Datasets:

giuliadc

/

pubmed-filtered

like 0

pubmed-1001

the emergence of primordial metabolism has been postulated to play a central role in the origins of life. many of the investigations so far have centered on the reductive citric acid cycle. however, in his glyoxylate scenario, eschenmoser theorized that glyoxylate 1 may have played an important role in the development of a primordial metabolism, acting as a primal source for biogenic molecules such as sugars, amino acids, and nucleobases. crucial to the scenario was the hypothetical formation of dihydroxyfumarate (dhf) 5, by dimerization of glyoxylic acid under the influence of an umpolung catalyst such as cyanide. dhf was proposed to undergo reaction with glyoxylate and aldoses, ultimately yielding biologically relevant -keto acids and sugars, respectively. subsequently it was shown by sagi et al. that the reaction of dhf with glyoxylate, glycolaldehyde, and glyceraldehyde led, via -keto acid intermediates, to the formation of triose, tetrulose, and pentuloses, with remarkable efficiency. this success emphasized the need to demonstrate the formation of dhf from glyoxylate. to this end, we set out to investigate the cyanide-mediated dimerization of glyoxylate (glyoxoin reaction) with the expectation of chemistry similar to the benzoin reaction. herein we report the results of this investigation: the unanticipated formation of meso- and dl-tartrates (the formal reduction products of dhf) rapidly and in high yield (scheme 1). we also present evidence that the glyoxoin reaction proceeds via dhf as a putative intermediate, thus strengthening the proposals made in the glyoxylate scenario. this facile production of tartrate combined with the known dehydration of tartrate to give oxaloacetate, and its decarboxylation to give pyruvate, potentially, provides an alternate entry into the citric acid cycle based on the glyoxylate scenario. the (homogeneous) glyoxoin reaction of glyoxylate (1.0 m) with a catalytic amount of nacn (0.1 m) in aqueous medium at room temperature in 2.0 m naoh (ph 14) showed complete consumption of glyoxylate (by c nmr after 28 h); no signals corresponding to the expected dhf were observed. (high ph was required to ensure cyanide was present only as its anion; however ph 14 was obtained when 2.0 m naoh was prepared rather than 0.5 m.) rather, the c nmr spectrum of the crude reaction mixture (figure 1) suggested the formation of meso- and dl-tartrates 8 in high yields (in some cases exceeding 80%, see table s1 for example calculations) along with carbonate, oxalate 9, formate 11, tartronate 12, and glycolate 13. the identities of products were confirmed by comparison to and by spiking with authentic materials (figure s1). in addition, the tartrates were isolated from the reaction mixture as calcium salts according to literature procedure and confirmed by c nmr spectroscopy and mass spectrometry (figure s2). the meso-tartrate is produced in equal or greater quantity than the combined dl-tartrates (table s1). no interconversion of meso-tartrate to and from dl-tartrates (nor conversion to any other reaction product) was observed under reaction conditions (figure s3). reaction of 1.0 m sodium glyoxylate (182/94 ppm, completely consumed) with 0.1 m cyanide (167 ppm) in aqueous 2.0 m naoh (room temperature, 1 h) produces meso-tartrate 8 (178.9/76.1 ppm) and dl-tartrates 8 (179.8/75.0 ppm). signals for carbonate (169.1 ppm), oxalate 9 (173.6 ppm), formate 11 (172 ppm), tartronate 12 (179.7/76.2 ppm), and glycolate 13 (trace, 181.4/62.4 ppm) were observed. the glyoxoin reaction also produced tartrates at lower concentrations (0.01 m of 1 and 0.002 m cn) and at lower temperatures (4 c). the reaction is, in fact, so resilient that even under heterogeneous conditions (when insoluble lithium glyoxylate was substituted in place of sodium glyoxylate), tartrates were still produced (figure s4). however, when the ph was lowered (ph 9), tartrates were not observed, indicating that high ph was crucial. when a control reaction (at ph 14) was conducted by omitting the cyanide ion, no tartrates were formed; only the disproportionation of glyoxylate to glycolate 13 and oxalate 9 was observed, proceeding through the well-known cannizzaro reaction (figure s5c). the production of tartrates (as opposed to dhf) from the glyoxoin reaction in basic media was unanticipated but did implicate dhf as an intermediate, since tartrate is formally the reduction product of dhf. therefore, a reaction of dhf 5 (5 mmol, insoluble), nacn (1 mmol/0.1 m), and glyoxylic acid (5 mmol/0.5 m) in aqueous naoh (2.0 m/10 ml) at room temperature was investigated. a vigorous bubbling was observed in this heterogeneous reaction mixture for 2 h, at which point a c nmr spectrum of the supernatant showed the production of tartrates 8 along with carbonate, oxalate 9, formate 11, tartronate 12, and glycolate 13. more revealingly, when the dhf/glyoxylate reaction was repeated, omitting the cyanide, tartrates 8 were still formed. when the reaction of 0.25 m of dhf 5 with 0.25 m glyoxylic acid (in the absence of cyanide) was repeated in a mixture of 1.0 m naoh and 1.0 m lioh, the reaction mixture became homogeneous (similar to the glyoxoin reaction). c nmr spectrum, after 1 h, showed production of tartrates 8, (in 69% yield by quantitative c nmr) with complete glyoxylate conversion and little carbonate formation (figure 2); the ratios of the accompanying product peaks were similar to the glyoxoin reaction (figure s5a, b) with higher proportion of meso-tartrate (table s1). interestingly, in the heterogeneous case, the c nmr spectrum of the reaction was also nearly identical to the glyoxoin reaction with the exception of a much more intense carbonate peak (figure s6b). in both heterogeneous and homogeneous cases, these results demonstrated that dhf could, by itself, mediate the transformation of glyoxylate to tartrates (figure s6). typical c nmr of the homogeneous dhf/glyoxylate (without cyanide) reaction. reaction of 0.25 m glyoxylate with 0.25 m dhf in aqueous 1.0 m naoh and 1 m lioh (room temperature, 1 h). for nmr details while these reactions showed that dhf might be an intermediate, it may not be the only path in the cyanide-mediated glyoxoin reaction. tartrates could have been additionally produced from the base catalyzed condensation reaction of glycolate 13 (a product of the cannizzaro reaction) with glyoxylate 1. this pathway was ruled out, since tartrates were observed neither in the glyoxylate control reaction discussed above nor when glyoxylate and glycolate were combined under identical reaction conditions. this leaves dhf formation and its reaction with glyoxylate as the most likely route to tartrates. two possible mechanisms were considered for this formal reduction of dhf 5 (scheme 2). the first is a simple cross-cannizzaro reaction in which the hydroxide adduct of glyoxylate transfers a hydride to the carbonyl of the keto form of dhf leading directly to tartrates 8 and oxalate 9. the second pathway involves an aldol reaction between dhf and glyoxylate resulting in a six-carbon tricarboxylate 6. this six-carbon compound 6 can undergo a hydroxide promoted fragmentation to form tartrates 8 and oxalate 9 (scheme 2). cross-cannizzaro reaction involving a hydride transfer (top) versus an aldol-reaction followed by hydroxide-mediated fragmentation (bottom). to differentiate between these two possible pathways, a reaction of dhf and glyoxylate was conducted using c-dilabeled glyoxylate. if the cross-cannizzaro hydride transfer was the sole pathway, only the formation of c labeled oxalate 9*would be expected. if the fragmentation of the six-carbon tricarboxylate 6*was the only pathway, only signals corresponding to labeled tartrates 8*would be observed. however, when c-dilabeled glyoxylic acid (0.1 m) was reacted with dhf (0.1 m) in 1.0 m naoh and 1.0 m lioh (homogeneous reaction), thec nmr spectrum showed that both labeled tartrates 8*and oxalate 9*were formed. while the presence of labeled tartrates 8*indicates that an aldol reaction fragmentation reaction must have occurred, formation of labeled oxalate 9*could be explained via the competing self-cannizzaro (as opposed to the cross-cannizzaro) reaction of glyoxylate. however, integration of the c signals corresponding to the carboxylate peaks of oxalate 9*and glycolate 13*revealed that there is 50% less labeled oxalate than labeled glycolate in the reaction mixture (figure s7c). this excess of glycolate indicated that (a) there is likely some side reaction that results in the production of labeled glycolate 13 *; and (b) if the cross-cannizzaro hydride transfer reaction is taking place, it is doing so to a lesser extent than this glycolate producing side reaction. therefore, although the cross-cannizzaro reaction can not be ruled out entirely, this experiment supports the aldol reaction a separate reaction using unlabeled glyoxylate (1.0 m) and c-labeled nacn (0.01 m), clearly revealed the glyoxylate cyanohydrin 2 at 125 ppm an otherwise empty spectral region; as the reaction progressed, a second peak appeared at 126 ppm (attributed to the dhf cyanohydrin 4) persisting for 4 h before disappearing (figure s8). in the heterogeneous reaction (in 2.0 m aq naoh) of labeled glyoxylate with dhf, a second pathway was suggested by the formation of significant amount (10%) of singly labeled tartrates 8 (figure s7b), along with singly labeled tartronate 12. interestingly, the (single) labeling occurs only at the carboxylate moiety of tartrates 8 and tartronate 12 as evidenced by a lack of splitting of the carboxylate signal. some of this could be explained by incomplete labeling of the starting material; however, the starting material contains<1% of singly labeled material (by c nmr, figure s7a). this suggested that the carbon carbon bond in glyoxylate is being broken during the course of the reaction. based on the above observations, we propose an overall mechanism (scheme 3), which accounts for the bulk of the tartrates 8 and oxalate 9. in this mechanism the deprotonated glyoxylate cyanohydrin 3 then reacts with an additional molecule of glyoxylate to form the cyanohydrin adduct of dhf 4, which is then converted to the keto form of dhf 5 (which tautomerizes to the typical enol form). dhf, thus formed, can react via an aldol reaction with an additional molecule of glyoxylate (c labeling shown in red) to yield a six-carbon tricarboxylate intermediate 6 *, which can (under high ph) rearrange to 7*via a cyanide-mediated retro-aldol pathway. this mechanism accounts for the primary pathway to tartrates, in which oxalate and tartrates are formed in a 1:1 ratio. these intermediates 6*/7*can be attacked at the carbonyl by a free hydroxide anion (under high ph) and undergo fragmentation to yield tartrates 8/8*and oxalate 9/9*. this mechanism accounts for the primary pathway to tartrates, in which oxalate and tartrates are formed in a 1:1 ratio. additional side products are formed by pathways (scheme 4) that include a series of benzoin-type rearrangements, which are possible under these high alkaline conditions and which also account for the formation of singly labeled products. in these pathways the tricarboxylate intermediate 6(6*)/7(7 *) can undergo benzoin-type rearrangements to a six-carbon aldehyde intermediate which fragments to yield singly labeled tartrates and formate. alternatively 6(6*)/7(7 *) can undergo a retro-aldol reaction generating dhf 5/5 *, which under these high-alkaline conditions undergoes a benzoin-type rearrangement to an aldehyde intermediate 10/10*. this intermediate can then react with hydroxide and fragment to form bicarbonate, formate 11/11 *, tartronate 12/12 *, and glycolate 13/13*. this second reaction pathway was identified from the experiments dealing with the heterogeneous decomposition of dhf alone to give formate and tartronate in 2.0 m naoh. this also accounts for the presence of formate in these samples; glycolate and oxalate are also produced by the hydroxide promoted fragmentation reaction of the keto form of dhf. in addition, there is a side reaction that occurs when glyoxylate 1 is in a far higher concentration than dhf 5, where tartrates 8 and tartronate 12 are formed in a 1:1 ratio. this side reaction (scheme 4, bottom) begins at intermediate 6/7, which decarboxylates to intermediate 14, which then undergoes an aldol reaction with an additional molecule of glyoxylate 1 to form a seven carbon tricarboxylate 15. further benzoin-type rearrangements followed by fragmentation gives rise to tartrates 8 and tartronate 12. the three pathways shown above account for all observed side products, including isotopically labeled side products. the results of the dhf glyoxylate reaction presented here are in sharp contrast to the work of sagi et al.; there, dhf was reacted with glyoxylate in lithium hydroxide at ph 78 to produce dihydroxyacetone and pentulosonic acid by way of six- and seven-carbon tricarboxylate intermediates (6 and 15) via several decarboxylations. however, in our work, 6 and 15 undergo attack by free hydroxide at the carbonyl, yielding oxalate 9, tartronate 12, and tartrates 8. while the carbonate produced in the glyoxoin reaction is indicative of decarboxylations occurring, no evidence was seen for any of the intermediates or products observed in the work of sagi et al. (6) this contrasting result demonstrates how even in consistently basic environments, ph may be used to alter the product suite of this reaction, from selective production of pentulosonic acid to selective production of tartrate. this dependence on ph underscores the need to investigate a wide range of conditions for potentially prebiotic reactions to fully explore the possibilities for producing these biologically relevant molecules. the products of this simple and robust glyoxoin reaction are stable in the high-ph environment, illustrating their potential as feedstock for further reactions. however two questions must be raised to determine the relevance to prebiotic chemistry; specifically, what are the abiotic availabilities of glyoxylate and of a high-hydroxide concentration? for the former there are many possibilities: (a) glyoxylate has been shown to be readily produced by photo-oxidation of acetylene under anoxic conditions; (b) reductive conversion of carbon dioxide and carbon monoxide to glyoxylate has been experimentally demonstrated; some of these could be reasonably extrapolated to early earth scenarios; and (c) glyoxylate was shown by weber to form reliably in the reaction of glycolaldehyde and formaldehyde, catalyzed by various primary amines, though it was not the primary product. the results of this investigation underscore the need and the opportunity to further explore these options and fully investigate formation of glyoxylate under prebiotic conditions. high-hydroxide concentrations are considered to be extreme (and unusual) in the conventional prebiotic line of thought. this usually renders any high-ph reaction problematic in this context. however, there are at least three plausible prebiotic scenarios one can consider. the first possible scenario is the widely investigated alkaline hydrothermal vent system; however, this system is not without drawbacks. related reservoirs of natural hydroxide are lakes fed by alkali springs, which could act as a natural reactor for this type of chemistry. while these lakes may have the advantage of sidestepping the magnitude of both dilution and thermolysis faced by oceanic vents, they too have their limitations. another possible high-alkaline environment can be found in the interlayer framework of double-layered hydroxides (e.g., hydrotalcites), which are especially conducive for uptake and concentration of anions, such as glyoxylate and cyanide, from dilute solutions. while each of these possibilities appear to be highly localized with their attendant weaknesses in a prebiotic context, they do offer potential for highly alkaline environments on early earth, that need to be validated from a prebiotic perspective, for the chemistry described here. notwithstanding the arguments presented above, it remains that the cyanide-mediated dimerization of glyoxylate at high ph to produce tartrates proceeds with remarkable consistency and speed, even at low temperature, low concentration, and low solubility. the fact that these reactions occur reliably and that the products are stable at high hydroxide concentrations demonstrates that a high ph environment need not be antithetical to production of such organics in a primordial setting. moreover, the use of cyanide as a catalyst is to be contrasted with many other conventional prebiotic scenarios that start with cyanide as a source molecule. in the context of primordial metabolism, the robust production of tartrates from glyoxylate opens up new venues for the origins of biologically relevant small molecules. the simple and known dehydration of tartrates results in oxaloacetate which is known to decarboxylate to give pyruvate, thus providing an entry into a prebiotic citric acid cycle. in extant biology, oxaloacetate is the entry point to the citric acid cycle, reacting with pyruvate to form citrate. there are examples in extant biology where tartrate is utilized and metabolized for production of oxaloacetate to be used in the citric acid cycle. thus, it is reasonable to posit that tartrates could have acted as a source of small molecules, which could become part of an emerging proto-metabolic process (e.g., reductive citric acid cycle). thus, the glyoxoin reaction (and the glyoxylate scenario) could serve as a plausible alternative start for rudimentary chemical evolution (scheme 5). glyoxylic acid monohydrate (0.110 mmol, 10100 equiv) and sodium cyanide (0.011 mmol, 1 equiv) were each weighed in individual 6 dram vials. ten ml of 2.0 m naoh or 2.0 m lioh was then added to the vial containing the sodium cyanide. the solution was then transferred by syringe to the vial containing the glyoxylic acid. the cyanide solution was added down the side of the vial to the glyoxylic acid over the course of 20 s and then closed, and the vial was cooled (by running cool water over the vial) as necessary to avoid with excess heating. dihydroxyfumaric acid dihydrate (0.15 mmol, 5 equiv), glyoxylic acid monohydrate (0.15 mmol, 5 equiv), and sodium cyanide (0.011 mmol, 1 equiv) were each weighed in individual 6 dram vials. five ml of 2.0 m naoh was then added to the vial containing the sodium cyanide. in a separate vial an additional 5 ml of 2.0 m aq naoh was then added to the vial containing the glyoxylic acid. the glyoxylate solution was added down the side of the vial to the dihydroxyfumaric acid over the course of 20 s and then closed, and the vial was cooled (by running cool water over the vial) as necessary to avoid with excess heating. dihydroxyfumaric acid dihydrate (0.15 mmol, 1 equiv) and glyoxylic acid monohydrate (0.15 mmol, 1 equiv) were each weighed in individual 6 dram vials. five ml of 2.0 m naoh as then added to the vial containing the glyoxylic acid monohydrate. this vial was mixed until no solid remained. in a separate vial, 5 ml of 2.0 m aq lioh the glyoxylate solution was then transferred into the vial containing the dhf solution, and the vial was closed and shaken. alternately, adding dhf to glyoxylate resulted in no noticeable differences.

an abiotic formation of meso- and dl-tartrates in 80% yield via the cyanide-catalyzed dimerization of glyoxylate under alkaline conditions is demonstrated. a detailed mechanism for this conversion is proposed, supported by nmr evidence and 13c-labeled reactions. simple dehydration of tartrates to oxaloacetate and an ensuing decarboxylation to form pyruvate are known processes that provide a ready feedstock for entry into the citric acid cycle. while glyoxylate and high hydroxide concentration are atypical in the prebiotic literature, there is evidence for natural, abiotic availability of each. it is proposed that this availability, coupled with the remarkable efficiency of tartrate production from glyoxylate, merits consideration of an alternative prebiotic pathway for providing constituents of the citric acid cycle.

PMC3777280

pubmed-1002

prostate cancer is the second most common cancer and second cause of cancer death in chilean men. prostate specific antigen (psa) is the most accurate serum marker for prostate and the only biomarker routinely used for the early detection of prostate cancer. although psa is highly specific for prostate, an elevated level is not specific for prostate cancer, being increased in benign pathologies [2, 3]. consequently, approximately 70% of men with an increased serum psa, defined as>4.0 ng/ml, do not have prostate cancer and thus undergo unnecessary prostate biopsies. a psa cutoff of 4.0 ng/ml is currently used to select men for prostate biopsy; however, this misses many cancers and it has been suggested that lowering the cutoff to 2.6 ng/ml will detect small but clinically significant cancers. the prostate cancer prevention trial reported that 39.2% of men with a psa 2.13.0 ng/ml, 27.7% of men with a psa 1.12.0 ng/ml, and 1.3% of men with a psa<1.0 ng/ml had end of trial prostate biopsies with foci of adenocarcinoma. in other words 38% of men with prostate cancer have a psa<4.0 ng/ml and 70% of men with a psa>4.0 ng/ml do not have cancer. the subject is further complicated by the high prevalence of prostate cancer detected at autopsy, the high frequency of positive prostate biopsies in men with a normal digital rectal examination (dre) and psa<4.0 ng/ml, the contrast between the incidence and mortality rates for prostate cancer, and the need to treat an estimated 37 men with screened detected prostate cancer to prevent one prostate cancer death [9, 10]. to achieve a relative mortality reduction of 40% by screening for prostate cancer, 50% of screened detected prostate cancers may be overtreated. this is especially so as the risks of prostate biopsy are not insignificant; rietbergen et al., in a study of 5,802 patients undergoing transrectal prostate biopsy, reported an incidence of complications of 0.5% hospitalizations, 2.1% rectal hemorrhage, 2.3% fever, and 7.2% persistent hematuria. the use of primary malignant cpc (mcpc) detection as a sequential test for deciding the need for prostate biopsy may resolve in part some of these problems. in the study protect of 228 patients undergoing first biopsy where 28.5% of patients had cancer diagnosed, the detection of primary mcpcs and the association with a positive biopsy had a sensitivity of 86.2% and specificity of 90.8%, with a positive predictive value of 78.9% and negative predictive value of 97.1%. the use of the detection of primary mcpcs as a sequential test to select men, with suspicion of prostate cancer for an elevated psa, to determine the need for prostate biopsy raised concern of the possibility of missing clinically significant prostate cancer. we present the results of 328 men diagnosed with prostate cancer as a result of a screening program and compare the results of primary mcpc detection with the biopsy gleason score, percent of infiltration of the samples by cancer, and the number of positive cores. after ethical committee approval of the study for the use of primary mcpc detection, a prospective study was carried out. all patients attended in the carabineros de chile health system and had a serum psa>4.0 ng/ml and/or a digital rectal examination (dre) suspicious of prostate cancer and were referred for prostate biopsy. immediately before the biopsy 8 ml of venous blood was collected in edta (beckinson-vacutainer) and sent to a central laboratory. patients were coded and clinical details of serum psa, age, and biopsy results were collected. the prostate biopsy and primary cpc detection were independently analyzed, with the evaluators being blinded to the clinical details and results of the biopsy or primary mcpc test. mononuclear cells were obtained by differential centrifugation using histopaque 1,077 (sigma-aldrich), washed, and resuspended in 100 l of autologous plasma. 25 l aliquots were used to make slides (silanized, dako, usa), dried in air for 24 hours, and fixed in a solution of 70% ethanol, 5% formaldehyde, and 25% phosphate buffered saline, ph 7.4. primary mcpcs were detected using a monoclonal antibody directed against psa and clone 28a4 (novocastro laboratory, uk) and identified using an alkaline phosphatase-anti-alkaline phosphatase based system (lsab2, dako, usa), with new .- fushcin as the chromogen. positive samples underwent a second process with anti-p504s clone 13h4 (dako, usa) and were identified with a peroxidase based system (lsab2, dako, usa) with dab (3,3-diaminobenzidine tetrahydrochloride) as the chromogen. a primary mcpc was defined according to the criteria of ishage (international society of hematotherapy and genetic engineering) and the expression of p504s according to the consensus of the american association of pathologists. a malignant primary cpc (mcpc) was defined as a cell that expressed psa and p504s; a benign primary cpc (bcpc) expressed psa but not p504s and leucocytes could be p504s positive or negative but did not express psa (figures 1(a)1(c)). a test was considered positive when at least 1 cell was detected/4 ml blood. the test was classified as positive or negative for mcpc; the number of mcpcs/4 ml of blood was not used as a parameter in order to simplify the result of the test. immunocytochemical staining of the slides was analyzed by one observer blinded to clinical and pathological details. an ultrasound guided 12-core biopsy was taken according to standard recommendations; samples were fixed in formaldehyde and sent to the pathology service. 3 m paraffin embedded sections were cut, deparaffinized, and stained with h&e as per standard procedure. if cancer was detected, gleason score, number of cores positive for cancer, and percent of infiltration were recorded. the prostate biopsy was analyzed by a single pathologist blinded to clinical details and results of the mcpc test. the ultrasound was used to guide the biopsy; not all reports had the prostate volume calculated or whether the prostate was homogeneous or heterogeneous. as it is not routine in chile the use of prostatic ultrasound prebiopsy, we did not include this parameter in the analysis. both the nccn guidelines and nice (uk) guidelines recommend as a treatment option active surveillance in men with the following criteria: clinical stage t1c or less, gleason score 6, less than 3 cores positive for cancer, and less than 50% or 10 mm infiltration in any one core. the frequency of patients who were primary mcpc positive and negative was compared using these guidelines to evaluate the number of patients complying with the criteria for active surveillance. we used the 1994 criteria for as and not those of tosoian et al. descriptive statistics were used for demographic variables, expressed as mean and standard deviation in the case of continuous variables with a normal distribution. in case of an asymmetrical distribution the median and interquartile range (iqr) values were used. the student t-test was used to compare continuous variables with a normal distribution, the mann-whitney test for ordinate and continuous variables with a nonnormal distribution, and chi-squared for the differences in frequency. statistical significance was defined as a p value less than 0.05 to all tests were two tailed. analysis was performed using the stata 11.0 program (statacorp lp, college station, texas, usa). the study was directed with complete conformity with the principles of the declaration of helsinki and approval of the local ethical committees. a total of 328 men of a cohort of 1123 patients had a prostate biopsy positive for cancer, with an overall incidence of 29.2% of all biopsies. 42/328 (12.8%) of these men were negative for the detection of primary mcpcs. men negative for primary mcpcs were significantly older and had lower serum psa levels, lower gleason scores, lower number of cores positive for prostate cancer, and cores less infiltrated with cancer. of the 1123 patients, 90 (8%) were positive for mcpcs but had an initial prostate biopsy negative for cancer. comparing men mcpc negative with those mcpc positive using the epstein criteria for active surveillance, 38/42 (91%) of mcpc negative men compared with 34/286 (12%) (p<0.0001) of mcpc positive men complied with the criteria for active surveillance of their prostate cancer (table 2). four men in the cpc negative group did not comply with the criteria for active surveillance; their details are shown in table 3. in patient number 3 patient number 1 had a cancer which needed treating and underwent radical prostatectomy as did patients 2 and 4. models of prostate cancer detection and estimates of progression suggest that 2342% of screen detected prostate cancers are overtreated. the introduction by epstein et al. of criteria to predict pathologically insignificant prostate cancer has been useful but there is caution about using it as the sole reference for making clinical decisions as many as 8% of these cancers were not organ confined based on postsurgical findings. active surveillance is considered the best option for patients with low risk cancers or a short life expectancy. thus if there is a significant percent of men overtreated for their prostate cancer and active surveillance is an accepted treatment option, then the aim of the prostate biopsy in men with an elevated psa is not to detect each and every prostate cancer but to detect those prostate cancers with the potential for causing harm. men with clinically insignificant prostate cancers that were never destined to have symptoms or to affect their life expectancy may not benefit from knowing that they have the disease. the detection of clinically insignificant prostate cancer could be considered as an adverse effect of the prostate biopsy. as such, there is considerable anxiety and distress found in men undergoing active surveillance. there are no directly relevant studies comparing immediate and delay biopsy in men with a raised psa level. a number of observational studies have reported risk factors for high grade prostate cancer in men referred for biopsy, related to age, psa, dre result, prior prostate biopsy, black ethnicity, and prostate volume [2325]. however, there are concerns over delaying a prostate biopsy because of the uncertainties of the natural history of untreated prostate cancer, the missed opportunity to detect and treat a curable cancer, or that due to delay in performing a biopsy the treatment of a larger or more aggressive cancer may lead to a more complex surgery with greater side effects. the use of primary cpc detection to select men for prostate biopsy fails to detect men with cpc negative cancer. this represents approximately 5% of all primary cpc negative men and an elevated psa of between 4.0 and 10.0 ng/ml. this study suggests that, of these 5% of primary cpc negative men, 9% would have a prostate cancer complying with the guidelines for treatment or that approximately 99.5% of all primary cpc negative men would not have a prostate cancer needing treatment or in the majority of cases primary cpc negative having benign prostatic hyperplasia. thus from these results the concern of missing significant prostate cancer is minimal, much less than the 38% of prostate cancers missed when using a psa level of 4.0 ng/ml as a cutoff point for recommending prostate biopsy. an ongoing study of the followup of all primary cpc negative men with an elevated psa is currently in progress. we used the epstein criteria to define active surveillance rather than those of tosoian et al.; men do not routinely undergo prostatic ultrasound as part of the prostate cancer screening program; thus the decision to refer the patient for prostate biopsy based on psa and mcpc determinations would not include prostate volume determinations. previously we reported the use of the number of cpcs/ml blood detected; however, the increase in specificity using a cutoff point of 4 cells/ml blood was minimal, 8%, with an important decrease in sensitivity. there are two questions not answered by the study, which are currently part of an ongoing investigation. firstly, mcpc positive men with a negative biopsy are these men at increased risk of prostate cancer, in that they have cancer but the biopsy failed to detect it; studies have shown that approximately 20% of men have cancer detected on repeated biopsy. if follow-up studies show that these men do indeed have cancer, it may be advisable to repeat the biopsy earlier or a biopsy for saturation. secondly, in mcpc negative men, we are currently repeating total and free psa with mcpc testing on a 6-month basis; men who become positive, with an abnormal dre or significant change in total psa and/or free psa, are referred for biopsy. it would be important to determine if a change from mcpc negative to positive was associated with a change in the clinic-pathological parameters to indicate active treatment. in chile, few men choose to undergo active surveillance, preferring active treatment, as we have little data on this type of patient. it is important to emphasize that these are primary mcpcs and are not associated with the prognosis; most of these cells disappear after radical treatment; men who remain positive, secondary mcpc positive, have a higher frequency of biochemical failure. one concern over the use of circulating tumor cell technologies is the discordant results achieved using different methods of detection. using a dual psa/prostate specific membrane antigen rt-pcr method eschwge et al davis et al. found no association between cpc detection using the cellsearch system and the clinical parameters prior to radical prostatectomy or between men with local pc or controls. however, stott et al. found primary cpcs in 42% of patients with localized cancer; fizazi et al., using anti-berep-4 epithelial antigen combined with telomerase activity, detected primary cpcs in 79% of patients with localized cancer, a similar figure to that reported using this same methodology. we believe that part of the difference documented is caused by the relatively high detection in control patients; one explication is that cpc can be found in men with prostatitis and benign hyperplasia; however, these cpcs are p504s negative. we also designed the test using cpcs to produce a result considered as positive or negative; the fundamental question was is there cancer and will it harm the patient ?; consequently we considered that the presence of single cell is sufficient to classify patients as positive or negative for cancer. we also need to emphasize that this is a single institution study; thus the test needs to be used in other centers to determine the reproducibility of the test. within our institution preanalytical variables are controlled and are limited; immunocytochemical staining can be automatically performed and thus the main variable is the observer. observer variation could be minimized with adequate training but is a variable that needs to be considered. the inter-observer variation in reported gleason scores has been a problem; recently published data on the clinical implications of interobserver variation showed an overall agreement of 80.789%, but this would lead to up to 10% of patients recommended for active observation would have received different treatments based on inter-observer variation. the objective of this study was to address the concern of not detecting potentially harmful prostate cancer using the detection of p504s expressing primary cpcs. the results suggest that the majority of cancers that the test failed to detect, when used as a sequential screening test in men with a psa level of between 4.0 and 10.0 ng/ml, are low grade small volume tumors which would comply with the criteria for active observation. thus in primary cpc negative men the possibility of a harmful cancer being missed is minimal; in these men prostate biopsy could be avoided or delayed, thus not exposing the patient to the adverse effects of biopsy or the anxiety or distress of active observation .

objective. to determine if primary circulating prostate cells (cpcs) are found in all men with prostate cancer. methods and patients. a prospective study, to analyze all men with an elevated psa between 4.0 and 10.0 ng/ml undergoing initial biopsy. primary cpcs were obtained by differential gel centrifugation and detected using standard immunocytochemistry using anti-psa; positive samples underwent a second process with anti-p504s. a malignant primary cpc was defined as psa (+) p504s (+) and a test positive if 1 cell/4 ml was detected. biopsy results were registered as cancer/no-cancer, number of cores positive, and percent infiltration of the cores. results. 328/1123 (29.2%) of the study population had prostate cancer diagnosed on initial biopsy, and 42/328 (12.8%) were negative for primary cpcs. cpc negative men were significantly older, and had lower psa levels, lower gleason scores, and fewer positive cores and with infiltration by the cancer. 38/42 (91%) of cpc negative men complied with the criteria for active surveillance in comparison with 34/286 (12%) of cpc positive men. conclusions. using primary cpc detection as a sequential test to select men with an elevated psa for biopsy, the risk of missing clinically significant prostate cancer is minimal when the patient is primary cpc negative; less than 0.5% of all primary cpc negative men had a clinically significant prostate cancer.

PMC4152931

pubmed-1003

aging is a gradual process, proportional to time, that causes structural and functional changes due to internal degeneration. aging can be divided into intrinsic aging, which is natural with the progression of time, and environmental aging caused by the external environment. uv-induced photoaging is usually observed on skin that is exposed to the sun. its clinical characteristics include earlier observation than intrinsic aging, deep and wide wrinkles, inconsistent pigmentation and solar lentigo on the exposed skin surface2. along with recent socio-financial improvements, improvements in medical technology, hygiene and nutrition have increased life expectancy. as the elderly population increases, many treatment methods to reduce skin aging and improve wrinkles and pores are currently being researched4, 5. however, ablative laser treatment causes a financial burden and side effects, such as erythema, edema, and hyperpigmentation. in addition, the damage on the epidermis caused by ablative laser treatment delays the time between returning to daily activities6,7,8. recently, non-ablative skin rejuvenation, which improves skin aging and photoaging without damaging the epidermis, has been the preferred treatment9. previous studies suggest that radiofrequency (rf) effectively reduces abdominal obesity by transferring heat to the dermis, increases blood volume in the capillaries and hence increases blood flow, induces collagen formation, and increases the thickness of the epidermis10,11,12. electroacupunture (ea) has been reported to reduce inflammation, induce healing of damaged tissues, reduce pain, and improve facial rejuvenation13,14,15. low-level laser therapy (lllt) has been used in various research studies and has been reported to have anti-inflammatory effects, reduce pain, reduce edema, induce healing of damaged tissue or fracture, produce collagen, induce skin rejuvenation and to be effective for acne and vitiligo16,17,18,19,20,21. in this study, the effects of rf, ea, and lllt on wrinkles and moisture content were investigated in 30 female subjects aged 3055 years. the results will be used as a reference for the further development of skin physical therapy. the subjects of this study were 30 adult women aged between 30 and 55 years who presented at m dermatology hospital in yongin, gyeonggi-do, south korea and who voluntarily agreed to participate after listening to an explanation of the purpose of the study. the subjects were assigned to rf, (n=10), ea (n=10) or lllt (n=10) groups. inter-group homogeneity testing for general characteristics prior to treatment revealed no significant differences. the ethics committee of namseoul university, south korea approved the study (irb approval number: 104147-201504-hr-003). the characteristics of the subjects are shown in table 1table 1.general characteristicsvariableslllt(n=10)ea(n=10)rf(n=10)age (years)42.9 3.743.4 7.142.8 4.9height (cm)159.8 4.3158.0 4.3163.0 7.9weight (kg)52.4 6.158.8 7.256.7 lllt: low-level laser therapy group; rf: radiofrequency group; ea: electroacupuncture group. lllt: low-level laser therapy group; rf: radiofrequency group; ea: electroacupuncture group for the rf group, prix iii (shenb co., ltd., korea) was used at 1 mhz (rf energy, maximum 450w/cm) in two 15-minute sessions per week for six weeks22. for the ea group, disposable stainless steel acupuncture (0.20 15 mm) was used. for ea stimulation, an ots h-306 (hanil tm co., ltd., korea) was used at a frequency of 3 hz, with 5 seconds of on time and 2 seconds of off time. the intensity of the ea was increased until the subject felt simulation and a small muscular contraction and was then maintained. for the lllt group, redpulsar (sometech inc., korea), which is a diode laser, was used in two 15-minute sessions per week for six weeks at 635 nm, with 10mw of the laser class iiib23. a janus skin measurement device (psi co., ltd. the faces of the subjects were fixed in a specific spot and the facial skin conditions were meticulously photographed using a 10 megapixel canon dslr camera lens. wrinkles under both eyes were measured through front-view photos, whereas wrinkles on the eye rims were measured through profile-view photos. to minimize the measurement errors, the same rater performed measurements from the beginning to the end in similar indoor environments (room temperature 2021 c and humidity 5060%). a moisture checker (psi co., ltd., korea) was used to measure the skin moisture levels on the forehead and right cheek. in order to reduce error, three measurements were taken and the average was calculated (table 2table 2.moisture ratevariablesforeheadcheekvery dry (au)124124dry (au)25342534moisturized (au)35443544sufficiently moisturized (au)45654565au: arbitrary unit). all data were coded and analyzed using the spss statistical analysis program (ver.18). to determine the post-intervention changes in the number of wrinkles and moisture content in each group, a test of normality was conducted. if subjects passed the test, a paired samples t-test was conducted; otherwise, the wilcoxon rank-sum test was conducted. to determine the inter-group differences in wrinkles and moisture content, one-way analysis of variance was used when they satisfied normality. treatment of under eyes showed that wrinkles have significantly decreased on both sides after rf, ea and lllt (p<0.05). treatment of eye rims showed that wrinkles have significantly decreased on the right side after rf, ea and lllt (p<0.05) (table 3table 3.changes in the number of wrinkles after rf, ea or lllt and a comparison of wrinkle improvements between groupswrinklesinterventionprepostunder eyesrightrf*11.2 2.88.3 3.6ea*14.7 9.510.7 7.3lllt*14.4 6.211.3 4.4leftrf*12.9 4.58.0 3.3ea*16.5 8.913.0 7.3lllt*12.7 5.810.1 4.6eye rimsrightrf*8.1 4.16.0 3.1ea*12.3 8.19.8 5.9lllt*7.6 3.76.6 2.9leftrf7.9 5.26.8 4.3ea13.0 8.211.2 6.7lllt7.7 4.06.6 3.8values are shown as the mean standard deviation,*significant difference between the pre- and post-tests within each group, p<0.05. paired samples t-test; wilcoxon rank-sum test; rf: radiofrequency; ea: electroacupuncture; lllt: low-level laser therapy). values are shown as the mean standard deviation,*significant difference between the pre- and post-tests within each group, p<0.05. paired samples t-test; wilcoxon rank-sum test; rf: radiofrequency; ea: electroacupuncture; lllt: low-level laser therapy treatment of forehead showed that skin moisture has significantly increased after rf, ea and lllt (p<0.05). treatment of cheek showed that skin moisture has significantly increased after rf, ea and lllt (p<0.05). significant differences have been observed on skin moistures of the cheek between the two groups (p<0.05) (table 4table 4.changes in skin moisture after rf, ea or lllt and comparison of skin moisture improvements between groupsmoisture contentinterventionprepostforeheadrf*35.3 2.537.1 3.0ea*33.7 3.838.7 3.2lllt32.9 4.836.9 4.9cheekrf*36.3 2.938.9 2.5ea*33.7 3.641.5 3.5lllt*34.5 2.939.9 3.3values are shown as the mean standard deviation,*significant difference between the pre- and post-tests within each group, p<0.05. paired samples t-test; wilcoxon rank-sum test; lllt: low-level laser therapy; ea: electroacupuncture; rf: radiofrequency; 1: rf; 2: ea; 3: lllt). values are shown as the mean standard deviation,*significant difference between the pre- and post-tests within each group, p<0.05. paired samples t-test; wilcoxon rank-sum test; lllt: low-level laser therapy; ea: electroacupuncture; rf: radiofrequency; 1: rf; 2: ea; 3: lllt desire for anti-aging and antioxidants has increased with economic growth and life expectancy. active participation of females in all aspects of society has increased the attention paid to skin management3, 21. therefore, this study aimed to investigate the effects of rf, ea and lllt on wrinkles and skin moisture content. a previous study by el-domyati et al.10, which conducted a quantitative evaluation of dermal collagen after rf treatment, reported an increase in type i and type ii collagens and a decrease in the number of wrinkles under the eyes and on the eye rims (p<0.01). a study by abraham et al.24 also reported improvements in wrinkles, pore size, and the laxity of facial skin. the present study reported similar findings in that wrinkles under the eyes and on the eye rims were significantly decreased (p<0.05). based on previous studies that reported that rf induces the formation of new collagen by transferring heat to the dermis25, 26, we hypothesize that the formation of new collagen contributed to the improvement of wrinkles under the eyes and on the eye rims in this study. barrett14 reported that the number of wrinkles on eye rims decreased by 50% and wrinkles under the eyes decreased by 20% after 10 sessions of ea. kwon et al.27 reported that miso facial rejuvenation acupuncture significantly decreased the width of wrinkles on eye rims from 4.87 3.63 to 2.43 2.04. using jae-seng acupuncture, cho et al.28 reported significant improvements in the number of eye wrinkles, consistent with the present study (p<0.001). a previous study by barolet et al.29, in which 12 led treatments at 660 nm, 50 mw/cm and 4 j/cm were conducted on a 3d model of tissue-engineered human reconstructed skin, reported improvements in wrinkle depth, surface roughness and fitzpatrick wrinkling severity scores. russell et al.30 incorporated combination led light therapy (633 nm and 830 nm) and also reported improvements in periorbital wrinkles. in the present study, wrinkles under the eyes on both sides and wrinkles on the left eye rims were significantly decreased after lllt treatment (p<0.05). based on previous studies, which reported that lllt treatment induced collagen up regulation and down-regulation of matrix metalloproteinase, it can be inferred that the increase in collagen on the epidermis contributed to the improvement of wrinkles. kwon et al.31 reported that the moisture content of the right side of the face increased from 49.10 10.95au to 63.20 12.42au after miso facial rejuvenation acupuncture (p<0.001). in the present study, the moisture content improved significantly on the forehead and the cheek in the ea group (p<0.05). a previous study by oh et al.32 reported that the relaxation of the skin and the wrinkles increased as aging progresses since the moisture content decreases. therefore, it can be inferred that the increase in the moisture content observed in the present study was caused by the decrease in wrinkles. firstly, since the study was not conducted on a large number of participants and it was only conducted on female adults between the ages of 3055 years, generalization of the results is limited. secondly, since the study only confirmed the effects in a span of 6 weeks, evaluation of long-term effects was not possible. therefore, further studies should be conducted on a larger sample pool composed of female participants from a larger age range, and long-term effects should be confirmed during a span of at least 6 months.

