a few publications reporting use of cbct for periodontal assessment , comparing this new imaging modality with the existing direct digital radiography may offer new perspectives in its use in diagnosis and treatment planning of agp . therefore , considering some of the limitations of conventional radiography for detection of periodontal bone lesions , advanced imaging methods such as cbct may offer a more effective investigation tool for diagnosis , treatment planning , and thus better prognosis . a 27-year - old male patient reported to the department of periodontology with a 2-year history of his teeth slowly becoming loose . clinical and radiological examinations were carried out . on clinical examination , generalized periodontal pockets with severe loss of attachment was observed . grade iii mobility of mandibular anterior teeth and left maxillary second premolar , grade ii mobility of right mandibular first molar , grade ii furcation involvement of maxillary and mandibular molars were recorded . treatment planned included scaling and root planning ( phase i ) followed by flap surgery ( phase ii ) for the elimination of the periodontal pockets . the treatment plan was explained to the patient and the consent of the patient as well as the institutional ethical clearance in accordance with the helsinki declaration was obtained . full mouth ddrs were obtained using dental x - ray machine ( planmeca , finland , 70 kv , 8 ma ) by long cone / paralleling technique and a charge coupling device ( kodak , rvg 5100 , size 35 5 mm ) [ figure 1 ] . photo of the ( a ) dental x - ray machine ( planemeca , finland , 70 kv , 8 ma ) , and ( b ) a charged coupling device ( kodak , rvg5100 , size 35 15 mm ) . cbct scan were performed with kodak cs 9300 scanner at voxel resolution of 0.18 0.18 0.18 mm . the beam height of surface image receptor was adjustable and set to visualize both jaws at low dose protocol of 90 kv and 8 ma . panoramic volumetric reconstructive cbct image of maxillary and mandibular jaws [ figure 2a and b ] and volumetric rendering ( vr ) images of maxillary and mandibular teeth [ figures 3 and 4 ] were procured . based on the clinical findings , radiographic analysis , and cbct image , the patient was diagnosed with generalized agp . 27-yearold male patient with 2-year history of loosening of teeth diagnosed with generalized aggressive periodontitis ( gap).(a ) 3d panoramic volumetric reconstructive cbct image of maxillary arch and ( b)3d panoramic volumetric reconstructive cbct image of mandibular arch reveal the severity of alveolar bone destruction and loss of alveolar bone from cemento - enamel junction till its base mainly in the molar and premolar region of both the arches . 27-year old male patient with 2-year history of loosening of teeth diagnosed with generalized aggressive periodontitis ( gap ) . 3d volumetric reconstructive cbct images of the different sections of maxillary arch , a , b and c ( top ) are labial and buccal view and d , e , and f ( bottom ) are palatal views . ( a ) right posterior region of the jaw reveals advance periodontal bone destruction tillapical root regions in relation to maxillary first molar ( tooth 16 ) ( black arrow ) and middle third of the root of the premolars ( teeth 14 , 15 ) and canine ( tooth 13 ) ( white arrows ) . ( c ) left posterior jaw region shows alveolar bone destruction till the apical third of the first molar ( tooth 26 ) ( black arrow ) , premolars ( teeth 24 , 25 ) and canine ( tooth 23 ) ( white arrow ) with the involvement of the buccal cortical plate . ( d , e and f ) palatal view show same areas of osseous defects in generalized aggressive periodontitis with severe bone destruction seen in the maxillary arch ( arrows ) . 27-year old male patient with 2-year history of loosening of teeth diagnosed with generalized aggressive periodontitis ( gap ) . 3d volumetric reconstructive cbct images of different sections of mandibular arch of the a , b and c ( top ) are buccal and labial view and d , e , and f ( bottom ) are lingual views . ( a ) right posterior jaw shows arc shaped bone loss ( arrow ) in relation to first molar extending from second premolar to second molar . ( b ) anterior region shows severe bone destruction till the apical third of all the central and lateral incisors ( arrow ) including canines . ( c ) left posterior jaw region shows bone destruction in relation to first molar ( only the root stumps are seen as shown with arrows ) and around premolars . ( white arrow ) ( d , e , and f ) lingual view images show same areas of severity of osseous defects in generalized aggressive periodontitis . phase i therapy performed consisted of scaling and root planning and the patient was evaluated after strict maintenance of oral hygiene for a month . debridement of the periodontal osseous defects was performed in order to visualize the entire osseous defect at each tooth surface , which is considered as a gold standard in study of these defects . measurements of the osseous defects were carried out with unc15 probe taking cej ( cemento - enamel junction ) as a reference point and measuring till the base of the defect [ figure 5 ] . flap was then sutured and periodontal dressing ( coe - pak , usa ) was applied to cover the surgical wound . the measurements obtained during surgical exposure of the defects were then compared with that obtained from digital and cbct reconstructive images . cbct images of periodontal osseous defects were identical to the measurements of osseous defects that were obtained during surgery . while digital radiography failed to reveal the extent of the osseous defects . 27-year old male patient with 2-year history of loosening of teeth diagnosed with generalized aggressive periodontitis . measurement of defect in furcation area done with unc 15 periodontal probe from cementoenamel junction till the base of the defect ( arrows ) . panoramic reconstruction view of the cbct images allowed measurements of periodontal linear and nonlinear bone levels that were comparable with those seen in intraoral digital radiography . measurements on 3d reconstructive images demonstrated a more accurate assessment , due to the absence of overlapping structures . measurements of periodontal defects after surgical exposure when compared with measurements taken on the cbct images showed 100% accuracy in the morphological description of periodontal bone crater , furcation involvements , and 3-walled osseous defects [ figures 6 and 7 ] . postoperative instruction were given to the patient for the care of the surgical site , not disturbing the periodontal dressing for a week till the removal of the sutures . patient was prescribed antibiotic , amoxicillin ( 500 mg ) every 8 h for 1 week and scheduled for a postoperative visit after 1 week and periodic checking after every 3 months for evaluation . only clinical examination was done during the six month postoperative check up and healing was found to be satisfactory with elimination of periodontal pockets , and increase in clinical attachment levels ( cals ) . imaging was not performed at this point of time since 6 months postoperative healing of alveolar bone would not show significant gain in alveolar bone height . 27-year old male patient with 2-year history of loosening of teeth diagnosed with generalized aggressive periodontitis.3d volumetric rendered images ( a , b , c , d ) , ( i ) and ( k ) in the areas of the both maxillary and mandibular arch as shown in figures 3 and 4 compared with 2d digital periapical radiographs ( e , f , g , h ) and ( j and l ) show underestimation of the amount of bone loss in digital radiographs due to projection errors and also due to lack of 3d information that help in distinguishing the buccal and the lingual cortical plates ( arrows ) . 27-year old male patient with 2-year history of loosening of teeth diagnosed with generalized aggressive periodontitis ( gap ) . ( a ) direct digital radiograph of the mandibular first olar ( tooth 46 ) shows the osseous defect , ( b ) 3d volumetric rendering of the same tooth shows the osseous defect , ( c ) cbct sagittal view of right mandibular first molar shows measurement of bone loss done by the cbct software , and ( d ) photo of the same tooth ( tooth 46 ) during intraoral procedure for measuring bone destruction in furcation area using unc 15 probe reveals the measurement to be exactly same as the measurement obtained in cbct image c. agp constitutes a group of rare and rapidly progressing form of periodontitis , leading to tooth loss and edentualism . many clinicians report difficulty in establishing a differential diagnosis for agp and chronic periodontitis due to an overlapping gray area that often makes difficult a clear - cut diagnosis . the diagnosis of agp relies almost exclusively on clinical parameters and traditional 2d dental radiography . clinical assessments such as probing depth ( pd ) and cal are somewhat subjective and time consuming and therefore underutilized in general dental practice . radiographs are an essential component of periodontal examination and indispensable in establishing a periodontal diagnosis . important information regarding the position and architecture of the alveolar crest of bone is obtained from radiographs . despite their value in periodontal diagnosis bitewing and periapical radiographs may overestimate or underestimate the amount of bone loss due to projection errors and they also lack 3d information and have difficulty in distinguishing the buccal and the lingual cortical plate . a successfully treated case of agp is likely to have similar pre- and posttreatment levels of radiographic bone loss . thus , there is a need for 3d images that can provide useful information about the regeneration of the bone after the surgery that may assist in monitoring the case following surgical intervention . the present case report demonstrated that the cbct images provided a high accuracy for the detection and diagnosis of periodontal osseous defects in agp , when compared with digital radiography . cbct allowed accurate assessment of bone levels and a better description of infrabony defects , such as interdental craters , 3-walled osseous defects , furcation involvement , than intraoral digital images . this finding indicated that the current cbct system can become an indispensible tool in the diagnosis of periodontal defects . when compared with cbct , direct digital radiograph remains a 2d imaging technique , which can not visualize 3d periodontal defects . the radiation dose of cbct has been reported to be 15 times lower than conventional radiography , only 4 - 15 times the dose of a standard panoramic image . cbct technology is highly relevant for oral health professionals , especially in the field of periodontology as it potentially provides greater information in the assessment of osseous defects around the teeth than direct digital intraoral radiographs . diagnosis of a periodontal lesion has been made easy and accurate with the use of cbct , without need for any surgical exposure of the affected area to study the defect . cbct can help in planning treatment , in follow - up monitoring of patients postsurgery and exposes the patient to a lower dose of radiation .