[ purpose] the purpose of this study was to investigate the effects of radiofrequency (rf), electroacupuncture (ea), and low-level laser therapy (lllt), which are used in physical therapies, on facial wrinkles and moisture. [subjects and methods] a total of 30 female participants aged 3055 years participated in this study and the results will be used as a reference for further development of skin physical therapy. thirty adult females were assigned to an lllt (n=10), ea (n=10), or rf group (n=10). the intervention was performed in two 15-minute sessions per week for six weeks. subjects skin tone and pigmentation were observed before and after the intervention. [results] treatment of the under eye area showed that wrinkles were significantly decreased on both sides after rf, ea, and lllt. treatment of the eye rims indicated that wrinkles significantly decreased on the right side after rf, ea, and lllt. [conclusion] the application of lllt, ea, and rf had positive effects on wrinkle and moisture content of adult women s faces.

PMC5332991

pubmed-1004

clinically significant mrsa and mssa isolates, identified during january 2006march 2008, within 3 select communities (sites a site b also included 1 adjoining community, and sites a and b also included additional first nations reserves serviced by the community. a total of 1,280 isolates, obtained from skin and soft tissue infections (sstis), urinary tract infections, upper respiratory tract infections, and lower respiratory tract infections, were identified as s. aureus. a high proportion of these isolates, 692 (54.1%) of 1,280, were mrsa. over the 2-year study period, rates of mrsa and mssa infections in the 3 communities ranged from 146482/10,000 and 112329/10,000 population, respectively. trends of seasonality were apparent for mrsa infections, with the highest rates being observed in the third and fourth quarters of the year (figure 1). overall, the highest quarterly rates of mrsa and mssa infections were observed at site c, with 738/10,000 and 610/10,000 population, respectively. crude rates of community-acquired methicillin-resistant staphylococcus aureus (a) and methicillin-susceptible s. aureus (b) infections per 10,000 population in 3 select communities (sites a, b, and c) of northern saskatchewan, canada. the highest proportion of mrsa (30.4%) and mssa (32.1%) infections were identified in children<10 years of age (figure 2). compared to mssa infections, mrsa infections were statistically more likely to be causing infections in persons<30 years of age (odds ratio [or] 1.46, 95% confidence interval [ci] 1.141.86, p=0.002) and less likely to be causing infections in patients>60 years of age (or 0.33, 95% ci 0.200.567), p<0.001) (figure 2). no significant difference was found in gender between those who acquired mrsa (46.7% male) and mssa (53.3% female, 49.4% male) infections. age distribution of methicillin-resistant staphylococcus aureus (mrsa) and methicillin-susceptible s. aureus (mssa) infections in 3 select communities of northern saskatchewan, canada. most mrsa (98.6%) and mssa (91%) isolates were obtained from sstis. further analysis of sstis, comparing where on the body the infections were seen, showed significantly more mrsa infections in the axillae (or 3.04, 95% ci 1.396.89, p=0.004), buttocks (or 2.1, 95% ci 1.273.49, p=0.003), and trunk (or 2.25, 95% ci 1.543.31, p=< 0.001) than mssa infections. mrsa infections were significantly less likely to be found in feet (or 0.29, 95% ci 0.180.45, p<0.001), hands (or 0.45, 95% ci 0.30.68, p<0.001), and face or head (or 0.66, 95% ci 0.480.90, p=0.009). of the additional infection sites included in this study, mssa infections were statistically more likely to be identified in lower respiratory tract infections (or 5.6, 95% ci 1.524.62, p<0.05) and urinary tract infections (or 6.76, 95% ci 2.8716.71, p<0.001). a subset of 665 isolates were further characterized by antimicrobial drug susceptibility testing (table 1). in comparison to mssa, mrsa were significantly more likely to be susceptible to clindamycin, erythromycin, fusidic acid, and gentamicin, but were more likely to be resistant to mupirocin (table 1). in regards to the clindamycin-resistant isolates, 3 (18.8%) of the 16 mrsa isolates and 73 (93.6%) of the 78 mssa isolates all 328 of the mrsa isolates, but only 54 (70.1%) of the 77 mssa isolates, displayed high level resistance (> 128 g/ml). mrsa, methicilllin-resistant staphylococcus aureus; mssa, methicillin-susceptible s. aureus; r, resistant; or, odds ratio; ci, confidence interval; mic50, 50% minimum inhibitory concentration; mic90, 90% inhibitory concentration; sxt, sulfamethoxazole/trimethoprim; ns, not significant. pulsed-field gel electrophoresis (pfge) showed that most mrsa isolates (372/379, 98.2%) were usa400. the remaining 7 mrsa isolates were identified as cmrsa10 (usa300, sequence type (st) 8) (n=5), cmrsa2 (usa100/800, st5) (n=1), and cmrsa8 (emrsa15, st22) (n=1). as anticipated, pfge revealed much greater genetic diversity among the mssa strains circulating in these regions than in mrsa strains. notably, however, most mssa pfge fingerprints (79.2%) were related to highly successful canadian epidemic mrsa strains, a finding that was further confirmed by using spa typing (5) (table 2).*mssa, methicilin-susceptible staphylococcus aureus; mrsa, methicillin-resistant s. aureus; pvl, panton-valentine leukocidin; pfge, pulsed-field gel electrophoresis; mlst, multilocus sequence typing; st, sequence type. mrsa isolates were more likely to harbor the genes encoding panton-valentine leukocidin than were mssa isolates, 95.5% versus 5.2%, respectively. the pfge and spa types of the 15 panton-valentine leukocidin positive mssa isolates were associated with the ca-mrsa epidemic strain types usa400, usa300, and usa1000 (table 2). rates of mssa and mrsa infections in these 3 northern saskatchewan communities (112482 cases/10,000 population) far exceed mrsa rates reported in the neighboring provinces of manitoba (16/10,000 population) (6) and alberta (10.7/10,000 population) (7), as well as benchmark hospital rates provided by the canadian nosocomial infection surveillance program (3.43 cases/10,000 patient days) (1). the high rates of s. aureus infections in remote northern saskatchewan communities has been attributed to a combination of risk factors, including overcrowding and poor housing conditions, inadequate hygiene, preexisting skin conditions, and previous high usage of antimicrobial drugs (8). usa400 was by far the predominant strain type in all 3 communities, accounting for>98% of the mrsa isolates. usa400 was first reported in manitoba as an outbreak in the southern region in the late 1990s, but has since spread to the northern regions of the province from 2000 to 2004 (9). usa400 was thereafter seen in a central eastern saskatchewan community adjacent to the manitoba border (2) and has since disseminated as far north as nunavut (10) and southwestern alaska (11). because mrsa and mssa sstis tended to be identified more frequently from different body sites, it is appealing to speculate that ca-mrsa strains, such as usa400, might also colonize different body sites (e.g., axillae or intestines) more efficiently than other strains of s. aureus. this hypothesis coincides with a recent report in which nasal colonization was less likely in patients with ca-mrsa sstis than in those with hospital-acquired mrsa sstis (12). intestinal carriage of s. aureus has been implicated as a risk factor for infection (13) and could be a strong contributor to environmental dissemination and transmission (14). this possibility was recently further supported by the results of a study in which the rectal carriage, but not nasal carriage, of usa300 was strongly associated with sstis in children (15). further study is required to determine whether specific lineages of s. aureus are more proficient colonizers at non-nasal colonization sites, what host/bacteria genetic factors are involved, and whether this colonization plays a role in the high success of these ca-mrsa strain types. to address the high rates of s. aureus infections in northern saskatchewan, physician treatment algorithms and educational materials these materials are all freely available (www.narp.ca) and are intended to promote proper antimicrobial drug usage and hygiene to diminish the spread of s. aureus disease.

surveillance of staphylococcus aureus infections in 3 northern remote communities of saskatchewan was undertaken. rates of methicillin-resistant infections were extremely high (146482/10,000 population), and most (98.2%) were caused by usa400 strains. although usa400 prevalence has diminished in the united states, this strain is continuing to predominate throughout many northern communities in canada.

PMC3377391

pubmed-1005

in the industrialised nations, food allergy is a growing epidemic affecting all age groups and appearing at any time in life. a marked increase in the incidence of food allergy in young children is of particular concern, with a reported 68% of young children and 3-4% of adults having some type of food allergy [13]. comparable to the trends first seen with asthma, countries such as the united states (us), united kingdom (uk), and australia have the highest rates of food allergy. in the past decade alone, prevalence rates in the us have increased by at least 18% [4, 5]. similarly, a recent study in australia found that more than 10% of a cohort of infants had challenge-proven ige-mediated food allergy to one of the common allergenic foods (peanut, raw egg, and sesame). this escalation in the prevalence of food allergies underlies the importance of further research to improve prevention and treatment strategies. these aberrant allergic reactions are principally driven by a t helper type 2 (th2) immune pathway, as evidenced by high levels of allergen-specific immunoglobulin e (ige), th2 polarisation involving inflammatory cells, and cytokines/mediators, and the reported efficacy of therapies that inhibit th2 immune responses in human subjects [912]. there is now also recognition of the innate properties of allergens and their role in th2 polarisation of dendritic cells (dcs) and the process of allergen sensitisation [9, 13]. the most common foods that trigger food allergy are cow's milk, hen's egg, and peanuts and tree nuts, while less common food allergens include soy, wheat, fish, and shellfish [31, 32]. food allergy is known to be most common in the first 3 years of life; however, studies have shown that most food allergies that begin early in life, such as milk, egg, soy, and wheat, are generally outgrown. conversely, allergies to peanut, tree nuts, fish, and shellfish usually persist, becoming a lifelong burden [12, 31, 33]. animal models hold great potential as powerful tools to help answer some of the difficult questions still surrounding the food allergy epidemic. research in humans is limited by ethical concerns and the chance of fatal anaphylactic reactions. this has stimulated great interest in the use of relevant animal models to predict possible triggers for allergy, identify possible mechanisms involved in setting up the allergic pathway, as well as the testing of novel therapeutic treatments [12, 35, 36]. the purpose of this review is to discuss the application of animal models for the study of the three main food allergens: cow's milk, hen's egg, and peanuts/tree nuts and to provide an overview of the contribution of animal models to our understanding of these allergens and food allergy in general. mice are the predominant laboratory animal used to study the development of many diseases, generally favoured for their size, short breeding cycles and manageable housekeeping, and the relative ease of genetic manipulation compared to larger models [35, 37]. the use of the murine species in research over several decades has led to the continued development of cellular and molecular tools to allow extensive investigation of mechanisms and pathways of interest. today, mice have the most comprehensive characterisation of their biology, immunology, and genetic makeup. this background has led to mice providing the foundation for the development of numerous food allergy models. murine models of food allergy have been investigated in several strains including c3h/hej, balb/c, c57/bl6, and dba/2 (table 1). these animals have the capacity to produce ige and/or igg1 anaphylactic antibodies, and strains can be divided into either high or low ige responders. one of the most challenging obstacles involved in developing murine models of food allergy is the tendency for the immune system to develop oral tolerance to ingested antigens [16, 17]. to avoid this, researchers have focussed on certain strains of mice, such as c3h/hej [14, 15, 23] and balb/c [1517, 27], which more readily display th2 responses than other common murine strains. the use of adjuvants such as cholera toxin (ct) to help stimulate a th2 response is also frequent in food allergy models [1417, 22, 23, 25, 29]. the rat is another common small animal model used in studies of food allergy, with the brown norway (bn) strain being the most suitable for inducing specific ige after oral sensitisation [18, 19, 40, 41]. other rat strains such as the wistar, hooded lister, and piebald virol glaxo (pvg) rats, have also been examined; however, these strains fail to produce quantifiable levels of antigen-specific ige. the bn rat, as well as other murine strains, has also been used to predict the allergenicity of novel proteins, such as those used in agricultural biotechnology, as reviewed by ladics and colleagues. the guinea pig has also been used as a model to investigate the allergenicity of food proteins, specifically cow's milk (cm).. demonstrated that within 13 days of drinking cm, guinea pigs could display fatal anaphylaxis if animals were subsequently challenged. there are obstacles in translating findings from guinea pigs to the human setting, including differences in immune physiology and having to estimate ige production in guinea pigs indirectly (e.g., through pca). the limited knowledge and tools available to study their immune system have also led to fewer studies on this model for food allergy research, though it has been a successful model for infectious diseases. pigs, dogs, and sheep are the main examples of large animal models that have been investigated for food allergy (table 1). like humans, dogs are one of the few species that can develop allergies to naturally occurring allergens including pollen, grass, house dust mite, and food. dogs have previously been used to examine other food allergens including wheat, egg, and meat proteins and displayed positive oral challenges in addition to specific ige production, traits similar to those seen in human patients. the university of california developed an atopic dog colony specifically for use in allergy research; these high ige producing canines were first used for asthma studies involving environmental allergens such as grass pollen and ragweed, which were shown to elicit prominent airway hyperresponsiveness (ahr) in these animals. pigs (swine) represent another large animal model that presents many advantages as a comparative model for food allergy. the intestinal physiology of swine is anatomically and histologically similar to humans, with a microflora more diverse than that seen in rodent models [12, 29, 49]. pigs also represent an outbred population, with notable variation in the quality of immune responses raised by individuals. these traits are extremely important when examining the pathogenesis and immune responses to food allergens. swine models have previously been used to investigate other allergic disorders such as asthma; in these studies, animals displayed airway obstruction, eosinophilia, and a late-phase asthmatic response following airway allergen challenge, as typically observed in human asthmatics. sheep have the advantage of being similar in size and physiology to humans, are placid in nature, and their use poses fewer ethical constraints compared to the use of other large animal models [37, 50]. sheep have previously been used for allergy studies involving house dust mite (hdm) allergen with a focus on human allergic asthma [37, 51], and more recently as a model for peanut food allergy. some key advantages of using large animal models include their outbred nature, allowing studies that are more comparable to humans, the ability to conduct serial experiments within the same cohort of animals, and their relative longevity, allowing more relevant investigations into chronic disease as well as the long-term evaluation of specific therapies [37, 50]. there are multiple physiological routes that can induce allergic sensitisation including oral, nasal, intraperitoneal, intragastric, and cutaneous. despite oral sensitisation being classified as one of the major routes for the sensitisation to food proteins, alternative pathways such as the skin and/or the respiratory tract may also play a role in allergic sensitisation. for example, in a human study it was found that peanut sensitisation arose from environmental exposure, primarily through cutaneous or inhalation routes, rather than from maternal or infant allergen consumption. further, in a mouse model strid et al. reported that an aqueous solution of either peanut or ova, when applied to the abraded skin induced the production of antigen-specific ige. it is worthy to note that the most effective route of food allergen sensitisation has also been shown to vary significantly between mouse strains [15, 56]. the route of allergen sensitisation is, therefore, an important and necessary consideration for the use of any relevant animal model of food allergy and will be the topic of further discussion throughout this review. cow's milk (cm) allergy is one of the most prevalent food allergies that occurs in infants and young children, with the incidence estimated at 2.5% of the general population [31, 57]. cm can be divided into two main classes, whole casein (bos d 8) which accounts for 80% of the total protein content and whey proteins that make up the remaining 20%. the casein fraction can be subdivided further into four main proteins (s1-, s2-, -, and -casein), whilst whey contains -lactoglobulin (lg or bos d 5), -lactalbumin (ala or bos d 4), immunoglobulins (bos d 7), bovine serum albumin (bsa or bos d 6), and traces of lactoferrin. although each protein has the potential to act as an allergen, casein, blg, and ala are believed to be the most allergenic [5860]. reactions to milk proteins can be either ige mediated (usually occurring immediately or within 2 hours of ingestion) or non-ige mediated (generally having a delayed onset). clinical features of ige-mediated hypersensitivities can include reactions involving the skin, respiratory tract, gastrointestinal tract, or in extreme cases, systemic anaphylactic shock. the chance of developing ige-mediated food allergy is greater in atopic humans that have the genetic predisposition towards mounting an immediate hypersensitivity reaction to food proteins. though research has shown that most patients outgrow cm allergy by the age of 3, those that suffer from ige-mediated hypersensitivities have a much poorer rate of outgrowing the disorder and are also at a greater risk of developing other atopic conditions [57, 61, 62]. mice and rats have been employed in numerous studies on cm allergy (table 1) and were first used in this field to help define the immunopathogenic mechanisms responsible for eliciting allergen-specific ige production and other cell-mediated reactions [14, 18, 20, 23]. the brown norway (bn) rat is a high-immunoglobulin (specifically ige) responder, allowing some level of comparison to atopic humans [18, 41]. in a study by atkinson and miller, sensitised bn rats displayed reaginic antibody responses to a range of milk proteins, similar to those recognised in allergic patients with cm allergy. milk proteins were also found to be less allergenic than ova, with the dose of antigen required to induce sensitisation being 20-fold higher. it has since been demonstrated that bn rats can also be sensitised orally and without the use of adjuvants through gavage dosing. rats sensitised in this way produced significant antigen-specific ige responses, comparable to those seen in allergic patients. li et al. used several techniques to induce ige-mediated cm hypersensitivity in three-week-old c3h/hej mice. sensitised via the intragastric (ig) route with milk proteins and ct as adjuvant, animals were boosted once a week for a five-week period. this study was one of the first murine models of cm allergy to generate systemic hypersensitivity by oral sensitisation and challenge. six weeks after the initial sensitisation, cm-specific ige antibody levels were significantly increased and ig challenge with allergen provoked systemic anaphylaxis, with immediate reactions regularly accompanied by respiratory symptoms. plasma histamine levels increased significantly in cm-sensitised mice after challenge, compared with ct-sham-sensitised mice and nave mice, suggesting histamine to be a major mediator involved in this anaphylaxis model. heat-treated sera did not produce anaphylaxis in contrast to untreated sera, thus confirming the presence of ige. furthermore, cytokine production in spleen cells of allergic mice was examined, and a significant increase in the type 2 cytokines interleukin- (il-) 4 and il-5, but not interferon- (ifn-) was detected. this finding provided strong support that th2 responses contribute to the development of cm allergy. genetic susceptibility is known to be a contributing factor towards developing food allergies; however, trying to observe the expected development of allergy in humans is practically impossible. morafo et al. aimed to investigate the susceptibility of different strains of mice to food hypersensitivity, following the sensitisation protocol li et al. their study focussed on c3h/hej and balb/c mice and involved sensitising animals to both cm and peanut (pn) allergen, via the ig route with ct. interestingly, though balb/c mice are routinely used as models for food allergy (usually induced by systemic antigen sensitization, e.g., ip), ig sensitisation in this study failed to induce hypersensitivity reactions to either of the food allergens, whilst c3h/hej mice were shown to display reactions to both. cm-specific ige levels at the time of challenge (week 6) were markedly increased in c3h/hej mice; however, ige levels in balb/c mice were only slightly higher than those of nave mice. furthermore, anaphylactic reactions were observed in 87% of c3h/hej mice, whilst none were observed in balb/c mice or nave mice of either strain. anaphylactic reactions were associated with increased plasma histamine levels found only in c3h/hej mice. the comparison of splenocyte cytokine profiles between the two strains illustrated that in balb/c mice ifn- production was significantly increased, whilst il-4 and il-10 were not. conversely, il-4 and il-10, but not ifn-, levels were considerably higher in c3h/hej mice. furthermore, a study by berin et al. investigated the role of tlr4 in the development of allergic sensitisation to either cm or pn proteins, in both c3h/hej and balb/c mice. t-cell responses were th2 skewed in tlr4-deficient c3h/hej mice but not tlr4-sufficient c3h/hej mice; however, this th2 skewing was not observed in tlr4-deficient balb/c mice. moreover, c3h/hej mice were susceptible to pn-induced anaphylaxis, whilst balb/c mice were completely resistant. this study concluded that though tlr4 status may impact t-cell responses and the severity of anaphylactic reactions to food proteins, the nature of the effect was highly dependent on the genetic background of the mouse. together, these findings suggested that genetic background plays a major role in the development of food allergies. other studies have demonstrated successful sensitisation to milk proteins via a systemic (ip) route [16, 17]. the most effective route of sensitisation has been shown to vary significantly between mouse strains and should be taken into consideration when developing a relevant food allergy model. a recent study by dunkin et al. assessed the impact of milk allergens via different sensitisation routes, with and without adjuvant (ct). three-week-old c3h/hej mice were exposed to ala, through ig, cutaneous, intranasal, or sublingual routes. although sensitisation was successful via each route, cutaneous exposure was shown to induce the maximal ige response. interestingly, the presence of the adjuvant ct was a more significant factor for sensitisation than the actual route. hen's egg (he) allergy is the second most common food allergy in children, with the dominant egg allergens found in egg white. egg yolk still holds some allergenic properties; however, these are considerably lower than the four major egg white proteins, ovomucoid (ovm or gal d 1), ovalbumin (ova or gal d 2), ovotransferrin (ovt or gal d 3), and lysozyme (lys or gal d 4). though ova is the major protein in egg white (54% of total protein), ovm (gal d 1) has been reported as the immunodominant allergen. similar to its use as a model for the study of cm allergy, the bn rat has been one of the most studied animal models for he allergy (table 1). atkinson and colleagues [18, 19] effectively dosed rats orally (0.5 ml/100 g body weight) with solutions of 1.012.5 mg/ml ova in distilled water twice a week, for a six-week period. oral sensitisation of ova was shown to induce both antigen-specific igg and ige antibodies (assessed by pca). levels of igg antibody were detected in sera from day 21 onwards from animals dosed with 5 mg/ml and above, with levels peaking at day 28. interestingly, ige could be detected from as early as day 14 onwards, in animals given the higher doses (10.0 and 12.5 mg/ml), while the lower dose (5 mg/ml) only induced antibody from day 28 onwards. levels of igg were also absent at lower doses, further illustrating the impact of allergen dose on sensitisation in this model and providing potential for its use in testing factors that could either enhance or inhibit sensitisation to food proteins. knippels et al. in subsequent studies used bn rats to further characterise the rat he allergy model by investigating parental sensitisation to ova without the use of adjuvants. in this study, three main factors were examined including dose (0.00220 mg/ml), method of dose application (ad libitum via the drinking water or gavage), and frequency of dosing (daily, twice a week, once a week, or once every two weeks) over a period of 6 weeks. rats were tested for anti-ova antibodies and delayed-type hypersensitivity (dth) responses on days 28 and 42 (separate groups). daily administration of ova by gavage (1 mg/rat) induced ova-specific igg and ige responses in nearly all animals tested. in the same group of animals, no significant dth response was detected at day 28 but by day 42, dth responsiveness had developed. in comparison, upon ad libitum exposure to 0.002, 0.02, or 0.2 mg/ml ova via the drinking water, no ova-specific antibodies were produced. however, exposure to 2 or 20 mg/ml ova caused ova-specific igg responses. no ova-specific ige was detected for either of the time-points investigated. interestingly, the most pronounced dth reactions were seen in rats exposed to ova via the drinking water at day 28, with weaker responses seen by day 42. results from this study clearly demonstrate how the method of dose application may impact on the quality and magnitude of the immune response. in further work with this model, knippels et al. examined the effects of oral challenge with ova in previously sensitised bn rats, reporting a minor, transient effect on breathing frequency or systolic blood pressure, similar to that observed in food allergy patients. another study by akiyama et al. also investigated oral sensitisation in bn rats and three murine strains (balb/c, b10a, and ask) and found that both bn rats and b10a mice had the highest sensitisation to ova from the models examined; this confirmed that bn rats were a suitable model for assessing the allergenicity of food proteins. this study also found that age was a contributing factor to sensitisation in balb/c mice, with 20-week-old mice showing the highest ova-specific ige and igg1 responses among the three different age groups examined (7 weeks, 20 weeks, and 1 year). though many studies have used ova to examine egg allergy, ovm (or gal d 1) has been reported as being the dominant allergen in hen's egg to cause allergic reactions in children. one study conducted by rupa et al. aimed to induce allergy to ovm using a neonatal swine model. three outbred litters of yorkshire piglets were used for this study, where animals were sensitised ip on days 14, 21, and 35 with 100 g of crude ovm, with ct as adjuvant (10, 25, or 50 g). pigs were fasted overnight before oral challenge on day 46 with a mixture of egg white and yoghurt. the majority of animals sensitised to ovm displayed strong skin reactivity to direct skin testing on day 35, in contrast to control pigs that did not respond. additionally, after oral challenge, only sensitised animals showed symptoms of allergic hypersensitivity. sera analysed from these sensitised pigs revealed ovm-specific igg, whilst pca reactions confirmed ige-mediated antibody responses to ovm. sera that were heat treated or collected from control animals failed to induce a positive pca response. these results confirm that ovm can successfully be used to sensitise and elicit allergy in pigs, and due to their outbred nature, these animals may also provide the opportunity to investigate some of the mechanisms that underlie allergic predisposition. despite their appearance and name, peanuts (arachis hypogaea) are not actually a nut; they are a species in the legume or bean family. however, though peanuts and tree nuts originate from different families, they have both been known to contain potent allergens, with a us study reporting peanut and tree nut allergy to specifically account for 90% of fatal anaphylactic reactions. unlike other food allergies such as cow's milk and egg, the ubiquitous use of pn proteins, together with the apparent increase in the prevalence of pn allergy over the last few decades, has generated great attention towards research in this field [68, 69]. as many as eleven pn allergenic proteins have been categorised (ara h 111), with ara h 1 and ara h 2 classified as the major pn allergens [70, 71]. following from their work with a murine cm allergy model, li et al. developed a murine model of pn-induced anaphylaxis using c3h/hej mice-sensitised ig with a low (5 mg/mouse) or high (25 mg/mouse) pn dose together with ct as adjuvant. in this study, both doses of the allergen induced pn-specific ige; however, the level of sensitisation was more effective with the lower dose. systemic anaphylactic reactions after oral challenge were also more sever in mice sensitised with the low pn dose, with 12.5% of mice exhibiting fatal or near-fatal anaphylaxis. furthermore, plasma histamine levels and mast cell degranulation from ear tissue were significantly increased in sensitised mice, suggesting that histamine and other mediators released from mast cells attributed significantly to the severe reactions (including anaphylaxis) seen in the pn-sensitised mice. investigations into t- and b-cell responses in these mice showed similarities to human patients, with allergic mice exhibiting significant in vitro t-cell proliferative responses to crude pn and the major allergens ara h 1 and ara h 2. more importantly, this study demonstrated that pn proteins are more allergenic than cm proteins, both with respect to a shorter sensitisation period (fewer doses) and the induction of hypersensitivity in adult (5-6-week-old) as well as 3-week-old mice [14, 23]. a comparison between oral and nasal routes of allergen sensitisation in a mouse model of pn allergy was performed by fischer et al., using female c57bl/6 mice, sensitised with whole pn protein extract (ppe) and ct as adjuvant. oral sensitisation was shown to induce higher pn-specific plasma ige antibody responses and lung eosinophilia following allergen challenge. this was in contrast to nasal sensitisation, which induced greater levels of pn-specific plasma igg and increased airway inflammation (recruitment of macrophages) after challenge. furthermore, only nasal sensitisation was found to favour an inflammatory response to nasal challenge with unrelated antigens. cytokine-specific mrna responses on whole-lung tissues were also analysed and compared for both groups before and after challenge. before challenge, nasally and orally after nasal challenge, however, orally sensitised mice displayed a greater increase for two th2-associated cytokines, il-4 and ccl-11, whereas nasally sensitised mice expressed a greater increase in the th1 cytokine il-17. overall data from this study proposed that mice sensitised orally were more prone to allergic-type responses whilst nasal sensitisation was shown to promote nonallergic inflammation. although peanuts are not actually classified as nuts, patients allergic to peanuts also regularly develop hypersensitivity to tree nuts including almonds, brazil nuts, cashew, and hazelnuts to name a few. [72, 73] found that the major pn allergen, ara h 2, shared similar ige binding epitopes with allergens from almond and brazil nuts, which may contribute to the increased rates of cosensitisation to peanuts and tree nuts in peanut-allergic individuals. peanuts and tree nuts are frequently associated with life-threatening anaphylaxis, with both forms of allergy rarely outgrown with age. a cashew nut mouse model of allergy showed robust induction of specific ige following transdermal sensitisation, as well as th2 cytokines (il-4, il-5, and il-13) production by cultured splenocytes from sensitised animals. more recently, a long-term mouse model for hazelnut (hn) allergy was investigated to determine whether sensitivity would persist over time. findings from this study in adult balb/c mice revealed that circulating hn-specific ige antibodies persist for long periods (up to 8 months) despite allergen withdrawal. these long-term memory ige responses were found to be associated with memory spleen cell il-4 responses. this data, therefore, illustrated possible mechanisms that could be involved with persistent nut allergies, even when the allergen is withdrawn for long periods of time. dogs, pigs, and sheep have reportedly been used as large animal experimental models for pn allergy (table 1). while dogs have previously been employed for the testing of numerous allergens, teuber et al. used atopic dogs for the first time to develop a canine model of pn/tree nut allergies. this study used inbred high ige-producing spaniel/basenji dogs, subcutaneously (sc) sensitising them with commercial extracts of either 1 g of pn, english walnut or brazil nut proteins, together with aluminium hydroxide (alum) as adjuvant. to test allergenicity, intradermal skin tests, ige immunoblotting and oral challenges were carried out with ground nut preparations. all animals skin tested at 6 months of age displayed positive wheal responses to the commercial extracts used for sensitisation, with pn generating the largest response and barley the least. ige immunoblotting revealed specific recognition of nut proteins, with pn-sensitised dogs displaying specific ige binding to ara h 1, one of the major pn allergens recognised by pn-allergic subjects. within 10 minutes of oral challenge, all pn-sensitised dogs vomited and showed signs of fatigue, further demonstrating the high allergenicity to pn proteins. overall, this study demonstrated the successful use of the dog model to display symptoms seen in food allergy sufferers, as well as a model for concurrent sensitisation to a number of food allergens. set out to develop a neonatal swine model of pn allergy that would not only display allergic reactions, but also immune and histological profiles similar to those seen in allergic patients. optimal sensitisation was achieved in piglets sensitised ip with 500 g of crude pn extract with ct as adjuvant on days 9, 10, and 11 after birth, then boosted on days 18 and 25. pigs were later challenged by either ig challenge or skin tests at 1-week intervals. following oral challenge, physical symptoms displayed by the animals were comparable to those seen in humans, including the appearance of rashes and distress associated with the gastrointestinal (diarrhoea) and respiratory (gasping/panting) systems. serum igg antibodies were analysed and correlations between allergen-specific igg levels and clinical symptom scores, suggesting that high igg levels afford greater protection against food challenge. while ige levels were not directly assessed in this study, repeated positive skin tests and passive cutaneous anaphylaxis indicated the presence of ige. finally, histological assessment of the small intestine revealed denudation of the villi, oedema, and infiltration of immune cells. collectively, these findings demonstrate clinical, immunological, and pathological features of pn allergy as seen in humans, supporting the neonatal pig as a suitable model for investigating mechanisms of pn allergy. more recent studies report the use of sheep as a model for pn allergy involving animals sensitised via sc injections of crude pn extract (100 g) with alum as adjuvant. sensitisation was achieved following 3 sc injections at 2-week intervals, followed by a boost injection after a 1-month rest period. concurrent sc injections of ova (100 g) and hdm (50 g) were also given to compare allergenicity. elevated pn-specific ige responses were detected in 4050% of immunised sheep, while only 10% (1 of 10 sheep) displayed detectable ova-specific ige. this level of sensitisation to pn allergen was similar to that seen in response to hdm allergen sensitisation here and elsewhere [51, 74] in sheep, and it likely reflects the outbred nature of this species. though ova was shown to have a low capacity for specific ige induction, total ova-specific ig levels were shown to increase significantly. conversely, the elevated pn-specific ige levels were not accompanied by a notable change in pn-specific total ig. significantly, pn-allergic sheep showed strong ige reactivity to two of the major peanut allergens: ara h 1 and ara h 2. furthermore, 80% of sheep that responded to pn allergen with high ige levels also displayed an immediate hypersensitivity reaction following intradermal pn challenge. the sheep model of pn allergy displays a robust systemic ige-responsiveness to pn proteins, providing a new large animal experimental system for studies of allergen-associated immune mechanisms. despite our improved understanding of food allergy in recent years, there is still no specific therapeutic option available. currently, strict avoidance and the use of adrenaline in the event of an accidental exposure are the only approved treatments, although several forms of immunotherapy are presently under investigation including oral (oit), sublingual (slit), epicutaneous (epit), and subcutaneous allergen-specific immunotherapy (scit) [75, 76]. a recent study by srivastava et al. demonstrated that anaphylaxis in a murine model can be prevented following treatment with the chinese herbal medicine formula fahf-2. findings from this study and other work from this group suggests that fahf-2 may have the potential to treat multiple food allergies, including peanut and egg [7779]. the high risk of anaphylaxis is a major factor limiting the development of food allergy immunotherapy in humans [75, 80]. in this context, animal models may play an important role in providing a platform for refining these treatments and ensuring thorough preclinical evaluation of their safety, prior to therapeutic human application.

food allergy is an emerging epidemic that affects all age groups, with the highest prevalence rates being reported amongst western countries such as the united states (us), united kingdom (uk), and australia. the development of animal models to test various food allergies has been beneficial in allowing more rapid and extensive investigations into the mechanisms involved in the allergic pathway, such as predicting possible triggers as well as the testing of novel treatments for food allergy. traditionally, small animal models have been used to characterise immunological pathways, providing the foundation for the development of numerous allergy models. larger animals also merit consideration as models for food allergy as they are thought to more closely reflect the human allergic state due to their physiology and outbred nature. this paper will discuss the use of animal models for the investigation of the major food allergens; cow's milk, hen's egg, and peanut/other tree nuts, highlight the distinguishing features of each of these models, and provide an overview of how the results from these trials have improved our understanding of these specific allergens and food allergy in general.