when wheatstone ( 1838 ) developed his mirror stereoscope in the first half of the nineteenth century , it was possible for the first time to independently control the presentation of images to the two eyes . in reporting his new device ( wheatstone , 1838 ) , the main focus was on his impressive demonstration that presenting a matched image to each eye , and adding a small lateral displacement in opposite directions , produced a vivid sense of three - dimensional depth . wheatstone went on to discuss stereo - depth and its underlying geometry at length , however , with complete control over what was presented to each eye , wheatstone s curiosity led him to try an obvious variation : what would happen if different images were presented to each eye ? toward the end of his paper , wheatstone ( 1838 ) illustrates the kind of stereo - image he used to investigate this question . it consists of two different upper case letters , one for the left eye and one for the right , each letter presented within a matching fusion circle . he then describes what happens when such an image is viewed through a stereoscope , and in so doing provides the first systematic description of binocular rivalry : if a and b ( fig . 25 . ) are each presented at the same time to a different eye , the common border will remain constant , while the letter within it will change alternately from that which would be perceived by the right eye alone to that which would be perceived by the left eye alone . at the moment of change the letter which has just been seen breaks into fragments , while fragments of the letter which is about to appear mingle with them , and are immediately after replaced by the entire letter . it does not appear to be in the power of the will to determine the appearance of either of the letters , but the duration of the appearance seems to depend on causes which are under our control : thus if the two pictures be equally illuminated , the alternations appear in general of equal duration ; but if one picture be more illuminated than the other , that which is less so will be perceived during a shorter time . 6 . when complex pictures are employed in the stereoscope , various parts of them alternate differently . , bold emphasis added ) remarkably , wheatstone s ( 1838 ) pioneering observations manage to capture all the main characteristics of binocular rivalry . he refers to the alternation of the monocular images , he mentioned the fragmented or piecemeal state that may occur during perceptual transitions , and he describes the changes in relative dominance associated with changes in stimulus strength . importantly , he also claimed not to be able to determine which image dominates by an act of will . in so doing , wheatstone ( 1838 ) made the first assertion in what was to be a long and vigorously contested debate : can binocular rivalry be controlled by voluntary attention ? in wheatstone s own time , this question engendered much discussion , with the great early scholars of perception voicing a variety of views on it ( e.g. , hermann von helmholtz , ewald hering , and william james ) . indeed , arguments about the role of attention in binocular rivalry have continued to the present day and the issue remains central in contemporary rivalry research . one could argue that this question is central to the most recent major controversy in binocular rivalry : whether rivalry is eye - based or image - based ( for a review of the controversy , see blake and logothetis , 2002 ) , where an image - based view on binocular rivalry would allow more room for voluntary control . as this historical background shows , the question of whether or not binocular rivalry is under voluntary ( or attentional ) control is as old as research into the fascinating phenomenon of rivalry itself . in this review , we will evaluate wheatstone s ( 1838 ) claim that attention can not determine rivalry dominance in light of research published since . in addition , we will review other studies which have sought to demonstrate a more moderate point , namely that attention can be used to modulate binocular rivalry , even if it can not ultimately determine what is perceived when experiencing it . as well as reviewing the literature relating to rivalry and attention , we will also discuss recent findings suggesting that neural networks implicated in binocular rivalry and visual attention overlap . overall , the review will focus as much as possible on studies of rivalry and attention . for more information about the many other aspects of binocular rivalry , the reader is referred to more general reviews ( blake and logothetis , 2002 ; alais and blake , 2005 ; tong et al . among the first scholars to study binocular rivalry , it was helmholtz ( 1925 ) who argued most forcefully that perception during rivalry was under volitional control . indeed , helmholtz claimed to have full control over what he perceived when viewing incompatible images , stating that i can retain the image of one pair or the other according to my fancy ( helmholtz , 1925 , pp . 497 ) . on this view , where perceptual dominance is controlled by the observer s volition , the mechanism responsible for selecting the dominant image must be at a high - level of processing . if a lower - level mechanism were to determine perceptual dominance in rivalry , then it should not be under the observer s control . this led helmholtz ( 1925 ) to conclude that binocular rivalry was indeed a high - level phenomenon , or as he labeled it : a psychic act . in adopting this position , helmholtz dismissed the retinal view taken by others such as breese ( 1899 ) and hering ( 1964 ) who emphasized the role of low - level factors in determining rivalry dominance . breese ( 1899 ) conducted his own experiments to test whether observers could control binocular rivalry . in his experiments , observers viewed a red and a green field presented separately to the eyes , and were instructed to try to hold one of them dominant . breese ( 1899 ) found that observers could lengthen the dominance period of the nominated color field according to instruction , but that the average number of perceptual alternations did not change . he also noted that in trying to maintain dominance of one image , observers made vigorous eye movements . he suspected that eye movements exerted a substantial influence over which of the images was dominant and for how long , and he went on to conduct experiments on himself in which he kept his gaze tightly fixed while inspecting rival images . under these conditions , he was not able to exert volitional control over rivalry dominance . this observation led breese ( 1899 ) to conclude , as hering ( 1964 ) had before him , that eye movements rather than volitional control were responsible for influencing perceptual dominance in binocular rivalry , and that the failure to control eye movements was the reason that helmholtz was able to control perceptual dominance in rivalry . in the ensuing decades , a number of other low - level and peripheral factors were studied for a possible confounding role in the apparent ability of attention to determine rivalry dominance . simple fixational eye movements were further considered , as were the possible roles of eye blinks and other ocular motor acts such as the intrinsic eye muscle activity involved in pupillary constriction and accommodation . mcdougall ( 1903 ) and george ( 1936 ) , for example , paralyzed the eye muscles of a single eye and found that this decreased the amount of apparent voluntary control over rivalry dominance , but it did not eliminate it . several other studies investigated the role of blinking in control over rivalry dominance ( washburn and gillette , 1933 ; brny and halldn , 1947 ; meredith and meredith , 1962 ) , with each reporting that voluntary control over rivalry was still possible when accounting for blinking . although these early studies addressing peripheral mechanisms and their possible confounding roles in volitional control over rivalry made strong claims , lack ( 1978 ) surveyed the literature and noted that all these studies were poorly conducted . for example , mcdougall ( 1903 ) and george ( 1936 ) used only one observer in their studies , and meredith and meredith ( 1962 ) did not actually measure blink rates in their investigation . clearly , a properly controlled reinvestigation of these peripheral factors was needed . in his dissertation selective attention and the control over binocular rivalry , lack ( 1978 ) presents several carefully controlled experiments designed to address the limitations of these preceding studies of peripheral ocular factors in rivalry , whose claims had been lingering for almost a century . in a systematic series of experiments , he was able to exclude a role for eye movements , blinking , accommodation , and pupillary activity as potential confounds in the apparent ability to voluntarily control binocular rivalry . with these peripheral factors excluded , lack then returned to the central question : can observers attentionally control binocular rivalry ? lack s ( 1978 ) studies first established that unpracticed observers were able to exert a modest degree of attentional control over binocular rivalry , and he went on to show that the extent of voluntary control could be increased with practice . first , the claim against attention s control over rivalry , which was based on uncontrolled peripheral factors , could be ruled out . second , with peripheral factors controlled , lack ( 1978 ) showed that perceptual dominance in binocular rivalry could be significantly influenced by an act of selective attention ( we will return to this point later ) . in the history of binocular rivalry , lack s ( 1978 ) study was a turning point that paved the way for a return to an examination of the role of attention in rivalry . in recent years , studies by meng and tong ( 2004 ) and van ee et al . ( 2005 ) have revived the issue of voluntary control and reach a similar conclusion to that of lack ( 1978 ) : control over binocular rivalry is possible . meng and tong ( 2004 ) compared the extent to which attentional control was possible for binocular rivalry and for the necker cube . they instructed observers to try to hold one image dominant ( or one perspective , in the case of the necker cube ) at the cost of the other , and compared this to a neutral baseline . they observed that a degree of attentional control was possible for both stimuli , but that there was less control over perception during binocular rivalry than for the necker cube . however , when observers followed a different instruction to try to attentionally modulate the rate of perceptual alternation in the displays the effect of attention on alternation dynamics was considerably greater , and comparable control was observed for rivalry and the necker cube . thus , although attentional control over binocular rivalry was possible , the authors concluded that rivalry involved a more automatic , stimulus - driven form of perceptual bistability than did the necker cube . a paper by van ee et al . ( 2005 ) also looked at attentional modulation of alternation dynamics in several bistable displays , comparing binocular rivalry , the necker cube , and a bistable stereo - slant stimulus . similar to meng and tong s ( 2004 ) observation , van ee et al . ( 2005 ) also found that attentional control over binocular rivalry dynamics was less than was possible for other perceptually bistable displays . in related papers ( van dam and van ee , 2006a , b ) , the role of eye movements in voluntary control over bistable stimuli was re - investigated , returning to the possible contribution of peripheral mechanisms to voluntary control . these studies analyzed the role of eye movements and found a positive correlation between saccades and perceptual alternations during binocular rivalry , implying that eye movements can be used actively to instigate a perceptual alternation . interestingly , however , these authors found that the role of saccades was not different in voluntary control conditions . thus , when trying to control perception during rivalry , observers did not use eye - movement strategies that were any different to those employed during passive viewing . this conclusion agrees with lack s ( 1978 ) investigation nearly 30 years earlier and confirms that voluntary control over binocular rivalry is indeed possible and can not be explained by eye movements . interestingly , a recent study showed that voluntary control over binocular rivalry can be increased when accompanied by congruent auditory information ( van ee et al . observers viewed a rival display consisting of a looming and a rotating pattern . when instructed to try to hold the looming percept dominant , attentional control was greater when a correlated looming sound accompanied the visual stimulus . this result shows a cross - modal influence on binocular rivalry and therefore broadens the search for the attentional mechanisms underlying voluntary control over binocular rivalry . moreover , this cross - modal effect on binocular rivalry was only observed when the stimuli were attended : the mere presence an auditory signal correlated with the visual stimulus that observers were instructed to maintain in dominance did not help them in their task . the auditory signal had to be actively attended if the sound signal were to help to maintain the looming percept dominant in binocular rivalry . the correlation between the auditory signal and the visual stimulus to be attended was also critical , as a looming sound with a different rate to the looming visual stimulus was ineffective at enhancing perceptual control . in a couple of interesting extensions of this work , the authors also report that a correlated tactile stimulus is equally effective as the correlated auditory signal at facilitating attentional control over visual rivalry , and that a combination of auditory and tactile stimuli is even more effective . in addition , control over a bistable auditory stimulus was found to be enhanced by adding a correlated visual stimulus . the earliest debate surrounding the role of attention in binocular rivalry was primarily concerned with whether perception during rivalry could be controlled entirely by an act of will . there is a clear analogy between attentional selection among competing objects and perceptual selection in rivalry between competing images . although appealing , this notion at least in its strongest form is easily overturned by empirical experience as selecting an image for perceptual dominance is only partly under the control of an observer . this led to the role of attention in rivalry being ignored for a long period . lack s ( 1978 ) careful experimenting on the topic , however , opened the door for a weaker form of the attention hypothesis by showing clearly that attention is at least a factor at work in binocular rivalry , even if it is not the primary or causative one . not surprisingly , therefore , the last decade or so has seen a number of studies published that have revisited the issue of attention and rivalry and asked a more subtle question : how can the various forms of attention modulate ( if not totally control ) binocular rivalry ? a fundamental distinction is drawn in the attention literature between voluntary or endogenous attention and involuntary or exogenous attention ( see bundesen and habekost , 2008 ; wright and ward , 2008 ) . both are acts of attentional selection , but endogenous attention is a voluntary choice to focus on an object , location , or feature ( an act of will , or as helmholtz called it : immediate attention ) whereas exogenous attention occurs when a stimulus onset or stimulus change captures attention and is automatically selected . this is an involuntary form of attention ( or mediate attention in helmholtz s terms ) . the first paper ( ooi and he , 1999 ) among the recent flurry of studies examining attention and rivalry investigated how both forms of attention voluntary and involuntary affect binocular rivalry . ooi and he ( 1999 ) first investigated the ability of voluntary attention to sustain dominance of a selected rival target . to do this , they exploited a well - known effect that a transient change in the suppressed eye s stimulus is an effective way to trigger a perceptual switch to that eye ( grindley and townsend , 1965 ; walker and powell , 1979 ) . ooi and he ( 1999 ) instructed observers to attend to one of four targets presented to the dominant eye , and a transient perturbation was made to the stimulus in the suppressed eye . they observed that when the transient was located at the location corresponding to the attended target in the dominant eye , dominance of that target was terminated less often than when the transient occurred at the location of one of the three unattended targets in the dominant eye . this result shows that voluntarily attending to a dominant image will help maintain the selected image in a state of perceptual dominance . ooi and he ( 1999 ) also investigated whether involuntary attention directed to a suppressed stimulus could break its suppression and cause the suppressed stimulus to become dominant . they tested this using a monocular pop - out cue ( a pair of parallel lines ) that flanked the location of one rival target in a circular array of six rivaling targets . a cue was added around all six targets ( thereby controlling for stimulus onset ) but five cues were horizontal line pairs and the critical sixth cue was a vertical pair and thereby popped out of the display as an effective exogenous cue . the authors found that this salient monocular cue significantly enhanced the tendency of the cued target to achieve dominance , relative to the non - cued targets . this finding demonstrated an effect of involuntary attention on the suppressed image in that the suppressed image was more likely to return to dominance when attention was drawn to it automatically by a salient monocular pop - out cue . together with their manipulation of endogenous attention , this study provided some of the first empirical evidence that both endogenous and exogenous attention can modulate the neural processes underlying binocular rivalry . in a recent study by paffen and van der stigchel ( 2010 ) it was shown that involuntary attention can also initiate a perceptual alternation : in their experiments , rival targets were presented both to the left and right of fixation . observers were instructed to press either of two buttons corresponding to the two rival locations whenever an alternation was perceived at these locations . at random intervals , an exogenous cue surrounding the rival targets was presented at one of the two locations . the results showed that alternations occurred earlier as well as more frequently at the location where the cue was presented . these results suggest that the occurrence of perceptual alternations is related to the spatio - temporal properties of visual attention : moving attention to a spatial location increases the chance of perceiving a perceptual alternation at that location . from the studies discussed so far , it is clear that attentional selection can be used to modulate binocular rivalry . selecting one image from a pair of rivaling images , whether by exogenous or endogenous attentional selection , will suffice to reveal this . endogenously attending to the dominant image will extend its dominance duration , and exogenously cueing attention to the rival images will increase the likelihood of a perceptual switch ( ooi and he , 1999 ; paffen and van der stigchel , 2010 ) . this question was addressed in an influential early study by ooi and he ( 1999 ) . in the final experiment of that paper , observers were briefly presented with a pair of rival images , one of which was preceded by a surrounding cue . the critical manipulation , however , involved presenting a vernier target at a different spatial location and having the observer perform a second task : was the vernier stimulus offset to the left or to the right ? a preceding experiment had shown that cueing an image usually caused it to dominate first . the results of the dual - task experiment showed that this cueing effect was reduced : the cued image became dominant less often in the divided attention condition , compared to a focused condition with no vernier task . this result nicely shows that dividing attention between two tasks weakens its ability to select a given stimulus at rivalry onset . one of the hallmarks of binocular rivalry is that constant visual input leads to spontaneous and ongoing changes in perceptual dominance . if withdrawing attention from the rivalry stimuli to a demanding competing task were to eliminate perceptual alternations , it would imply that attention is necessary for binocular rivalry to occur . they had observers continually track their rivalry alternations while also performing a secondary task at a different spatial location . surrounding occasional bursts of weakly coherent motion intermittently replaced the incoherent motion , and observers had to detect when these weak motion bursts occurred . with this dual - task paradigm , paffen et al . ( 2006 ) found that the rate of rivalry alternations decreased when observers had to detect the motion bursts , compared to when the motion was ignored . thus , withdrawing attentional resources from the rivalry stimuli slowed the rate at which rivalry alternations occurred , but did not abolish them . as attentional resources might still have been deployed to the rival images while detecting motion bursts , the authors went on to increase the difficulty of the motion detection task . even when the motion detection task was difficult ( d were around 1 ) , rival alternations were far from arrested : alternation rates were still around 0.35 alternations per second . although these results show that rival alternations still occur when attentional resources are withdrawn , it is clear that attentional resources affect the rate at which rival alternations occur : when attentional resources are withdrawn , rival alternations become slower . a similar result was recently reported by paffen and hooge ( 2011 ) . in this study , observers reported perceptual alternations in multiple rival images . the results showed that the number of alternations reported per rival pair went down when the number of rival images was increased . notably , withdrawing attention does not only slow alternations during binocular rivalry , but affects other instances of bistable perception as well ( e.g. , reisberg and oshaughnessy , 1984 ; pastukhov and braun , 2007 ) . for example , pastukhov and braun ( 2007 ) performed experiments in which attention was withdrawn from a bistable plaid stimulus . interestingly , when attentional resources are deployed in another modality , rival alternations also become slower : alais et al . ( 2010b ) recently showed that attending to auditory signals also slows alternations in a visual rival display . in addition , it was reported that withdrawing attention had a bigger effect when rivalry was instigated between images of a house and a face , than when instigated between two gratings . ( 2005 ) : in that study , observers had greater ( voluntary ) control when rivalry occurred between images of a house and a face then when between sinewave gratings . this seems to imply that the influence of attention on rival images increases as these images are analyzed higher up the visual processing stream . to our knowledge , there is one neuro - imaging study investigating the withdrawal of attention on binocular rivalry . for this , ( 2007 ) used the phenomenon of traveling waves that occurs when rival images are of considerable size : a transition from one percept to the next often involves a local