PMC3649177

pubmed-1006

the first study of this dissertation (chapter 2) concentrated on trauma exposure in childhood. early in life, the hpa-axis is in development and trauma exposure during childhood is thought to have profound effects on hpa-axis regulation. these effects may be evident even throughout adulthood and in the absence of psychiatric morbidity. in this chapter, we explored the influence of exposure to childhood trauma on hpa-axis regulation in a group of women without present and lifetime psychiatric disorders, and compared them with women without a history of childhood trauma. the results of this study support the hypothesis that hpa-axis regulation is durably changed by exposure to sustained childhood trauma, as we found a blunted cortisol and adreno-corticotropic hormone (acth) response to the dexamethasone/corticotropin-releasing hormone (dex/crh) challenge test. these findings are largely consistent with several lines of evidence, which comprise animal studies (de kloet, sibug, helmerhorst,&schmidt, 2005; sanchez, ladd,&plotsky, 2001; sapolsky&meaney, 1986; suchecki, rosenfeld,&levine, 1993). however, causal inference can not be asserted based on our cross-sectional analysis. therefore, an alternative interpretation of the results is that higher resilience against psychopathology explains why the women in our study had not developed psychiatric illnesses following childhood trauma exposure. the salivary cortisol responses to awakening, as well as the cortisol levels over the rest of the day, were not (lastingly) altered by childhood trauma exposure (fig. no effect of childhood trauma exposure on basal hpa-axis regulation was found; a blunted cortisol and acth response to the dex/crh challenge test were found in trauma-exposed (te) women. in chapter 3, we described the mental health of a large group of dutch peacekeeping veterans 1025 years after deployment to lebanon and former yugoslavia, and its association with deployment-related trauma exposure. we found that 1025 years post-deployment, dutch peacekeeping veterans did not show more psychological distress than the general dutch population as assessed with the brief symptom inventory (bsi). in addition, we did not find a significant association between past trauma exposure (1025 years ago) and current psychological distress. moreover, trauma exposure explained only 9% of the variance in psychological distress. from these findings, we concluded that even though military peacekeeping operations may have a strong impact on the lives of soldiers, trauma exposure in this group of veterans did not seem to be related to current psychological distress. in other words, exposure to traumatic events often occurs during deployment, but this did not cause sustained psychological distress in the majority of the dutch peacekeepers. in chapter 4 the relationship between past trauma exposure (as described above) and current hpa-axis regulation in a group of peacekeeping veterans without current or lifetime dsm-iv axis i psychiatric disorders was explored. the hpa-axis was tested through basal salivary cortisol over the day as well as with the dex/crh challenge test. in contrast to our hypothesis that trauma exposure during adulthood would be associated with altered hpa-axis functioning, we did not find evidence of hpa-axis alterations. however, as hpa-axis regulation in military personnel may well be different than that of non-military controls due to e.g., chronic stress during deployment, military training, or personality structure, we also compared peacekeeping veterans with civilian non-trauma-exposed controls (ne) without current and lifetime psychiatric morbidity. again, no differences were found. from these results we concluded that deployment-related trauma exposure in male peacekeeping veterans is unrelated to long term hpa-axis alterations (fig. 3). established relationship between deployment-related trauma exposure and hpa-axis regulation. no effect of deployment-related trauma exposure on hpa-axis regulation was found. in chapter 5, we studied the effect of work-related trauma exposure on hpa-axis regulation in dutch railway personnel. train drivers and conductors in the netherlands are frequently exposed to severely stressful and traumatic events during the course of their daily work. verbal and physical aggression as well as person-under-train accidents and near-accidents occur on a regular basis for many of the men and women. in this study, we compared te male train drivers and conductors without current and lifetime dsm-iv axis i psychiatric disorders with ne controls, also without psychiatric disorders. in support of our hypothesis that trauma exposure during adulthood is associated with hpa-axis dysregulation, we found a blunted salivary cortisol response to awakening in the te subjects. however, no effect was found in hpa-axis reactivity during the dex/crh test. these results support the idea that trauma exposure during adulthood is associated with subtle basal hpa-axis alterations, even in the absence of psychiatric morbidity (fig. 4). established relationship between civilian trauma exposure during adulthood and hpa-axis regulation. no differences were found on the cortisol and acth response to the dex/crh. the results from the studies on the effect of adulthood trauma on hpa-axis regulation in this dissertation are mixed. in order to describe and summarize all current evidence on the association between trauma exposure during adulthood and hpa-axis regulation in our and other studies that included te healthy individuals as well as ne healthy controls and ptsd patients, we performed two meta-analyses on 37 eligible studies published between 1995 and 2010 (chapter 6). in the first meta-analysis, the te subjects were compared with ne control subjects (including 21 studies) and, in the second meta-analysis, te subjects were compared with ptsd patients (including 34 studies). the results clearly show that trauma exposure during adulthood is not associated with basal hpa-axis dysregulation. in addition, no evidence was found for an association of ptsd with basal hpa-axis regulation. in subgroup analyses, however, we found increased cortisol suppression after dexamethasone in te subjects. mechanisms that have been proposed to explain the enhanced cortisol suppression in response to dexamethasone are an up-regulation of pituitary glucocorticoid receptors or glucocorticoid receptor sensitivity, resulting in an increased negative feedback sensitivity in te individuals. as the results of the dst in te subjects and ne controls were based on only five publications, more studies on this topic are needed. the findings of the studies presented in this dissertation add to the literature on the association of trauma exposure and hpa-axis functioning in several ways. first, in the design of our studies, we focused on te individuals without current or lifetime psychiatric disorders and compared them with a non-psychiatric ne control group. in most studies on the association between trauma exposure, ptsd, and hpa-axis regulation, ptsd patients were compared with individuals without psychiatric disorders. this precludes the possibility to distinguish between effects of psychiatric symptoms or trauma exposure per se (lindley, carlson,&benoit, 2004; muhtz, wester, yassouridis, wiedemann,&kellner, 2008; simeon et al., 2007). second, although the issue of trauma exposure in control subjects is important, many studies did not address this issue. some studies screened their eligible control subjects on trauma exposure (either during childhood, adulthood or both), and included only ne controls (lindley et al.. occasionally, te controls with a comparable type of trauma-exposure, e.g., military veterans with deployment related trauma exposure, were included (de kloet et al., 2007, 2008; golier, schmeidler, legge,&yehuda, 2007). often, however, the presence or absence of trauma exposure in non-psychiatric controls was not taken into account (baker et al., 2005; smith et al., 1989; yehuda, golier, halligan, meaney,&bierer, 2004; yehuda et al., 1993). these different ways of selecting and handling trauma exposure in control groups between studies makes comparison and interpreting the mixed results difficult. this was a major reason for conducting a meta-analysis on studies investigating trauma exposure and hpa-axis regulation in te and ne subjects without psychiatric disorders. to study the additional effect of ptsd, we also carried out a meta-analysis on studies investigating ptsd patients and te subjects. in the following sections, we will discuss the findings from this dissertation within a broader perspective of vulnerability and resilience. furthermore, we will discuss our experiences in relation to the inclusion of the te participants. consistent with our hypothesis and with findings from previous studies, we found a blunted cortisol and acth response to the dex/crh challenge test in mentally healthy adult women with a history of moderate to severe childhood trauma exposure. preclinical studies have shown that in rodents, very early in life, a time window exists during which low basal levels of corticosterone (with the same role in rodents as cortisol in humans) and hypo-responsiveness of the hpa-axis are crucial for the normal development of the brain circuitry (de kloet et al., 2005). this window of vulnerability is known as the stress hypo-responsive period (shrp), and prolonged activation of the hpa-axis is only resorted to under severe physiological and psychological stress (sapolsky&meaney, 1986). the shrp in rats is sustained by specific components of maternal care: licking and grooming, and delivery of milk to the pup (suchecki et al., 1993). manipulations that alter the licking and grooming (maternal separation) result in long-term alterations in hpa-axis regulation and in emotional behaviour (sanchez et al., 2001). similar findings on variations in maternal behaviour during infancy have been reported in non-human primate studies (coplan et al., 1996). mothers with low foraging demands (lfd) could obtain food without effort, whereas mothers with constantly high foraging demand (hfd) had to complete a daily task to obtain their food. in the variable foraging demand (vfd) condition, the mothers were exposed to unpredictable conditions with respect to food access, resulting in diminished perception of security and a reduction of maternal care of the infants. as adults, the vfd-reared macaques exhibited more trait anxiety than the lfd and hfd- reared macaques. in addition, dysregulation of the hpa-axis was reported, in particular, increased corticotropin releasing factor concentrations and decreased adrenal activity (coplan et al., 1996). in humans, during the first year of life, the hpa-axis also seems to have a hypo-responsive period. several studies have shown that hpa-axis activity in early human development is under strong psychosocial regulation and that a healthy attachment style is an important protective factor from developing poor hpa-axis regulation (gunnar&donzella, 2002). children who received insensitive, unresponsive care were more susceptible to cortisol elevations after a stressor than children who were securely attached to a caregiver (tarullo&gunnar, 2006). the fact that the women in our study were exposed to sexual and physical abuse as well as physical and emotional neglect during a time in their lives when hpa-axis regulation was vulnerable to change, may, therefore, explain our findings of a blunted cortisol response to stress in this group. our findings suggest that exposure to traumatic events during childhood alters the regulation of the hpa-axis. the results in our studies on military veterans differ from those on civilian subjects, suggesting that trauma exposure affects military personnel in other ways than it does civilian railway personnel, or, alternatively, that military personnel have a different level of hpa-axis-related resilience on average than civilian railway personnel. there may be several explanations for the findings of a blunted cortisol response in train drivers and conductors and no dysregulation in military veterans. an important purpose of military training is to let the soldiers get used to stressful circumstances and to keep their cool in times of danger. another explanation may be that people who are drawn to choosing a profession in which they are confronted with higher levels of stress and, potentially, even trauma, may have different personality structures (as well as hpa-axis set points) than people who do not make this choice. as ptsd was first diagnosed in combat veterans, it seems indicated to investigate hpa-axis regulation after trauma exposure in military veterans. however, this rather obvious choice has some pitfalls: there is a good chance that other factors such as personality, trained adaptation to stress, and resilience play a significant role in regulation of the hpa-axis in military personnel. another explanation for the blunted cortisol response to awakening we observed in te railway personnel may be the fact that 25% of these men were working irregular shifts as opposed to none of the ne civilian controls. as the effect of working irregular shifts on hpa-axis regulation griefahn&robens, 2008; kudielka, buchtal, uhde,&wust, 2007), we did not make this an exclusion criterion. it may however be possible that working irregular shifts has a dysregulating effect on the circadian rhythm, and therefore on the circadian cortisol release. a third explanation for the difference in findings in the two groups may be the fact that railway personnel are still functioning in the environment where the traumatic events took place (in the trains, on the platforms), perhaps resulting in an increased fight-or-flight readiness, a normal response after stress. the types of adult trauma and time since trauma may have different effects on hpa-axis regulation. these differences, however, may well be indissociable from the effects of personality traits and lifestyle factors. therefore, we would recommend studying the effect of trauma exposure in large cohorts of individuals from the general population. the most important psychosocial risk factors for the development of psychiatric disorders such as ptsd after trauma exposure are a history of psychopathology, prior trauma, trauma severity, a family history of psychiatric disorders, a lack of social support, and additional life stress (brewin, andrews,&valentine, 2000; ozer, best,&lipsey, 2003). in addition, we know that trauma exposure during childhood increases the vulnerability to the development of ptsd and mdd in adulthood, especially in women (heim, newport, bonsall, miller,&nemeroff, 2001; kessler, davis,&kendler, 1997; kessler et al., 1995). the presence of risk factors does not necessarily mean that a person will develop a psychiatric disorder after exposure to trauma. also, the absence of risk factors does not automatically imply that a person is not susceptible to the development of psychiatric disorders after trauma. the currently known risk factors can only explain a portion of the risk for ptsd in te populations. both risk and resilience factors are closely related and may reflect twin sides of adaptation to trauma (agaibi&wilson, 2005). in the studies described in this dissertation, we selected the participants who were likely to have high resilience against trauma-related psychopathology, as we only included individuals with multiple trauma exposure, without a history of psychiatric disorders as assessed with the mini international neuropsychiatric interview (m.i.n.i.) (van vliet&de beurs, 2007) and without current psychological complaints as assessed with the bsi (de beurs&zitman, 2006). all participants scored well below the cut-off for psychopathological caseness on the bsi. by selecting the te participants in this way, we were able to study the effect of trauma exposure per se on hpa-axis regulation. most studies on resilience after trauma exposure have relied on assessments of people after the traumatic event has occurred. determination of true resilience factors would require prospective studies in which these factors are assessed prior to the onset of a trauma (hoge, austin,&pollack, 2007). as far as we are aware, a large prospective study is currently carried out amongst dutch military men and women who have been deployed to afghanistan between 2005 and 2008 (prismo). all participants were assessed on psychological- and hpa-axis functioning prior to, during and directly after deployment, as well as during follow-up assessments after 6 months and 1, 2, 5, and 10 years. this study will provide more information on resilience to the development of ptsd and other stress-related psychiatric disorders. schematic outline of trauma exposure, hpa-axis regulation, resilience, and vulnerability for developing psychiatric disorders, and the mediating role of the hpa-axis. alternatively, study designs with twins could help unravel the genetic and environmental factors involved in vulnerability and resilience. twin research to date suggests that (1) exposure to assaultive trauma is moderately heritable whereas exposure to non-assaultive trauma is not, (2) ptsd symptoms are moderately heritable, and (3) comorbidity of ptsd with other disorders may be partly due to shared genetic and environmental influences (afifi, asmundson, taylor,&jang, 2010). as in many studies, recruitment of the participants was a major task and more difficult than expected. we sought to include healthy individuals with a history of exposure to psychological trauma in childhood as well as in adulthood. first, we set out to recruit healthy individuals with a history of childhood trauma exposure. an advertisement was placed in a well read dutch women's magazine (libelle). we asked for te as well as ne individuals without current or lifetime psychiatric disorders. the response was somewhat disappointing: 42 women and six men responded to the advertisement. almost half of them were not eligible because of nightshift work, current stress or medical issues such as thyroid problems. at the same time as recruiting individuals with a history of childhood trauma exposure, we placed an interview and an advertisement in the most read nationwide newspaper (de telegraaf) to recruit individuals with a history of trauma exposure during adulthood and without current or lifetime psychiatric disorders. the response was unsatisfactory as well; a mere 50 individuals (the majority of whom were women) responded. first, the most likely explanation may be that well-functioning te individuals are more inclined to forget the negative impact of the traumatic event (engelhard, hout,&mcnally, 2008), and as a result, do not remember the event as being traumatic (i.e., bias for not remembering traumatic events), and, therefore, do not recognise themselves in the description of the advertisement.. a final explanation may be that participation in the study required too much time and effort (as it included crh infusion and blood sampling), especially considering the fact that we only wanted to include healthy people, who generally have other obligations and limited time. of the people who did respond to our advertisement, many were not eligible to participate because they were (again or still) going through a stressful period (e.g., divorce, illness of partner or child) or they were using medication that interfered with hpa-axis regulation. the next step in recruiting the necessary individuals for our study was to approach organizations through which large numbers of te healthy people could be reached. first, we contacted the dutch veterans institute, where we found veterans with and without deployment related trauma exposure. second, we contacted the ns (nederlandse spoorwegen [dutch railways]), the main dutch railway company, to find te train drivers and conductors. during inclusion of the railway personnel, we discovered that some of the men (as not enough women were eligible) worked irregular shifts, either morning shifts, day shifts or evening shifts. none worked night shifts. to obtain a well-matched control group, we hoped to include train drivers and conductors without exposure to traumatic events. unfortunately, due to reasons unknown to us, the dutch railway company did not give us permission to contact ne healthy train drivers and conductors and, therefore, we had to include a sample of ne men from the general community, who were not working in irregular shifts. recruiting te individuals without psychiatric disorders also was a challenge. those who chose to respond to the advertisements might have had more close relatives with ptsd or trauma exposure, specific personality traits, or other unmeasured characteristics that may have confounded associations. recruitment of participants among specific groups with a high incidence of trauma exposure may have led to a confounding influence of personality traits or other lifestyle factors that are relevant to these specific groups. however, an advantage of contacting and selecting potentially eligible participants instead of having them respond to an advertisement is that self-selection bias plays a lesser role. the overall conclusion of this dissertation is that trauma-exposure during childhood is associated with an attenuated cortisol response after the dex/crh challenge test in women. in contrast, trauma exposure during adulthood was not associated with alterations in hpa-axis regulation after the dex/crh test. we did, however, find a blunted salivary cortisol response to awakening in male railway personnel compared to unexposed controls. even though our results on childhood trauma exposure are based on just one study, pre-clinical studies using rodents and non-human primates have given us more understanding of the neuroendocrine consequences of early life stress and indicate that hpa-axis response to stress may be influenced by early adversity (shea, walsh, macmillan,&steiner, 2005). also, recent studies support our findings (carpenter et al., 2007; elzinga, roelofs, tollenaar, bakvis, van pelt et al., 2008; meinlschmidt&heim, 2005) of lower cortisol levels in te subjects compared to ne controls with respect to childhood trauma. similar to the results of our two empirical studies on trauma exposure during adulthood, the literature on adulthood trauma exposure and its association with hpa-axis regulation and ptsd is inconsistent. this inconsistency may, for one, be the result of some studies including te control subjects whereas other studies included ne control subjects, and still other studies included both te and ne controls. to explore the complex and subtle relationship between trauma exposure and hpa-axis regulation further we focussed exclusively on adult trauma exposure and not childhood trauma in these meta-analyses, because: (1) adulthood trauma exposure may differently impact the hpa-axis than childhood trauma exposure, (2) there are many groups of people who are at risk for trauma exposure during adulthood (e.g., military personnel, police officers, fire-fighters, rescue workers, health care workers), and 3) less is known about adulthood trauma. based on the results from our meta-analyses of studies examining trauma exposure during adulthood and hpa-axis regulation in individuals with and without ptsd, we concluded that basal hpa-axis dysregulation in te adults is neither associated with trauma exposure nor with ptsd symptomatology. cortisol suppression after dexamethasone, however, was higher in te healthy individuals compared to ne healthy controls. this suggests that trauma exposure during adulthood may be associated with more delicate neuroendocrine hpa-axis dysregulation involving the hypothalamic-pituitary feedback system. because the findings on the dexamethasone suppression test (dst) were based on only 5 studies, they should be confirmed by future studies. resilience to psychiatric disorders after trauma exposure during childhood is associated with hpa-axis alterations that are demonstrable in adult women. resilience and vulnerability to ptsd after trauma exposure during adulthood, however, were not clearly associated with hpa-axis alterations. the association between childhood trauma exposure, resilience and vulnerability in which the hpa-axis plays a mediating role, and the association between adulthood trauma exposure and resilience and vulnerability without the mediating role of the hpa-axis. even though our studies on trauma exposure during adulthood do not clearly show an association between trauma and hpa-axis regulation, studies assessing the effect of administering cortisol to patients post-trauma show that the development of subsequent ptsd can be influenced (aerni et al., 2004; schelling et al., 2001, schelling et al., 2004 this forms another line of evidence that the (modulating) role of the hpa-axis is of importance. since the association between adulthood trauma and resilience can not be explained by hpa-axis regulation, other factors must play a role. as described in the introduction of this dissertation, the autonomic nervous system (ans) is another important part of the stress system, in addition to the hpa-axis. the most studied outcome measures of the ans are heart rate, blood pressure and skin conductivity. in addition a recent study in patients with generalized social anxiety disorder (gsad) showed that not cortisol but salivary alpha-amylase (saa), a relatively new marker of autonomic activity, was found to be higher in basal, non-stimulated conditions, as well as after the dst (van veen et al., 2008). the findings in this study suggest that in gsad there is an increased activity of the ans but not of the hpa-axis. this hyperactivity of the ans is in line with the clinically observed somatic symptoms of hyperarousal in gsad such as trembling, blushing and perspiration. as symptoms of chronic hyperarousal of the ans often are present in ptsd, the ans may play a role in resilience and vulnerability after trauma exposure. when an individual experiences a traumatic event, the brain activates the ans to meet the threat of a traumatic event, which is a normal, healthy, adaptive survival response. sometimes, however, the ans continues to be chronically aroused even though the threat has passed and has been survived a key symptom of ptsd. also, in a study among depressed adult women with a history of childhood trauma, hyperreactivity of the ans was reported (heim et al., 2000). the assessment of the ans in studies investigating the relation between trauma exposure and the resilience or vulnerability to psychopathology may provide new information on why some people develop psychiatric disorders and others do not. beside the ans, the experience of a traumatic event may disrupt major beliefs regarding personal invulnerability, benevolence of the world, meaning, self-worth, and relations with others. an individual may feel vigilant, depressed, powerless, vulnerable or guilty about not being able to change the situation, and these feelings may colour the way the individual sees the world. based on the findings and conclusions from the studies that were presented in this dissertation, we suggest that it should become good practice to include a te and/or a ne control group in studies examining psychiatric disorders and hpa-axis regulation. in studies examining the relationship between trauma exposure and stress regulation, adequate trauma assessment, not only of the te subjects but also of the controls should take place. this trauma assessment should not only cover trauma exposure in adulthood but more importantly, also trauma exposure during childhood. even though this dissertation mainly refers to ptsd, trauma assessment during childhood as well as during adulthood should also be carried out in studies involving mdd and hpa-axis regulation. also, a meta-analysis on the effects of childhood trauma exposure on hpa-axis regulation in healthy individuals is needed to confirm the findings we presented in chapter 2. furthermore, in future studies on trauma exposure, stress regulation, and psychopathology, it is important not to focus solely on the hpa-axis but to shift attention to other principal stress-axes (e.g., the ans) and their interaction with the hpa-axis to fully understand the neural effects of stress. as mentioned earlier, assessment of alpha-amylase may be studied as a marker of ans functioning. another example for further study is the neuropeptide oxytocin that plays a role in mediating social affiliation, attachment, social support, and maternal behaviour (young&wang, 2004). oxytocin also has a protective effect against stress and anxiety, and may therefore increase resilience to psychiatric disorders. a preliminary association has been found between decreased oxytocin concentrations and trauma exposure in childhood, suggesting that oxytocin may somehow be involved in the mechanism translating early adversity into adult vulnerability to stress and disease, including depression and anxiety disorders (heim et al., 2009). as far as psychological factors are concerned, enhancing resilience in individuals at risk of trauma exposure as well as in te individuals by focusing on interpersonal factors such as attachment and interpersonal relationships may prove to be a valuable addition to the exposure techniques that are widely used as treatment for ptsd (markowitz, milrod, bleiberg,&marshall, 2009). it is important for future studies to assess hpa-axis functioning with uniform protocols (e.g. cortisol sampling at specific time points and over more than one day) and also to use the same outcome measures and statistical analysis techniques (e.g. area under the curve, glm repeated measurements). in addition, because of the issue of compliance to the salivary cortisol sampling procedure, cortisol sampling monitoring devices should be developed and used. in addition to all the cross-sectional studies that have been discussed in this dissertation, prospective (longitudinal) studies, for instance in groups of people with a high risk of trauma exposure, will lead to more understanding of the relationship between trauma exposure, psychiatric disorders and stress regulation. finally, an increasing number of studies on the influence of genetics and epigenetics on the development of psychiatric disorders and resilience after trauma exposure are being published. on the one hand, genetic factors can influence the risk of exposure to some forms of trauma, perhaps through individual differences in personality that influence environmental choices (stein, jang, taylor, vernon,&livesley, 2002). on the other hand, animal studies show that neglect and exposure to stressors may alter gene expression in the brain, leading to increased stress and anxiety in rats (francis&meaney, 1999). in general, future research involving genetics may deepen our understanding of the complex links among genes, brain, cognition, emotion, and the environment.

backgrounddysregulation of the hypothalamic pituitary adrenal (hpa)-axis is thought to underlie stress-related psychiatric disorders such as posttraumatic stress disorder (ptsd). some studies have reported hpa-axis dysregulation in trauma-exposed (te) adults in the absence of psychiatric morbidity. in this dissertation we set out to unravel part of the mechanism that underlies the complex relations between trauma exposure, stress regulation, and psychopathology. methodmentally healthy te subjects were compared with non-trauma-exposed (ne) healthy controls. to distinguish between the potential effects of childhood trauma and adulthood trauma, we included women exposed to childhood trauma as well as men who were exposed to trauma during adulthood. basal hpa-axis functioning was assessed with salivary cortisol samples. hpa-axis reactivity was assessed with the dexamethasone/corticotropin-releasing hormone (dex/crh) test. resultsthe results show that childhood trauma exposure is associated with an attenuated cortisol response after the dex/crh challenge test in women. in contrast, trauma exposure during adulthood was not associated with alterations in hpa-axis regulation after the dex/crh test. neither childhood trauma nor adulthood trauma were associated with basal hpa-axis functioning. conclusionchildhood trauma rather than adulthood trauma may chronically affect hpa-axis functioning. since the association between adulthood trauma and resilience to psychopathology can not be explained by hpa-axis functioning alone, other factors must play a role.

PMC3402002

pubmed-1007

hemopericardium is an effusion of blood into the pericardial sac and it is due to heart disease (heart rupture as a consequence of necrosis or traumas) or to an intrapericardial aortic rupture. in both cases, death may occur as a result of cardiac tamponade due to the accumulation of blood in the pericardium, which leads to an obstructive shock. as the external pressure on the heart increases, the distending or transmural pressure (external-intracavitary pressure) decreases and consequently the intracavitary pressure rises for compensation, leading to an impaired venous return and an elevation of the venous pressure. if the external pressure is so high to exceed the ventricular pressure during diastole, diastolic ventricular collapse and a cardiac arrest may occur. the obstructive shock results in a moderate/severe cyanosis of the face and neck. during the last few years, with the introduction of post-mortem computer tomography (pmct), a valuable contribute has been given to forensic investigations in making, contributing and supporting the diagnosis of several violent and natural causes of death, leading to the introduction of this technique in some offices of forensic sciences as a standard procedure before the traditional autopsy and in sporadic cases even to substitute it. in this paper, a case of death due to cardiac tamponade as a consequence of hemopericardium is reported, in which pmct was useful in order to understand the dynamic and cause of death, before the post-mortem examination. the body was still warm and no signs of trauma or other injuries were found. he had a medical history of hepatitis c and hypertension with a poor pharmacological response. before the autopsy a pmct examination was performed about 3 h after the discovery of the corpse. the obtained dicom scans were rendered in 2d and 3d images using the open source software osirix on a maxosx computer. a board certified radiologist interpreted all radiological images. the pmct report was available before the autopsy examination and showed an intrapericardial aortic dissection together with a periaortic hematoma, a sickle-shaped intramural hematoma and a false lumen. a hemopericardium was also shown, consisting in fluid and clotted blood, which differentiated to each other because of their densities (figure 1). even before the traditional postmortem examination, we were able to declare death due to a cardiac tamponade as a consequence of hemopericardium in a type-a aortic dissection according to stanford classification. at the external examination of the body, no signs of trauma were observed. at the autopsy examination, the features observed by the pmct scans were totally confirmed. on opening the pericardial sac, a cardiac tamponade was present, consisting in a large size hematoma of clotted blood (800 g) and fluid blood (500 g) (figure 2a). after a block dissection of the heart together with the ascendant aorta, and a careful dissection of the soft tissues of these anatomical structures, an intrapericardial aortic dissection was found (figure 2b). (a): a hypodense area compared with the lumen (blue arrow in the red circle); (b): a false lumen together with an intramural hematoma displayed as a hyperdense area (blue arrow in the red circle); and (c&d): a hemopericardium consisting in fluid blood (blue circle) and clotted blood (red asterisk). (a): the presence of the hemopericardium confirmed the pmct findings when the pericardial sac was opened; (b): site of aortic dissection (indicated by the probe) involving the ascending aorta in its intrapericardial tract. aortic dissection is by far the most common and serious condition affecting the aorta. among these pathologies, the ascendant aortic dissection is the most severe condition that may lead to death in a large number of cases, due to the rapidity of the pathological process. the dissection seems to be strictly related to the cystic medial necrosis, a disorder of large arteries, in particular the aorta, characterized by an accumulation of basophilic ground substance in the media with cyst-like lesions. it usually results from chronic hypertension or from rare conditions (such as marfan's syndrome, aortic coarctation and bicuspid aortic valve). whatever the mechanism, it is often brought about by degenerative changes in the aortic wall. since dissection can involve any aortic segment, the disease can manifest itself through a variety of clinical presentations. in fact, when aortic dissection occurs, aortic branches occlusion may happen. in case of dissections of the ascending aorta, the major aortic branches are occluded, resulting in rapidly fatal complications such as cardiac tamponade, major stroke, or massive myocardial infarction. if the fluid occurs rapidly (as may occur after trauma or myocardial rupture), as little as 100 ml can cause tamponade. however, the data reported in literature about the amount of blood able to cause death in acute cases are discordant. frequently, a quantity of 300400 ml of blood is found in bodies, even if other reports show a greater volume. aortic dissections can be classified by the location of the tear. according to the stanford classification, there are two types of aortic dissections: (1) type a aortic dissections involve the ascending aorta and frequently needs emergency surgery. these types of dissections are often found in subjects with a history of high blood pressure, an ascending aortic aneurysm, connective tissue disorder (e.g., marfan syndrome, bicuspid aortic valve, or a family history of aortic dissections). (2) type b aortic dissections do not involve the ascending aorta (involvement of aortic arch without involvement of the ascending aorta is considered type b or simply called arch dissection but is not a type a dissection). these types of dissections may be managed conservatively with blood pressure and heart rate control. therefore, the case here reported can be classified as a type a aortic dissection. the evaluation in living subjects of cardiac tamponade due to a hemopericardium, using diagnostic imaging techniques with special regard to the ct, allows a good interpretation of the anatomy and the pathology of the pericardium., in post-mortem investigations, few studies have used pmct imaging to investigate cardiac tamponade in the last decade, (table 1) and the results obtained show the feasibility of using the pmct technique to diagnose haemopericardium and cardiac tamponade in cadavers. it must also be considered that since in in-vivo imaging of aortic dissections the contrast-enhancement of the lumen is essential to detect critical radiological features, it is possible that these findings can be missed during a standard pmct without contrast. to overcome this problem, a pmct-angiography can be carried out, even if the use of this technique is currently limited. regarding this topic, f: female; m: male; pmct: post-mortem computer tomography. bello, et al. have recently reported a case involving a 72 year-old man, in which multi-phase pmct angiography was helpful in defining the diagnosis, detecting a hemopericardium and the ruptured wall situated in the posterior part of the left ventricle. the autopsy was then performed, totally confirming the ct angiography findings. in the present case, this pathology was the trigger for the development of the ascendant aortic dissection resulting in a rapid cardiac tamponade, causing the man's death. according to the italian jurisdiction, when a subject (even a foreigner) dies in italy and questions concerning the cause and the manner of death arise, the prosecutor requires the forensic pathologist to perform a full postmortem examination, consisting in external and internal examination. the family of the deceased can not refuse the autopsy. because the deceased was jewish, his family objected to the autopsy in observance of their religion, however, the prosecutor ordered that the autopsy had to be carried out, notwithstanding the fact that the pmct was able to demonstrate the cause of death, because it was not considered a technique reliable and accurate enough to determine the cause of death. according to this conclusion, the autopsy was performed, confirming the ct findings. according to us, a pmct examination in always necessary in all cases of violent deaths, such as gunshot wounds, asphyxia, sharp force injuries, etc., in such cases, the pmct must be considered as a support to the traditional postmortem examination that must always to be carried out. in case of natural deaths, a pcmt should always be performed whenever possible, because it sometimes can give a clue regarding the cause of death, making the autopsy virtually not mandatory (in the countries where it is allowed). for example, regarding to sudden natural deaths in the absence of traumas or in deaths due to infectious diseases, the real effectiveness of a full autopsy should be evaluated taking into account the potential risks for the pathologist during the autopsies. in these cases, a full pmct examination, together with an accurate clinical history of the deceased, exhaustive investigative reports concerning the circumstances surrounding the death and toxicological analyses from biological samples collected at the external examination, is a valuable tool that can alone led to determine the cause of death. the forensic pathologist, on the basis of the available information, to his own experience and also to the specific justice issues concerning the case, should be able to decide when and why the pmct alone is enough to clarify the cause of death or if a full postmortem examination is required. furthermore, ethical and religious issues should be taken into consideration in such cases, when the traditional autopsy is not really necessary. a pmct approach in these cases can be useful to reduce the manipulation of the bodies, allowing families to observe their own religions. however, despite the rapid growth of forensic radiology, we must underline that a multidisciplinary approach in suspicious cases is always required. on the one hand, the pmct should become a standard in forensic practice in order to be performed whenever possible. on the other hand, if that happens, it must be avoided that the pmct led the pathologist to focus his attention only on the main radiological findings, giving less importance to other features, hence missing possible secondary diseases. specifically, a pmct-guided postmortem examination must always to be carried out as fully as possible. in conclusion, pmct should be considered as an essential support to the traditional autopsy of violent deaths (and not its replacement), becoming as important as histopathological and toxicological analyses, in order to allow the forensic pathologist to have an overall view of all the features concerning the case. in natural deaths, conversely, when no specific issues arise, the pmct alone should be virtually considered as a valuable technique to clarify the cause of death, to reduce potential risks for the pathologist and also to overcome ethical and religious issues.

hemopericardium is a common finding at autopsy, but it may represent a challenge for the forensic pathologist when the etiopathological relationship in causing death is requested. hemopericardium and cardiac tamponade can be evaluated in living people using radiological techniques, in particular computer tomography (ct). only a few studies are reported in literature involving post-mortem (pm) cases, where pmct imaging has been used in order to investigate acute hemopericardium, and they have shown a good accuracy of this technique. here we report a case involving a 70-year-old white male found dead on the beach, with a medical history of hepatitis c and chronic hypertension with a poor pharmacological response. a pmct was performed about 3 h after the discovery of the body. the pmct examination showed an intrapericardial aortic dissection associated to a periaortic hematoma, a sickle-shaped intramural hematoma, a false lumen, and a hemopericardium consisting in fluid and clotted blood. in this case, the pmct was able to identify the cause of death, even though a traditional autopsy was required to confirm the radiological findings. pmct is a reliable technique, which in chosen cases, can be performed without the need for a traditional autopsy to be carried out.

PMC4294154

pubmed-1008

during root canal treatment, clinicians face various unwanted procedural mishaps that can occur at any stage of treatment. of all, instrument fracture within the root canal system and more rarely fractured piece protruding beyond the apex are among the most troublesome and frustrating errors. fractured instrument extending beyond rotary nickel titanium (niti) files are extensively used for cleaning and shaping of the root canals because of their higher flexibility compared to stainless steel (ss) files. despite the superior qualities of niti rotary files, niti rotary files fracture because of excessive cyclic fatigue, torsional failure or a combination of both while most of ss instruments fracture due to excessive torque. various factors that predispose the files to fracture are instrument design, dynamics of instrument use, the manufacturing process, canal configuration, cleaning and sterilization process and frequency of usage of instrument. a previous study documented no adverse effect of the broken fragment retained in the root canal system on healing of endodontically treated teeth while another study reported lower rate of healing when broken instrument remained in the canal. presence of preoperative periapical radiolucency, inadequate size and apical extent of fractured instrument are some of the prognostic factors affecting the outcome of root canal treatment in such cases. proper cleaning and shaping of the root canals are hindered or prevented by presence of fractured fragments inside the root canal. retrieval of fractured instruments is usually very difficult and impossible at times, with a reported success rate of 55 to 79%. several devices and techniques have been introduced for retrieval of separated instruments such as ruddle irs (dentsply, tulsa, ok, usa), masseran endodontic kit (micro-mega, lynnewood, washington, usa) and the cancellier instrument removal system (sybronendo, orange, ca, usa). newly developed ultrasonic tips used with piezoelectric ultrasonic units are used for conservative removal of dentin surrounding the separated instrument; moreover, their vibrations facilitate the removal of fractured instrument. the endo success retreatment kit (satelec acteon, mrignac, france) was recently developed for use in satelec acteon piezoelectric ultrasonic device (satelec acteon, mrignac france) to assist in retrieval of fractured instruments, amongst many other uses. endo success retreatment kit consists of six titanium-niobium mini-tips, designed for retreatment available in different lengths and tapers. herein, we describe a clinical scenario of instrument retrieval broken beyond the apex of a mandibular molar tooth using endo success ultrasonic tips. a 38 year-old female patient was referred by her local dentist to the endodontics department of manubhai patel dental hospital, for retrieval of a fragment of a niti protaper file (f1, dentsply maillefer, ballaigues, switzerland) broken during root canal enlargement and embedded in the distal canal of the mandibular right first molar extending beyond the apex (tooth #46). during clinical examination, there was an access cavity filled with a temporary filling material and the tooth was sensitive to percussion. one of the two intra-oral periapical (iopa) radiographs brought by the patient revealed incomplete root canal treatment of the right mandibular second premolar and first molar (fig. 1b), showed attempted endodontic retreatment in both premolar and molar and also the separated instrument in the distal canal of the mandibular right first molar extending beyond the apex. (a) pre-operative radiograph (b) retreatment and the fractured file after rinsing the patient s mouth with 0.2% chlorhexidine solution, local anaesthesia was administered and isolation was done with rubber dam. access cavity was modified using a safe-end fissure bur (dentsply, maillefer, ballaigues, switzerland) to obtain a straight line access to the canals. then, using a modified gates glidden drill (size 3, dentsply maillefer, ballaigues, switzerland), a staging platform was created. this was done to expose the file and the surrounding dentin to allow thinner ultrasonic tips to trough deeper around the file. after staging, et25 tip of endo success retreatment kit was attached to the ultrasonic device and was activated first at the inner dentinal wall of the distal canal to create a tiny pocket approximately 1.0 mm deep from the severed surface of the file fragment. once this narrow space was obtained, a shallow groove was cut along the outer dentinal wall such that there was no obstruction to keep the fragment from being pulled coronally. then, two h files were inserted in an attempt to grab the fractured fragment and pull it out with an anti-clockwise motion. edta solution was introduced inside the canal to enhance the cavitation and acoustic streaming effect of ultrasonics. ultrasonic vibration was applied to the separated file in the space created between the fragment and the inner wall of the canal, and moved in push and pull motions until the separated instrument jumped out of the canal. (a) retrieved rotary niti file (b) the 7 mm rotary niti file fragment retrieved (c) retrieved h file (d) the 2 mm h file fragment retrieved (e) obturation (f) one year follow-up the retrieved file fragment was 7 mm long (fig. 2b). but still, the fractured h file was inside the canal, which was retrieved using the ultrasonic vibration. again, a radiograph was taken and retrieval of both fractured instruments was ensured (fig. after instrument retrieval, working length was determined using an apex locator (propex, dentsply, maillefer, ballaigues, switzerland) and radiographs. the root canals were cleaned and shaped in a crown-down manner using rotary niti files (protaper, dentsply maillefer, ballaigues, switzerland). next, 2.5% sodium hypochlorite and 2% chlorohexidine were used for irrigating the root canals and calcium hydroxide (calcicur, voco, cuxhaven, germany) as an intracanal medicament was placed. in the second visit, obturation was carried out by lateral compaction technique using gutta percha points (protaper, dentsply, maillefer, ballaigues, switzerland) and ah-plus sealer (dentsply, maillefer, ballaigues, switzerland). 2e) and the patient was referred to her general dental practitioner for the permanent coronal restoration of this tooth and endodontic retreatment of the second premolar. fracture of an endodontic instrument during root canal treatment hinders further cleaning and shaping of the root canal system. such inability to further clean and shape the root canal system can compromise the outcome of the treatment. in such cases, it is said that the prognosis depends on the condition of the root canal (vital or non-vital), canal anatomy, type of pulpal pathology, periapical status, degree of cleaning and shaping at the time of separation, the level of file separation in the canal and type of fractured instrument. the prognosis of these teeth is generally lower than that of a tooth with normal endodontic treatment. orthograde and surgical approaches are the two methods recommended for managing cases with broken instruments. bypassing the instrument, removing the instrument or preparation of the canal and obturation to the level of the fractured instrument are phases of an orthograde approach. in our case as the patient was referred by some other dentist, we did not know the actual extent of canal disinfection when the instrument broke, and thus, bypassing or retrieving the separated instrument deemed necessary. as the separated instrument extended beyond the apex, bypassing the instrument or obturation to the level of the fractured instrument would not serve the purpose. considering the non-surgical endodontics being the more conservative approach, the retrieval of instrument was attempted. diameter, length and position of the fragment within the root canal influence the nonsurgical removal of a broken instrument. also, the thickness of root dentin, the depth of external concavities and the root canal anatomy influence the removal of the broken fragment. instruments that lie in the straight portions of the canal can be typically removed. in this case report, instrument was fractured in the distal canal, which was a straight canal with the least curvature. material type of the fractured instrument is also an important factor to be considered during its removal. the ss files do not fracture upon removal with ultrasonics, while niti instruments may undergo further fracture due to heat build-up when ultrasonic devices are used for their removal. the ss fragments will show early movement as they absorb the ultrasonic energy bodily, while in case of niti fragments, only the point of contact with the tip absorbs the energy. tu et al. reported a case in whom, a separated ni-ti instrument was retrieved using several ultrasonic tips under a dental operating microscope from the distolingual root canal of a mandibular first molar. the instrument was separated at the middle third of the canal whereas in our case the file broke in the apical third extending beyond the apex, which made its retrieval more difficult. recently, a case was reported by shenoy et al, where a separated hand instrument extended beyond the apex was retrieved from the mesiobuccal canal of a second molar. they extracted the tooth atraumatically, retrieved the instrument and reimplanted the tooth again in the socket. in our case, several methods and instrument retrieval systems have been proposed for retrieval of broken instruments from the root canals. however, none of them can guarantee 100% success or can be considered the gold standard for instrument retrieval. due to various advantages of ultrasonics in instrument retrieval such as minimal dentin damage and compatible tip designs, which can reach the apical third of the canal, however, one must consider that with the advent of rotary niti files, the occurrence of broken instruments has increased, especially in the hands of inexperienced clinicians. proper training of new techniques and adherence to the established principles and guidelines of clinical usage can reduce the incidence of niti instrument fracture. the ultrasonic technique was successful in removing the rotary niti file fractured beyond the apex and the stainless steel h file from a mandibular molar tooth.

during endodontic treatment, clinicians may face endodontic procedural mishaps such as broken instruments, which is a complex situation especially when the file breaks beyond the apex. this condition is associated with potential risk of contamination, which compromises the healing process. management of a broken instrument beyond the apex is difficult and time consuming and requires creativity as well as clinical knowledge and skills. several devices and techniques have been developed to retrieve the fractured instruments, but none are consistently successful. this case report describes a technique using modern ultrasonic tips for retrieval of broken instruments separated beyond the apex.

PMC4749419

pubmed-1009

inflammatory bowel disease (ibd) is a chronic, relapsing, idiopathic inflammation of the gastrointestinal tract. subtypes of ibd include crohn's disease (cd), ulcerative colitis (uc), and inflammatory bowel disease unclassified (ibd-u). the majority of epidemiological studies on the incidence and prevalence of ibd relate to the adult population. historically, europe and north america have been considered high incidence areas while asia, africa, and the middle east have been considered low incidence areas [2, 3]. emerging data has suggested that the incidence of ibd is increasing globally in both developed and developing countries. one study from central saudi arabia on the epidemiology of juvenile onset ibd estimated an incidence of 0.5 per 100 000 per year and a prevalence of 5/100 000. while this is significantly lower than the incidence rates of 11.43/100 000 per year reported in north america, comparison with older data nevertheless suggests an increasing incidence. the emergence of chronic inflammatory diseases such as ibd has been closely linked to social and economic development and it has been postulated that the westernisation of society accounts for the increasing incidence of ibd in countries where it was once considered rare. the importance of ethnic, racial, and geographic factors in ibd is illustrated by the considerable literature citing varying risks of developing ibd in different ethnic populations. it has been well established that the ashkenazi jewish population have a higher risk of developing ibd than other ethnic groups [7, 8]. several studies also show that ethnic groups with low rates of ibd in their home country have a much higher incidence of ibd following immigration to western countries. for instance, studies on migrant populations found a higher incidence of ibd in south asians than non-south asians in the pediatric population of british columbia and the adult population of leicester [911]. recent studies have found the overall incidence rate of ibd in australia to be among the highest reported. in addition, phavichitr et al. found that the incidence of pediatric cd in victorian children rose from 0.128 per 100 000 per year in 1971 to 2.0 per 100 000 per year in 2001. however, there are no reports on the epidemiology of ibd in specific ethnic groups in australia. given the fact that australia is a multicultural society with significant emigration of families from the middle east this may be relevant. therefore the objectives of the current study were to examine the clinical characteristics and management of ibd in children of middle eastern descent diagnosed at the sydney children's hospital randwick (schr). a retrospective chart review was undertaken on all patients identified as being of middle eastern ethnicity on the schr ibd database. ibd specific data collection began at schr in 1987 and data was complete up to the year 2011 at the time of review. at diagnosis, children were considered to be of middle eastern ethnicity if one or both parents self-identified as being of middle eastern ethnicity or from any of the following countries: egypt, iran, iraq, israel, jordan, kuwait, lebanon, oman, qatar, saudi arabia, syria, united arab emirates, west bank and gaza, and yemen. children with israeli ancestry and jewish ethnicity were not included in this study due to the well-defined predisposition to ibd in this population. a control group of patients of non-middle eastern descent was also identified from the schr ibd database: these were matched to patients of middle eastern descent according to age at diagnosis, gender, and disease type. the project was approved by the south eastern sydney and illawarra area health service research ethics committee. information collected at diagnosis for the study and control groups included family history of ibd in first degree relatives, smoking exposure history, residential postal code, age at diagnosis, symptoms at presentation, duration of symptoms at presentation, specific blood tests (erythrocyte sedimentation rate (esr), c-reactive protein (crp), platelets, albumin, haematocrit, alanine transaminase (alt), aspartate transaminase (ast)), disease location, extraintestinal manifestations, pediatric crohn's disease activity index (pcdai) or pediatric ulcerative colitis activity index (pucai) score, height, and weight. disease management information was also collected including whether they received the following treatments: exclusive enteral nutrition (een), corticosteroids, aminosalicylates, thiopurines, methotrexate, biological, tacrolimus, or surgical intervention. disease location was classified according to the montreal classification of l1 (terminal ileum), l2 (colon), l3 (ileocolonic), and l4 (upper gastrointestinal (gi)) for cd. symptoms at presentation were grouped under the following categories: abdominal pain, diarrhoea, mucus and/or blood in stools, weight loss, per rectal bleeding, and loss of appetite. height and weight measurements at diagnosis were converted to height for age z-scores and weight for age z-scores using the centre for disease control application epiinfo, based on the cdc-2000 charts. point incidence and point prevalence were calculated for both the middle eastern study group and the control group for the schr catchment area. for this purpose the catchment of the schr was defined as the local government areas (lga) of the south eastern sydney and illawarra area health service, which includes botany, hurstville, kogarah, randwick, rockdale, sutherland, sydney, waverley, wollongong, and woollahra. population information for the lgas was obtained from the australian bureau of statistics 2006 census data. ancestry information in the 2006 census data was collected by similar means to data in the schr database, where ancestry was defined by self-reporting of familial ancestry and birthplace. the census data was sorted by ancestry, lga, and age (016 years). the schr ibd database was used to identify patients who resided in the defined catchment area and had active inflammatory bowel disease in 2006 to calculate point prevalence. the database was also used to identify those patients within the catchment area who were diagnosed in 2006 to calculate the point incidence. the remoteness area category was calculated for each patient from residential postal codes based on the australian standard geographical classification-remoteness area (asgc-ra). the asgc-ra is a hierarchical classification system of geographical areas developed by the australian bureau of statistics (abs) that provides a common framework of statistical geography. the categories used were ra1 (major cities of australia), ra2 (inner regional australia), ra3 (outer regional australia), ra4 (remote australia), and ra5 (very remote australia). a fisher's exact test was used to compare the two groups with regard to smoking exposure history, family history, symptoms at presentation, extraintestinal manifestations, and disease location. the management of ibd was analysed by fisher's exact tests, with uc and cd being analysed separately. an unpaired t-test was used to compare platelets, albumin, haematocrit, pcdai, height for age z-scores, and weight for age z-scores between the two groups. the mann-whitney test was used to compare the groups for esr, crp, alt, and ast. the relative risk (rr) was calculated for incidence and prevalence; a result was considered significant if the confidence intervals (ci) did not embrace a relative risk of one. of the 441 patients on the schr ibd database, 35 (7.9%) were identified as being of middle eastern ethnicity. however, 11 of the 35 were excluded from this retrospective study as files for these patients were unavailable. therefore a final cohort of 24 patients of middle eastern ethnicity (both parents of middle eastern ethnicity) and 24 non-middle eastern controls were included in this study. of the 24 patients of middle eastern ethnicity, 14 (58.3%) had cd, 7 (29.2%) had uc, and the remainder had ibd-u (table 1). fifteen (62.5%) of the group were male: 9 of these had cd and 4 had uc and 4 had ibd-u. twenty (83.3%) patients were born in australia, 2 (8.3%) were born in lebanon, and 2 were born in the usa. the mean age at diagnosis overall was 9.8 years (range, 0.715.7). four patients (16.6%) were diagnosed under the age of five years and 11 patients (45.8%) were diagnosed before the age of 10 years. there was mean of 92 days (range 23227 days) between date of diagnosis of the middle eastern ethnicity patients and their matched controls. identified as middle eastern ethnicity, 16 had parents identified as lebanese, 3 egyptian, 2 turkish, and 1 algerian, and 2 parents did not provide a country of birth but self-identified as middle eastern ethnicity. of the controls, 18 had parents identified as caucasian, 2 indian, and 1 caucasian-jewish, and 3 did not provide a country of birth but self-identified as non-middle eastern ethnicity. there was no difference in family history of ibd in first-degree relatives of middle eastern (5/22; 2 unknown; 22.7%) and control (2/22; 2 unknown; 9.1%) patients. there was no difference in smoking exposure history between the two groups, middle eastern (7/21; 33.3%) and control patients (5/19; 26.3%). all middle eastern patients (24/24; 100%) were living in ra1 (major city), while the controls had fewer patients (17/24; 70.8%) in ra1 and a greater distribution over ra2 (4/24; 16.7% inner regional australia) and ra3 (3/24; 12.5% outer regional australia) areas (p=0.017). symptom duration prior to diagnosis did not vary between the middle eastern (median 8, range 1208 weeks) and control groups (median 16, range 2104 weeks) (p=0.37). abdominal pain and diarrhoea were the most common symptoms at presentation for both groups (table 2). erythrocyte sedimentation rate (esr) at diagnosis was more elevated in middle eastern children compared to controls (p=0.02); however, all other standard blood results were similar in both groups (table 3). alt and ast values were lower in the middle eastern group compared to the control group (p=0.03 and p=0.02, resp.) (table 3). pcdai scores at diagnosis were significantly higher in the middle eastern group (mean 37, sd 13) compared to the control group (mean 27, sd 11; p=0.033) (figure 1). height for age z-score and weight for age z-scores at diagnosis were similar between the groups. two (8.3%) of the middle eastern patients and one (4.2%) control had height for age z-score indicating stunted growth (< 2 sd). there was a lower incidence of colonic disease (l2) (p=0.01) in the middle eastern group with cd compared with the control group (table 4). upper gi disease was present in 10 (71%) of the controls and 13 (93%) of the middle eastern cd patients. terminal ileal location (l1), ileocolonic disease (l3), and upper gi tract involvement (l4) were similar in both patient groups (table 4). there was no difference between the groups for disease location in uc as most patients in both groups had pancolitis (e3). the incidence of ibd in the schr catchment area in 2006 for the middle eastern pediatrics population (aged 016 years) was higher (33.1 per 100 000 children per year) compared to the control group (4.3 per 100 000 children per year). the relative risk analysis, although indicating a high risk of ibd with middle eastern ethnicity, does not reach significance (rr 7.63, 95% ci 0.9565.01) (figure 2). however the prevalence of ibd in the middle eastern pediatric population was significantly higher at 165.4 per 100 000 children compared to the control prevalence rates of 28.7 per 100 000 children (rr 5.76, 95% ci 2.3014.43) (figure 2). overall, there were no differences in the use of standard medical therapies between the groups (p>0.05 for all). in addition, there was no difference in surgical management between the two groups (p>0.05). however, considering the children with cd separately, the use of thiopurines was significantly higher in the middle eastern group for the management of cd (p=0.002) (table 5). there was no difference in use of corticosteroids, aminosalicylates, biologicals, or tacrolimus for management of cd between the groups (table 5). there was also no difference for any of the therapies between the groups for the management of uc. this is the first study comparing the incidence, presentation, and management of ibd in a middle eastern pediatric population now residing in a the estimated incidence rate for ibd in this population in 2006 was among the highest reported in the pediatric literature and was almost 8 times higher than that observed for the non-middle eastern population in the same location. there is great variation in the literature on the difference in incidence between different populations. however our findings are consistent with those of other studies that have identified higher risk of ibd in specific groups such as south asians and ashkenazi jews [7, 9]. accurate prevalence and incidence rates of pediatric ibd for many middle eastern countries have not been reported in the literature. it has been postulated that the low incidence of ibd in developing countries is attributed to poor sanitation and hygiene and greater exposure to microorganisms during childhood. the recent rise in incidence in both developed and developing countries has coincided with improvements in hygiene over the twentieth century and the move from a lifestyle of high microbial exposure to low microbial exposure [6, 16]. previous studies have reported people who emigrate to western industrialised countries are at higher risk of developing ibd. similar findings of increased incidence upon migration have been reported in patients of south asian origin upon emigration to canada and the uk. interestingly, 83.3% of the middle eastern patients in the current study were born in australia, adding support to the theory that the 2nd generation of immigrants to industrialised countries is most at risk of developing ibd. we have presented point incidence and point prevalence; however, there are a number of limitations that must be considered when assessing this data. the cohort was limited to the geographical catchment area of one pediatric centre in sydney, australia. taking into consideration the limitations of this dataset, the small sample size and potential confounders due to immigration, emigration, and referrals outside of the catchment area, the results presented here may have either overestimated or underestimated the incidence of ibd in this population. ahuja and tandon suggested studies that relying on the reporting of pediatric hospitals, such as the current study, may lead to an underestimation of incidence and an overestimation of disease severity. the control cohort were matched based on age, gender, and type of disease; therefore, 24 controls were included from 406 non-middle eastern patients listed in the ibd database. several patients listed in the ibd database were excluded from the incidence and prevalence calculations as they came from outside the schr catchment area. although the numbers are likely to be small, it is also possible that several pediatric ibd patients, both middle eastern and non-middle eastern, from within the catchment area were attending other hospitals or were being treated as private patients and as such were not included in the schr database. therefore, we propose that these initial findings indicate that a further population based cohort study is warranted. the gender preponderance (higher number of boys) observed among these middle eastern children contrasts with studies of the adult ibd population where there are a slightly greater proportion of females with cd, although a recent report by el mouzan et al. of childhood-onset ibd in saudi arabia also reports a higher predominance of males with cd at 56%. nevertheless this pattern of disease distribution (58.3% cd, 29.2% uc, and 12.5% ibd-u) is consistent with recent british, canadian, and american studies of pediatric cd populations [1921]. middle eastern children with cd had significantly less disease restricted to the colon (l2) than the controls while there were similar levels of terminal ileal disease, ileocolonic disease, and upper gastrointestinal involvement between the groups. in contrast to this, studies in other ethnic populations have found more extensive colonic disease than the general ibd population. however, this is consistent with a low incidence of colonic disease and high incidence of ileocolonic disease that has been observed in a series of kuwaiti children with ibd. in the current study, excluding upper gastrointestinal involvement (l4), ileocolonic disease (l3) was the most common presentation site affected in middle eastern cd patients. studies estimate that upper gastrointestinal involvement occurs in the range of 3080% in children and less than 10% of adults with cd [2326]. in concordance with this, a large proportion of both groups in the current study had upper gi (l4) involvement. the comparatively high use of thiopurines in the treatment of cd in the middle eastern patients is suggestive of a more severe disease requiring immunosuppressive treatment. the efficacy of thiopurines in maintaining clinical remission in cd is well established with trial data supporting the introduction of thiopurines in children with moderately severe disease at diagnosis. interestingly, in the current study, the severity of disease was not reflected in the duration of symptoms, symptoms at presentation, or surgical management, as there were no differences between the two groups. however the middle eastern patients had higher cd activity scores and esr at diagnosis than the controls. this finding, along with the higher thiopurine use, is suggestive of a more active disease in middle eastern children. the mean age at diagnosis for this cohort of patients was 9.8 years, which was slightly lower than reported in the literature. family history appears to be one of the most important factors that confer risk for the development of ibd. no difference was established in family history rates between the middle eastern (22.7%) and non-middle eastern patients (9.1%). recent publications of pediatric ibd in saudi arabia report family history rates of 15.3% and 9.4%. further, the incidence of a positive family history in the middle eastern patients was comparable to that observed in a series of kuwaiti children. despite this, there is variability in the family history rates reported which likely reflects the small numbers of patients in these reports. therefore further investigation is required to determine if middle eastern children are at the same or greater risk of ibd than non-middle eastern children. consanguinity data was not available for either the middle eastern or non-middle eastern cohorts and could not be considered when assessing family history rates. altered linear growth is commonly present in children at the time of presentation with ibd [29, 30]. a pediatric study in kuwait found that growth failure was a significant problem in their patients at presentation. in contrast to this, only 8.3% of the middle eastern children and 4.2% of controls had height for age z-scores indicative of stunted growth. this inconsistency may be due to the small sample size or may represent shorter symptom duration prior to diagnosis and therefore less impact upon linear growth. although the pubertal status of the children at diagnosis in the current retrospective study was not available, many of the children were of a prepubertal age. in addition to the limitations provided by a retrospective study design, the sample size of the current study also limited more complete full data interpretation. the sample size also likely influenced the interpretation of the incidence rates between the two groups: this lack of significance may reflect a type 2 error. in conclusion, the present study indicated that middle eastern patients were less likely to have disease restricted to the colon than the control children. further the middle eastern children had higher cd activity at diagnosis and also required a higher incidence of immunosuppressive treatment. this data is consistent with a more severe phenotype of cd in middle eastern children. although there were limitations with the dataset used to calculate point incidence and prevalence, the calculated values indicated that there is a higher point incidence and prevalence of ibd in middle eastern children attending the schr. likely these patterns of disease in an ethnic group now resident in australia reflect the interactions between environmental and genetic factors. further epidemiological and genetic investigations of such populations with high incidence of disease are required to better understand the aetiology of pediatric ibd.

increasing rates of inflammatory bowel disease (ibd) are now seen in populations where it was once uncommon. the pattern of ibd in children of middle eastern descent in australia has never been reported. this study aimed to investigate the burden of ibd in children of middle eastern descent at the sydney children's hospital, randwick (schr). the schr ibd database was used to identify patients of self-reported middle eastern ethnicity diagnosed between 1987 and 2011. demographic, diagnosis, and management data was collected for all middle eastern children and an age and gender matched non-middle eastern ibd control group. twenty-four patients of middle eastern descent were identified. middle eastern crohn's disease patients had higher disease activity at diagnosis, higher use of thiopurines, and less restricted colonic disease than controls. although there were limitations with this dataset, we estimated a higher prevalence of ibd in middle eastern children and they had a different disease phenotype and behavior compared to the control group, with less disease restricted to the colon and likely a more active disease course.

PMC4060396

pubmed-1010

malaria has been one of the major challenges to global health during the past century. in 1900, 58% of the world's land area more than a million deaths annually have been attributed to malaria throughout the latter half of the 20th century, most in children younger than 5 years, with countries of sub-saharan africa bearing the largest toll. however, mounting evidence suggests a decline in the global burden of malaria, a decrease that began in the mid 20th century in some regions but was most notable in parts of africa over the past decade. this reduction has led to renewed focus among the malaria community on a goal of malaria elimination in many countries. while malaria has been in decline, the geographical range and disease burden of another tropical infectious disease has been on the rise. dengue has emerged as an increasing public health problem over the past 50 years, particularly in southeast asia and central and south america, with an unknown but possibly substantial level of transmission in africa. like malaria, dengue is a vector-borne disease of the tropics and is a major cause of morbidity in endemic areas, particularly in children and young adults; however, the scale of dengue morbidity and mortality is uncertain and thought to be less than that of malaria. dengue is caused by four distinct but related viruses (serotypes denv 14) that are transmitted among people by aedes mosquitoes. the disease burden and geographical range of dengue have expanded, from about 15 000 cases reported annually from fewer than ten countries during the 1960s to almost one million cases a year across more than 60 countries in 20002005. as a result, dengue has been identified as an important threat to global public health. in view of this rising challenge, could lessons learned from global efforts to control malaria help inform strategies to prevent and perhaps reverse the spread of dengue? in this personal view, we compare and contrast malaria and dengue with respect to epidemiology, current and future interventions available for prevention and control, and their prioritisation as global health issues, in terms of funding, capacity, and international collaborations. we also argue that improved data on the range and endemicity of dengue are a vital component of global prevention and control efforts. the geographical ranges of both malaria and dengue are limited by the spatial extent of the competent vectors particular species of anopheles and aedes mosquitoes, respectively. the bionomics of the vectors shapes the epidemiology of each disease. with a few exceptions, anopheles mosquitoes favour rural environments, mainly because of their larval habitat requirements. by contrast, the primary vector of dengue, aedes aegypti, thrives in urban environments where abundant container breeding sites in and around human habitations allow immature vectors to develop and adults to feed and rest close to high densities of humans, their preferred host for blood meals. although aedes mosquitoes have a restricted flight range of about 100 m in the field, passive transport of ae aegypti by land and, in immature stages, by sea led to their re-establishment in countries of south and central america, from which they had previously been eliminated in the mid 20th century, and dispersal throughout southeast asia during and after world war 2. the geographical range of a secondary dengue vector, aedes albopictus, has also expanded substantially over the past 30 years, but it is a less efficient vector and is not currently seen as a major contributor to or risk factor for increased dengue transmission. the growing mobility of viraemic people, both within endemic settings and into new regions by increased domestic and international travel and migration, has been key in driving the global expansion of dengue in recent decades. this movement has created conditions in which multiple virus serotypes cocirculate, leading to an increase in the risk of sequential infections and severe disease. by contrast, the ecological requirements of anopheles mosquitoes have not facilitated their dispersal, and the unprecedented urbanisation that has characterised the past century is associated with reduced risk of malaria transmission, at least in the african setting. the global burden of a disease is a function of both its geographical range and the intensity of transmission in affected areas. by both these measures, the global burden of malaria has unequivocally decreased over the past century, although this decline has not been consistent across all malaria-endemic countries. serious efforts to define the geographical limits and intensity of malaria transmission go back to the mid 20th century, when global control and eradication efforts were gathering momentum. a renewed effort to quantify the magnitude and distribution of the burden of malaria has seen new epidemiological and cartographic techniques applied to multiple collated data sources to model the spatial extent of malaria transmission and so to estimate populations at risk of exposure. these calculations place 24 billion people living in 87 countries at risk of plasmodium falciparum infection in 2007, resulting in around 450 million clinical cases of p falciparum malaria annually. the inclusion of uncertainty intervals around estimates has been a major step forward with these cartographic methods. for dengue, assessments of the spatial extent of transmission have been based largely on empirical data of reported dengue cases from endemic and epidemic settings, with models then fitted to correlate the observed distribution with environmental and climatic characteristics. who estimates that 50 million dengue virus infections occur every year across about 100 countries, representing a population at risk of 25 billion people, although this number could be an underestimate of the true burden. the most recent assessment of the global distribution of dengue identifies 128 countries with good evidence of transmission and puts almost four billion people at risk. the most commonly used measure of malaria endemicity is the parasite prevalence rate, which represents the proportion of a population with malaria parasites detectable in their blood. this measure has been used widely in malaria surveys throughout the past century and has been used to generate the first evidence-based global map of malaria endemicity in 2007, recently updated for 2010 (figure). another key metric of malaria transmission risk is the entomological inoculation rate, which represents the rate at which people are bitten by infectious mosquitoes. the relationship between the entomological inoculation rate and the parasite prevalence rate is non-linear. empirical measurements for the entomological inoculation rate have been gathered less routinely and consistently than for the parasite prevalence rate, making the former a less useful measure for global endemicity mapping. consequently, the entomological inoculation rate and other important metrics for malaria have been inferred with modelled relationships between them and extensive maps of parasite rates. epidemiological data on the global burden of dengue rely almost entirely on reports of clinically apparent disease, derived from national surveillance systems and, in a few cases, from prospective longitudinal studies. the figure shows a map of dengue risk that combines disease notification and outbreak data from international organisations, case reports on returning travellers, published scientific literature on dengue occurrence, and a biological model of environmental suitability. serological data from longitudinal studies permit estimation of infection incidence in a population, including the ratio of symptomatic to inapparent infections. this type of study depends, however, on follow-up of cohorts, which needs far greater investment of time and money compared with cross-sectional surveys that are used to obtain estimates of the malaria parasite prevalence rate. traditional indicators of the abundance of aedes mosquitoes, based on immature vector stages (house index, container index, breteau index), are collected routinely in many dengue-endemic countries, but their correlation with human infection and disease is poor. counts of ae aegypti pupae per person might correlate more closely with adult vector density and, therefore, potential for dengue transmission. direct measurement of the density of adult ae aegypti with pcr to ascertain the proportion infected with dengue virus would be most informative, but this approach is logistically and financially demanding to do on a sufficiently large scale in view of the difficulty in sampling adult vectors and the expected large variance in both adult numbers and prevalence of infection. for both malaria and dengue, the relationship between the risk of infection and the risk of disease is non-linear and depends on host immune status and age at infection. clinical case numbers are relevant to the prediction of demand for diagnostic tests, health-care services, and treatments. who also defines laboratory-confirmed clinical dengue cases of any severity as the most appropriate endpoint for dengue vaccine trials. however, for describing transmission extent and intensity, especially when making comparisons between countries and over time, reliance on case-burden data is fraught with issues of inconsistent reporting patterns (both spatially and temporally), differences in clinical case definitions, over-reporting when laboratory testing is not routine, and under-reporting of patients who do not present to health services or who are managed as outpatients only. a measure of the incidence of infection, rather than disease, might also be an appropriate endpoint for trials of dengue vector-control interventions in the community; not only is active surveillance of clinical outcomes more resource-intensive than cross-sectional blood sampling but also a large (and variable) proportion of prevented infections are likely to be asymptomatic. therefore, a smaller sample size will be needed to show an effect on infection rates, compared with a clinical effect of the same size, because of the higher overall event rate for infections versus clinical cases. what alternative metric could be used to measure dengue endemicity, equivalent to the parasite rate for malaria? virological markers of dengue such as viraemia and presence of the ns1 antigen in blood are short-lived compared with untreated malaria parasitaemia, disappearing about 1 week after onset of clinical symptoms. furthermore, the magnitude and duration of viraemia varies with severity of disease, virus serotype, and host immune status. cross-sectional age-stratified serological surveys of dengue-specific igg can indicate the prevalence of past exposure to dengue virus but are confounded by antibodies directed against other flaviviruses, where these cocirculate. cross-sectional seroprevalence surveys of dengue-specific igm might indicate recent infection with dengue virus or other flaviviruses. aside from potential low specificity, interpretation is complicated by the variable kinetics of the igm response, most importantly, the difference between first and subsequent infections, making comparison of population-based igm surveys between epidemiological settings difficult. population-based surveys of dengue neutralising antibody, measured by the plaque reduction neutralisation test, would provide the most sensitive and specific information on virus transmission patterns, including serotype-specific data and multiple heterotypic exposures. however the plaque reduction neutralisation test is substantially more resource-intensive than standard igm and igg immunoassays. finding the appropriate metric to measure the endemic level of dengue is a clear research priority. success in controlling malaria over the past century has been attributed predominantly to widespread implementation of insecticide-treated bednets, household spraying of residual insecticides, and effective drugs to reduce mortality and interrupt transmission. the countries in which little progress has been made with malaria control are commonly those where political instability, war, or economic underdevelopment have hindered widespread implementation of these interventions. the situation with dengue is different; vector control is the only currently available approach for prevention and control and is pursued mainly through reduction of larval development sites, via environmental clean-up campaigns to dispose of discarded or unnecessary water containers, and prevention of mosquito access to breeding sites. other methods include treatment of water-storage vessels with larvicide or predacious copepods to kill larval stages. the effectiveness of these interventions has been demonstrated at a local community level but rarely on a large scale or across diverse epidemiological settings (not since the ae aegypti eradication campaign of the 1950s), with singapore and cuba perhaps the only exceptions. success of such efforts depends on sustained community support and participation. however, even when mosquito populations have been reduced drastically, as in singapore, cases of dengue still occur, with evidence of increasing risk of clinical disease associated with older age at first infection. killing adult mosquitoes has a theoretically greater effect on transmission than does targeting larvae. space-spraying of insecticide to kill adult vectors in and around households is popular because it represents a highly visible response to localised outbreaks of dengue, but a sustained effect on virus transmission has not been demonstrated. indoor residual spraying of insecticide has a long history of use in malaria control, and its importance as a key intervention for interruption of malaria transmission has been reaffirmed by who. many behavioural characteristics of anopheles vectors that make indoor residual spraying an effective malaria intervention, such as their anthropophagic biting preferences and tendency to rest and feed indoors, are common also to aedes dengue vectors. there is some evidence that high household coverage of indoor residual spraying in an outbreak setting could reduce dengue transmission. use of this method to control yellow fever in the americas in the mid 20th century had a concomitant and striking effect on dengue transmission, but there are very few reports of the application of indoor residual spraying specifically to control dengue. the preference of aedes vectors for daytime activity and feeding means that insecticide-treated bednets are ineffective for dengue control. findings of several small trials of other insecticide-treated materials, such as curtains and water-jar covers, indicate a reduction in indices of household vectors, and larger trials are warranted to investigate effectiveness in a range of epidemiological settings. international guidelines recommend parasitological confirmation, when possible, of all suspected cases of malaria and prompt initiation of treatment to prevent progression to severe disease. timeliness is also very important for effective clinical management of dengue; progression from an acute febrile phase to non-complicated recovery, or through a critical phase characterised by thrombocytopenia and capillary permeability with potential for haemorrhage and shock, takes place over 37 days. unlike malaria, no specific treatment for dengue is available, and clinical management entails close haematological monitoring, fluid-replacement therapy as required, and recognition of warning signs of severe disease. although serological, molecular, and rapid diagnostic tests for dengue are widely available, the expense, waiting time, and large case numbers mean that clinical management and case reporting in most endemic settings is based on clinical diagnosis alone. increasing availability of rapid diagnostic tests could theoretically improve timeliness and accuracy of dengue diagnoses. however, studies of the effect of test results on clinical management and outcome of dengue cases, including cost-effectiveness studies, are needed to inform recommendations for widespread use. demand for routine diagnostic testing for dengue could increase substantially if an antiviral drug were available. research efforts towards vaccines against malaria and dengue are similarly complicated by (among other challenges) the antigenic or serotypic variability of the organisms. a longlasting highly effective dengue vaccine should be much easier to develop than an equivalent malaria vaccine because of the relative antigenic complexity of the two pathogens and the longevity of immune responses to viral infections, compared with those to malaria parasites. however, developers of a dengue vaccine must contend with the theoretical risk of severe disease associated with sequential infection with a heterologous serotype and, thus, aim to develop a tetravalent vaccine. candidate vaccines for malaria and dengue are in phase 3 field trials, but despite publication of promising clinical trial data for the leading malaria vaccine candidate, a substantial vaccine-mediated reduction in the global burden of either disease is not imminent. thus, vector control, effective diagnosis, and clinical management remain the cornerstones of control for both diseases, for the foreseeable future. the challenge now in malaria control is equitable and effective implementation of interventions that have proven efficacy. however, to tackle the increasing burden of dengue, well designed and controlled field trials are needed of both existing and novel vector-control interventions, linked to detailed epidemiological data, to improve the evidence base and inform local and national dengue-control strategies. further challenges for evaluation of dengue interventions might include the effect of human movement on patterns of transmission, and the pronounced temporal and spatial heterogeneity in transmission, which will necessitate very large cluster-randomised study designs. these issues are also likely to be challenges for malaria control though the elimination or eradication phases. malaria control throughout the past century has been a combined effort of national, regional, and international programmes. the global malaria eradication programme launched in 1955 by who was the largest coordinated international public health campaign in history. with an intensive strategy of vector control using residual insecticides, combined with detection and treatment of cases, 22 countries in the americas and 27 in europe achieved malaria elimination between 1950 and 1978. despite these successes, the goal of elimination was not met universally and was never proposed for sub-saharan africa; in 1969, who's strategy was revised to one of control. efforts to control dengue also benefited from an elimination campaign in the mid 20th century; in 1947, the pan-american health organization adopted a proposal by brazil for a so-called hemispheric (pan-american) strategy to remove the ae aegypti vector. although the aim of this campaign was eradication of urban yellow fever, which shares the same vector as dengue, the successful elimination by 1967 of ae aegypti from all countries of the americas (except for the usa, venezuela, and the caribbean region) saw a substantial reduction in dengue morbidity across this region. unfortunately, this campaign had the same outcome as the global malaria eradication programme, with a reversion to a strategy of control because of a combination of reduced political will, insufficient financing to sustain intensive control efforts, and increasing decentralisation of national public health authorities, among other factors. the ae aegypti vector re-established itself in areas from which it had been eliminated, with a resultant rise in dengue epidemics in the americas throughout the 1970s and 1980s. in southeast asia, an elimination goal for dengue or its vector has never been proposed formally. efforts to control malaria during the past 15 years have intensified after the development of international initiatives to coordinate and finance the scale-up of interventions, beginning with the roll back malaria partnership, launched in 1998, and the global fund for aids, tuberculosis, and malaria, founded in 2002. more recently, the bill and melinda gates foundation has allocated substantial funds to malaria control and eradication efforts. these initiatives recognise the need for external funding and support to malaria-endemic countries to achieve coverage of interventions at a level that will affect transmission and morbidity. an estimated us$99 billion was committed by international donor agencies for malaria control in endemic countries between 2002 and 2010. by contrast, vector-control interventions for dengue remain the financial and logistical responsibility of national control programmes in endemic countries, which are funded from national budgets with no substantial or sustained external sources of financing. dengue is a high public health priority in endemic countries, but the main target of spending is responsive vector-control activities around reported cases, combined with passive case surveillance and some routine virus and vector surveillance. budgets are usually insufficient to implement these actions fully, let alone to sustain breeding source reduction activities, larval control, and environmental management, which might be more effective but are highly resource-intensive. it is difficult to see how the continuing geographical spread and increasing intensity of dengue transmission can begin to be reversed without support in coordination and financing from outside endemic countries. support should include applied research to improve the evidence base for existing vector-control techniques, for novel interventions such as transfection of wolbachia spp into ae aegypti to suppress dengue transmission, and for strategic planning to implement and finance a future vaccine. even when a dengue vaccine becomes a reality, external assistance for financing and implementation will be needed by some endemic countries, as will continued concerted efforts in vector control. unlike malaria, which receded from southern europe in the mid 20th century, aedes mosquitoes, and possibly dengue, could continue to expand into warmer areas of high-income countries, including australia, the usa, and southern europe. this possibility should provide any additional impetus needed for dengue to be viewed as more than a neglected tropical disease. the burden of morbidity, mortality, and economic loss attributable to dengue is not comparable with that caused by malaria. however, the coordinated initiatives for funding of regional and global collaborative research and control activities, which have proven effective to address the global burden of malaria, could also drive similar gains in dengue control. based on lessons learned from malaria control, we propose that development of better methods to quantify dengue endemicity and disease burden, permitting comparisons across countries and regions, is an essential step towards halting the current rise in disease range and intensity. we must be able to quantify these increases accurately so we can establish baselines against which future trends can be compared. analysis of the clinical and demographic profile of acute cases can tell us much about local dengue transmission dynamics, but improved indices of transmission including means of accounting for asymptomatic infections that can be measured at a population level and within specific subgroups would provide a much more complete picture of local transmission patterns. use of serological markers of dengue infection in epidemiological studies has some limitations, but age-stratified serosurveys of neutralising antibodies against the virus probably represent the best equivalent to the malaria parasite prevalence survey for population-based estimates of the incidence of infection. improved entomological measures of risk for dengue transmission, based on density of the adult vector and infection prevalence, could complement these estimates but might also be inferred, similar to malaria, from measurement of incidence in human populations. improved estimates of the dengue disease burden would inform economic analyses of vector-control activities and future vaccination strategies. effective implementation of these interventions could be achievable within the national budgets of a few dengue endemic countries, but many national dengue control programmes would benefit from coordinated international funding to achieve adequate coverage, as has proven effective in malaria control. this fact reinforces the importance of developing improved indicators of local, regional, and global dengue endemicity and disease burden, to advocate for funding directed to areas of greatest need, to identify locations where interventions are most likely to succeed, and to monitor future progress of disease prevention efforts, including vaccines. sih is funded by a senior research fellowship from the wellcome trust and is supported by the li ka shing foundation, the rapidd program of the science and technology directorate, department of homeland security, and the fogarty international center, national institutes of health. this research was also supported partly by the idams project (grant no 281803) within the 7th framework programme of the european commission. the sponsors had no role in preparation of the manuscript or the decision to publish. we thank cameron simmons, oliver brady, peter gething, thomas scott, philip mccall, and jeremy farrar for valuable comments and suggestions during the preparation of this manuscript; and katherine battle for proofreading.

summaryachievements in malaria control could inform efforts to control the increasing global burden of dengue. better methods for quantifying dengue endemicity equivalent to parasite prevalence surveys and endemicity mapping used for malaria would help target resources, monitor progress, and advocate for investment in dengue prevention. success in controlling malaria has been attributed to widespread implementation of interventions with proven efficacy. an improved evidence base is needed for large-scale delivery of existing and novel interventions for vector control, alongside continued investment in dengue drug and vaccine development. control of dengue is unlikely to be achieved without coordinated international financial and technical support for national programmes, which has proven effective in reducing the global burden of malaria.

PMC3574272

pubmed-1011

giant cell pancreatic cancer was first described by sommers and meissner in 1954. in the literature, these rare tumours have been divided into two subtypes: osteoclast-like giant cell and pleomorphic giant cell carcinoma of the pancreas. although a number of reviews have shown possible prognostic differences between these two subtypes, the most recent world health organisation (who) classification places the neoplams in the same category, undifferentiated carcinoma with osteoclast like giant cells. in any case, unless detected early, the majority of cases have a very poor prognosis often worse than pancreatic adenocarcinoma. in this report, we review the literature in the area and present a unique case of a patient with known alcohol abuse who developed metastatic pleomorphic giant cell cancer of the pancreas within months of a diagnosis of a pancreatic serous cystadenoma. the case also highlights the challenges in managing pancreatic cystic lesions and emphasizes the importance in considering rare forms of pancreatic cystic masses when the findings are atypical for the presentation. a 44-year-old man, who was a known alcoholic, presented to the first department of surgery, university of athens with symptoms of epigastric abdominal pain, vomiting, and weight loss. biochemical analysis revealed alanine aminotransferase (alt) 172 u/l, gamma-glutamyl transpeptidase (-gt) 163 u/l, alkaline phosphates (alp) 464 u/l, and c-reactive protein (crp) 84.90 mg/l. the serum levels of various tumour markers were not increased: alfa feto protein (afp) 1.6, carbohydrate antigen 19-9 (ca19-9) 12.3, carbohydrate antigen 72-4 (ca72-4) 1.8, and carcinoembryonic antigen (cea) 3.6. a subsequent computed tomography (ct) scan revealed the presence of a 4 cm 4.2 cm cystic lesion in the body and tail of the pancreas. there was also a minor increase in diameter of the peripheral segment of the pancreatic duct and disseminated damage of the pancreatic parenchyma, suggestive of multiple episodes of pancreatitis in the past. fine-needle aspiration biopsies with endoscopic ultrasound guidance (eus) of the pancreatic lesion were performed. u/l), and cytology was consistent with the diagnosis of a serous cystadenoma. tumour markers (cea, afp, and ca 19-9) were negative. the patient's symptoms subsequently improved with conservative management only: fluid resuscitation, analgesia, and antiemetics. six days after admission, the patient was discharged with outpatient followup with repeat scanning. four months followed without symptoms, and a second ct scan indicated only a small increase (4 cm 4.5 cm) in the pancreatic cystic lesion. a repeat ct in addition to magnetic resonance imaging (mri) and magnetic resonance cholangiopancreatography (mrcp) revealed only marginal enlargement in the pancreatic cystic lesion, but now there were also multiple lesions in the liver ranging from a few milimetres to 2.5 cm in diameter (figure 1). the patient underwent laparoscopy and biopsy which revealed infiltration of the liver tissue by a giant cell carcinoma. the growth pattern was diffuse with pseudospaces, and the stroma was loose and abundant with inflammatory infiltrates (figures 2(a) and 2(b)). the neoplastic cells showed cytokeratin 7 (figure 3(a)) and cytokeratin 19 (figure 3(b)) immunopositivity. the morphological and immunohistochemical features from the hepatic, pancreatic, and lymph node biopsies revealed the diagnosis of pleomorphic giant cell carcinoma, with the organ of origin the pancreas. at this advanced stage, surgical resection was not possible and the patient died four months later. cystic lesions of the pancreas are an increasingly common finding with modern radiological investigations, although pancreatic cystic neoplasms remain rare and account for only 10%15% of these cysts [4, 5]. once identified, the initial step in managing cystic lesions is differentiating a pancreatic pseudocyst from a cystic neoplasm. a careful review of the clinical background of the patient is paramount, with previous documented pancreatitis or identifiable risk factors for pancreatitis (chronic alcohol consumption, history of gall stones, or a strong family history of pancreatitis) an essential starting point. if these factors are present the cystic lesion is more likely a pseudocyst, but it may also be the first presentation of a neoplastic lesion. the patient demographics, and the cyst size, site, and quantity provide valuable information in predicting the nature of the lesion. ultimately a combination of ct, mri, mrcp, endoscopic retrograde cholangiopancreatography (ercp), or eus with biopsy provides the diagnosis in most cases, with eus the most fashionable approach at present [68]. the patient in this report was a 44-year-old male with known excess alcohol consumption, and ct findings are consistent with previous pancreatitis. although the clinical features were suggestive of a pseudocyst, an eus with biopsy was performed and while the amylase was elevated, the cytology suggested a serous cystadenoma. serous cystadenomas are largely benign lesions which present more frequently in middle aged/elderly females without a history of pancreatitis are evenly distributed throughout the pancreatic gland and have a low amylase level and low tumour markers (specifically cea) [9, 10]. it is worthwhile noting however that the diagnostic accuracy of ct for pancreatic cysts has been reported to range from 2090% and the sensitivity for analyzing pancreatic cystic fluid shows a range from 5093% [1113]. in this instance, the patient clinically improved and with cytology demonstrating a serous cystadenoma; close observation was deemed the most appropriate management. interestingly, tseng et al. recommend excision of large (> 4 cm) serous cystadenomas irrespective of symptoms, which goes against the management of this 4.4 cm cyst. although serous cystadenomas are considered effectively benign, there have been a number of single-case reports highlighting the presence of malignant features [15, 16]. however, there are no reported cases in the english literature of a coexistent serous cystadenoma and giant cell pancreatic cancer, as was the case here. giant cell pancreatic cancer is a rare neoplasm, characterised by the presence of giant cells, hypervascularity, and an inflammatory response. it accounts for 2%12.8% of all cases of pancreatic malignancies, and despite active intervention, patients usually die within months of diagnosis. the neoplasm has been subdivided into two groups, osteoclast-like and pleomorphic giant cell pancreatic cancer. indeed, a third grouping, known as mixed type, has highlighted the possibility that these tumours may indeed represent a morphological spectrum with osteoclast-like giant cell tumours at one end and pleomorphic giant cell tumours at the other. classic osteoclast-like giant-cell tumours have a predominant population of osteoclast-like giant cells and abundant hemosiderin granules whereas pleomorphic giant cell pancreatic neoplasms have more pleomorphic multinucleated giant-cells and mononuclear cells. the clinical features of pleomorphic giant cell carcinoma are comparable to those of pancreatic adenocarcinoma with abdominal pain and weight loss the most prevalent [17, 20]. cancer site has a role to play here, with head of pancreas cancers presenting more frequently with jaundice. although there does not appear to be a preferred pancreatic site, even though some studies report higher prevalence in the body and tail. the mean age of onset is 65 years, and there appears to be a male predominance. elevated inflammatory markers are present in the majority of cases, and ct findings often show large irregular hypodense masses (majority>6 cm) [17, 19, 20]. the survival range for pleomorphic giant cell pancreatic cancer ranges from several weeks in advanced unresectable disease to 25 months [21, 22]. the osteoclast-like giant cell variant may have a better prognosis (due to reduced prevalence of metastasis), but the evidence for this is inconclusive [20, 22, 23]. there have been at least two reported cases of osteoclast-like giant cell pancreatic tumours presenting as pseudocyst lesions and a similar number as mucinous cystadenomas [2426]. there has been one case of a mixed (osteoclast-like and pleomorphic) giant cell pancreatic cancer presenting as a pseudocyst. there have been no reported cases of an association between serous cystadenoma and any form of giant cell pancreatic cancer, which we report here. the diagnostic accuracy of ct, eus with biopsy and cytology is quite high, depending on the papers cited [69]. however, it is more than possible for a neoplastic cyst to be missed on a single biopsy, which is plausible in the case here. however, considering the clinical improvement in the patient's condition, background history of alcohol excess+/ episodes of pancreatitis and stable disease on repeat scanning, the role of conservative management could be justified. it may also be suggested that in the eight months from initial diagnosis an aggressive pleomorphic giant cell cancer may have developed at or near the site of the presumed cystadenoma rather than a direct association between the two. the management of this case may have been different on reflection of the radiological and cytological findings considering the clinical background of the patient. surgical resection at the initial presentation may have identified the neoplasm and altered the outcome for the patient. overall the case emphasizes the challenge in managing pancreatic cystic lesions and suggests lowering the threshold for surgical resection in atypical cases. the report discusses an unusual case of pleomorphic giant cell cancer of the pancreas which presented initially as a pancreatic cystic lesion and was diagnosed as a serous cystadenoma. the case highlights the challenges in managing pancreatic cystic lesions and emphasizes the importance of considering less common forms of pancreatic cystic masses when the findings are atypical with the presentation. surgical excision in these cases over conservative steps may be the most appropriate management.

introduction. pleomorphic giant cell pancreatic cancer is a very rare and aggressive pancreatic neoplasm. a case of pleomorphic giant cell pancreatic cancer presenting as a cystic lesion and in association with a serous cystadenoma presents a unique case which has not been described before. case presentation. a 44-year-old alcoholic man presented with abdominal pain, vomiting, and weight loss. initially, imaging suspected a pancreatic pseudocyst measuring 4.2 cm. endoscopic ultrasound- (eus-) guided fine-needle aspiration revealed a serous cystadenoma. with conservative intervention only (fluid resuscitation, analgesia, and antiemetics) the patient improved and was discharged under close observation. follow-up scan at four months revealed minimal change. three months later, he was admitted acutely. repeat scans demonstrated mild cyst enlargement with new liver lesions. laparoscopic biopsy revealed pleomorphic giant cell carcinoma with the organ of origin the pancreas. conclusion. this unusual case highlights the challenges in managing pancreatic cystic lesions and emphasizes the importance of considering less common forms of pancreatic cystic masses when the findings are atypical for the presentation. surgical excision in these cases over conservative steps may be the most appropriate management.