breakthrough of the suppressed image , followed by a traveling wave of emergent perceptual dominance of the other parts of the suppressed image ( wilson et al . , 2001 ) . when attention was directed to the rival images , traveling waves of activity in v1 , v2 , and v3 correlated both temporally ( i.e. , the speed of the waves in perception and neural tissue ) and spatially ( the location of the waves in the visual field and retinotopically in the neural tissue ) with perceived traveling waves . when attention was diverted to monitoring letters at the center of the display activity in v1 still correlated with perception of the dominance wave , in v2 and v3 , however , the correlation was abolished . thus , when attention was diverted , rivalry - related activity was present in v1 , but not in later areas . to this point , we have demonstrated a number of ways by which attention can modulate binocular rivalry . a converse question can also be asked : is a rivaling stimulus able to automatically attract attention ? in other words , is binocular rivalry ( or more specifically , interocular conflict ) a pop - out attribute ? the first investigation of this question ( wolfe and franzel , 1988 ) involved a series of experiments in which observers searched for targets defined by interocular conflict among an array of distractors that were interocularly matched . the stimuli were square - wave grating patches , with the distractors being interocularly matched in orientation and the target being orthogonally oriented gratings . by measuring search times for such targets among various numbers of distractors , the results showed that search for a target defined by interocular conflict was not parallel ( or in contemporary terms , was not efficient ) , nor was it much faster than the converse relationship ( searching for a target of fused orientations among rival distractors ) . from this investigation , wolfe and franzel ( 1988 ) concluded that targets defined by binocular rivalry do not pop - out . in a recent study , however , paffen et al . ( 2011 ) , showed that search for targets defined by interocular conflict could lead to a near efficient search ( corresponding to search slopes of about 15 ms per item ) , depending on the stimulus conditions . these authors found that slow search times occurred when high - contrast stimuli were used , but that search times were faster and more efficient for lower contrasts . while this explains the discrepancy with wolfe and franzel s ( 1988 ) findings ( they used a high - contrast display of white gratings on a black background ) , it does seem counterintuitive : lowering the contrast of a search target generally attenuates search performance ( pashler et al . , 2004 ) . however , when dissimilar images are presented dichoptically , it takes a while for binocular rivalry to occur : during the first 150 ms or so , images do not rival but instead undergo a false fusion ( wolfe , 1983 ) . this is not normal fusion ( as the monocular images are not matched ) and observers can easily discriminate between fused images and images that are fused optically ( georgeson and meese , 1997 ) . furthermore , it has been shown that the duration of the false fusion period ( or proto - rivalry , as it was labeled by solomon et al . , 2006 ) increases as the contrast of rival images decreases ( liu et al . , 1992 ) . ( 2011 ) reasoned that this relationship was the cause of the higher search efficiency observed in low contrast displays . ( 2011 ) presented the search displays for just 150 ms ( thereby optimizing abnormal fusion ) , observers could easily detect the search target defined by interocular conflict . as has been discussed above , the debate about the relationship between binocular rivalry and attention has been present since research into rivalry first began . for helmholtz ( 1925 ) , binocular rivalry was a psychic act : keeping an image dominant in perception during binocular rivalry was an act of both immediate ( voluntary ) and mediate ( involuntary ) attention . if it seemed keeping an image dominant in perception by mere voluntary attention was difficult , it was because the image would eventually cease to be new , and voluntary control would become more difficult . helmholtz thought this tendency could be counteracted by keeping an image interesting , for example , by counting the number of lines in the display . the parallel with visual attention is obvious : selection of visual information can occur voluntarily , but can also occur when aspects of the stimulus can attract attention automatically . more recently , after reviewing several commonalities between attention and binocular rivalry , leopold and logothetis ( 1999 ) concluded that mechanisms of selective attention and multistability might be closely related ( leopold and logothetis , 1999 ) . first , both visual attention and binocular rivalry involve competition in which some information is selected at the expense of other information . second , neuro - anatomical networks of visual attention and binocular rivalry show considerable overlap . the first observation , that visual attention and binocular rivalry are both acts of selecting information , was used in a study by mitchell et al . ( 2004 ) . in their experiments , observers binocularly viewed two counter - rotating fields of rotating dots that were superimposed in transparent motion . attention was then cued to one of the surfaces by a brief translational motion pulse after which the viewing conditions quickly changed to dichoptic , with each surface presented to a separate eye to trigger binocular rivalry . the authors observed that the surface that was cued prior to the initiation of dichoptic viewing tended strongly to be the dominant image in the first period of rivalry . based on these results , the authors concluded that attention and rivalry rely on shared object - based selection mechanisms and that both engage common competitive mechanisms ( mitchell et al . , 2004 ) . a related result has earlier been published by ooi and he ( 1999 ) , who showed that pre - cuing the location of one rival target among an array of six rival targets raised the likelihood that it would become dominant at rivalry onset . while both these two studies used exogenous cues , chong and blake ( 2006 ) went on to study the effect of an endogenous cue on initial phase of rivalry dominance . observers were presented with binocularly viewed plaids whose component gratings underwent independent changes in orientation and spatial frequency . similar to mitchell et al.s ( 2004 ) procedure , each of the gratings was then presented separately to the eyes and the same result was reported : initial dominance tended to favor the endogenously attended grating . as the above discussion shows that attention and binocular rivalry do interact , the next question is how they interact . a few studies suggest that attention affects binocular rivalry by affecting the effective contrast of the rivaling images ( chong et al . , 2005 ; chong and blake , 2006 ; paffen et al . , 2006 ; first , changing the contrast of rival images has a profound impact on the temporal dynamics of rivalry : lowering the contrast of both images will lengthen the time that each image is dominant in perception ( e.g. , levelt , 1965 ; brascamp et al . , 2006 ) . second , attending a stimulus is known to increase its perceived contrast ( carrasco et al . , 2004 ) , a finding that parallels the finding that attending a stimulus ( contrasted with disattending the stimulus ) affects neural responses in a manner similar to increasing the contrast of that stimulus ( reynolds and chelazzi , 2004 ) . ( 2006 ) used these two observations and reasoned that one influence of attending to the rival stimuli could be to increase their effective contrast . ( 2005 ) had observers track spatial frequency changes of one of two rival targets , or increased the contrast of one of the targets as soon as it became dominant . these authors reported that both attending to the grating and increasing its contrast were effective at increasing the perceptual dominance of that grating . the relationship between attention and contrast in binocular rivalry it has already been noted above that observers tracked rivalry alternations in a central stimulus while at the same time detecting brief motion bursts in an annulus surrounding the rival targets . this attentional condition was compared with a passive viewing condition , and both were done at four levels of contrast . the results showed that diverting attention to the motion detection task had a quantitatively similar effect on slowing the alternation rate as halving the contrast of the rival targets . ( 2005 ) , with the tight relationship between stimulus contrast and rivalry alternation rate , show that attention s influence on binocular rivalry can be modeled as a change in effective contrast . when rival targets are attended , the effective contrast of the targets increases , leading to an increase in alternation rate equivalent to that produced by increasing stimulus contrast by roughly a factor of two ( paffen et al . , 2006 ) . the observation that attention affects rivalry by boosting its effective contrast predicts that attention and contrast should influence rivalry in the same way . interestingly , levelt ( 1965 ) noticed that changing the contrast of only one rival image actually affected the dominance duration of the other image , leaving its own dominance unaffected . this famous finding ( formalized into levelt s 2nd proposition ) leads to the counterintuitive prediction that attending to one rival image will affect the dominance of the other image , and not the attended one . et al.s ( 2005 ) study , the mean dominance duration of the attended grating was increased by as much as 50% , but the mean dominance duration of the unattended grating was no different from what was observed in the passive viewing condition . this result shows that attention only exerts its influence on the stimulus that is perceptually dominant , and not on the suppressed stimulus , thereby violating what would be expected from levelt s 2nd proposition . ( 2005 ) remark , this is not surprising because one can only attend to an image that it is perceptually present and available for selection ; it is impossible to select an image that can not be seen . their results square with those on voluntary control mentioned above , where voluntary control generally increases the time the attended image is perceived . in contrast to these findings , hancock and andrews ( 2007 ) reported that attending one of two rival gratings decreased the mean dominance duration of the unattended grating , leaving that of the attended grating unaffected . it is unclear what exactly explains the discrepancy between the findings of chong et al . ( 2005 ) and those of hancock and andrews ( 2007 ) but there is clearly more to discover about the role of attention on rivalry dominance durations . the second important point that leopold and logothetis ( 1999 ) made was that a number of the brain areas involved in attention are also implicated in binocular rivalry . at the core of this is the observation that both attention and binocular rivalry involve a distributed fronto - parieto - occipito network that is crucial in attentional selection and mediating perceptual alternations during binocular rivalry . in the case of visual attention , the existence of such a network is relatively undisputed : many studies have shown fronto - parietal areas to be crucial in exerting top - down control over visual perception ( posner and dehaene , 1994 ; desimone and duncan , 1995 ; kastner and ungerleider , 2000 ; corbetta and shulman , 2002 ; bisley , 2011 ) . as an example , zanto et al . ( 2011 ) recently targeted frontal areas with rtms and found that this lead to diminished top - down modulation of visual processing in posterior ( visual ) areas . in binocular rivalry , perception - related activity has been found as early as the lateral geniculate nucleus ( lgn : haynes et al . , 2005 ; wunderlich et al . , 2005 ) , primary visual cortex : ( polonsky et al . , 2000 ; tong and engel , 2001 ; lee et al . , 2005 ) and later processing areas such as fusiform face area ( ffa ) and the parahippocampal place area ( ppa : tong et al . , 1998 ) . interestingly , one of the first imaging studies of binocular rivalry found transient activation related to perceptual alternations in parietal and prefrontal areas ( lumer et al . , 1998 ) . in this study , bold activity was contrasted between observers viewing rival displays and displays in which rivalry was mimicked ( images were presented in alternation on the display ) . the results showed that right fronto - parietal regions showed greater activation during rival alternations than during simulated rivalry . the authors noted that these brain regions were also involved in spatial attention and suggested that both visual attention and binocular rivalry may there for call upon a common neural machinery in fronto - parietal cortex , involved in the selection of neuronal events leading to visual awareness subsequent to lumer et al.s ( 1998 ) study , several later studies also found this fronto - parietal network to be implicated in binocular rivalry ( lumer and rees , 1999 ; srinivasan et al . , 1999 ; miller et al . , 2000 ; cosmelli et al . , 2004 ; sterzer and rees , 2008 ) . the involvement of frontal and parietal regions in binocular rivalry , therefore , is not disputed . the question remains , however , whether perceptual alternations during rivalry arise in these areas and mediate earlier processing via feedback ( as suggested , for example , by leopold and logothetis , 1999 ) , or whether perceptual alternations arise at an earlier level of visual processing and then feed forward to fronto - parietal areas . the feedback possibility would more closely correspond to the notion of frontal areas exerting top - down control over visual perception , as in the case of selection by attention . the feedforward possibility would correspond more with a bottom - up component to perceptual alternations during rivalry with the competition between the monocular inputs resolved at early levels , where subsequent percept - related activity can be found higher up the processing stream . there is some evidence for the feedback possibility ( sterzer and kleinschmidt , 2007 ; britz et al . , 2009 ) , where frontal ( sterzer and kleinschmidt , 2007 ) and parietal ( britz et al . importantly however , these results were obtained by using a complex necker cube ( britz et al . , 2009 ) and apparent motion ( sterzer and kleinschmidt , 2007 ) stimuli which ( 2008 ) , who used binocular rivalry stimuli and observed that while parietal and frontal activation were involved in mediating perceptual alternations , a phase analysis of this activity showed it was the result of occipital sources . recently , is has become evident that regions of parietal cortex are particularly important in mediating perceptual alternations . ( 2010 ) applied tms over right superior parietal cortex ( spl ) and found that this shortened dominance durations during binocular rivalry . ( 2010 ) found that cortical thickness of bilateral superior parietal cortex was negatively correlated with the speed of perceptual alternations triggered by a structure - from - motion stimulus . interestingly , these authors went on to apply continuous theta - burst stimulation ( ctbs ) over right and left spl and found that applying this kind of tms increased percept durations . the apparent contradictions between the two studies was resolved in another study by kanai et al . ( 2011 ) . by applying a roi analysis based on the relation between percept durations and cortical thickness reported by kanai et al . ( 2010 ) , different sub - regions of spl were targeted with offline tms . disrupting right anterior spl was found to shorten percept duration , while disrupting right posterior spl increased percept durations . importantly , these results apply both to perceptual alternations caused by binocular rivalry stimuli and a structure - from - motion stimulus , implicating that these areas are similarly involved in both kinds of bistability . although this study resolved the conflicting results of carmel et al . ( 2010 ) on the other , they are in conflict with another study showing that online tms over anterior spl increases percept durations during binocular rivalry ( zaretskaya et al . , 2010 ) . the reason for this discrepancy is not clear , although one notable difference between the studies is that zaretskaya et al . this difference may be critical , as it is possible that the region targeted by offline tms spreads during the offline period to affect non - targeted regions during testing . more research will be needed to resolve this discrepancy but for the moment these tms studies show that parietal cortex , a crucial structure in ( spatial ) attention ( e.g. , corbetta and shulman , 2002 ) , also has a critical role in determining binocular rivalry dynamics . it is less clear what these studies imply regarding feedforward versus feedback initiation of perceptual alternations because apart from affecting processing in parietal areas , tms likely also affects the feedback / feedforward interplay between parietal and other processing areas at both lower and higher stages . a specific involvement of frontal areas in bistable perception has recently been implicated by windmann et al . this study used patients with prefrontal lesions who were given one of three instructions ; to hold one of the two bistable percepts , to look passively at the stimulus , or to try to speed up the rate of alternations . interestingly , the ability to hold a percept was not different between patients and controls , however , patients were less able to speed up the rate of perceptual alternations by will . although binocular rivalry was not used in this study , it suggests that prefrontal cortex serves a specific role in attentional control over bistable stimuli . as the authors remark , damage to prefrontal cortex might have hampered the ability to intentionally switch between two images , leaving the ability to hold a percept unaffected . we noted in the introduction that it was wheatstone ( 1838 ) who first posed the question of whether binocular rivalry can be controlled by will . more than 170 years later , and with the benefit of techniques and methodologies that were not even conceivable when he published his pioneering observations in 1838 , we can now answer his question : voluntary control over binocular rivalry is possible , yet limited . like many highly polarized debates , carefully controlled studies have clearly shown that observers can use attention to modulate their perception during binocular rivalry , either lengthening the dominant percept s duration or changing the overall alternation rate ( lack , 1978 ; meng and tong , 2004 ; van ee et al . , 2005 ) . complementing this is the wealth of data showing that binocular rivalry depends strongly on low - level visual attributes such as orientation , spatial frequency , and contrast ( blake , 1989 ) . the conclusion that binocular rivalry can be partially controlled by voluntary attention is suggestive of an interplay between top - down and bottom - up factors . the fact that observers can not voluntary take full control over their perception in rivalry suggests that bottom - up factors are important . it has long been theorized that binocular rivalry is initiated early in cortical processing , at a stage where monocular inputs are first combined , and that reciprocal inhibition exists between the monocular neural populations ( blake , 1989 ) . the balance between left- and right - eye neurons varies over time because of adaptation , changing the balance , and causing perceptual switches ( alais et al . , 2010a ) . within this framework , the image that happens to be dominant at a particular point in time is available to be attentionally selected by top - down processes . as is now well established , this will boost the neural response to the selected image ( reynolds and chelazzi , 2004 ) and raise its effective contrast , causing it to dominate more . however , this process can not continue indefinitely as there is also adaptation taking place that will weaken the response to the dominant image and inevitably lead to a switch in perceptual state . thus , just as there is a reciprocal relationship between the left- and right - eye s responses , there is also a reciprocity between , on one hand , the response - boosting effect on the early neurons from top - down selection ( reynolds and chelazzi , 2004 ) , and on the other hand , the response decrement effect due to neural adaptation in these early neurons . because of this reciprocity , an observer s attempt to attentionally control their perception in rivalry is inevitably limited . while the primary role proposed for early interocular interactions in binocular rivalry has been contrasted with results implying that binocular rivalry involves later processing stages ( kovcs et al . , 1996 ; logothetis et al . , 1996 ) , these results can be integrated within the contemporary view that binocular rivalry involves a multitude of visual stages from early to late processing ( ooi and he , 1999 ; blake and logothetis , 2002 ; wilson , 2003 ; blake and wilson , 2011 ) . this view also provides the neural framework within which the top - down / bottom - up interplay that we are proposing can take place . from the literature reviewed above it is obvious that neuro - anatomical networks involved in attentional selection and binocular rivalry overlap . a series of fmri studies by he and colleagues ( fang and he , 2005 ; jiang and he , 2006 ) showed that for some classes of stimuli , a cortical response was still elicited even when they were perceptually suppressed . this was found in dorsal areas for visual objects such as tools , and in ffa , and sts for faces , especially fearful faces . further , it has been found that when erotic images are suppressed they are still able to influence the spatial allocation of attention ( jiang et al . although these studies used continuous flash suppression ( tsuchiya and koch , 2005 ) rather than conventional binocular rivalry , they do suggest interesting possibilities relevant to this review . one is that visual information could arrive in extrastriate visual cortex through subcortical pathways and bypass early suppression ( weiskrantz , 1997 ; morris et al . , 1999 ) . a second possibility is that suppression is an attenuation process that leaves signals weakened but still able to activate subsequent areas , albeit without awareness . broadly , these findings are consistent with other recent evidence suggesting a multistage rivalry process ( nguyen et al . , 2003 ; alais and melcher , 2007 ) and that dorsal and ventral rivalry - processes may be independent ( alais and parker , 2006 ) . although it is tempting to conclude that the fronto - parietal areas involved in attentional selection ( duncan , 2001 ; miller and cohen , 2001 ) must also be involved in selecting and maintaining the dominant image during binocular rivalry , it is not clear that this conclusion follows . although a role for these areas in selection may be evident in some circumstances , the involvement of these areas does not appear to be strictly necessary to select a that is , it is clear that an adapting reciprocal inhibition model of rivalry can also explain perceptual switches ( alais et al . , 2010a ) , and that such a model can be located early in visual processing ( tong and engel , 2001 ; lee et al . , 2005 , 2007 ) . indeed , the sufficiency of the early process to produce switches may explain the finding in several reports that while removing attention slows the rate of rivalry alternations , the alternations continue to occur in the near - absence of attention ( paffen et al . , 2006 ; pastukhov and braun , 2007 ; paffen and hooge , 2011 ) . in addition , this suggestion is in line with a very recent report by knapen et al . ( 2011 ) , who showed that frontal activation related to perceptual alternations was more likely reflecting a response to these alternations rather than being their cause . human frontal cortex has been implicated as the site responsible for maintaining conscious representations of the visual world ( crick and koch , 1995 ; rees , 2001 ) . from these observations , it could be hypothesized that prefrontal cortex is involved in selecting one of two competing images during binocular rivalry . nonetheless , it is still possible that a similar pattern of activity would be seen in prefrontal cortex without endogenous attention , simply as a consequence of maintaining a conscious representation of the current winner of the early reciprocal inhibition process . indeed ( 2006 ) who found that the ability to hold a percept dominant in perception was unaffected in patients with prefrontal lesions ( although this study did not use binocular rivalry displays ) . in sum , binocular rivalry may be considerably modulated by voluntary attention , but it is not under complete attentional control . first , an adapting reciprocal inhibition arrangement between early monocular channels is sufficient to trigger switches in perceptual dominance independently of a high - level selection mechanism . second , the contrast enhancing effect of top - down attentional selection is counteracted over time by a response attenuating effect of neural adaptation which weakens the response to the dominant image . both of these processes can be thought of as reciprocal and therefore self - balancing processes , with the consequence that complete attentional control over binocular rivalry could never be realized . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

the number of people who are considered overweight or obese is climbing in the united states , with studies now demonstrating that in some demographic and age categories obese persons are beginning to outnumber those who are simply overweight . many factors contribute to obesity , such as dietary intake , inadequate exercise or sedentary lifestyles , various medical / metabolic conditions , or iatrogenically by medications prescribed to patients . medications in psychiatry are no exception to this with clear weight - inducing agents such as antipsychotics , antidepressants , and mood - stabilizing antiepileptics and lithium often used in routine care . gaining weight is undesirable to healthcare providers as it raises the probability of the development of associated health concerns and medical complications such as diabetes , hypertension , and osteoarthritis . what is sometimes overlooked is the toll it takes on patients emotional and psychological state . a few pounds of weight gain may not seem like much , but to the individual patient that experiences unwanted weight gain it may be a larger burden , especially in those with an eating disorder or altered body image . these problems may lead to non - adherence to the prescribed treatment plan , resulting in sub - optimal results or perhaps treatment failure . unwanted weight gain is a common reason for antidepressant discontinuation and may prompt depressive recurrences in certain individuals . with a number of treatments and medications available for any particular clinical situation , determining which one to utilize can sometimes be a challenge for the clinician . clinicians generally become aware of federal approvals and weight loss indications and then assess each drug s day - to - day side - effect profile and must also determine if there are serious adverse side - effects to contend with . in this manner , each drug is ideally scrutinized prior the clinician prescribing it to any individual patient . rarely , there are head - to - head clinical trials to guide absolute medication selection . meta - analyses may be one way to review all weight loss medications as well . another possible method that can be used to help judge the overall efficacy of medications is through the use a statistical formula known as number needed to treat ( nnt ) and the same formula when examining undesirable outcomes such as adverse medication effects is the number needed to harm ( nnh ) . ideally , the nnt is very low , suggesting a better rate of lower weight in the case of weight loss medications . the nnh ideally should be a higher number , suggesting that the medication tends not to create side effects in a majority of patients . a truly ideal drug would have a nnt < nnh ratio that is very high . clinical data can be obtained for the intervention that is to be examined and can then be considered alongside other interventions and more actively compared . these numbers can be found by taking the inverse of the absolute risk reduction ( arr ) , which is calculated by subtracting the control event rate ( cer ) from the experimental event rate ( eer ) , for the placebo and intervention groups , respectively . the nnt or nnh is then rounded up to the nearest whole number and can then be considered in the context of the clinical question . to understand this , a nnt of 14 would mean that of one patient for every 14 people undergoing a particular intervention would experience a desired good clinical response attributable to the intervention itself , while the remaining 13 could be due to placebo effects or perhaps to nonresponse itself . the nnh is the number of patients taking a drug that it takes to reach one patient who has an adverse effect or harm . once the nnt and nnh values are determined , they can then be compared in a tabular or graphical form to allow some comparison among all agents . lower nnt numbers are often more desirable than higher nnt numbers , with the opposite being true when considering nnh values . however , there is more to examining these interventions than simply considering low nnt and high nnh numbers as the markers of success . for example , a drug may have an ideal low nnt but may have a rare risk of a serious side - effect ( hepatitis , cardiotoxicity ) . even a very rare serious side - effect may make prescribing the low - nnt ideal agent less palatable to patient and prescriber alike . also , ensuring the groups examined in the studies have relatively similar patient backgrounds , baseline characteristics ( weight , gender , bmi ) and demographics , as well as considering the individual side - effect profiles of each agent and how they relate to the individual patient will help guide the use of these nnt / nnh statistics . this paper seeks to review individual weight loss medications , their mechanism of action , and side - effect profiles , so that clinicians may increase their comfort level in prescribing . finally , nnt / nnh will be used to make global comparisons regarding these agents . first , a brief literature search was performed via medline up through july 13 , 2015 . the search terms obesity treatment and medication yielded 714 results that were considered to be target papers . of these , papers of large sample size , statistical power , and randomized controlled design were selected for nnt / nnh review . topiramate , and bupropion naltrexone were specifically searched with this group of available papers , as these represent the most modern era of drugs that are approved as prescription weight loss regimens . this literature review was not intended to be an exhaustive search , rather a source for obtaining background information on the medications themselves and obtaining enough trial data for the purposes of nnt and nnh calculations . pharmaceutical companies seeking us food and drug administration ( fda ) approval prior to marketing new medications are required to submit a report for review and approval , referred to as a new drug application ( nda ) . nda applications are required to outline clinical trial information including data on efficacy , safety , adverse effects , and trial sizes . each medication discussed in the paper was found using a basic web search consisting of the medication name and the term nda , and this information was secondarily reviewed in order to develop data to conduct nnt / nnh values . many trials defined their goals or end - points as groups that were equal to or greater than 5 , 10 , and 15% loss of their initial total body mass . as all drugs examined used at least 5 and 10% , those subsets were utilized for this review . the data pertaining to these endpoints were entered into a spreadsheet program , and calculations ( described above ) were performed to obtain the desired nnt and nnh for each medication . after the nnt and nnh values were calculated by the authors of this article , they were then placed into a graphical format to be used in an efficient manner by a clinician , labeled figures 1 and 2 in this article . it should be noted that weight loss studies vary based upon sample size , design ( randomized ) , stratification ( results analyzed based upon pre - treatment baseline weight or bmi , etc ) . where possible , larger scale , larger sample , randomized and placebo - controlled trials were preferentially utilized in this review . outside of nnt and nnh outcomes , clinicians must also weigh the general tolerability of the drug and ultimate risk of serious adverse effects even if the chance of these is quite small . for example , the best nnt medication , phentermine topiramate combination carries a risk of oligohydrosis , acute glaucoma , and acidosis . these are rare events more often detected when topiramate is used for treating epilepsy , but some patients may wish to tolerate a drug with higher nnt to findings to avoid having any of these specific medical risks . therefore , nnh and nnt is one variable that should be used in clinical decision making analysis and on a patient - by - patient basis . naltrexone is a mu - opioid receptor antagonist used for management of alcohol dependence and opioid addiction . bupropion is a norepinephrine - dopamine reuptake inhibitor and is currently used for treatment of both depression and seasonal affective disorder , as well as to aide smoking cessation efforts . although the mechanism for each individual medication is known , the effect while in their combined role is not entirely clear but could involve naltrexone dampening the neurological reward pathways in the brain , while the bupropion curbs the appetite . simply , appetite is reduced and the pleasure or reward for eating is also reduced . due to its bupropion component , this particular weight loss medication is contraindicated in those with a history of seizure disorder or anorexia . the former would be considered a serious adverse event and could limit its use in certain patients . the naltrexone component precludes the use of this medication in those who concurrently take an opiate medication as it could produce a fulminant opioid withdrawal to occur . these withdrawals are not lethal but clearly could be detrimental to the patient or could