PMC3010638

pubmed-1012

local anesthetic agents are chemicals that reversibly block the transmission1 of action potential of nerve membrane. an essential pre-requisite to success in dentistry is to achieve good quality local anesthesia (la). local anesthetic agents are normally associated with absence of pain during surgical intervention in bone and soft tissue. there are many local anesthetic agents, lignocaine being the gold standard2 available with the wide selection of vaso-constrictive agents that improve the clinical efficacy and the duration la. lignocaine diffuses readily through interstitial tissues and lipid rich nerves, giving rapid onset of action. its vasodilating effect is more than that of prilocaine and mepivacaine.3 adrenaline prolongs the duration as well as the depth of anesthesia. it is effective in preventing or minimizing blood loss during surgical procedures. due to vaso-constrictive effects of adrenaline, absorption of la and systemic toxicity are reduced. if adrenaline is not added to lignocaine, vasodilating effect of lignocaine limits pulpal anesthesia to only 5-10 min. 0.2 mg adrenaline is a safe maximum dose in healthy patients and it is best to limit the total dose to 0.04 mg in cardiac patients. it should be kept to a minimum amount capable of producing adequate results. systemically adrenaline like drugs can cause a number of cardiovascular disturbances while most are short lived, permanent injury or even death may follow drug induced ventricular fibrillation, myocardial infarction or cerebro-vascular accidents.4 to compare the efficacy of 2% lignocaine with two different concentrations of adrenaline-1:80000 and 1:200000.to study the cardiovascular effects of la with adrenaline in two different concentrations.to recommend the ideal concentration of adrenaline to the elderly and asa iii and asa iv risk patients with the history of cardiovascular problems. to compare the efficacy of 2% lignocaine with two different concentrations of adrenaline-1:80000 and 1:200000. to study the cardiovascular effects of la with adrenaline in two different concentrations. to recommend the ideal concentration of adrenaline to the elderly and asa iii and asa iv risk patients with the history of cardiovascular problems. to compare the efficacy of 2% lignocaine with two different concentrations of adrenaline-1:80000 and 1:200000.to study the cardiovascular effects of la with adrenaline in two different concentrations.to recommend the ideal concentration of adrenaline to the elderly and asa iii and asa iv risk patients with the history of cardiovascular problems. to compare the efficacy of 2% lignocaine with two different concentrations of adrenaline-1:80000 and 1:200000. to study the cardiovascular effects of la with adrenaline in two different concentrations. to recommend the ideal concentration of adrenaline to the elderly and asa iii and asa iv risk patients with the history of cardiovascular problems. irrespective of the number of teeth extracted, inferior alveolar and lingual nerve blocks were administered (long buccal whenever necessary). unilateral extractions were carried out in a single sitting and the other side was done on next visit. the patients who had any systemic illness like hypertension, cardiac problems and diabetes etc. were excluded from the study. the following data were collected during the procedure: time of administration of la, onset of anesthesia noted as subjective and objective symptoms (subject: tingling and numbness in the lower lip and tongue, objective: absence of pain on instrumentation).amount of la used.pulse rate and blood pressure (bp)were recorded using automated multi-nodular monitor-before the administration and immediately, 10 mins, 30 mins and 60 mins.evaluation of analgesia was done by the operator as successful, partial success and failure.intra operatively pain was scored on visual analogue scale (vas)5 as reported by the patient. the vas was presented in the form of a printed ruler numbered 0-10.any sign of systemic toxicity was recorded. time of administration of la, onset of anesthesia noted as subjective and objective symptoms (subject: tingling and numbness in the lower lip and tongue, objective: absence of pain on instrumentation). pulse rate and blood pressure (bp)were recorded using automated multi-nodular monitor-before the administration and immediately, 10 mins, 30 mins and 60 mins. evaluation of analgesia was done by the operator as successful, partial success and failure. intra operatively pain was scored on visual analogue scale (vas)5 as reported by the patient. the vas was presented in the form of a printed ruler numbered 0-10. safety and efficacy of the two solutions with two different concentrations of adrenaline were studied in 40 patients. no systemic toxicity was observed. as observed in the table 1 and graph 1, there was no significant change in both the groups in the point of view of time of onset. with regard to the duration of action of la, 1:80000 adrenaline concentrations showed more than that of 1:200000. this is due to the faster absorption of la when used with less concentration of adrenaline. the amount of la used for both the groups does not show any significant change. as shown in the table 1, there was no change in the vas scale as both the solutions had same efficacy. time of onset, duration, amount of la used and pain (vas) comparison in two groups. comparing the onset of anesthesia in two groups subjectively and objectively. there was significant rise in the pulse rate immediately when la with 1:80000 adrenaline concentrations was used and it came to the normal gradually after 60 min as seen in the graph 2. variations in pulse rate. but when la with 1:200000 adrenaline concentrations was used, there was no significant rise in the pulse rate. while assessing the systolic bp, there was rise significantly when la with 1:80000 adrenaline concentrations was used whereas there was no major change observed when la with 1:200000 was used as shown in graph 3. there was slight rise in diastolic bp when la with 1:80000 adrenaline was used but there was decrease when la with 1:200000 adrenaline concentration as seen in the graph 4. though there are many la agents available in the market, lignocaine is the most widely used in dentistry. most of the time, la agents are used with vasoconstrictors, though the concentrations may vary. the presence of a vasoconstrictor in the anesthetic cartridge has a major influence on the duration of anesthesia.6 the ability of vasoconstrictors to retard the systemic absorption of injected la agents is the basis for their widespread use.4 vasoconstrictors employed in local anesthetic solutions have the potential for interacting with the wide variety of drugs.7 physiological responses associated with local anesthetic solutions containing a vasoconstrictor have included changes in heart rate and bp, dysarrythmias, ischemic changes (st segment and t wave), the release of endogenous catecholamines, endocrine response to surgery and hypokalemia.8 local aesthetic agents with adrenaline as the vasoconstrictor used for the surgical soft tissue and bone interventions in the oral region tend to cause more post-operative pain than la without adrenaline as the vasoconstrictor.9 in our study, comparison of two different concentrations of adrenaline is evaluated (efficacy as well as cardiovascular effects). so the epinephrine concentration does not affect the clinical efficacy of local anesthetic agent as reported by the study conducted by santos et al. and dagher et al.10,11 the time of onset of anesthesia as well as the amount of la used in our study is similar to the study conducted by malamed et al.12 significant cardiovascular effects were observed in the study as seen in the statistical analysis, there was significant rise in the mean pulse rate when 1:80000 adrenaline used whereas no significant change observed in 1:200000 used. there was significant rise in the systolic and diastolic bp when la with 1:80000 adrenaline used while 1:200000 adrenaline did not bring any significant change. (2001)demonstrated significant cardiovascular changes 10 mins after the injection of lidocaine with the higher adrenaline concentration of 1:80000.8 gregorio et al. has reported after his study that it is important to stress that with articaine and other local anesthetic solutions in general, 1:100000 and 1:50000 epinephrine concentrations are associated with greater cardiovascular stimulation than 1:200000 epinephrine formulations.13 for an adult healthy patient, la with any of the concentration of adrenaline can be used as the efficacy is not altered in both the solutions. since the duration of anesthesia is significantly different for both the solutions, la with 1:80000 is preferred in case of long procedure. for hypertensive patients, some physicians advise la without adrenaline but la with 1:200000 could be used taking the advantage of adrenaline and avoiding complications as the adrenaline concentration is insignificant. the present study of two types of 2% lignocaine with two different concentrations showed that both of them have the same efficacy. coming to the cardiovascular effects, 1:80000 adrenaline concentrations showed significant rise in pulse rate as well as bp as compared with the other drug. for the cardiac and elderly patients, when treating any patient taking medication, one should be aware of the potential medical complications and always use the least concentrated solution of vasoconstrictor that allows for deep anesthesia during a period of time. la with a lower concentration of adrenaline will not compromise the profundity and success of anesthesia and would be safe for this group of patients.

background: local anesthetic agents are more commonly used in dentistry to have painless procedure during surgical intervention in bone and soft tissue. there are many local anesthetic agents available with the wide selection of vaso-constrictive agents that improve the clinical efficacy and the duration of local anesthesia. most commonly lignocaine with adrenaline is used in various concentrations. systemically adrenaline like drugs can cause a number of cardiovascular disturbances while most are short lived, permanent injury or even death may follow in drug induced ventricular fibrillation, myocardial infarction or cerebro-vascular accidents. this study compared the efficacy and cardiovascular effects with the use of 2% lignocaine with two different concentrations. materials and methods: forty patients underwent extractions of mandibular bilateral teeth using 2% lignocaine with two different concentrations-one with 1:80000 and the other with 1:200000. results: there was no significant difference in the efficacy and duration with the 2% lignocaine with 2 different concentrations. 2% lignocaine with 1:80000 adrenaline concentration has significantly increased the heart rate and blood pressure especially systolic compared with the lignocaine with 1:200000. conclusion: though 2% lignocaine with 1:80000 is widely used in india, 1:200000 adrenaline concentrations do not much affect the cardiovascular parameters. so it is recommended to use 2% lignocaine with 1:200000 for cardiac patients.

PMC4385721

pubmed-1013

peyronie disease (pd) is a connective tissue disorder that is characterized by localized fibrotic plaques in the tunica albuginea, most commonly on the dorsal surface of the penis, that result in penile bending and often pain. as an initial trigger, an inflammatory process and subsequent aberrant wound healing by repetitive trauma to the penis during intercourse has gained widespread acceptance. this inflammatory process itself is self-limited and the pain typically resolves with time. unfortunately, by progression, the penile deformity remains in 90% to 95% of patients, with surgery remaining as the sole conclusive treatment for this sequel. in addition, pd is frequently associated with erectile dysfunction (ed); in a recent retrospective study of 1,001 patients with pd, 58.1% of patients reported having ed. diagnosis of pd is based on sexual history and careful physical examination of the penis, which are sufficient for establishment of the diagnosis. in contrast, owing mainly to an incomplete understanding of the exact pathogenesis, the optimal management of pd remains a clinical dilemma, particularly the nonsurgical approach. despite a wide spectrum of currently available treatment options, including oral agents, intralesional injection, extracorporeal shock wave therapy, and external traction therapy [8-11], none of these has demonstrated conclusive effects and most studies of these treatments did not have a placebo-controlled design. to date, none of these treatment options carries a grade a recommendation according to contemporary western guidelines; thus, the clinical strategy for management of pd is primarily dependent on the preferences of physicians and patients. however, incorrect and outdated information on this condition from the first-encountered physician may cause misdiagnosis or mislead the patient into unrealistic beliefs, as demonstrated in a recent survey on primary care physicians and urologists. with this background, we conducted a survey to elucidate the actual diagnosis and treatment patterns, including nonsurgical and surgical approaches, by korean urologists. we also intended to assess each treatment modality, as preliminary data for creation of further local guidelines on pd, by evaluation not only of the urologists ' perceptions from the point of view of the suitability of the treatment for pd, but also of patient satisfaction with each management modality investigated by the urologist. a probability sample was taken from the korean urological association registry of physicians, and a specially designed questionnaire was e-mailed to 2,421 randomly selected urologists. the purpose of the survey was to explore the practice characteristics and attitudes of each urologist. in this study, the researchers observed human subjects set forth in the helsinki declaration of the compliance with ethical principles of medical research. the survey contained 56 questions on pd-related symptoms and diagnosis of pd (n=13), methods for management of pd (n=37), and general questions about demographics (n=6). in questions on the available method used in the diagnosis and treatment of pd, multiple-choice was permitted, given the current uncertainty in the management of pd. as an attempt to identify proper methods for treatment of pd, we asked the urologists about their perceptions from the point of view of the suitability of each treatment and modality, which was divided into a scale with five grades (1, below 20%; 2, 20%-39%; 3, 40%-59%; 4, 60%-79%; and 5, over 80%), and patient satisfaction, which was estimated by use of a scale from 0 to 10 (0, no satisfaction; 10, full satisfaction). responses were received from 385 practicing urologists (15.9%). among them, 263 were from nontraining hospitals, including 68.3% of responses (231/385) from primary care urologists and 122 responses from university-training hospitals (21.7%). the median duration after certification as an urologist was 12 years (range, 0.41 years), and 59% (227/385) had clinical experience of more than 10 years. of the respondents, 66% (255/385) had treated fewer than five patients with pd per year, whereas 16.6% of urologists saw more than 10 pd patients (64/385). the most bothersome symptom causing patients to visit the urology clinic was penile curvature (75.1%, 289/385), followed by painful erection (13.5%, 52/385), difficulty in penetration (4.2%, 16/385), and ed (2.1%, 8/385). plaques were palpable in approximately half of cases (193/383). regarding the interval from development of symptoms to seeking a specialist, 47.5% of urologists (182/383) answered that their patients visited between 6 and 12 months from the development of symptoms, followed by 3 to 6 months (32.6%, 125/383). regarding the natural course, most urologists (87.8%, 338/383) believed that pd is a progressive disease. similarly, most urologists (82.2%, 315/383) responded that spontaneous healing in pd occurred in fewer than 20% of patients. for these two questions, the working year after certification of the urologist or the type of institution they worked for showed no statistical difference (table 1). on a multiple-choice question regarding diagnostic method for pd, the responses were, in order, history taking with physical examination (97.9%, 375/385), international index of erectile function (iief) questionnaires (39.7%, 152/385), combined intracavernous injection and stimulation (34.7%, 133/385), and duplex sonography (28.2%, 108/385). as for the proper timing to initiate management of pd regardless of medical or surgical approaches, 44.1% of urologists (169/383) responded " when penile curvature or pain occurred, " followed by " when the patient wants " (38.1%, 146/383) and " when the penile nodule was identified " vitamin e was the most preferred initial medical management for 80.2% of respondents (307/385), followed by phosphodiesterase-5 (pde-5) inhibitors (27.4%, 105/383), potaba (aminobenzoate potassium; 20.1%, 77/383), carnitine (16.7%, 64/383), colchicine (11.7%, 45/383), tamoxifen (10.4%, 40/383), and pentoxifylline (7.0%, 27/383). however, among the three most common of these, the urologists ' perception from the point of view of the suitability of treatment and patient satisfaction with the treatment were significantly different (p<0.001 and p<0.001, respectively, by chi-square test) (fig. seventy-two urologists (277/385) replied positively on the use of intralesional injection. regarding combination with an oral agent, 41.8% of urologists (160/383) initiated injection when oral medication had failed; however, 35.3% started injection from the beginning of use of an oral agent (136/383). the most preferred injection protocol was that administered on a weekly basis (89.6%, 240/268), with duration of less than 12 weeks (94.9%, 263/277). the preferred injection agent was, in order, corticosteroid (72.2%, 200/277), verapamil (45.1%, 125/277), and interferon (3.2%, 9/277); however, the type of agent did not have an effect on either urologists ' perception regarding the suitability of treatment or patient satisfaction (p=0.485 and p=0.498) (fig. urologists who responded considered surgical treatment, particularly when initial oral and injection therapy had failed (67.6%, 259/383). thirty-eight percent of respondents (148/383) performed surgery for pd in their own clinic, whereas the others (61%) did not. the most frequently performed procedure was plication (84.1%, 190/226), followed by excision and graft (42.9%, 97/226), penile prosthesis implantation (14.2%, 32/226), and others (1.3%, 3/226). among these procedures, urologists ' perception and patient satisfaction were significantly different (p=0.001 and p=0.002) (fig. 3a, b), favoring penile prosthesis implantation. among the most popular treatments in each modality among oral agents, intralesional injection, and surgery, although pd has been recognized for over 200 years, no consensus exists, particularly with regard to the standard treatment of this condition. on the basis of contemporary western guidelines, surgery is the only recommended treatment option, and plication techniques have been used almost exclusively in cases of isolated penile curvature with high curvature correction rates. in contrast, the nonsurgical modalities have shown little progress and have not kept pace with the surgical options in the treatment of pd. to date, there are no u.s. food and drug administration-approved, nonsurgical options. nevertheless, it is also true that there is interest in pd, mainly as a result of improved recognition, widespread use of pde-5 inhibitors, and increasing sexual activity of older men and resultant injury of the penis. indeed, the prevalence of pd appears to be 3 to 10 fold higher than previously estimated. by definition, patients being seen in our clinic complaining of pd are highly motivated; hence, the actual occurrence of this disease within the population may be higher owing to patients ' reluctance to come to their physician for treatment and diagnosis of this embarrassing condition. besides its efficacy in the treatment of deformity, surgery is indicated when pd is stable for at least 3 months, which is usually the case after 12 months from the onset of symptoms, and intercourse is compromised as a result of deformity. in addition, surgery may be associated with complications and the possibility of penile shortening. therefore, based on limited placebo-controlled clinical trial support, physicians usually have no choice but to recommend nonsurgical options, reserving surgery for patients in the chronic phase of pd with deformity and interference in sexual function. to the best of our knowledge, this is the first nationwide survey to address the practice patterns and general perceptions about pd of urologists in korea, as well as patient satisfaction with the management of pd. first, the korean urologists ' perceptions regarding the natural course of pd and diagnostic approaches were analogous with currently available western guidelines. the majority of urologists (87.8%) believed that pd is a progressive condition, and more than 81% of respondents believed that spontaneous healing in pd occurs in fewer than 20% of patients. these observations are quite the opposite of the outcomes reported by larochelle and levine, whose group conducted a survey on pd in the united states. in their study, 17% of primary care physicians and 38% of urologists believed that the disease resolves spontaneously in more than 50% of cases. it is also notable that in this survey, these notions were not affected by the duration in practice as a urological specialist or the type of medical institution in which the urologist worked (table 1). this is in contrast with the depictions by larochelle and levine, in which urologists who had been in practice for more than 10 years were more likely to have incorrect assumptions about pd than were urologists in practice for less than 10 years. regarding diagnostic approaches, most of the respondents in this survey performed physical examination, and approximately 40% evaluated potentially concomitant ed by use of the iief questionnaire. this also contrasts with the findings of the survey conducted by larochelle and levine, where nearly one in two primary care physicians and one in six urologists did not perform routine examination of the patient's penis. second, regarding a nonsurgical approach, whereas vitamin e was used primarily for initial oral management by more than 80% of respondents, its reported efficacy was relatively lower both according to the physicians ' perception of treatment suitability and patient satisfaction in comparison with other oral agents. in contrast, for intralesional injection, physicians ' perception of treatment suitability and patient satisfaction were not affected by the agents injected. among the most common choices in oral and intralesional injection, corticosteroid injection was significantly better perceived by both patients and physicians in comparison with vitamin e. however, this outcome should be interpreted with caution, considering that there is currently no conservative treatment that eventually results in complete relief of all symptoms, including pain, plaque formation, and penile curvature. indeed, several double-blind, placebo-controlled trials on the use of vitamin e, potaba, propoleum, tamoxifen, colchicine, acetyl-l-carnitine, propionyl-l-carnitine, and omega-3 fatty acids for the treatment of pd have been conducted, usually with minor or little proven effect [17-23]. with regard to intralesional injection therapy, whereas 90% of the studies reported positive outcomes, most of those studies did not offer convincing evidence-based data, hampered by their small patient populations. despite initial promising results, in a recent placebo-controlled, single-blind trial of intralesional verapamil injection, no significant improvements were observed in penile curvature, plaque size, or penile pain. the most peculiar finding in this survey was that the highest grade in both patient satisfaction and physicians ' perception of the suitability of treatment was achieved by the surgical approach, as shown in fig. 4. currently, owing to a lack of any nonsurgical management that can definitively alter the progression of the disorder, surgical intervention is the only efficacious treatment for pd. if there is ed that is not responding to pharmacologic treatment, the best option from contemporary guidelines is the implantation of an inflatable penile prosthesis, with or without an associated procedure over the penis (modeling, plication, or even grafting plus the prosthesis). indeed, for the surgical techniques, the urologists ' perception and patient satisfaction were significantly different, favoring penile prosthesis implantation with a relatively higher grade in both aspects (fig. 3). finally, in this survey, the duration of time to a doctor visit was relatively shorter than that reported in western countries, where approximately one-third of pd patients did not see a doctor until 4 years after the emergence of penile symptoms. this is also in contrast with a widely accepted notion that members of the asian population are highly sexually conservative and less sexually active. while distinctions including medical insurance systems, accessibility to medical suppliers, and cultural differences should be considered, this aspect reflects the urgent need for active treatment for patients suffering from this embarrassing condition. a strength of the current study is the recruitment of a reply from 385 acting urologists; to the best of our knowledge, this is the largest number of urologists recruited by use of a detailed survey, particularly on pd. a possible criticism of this study is the response rate of 15.9%, which is far from that required to attain representativeness among practicing korean urologists. because the categories on the questionnaire used in the survey were not designed to permit direct comparison, limited information can be obtained, particularly on the diagnostic approach and efficacy of treatment. in addition, many other factors in terms of patient or physician demographics that were not investigated in this survey may have an effect on the outcomes. indeed, because these data were obtained only from urologists from the physician's point of view, the actual characteristics and responses of the patients remain obscure. in the future, conduct of local population-based studies and randomized controlled trials will be needed; until then, approaches based on currently available guidelines are still recommended. eventually, the development of integrated curricular and specialized guidelines for korean males supported by local data on treatment of pd may be required. the results of our current survey provided insights into the clinical practice of korean urologists in the treatment of pd. the urologists ' recognition of pd is in line with current understanding of this disease, and the diagnosis was based mainly on history taking and physical examination. among various treatment approaches, surgery was the most effective modality from the perspective of both the urologists ' perceptions regarding the suitability of treatment and patient satisfaction. these observations indicate the need for development of practical local guidelines based on solid clinical data and to ensure that these guidelines are widely promoted and accepted by the urological community.

purposea nationwide survey was conducted of korean urologists to illustrate physicians ' perceptions and real practical patterns regarding peyronie disease (pd). materials and methodsa specially designed questionnaire exploring practice characteristics and attitudes regarding pd, as well as patient satisfaction with each treatment modality, was e-mailed to 2,421 randomly selected urologists. resultsresponses were received from 385 practicing urologists (15.9%) with a median time after certification as an urologist of 12 years. regarding the natural course, 87% of respondents believed that pd is a progressive disease, and 82% replied that spontaneous healing in pd occurred in fewer than 20% of patients. regarding diagnosis of pd, the methods used were, in order, history taking with physical examination (98%), international index of erectile function questionnaires (40%), intracavernous injection and stimulation (35%), and duplex sonography (28%). vitamin e was most preferred as an initial medical management (80.2%), followed by phosphodiesterase-5 inhibitors (27.4%) and potaba (aminobenzoate potassium, 20.1%). for urologists who administered intralesional injection, the injected agent was, in order, corticosteroid (72.2%), verapamil (45.1%), and interferon (3.2%). the most frequently performed surgical procedure was plication (84.1%), followed by excision and graft (42.9%) and penile prosthesis implantation (14.2%). among the most popular treatments in each modality, the urologists ' perceptions regarding the suitability of treatment and patient satisfaction were significantly different, favoring plication surgery. conclusionsthe practice pattern of urologists depicted in this survey is in line with currently available western guidelines, which indicates the need for development of further local guidelines based on solid clinical data.

PMC3897632

pubmed-1014

we report a case of a 67-year-old male who presented with a cecocentral scotoma caused by a septic embolus from subacute bacterial endocarditis (sbe). a 67-year-old man presented with sudden, painless decreased vision in the left eye. a dilated fundoscopic exam, humphrey visual field test, transthoracic echocardiogram, abdominal computed tomography (ct), and blood cultures were all performed. a dilated fundoscopic exam revealed temporal segmental optic disc pallor on the left, and humphrey visual field testing demonstrated a dense left cecocentral scotoma. 9f) and palpitations, transthoracic echocardiogram revealed valvular vegetations, and contrast ct of the abdomen revealed an abscess in the dome of the liver likely due to an infectious thrombus. this case illustrates that a sudden cecocentral scotoma may be the initial manifestation of sbe. subacute bacterial endocarditis (sbe) is an indolent microbial infection of the endocardium with the potential for systemic dissemination by way of septic emboli. we report the case of a 67-year-old male who presented with a cecocentral scotoma caused by an infectious embolus from sbe. a 67-year-old man presented to our emergency department (ed) complaining of sudden, painless decreased vision in the left eye for 3 days. he reported no other systemic or ocular symptoms, including no fever, weight loss, pain on chewing, joint pain, or skin rashes. other than treatment for dental caries 1 week prior to presentation, he had not sought medical attention for over 10 years. on examination, the patient correctly identified nine of nine ishihara color plates on the right but only four of nine color plates on the left. dilated fundoscopic exam revealed sharp, nonedematous, nonglaucomatous-appearing optic disks bilaterally but with temporal segmental pallor on the left. the remainder of the peripheral posterior exam was within normal limits, including no roth or cotton wool spots, no hollenhorst plaques, no retinal edema or hemorrhage, and no neovascularization. other than a mildly elevated temperature to 100.1f, all other vital signs were within normal limits, and there were no focal neurologic findings. laboratory testing revealed a sedimentation rate of 80 and a white blood cell count of 11,000/l with 78% neutrophils. platelet count was 225,000/l, and the hematocrit and basic metabolic panel were within normal limits. as computed tomography (ct) and/or magnetic resonance imaging (mri) were not acutely available, we performed humphrey visual field testing, which demonstrated a dense left cecocentral scotoma (figure 1). the differential diagnosis of a pale nerve with a cecocentral scotoma includes an embolic event, optic neuritis, toxic optic neuropathy, and nutritional deficiency. the patient was admitted to the intensive care unit for further medical workup, including further imaging and blood studies. seventy-two hours later, the patient returned to the ed with increased temperature (103.9f), palpitations, and stable decreased visual acuity of the left eye and was therefore readmitted. transthoracic echocardiogram revealed valvular vegetations (not shown), and contrast ct of the abdomen revealed an abscess in the dome of the liver that was likely due to an infectious thrombus (figure 2). following intravenous antibiotic treatment, his systemic condition steadily improved over 1 week, warranting discharge from the hospital. the patient continued oral antibiotic therapy for 3 additional weeks until repeat blood cultures showed no evidence of residual infection. on serial yearly follow-up examinations almost a decade after the original insult, the patient s low vision status on the left persists with decreased snellen vision, reproducible red desaturation, and decreased color plates on that side. follow-up intravenous fluoroscein angiography has remained unremarkable, with recent fundus photos of the left eye (figure 3) showing inferotemporal disk pallor. follow-up mri was not acquired, as the patient s examination and visual defect remained stable over many years. we postulate that an infectious embolus from endocarditis impeded circulation, causing ischemia and segmental infarction of the left optic nerve and affecting the maculopapillary bundle. we report the first case of a cecocentral scotoma presenting as the initial manifestation of sbe. it is important for both the ophthalmologist and general practitioner to recognize that infective endocarditis has varied presentations, ranging from general malaise to loss of appetite. if left untreated, it can be fatal.1 it is commonly caused by relatively avirulent viridans streptococci organisms that have a propensity to adhere to damaged heart valves and endothelium.2 infective endocarditis is typically handled on an inpatient basis to employ the use of intravenous bacteriocidal antibiotics tailored to the specific organism found in cultures and also to closely monitor the patient.3 another option is to administer antibiotics on an outpatient basis but only after treatment has already been started in the hospital and a full initial assessment performed.1 an embolic event due to sbe is a frequent and potentially life-threatening complication of the disease. it has been reported that neurological complications due to embolic events may be as high as 20%40%.3 mri may show infarctions scattered throughout the brain secondary to emboli. ocular manifestations of embolic disease can include roth spots, retinal hemorrhages, and infectious vitritis.3 because sbe often presents as a fever of unknown origin, ophthalmic signs of the disease may often present prior to a confirmatory echocardiogram or blood culture but are often visually insignificant. some studies have demonstrated premacular hemorrhage as the first sign of sbe, whereas others have reported patients with seizures, headaches, and roth spots prior to being diagnosed with sbe.4,5,6 systemic embolization of infective thrombi reportedly occurs in 45%65% cases of sbe.7 we postulate that visual symptoms and signs occur from turbulent flow within the small vascular channels supplying the optic nerve head, causing local ischemia and thereby leading to infarction of the retinal nerve fiber layer. the standard of practice is to rely on echocardiograms as a diagnostic and prognostic tool to guide our management of sbe; however, our ability to predict the risk of embolic events is limited.8 in our case, the sudden appearance of a cecocentral scotoma in the absence of systemic symptoms and grossly abnormal laboratory values was the harbinger of future embolic events in this patient and the first manifestation of a serious generalized infectious process. our case confirms that ophthalmic events may indeed herald sbe and that ophthalmologists should consider systemic workup (in concert with primary care physicians) for patients who present with sudden cecocentral scotomas or other visual field defects.

introduction: we report a case of a 67-year-old male who presented with a cecocentral scotoma caused by a septic embolus from subacute bacterial endocarditis (sbe). methods: a 67-year-old man presented with sudden, painless decreased vision in the left eye. a dilated fundoscopic exam, humphrey visual field test, transthoracic echocardiogram, abdominal computed tomography (ct), and blood cultures were all performed. results:a dilated fundoscopic exam revealed temporal segmental optic disc pallor on the left, and humphrey visual field testing demonstrated a dense left cecocentral scotoma. when the patient developed fever (103. 9f) and palpitations, transthoracic echocardiogram revealed valvular vegetations, and contrast ct of the abdomen revealed an abscess in the dome of the liver likely due to an infectious thrombus. blood cultures grew viridians group streptococci in three separate peripheral collections. conclusion:this case illustrates that a sudden cecocentral scotoma may be the initial manifestation of sbe.

PMC3065569

pubmed-1015

paclobutrazol (chemical structure as in figure 1) was a plant growth regulator registered for the reduction of terminal growth and pruning volume, the inhibition of gibberellins and sterol biosynthesis, and hence the rate of cell division [1, 2]. due to its toxicity, the agreed adi (accepted daily intake) and arfd (acute reference dose) were all 0.1 mg/kg bw/day. according to reg. number 396/2005 (ec) annex i, the mrl for paclobutrazol in fruit was 0.5 mg/kg, and the national food safety quality standard (gb 2763-2014, china) was 0.5 mg/kg in wheat and rice. however, no information was available concerning the residual status and pattern of paclobutrazol in potato. growth inhibition characteristics had been reported for paclobutrazol with soil drenches, soil sprays, and foliar sprays. cross-comparisons among these studies were difficult since they were conducted under different growth conditions (field, greenhouse, and growth chamber). two other factors that influenced the paclobutrazol residues were absorption rate and longevity or persistence of the compound in treated plant tissue and soil. traditionally, gas chromatography (gc) and gas chromatography-mass spectrometry (gc/ms) was once popular for analyses of paclobutrazol, but gc/ms required prederivatization and target compounds may be decomposed by injection at high temperatures. more recently, hplc-based methods for analyses of paclobutrazol had been published in plant [69] and pear pulps using uv detection and different cleanup steps in order to get recoveries of 70% at the 0.01 mg/kg level. thus, using these conventional techniques, it was necessary to perform one or more cleanup steps to decrease interferences and preconcentration steps in order to obtain adequate detection levels. nowadays, lc coupled to tandem ms (ms-ms) [1113] had also been applied to plant growth regulator analysis in fruits as a powerful confirmation tool, improving the sensitivity and reducing the sample pretreatment steps, such as solid phase extraction (spe) techniques. recently, the liquid-liquid extraction with low temperature partitioning (lle-ltp) was promising for multiresidues analysis since this technique presented some advantages in relation to other extraction techniques, such as practicability, reduced number of steps, and low consumption of organic solvents, as well as being reliable and selective [11, 14]. in this study, it was to develop and validate a uhplc-ms/ms method for determination of paclobutrazol in potato and soil, taking advantage of liquid-liquid extraction at low temperature. in addition, the paclobutrazol residue in potato and soil and the dynamics dissipation in soil were investigated through field trials. the purpose of this study was to evaluate the influence of paclobutrazol residue in potato, and a mrl of paclobutrazol in potato was recommended. a high-performance liquid chromatography- (hplc-) grade acetonitrile and methanol were obtained from merck co. ltd. sodium chloride and sodium acetate of analytical grade were obtained from the chemical reagent company (shanghai, china). highly purified water (milli-q, millipore, bedford, ma) was used throughout the preparation of the mobile phase. stock solution was prepared at 1000 mg/l in methanol and stored in dark vials at 20c. for the calibration curve, matrix-matched calibration was used with five series concentrations of extraction solution (0.001, 0.01, 0.05, 0.1, and 0.5 mg ultimate residue experiments were conducted in experimental fields located in songming agriculture demonstration garden, yunnan province, china, from april 18 to june 29, 2013. the soil was sandy clay loam, with content of sand 46%, clay 28%, organic matter 2.02%, and ph 6.94. the experiments were designed according to ny/t 7882004 (guideline on pesticide residue trials) issued by the ministry of agriculture, china. according to the usage guide, paclobutrazol formulation spray application was recommended one time during the early flowering stage of potato (in 45 days). plants were treated with 3 dosage levels, 40 g (available ingredient)/ha (the low dosage, recommended dosage), 60 g (available ingredient)/ha (the middle dosage, 1.5 times the recommended dosage), and 100 g (available ingredient)/ha (the high dosage, 2.5 times the recommended dosage). treatments were consisted of foliar sprayed (with or without thick polypropylene soil cover), and the tuber on the paclobutrazol residual soil with 60 g (available ingredient)/ha, and the control plants were treated with distilled water. foliar sprays were applied with and without a ground cover to evaluate the impact of foliar adsorption and indirect soil absorption from foliar runoff on soil residue. to check the possibility of paclobutrazol contamination from surface and peel of tuber, twenty tubers (4.8 kg) were sprayed with paclobutrazol (1.0 mg/l), five of which were rinsed with 500 ml distilled water and 100 ml acetonitrile; then the rinsing acetonitrile was determined by uhplc-ms/ms after 30 min. another five samples were peeled; then the peel and pulp were analyzed for comparison with potato harvest. as reported paper, potato was harvested about one month after flowering stage, so the tuber and soil were collected to determine final residue at ten days before harvest (22 days), harvest time (32 days), and eight days after harvest (40 days) after foliar spraying. to determine dissipation rate of paclobutrazol in soil, soil samples of approximately 500 g from depth of 010 cm were collected randomly from five points in each plot at 1 h, 1, 3, 7, 14, 21, 32, 40, and 50 days after soil spray. the soil samples were air-dried, clod broken, mixed, and sieved through a 2 mm sieve as described by sharma. soil: 10 g soil sample was weighed into a 100 ml centrifuge tube and then 50 ml acetonitrile was added. the centrifuge tube was extracted in an ultrasonic bath for 10 min and centrifuged at 3000 g for 5 min. afterwards, the tube was stored at low temperature (20c) in refrigerator (haier, qingdao, china) for 10 min to easily separate organic layers. two-milliliter portions of the organic layer were filtered through 0.2 m membrane filters prior to analysis by uhplc-ms/ms. potato: 25 g sample was weighed into a 100 ml centrifuge tube and extracted with 50 ml acetonitrile. the same procedure was followed as that described for soil up to uhplc-ms/ms. sample analyses were performed on tandem mass spectrometry ab 4000 (ab sciex, ontario, canada) which consisted of a 1290 ultrahigh performance liquid chromatography (agilent technology, usa). a zorbax eclipse plus c18 column (50 mm 2.1 mm i.d., 1.8 m particle size) was employed for the separation of the analyte and was maintained at 30c. the mobile phase was comprised of acetonitrile/water containing 0.1 percent formic acid (78/22, v/v) and was delivered at a constant flow of 0.3 ml/min. the injection volume was 1 l. the spectral acquisition was operated in positive electron spray ionization mode, and multiple reactions monitoring (mrm) was utilized. the gas temperature was set at 350c with a flow rate of 8.0 l/min. the precursor ion was m/z 294.2, and production ion was m/z 129.0, 70.0 for paclobutrazol, with relative intensity of 4.5%/68%, in which the most intense production ion m/z 70.0 was the quantitative ion, and collision energy and fragmentor were 110 and 50 ev, respectively. solid-phase extraction (spe) was a preferred way to prevent matrix interference, but it was time-consuming with high cost. the advantage of liquid-liquid extraction with low temperature was that the sample components remained in the ice phase, whereas paclobutrazol was extracted by the completely transparent liquid, which was easily obtained and directly analyzed by uhplc-ms/ms. as it had been previously indicated, cho et al. the result showed that the sample would be frozen and separated easily under 20c to 10 min. so it can be operated under facile condition by home refrigerator. in order to gain a favorable extraction yield, the extraction yield of the various solvents for paclobutrazol was listed in the following sequence: acetonitrile (recovery 95%)>acetone (recovery 86%)>dichloromethane (recovery 65%)>n-hexane (recovery 10%). furthermore, the ratio of acetonitrile to the sample showed that the best results were with 2: 1 (potato) and 5: 1 (soil), resulting in 85% recovery greater than other ratios with 1: 1 or less. the tuning solution was introduced into the electrospray ionization (esi) source by direct infusion. the main ions produced in ms and ms/ms were identified in positive ionization modes. the obtained precursor ions indicated a clear relation between the structure of paclobutrazol and its ability for positive ionization. the precursor ion was m/z 294.2, and production ion was m/z 294.2129.0 and 294.270.0 (quantitative ion). the composition of mobile phase can influence the performance of the ionization process in esi mode. so, different mobile phases (acid, base, and neutral) were tested. the result showed that the response of paclobutrazol can be increased in acid mobile phase (0.1% formic acid). the optimized mobile phase was acetonitrile/water containing 0.1% formic acid (78/22, v/v), as shown in figure 2. for this reason, residues of paclobutrazol in samples were quantified with matrix-matched five-series standard calibration (0.001 mg/l, 0.5 mg the calibration curves showed good linearity with the following equations and relative coefficients: y=1.95693 10+964964x, correlation coefficient r=0.9976. the instrument detection limit (lod) and limit of quantification (loq) were estimated through ten repetitive injections of standard solution, which can detect at a signal-to-noise ratio (s/n) of three multiples and ten multiples, respectively. the lod value was 0.5 g/kg, and the loq values were always 2 g/kg in the potato and 5 g/kg in soil. repeatability and reproducibility were expressed as relative standard deviations (rsd) of retention time (rt) and peak area (ar). reproducibility of rt and peak area was good for 1 month; all values were 3.4% (rt) and 5.2% (peak area) or less. furthermore, repeatability of rt and peak area, which was evaluated on 1 day, proved more satisfactory, with values of 1.5% (rt and peak area) or less. the accuracy of the whole method was evaluated by the development of a recovery study carried out at three concentration levels (5, 50, and 100 g/kg). all experiments were carried out in quintuplicate at each level (results are shown in table 1). as it can be seen in table 1, recovery values were satisfactory, ranging between 83 and 106% with rsd lower than 10%. as it can be seen from the rsd values, the method was reproducible and applicable to the analysis of paclobutrazol in potato and soil. foliar spray without cover treatment showed that amounts of paclobutrazol were absorbed by foliage and foliar runoff was absorbed by the soil.. showed result that paclobutrazol residues in the soil increase due to falling leaves from nearby sprayed trees. apparently, the amount of paclobutrazol absorbed by stolon, then transported to tuber, was larger than by foliar absorptive capacity. to check the possible contamination of paclobutrazol from surface and peel of tuber the content in organic solvent was very lower than the expected concentrations in whole potato. so the paclobutrazol residue in potato harvest was mainly from absorption and transport from soil, which was not removed by peeling. the result showed that the initial deposits of paclobutrazol in soil were 1.14 mg/kg. except for a slight increase on 1st day, the residue value showed a steady decrease and was below 0.22 mg/kg on 50th day. the dissipation equation of paclobutrazol was y=1.0784e, r=0.9403. to establish a recommended maximum residue limit (mrl) of paclobutrazol in potato, two guideline values, with need maximum daily intake (nedi) and acceptable daily intake (adi), the value of adi with paclobutrazol was 0.1 mg/kg bw/day. neda was derived on the supervised trials median residue (stmr) or processing factor (stmr-p) and food intake rate (f). safe level of exposure (mrl) does not exceed the estimated level of actual exposure (adi). the equation was (1)nedi=stmristmr-pifi. according to the investigation of nutrition and health by chinese health ministry in 2002, the f of potato was 0.0496 kg, stmr in potato harvest (recommended dosage: high dosage level) was 00.521 mg/kg, and then the high value nedi (0.0258 mg) was not beyond 5% the value adi 63 (adult weight) of 6.3 mg. liquid-liquid extraction with low temperature partitioning was developed and validated for analysis of paclobutrazol in potato and soil using uhplc-ms/ms. the optimal chromatographic separation and sensitivity were successfully applied to the analysis of paclobutrazol residue in potato and soil. according to risk assessment with nedi and adi ,

a simple, accurate, and highly sensitive analytical method was developed for determining the paclobutrazol residue in potato and soil, the dynamics dissipation in soil. extraction was carried out by low temperature partitioning and analyzed by ultrahigh performance liquid chromatography tandem mass spectrometry (uhplc-ms/ms). for a favor extraction yield, the parameters such as temperature and solvent were optimized. the result showed that sample would be easily frozen and separated using acetonitrile under 20c for 10 min. the limit of detection (lod) was 0.5 g/kg, and the limit of quantification (loq) was 2 and 5 g/kg for potato and soil, respectively. the influence of paclobutrazol residue in potato was evaluated. the possible contamination of paclobutrazol from surface can be rinsed by distilled water or peeled off, but the paclobutrazol in potato harvest comes mainly from absorption and transport, which could not be removed by peeling. the half-life of paclobutrazol in soil was 20.64 days, and the residue was below 0.22 mg/kg on 50th day after spraying. according to the risk assessment with need maximum daily intake (nedi) and acceptable daily intake (adi), a maximum residue limit (mrl) of paclobutrazol in potato was recommended as 1.0 mg/kg.