interfere with a needed pain management regimen . data were presented to the fda in 2010 , comparing the naltrexone bupropion combination ( n=2514 ) medication with placebo ( n=1319 ) in 4 trials . the most common reason for discontinuation in the treatment group was reported as undesirable medication side - effects , while failure to lose weight was attributed to be the leading reason for placebo group dropout . two subjects were mentioned in the nda report as having had a seizure that had no prior history , comprising 0.06% ( 2/3239 ) of the total participants . there were three 56-week trials available ( nb-301 , nb-302 , nb-304 ) with 5 and 10% end point comparisons between naltrexone sr 32 mg / bupropion sr 360 mg combination medication and placebo groups , which allowed a mean to be calculated for the purposes of nnt and nnh . the experimental group participants that lost 5% body mass did so in approximately 53.0% , with the placebo group responding at a rate of 25.9% , yielding an nnt of 4 . the experimental group participants that lost 10% body mass did so in approximately 28.2% , with the placebo group responding at a rate of 11.1% , resulting in an nnt of 6 . the most common adverse effect was nausea , with 6.3% ( 203/3239 ) of the pooled medication group reporting this , compared with 0.2% of placebo groups , resulting in an nnh of 17 . lorcaserin is a selective serotonin 5-ht2c receptor agonist medication , which may cause an anorectic effect via activation of proopiomelanocortin ( pomc ) neurons in the hypothalamus . the heart valvulopathies associated with the withdrawal of the nonspecific serotonin receptor medications dexfenfluramine or fenfluramine , are not associated with lorcaserin as this drug s mechanism is wholly different in nature . as lorcaserin agonizes the 5-ht2c receptor , typical side effects for lorcaserin include nausea , headaches , fatigue and dizziness . during the blossom trial , one patient of the 3195 in the 10 mg bid arm during the behavioral modification and lorcaserin second study for obesity management ( blossom ) trial was felt to have symptoms that could be serotonin syndrome . she became vertiginous , developed nausea , vomiting , diarrhea with small amount of blood noted , and blood pressure variability . the serotonin syndrome was likely due to a drug drug interaction as she was taking the cough suppressant with dextromethorphan . symptoms did not reappear when the subject restarted lorcaserin one week after antitussive discontinuation . at the end of one year in the blossom trial , 47.2% ( 77/1560 , p<0.001 ) of the lorcaserin 10 mg twice daily group experienced at least a 5% loss of total body mass , compared with 25% ( 385/1539 , p<0.001 ) who experienced the same level of weight loss in the placebo group . in comparing those that lost at least 10% of their body mass , the lorcaserin 10 mg group experienced a rate of 22.6% ( 353/1560 , p<0.001 ) , compared to a response in the placebo group of 9.7% ( 150/1539 , p<0.001 ) . this results in a calculated nnt for the 5 and 10% groups of 5 and 8 , respectively . the most common adverse effect experienced were headaches ; the lorcaserin group having a 16.8% ( 537/3195 ) incidence , the placebo group experiencing 10.1% ( 321/3185 ) rate , resulting in an nnh of 15 . approved by the fda in 1999 in prescription strength , it was rereleased as an over - the - counter medication a few years later at a lower dose . however this inhibition comes with the risk of adverse side effects such as increased flatulence , oily spotting , greasy loose stools , fecal urgency or frank incontinence . there are no known serious adverse effects , though there may be a worsening of hepatic function early in treatment . this finding is controversial with the most recent data showing little association . in a study published in 2006 , orlistat 60 and 120 mg trial participants with 5% loss of body mass included 42.3% ( 191/452 ) of orlistat 60 mg , around 44.6% ( 201/451 ) of orlistat 120 mg participants , and 23.0% ( 103/448 ) of the placebo group . trial participants with 10% loss of body mass included 14.6% ( 66/452 ) of orlistat 60 mg , approximately 17.1% ( 77/451 ) of orlistat 120 mg participants , and 5.6% ( 25/448 ) of the placebo group . this resulted in nnt values of 10 in both medication categories to achieve 5% total body mass loss , and an nnt for 10% losses in orlistat doses of 60 and 120 mg were 12 and 9 , respectively . while these numbers may seem encouraging , it is important to note that a significant portion of participants lost between 05% of body mass , with placebo showing 43.3% compared to orlistat 60 and 120 mg of 39.6 and 41.0% , respectively . one of the more common adverse effects reported was oily fecal spotting , which was defined by the sponsor as an uncontrolled seepage of oil without stool [ 9 , p. 58 ] . the orlistat 60 mg group experienced this adverse effect at 17.7% ( 110/623 ) , the 120 mg group had an incidence of 21.7% ( 137/632 ) , and placebo group had a 1.1% ( 7/634 ) incidence reported . this resulted in an nnh of 7 and 4 for the 60 and 120 mg groups , respectively . it has been in use since 1996 as an antiepileptic agent , and since 2004 for the prophylactic treatment of migraine headaches . there is some evidence that indicates topiramate can decrease calorie intake through promoting early satiety , or decreases in gluconeogenesis . phentermine was introduced in 1959 for the purposes of weight loss and continues to be prescribed today . appetite suppression is theorized to be achieved through increased hypothalamic norepinephrine release and raising serum levels of leptin . phentermine adverse effects include tachycardia , palpitations , insomnia , anxiety , and elevated blood pressure . although no major congenital malformations were apparent from pregnancies occurring during the clinical trials , there are concerns for this potential . the potential for increased teratogenicity would appear to outweigh the benefit of weight loss in a woman trying to become pregnant , so the combination medication was assigned pregnancy category x . this allows for comparison of the top dose of phentermine / topiramate , 15/92 mg daily between the trials but , limits the ability of examining the second drug dosage in each trial . the mean values of the top dose in ob-302 and ob-303 for 5 and 10% loss of total body mass were approximately 68.4 and 47.4% . this is compared to the placebo group losses for 5 and 10% loss of total body mass of 19.1 and 7.4% , which results in nnt values of 3 for both weight loss end points . the most common adverse effect of paresthesias occurred in 19.9% ( 315/1580 ) of the high dose medication group , the placebo group experienced a much lower rate of 1.9% ( 30/1561 ) , resulting in an nnh for this particular medication of 6 . the most recent anti - obesity medication approved is the glucagon - like peptide-1 ( glp-1 ) receptor agonist liraglutide , an endogenous ligand . glp-1 receptors are located on pancreatic beta cells , the activation of which causes more insulin to be released and the suppression of glucagon to occur secondarily . the medication as a once daily 1.8 mg subcutaneous injection has been used in the united states since 2010 as a treatment for type 2 diabetes mellitus , and the 3 mg once daily subcutaneous version was fda approved in 2014 for the treatment of obesity . it was approved in 2015 by the european medical agency ( ema ) for the same purpose . there is a theoretical increased risk of medullary thyroid carcinoma based on studies in rodents , but no known case have been reported in humans . this is the only non - oral drug discussed and this drug requires patients to inject their medication . several trials were completed with the largest being trial 1839 , a 56-week phase 3 trial which compared weight loss with liraglutide 3 mg ( n=2437 ) against placebo ( n=1225 ) . approximately 63% ( 1536/2432 ) of the experimental group achieved a weight loss of 5% body mass , and 27.1% ( 331/1220 ) of the placebo group achieved the same loss of body mass , resulting in an nnt of 3 . approximately 33.1% ( 805/2432 ) of the patients in the experimental group achieved a loss of 10% of body mass , while 10% ( 129/1290 ) of the placebo group achieved this same end point resulting in an nnt of 5 . around 40% of trial participants reported adverse effects of nausea , 15% had vomiting , and 21% experienced diarrhea , compared to patients in the placebo group at 14 , 4 , and 10% , respectively . in considering the most common adverse effect of nausea , the liraglutide group experienced a rate of 39.3% ( 1329/3384 ) , while the placebo group experienced the nausea at a rate of 13.8% ( 267/1941 ) , resulting in an nnh of 4 . in these trials , 9 patients developed a serious or severe case of acute pancreatitis compared to one in the placebo group . naltrexone is a mu - opioid receptor antagonist used for management of alcohol dependence and opioid addiction . bupropion is a norepinephrine - dopamine reuptake inhibitor and is currently used for treatment of both depression and seasonal affective disorder , as well as to aide smoking cessation efforts . although the mechanism for each individual medication is known , the effect while in their combined role is not entirely clear but could involve naltrexone dampening the neurological reward pathways in the brain , while the bupropion curbs the appetite . simply , appetite is reduced and the pleasure or reward for eating is also reduced . due to its bupropion component , this particular weight loss medication is contraindicated in those with a history of seizure disorder or anorexia . the former would be considered a serious adverse event and could limit its use in certain patients . the naltrexone component precludes the use of this medication in those who concurrently take an opiate medication as it could produce a fulminant opioid withdrawal to occur . these withdrawals are not lethal but clearly could be detrimental to the patient or could interfere with a needed pain management regimen . data were presented to the fda in 2010 , comparing the naltrexone bupropion combination ( n=2514 ) medication with placebo ( n=1319 ) in 4 trials . the most common reason for discontinuation in the treatment group was reported as undesirable medication side - effects , while failure to lose weight was attributed to be the leading reason for placebo group dropout . two subjects were mentioned in the nda report as having had a seizure that had no prior history , comprising 0.06% ( 2/3239 ) of the total participants . there were three 56-week trials available ( nb-301 , nb-302 , nb-304 ) with 5 and 10% end point comparisons between naltrexone sr 32 mg / bupropion sr 360 mg combination medication and placebo groups , which allowed a mean to be calculated for the purposes of nnt and nnh . the experimental group participants that lost 5% body mass did so in approximately 53.0% , with the placebo group responding at a rate of 25.9% , yielding an nnt of 4 . the experimental group participants that lost 10% body mass did so in approximately 28.2% , with the placebo group responding at a rate of 11.1% , resulting in an nnt of 6 . the most common adverse effect was nausea , with 6.3% ( 203/3239 ) of the pooled medication group reporting this , compared with 0.2% of placebo groups , resulting in an nnh of 17 . lorcaserin is a selective serotonin 5-ht2c receptor agonist medication , which may cause an anorectic effect via activation of proopiomelanocortin ( pomc ) neurons in the hypothalamus . the heart valvulopathies associated with the withdrawal of the nonspecific serotonin receptor medications dexfenfluramine or fenfluramine , are not associated with lorcaserin as this drug s mechanism is wholly different in nature . as lorcaserin agonizes the 5-ht2c receptor , typical side effects for lorcaserin include nausea , headaches , fatigue and dizziness . during the blossom trial , one patient of the 3195 in the 10 mg bid arm during the behavioral modification and lorcaserin second study for obesity management ( blossom ) trial was felt to have symptoms that could be serotonin syndrome . she became vertiginous , developed nausea , vomiting , diarrhea with small amount of blood noted , and blood pressure variability . the serotonin syndrome was likely due to a drug drug interaction as she was taking the cough suppressant with dextromethorphan . symptoms did not reappear when the subject restarted lorcaserin one week after antitussive discontinuation . at the end of one year in the blossom trial , 47.2% ( 77/1560 , p<0.001 ) of the lorcaserin 10 mg twice daily group experienced at least a 5% loss of total body mass , compared with 25% ( 385/1539 , p<0.001 ) who experienced the same level of weight loss in the placebo group . in comparing those that lost at least 10% of their body mass , the lorcaserin 10 mg group experienced a rate of 22.6% ( 353/1560 , p<0.001 ) , compared to a response in the placebo group of 9.7% ( 150/1539 , p<0.001 ) . this results in a calculated nnt for the 5 and 10% groups of 5 and 8 , respectively . the most common adverse effect experienced were headaches ; the lorcaserin group having a 16.8% ( 537/3195 ) incidence , the placebo group experiencing 10.1% ( 321/3185 ) rate , resulting in an nnh of 15 . approved by the fda in 1999 in prescription strength , it was rereleased as an over - the - counter medication a few years later at a lower dose . however this inhibition comes with the risk of adverse side effects such as increased flatulence , oily spotting , greasy loose stools , fecal urgency or frank incontinence . there are no known serious adverse effects , though there may be a worsening of hepatic function early in treatment . this finding is controversial with the most recent data showing little association . in a study published in 2006 , orlistat 60 and 120 mg dosed three times daily was compared against placebo over a period of 6 months . trial participants with 5% loss of body mass included 42.3% ( 191/452 ) of orlistat 60 mg , around 44.6% ( 201/451 ) of orlistat 120 mg participants , and 23.0% ( 103/448 ) of the placebo group . trial participants with 10% loss of body mass included 14.6% ( 66/452 ) of orlistat 60 mg , approximately 17.1% ( 77/451 ) of orlistat 120 mg participants , and 5.6% ( 25/448 ) of the placebo group . this resulted in nnt values of 10 in both medication categories to achieve 5% total body mass loss , and an nnt for 10% losses in orlistat doses of 60 and 120 mg were 12 and 9 , respectively . while these numbers may seem encouraging , it is important to note that a significant portion of participants lost between 05% of body mass , with placebo showing 43.3% compared to orlistat 60 and 120 mg of 39.6 and 41.0% , respectively . one of the more common adverse effects reported was oily fecal spotting , which was defined by the sponsor as an uncontrolled seepage of oil without stool [ 9 , p. 58 the orlistat 60 mg group experienced this adverse effect at 17.7% ( 110/623 ) , the 120 mg group had an incidence of 21.7% ( 137/632 ) , and placebo group had a 1.1% ( 7/634 ) incidence reported . this resulted in an nnh of 7 and 4 for the 60 and 120 mg groups , respectively . it has been in use since 1996 as an antiepileptic agent , and since 2004 for the prophylactic treatment of migraine headaches . there is some evidence that indicates topiramate can decrease calorie intake through promoting early satiety , or decreases in gluconeogenesis . phentermine was introduced in 1959 for the purposes of weight loss and continues to be prescribed today . appetite suppression is theorized to be achieved through increased hypothalamic norepinephrine release and raising serum levels of leptin . phentermine adverse effects include tachycardia , palpitations , insomnia , anxiety , and elevated blood pressure . although no major congenital malformations were apparent from pregnancies occurring during the clinical trials , there are concerns for this potential . the potential for increased teratogenicity would appear to outweigh the benefit of weight loss in a woman trying to become pregnant , so the combination medication was assigned pregnancy category x . this allows for comparison of the top dose of phentermine / topiramate , 15/92 mg daily between the trials but , limits the ability of examining the second drug dosage in each trial . the mean values of the top dose in ob-302 and ob-303 for 5 and 10% loss of total body mass were approximately 68.4 and 47.4% . this is compared to the placebo group losses for 5 and 10% loss of total body mass of 19.1 and 7.4% , which results in nnt values of 3 for both weight loss end points . the most common adverse effect of paresthesias occurred in 19.9% ( 315/1580 ) of the high dose medication group , the placebo group experienced a much lower rate of 1.9% ( 30/1561 ) , resulting in an nnh for this particular medication of 6 . the most recent anti - obesity medication approved is the glucagon - like peptide-1 ( glp-1 ) receptor agonist liraglutide , an endogenous ligand . glp-1 receptors are located on pancreatic beta cells , the activation of which causes more insulin to be released and the suppression of glucagon to occur secondarily . the medication as a once daily 1.8 mg subcutaneous injection has been used in the united states since 2010 as a treatment for type 2 diabetes mellitus , and the 3 mg once daily subcutaneous version was fda approved in 2014 for the treatment of obesity . it was approved in 2015 by the european medical agency ( ema ) for the same purpose . there is a theoretical increased risk of medullary thyroid carcinoma based on studies in rodents , but no known case have been reported in humans . this is the only non - oral drug discussed and this drug requires patients to inject their medication . several trials were completed with the largest being trial 1839 , a 56-week phase 3 trial which compared weight loss with liraglutide 3 mg ( n=2437 ) against placebo ( n=1225 ) . approximately 63% ( 1536/2432 ) of the experimental group achieved a weight loss of 5% body mass , and 27.1% ( 331/1220 ) of the placebo group achieved the same loss of body mass , resulting in an nnt of 3 . approximately 33.1% ( 805/2432 ) of the patients in the experimental group achieved a loss of 10% of body mass , while 10% ( 129/1290 ) of the placebo group achieved this same end point resulting in an nnt of 5 . around 40% of trial participants reported adverse effects of nausea , 15% had vomiting , and 21% experienced diarrhea , compared to patients in the placebo group at 14 , 4 , and 10% , respectively . in considering the most common adverse effect of nausea , the liraglutide group experienced a rate of 39.3% ( 1329/3384 ) , while the placebo group experienced the nausea at a rate of 13.8% ( 267/1941 ) , resulting in an nnh of 4 . in these trials , 9 patients developed a serious or severe case of acute pancreatitis compared to one in the placebo group . trying to determine which anti - obesity medication may be appropriate for a particular patient can be dependent on several factors . some insurance plans are beginning to cover these medications , but other plans do not consider them to be necessary or to be incurring out - of - pocket expenses might make this line of medications harder to afford , as many are still on patent with no generic available . some insurers insist the patient enroll in commercially available diet and exercise programs , which also carries a financial burden . however , for each of these medications , an educational and behavioral approach is generally suggested and warranted for optimum weight loss results . does this medication work , and if so , how well ? to answer this , a comparison of the number needed to treat ( nnt ) for the medications in question is warranted . in examining their efficacy over a 56-week period , the nnt ranged from 3 patients for some of the newest medications such as liraglutide , bupropion naltrexone , and phentermine toperimate , and as high as 1012 for the older orlistat . while this is not a staggering difference , it gives a framework as to the relative effectiveness of each agent . it may take a prescriber 4 patients on bupropion naltrexone combination to see significant weight loss comparable to its regulatory studies , where it may take 12 orlistat patients to see the same results . in foreshadowing to the next paragraph about tolerability , the more effective combination preparation could be detrimental or lethal to a patient with known epilepsy . adverse effects largely included gastrointestinal side - effects such as nausea , diarrhea , constipation , abdominal pain , oily spotting or frequent defecation . rarer neurological effects are noted with phenteramine topiramate and bupropion naltrexone , such as paresthesias and headaches . liraglutide had pancreatitis as a rare adverse effect . felt to be safer and better tolerated because of their higher nnh figures were bupropion naltrexone ( nausea , nnh=17 ) , and lorcaserin ( hyperglycemia , nnh= 13 ; nausea , nnh=15 ) . orlistat and liraglutide were noted for low nnh figures , with oily spotting ( nnh=4 ) and nausea ( nnh=4 ) causing more intolerability and dropout , respectively . generally , gastrointestinal distress is not a serious or lethal side - effect but is highly intolerable to patients . orlistat may have some of the least risky serious adverse effects , but its notoriety for gastrointestinal distress extremely lowers its nnh , making it an unfavorable medication . naltrexone had a fairly low nnt to achieve either 5 or 10% loss of body mass , with a nnh based on adverse effects higher than the rest of the medications considered in this review . for the same reasons , phentermine topiramate is similarly rated . however , these two medications may have rarer but significant serious adverse risks to consider on a patient - by - patient basis . liraglutide appears somewhat favorable based on nnt , but the lower nnh that resulted from reported nausea may decrease patients desire to continue taking the medication . lorcaserin may not be as efficacious as some of the previously listed medications , but it does have the second highest nnh figure making it one of the safer and more tolerable option for many patients . with the population becoming more overweight over time , the topic of pharmacologic augmenting of failed diet and exercise treatments is both timely and necessary . the increased prevalence of type 2 diabetes mellitus , cardiovascular disease , fatigue , depression , premature osteoarthritis , feelings of poor self - image or worth , and other associated risks of obesity are all reasons to promote pharmacologic management of obesity . while it may be stoically sanctioned to discuss tough love and insist that all weight loss can be achieved through willpower , a sensible diet and exercise , this is sometimes not enough . for patients that can not exercise ( enough or at all ) , or have issues controlling their appetite , medications that can aid in their weight loss reduction is clinically warranted . this paper would suggest that all approved medications have the ability to lower weight gain from metabolic , medical , or even iatrogenic causes . all agents carry common and more esoteric or extreme side - effects and these must be considered when prescribing .