PMC4584097

pubmed-1016

currently, endoscopic submucosal dissection (esd) is widely used as an alternative to surgical resection in patients with early-stage gastric cancer or adenoma.1 since esd enables en bloc resection of large lesions, esd results in the creation of larger artificial ulcers. kakushima et al2,3 have reported that gastric ulcers induced by esd will heal within 8 weeks, regardless of size, location, helicobacter pylori (h. pylori) infection, or the extent of gastric atrophy. size reduction in the ulcers occurs by contraction in the early phase, and then regenerative mucosa covers the remaining mucosal defect within 8 weeks.4 however, at 4 weeks, the ulcers of all cases remain in a healing stage.2 oh et al5 reported that the initial ulcer size affects ulcer healing using proton pump inhibitors (ppi) at 4 weeks post-esd. if the size of the post-esd gastric ulcer is larger than predicted, ppi administration alone might not be sufficient for the ulcer to heal within 4 weeks. esomeprazole6 is the s-isomer of omeprazole and was developed with the aim of improving the pharmacokinetic and pharmacodynamic profiles of racemic omeprazole. there is no report about the efficacy of post-esd gastric ulcers by esomeprazole. on the other hand, rebamipide, which is a mucosal-protective antiulcer drug, promotes healing rates at 8 weeks for patients with esd derived artificial ulcer.7 kato et al8 showed that the combination of ppi plus rebamipide was more effective than the ppi alone for treating ulcers larger than 20 mm within 4 weeks of esd. woon geon shin et al9 showed that ppi and rebamipide combination therapy had a superior 4-week esd-induced ulcer healing rate and quality of ulcer healing compared with ppi monotherapy. thus, ppi plus rebamipide combination therapy was generally effective for a 4-week esd-induced ulcer healing rate, but in larger esd-induced ulcers there were some issues that need to be addressed. therefore, in the current study we assessed the efficacy of esomeprazole plus rebamipide combination therapy for esd-induced ulcer healing compared with omeprazole plus rebamipide combination therapy. a total of 153 patients who underwent esd for adenoma or early-stage gastric cancer at saiseikai wakayama hospital from september 2007 to august 2012 were included in this study. of the 153 patients, 75 were excluded from analysis because they had been treated with other ppis or had major organ failure. patients receiving antiplatelet or anticoagulant agents were asked to stop these medications at least 4 days before study procedures took place. esd was indicated in patients with adenoma accompanied by any degree of dysplasia and in patients with early superficial gastric cancer. we conducted a case-control study to compare healing rates within 4 weeks effected by esomeprazole plus rebamipide (group e) and omeprazole plus rebamipide (group o). the esd technique has been precisely described elsewhere.1,10 and all esd was performed by a single endoscopist. the knives used in esd included flusknife, (dk2618jb, 1.5 mm type; fujinon, tokyo, japan) and insulation-tipped (it) diathermic knife (kd-10 l; olympus, tokyo, japan)1 in this study. the ulcer created after resection was carefully examined, and any visible vessels were coagulated by hemostatic forceps (radial jaw3 hot biopsy forseps; boston scientific, tokyo, japan). the resected specimen was immediately pinned flat to a rubber plate to measure the size. the ulcer area was approximated from multiplication of the long diameter and the diameter perpendicular to the long diameter of the resected specimen. the sizes of the artificial ulcers were divided into normal size (area<1,200 mm) or large size (area 1,200 mm).11 multifragment resection was considered incomplete, even when the lesion was completely removed endoscopically. post procedure-related bleeding was defined as that when hematemesis, melena, or hemoglobin concentration decreased by more than 2 g/dl were observed. all bleeding was controlled by endoscopic treatments such as hemoclipping, epinephrine injection, electrocoagulation, argon plasma coagulation (apc), and hemostatic forceps. perforation was diagnosed endoscopically by direct observation of mesenteric fat just after resection or by the presence of free air on radiographs or the ct image.12 after esd, all patients received intravenous administration of 20 mg omeprazole (omepral injection; astra zeneca co, osaka, japan) daily for the first 2 days, followed by 4 weeks of drug treatment. the group e was administered 20 mg oral esomeprazole (nexium; astra zeneca co, osaka, japan) and 300 mg oral rebamipide (mucosta; otsuka pharmaceutical, tokyo, japan) daily, whereas the group o was treated daily with 20 mg oral omeprazole (omepral; astra zeneca co, osaka, japan) and 300 mg oral rebamipide. esophagogastroduodenoscopy was performed on the operative day, postoperative day (pod) 1, pod 7 and pod 28 in order to record the healing rates of each artificial ulcer, as well as any immediate complications. ulcer stages were assessed using a six-stage system as proposed by sakita and fukutomi (table 1) at 28 days after the esd.13 statistical comparisons of the patients were performed using the test for categorical data and student s t-test for numerical data. data are expressed as mean sd. differences in the categorical variables between two groups were examined with the test. data regarding the clinical and endoscopic features of the patients are outlined in table 2. there were no significant differences between the two groups with respect to ulcer size, location of ulcer, tissue size, histopathology (included histopathology of subgroup) and positive h. pylori, except for age, gender and procedure time. complications included post-procedure related bleeding in one patient from group e on the second day after esd. 39 percent and 27 percent of the patients had s1 stage disease after 4 weeks of group o and e and there were no significant differences between the two groups with respect to healing rate of s1 stage. to evaluate the effect of rebamipide plus ppi in large-sized or normal-sized ulcers, we performed a subgroup analysis of healing rates between the two groups. in group o, the healing rate of s1 stage in the large-sized ulcer was significantly lower than that of the normal-sized ulcer. by contrast, there were no significant healing rate differences between large-sized ulcer and normal-sized ulcer for the s1 stage in group e. in large-sized ulcers, a significantly higher healing rate of s1 stage were observed in the group e compared to group o, although there were no significant differences in normal-sized ulcers (table 3). during follow-up, endoscopic mucosal resection (emr) is widely applied for curative treatment of gastric neoplasms such as early gastric cancer or adenoma. recently, emr has been replaced by esd, because it is difficult to achieve en bloc resection of specimens larger than 20 mm with emr; piecemeal resection leads to local recurrence with reported rates of about 15%.14,15 the development of esd has enabled performance of en bloc resections of lesions, irrespective of their size or location. additionally, better pathological evaluation is achieved using en bloc specimens.16 however, there have been concerns regarding the technical difficulties of the procedure, the cost, the long operation time and the higher incidence of complications such as bleeding or perforation compared with conventional emr. because ulcer dimensions are larger and the resection depths are greater than those associated with emr, the risk of bleeding is believed to be higher. bleeding from the ulcer is the most serious complication during and after esd.17 green et al18 and berstad19 have shown that the intragastric ph should be 6.0 in order to allow platelet aggregation and prevent platelet disaggregation. therefore, inhibitors of gastric acid secretion such as ppis and histamine-2-receptor antagonists (h2-ras) have been administered after endoscopic therapy for gastric neoplasms to keep the ph of gastric juice high and to induce rapid ulcer healing.17,2023 kakushima et al22 have shown that after esd, artificial ulcers treated by normal-dose ppi therapy healed within 8 weeks regardless of size and location. there is no consensus, however, regarding optimal treatment durations and drug regimens for relatively large esd-induced ulcers. kakushima et al3 have also shown that 4 weeks of ppi treatment was not enough for a large post-esd ulcer to heal, and that 8 weeks was required. oh et al5 had reported that the degree of healing of esd-induced ulcers was dependent on the initial ulcer size, indicating that the duration of treatment with ppi should be considered. taking these data into consideration, it seems that the administration of a ppi alone may not be sufficient for a large esd-induced ulcer to heal within 4 weeks. bleeding, which always occurs within 2 weeks of esd, is the most common complication with surgical-based artificial ulcers. the most effective strategy to prevent bleeding from an artificial ulcer after esd is to promote quick recovery from mechanical and artificial gastric mucosal wounds. in most patients, short-term administration of a ppi or h2-ras may be sufficient to heal artificial ulcers; however, in some patients the ulcer does not heal at an early stage, even after 8 weeks of ppi administration. this inability to heal may be due to severe atrophic gastritis, which commonly requires dissection of larger areas of mucosa. in addition, the more extensive dissection of the gastric submucosa, just above the muscularis propria, which is required for the assessment of cancer spread of lymphovascular invasion may also delay ulcer healing.7 although there have been several reports comparing ppis and h2ras for the prevention of delayed bleeding and the promotion of the healing of esd-induced ulcers, the reported results conflict.21,24,25 some authors report that ppi therapy is superior to h2-ras therapy21,24 while others find no differences between the 2 therapies.25,26 furthermore, several authors have reported that ppi and rebamipide combination therapy had a 48 week esd-induced ulcer healing rate compared with ppi monotherapy.7,27 other authors have reported that rebamipide promotes ulcer healing in large-sized esd-induced ulcers within 46 weeks after esd.8,11 these results could be explained by the regulatory action of rebamipide in the inflammatory processes. rebamipide promotes the ulcer healing process by increasing the level of cytoprotective prostaglandin, epidermal growth factor, or nitric oxide, and decreasing the level of oxygen free radical. these actions of rebamipide could promote gastric mucosal blood flow at the ulcer margin, an important factor in ulcer healing, and accelerate mucosal or submucosal reconstruction of damaged structure.27 taking these data into consideration, it seems that the administration of a ppi alone may not be sufficient for a post esd-induced ulcer to heal within 4 weeks. in the present study, the number of ulcers that reached the scar stage was larger, but not significantly larger, in group e (27%) than in group o (39%) at 4 weeks after esd. kato et al8 have reported that the combination of ppi plus rebamipide was significantly more effective than ppi alone for treating ulcers larger than 20 mm at 4 weeks after esd. the endpoint ulcers reached the scar stage in the ppi group (36%) and in the combination group (68%). there may have been a difference in the ulcer scarring rate because of possible differences in the baseline data such as the use of anti-platelet or inflammatory drugs. however, several authors have reported that artificial ulcers reached the scar stage at 4 weeks after emr/esd in 17% of the ppi group,28 15% of the ppi group,17 and approximately 10% of the ppi group,5,29 which were similar to our scarring rate results in both groups at 4 weeks. on the other hand, there is no report about the efficacy of post esd induced ulcers by esomeprazole. esomeprazole was developed as a single optical isomer of racemic omeprazole and, accordingly, has demonstrated some pharmacological advantages. in particular, a higher oral bioavailability is thought to contribute to the greater degree of acid suppression with esomeprazole than omeprazole, and differences in metabolism pathways are thought to contribute to less interpatient variability with esomeprazole.6 findings from studies in healthy volunteers, patients with gastro-esophageal reflux disease (gord) or those with continuous nsaid therapy have shown that, by day 5, once-daily oral esomeprazole at doses of 20 or 40 mg is more effective at increasing intragastric ph to>4 than once-daily lansoprazole, omeprazole, pantoprazole or rabeprazole. during day 5, the mean percentage of time that intragastric ph was>4 with daily esomeprazole 40 mg was significantly greater than that with comparator ppis.6 therefore, we assessed the efficacy of esomeprazole plus rebamipide combination therapy for esd-induced ulcer healing compared with omeprazole plus rebamipide combination therapy. in our results, there were no significant differences between the two groups with respect to healing rate of s1 stage at 4 weeks after esd, but in subgroup analysis, regarding large-sized ulcers, a significantly higher healing rate of the s1 stage was observed in group e compared to group o. this result suggests that esomeprazole plus rebamipide combination therapy was found to be more effective than omeprazole plus rebamipide combination therapy for large esd-induced artificial ulcers (1200 cm). because rapid ulcer healing through clot stabilization at an elevated intragastric ph is required, a strong acid suppressant such as esomeprazole is more effective with respect to healing rate of s1 stage at 4 weeks after esd. although a ppi is certain to be the most useful drug with healing effects for post esd-induced ulcer, recent reports have confirmed a number of patients who are ppi-refractory (resulting from ppi metabolization, such as that occurring via cyp2c19).30 therefore, clinical research on therapeutic options other than acid-suppressing agents has been needed. there appears to be less variability in the pharmacokinetics of esomeprazole in the overall population compared with other ppis, because esomeprazole appears to be less dependent on cyp2c19 genetics.6 thus, at this point, although cyp2c19 genotyping of the patients could not be performed in this study, esomeprazole may show a high degree of stability in the treatment of post esd-induced ulcer. large-scale, controlled studies are needed to verify the effectiveness of 4 weeks of esomeprazole plus rebamipide combination therapy in the prevention of late bleeding, as well as to investigate its effects on quality of ulcer healing. in conclusion, to the best of our knowledge, the present report is the first retrospective study to demonstrate that the safety and efficacy profiles of esomeprazole plus rebamipide and omeprazole plus rebamipide are similar for the treatment of esd-induced ulcers. especially in large-sized ulcers, esomeprazole plus rebamipide promotes ulcer healing.

objectivesendoscopic submucosal dissection (esd) is useful for treating gastric tumors. several trials have shown the efficacy of 4 or 8 weeks of proton pump inhibitor (ppi) administration for post-esd ulcers. however, if the size of the post-esd ulcer is larger than predicted, ppi administration alone might not be sufficient for the ulcer to heal within 4 weeks. there is no report about the efficacy of post-esd gastric ulcers by esomeprazole. we examined retrospectively the efficacy of a combination therapy of esomeprazole plus rebamipide, a mucosal-protective antiulcer drug, on the acceleration of post-esd ulcer healing comparing with omeprazole plus rebamipide. methods:we reviewed the medical records of patients who underwent esd for gastric neoplasia. we conducted a case-control study to compare the healing rates within 4 weeks effected by esomeprazole plus rebamipide (group e) and omeprazole plus rebamipide (group o). the sizes of the artificial ulcers were divided into normal-sized or large-sized. results:the baseline characteristics did not differ significantly between the two groups except age and sex. stage s1 disease was observed in 27.6% and 38.7% of patients after 4 weeks of treatment in the group e and o, respectively. in large-sized artificial ulcers, the healing rate of stage s1 in group e is significantly higher than that in group o in 4 weeks.(25% vs 0%:p=0.02)conclusions: the safety and efficacy profiles of esomeprazole plus rebamipide and omeprazole and rebamipide are similar for the treatment of esd-induced ulcers. in large-sized ulcers, esomeprazole plus rebamipide promotes ulcer healing.

PMC3742353

pubmed-1017

according to china's ministry of health, china has approximately 4 million cataract victims, with 500,000 new cases being diagnosed each year. as a developing country, especially in rural china, poverty and limited access to health care, due to the uneven distribution of health care sources, can make it very difficult for these people to obtain proper treatment. cataract surgical rate (csr) is still very low in rural china. lifeline express hospital eye-train (lehet), the first charge-free cataract surgery project founded in 1997, is a quite important way to restore vision for the low-income rural people in china. independent of cost or other factors, the first expectation from surgeons and patients is good postoperative visual outcomes. to meet these expectations, attention to accurate biometry measurements the biometry is indispensable to the surgeons and patients as it might indicate the prognosis and safety of the coming operation. in the biometric parameters, axial length (al) and corneal curvature are the most important however, the distribution and determinants of al have been assessed in only a few population-based studies of older persons [410], of which there is still no study of rural chinese population, especially in middle china, having cities with extremely long history. in 2011 and 2012, our hospital (peking university people's hospital, puph) had three missions of lehet in middle china. in this study, we explored the biometric parameters of adult cataract patients who had cataract surgeries on lehet in these missions and all were rural people. our hospital, puph, had four missions of lehet, zhoukou in henan province and songyuan in jilin province in 2011, yuncheng in shanxi province and sanmenxia in henan province in 2012. the sites were selected by the office of lehet, and they were blind to our hospital before the mission start. yuncheng (n 35.03; e 111.01; altitude: 369.53 m) in shanxi province and zhoukou (n 33.62; e 114.66; altitude: 50.50 m) in henan province have thousands of years of history. sanmenxia (n 34.77; e 111.20; altitude: 376.08 m) in henan province was built in the 1950s and also is a rural city. residents in this new city partly immigrated from the whole of china, such as northeast china and west china. in 2011, the pure annual income of rural people was 5601.40 cny (about 889.11 usd) in shanxi province and 6604.03 cny (1048.26 usd) in henan province, much lower than beijing 14735.68 cny (about 2339.00 usd) cited from china statistical yearbook 2012. based on the sixth national census of china 2010 (http://www.stats.gov.cn/) and the 2010 annual survey data of china disabled persons ' federation (http://www.cdpf.org.cn), cataract surgical rate (csr) was calculated as in table 1. any patients who wanted to have the charge-free cataract operations on lehet registered at the base hospital (a local hospital selected by the office of lehet). after the systemic and ocular examinations and signing the informed consent at the base hospital, the patients were sent to lehet. preoperatively on lehet, all patients underwent a complete ophthalmological examination, that is, measurement of presenting visual acuity (va) by means of snellen charts (performed by the nurses from the base hospital), intraocular pressure evaluation (iop) by noncontact tonometer (canon tx-10/tx-f, tokyo, japan) by the trained nurses from puph, slit lamp examination (topcon sl-1e, tokyo, japan), and fundus examination (90 dioptre, volk optical, mentor, oh) with dilated pupil by the ophthalmologists from puph. corneal curvature by auto-keratometer (nikon speedy-k, tokyo, japan), axial length (al) and b-scan by ultrasonic system (odm-2100, meda, tianjing, china), and corneal endothelial counting (cec) by specular microscope (topcon sp-3000p, tokyo, japan) were performed by the trained technicians from puph on the patients suitable for operation. the flatter (k1) and steeper corneal curvature (k2) were read directly from the auto-keratometer, and k was calculated as the average of k1 and k2. corneal radius (cr) was calculated from the formula cr (millimeter, mm)=1000 0.3375/k (diopter, d). the srk/t formula for normal or long axial length (al more than 25.00 mm) and hoffer q formula for short axial length (al less than 22.00 mm) were used to calculate the power of intraocular lens (iol) and the estimated postoperative refractive errors were less than 0.25 d except patients with high myopia. lehet was equipped with specular microscope, sp-3000p, in the first half of year 2012; the patients of zhoukou and part of yuncheng had no cec measurement. exclusion criteria for this study are as follows: age less than 20 years, al equal to or more than 27.00 mm, and history of intraocular surgery. the study was in accordance with the tenets of the declaration of helsinki and has been approved by the institutional review board of puph. the student t-test was used to compare age and chi-square test was used to compare the female ratio between the groups. a p value less than 0.05 statistical analysis was performed using statistical product and service solutions software (spss version 20.0, armonk, new york, usa). 3828 cataract patients (3828 eyes) were enrolled in this study, including 1419 males and 2409 females (male: female=1: 1.70) and 1984 right eyes and 1844 left eyes. there were no statistically significant differences between missions preoperatively in age, gender, and eye operated on. as in table 2, average age of these cataract patients was 69.50 8.05, which was 69.10 8.41 for males and 69.74 7.82 for females (p=0.019), respectively. in detail, the average age was 68.55 8.12 for males and 69.57 8.07 for females in zhoukou (p=0.056), 69.02 8.33 for males and 70.16 7.50 for females in yuncheng (p=0.010), and 69.52 8.64 for males and 69.48 7.92 for females in sanmenxia (p=0.933). although the average age of females is older than males totally, that of males and females was of no difference for zhoukou and sanmenxia, except that of females which was older than that of males in yuncheng. as shown in tables 3, 4, and 5, not only for males or females, but also for total patients, the preoperative va (logmar) of these three groups is as follows: zhoukou>yuncheng>sanmenxia. the patients in sanmenxia had the best preoperative va, even in each gender, significantly. as shown in tables 3, 4, and 5, there was a statistically significant difference in preoperative iop between the patients of yuncheng and zhoukou, yuncheng and sanmenxia. the males, females, and total patients of yuncheng had lower preoperative iop compared with those in zhoukou or sanmenxia. as shown in figure 1 and tables 3, 4, and 5, the patients of zhoukou had lower k1 and k2, significantly. there was no statistically significant difference in k1 between those of yuncheng and sanmenxia, but k2 of yuncheng was higher than sanmenxia significantly. respectively, both the males and females in zhoukou had lower k1 and k2. however, for either the males or the females, there was no difference of k1 and k2 between those in yuncheng and sanmenxia. average corneal power (k) is an important parameter to calculate the power of iol. in figure 1 and tables 3, 4, and 5, the patients in zhoukou had lower average corneal power (k) significantly compared with the other two groups, the same for male and female patients in zhoukou. but there was no significant difference in average corneal power (k) between those in yuncheng and sanmenxia, for either the males or the females. the difference between k1 and k2 could be used to indicate the corneal astigmatism, which has the effect on the postoperative visual acuity. in figure 1 and tables 3, 4, and 5, the difference of k1 and k2 for the patients was as follows: zhoukou>yuncheng>sanmenxia. but for the males except that |k1 k2| of zhoukou was higher than sanmenxia significantly, there was no significant difference between zhoukou and yuncheng or between yuncheng and sanmenxia. as seen in figure 2 and tables 3, 4, and 5, al for the patients was as follows: zhoukou<sanmenxia<yuncheng. for the males, al of zhoukou was shorter than the other two cities. for the females, al of yuncheng was longer than the other two sites. there was no significant difference in al between yuncheng and sanmenxia for males or between zhoukou and sanmenxia for females. the al/cr ratio is highly correlated with the spherical equivalent as a previous study. as seen in figure 2 and tables 3, 4, and 5, the patients in zhoukou had the smallest al/cr ratio closer to 3.0, and yuncheng and sanmenxia had similar ratio. cec is a very important factor to decide the operation scheme and to predict prognosis. as there was no machine in zhoukou at that time, we only could compare cec between those in yuncheng and sanmenxia. as shown in figure 2 and tables 3, 4, and 5, cec of yuncheng was higher than sanmenxia, which was same result for the males. but for the females, there was no significant difference in cec between yuncheng and sanmenxia. this study explored the data of cataract patient, who had the free surgeries on lehet, on ocular biometry of chinese population in rural china. and our study provided the normative data on k1, k2, |k1 k2|, average corneal power (k), al, al/cr, and cec of this population; those were 43.74 1.64 d, 44.75 1.68 d, 1.02 0.86 d, 44.24 1.60 d, 23.04 1.49 mm, 3.03 0.12, and 2462.36 423.65/mm, respectively. our study showed al in rural chinese population was normally distributed with a positive skew and a big kurtosis (1.417). skew and kurtosis have been reported in the distribution of al in the reykjavik eye study, the singapore malay eye study, the singapore indian eye study, and fotedar et al. hence, this is the first report of the appearance of big kurtosis in the distribution of al in rural chinese population. it is worthwhile comparing our findings with those of the tanjong pagar study on adult chinese population in singapore, which also used a-scan. the mean al in that study (23.23 1.17 mm) was a little longer than in our study (23.04 1.49 mm). moreover, al in our study is shorter than latinos (23.38 mm) in los angeles with a-scan, malay people (23.55 mm) in singapore, indian people (23.45 mm) in singapore, and caucasian people (23.44) in the blue mountains area in australia with iolmaster, longer than another asian population (22.76 mm) in myanmar with ocuscan. the similarity of al in those studies with a-scan and ours is likely to be explained by the same method of al measurement. the difference in al of these studies might be explained by a greater degree of urbanization in singapore and subsequently a higher rate of axial myopia. those three studies with iolmaster indicated that the race might have significant effect on al compared with region as the similarity of indian and caucasian people. the corneal power k1, corneal power k2, and k (average corneal power) in our study were not normally distributed with different skews and kurtosis. k2| in our study was normally distributed with a positive skew (2.704) and a significant kurtosis (13.317). moreover, the preoperative visual acuities in the three missions of our study had the same trend as |k1 k2|, both of that of males and females are the same. there is evidence that the al/cr ratio of an emmetropic eye is usually very close to 3.0, and a higher al/cr ratio was reported to be a risk factor in myopia [15, 16]. however, few studies have reported the al/cr ratio. compared with zhoukou, the patients in yuncheng and sanmenxia had similar al/cr ratio, also in males and in females. the singapore indian eye study showed that the al/cr ratio correlated more highly with the spherical equivalent than al alone. this correlation indicated that longer eyes are not necessarily myopic and worse presenting visual acuity, including those that are long because of overall body stature. the patients in zhoukou, who had shorter al and al/cr closer to 3.0, had the worst preoperative visual acuities. this indicated that in rural chinese population at least in the cataract patients the al/cr ratio, in other words, the spherical equivalent, had less effect on the visual acuity than |k1 k2|, the corneal astigmatism. in conclusion, this study provides normative ocular biometry in a large, representative rural chinese population. the corneal power k1, corneal power k2, and k (average corneal power) are not with normal distribution

aims. to describe and explore the distribution of ocular biometric parameters of adult cataract patients in rural china. methods. three lifeline express hospital eye-train missions of peking university people's hospital in china were chosen. 3828 adult cataract patients aged 29 to 88 years with axial length (al) less than 27.0 mm were enrolled. the ocular biometry including visual acuity (va), intraocular pressure, al, corneal power (k1 and k2), and corneal endothelial counting (cec) were collected and analysis. corneal radius (cr) was calculated from the corneal power. results. the participants in zhoukou of these three missions had the worse preoperative va (p<0.001), the lowest k1 (p<0.001), k2 (p<0.001), and k (p<0.001) and the highest |k1 k2| (p<0.001), moreover al/cr more closely to 3.0. the al, |k1 k2|, and al/cr were normally distributed. but the k1, k2, k, and cec were not normal distributions. except k1, all parameters were positively skewed and peaked. conclusion. our study provides normative ocular biometry in a large, representative rural chinese population. the al is normally distributed with a positive skew and big kurtosis. the corneal powers are not normal distribution. the corneal astigmatism might have a significant effect on the visual acuity.

PMC4609820

pubmed-1018

analizie retrospektywnej poddano 206 dzieci (k 113, m 93; rednia wieku 10,6 roku) ze wieym urazem skrtnym stawu skokowego do 7 dni od urazu. wszyscy pacjenci mieli wykonane badania rtg i usg stawu skokowego do 7 dni od urazu. w badaniu rtg nie stwierdzono patologii u 129 pacjentw (63%); u 24 pacjentw (12%) stwierdzono zamanie awulsyjne kostki bocznej; u 36 pacjentw (17%) stwierdzono wysik w stawie skokowym grnym. w badaniu usg nie stwierdzono patologii u 19 pacjentw (9%); u 60 pacjentw (29%) stwierdzono zamanie awulsyjne kostki bocznej obejmujce przyczep wizada skokowo-strzakowego przedniego (atfl); u 34 pacjentw (17%) stwierdzono cakowite zerwanie atfl; u 51 pacjentw (25%) stwierdzono czciowe uszkodzenia atfl; inne uszkodzenia stanowiy 19%. wykonane zabiegi operacyjne rekonstrukcji wizada skokowo-strzakowego przedniego (19) potwierdziy rozpoznania usg/rtg w 100%. zerwania awulsyjne atfl, czyli obejmujce przyczep wizada, wystpuj u dzieci modszych (mediana 8 lat). zerwania cakowite atfl (na przebiegu wizada, nieobejmujce przyczepu) wystpuj u dzieci starszych (mediana 14 lat). ze wzgldu na istotnie ograniczon warto badania rtg w rozpoznaniu patologii stawu skokowego w wieych urazach skrtnych dzieci badanie wykorzystujce obrazowanie tkanek mikkich ultrasonograa zamania awulsyjne obejmujce przyczep atfl, przewaajce u dzieci modszych, wynikaj z niezakoczonego procesu kostnienia i wymagaj pilnej diagnostyki oraz konsultacji ortopedycznej. sprain injuries are diagnosed in 6% of young people who practice sports, and the highest risk is associated with the following sports: soccer, rugby, hockey, handball, volleyball, basketball and squash. most ankle sprain injuries involve the region of the lateral malleolus and its ligament complex (the lateral ligament complex of the ankle joint) which consists of three ligaments: anterior talofibular ligament (atfl), calcaneofibular ligament (cfl) and posterior talofibular ligament (ptfl). sprained ankle is a result of the supination movement, i.e. plantar flexion and inversion of the foot. this structure is a strong ligament and it is an element of the lateral ligament complex of the ankle joint. it attaches to the distal end of the fibula; the center of the enthesis is localized approximately 10 mm above the apex of the lateral malleolus. the talar enthesis of the atfl is localized on the lateral surface of the talus bone (fig. when the foot is in the anatomic position, the ligament runs nearly horizontally, but in the plantar flexion, the axis of the ligament is nearly parallel to the long axis of the shin bone. an injury to the ligament can concern its fibers (mid-substance complete or partial ligament tear) or the enthesis. in the latter situation, the bony attachment site of the ligament is detached (avulsion fracture of the fibula). injuries in sprained ankle are assessed by x-ray and ultrasound (us) examinations, both of which are commonly available. the assessment of the degree to which the anterior talofibular ligament is damaged and the evaluation of coexisting injuries are important when planning the treatment. surgery is indicated, for instance, when the anterior talofibular ligament is torn completely and the patient manifests clinical sings of ankle joint instability or when the ligaments of the ankle joint are damaged with a coexisting osteochondral fracture (e.g. avulsion fracture of the lateral malleolus with the dislocation of an osteochondral fragment in children). when untreated, sprain injury can lead to joint instability, early degenerative changes and chronic joint pain. the aim of this paper is to draw attention to the usefulness of the ultrasound examination in the diagnosis of recent sprain injuries of the ankle joint. the retrospective analysis involved 206 patients (113 girls and 93 boys) who reported to the trauma outpatient clinic with recent ankle joint sprain. the average age of the patients was 10.6. all of them were instantly examined with x-ray and us (within 7 days of sustaining injury). x-ray examinations were conducted with the use of a philips digital diagnost v.2 system with eleva workspot v.2 software. ultrasound examinations were conducted with the use of a ge voluson e8 system using linear probes sp10-16d with the frequency of 718 mhz and an 11 l-d probe with the frequency of 410 mhz. x-ray examinations of the ankle joint were conducted in three views: a-p, lateral and mortise view (used for the assessment of the width of the tibiofibular syndesmosis and for the optimization of the talocrural joint space imaging). x-ray pictures were assessed by four radiologists experienced in diagnosing conditions within the muscoskeletal system. ultrasound images were assessed by five radiologists experienced in diagnosing conditions within the muscoskeletal system. the following signs were assessed in each us examination: the presence of fluid/hematoma in the ankle joint, the image of the synovial membrane and the presence of injuries to the ligaments of the ankle joint: anterior and posterior tibiofibular ligament, anterior talofibular ligament, calcaneofibular ligament, medial ligament, chopart's joint ligaments (talonavicular and bifurcate ligament), as well as tendons of the peroneus muscles, tibialis muscles, extensor and flexor digitorum longus as well as the region of the epiphyseal cartilage of the fibula and the tuberosity of the fifth metatarsal bone. moreover, bone fragments that could be detached in the mechanism of avulsion were actively searched for. grade 1 referred to ligament edema/thickening, which results from elastic deformation of its fibers without the loss of their continuity (commonly known as stretched grade 2 was defined as injury in which some fibers are torn (edema, blurred fibrillar echotexture, areas of decreased echogenicity). finally, grade 3 referred to complete rupture of the ligament (edema and ligament thickening, no evidence of fiber continuity, failure of function in a dynamic examination: ligament stumps or torn fibers move away from each other). a hematoma at the site of the ligament can be present for several days after sustaining injury. avulsion fracture, i.e. injury involving the attachment site, is a specific type of grade 3 damage. the structure of the ligament itself is usually assessed as normal or as in grade i injuries. based on the clinical assessment and imaging findings, 19 patients were scheduled for a surgery to repair the anterior talofibular ligament. x-ray failed to visualize a pathology in 129 children (63%) (fig. 2). in 24 patients (12%), avulsion fracture of the lateral malleolus 3), and in 36 cases (17%), the examinations showed evidence of effusion in the ankle joint or thickening of the soft tissues adjacent to the lateral malleolus (fig. 4 and 5). a slight detached bone fragment, separated from the fibular outline, can be seen x-ray picture of the right ankle joint in the ap view. thickening of the soft tissues adjacent to the lateral malleolus (arrow) x-ray picture of the right ankle joint in the lateral view. radiological evidence of effusion in the talocrural joint (arrow) a us examination failed to visualize a pathology in 19 children (9%) (fig. 6; fig. 7). in 60 patients (29%), avulsion fracture of the lateral malleolus involving the atfl enthesis was found (fig. in 34 patients (17%), the atfl was found completely torn (fig. 9), i.e. the ligament itself was torn (not involving the enthesis). partial atfl injury was diagnosed in 51 patients (25%), and other injuries in 19% of cases (fig. the course of the ligament (arrows) and ligament attachment sites (arrowheads). marked fibrillar structure; stretched in a resting position avulsion injury of the anterior talofibular ligament at the fibular enthesis. bone entheses are marked with arrowheads ultrasound image of complete tear of the anterior talofibular ligament. swollen ligament stumps (arrows) bridged by thin scars the surgeries (19) conducted confirmed the us/x-ray diagnoses in 100% of cases (fig. ligament stumps (arrowheads) based on the data, it can be concluded that avulsion atfl injuries are usually found in younger children (median: 8 years of age) in whom the ligament entheses are partially chondral attachments. in most cases (over 60%), the result of an x-ray examination was normal no visible structural changes within the joint, which considerably contrasts with the number of normal ultrasound results (9%) (fig. 2 and 6). effusion in the ankle joint or thickened shadow of the soft tissues at the ankle level (fig. atfl injuries, both those of the ligament only and those involving the enthesis (avulsion fractures), accounted for 70% of cases. some patients with these injuries were scheduled for a surgery. it must be observed that in 36 patients, avulsion fracture was occult in x-ray, which accounts for 60% of patients with this injury. it merely enables one to make conclusions concerning soft tissue injuries based on the presence of joint effusion or soft tissue thickening. the sensitivity and specificity of both modalities (x-ray and us) can be compared only with respect to avulsion injuries when a separated bone fragment is visible in an x-ray picture. x-ray us sensitivity 40%100% x-ray examinations helped establish the correct diagnosis in 40% of cases with avulsion injury whereas this value reached 100% for a us examination. the specificity of both methods in detecting avulsion fractures is as follows: x-ray us specificity 100%100% all patients without avulsion fracture were diagnosed correctly, i.e. they obtained a negative result both in an x-ray and us examination. ultrasonography is a valuable method to assess avulsion fractures, tiny fractures due to compression injury as well as coexistent soft tissue injuries in the ankle joint. ultrasonography, as an inexpensive, easily available and noninvasive method, can be broadly used particularly in pediatric radiology, and its findings can significantly influence the therapeutic process. the final decision concerning the treatment is made by an orthopedists on the basis of the whole clinical picture, current patient condition and own experience. however, it is not used routinely to assess recent sprain injuries of the ankle joint in children because of its limited availability and long duration of scanning. ultrasonography can be useful in the initial assessment of whether patients need an mri examination. the literature reports demonstrate that us and mri are equally sensitive in detecting ligament injuries in the ankle joint. x-ray and us examinations are used for the assessment of sprain injuries of the ankle joint in children and should be used as complementary tests in the emergency department. a us examination of the ankle joint is characterized by greater sensitivity in assessing avulsion injuries. ultrasonography should be therefore considered the primary modality for the assessment of ligament injuries in the ankle joint since its findings can change the therapeutic process. authors do not report any financial or personal links with other persons and organizations, which might affect negatively the content of this publication and/or claim authorship rights to this publication.

introductionsprained ankle is a very common injury in children. proper treatment of ligament injuries enables full recovery. x-ray and us examinations are commonly available diagnostic methods. material and methodstwo hundred and six children (113 girls and 93 boys, mean age 10.6) with recent ankle joint sprain (up to 7 days of injury) were subject to a retrospective analysis. all patients underwent an x-ray and us examination of the ankle joint within 7 days of injury. in 19 patients, anterior talofibular ligament reconstruction was conducted. resultsx-ray failed to visualize a pathology in 129 children (63%); in 24 patients (12%), avulsion fracture of the lateral malleolus was found, and in 36 cases (17%), effusion in the talocrural joint was detected. ultrasonography failed to visualize a pathology in 19 children (9%); in 60 patients (29%), it showed avulsion fracture of the lateral malleolus involving the attachment of the anterior talofibular ligament (atfl); in 34 cases (17%), complete atfl tear was detected, and in 51 patients (25%), partial atfl injury was found. other injuries constituted 19%. the surgeries conducted to repair the anterior talofibular ligament (19) confirmed the us/x-ray diagnoses in 100% of cases. avulsion atfl injury, i.e. the one that involves the ligament attachment site, is usually found in younger children (median: 8 years of age). complete atfl tears (not involving the attachment site) concern older children (median: 14 years of age). conclusionssince x-ray is of limited value in diagnosing ankle joint pathologies in recent sprain injuries in children, soft tissue imaging, i.e. ultrasonography, is the basic examination to assess the ligament complex. avulsion fractures, which involve the atfl attachment site and are usually found in younger children, are a consequence of the incomplete ossification and require urgent diagnosis and orthopedic consultation.

PMC4657396

pubmed-1019

treatment of severe sepsis and septic shock remains a major challenge in the critically ill, and it is still one of the leading causes of death worldwide. despite increased awareness of the importance of early resuscitation, mortality in north america and europe ranges between 28 and 41%. based on a consensus agreement sepsis is defined as infection in the presence of systemic inflammatory response syndrome (sirs). however, the signs of sirs are nonspecific and can often be seen in several (none septic) critically ill conditions. fever, tachycardia, or leukocytosis on their own has low sensitivity and specificity [4, 5]. detailed microbiological results are often only available after 24 hours or later, and negative results do not necessarily rule out infection. nevertheless, early diagnosis of infection in critically ill patients is of utmost importance, and delay in starting appropriate antibiotic therapy may lead to lethal events. however, giving antibiotics unnecessarily to every acutely ill patient is an unacceptable practice for several reasons. therefore, fast reacting biomarkers of infection have been used for almost 50 years to help the clinician, of which c-reactive protein (crp) and procalcitonin (pct) are the most often used and studied. procalcitonin is a fast reacting biomarker with a half-life of around 24 hours. its sensitivity and specificity for bacterial infection seem to be superior compared to crp [10, 11]. however, it must be considered that the same absolute values of pct can not be used in all circumstances. it has been reported that pct levels are higher in surgical compared to medical patients, and elevated pct can also be present without infection, in conditions such as trauma and surgery or after cardiac arrest. there is some evidence that evaluating pct kinetics may be superior to absolute values [12, 16]. in this study, our aim was to investigate whether the absolute value of pct measured in critically ill patients on the day when infection was suspected, or the change in pct (delta-pct) from the day before to the day when infection was suspected, was a better indicator of infection. this prospective observational study was part of the early procalcitonin kinetics (eprok) study, which was undertaken between october 2012 and october 2013 and approved by the regional and institutional human medical biological research ethics committee, university of szeged, hungary (who-3005; 19.04.2012, chairperson professor t. wittmann). the investigation was performed at the university of szeged (szeged, hungary), albert szent-gyrgyi health center in four tertiary intensive care units. written informed consent was obtained from all subjects or from their relatives. in the eprok study all patients over 18 years with suspected infection on admission or during their stay on the intensive care unit were screened for eligibility. patients were enrolled, when the attending intensive care specialist suspected infection, based on (1) suspected source which could be identified, (2) new onset organ dysfunction, and (3) body temperature, pct, crp, and the decision to start empirical antibiotic therapy. once the original eprok study was completed, in a post hoc analysis those patients in whom pct and crp values were available from the previous day (t1) were included in the current analysis. exclusion criteria included patients younger than 18 years, who had received antibiotic therapy in the previous 48 hours, and those who received acute renal replacement therapy 24 hours before enrollment. patients were also excluded following cardiopulmonary resuscitation and with end stage diseases with a do not resuscitate order. immunocompromised patients (human immunodeficiency virus infection, bone marrow transplantation, malignant haematological disorders, and chemotherapy) were also excluded. diagnosis of infection was based on a post hoc analysis of mainly microbiological results but also clinical parameters and biochemical results which were evaluated by two experts (infectologist, eh, and an intensivist, fj) blinded for the pct data apart from the first pct measurement (t0, see below). the experts also took into consideration the recommendations of international guidelines [18, 19]. based on these results, patients were grouped into infection- (i-) and noninfection- (ni-) groups. for subgroup analysis the medical-group represented patients who had had no surgical intervention before and during the study period and for source control did not require surgery. in the surgical-group infection either was related to an operation or required surgery for source control. whenever infection was suspected by the attending physician, the signs of infection and the suspected source were recorded, which included high/low body temperature (< 36c;>38c), high/low white blood cell count (< 4,000;>12,000 million/ml), acute worsening of the clinical picture (hemodynamic instability, worsening pao2/fio2 ratio, and deterioration in mental status or any other clinical sign indicating infection). microbiological specimens were collected from all suspected sources immediately before the administration of the first dose of antibiotics (t0). after enrollment, demographic data, signs of infection, the suspected source of infection, and corresponding microbiological samples were registered. the length of intensive care unit and hospital stay, 28 days, and the overall mortality were also documented. it is common practice in our icu to measure pct daily in critically ill patients. procalcitonin levels were documented from the previous day of enrollment (t1) and immediately before the initiation of abs (t0). core temperature, c-reactive protein (crp), and white blood cell count (wbc) were also recorded with every pct measure. serum pct levels were measured with cobas 6000 analyzer (hitachi high-technologies corporation, tokyo, japan). analyzer reagents (elecsys brahms pct assay) were developed in collaboration with brahms corporation (hennigsdorf, germany) and roche diagnostics (mannheim, germany). procalcitonin was determined by electrochemiluminescence immunoassay (eclia) serum on the automated roche elecsys and cobas immunoassay analyzers. microbiological tests were performed and sent at t0, before the first antibiotic dose was administered and if needed they were repeated on the following days, to identify infection. data were analyzed using ibm spss statistics version 20 (armonk, ny, usa) and systat software inc. demographic data were analyzed between groups with student's t-test or nonparametric data with the mann-whitney u test as appropriate. biomarkers were analyzed by using two-way repeated measures analysis of variances (all pairwise multiple comparison procedures: holm-sidak method). logistic regression, receiver operating characteristic (roc) curve, and the respective areas under the curves (auc) were calculated for pct, crp, body temperature, and white blood cell count levels. the best cut-off values were determined using the youden index (j=max[sens+spec 1]). the test parameters (sensitivity, specificity, positive, and negative predictive values) were compared by their 95% confidence intervals. logistic regression analysis was used to determine the best combination of parameters and cut-offs for predicting infection. data are given as mean standard deviation or median (interquartile range) as appropriate. the delta was considered as the changes in the absolute values (subtracting t1 from t0); the percentage values were calculated as [(t0/t1) 100 100]. over the one-year study period all icu patients were screened for eligibility and 209 patients were recruited into the eprok study. out of the 209 patients in the current post hoc analysis demography and outcomes characteristics for the entire cohort are summarised in table 1. out of the 114 patients, 85 (75%) patients were identified as having proven infection and in 29 (25%) patients the presence of infection was highly unlikely. disease severity scores and outcomes were similar in the two groups, but the ni-group required less organ support. the clinical and laboratory signs of infection on which the clinicians suspected infection at the time of inclusion (t0) are summarised in table 2. although all indices were higher in the i-group, but only the altered level of consciousness, hemodynamic instability, and the pct was significantly different between the two groups. regarding the suspected source of infection, generally there was nonsignificant difference between the groups, but significantly more patients were suspected of having abdominal related infection in the ni-group. detailed data on the isolated pathogens and their sources are summarised in the supplemental digital content tables s57 (see supplementary material available online at http://dx.doi.org/10.1155/2016/3530752). measurement results at t1 and t0 in the i- and ni-groups are shown in figure 2. pct absolute values were similar at t1, but by t0 in the i-group levels were significantly higher compared to the ni-group and there was also a significant increase from t1, while there was no such change in the ni-group. there was no significant difference in crp and wbc count between the two groups nor could we find significant changes from t1 to t0. there was no difference between the groups for body temperature but there was a statistically significant increase in the ni-group by t0. measurement results in medical (n=80) and surgical (n=34) patients are summarised in table 3. in the surgical subgroup pct absolute values were significantly higher than in the medical cohort, but the pattern of change was similar. in the ni-group there was a slight, but statistically significant increase in medical patients from t1 to t0, while there was no significant change in surgical patients, where levels actually decreased slightly. however, in the i-group there was an almost 3-fold increase in the pct levels. regarding the crp, body temperature, and wbc count, there was no significant changes over time and no differences between medical and surgical patients. the predictive value for infection for the absolute values of pct, crp, temperature, and wbc count can be seen in figure 3 and is summarised in table 4. only pct had a significant predictive value, but with a poor auc (figure 3). however, regarding the percentage and delta changes crp, temperature and wbc counts diagnostic value did not change, while pct's auc for both percentage and delta changes had a significantly better performance for predicting infection. the best cut-off values were defined for pct only as there was no significant predictive value for the other parameters, as determined by the youden index. for the pct absolute value it was 0.84 ng/ml with a sensitivity of 61% (95% ci: 5072) and specificity 72% (5387) to indicate infection in the icu. regarding the percentage change a pct increase of>88% from t1 to t0 had a sensitivity of 75% (6584) and specificity of 79% (6092) and a pct delta change of>0.76 ng/ml had a sensitivity of 80% (7088) and specificity of 86% (6896) to indicate infection. data were also analyzed using the logistic regression model for finding the best combination of these four parameters together to predict infection in the icu. however, none of the combinations tested improved the performance for predicting infection (data not shown). the main finding of this observational study was an increase in pct levels from the day before (t1) to the day when infection was suspected (t0) predicted infection, while in patients with no proven infection pct remained unchanged. furthermore, regarding the conventional indicators of infection such as wbc, body temperature, and crp, neither the absolute values nor their change from t1 to t0 could predict infection. diagnosing infection in the critically ill is challenging. appropriate decision making has paramount importance as any delay in adequate antibiotic treatment of sepsis and septic shock evokes worsening morbidity and mortality results [6, 20]. on the other hand unnecessary antibiotic administration in patients without infection has led to the emergence of multidrug-resistant bacteria [21, 22], complications related to the side effects of the antibiotics themselves and an increased burden of healthcare expenses. despite its importance, there is no gold standard for diagnosing/proving infection in the critical care setting. in our study 75% of patients had proven infection. this complex post hoc analysis of all results is fundamentally different from labelling patients as septic, based solely on the surviving sepsis guideline criteria at the time of initial assessment as seen in several studies [24, 25]. although our method also has some uncertainties, it provides a more robust approach utilising all data, clinical, biochemical, and microbiology alike, to aid in the diagnosis of patients with bacterial infection. however, it is also important to acknowledge that there is no gold standard to diagnose infection; therefore despite all our efforts, some patients in the ni-group may have had culture negative infection. in our investigation it was found that conventional indicators of infection such as body temperature and white cell count had less value in diagnosing infection. levels of wbc count remained elevated on both days and there was no significant change over time. this phenomenon can be explained by the nonspecific activation of the immune cascade as often seen in icu patients. although there was a statistically significant increase in body temperature in the ni-group, levels largely remained below 38c in almost all patients. these results are in accordance with recent findings that increased temperature alone does not predict infection. although microbiology remains the gold standard for confirming pathogens, results only come back at least 2448 hours after sampling. furthermore, in several cases results remained negative, despite obvious signs of infection. in order to help the diagnostic process however, all biomarkers share the same limitations that one size will not fit all, due to the complex pathomechanism and the heterogeneity of patients. the two most commonly used markers in infection/sepsis diagnostics are pct and crp. procalcitonin is detectable in the serum a few (24) hours after the onset of bacterial infection. it reaches its peak within 24 hours and then starts to decline with adequate treatment by around a 50% daily decrease according to its half-life. it reaches its maximum value usually after 48 hours of an insult and in general it lags behind the actual events of the inflammatory and clinical process. furthermore, crp levels are generally elevated in most icu patients regardless of the aetiology. in our study neither the absolute values of crp nor its delta changes were able to indicate new onset infection. patients had elevated crp values with a median of almost 200 mmol/l for the whole cohort, which makes interpretation very difficult. therefore, our results question the place of crp measurements for diagnosing infection on the icu. the most important finding of the current study was to show the superiority of pct kinetics over the absolute values to indicate new onset infection in the icu. however, this requires at least daily measurements of pct, which has been common practice in our icu in critically ill patients in whom infection can not be excluded. they also measured pct daily and observed a twofold increase of pct levels from the day before to the day when there was a sudden onset of fever in patients with proven infection, but no change in pct was found in patients without infection. they concluded that, in patients treated chronically in the icu, pct values on the day of fever onset must be compared to values measured the previous day in order to define whether this rise in temperature was due to infection or not. an important difference between their and our study is that in our patients body temperature merely reached 38c; in fact most of these patients were apyrexial, despite 75% having proven infection. therefore, we recommend to evaluate pct kinetics not only in the onset of fever, but whenever infection is suspected on the icu. based on the current results, the best cut-off values were also determined for change in pct, which were>88% and>0.76 ng/ml delta change from t1 to t0. the reasons why a given absolute value of any biomarker, not just pct, may be of limited value as compared to its changes can be explained by the pathomechanism of systemic inflammation. it was a very important discovery that after trauma, burns, ischemia-reperfusion, pancreatitis, major surgery, and so forth, the same or similar molecules are released predominantly from the mitochondria, as after an infectious insult. based on aetiology these are called damage-associated molecular patterns (damp), or pathogen associated molecular patterns (pamp). once similar mediators/proteins are released they act on the same receptors of monocytes inflicting a similar inflammatory response, including pct release and subsequent organ dysfunction [28, 29]. indeed, pct levels were found to be severalfold higher in surgical compared to medical patients in septic shock despite the similar clinical manifestation and severity of the clinical picture. this explains why pct levels were elevated in our surgical patient population without proven infection, with median values of around 3.5 (ni-group) and 3.8 (i-group) ng/ml at t1. the corresponding pct values in medical patients were substantially lower (0.26 and 0.89 ng/ml, resp.). although levels were higher in the i-group at t1, this difference did not reach statistical significance while there was a severalfold increase in the i-group in both medical and surgical patients with no change in kinetics in the ni-groups. in two large recent multicenter trials the authors could not show any benefit from a pct-based approach in antibiotic management in the icu [30, 31]. however, in both studies the threshold for intervention was a pct of>1 ng/ml. as 40% of the patients in both trials were surgical, in whom this threshold for intervention may be too low, one can not exclude that these patients may have had received antibiotics unnecessarily. this overuse of antibiotics may be one of the reasons for the worse outcome in the pct-guided group in both studies. our study provides further evidence that changes or kinetics of pct may be superior to absolute values. firstly, one may argue that there was a selection bias; in other words, physicians suspected infection more often when they observed a pct increase in a patient. although this can not be excluded completely, at the time when the study was performed, pct collection was not the routine practice within the department, and delta-pct was not included among the criteria of inclusion either. the whole idea of retrieving pct data from the day before came after we analyzed the original eprok database. secondly, despite all our efforts of allocating patients into the i- and ni-groups, this took place in a post hoc fashion. the available clinical results were analyzed in a blinded manner for delta-pct (apart from pct values at t0) and thoroughly by our experts; however, one can not exclude the possibility of inappropriate judgment during the decision making. the lack of gold standard for diagnosing infection is aggravated by this obscurity when configuring groups. furthermore, the sample size was generally small, especially to be able to draw firm conclusions regarding the medical, surgical subgroups, although the trend in our results was certainly promising. finally, it remains uncertain why pct values were measured on the previous day before starting empiric antibiotic therapy in more than 50% of the 209 patients of the eprok study. the median day of inclusion into the study from icu admission was 1 day, indicating that 50% of patients had pct measurements on the ward/accident and emergency unit, before admission. the main finding of this observational study was that an increase in pct levels from the day before (t1) to the day when infection was suspected (t0) predicted infection, while in patients with no proven infection pct remained unchanged. based on the data presented a single pct measurement may not be adequate to differentiate between an infectious and noninfectious inflammatory response. this means that the kinetics of procalcitonin values based on daily measurements are superior to absolute values in diagnosing infection on the icu and absolute values of procalcitonin may be of limited use. both absolute values and kinetics of c-reactive protein are poor indicators of infection; furthermore, conventional indicators of infection such as white cell count and body temperature have limited use for predicting infection in the icu. the clinical implication of these results is that daily pct measurements in patients at high risk of infection allow the opportunity to evaluate pct kinetics, which may improve diagnostic accuracy and rationalise antibiotic therapy on the icu and improve outcome.

purpose. to investigate whether absolute value of procalcitonin (pct) or the change (delta-pct) is better indicator of infection in intensive care patients. materials and methods. post hoc analysis of a prospective observational study. patients with suspected new-onset infection were included in whom pct, c-reactive protein (crp), temperature, and leukocyte (wbc) values were measured on inclusion (t0) and data were also available from the previous day (t1). based on clinical and microbiological data, patients were grouped post hoc into infection- (i-) and noninfection- (ni-) groups. results. of the 114 patients, 85 (75%) had proven infection. pct levels were similar at t1: i-group (median [interquartile range ]): 1.04 [0.403.57] versus ni-group: 0.53 [0.161.68], p=0.444. by t0 pct levels were significantly higher in the i-group: 4.62 [1.9112.62] versus 1.12 [0.301.66], p=0.018. the area under the curve to predict infection for absolute values of pct was 0.64 [95% ci=0.520.76], p=0.022; for percentage change: 0.77 [0.660.87], p<0.001; and for delta-pct: 0.85 [0.780.92], p<0.001. the optimal cut-off value for delta-pct to indicate infection was 0.76 ng/ml (sensitivity 80 [7088]%, specificity 86 [68-96]%). neither absolute values nor changes in crp, temperature, or wbc could predict infection. conclusions. our results suggest that delta-pct values are superior to absolute values in indicating infection in intensive care patients. this trial is registered with clinicaltrials.gov identifier: nct02311816.

PMC5002471

pubmed-1020

short-term atmospheric blocking over greenland contributes to melt episodesassociated temperature anomalies are equally important for the meltduration and strength of blocking events contribute to surface melt intensity short-term atmospheric blocking over greenland contributes to melt episodes associated temperature anomalies are equally important for the melt duration and strength of blocking events contribute to surface melt intensity recently, a data record of the clear-sky ice surface temperature (ist) of the greenland ice sheet (gis) was developed using moderate resolution imaging spectroradiometer (modis) data from the terra and aqua satellites [hall et al., the record extends from march 2000 through the present, providing daily and monthly average ist, and melt maps at 6.25 6.25 km resolution. based on this modis ist record, years experiencing major melt (defined as melt covering 80% or more of the ice sheet surface) have occurred twice since 2000 [hall et al., the most unusual melt event occurred on 1112 july 2012 and was unprecedented during this and the previous century, covering 99% of the ice sheet surface including areas>3000 m at summit station (figure 1a) according to data from multiple satellite sensors [nghiem et al., 2012]. melt this extensive had not occurred since 1889 (+ /1 year) according to ice core records [nghiem et al., 2012; clausen et al., another large melt event occurred on 29 july 2012, where 79% of the surface experienced some melt according to data from multiple satellite sensors [nghiem et al., the cumulative melt during the 2002 melt season covered>87% of the ice sheet surface according to modis ist clear-sky data [hall et al., extent of melt on the greenland ice sheet for (a) 1 january to 31 december 2012 (days 1366) and (b) 1 january to 30 august 2013 (days 1243) as determined from modis-derived melt maps. a maximum of 95% of the ice sheet surface (shaded red) experienced some melt in 2012 and only 49% of the ice sheet surface experienced some melt in 2013. white represents no melting (according to modis), and green represent non-ice covered land areas. elevation contours are shown at 1500, 2000, 2500, and 3000 m. the negative phase of the north atlantic oscillation (nao), with a high-pressure anomaly over the gis, has previously been implicated [mote, 1998] in enhancing melting of the surface of the gis. also, the 2012 melt event was associated with a high-pressure ridge over the gis [nghiem et al., 2012; tedesco et al., 2013; hanna et al., a high-pressure ridge brings relatively warm southerly winds over the western flank of the ice sheet causing widespread surface melting [nghiem et al., a high-pressure ridge also represents atmospheric blocking, which is a long-lived (5 days or longer) atmospheric circulation system with strong meridional flows embedded within the latitude belt of westerlies [tibaldi and molteni, 1990; tibaldi et al., 1997] (definition also shown in the supporting information). blocking in the north atlantic sector is usually associated with the negative phase of the nao, and known as a greenland blocking episode (gbe) [fang, 2004; woollings et al., gbes have a continuum of behavior, from being relatively frequent but weak events, to longer and stronger events that better conform to the conventional interpretation (and definition) of midlatitude blocking. here we are also interested in shorter than 5 day blocking activity, because we anticipate that even a 2 day burst of warm subtropical air over the gis could lead to melting. these short events are called local and instantaneous blocking (lib), if on any day a longitude is blocked based on the reversal of the gradient in the 500 hpa geopotential height field [tibaldi and molteni, 1990; tyrlis and hoskins, 2008]. some of the libs belong to gbes if they are spatially stationary for 5 days or more. we focus here on daily variability of melt and atmospheric conditions instead of seasonal variability. both libs and gbes are accompanied by warm air temperatures and we will show that are both capable of initiating ice sheet melt. we will also show that daily air temperature at about 5 km height, about 2 km above the ice sheet, varies in-phase with modis ist in june and july, the months most likely to have intense melt events. finally, we will discuss the relationship between gis melt and blocking and associated temperature variability. we use the modis clear-sky ist data record (20002013) to calculate gis melt. for the retrieval of modis clear-sky ist, a split-window technique is used, where split-window refers to the brightness-temperature difference in the 1112 m atmospheric window. the technique was first used to determine ist in the arctic with advanced very high resolution radiometer (avhrr) data on noaa polar-orbiting satellites [key and haefliger, 1992] and later adapted for use with modis. using modis ist we quantify number of melt days and areal extent of melt for each year of the study (figure 1). melt cloud cover is determined from the standard modis cloud mask of ackerman et al.. to partly compensate for the effects of cloud cover, for this work we employ a cloud-gap filling algorithm (see supporting information) to minimize the impact of cloud cover. as in previous work [hall et al., 2012, 2013], we also classify an ist grid cell as melt if the surface temperature is 1c. this temperature has been found to be representative of melting conditions over the gis, in consideration of modis ist measurement uncertainty of+/1c at the high (near 0c) values of ist over ice [hall et al., we utilize the national centers for environmental prediction/national center for atmospheric research (ncep/ncar) reanalysis data [kalnay et al., 1996] to analyze daily average 500 hpa geopotential height (z500) and temperature (t500), and daily average air temperature at 2 m (t2 m), all of which are derived from 6-hourly data. the reanalysis data resolution is 2.5 2.5. to compute area-average temperatures, t500 and t2 m were interpolated to the modis ist grid of 6.25 km and constrained by the modis ice sheet mask. blocking is computed by searching reversals of the gradient in the daily (average) 500 hpa geopotential height at each grid longitude and latitude in a region 20w60w, 50n85n instead of over fixed latitudes [tibaldi and molteni, 1990] (supporting information). the maximum area that experienced at least 1 day of melt during the melt period in 2012 and 2013 is shown in figures 1a and 1b, as determined from the modis ist product. the contrast in the extent of melt between 2012 and 2013 is striking, with modis-derived melt covering 95% of the ice sheet surface in 2012 and 49% in 2013. (by combining modis with microwave sensors that can detect melt through cloud cover, the 2012 melt extent actually covered 99% of the ice sheet surface [nghiem et al., 2012] as discussed previously.) using available atmospheric ncep/ncar reanalysis fields, we can illuminate the differences in the synoptic regime between these two consecutive years and illustrate the relationship between atmospheric patterns and melt over the entire 20002013 melt season modis ist record on the daily time scale. the modis-derived daily melt area is shown in figure 2 for june and july. modis melt data are not plotted if the gap-filled cloudiness is>11% of the ice sheet area. (this cutoff of 11% was determined by visual scanning of the cloudiness data and thus appeared to be a logical cutoff value. though it is a subjective choice, the results do not change significantly if we select a cutoff number between 10 and 15%.) daily percent melt fractions do not reach as high as quoted above for the cumulative area of melt because the melt location varies day-to-day. the 14 year june-july mean daily melt percentage is 13% and the standard deviation (sd) is 8% (based on 834 daily values excluding modis data gaps). the maximum 1 day percent melt of 71% (clear-sky) occurred on 13 july 2012. the only other days with melt percentage over 40% occurred on 29 june 2002 (46%), and 1112 july (49% and 62%), and 1416 july (63%, 54%, and 41%) 2012. low melt years in the modis record are the following: 2000 (potentially 2001; based on atmospheric temperatures, shown later), 2003, 2008, 2010, and 2013. in each of the low melt years, the average june-july melt fraction was less than or equal to the 14 year june-july mean. the low melt years 2000 (2001), 2003, 2008, and 2010 occurred during a negative or neutral nao phase (table 1 and the nao index in figure s1 in the supporting information), which should have favored increased melt. the low melt in 2013, however, was associated with a positive nao index as expected. wrong sign is the extensive melt year 2002, which was dominated by a positive phase of the nao (table 1). thus, the gis melt-nao relationship is not consistent during the modis years, and when using daily nao index data, the nao index explains only 15% of the gis melt variance. total melt area percentage over the area of the greenland ice sheet (y axis, %) for june and july for each year, 20002013, derived from daily modis ist data. nao index versus the total gis melt percentage from modisa modis data updated from hall et al.; nao index from noaa/climate prediction center. minimal melt years are in italics. to identify the atmospheric pattern associated with the intense melt events in the modis record on a daily time scale, we analyzed daily june-july z500 and t500 fields for 20002013. we composited these fields based on the daily anomaly in the modis melting fraction as an index time series. the daily modis melt anomalies were derived, and the modis melt index was formed, by normalizing the anomaly time series by its sd: we selected z500 and t500 fields from the days when the melt index exceeded 1 sd (in absolute terms). this approach groups the selected z500 and t500 fields to positive melt index anomaly days (120 fields) and negative melt index anomaly days (113 fields). the composited fields show that the large melt events are associated with a meander in the z500 field resembling an omega-block (pattern, see figures 3a and 3b) over greenland, with lows flanking the high-pressure domain. minimal melt anomalies are associated with a more-or-less zonal flow over the ice sheet (figures 3c and 3d). the warmest intrusion of the subtropical air masses envelopes both western and eastern flanks of the gis south of about 75n. however, the influence of blocking on temperatures extends far outside this core region as a subtropical regime has moved northward pushing cold air masses far into the arctic. the 20002013 composite of 500 hpa (a, c, and e) geopotential heights (meters) and (b, d, and f) temperatures (c) when the modis melt (shown in figure 2) anomaly is stronger than+1 standard deviation (figures 3a and 3b), and less than 1 standard deviation (figures 3c and 3d). 3a and 3c, z500=5600 m is drawn as a white contour; also, in figure 3a, maximum z500=5647 m is marked. while it is obvious that the composited patterns corresponding to high and low melt events are significantly different, we show also the difference fields of z500 and t500 with cross hatching for areas significant at the 99% level (figures 3e and 3f). the z500 difference field has a strong positive anomaly over greenland but lacks a strong negative height field anomaly at the midlatitudes across the north atlantic, typical of the negative nao [barnston and livezey, 1987]. this is consistent with a weak relationship between modis melt area variations and the nao index. comparing the blocked flow with the zonal flow (figures 3c and 3d), the upper air temperature anomaly over greenland reaches almost 10c during these subtropical air mass intrusions. another approach to show the impact of the subtropical intrusions is to analyze the daily area-average modis ist, t2 m, and t500 variability. we created an anomaly time series for each of these quantities and then normalized them by their sd (anomaly and sd with respect to 20002013 june-july average, sd based on all days in each time series) giving sds of 2.5c, 2.1c, and 2.9c for ist, t2 m, and t500, respectively. the normalized area-average modis ist, t2 m, and t500 are displayed in figure 4 for june-july of each year. the daily temperature variations from the ice sheet surface to the upper atmosphere, about 2 km higher than summit station, vary in-phase and in most years with similar normalized amplitude. previously, box and cohen showed this relationship between surface and tropospheric temperatures on seasonal and annual time scales from the coastal radiosonde measurements. (in their data, the relationship was not as strong in the stations on the eastern side of greenland.) the tight coupling between the surface and upper atmosphere shows that during the period of high insolation, the only preconditioning necessary for melt is an intrusion of subtropical air. here we note that this relationship is the strongest for june-july; adding august to the time series does not affect the timing of the variations but changes slightly the relationship between surface and upper air temperatures by increasing the differences in amplitudes (not shown). area-average modis ist (black), t2 m (pale blue), and t500 (pink) temperature anomalies and modis melt anomaly (in orange) (referenced to 14 year june-july averages), which are then normalized by their individual standard deviation (y axis measures sds). during 2012 summer normalized melt anomaly reached 7 standard deviations (beyond the y axis upper limit). blocking days (green bars) and all days when the 500 hpa geopotential height gradient is reversed (blocking+wave breaking events, blue bars) are shown for june the blocking and wave breaking events do not always start and end at the same day, because not all gradient reversals occurred at the same locations on the ice sheet (and lasting 5 days). in figure 4 we have also identified days of libs (there is at least one longitude that is blocked at least 1 day), of which some belong to gbes, if the condition of z500 gradient reversal existed at least in one grid point for 5 days or more. considering first the temperature anomalies above 1.5 sds, these warm events occur when they overlap with libs and/or gbes with the spatial pattern depicted in figures 3a and 3b. there are two exceptions: on 1618 july 2004 and 1315 june 2011, with gis melt reaching 2831% (2 sds above 14 year june-july mean of 13%; sd=8%). in both cases the z500 gradient reversal occurred but the westerlies north of the blocking high were too weak to classify them as libs by our definition; however, the circulation associated with their z500 pattern favored bringing subtropical air masses over greenland (figure s2). in the case of weaker warming events with 11.5 sds, the warming-blocking relationship also holds with three exceptions23 july 2003, 78 july 2011, and 1315 july 2011. during these three events, the gis melt percentage either did not reach above 1 sd (15% in 2003) or did so marginally (22% in 2011). these three marginal warming/melting events are not classifiable by our blocking definition because they had complex patterns, involving a cutoff low with or without a ridge over the gis (figure s3). only a few libs/gbes occurring in the first half of june will result in a large melt event. if melt occurs, the temperature anomaly, whether surface or upper air, has to be about 1.5 sds above the summer average (e.g., in 2002, 2005, and 2012). furthermore, we can estimate that area-average temperature anomalies of almost 2 sds above the summer average are needed to reach a melt fraction over 40% as happened in 2002 and 2012 (figures 2 and 4). once temperature anomalies reach 2 sds (56c), the melt amplifies almost exponentially (figure s4). even if the blocking activity does not lead to a melt event figure 4 shows that june-july 2007 had the most blocking days but did not have the largest melt, although 2007 has been identified as a large melt year in a seasonal sense [mote, 2007; tedesco, 2007]. the melt was largely confined to the southern part of the ice sheet, but figure 4 also shows that the 2007 area-average temperature anomalies barely reached 1.5 sds (only once in the end of june). if compared especially to 2012 with a long-lasting anomaly of 22.5 sds at the peak melt 1015 july, the potential of 2007 to be an extreme melt year evaporated due to the weak temperature anomalies in the subtropical air masses. we conclude that the total number of days with blocking over greenland does not necessarily correlate with the most melt area, but the associated temperature anomalies are equally, if not more, important. previously studies have shown that blocking can be associated with increased greenland ice sheet melt on seasonal time scales [e.g., fettweis et al., 2013], and here we show, using modis and atmospheric reanalysis (ncep/ncar) data, that the relationship holds also on a daily time scale. our analysis of all 14 melt seasons (20002013) shows that blocking that occurs in a range of time scales, from short-term blocking activity (< 5 days) (libs) to full-fledged gbes (blocking for 5 days or longer), can bring warm subtropical air masses over the gis to instigate melt. despite the overall close relationship between gbes/libs and ice sheet melt, not all blocking activity leads to melt as exemplified in the summer 2007 which had the most june-july blocking days during the period 20002013. in addition, the surface and upper air temperature anomalies, computed here from area-average temperatures, play an important role during the largest melt years such that temperature anomalies have to reach almost 2 standard deviations to result in a melt area above 40% as happened in 2002 and 2012. in the case of summer 2007, the temperature anomalies barely reached 1.5 standard deviations; hence, the summer 2007 melt did not achieve extreme melt status.

daily june-july melt fraction variations over the greenland ice sheet (gis) derived from the moderate resolution imaging spectroradiometer (modis) (20002013) are associated with atmospheric blocking forming an omega-shape ridge over the gis at 500 hpa height. blocking activity with a range of time scales, from synoptic waves breaking poleward (< 5 days) to full-fledged blocks (5 days), brings warm subtropical air masses over the gis controlling daily surface temperatures and melt. the temperature anomaly of these subtropical air mass intrusions is also important for melting. based on the years with the greatest melt (2002 and 2012) during the modis era, the area-average temperature anomaly of 2 standard deviations above the 14 year june-july mean results in a melt fraction of 40% or more. though the summer of 2007 had the most blocking days, atmospheric temperature anomalies were too small to instigate extreme melting.key pointsshort-term atmospheric blocking over greenland contributes to melt episodesassociated temperature anomalies are equally important for the meltduration and strength of blocking events contribute to surface melt intensity

PMC4373136

pubmed-1021

derangements of the condyle-disc complex arise from a breakdown of the normal rotational movement of the disc on the condyle. the thinning of the posterior border of the disc can cause the disc to be displaced in a more posterior position. with the condyle resting on a more posterior portion of the disc or retrodiscal tissues, an abnormal translatory shift of the condyle over the posterior border of the disc can occur during the opening. a click is associated with the abnormal condyle-disc movement and may be initially felt just during opening (single click) but later may be felt during opening and closing of the mouth (reciprocal clicking).1 molinari et al.2 reported that occasionally a second clicking sound is heard during mouth closure (reciprocal click), because the posterior band of the disc slips forward off the condyle. other clicking sounds can also be produced by irregularities or defects in the surface of the disc or by changes in the convexity of the condylar and/or articular eminence. they are also found at the same point of the temporomandubular joint (tmj) traslator movement rather than at different points, as occurs with reciprocal clicking. clicking and crepitation should be considered signs of morphological alterations, being indicative of anterior disk displacement with reduction3 and arthrosis, respectively. electrovibratographic records and macroscopic examinations of articulations of corpses showed that 20% of the tmjs with clicking had the disk displaced anteriorly and 22% of the tmjs with crepitation had arthrosis or disk perforation.4 later recapture of the disk causes clicking at the end of mouth opening and indicates that the bilaminar zone is more affected.5 the microscopic aspects of the disk surface can also be altered.6 qualitative and semi-quantitative methods have been developed for tmj sound classification, but the criteria presented are completely inhomogeneous.7-12 thus, to develop more objective criteria for defining tmj sounds, electroacoustical systems have been developed.7-9, 11-15 we used joint vibration analysis (jva) in the biopak system (bioresearch inc., milwaukee, usa) as the electrovibratography, and jaw tracker (jt)-3 device in the biopak system (bioresearch inc., milwaukee, usa). using jt-3 deivce allowed the computer to estimate where a joint vibration occurs in the open/close cycle and let us distinguish tooth contact from joint sound precisely. ishigaki et al.17 reported a disc displacement with reduction generates a " click " in the lower frequencies (under 300 hz) and a degenerative condition generates " crepitus " in the higher frequencies (over 300 hz). in the previous study, we found that in an integral>300 hz /<300 hz ratio it is conceivable that the higher the integral>300 hz /<300 hz ratio number, a more advanced degenerative condition exists. gallo et al.16 reported that tmj clicking was subjectively and objectively stable over a period or 10 days. we found few studies about long term follow-up based on the frequency spectrum patterns associated with the integral>300 hz /<300 hz ratio. the aim of this study was to examine the tmj sounds with repect to frequency spectra patterns and the integral>300 hz /<300 hz ratios via six-months follow-up. twenty dental school students (18 males and 2 females: age range 25-34 years old; mean age=22.4 years old) participated in the before (control group) and after (experimental group) the six-months joint sound recordings. group i (8 males and 2 females) was composed of the subjects that showed anterior disk displacement with reduction. they were selected by means of clinical examinations. as inclusion criteria, all subjects had clicking in both tmjs upon mouth opening and/or closing and a normal range of jaw movement during opening and/or pain at palpation (any of the masseter, temporalis, pterygoid, digastric muscles) and jaw movement during chewing. group ii (10 males) was composed of subjects that showed a normal state of tmj. they showed absence of tmj noises, pain at palpation (any of the masseter, temporalis, pterygoid, digastric muscles) and jaw movement or chewing. in each subject, a magnet was attached to the labial surface of mandibular incisors of the subjects in order to bring the midline of the magnet to the labial frenum and to locate the groove of the magnet to the left side of the subjects. if the subject tended to have a deep bite so that it is impossible to attach the magnet, it was attached to the labial gingival surface or lingual tooth surface. one transducer was placed on the skin over the right tmj, and the other over the left tmj. once the horizontal and vertical standard points were set, we controlled them to fit with the subjects'heads. the bar of the front side was kept parallel to the interauditory axis and the lateral side to the frankfort horizontal plane. the accessory bar for approaching the magnet was fixed temporally and operated in order to set the exact midline. as the subject performed metronome-guided maximun active opening/closing with the jva, the condyles rubbed against the various surfaces in the joint, creating characteristic vibrations which are then, in turn, detected by the accelerometers, which convert those specific vibrations into an electronic signal. the signal from the accelerometers is amplified by a small, light-weight amplifier which is placed around the patient's neck. the amplified signals are then transmitted to a pc computer where they are recorded and analyzed with a software program, then displayed on a crt. after the best recording was selected from three, vibrations showing the highest amplitude were screened priorly. when we excluded tooth contact precisely, reproducible joint sound was analyzed for each opening&closing cycle. after subject selection, the largest vibration amplitude consistently occurring in each joint recording was used to calculate frequency spectrum computed by the fast fourier transform (fft) algorithm. the numeric values that are calculated and displayed in the jva summary view are based on the absolute frequency spectra. the frequency spectra view plots amplitude (vertical axis) versus frequency (horizontal axis). the height of the curve is directly proportional to the energy of the spectrum at each frequency. two spectra are plotted for each side: the smaller of the two represents the absolute magnitude of the vibrations'spectra as recorded (n/m), the larger one has been scaled to the maximum range (at the recorded amplification) and is known as the relative plot. the relative plot accentuates features that may not be visible in the absolute plot (fig. the integral>300 /<300 ratios in group i and group ii listed in table i and ii show variations before and after the six-months recordings respectively. in group ii, 17-20 showed integral>300 /<300 ratios disappeared six-months later. the integral>300 /<300 ratios and the frequency spectra were analyzed in all subjects. the frequency spectra in some subjects showed similar patterns while the others showed varied patterns. by the comparative study between the integral>300 /<300 ratios and the frequency spectrums, it was conceivable that the frequency spectrums showed similar patterns at the same location that the joint sound occurred between before and after the six-months recordings. while the frequency spectra showed varied patterns at the different location that the joint sound occurred in before and after the six-months recordings (fig. 2, 3). disc displacement is characterized by a normal range of jaw movement during opening and eccentric movements. when reciprocal clicking is present, the two clicks normally occur at different degrees of mouth opening, with the closing click usually occuring near the intercuspal position.1 although physiological changes occur in the disc, its ability to remodel is lower than that of other tissues of the tmj, such as the capsule, capsular ligaments, and retrodiscal tissues. decreased vascularity and extensive fibrous transformation have been reported in the retrodiscal tissue for continuous compression and shear. these adaptative changes can also have mechanical implications on the behavior of the articular disc. however, as long as the system preserves the ability to adapt to the new functional status, the altered mechanical loading is compensated for by the structural modeling of the tmj. although the coordination of the disc-condyle complex may be lost in this stage, the patient is usually asymptomatic.2 garcia et al.19 reported that some patients present alterations in the structure of the arcitular disk located in several areas. small vibrations in the position of the condyle may induce unstable areas with production of articular vibrations. the frequencies (in hertz), as well as the amplitude of the vibration can be expressed mathematically. the precise moment of the sound generated in the opening and closing cycles. in this study group i and group ii showed varied integral>300 /<300 ratios before and the after six-months recordings. also, by the comparative study between the integral>300 /<300 ratios and the frequency spectrums, it was conceivable that the frequency spectrums showed similar patterns at the same location that the joint sound occurred before and after the six-months recordings. while the frequency spectrums showed varied patterns at the different locations that the joint sound occurred before and after the six-months recordings, it would possibly be due to the differences in the degree of internal derangement and/or in the shape of the disc. it is suggested that clinicians consider the integral>300 /<300 ratios as well as the frequency spectrums to decide the starting-point of the treatment for tmj sounds. therefore jva will provide the clinician with the visible patterns of tmj sounds for patient management.

statement of problemqualitative and semi-quantitative methods have been developed for tmj sound classification, but the criteria presented are completely inhomogeneous. thus, to develop more objective criteria for defining tmj sounds, electroacoustical systems have been developed. we used joint vibration analysis in the biopak system (bioresearch inc., milwaukee, usa) as the electrovibratography.purposethe aim of this study was to examine the tmj sounds with repect to frequency spectra patterns and the integral>300 hz /<300 hz ratios via six-months follow-up. material and methodsthis study was done before and after the six-months recordings with 20 dental school students showed anterior disk displacement with reduction. joint vibrations were analyzed using a mathematical technique known as the fast fourier transform. resultsin this study group i and group ii showed varied integral>300 /<300 ratios before and after the six-months recordings. also, by the comparative study between the integral>300 /<300 ratios and the frequency spectrums, it was conceivable that the frequency spectrums showed similar patterns at the same location that the joint sound occurred before and after the six-months recordings. while the frequency spectrums showed varied patterns at the different locations that the joint sound occurred before and after six-month recordings, it would possibly be due to the differences in the degree of internal derangement and/or in the shape of the disc. conclusionsit is suggested that clinicians consider the integral>300 /<300 ratios as well as the frequency spectrums to decide the starting-point of the treatment for tmj sounds.

PMC2994670

pubmed-1022

diabetes mellitus is associated with aggressive vascular abnormalities in human subjects, and atherosclerosis is regarded as the leading cause of morbidity and mortality in diabetic patients. microalbuminuria has a strong prediction of both the development of diabetic nephropathy and subsequent atherosclerotic vascular dysfunction [2, 3]. the previous epidemiologic study has proved the predictive value of microalbuminuria for atherosclerotic vascular disease in the patients of type 2 diabetes. several biochemical parameters including soluble vascular cell adhesion molecule1, sialic acid, c-reactive protein, and fibrinogen have been proved to be significantly associated with microalbuminuria [57]. and these findings may support a hypothesis that microalbuminuria reflects generalized vascular damage which may promote atherosclerosis [8, 9]. high-frequency b-mode ultrasonography is a noninvasive method of detecting carotid artery wall and provides measurement of intima-media thickness (imt) and presence of plaques [10, 11]. the increased imt can predict future events of silent brain infarction and coronary heart disease in the patients of type 2 diabetes mellitus [13, 14]. but the previous reports showed the inconsistent associations among imt, plaque, risk factors, and clinical disease [1518]. and which one is a more powerful predictor of vascular outcomes, imt or plaque, is still in controversy [18, 19]. in addition, the reported results of the relationship between microalbuminuria and carotid imt is also different [20, 21]. therefore, in this study we sought to clarify the relationship between microalbuminuria and markers of carotid atherosclerosis including imt and plaque in type 2 diabetic patients. the study included 250 patients of type 2 diabetes mellitus at the department of endocrinology of the second affiliated hospital of dalian medical university. the ethics committee of the second affiliated hospital of dalian medical university approved the study. all patients gave their informed consent to participate in the study. according to the level of urinary albumin excretion rate (uaer), 250 patients of type 2 diabetes mellitus were divided into two groups: normoalbuminuria group (uaer<30 mg/24 h; 130 cases, 66 males and 64 females; mean age, 56.45 9.35 years; age range, 2976 years; diabetes duration, 7.57 5.53 years; treatment with diet or oral drugs) and microalbuminuria group (30 mg/24 h<uaer<300 mg/24 h; 120 cases, 62 males and 58 females; mean age, 57.67 11.12 years; age range, 4180 years; diabetes duration, 8.00 5.12 years; treatment with diet or oral drugs). medical history was obtained and physical examination was performed in all patients. type 1 diabetes mellitus, hypertension, history of ischemic heart disease, renal impairment (serum creatinine >150 the clinical conditions that could cause transient elevations in urinary albumin excretion, such as exercise, urinary tract infection, febrile illness, were also excluded. carotid artery ultrasonography was performed by an experienced specialist physician who was specifically trained for the vascular ultrasonography. a real-time ultrasound scanner was used: hitachi eub 7500 with a linear 315 mhz probe (hitachi medical systems, tokyo, japan). the patients were examined in the supine position with the head turned 45 contralateral to the side of scanning. imt was defined as the distance between the lumen-intima and the media-adventitia ultrasound interfaces. the imt on the far wall of the bilateral common carotid artery about 10 mm proximal to the bifurcation of the carotid artery was measured manually as previously described [22, 23]. three measurements on both sides were performed for each patient and the mean value was obtained for analysis. a high degree of reproducibility (a mean difference in cimt: 0.020 mm) was shown in paired cimt measurements in the same arteries. the presence of plaque was defined as an area of focal wall thickening>50% greater than surrounding wall thickness confirmed by marking and comparing plaque thickness with the thickness of the surrounding wall during scanning by electronic calipers. furthermore, the plaques were classified into three types: calcified plaques (hyperechogenic), dense plaques (less hyperechogenic than calcified lesions), and soft plaques (isoechogenic in comparison with blood), based on their echogenic properties according to the criteria established by johnson et al.. the following laboratory parameters were obtained: total cholesterol (tc), triglyceride (tg), low density lipoprotein (ldl), high density lipoprotein (hdl), hemoglobin a1c (hba1c), fasting plasma glucose (fbg), and urinary albumin excretion rate (uaer). serum concentrations of tc, tg, ldl, hdl, and fbg were measured by enzymatic method. hba1c was measured by high performance liquid chromatography (bro-rad company, usa). body mass index (bmi) was calculated as weight in kilograms divided by height in meter squared. pearson's chi-square () test was used to compare groups regarding categorical variables. correlation analysis including pearson's for continuous and spearman's for discrete variables and multiple linear stepwise regression analysis was used to show the influences of variables on imt. patients of the microalbuminuria group with elevated uaer had higher fbg, bmi, waist and hip circumference, triglycerides, hba1c, and imt than those of the normoalbuminuria group with normal uaer (p<0.05 for all; table 1, figure 1). the plaque incidence rate and plaque type rate (soft, dense, and calcified plaques) between two groups were shown in table 2. there were no significant difference in plaque incidence rate and plaque type rate between normoalbuminuria and microalbuminuria groups (p<0.05 for all). in both normoalbuminuria and microalbuminuria groups, and the rate of soft plaque was higher than that of dense and calcified plaques. in detail, in normoalbuminuria groups, soft plaques rate (66.67)>dense plaques rate (25)>calcified plaques rate (8.33), and in microalbuminuria group, soft plaques rate (68.42)>dense plaques rate (24.21)>calcified plaques rate (7.37) (table 2). in univariate analysis, imt was positively and significantly associated with age (r=0.265, p<0.05), waist circumference (r=0.263, p<0.05), body mass index (r=0.285, p<0.05), systolic blood pressure (r=0.276, p<0.05), uaer (r=0.359, p<0.05), hba1c (r=0.462, p<0.05), and duration of diabetes (r=0.370, p<0.05). in multiple stepwise regression analyses, age, body mass index, systolic and diastolic blood pressure, waist and hip circumference, uaer, fbg, plasma hba1c concentration, serum concentrations of triglycerides and total, hdl and ldl cholesterol, current smoking, and duration of diabetes mellitus were included in the model as independent variables. uaer and hba1c were appeared to be significantly associated with imt (p<0.05 for all) (table 3). in the present study, we found that the values of imt of type 2 diabetic patients with microalbuminuria was significantly higher than those without microalbuminuria. the results indicated that microalbuminuria was related to atherosclerosis in the early stage of diabetic nephropathy. but the mechanism underlying the relationship between microalbuminuria and atherosclerosis in type 2 diabetic patients is still unknown. results showed that microalbuminuria was found to be associated with carotid atherosclerosis in middle aged individuals. but the subjects enrolled in this study were not only limited to the diabetic patients. there was a hypothesis that increased uaer could reflect a generalized vascular dysfunction which was caused by structural alterations, such as a reduction in the density of heparan sulfate-proteoglycan (hs-pg) and/or the sulphation of hs within the extracellular matrix of the glomerular basement membrane and vascular wall [8, 9]. it is a normal component of glomerular basement membrane, endothelial vascular surface, and basement membrane of vascular smooth muscle cells. furthermore, many proteins, such as lipoprotein lipase, tissue factor pathway inhibitor, platelet factor 4, and antithrombin iii, are anchored to the vascular wall through interaction with the chains of hs-pg, which may enhance albuminuria and processes involved in atherogenesis [9, 2628]. stehouwer et al. found that microalbuminuria was linearly associated with impaired endothelium-dependent, flow-mediated vasodilation in elderly individuals without and with diabetes. it is possible that endothelial leakiness, as reflected by uae, is in part a primary and possibly genetically determined vascular risk factor, or that it mirrors the endothelial dysfunction featuring the atherosclerotic process or arises from the action of yet unknown risk factors. also, the previous study results showed that endothelial dysfunction assessed by brachial artery flow-mediated dilation (fmd) was associated with urinary albumin excretion (uae) and was interrelated with carotid imt in type 2 diabetic patients with microalbuminuria. in the same time, our study showed that the value of hba1c in type 2 diabetic patients with microalbuminuria was significantly higher than that in patients with normoalbuminuria. the result indicated that hba1c maybe played an important role in the relationship between carotid atherosclerosis and microalbuminuria. clinically, hba1c is now used to assess glycemic control in patients of diabetes mellitus, and it is regarded as a useful method of screening and diagnosing diabetes. and hba1c has been accepted as the best marker for diabetic microvascular complications. moreover, hba1c is associated closely with advanced glycation end products (ages). the previous study showed that ages are widespread in the diabetic vascular system and contribute to the development of atherosclerosis. ages contribute to many microvascular and macrovascular complications through the formation of bridging between molecules in the basement membrane of the extracellular matrix by joining the receptor for advanced glycation end products (rage). concerning microalbuminuria, it was reported that the accumulation of ages in the glomerular and tubulointerstitial spaces correlates with the severity of diabetic nephropathy. in addition, the results showed that there were no significant difference in plaque incidence rate between normoalbuminuria and microalbuminuria groups. our results showed that there were significant differences of plaque types in both normoalbuminuria and microalbuminuria groups. and the incidence rate of soft plaques was the most compared with dense plaques and calcified plaques. it is known that the presence of carotid plaques correlates with an increase in the risk of stroke and cerebral infarction, and softer plaques are more likely to be unstable or vulnerable plaques when compared to calcified plaques [3538]. second, some type 2 diabetic patients have already been treated for diabetes and hyperlipidemia which may lead to inaccuracy of the results. our data show that there is a significant association between microalbuminuria and imt which is regarded as the early sign of carotid atherosclerosis in type 2 diabetic patients. routine screening of carotid artery imt and plaque presence in type 2 diabetic patients with microalbuminuria is necessary. it helps us not only to detect early atherosclerosis but to prevent further development of diabetic nephropathy and cardiovascular events by applying more intensive therapy

the aim of this study is to evaluate carotid atherosclerosis in patients of type 2 diabetes mellitus with microalbuminuria (ma) by high-frequency ultrasonography. two hundred and fifty patients of type 2 diabetes mellitus were divided into two groups according to urinary albumin excretion rate (uaer): normoalbuminuria group (130 cases) and microalbuminuria group (120 cases). the intimal-medial thickness (imt) and the atherosclerotic plaques of carotid artery were observed in both groups by high-frequency ultrasound. fasting blood glucose (fbg), hemoglobin a1c, and lipid profiles were measured. the values of imt of microalbuminuria group were significantly higher than those of normoalbuminuria group (p<0.05). in univariate analysis, imt was positively and significantly associated with age (r=0.265, p<0.05), waist circumference (r=0.263, p<0.05), body mass index (r=0.285, p<0.05), systolic blood pressure (r=0.276, p<0.05), uaer (r=0.359, p<0.05), hba1c (r=0.462, p<0.05) and, duration of diabetes (r=0.370, p<0.05). in multivariate linear regression analysis, uaer and hba1c were independent predictors of imt (p<0.05 for all). in the two groups, the rate of soft plaques was higher than that of dense plaques and calcified plaques. in conclusion, there is a significant association between microalbuminuria and imt which is regarded as the early sign of carotid atherosclerosis in type 2 diabetic patients.

PMC3612477

pubmed-1023

attention-deficit/hyperactivity disorder (adhd) affects a large number of children. in the united states, rates range from 5% to 6% of school-age children (guevara et al 2002; lesesne et al 2003).the illness is characterized by a triad of symptom clusters which include inattention, hyperactivity, and impulsivity. usually the illness is first detected during the early school years (goldman et al 1998), but can persist during adolescence and even adulthood. if left untreated, adhd can be associated with a number of poor outcomes including academic failure, delinquency, and problems with substance abuse (barkley 1990; biederman et al 1996; dulcan 1997; wilens et al 2004). their effect on disruptive behavior was discovered in 1937, when these drugs proved to increase compliance, improve academic performance, and reduce motor activity in hyperactive children (bradley 1937). it has proven efficacy on adhd symptoms (kimko et al 1999; greenhill et al 2002). until the introduction of the d-mph (d-threo-(r, r)-mph, d-mph) in 2002, all clinically used mph formulations contained a racemic (1:1) mixture of d-threo-(r, r)-mph and l-threo-(r, r)-mph isomers (figure 1). the development of d-mph was based on the findings that similar improvement on sustained attention was achieved after treatment with d-equivalent doses of d-mph and d, l-mph, but not after l-mph (srinivas et al 1992). it was found that clinical efficacy was highly correlated with plasma concentrations of d-mph. the elimination of the l-isomer does not diminish the efficacy of an acute dose of mph (quinn et al 2004). the efficacy of the d-isomer was equivalent to the racemic preparation in ameliorating the target symptoms of adhd and increasing academic productivity. thus, it was thought that the efficacy of mph resides in the d-isomer (lim et al 1986; patrick et al 1987; srinivas et al 1987, 1992). other research demonstrated that besides clinical effectiveness, the undesired pressor and anorexic actions of d, l-mph also appear to reside in the d-isomer (srinivas et al 1992; anonymous 2002; scheffler et al 2003; teo et al 2004). d-mph not only appears to be the more active of the two enantiomers, but also better absorbed; plasma concentrations of d-mph are many times higher than the l-enantiomer after oral dosing of racemic mph (hubbard et al 1989; ding et al 1997; kimko et al 1999; modi et al 2000) or intravenous administration (kimko et al 1999). this is seen with both immediate-release (kimko et al 1999) and sustained-released (hubbard et al 1989; kimko et al 1999) forms of racemic mph. the pre-systemic metabolism and metabolic clearance of d, l-mph is also an enantioselective process which, too, contributes to markedly higher plasma concentrations of d-mph relative to l-mph (markowitz et al 2003; patrick et al 2005). it was also found that equimolar doses of d-mph yielded similar pharmacokinetics as those noted with administration of the d, l-racemic mixture (srinivas et al 1992). as a result, the d-mph product was developed, and approved by the fda for clinical use on august 31 2001. the d-mph product appears to double the therapeutic potency of the racemic d, l-mph; when only half dose of racemic d, l-mph was used, d-mph produced similar pharmacokinetic parameters (cmax, tmax, and half-life) (anonymous 2002; keating and figgitt 2002; markowitz et al 2003). the administration of d-mph with food has no significant effect on bioavailability, but with racemic mph, tmax was delayed by 1 hour (teo et al 2004). in addition, a number of studies (patrick et al 1981; arnold et al 2004; quinn et al 2004; silva et al 2004; wigal et al 2004) suggested that d-mph might have a longer duration of action than d, l-mph on tests measuring attention, hyperactivity, and impulsivity, the use of d-mph in adhd allows the administration of lower doses than those currently prescribed with d, l-mph. molecules that are non-superimposable mirror images of one another are termed enantiomers and when equal amounts (1:1) of enantiomeric molecules are present together, the product is termed racemic. most current commercial formulations of mph consist of the racemic mixture of the threo pair of mph isomers (d, l-threo mph). although mph has two chiral centers, and therefore four isomers, a d, l-erythro-mph pair and a d, l-threo-mph pair, only the racemic mixture of the threo pair of enantiomers (d, l-threo-mph) is used therapeutically. this is due to the recognition that it has fewer side-effects than the erythro enantiomers. it should be noted that the phenethylamine moiety of d-mph is shared by dopamine and norepinephrine. it is the phenethylamine structure that provides the transporter receptor affinity and it competes with dopamine for binding (kimko et al 1999). the predominant metabolic pathway of mph is de-esterification to form pharmacologically inactive d- or l-ritalinice acid by the carboxyesterase-i isoform, ces1a1 (sun et al 2004). it was shown that d, l-threo-methylphenidate was stereoselectively metabolized in humans (lim et al 1986; srinivas et al 1987), with l-threo-mph being eliminated faster than d-threo-mph (srinivas et al 1992; sun et al 2004). in a double-blind, four-way, randomized, crossover study, l-mph showed no difference vs placebo in improving the sustained attention in humans. moreover, a 5-mg dose of d-threo-mph has the same attention improvement effect as a 10-mg dose of d, l-threo-mph racemic mixture. hence, the clinical effect of mph is attributed to the d-enantiomer (srinivas et al 1992). the brand name for d-mph is focalin. in terms of its chemical composition, d-mph hydrochloride is methyl -phenyl-2-piperidineacetate hydrochloride, (r, r)-(+)-. although its mechanism is poorly understood, pharmacodynamic studies have suggested that the therapeutic effect of mph in the treatment of adhd appears to lie primarily in increasing the synaptic concentration of dopamine by blocking dopamine transporters (dat) (gatley et al 1996; ding et al 1997; davids et al 2002), as well as in blocking norepinephrine transporters. this is in agreement with recent reports that there is significantly increased expression of dat in adhd patients (volkow et al 2002) and the effects of mph administration is associated with a decrease in dat receptor concentration in the striatum (krause et al 2000). however, in methamphetamine abusers, the number of dat also are reduced (volkow et al 2001a, 2001b). recovery of dat receptors is evident with protracted abstinence (volkow et al 2001a). the binding of d-mph to dat in the striatum is reduced by cocaine in a dose-dependent manner (fowler et al 1998). studies in humans, baboons, and rats seem to indicate that the pharmacological specificity of mph resides predominantly in its d-isomer (srinivas et al 1992; ding et al 1997; anonymous 2002). thus, in vivo binding measures of radiolabeled d-mph to dopamine transporter in the brain with positron emission tomography (pet) or microdialysis have not only become a valuable technique to analyze pharmacodynamics of mph and its enantiomers (ding et al 1995, 1997, 2004; gatley et al 1995; logan et al 1996, 2001; volkow et al 2002; kilbourn 2004), but also served as an effective tool to assess expression or density of dopamine transporters in tissues of humans and animals (volkow et al 1995, 1996b, 2001a, 2001b; fowler et al 1998; gatley et al 1999). pet studies provide a quantitative measure of distribution volume ratios, which represent specific radioligand binding (volkow et al 1995; wang et al 1995). measures of distribution volume ratios are based upon the following assumptions: (i) even if the plasma concentration of the radiolabeled tracer is unknown (for example, without blood samples from patients), non-invasive quantification is still possible using a reference region with graphical analysis (logan et al 1996); (ii) for neuroreceptor transporter modeling, no specific binding occurs in the reference region (volkow et al 2002); (iii) the distribution volume of the reference region is the same as the distribution volume of the first compartment (free and non-specifically bound tracer) in the target region. since the basal ganglia of striatum expresses more dopamine transporters (dat), it is considered as the target region for d-mph, while the cerebellum does not express dat, so it usually is considered the reference region (volkow et al 2002; kilbourn 2004). thus, the tissue distribution volume ratio of [c]d-mph in the basal ganglia containing the specific binding to that in the cerebellum which demonstrates non-specific binding should be considered to be a reflection of dopamine transporter availability. recent results from pet and other imaging studies for the two enantiomers of racemic mph demonstrated that [c]d-mph bound to the dopamine transporter in the basal ganglia is highly specific and reproducible (ding et al 1997). however, there is no evidence of regional specific binding for [c]l-threo-mph in the brain. these results suggest that the binding of mph to dat in the striatum is enantiospecific. these data are also in agreement with those from basic and clinical studies showing that d-mph at therapeutic doses exerts much stronger effects than racemic mph or l-threo-mph on extracellular dopamine in rats and on improvement in sustained attention in children (srinivas et al 1992; patrick et al 1987). moreover, d- and l-mph also undergo enantioselective metabolism (srinivas et al 1987; hubbard et al 1989; anonymous 2002; sun et al 2004), as evidenced by the following findings. first, as mentioned before, because of rapid pre-systemic metabolism, orally administered l-threo-mph is poorly absorbed in humans thus, the absolute bioavailability of d-mph is significantly greater than that of l-threo-mph (srinivas et al 1993; sun et al 2004). second, because there is a correlation between plasma concentrations and dat occupancy, the plasma concentration could serve as an indicator for dat binding (srinivas et al 1992). however, dat binding by d-mph could also be obtained from calculated tissue distribution volume without patients blood samples (logan et al 1996). third, while the rate of brain uptake for both enantiomers was not significantly different, the rate of clearance after 1.5 hours from the brain or plasma was much slower for d-mph than that of l-threo-mph (volkow et al 2002). fourth, greater than 50% dat binding in the basal ganglia by d-mph may be required for therapeutic efficacy for adhd. however, despite greater than 50% dat occupancy by d-mph when administered intravenously or orally, the reinforcing effects were not perceived by patients receiving oral d-mph (volkow et al 2002). this phenomenon is possibly due to slower blockade of dat by oral d-mph and may explain why intravenous injection of mph may lead to addiction. finally, there is no inter-conversion between the enantiomers after oral administration of pure d- and l-mph separately (volkow et al 2002). the recent in vitro binding study of markowitz et al (2005) found that d-mph exhibited prominent effects at the norepinephrine transporter site, even exceeding the activity at the dat. the result demonstrated that affinity for catecholaminergic sites largely resides in the d-isomer. animal toxicology studies showed that the toxicity of d-mph and d, l-mph were comparable at equimolar doses (teo et al 2002). a recent comparative study assessing the acute behavioral toxicity of d-mph, l-mph, and d, l-mph in rats has revealed that females were more sensitive than males to some toxic behavioral effects of the l-isomer and d, l-mph (racemic), suggesting a possible sex difference in sensitivity (teo et al 2003d). in related studies, increased incidence of dilated pupils and vocalization was found with d, l-mph compared with the pure d-mph given at half the dose (teo et al 2002). in the same study, no other significant toxic effects were found in perinatal or postnatal rats at a dose 25 times the maximum daily human therapeutic dose (teo et al 2002). another toxicology study in beagle dogs demonstrated that only minimal reversible toxicity such as reduced appetite and weight loss were found in male and female dogs receiving 10 mg/kg of d-mph and 20 mg/kg of d, l-mph for 90 days (teo et al 2003c). neither d-mph nor d, l-mph were found to be carcinogenic or clastogenic in either in vitro or in vivo studies, although very high oral doses of the l-mph produce behavioral, and even lethal, effects in mice (teo et al 2003a). the authors believed that d-mph and d, l-mph do not present carcinogenic risk to humans. animal studies in rats and rabbits also suggested that d-mph and d, l-mph were not teratogenic (teo et al 2003b). the same study suggested that some negative behaviors in pregnant animals may be attributed to l-mph because inclusion of the l-isomer, when comparing d, l-mph and d-mph at half the dose, resulted in repetitive pawing, dilated pupil, and aggressive behavior. a recent study, using pet and micropet to trace orally administered, as well as radiola-beled d- and l-mph, in the brain of baboons and rats, suggested that l-mph may not be pharmacologically active. additionally, l-mph might contribute to the behavioral and side-effect profiles of d, l-mph during the treatment of adhd (ding et al 2004). the immediate-release (ir) d-mph product is deemed to provide effective management of adhd at half the dose of racemic mph products and was shown to be effective and well tolerated in clinical trials (swanson et al 2002; arnold et al 2004; quinn et al 2004; wigal et al 2004). an initial pharmacokinetic study showed that after an oral dose of d-mph, plasma d-mph concentration increased rapidly, reaching maximum levels at 11.5 hours post-dose in fasting states. plasma pharmacokinetics of d-mph were similar to d, l-mph given the equimolar amounts of d-mph. the mean plasma elimination half-life for d-mph is approximately 2.2 hours (anonymous 2002). however, recent studies, including one post hoc analysis (weiss et al 2004), one open-labeled (silva et al 2004), and three placebo-controlled clinical studies (arnold et al 2004; quinn et al 2004; wigal et al 2004) in children with adhd, suggested that ir d-mph may produce a longer duration of therapeutic action (6 hours) which can not be explained solely on the basis of the agent s pharmacokinetics. some authors have postulated that the need for a midday dose for ir mph products may erode social functioning and sometimes the self-esteem of children with adhd. thus, an extended-release form of d-mph (d-mph-xr) was designed, known as focalin xr, and approved by fda for clinical use in may 2005. this product is a modified release capsule formulation of d-mph specifically engineered to deliver a bimodal (biphasic) release of d-mph that mimics a twice daily d-mph dosing (ie, two distinct peaks approximately 4 hours apart). the d-mph-xr product uses the same proprietary sodas (spheroidal oral drug absorption system) technology as one of the racemic mph products (ritalin-la) currently on the market. for each of these products, capsules are filled with a mixture of 50% immediate-release beads and 50% enteric-coated, delayed-release beads, thus providing immediate release and a second delayed-release component. after administration of d-mph-xr, the first peak concentration (cmax1) of d-mph occurs on average after 1.5 hours (typical range 14 hours). the mean time to the inter-peak minimum is slightly shorter, and time to the second peak (tmax2) is slightly longer for d-mph- xr given once daily (about 6.5 hours, range 4.57 hours) compared with the ir d-mph given in two doses 4 hours apart. the d-mph-xr product given once daily exhibits a lower second peak concentration (cmax2), higher inter-peak minimum concentrations, and fewer peak and trough fluctuations than the ir form of the agent, given in two doses 4 hours apart. the area under the plasma concentration-time curve (auc) after administration of d-mph-xr given once daily is equivalent to the same total dose of ir d-mph tablets given in two doses 4 hours apart (novartis pharmaceuticals corporation 2005). the clinical efficacy as well as safety of d-mph-xr in treating children with adhd was demonstrated in a randomized, double-blind, placebo-controlled clinical trial (greenhill et al 2005). in this study, flexible dosing schedules of between 5 and 30 mg of d-mph-xr were administered once daily over a 7-week period. greenhill et al (2005) reported that d-mph-xr was associated with significantly improved attention and behavior in children with adhd. silva et al (2005, 2006), in two separate studies, demonstrated that the therapeutic effect significantly differentiated from placebo during each time point of the 12-hour laboratory classroom studies. both of these studies employed a double-blind, placebo-controlled, crossover design. the sample sizes were slightly more than 50 patients in each trial; all subjects satisfied dsm-iv criteria for adhd. in the two studies, swanson, kotkin, agler, m-flynn, and pelham (skamp) scales and math tests were administered. significant differences were observed across all measures and in each of the subscales at each of the time points studied. another noteworthy observation is related to the elapsed time at which efficacy was first detected. in the silva et al (2005) study significant differences were noted at the first time point measured, which was half an hour after medication administration. based on the information we have reviewed it seems that d-mph is a useful agent in the treatment of adhd. furthermore, it should be noted it is the only mph product approved for the treatment of this disorder in adults. the literature reviewed identified that there are meaningful differences in the clinical efficacy and pharmacokinetic profile between the d- and l-isomers of mph. when comparing the single isomer with the racemic compound, a consistently noted difference across studies is that d-mph has a longer duration of action than d, l-mph. further study is required to more fully understand the side-effect differences between the d-isomer and its racemic counterpart.

attention-deficit/hyperactivity disorder (adhd) affects a large number of children. for decades, the stimulants have been the mainstay of pharmacological treatment for adhd. dexmethylphenidate (d-mph), the d-isomer of the traditional racemic mixtures of d, l-threo-(r, r)-mph, was recently introduced as another potential option in the stimulant class of medications. this paper reviews and summarizes the available research literature on d-mph regarding pharmacodynamic, pharmacokinetic, chemical structure, receptor binding, toxicology, and clinical perspectives. d-mph potentially may offer some advantages in the realms of absorption and duration of action compared with its racemic counterpart. the differences in pharmacokinetics and clinical implications of the immediate-release and extended-release forms of d-mph are also compared and contrasted.

PMC2671958

pubmed-1024

fractures among patients infected with human immunodeficiency virus (hiv) have been the focus of an increasing number of studies since 2000.117 such fractures have been documented to occur more frequently than in people not infected by hiv6 and to involve longer healing times and an increased risk of infection.18 the large us prospective cohort hiv outpatient study (n=5826) reported that, in 2006, the frequency of all fractures among hiv-infected patients aged 2554 years was over two-fold higher than in the us general outpatient population (84.2 versus 35.6 fractures per 10,000 people, adjusted for gender).6 hiv-infected patients have been shown to be at particularly high risk for developing fractures if they are aged 47 years (compared with 35 years), have a history of cd4 cell count below 200/mm, have diabetes or hepatitis c coinfection, or are an intravenous drug user.6 because combination antiretroviral therapy has allowed more and more hiv-infected people to live well beyond 50 years, when osteoblastic activity significantly declines,1 the occurrence of fractures is expected to increase in this population in the future. the higher prevalence of fractures among hiv-infected patients compared with the general population is due in part to their lower bone mineral density, which makes their bones more fragile and susceptible to breaking.1,4,6,13 this is reflected in their six-fold higher rate of osteopenia and nearly four-fold higher rate of osteoporosis.6 for every one standard deviation reduction in vertebral bone mineral density, there is a two-fold increased risk of vertebral fracture.1 hiv itself appears to lower bone mineral density due to the presence of increased levels of certain proinflammatory cytokines (interleukin-1, interleukin-6, and tumor necrosis factor) that directly accelerate bone loss.13 many antiretroviral and nonantiretroviral drugs are also known to contribute to low bone mineral density through a variety of mechanisms, including enhanced osteoclastic activity, reduction in osteoblastic activity, impaired calcium absorption, and renal phosphate wasting.8,13 of the reverse transcriptase inhibitors, the nucleotide, tenofovir disoproxil fumarate, has been most documented to produce significant reductions in bone mineral density following initiation of therapy.10,1925 in clinical trials that have directly compared tenofovir with the nucleoside reverse transcriptase inhibitors, ie, stavudine, zidovudine, and abacavir, tenofovir was found to reduce bone mineral density to a greater degree.22,26,27 in a cross-sectional observational study by guillemi et al10 in 285 unselected adult hiv patients (80% caucasian, 85% male, median age 48 years), multivariate analysis revealed that tenofovir exposure for at least three months and lower body mass index, but not exposure to other nucleosides or protease inhibitors, were risk factors for low bone mineral density. to date, studies of fractures in hiv-infected patients have focused primarily on fractures of the hip and spine, as confirmed by dual energy x-ray absorptiometry (dexa) or magnetic resonance imaging.4,14,18,21,28 fractures of the feet have rarely been mentioned in any publication. considering their weight-bearing role, feet would be expected to be highly vulnerable to fracture in hiv patients, especially those with reduced bone mineral density and the common hiv-associated peripheral neuropathy. the purpose of the present study was to describe the clinical, laboratory, and medical history characteristics of all male hiv-infected patients diagnosed with foot fractures within a one-year period at a private practice rheumatology clinic in los angeles, and to differentiate these characteristics in tenofovir-treated versus non-tenofovir-treated patients. in this retrospective case series study (col109415), a rheumatologist (aah) and podiatrist (rjj) reviewed the medical records for all male hiv-infected patients in los angeles area outpatient podiatry and rheumatology clinics who had been diagnosed as having foot fractures confirmed by magnetic resonance imaging (n=30) over a one-year period (20062007). in most cases, the patients had been seen initially in private podiatry clinics in los angeles and were referred to the center for rheumatology. however, some patients were seen first at the center for rheumatology and were then referred to rjj s private podiatry practice for foot fracture assessment. female fracture patients were excluded from the study because it was felt that their greater fracture risk due to lower bone mineral density and bone mass,29 and the complication of premenopausal and postmenopausal estrogen use (oral contraceptives and estrogen supplements,30 respectively) could lead to data that would not be comparable with that from a solely male population. fracture data were included for analysis only for patients whose fractures had occurred either in the absence of trauma or after only trivial trauma. medical records for patients with fractures due to highenergy traumatic injury (eg, a motor vehicle accident) were excluded from analysis. excel sheets were used to capture data pertaining to the patients demographics, hiv history, comorbidities, alcohol intake, smoking history, highly active antiretroviral therapy (haart)/non-hiv drug prescription history, bone mineral density scores by dexa, fracture type, and laboratory values (especially serum calcium, phosphorus, alkaline phosphatase, thyroid-stimulating hormone, 25-hydroxyvitamin d, and parathyroid hormone). the investigators also noted the characteristics of the foot fracture events, which included the situation surrounding the fracture, location/type of fracture, the presence of concurrent fractures in other body regions, the time between hiv diagnosis and foot fracture occurrence, the time between the start of a particular treatment and foot fracture, and how fractures were managed. statistical analysis was primarily descriptive, although stepwise logistic regression analyses were performed to evaluate a correlation between the category variables, ie, femur dexa t scores<1.5 or 1.5 or spine dexa t scores<1.5 or 1.5, and independent variables (baseline demographic characteristics, hiv-1 rna, cd4 cell count, laboratory values, comorbidities, and concurrently administered drugs). these fractures were marked by pain, often of the pinpoint type when the fracture area was touched, with concomitant swelling and little or no bruising. proportionally more patients with foot fractures had received tenofovir-containing antiretroviral (17 [57% ]) than non-tenofovir-containing antiretroviral (13 [43% ]) drugs prior to the fracture. median time from tenofovir initiation until fracture was 2.57 (range 1.175.69) years. at the time fracture was diagnosed, the tenofovir and non-tenofovir groups did not differ significantly in median or mean age (49 versus 48 years and 50.0 versus 54.2 years, respectively). although there were outliers in age in each of these groups, ie, a 63-year-old in the tenofovir group and an 80-year-old in the non-tenofovir group, most of the patients were in their mid to late forties. the tenofovir and non-tenofovir groups were also similar with respect to baseline viral load (2.1 versus 2.4 log10 copies/ml), time between hiv diagnosis and foot fracture (both 17.0 years), proportion of fractures affecting the metatarsophalangeal area (12% versus 15%), incidence of concurrent vertebral fracture (12% versus 15% of all foot fracture cases), and family history of osteoporosis (24% versus 23% of cases, table 1). no between-group differences were observed regarding presence of most comorbidities, including hypogonadism, hypertension, malabsorption syndrome, renal failure, calcium deficiency, or vitamin d deficiency, nor were differences seen in serum laboratory values for calcium, albumin, potassium, blood urea nitrogen, sodium, creatinine, chloride, glucose, liver enzymes, and hematocrit. more patients in the tenofovir group than in the non-tenofovir group were osteoporotic, smoked cigarettes regularly, and had truncal obesity and wasting syndrome. fewer tenofovir-treated patients had a history of alcoholism and anemia secondary to chronic disease. iu/l versus 72 iu/l), parathyroid hormone (41 pg/ml versus 32 pg/ml), 25-hydroxyvitamin d (37 ng/ml versus 26 ng/ml), and a lower median white blood cell count (5.5 10/mm versus 6.3 10/mm). evaluation of prior nucleoside reverse transcriptase inhibitor, non-nucleoside reverse transcriptase inhibitor, and protease inhibitor use showed that more patients in the tenofovir group had taken lopinavir/ritonavir (53% versus 23%) and ritonavir (24% versus 8%), whereas more patients in the non-tenofovir group had taken abacavir/lamivudine (31% versus 6%). no between-group differences were observed in the frequency of use of any other individual antiretroviral agents. logistic regression analyses showed a significant relationship between femur dexa t-scores<1.5 and decreased body weight (p=0.036) and increased serum glucose (p=0.03). no relationship was seen between femur or spine dexa t scores<1.5 and alendronate use or testosterone use, serum creatinine, serum blood urea nitrogen, electrolytes, or 25-hydroxyvitamin d levels. the fractures were treated with immobilization of the foot, often with the aid of a casted stiff-soled shoe to be worn to prevent pressure or bending of the fracture area. surgery was not required, and crutches were generally needed only for metatarsal base injuries. with these precautions, fractures usually required 46 weeks to heal fully. in tenofovir-treated patients, custom orthotics were created for the patients for insertion into shoes to reduce pressure on the previously fractured foot areas. for patients whose bone mineral density values demonstrated osteoporosis or osteopenia, treatment with supplemental calcium, vitamin d, bisphosphonates, or teriparatide was considered. this small pilot study suggests that foot fractures may occur more often in hiv-infected patients treated with tenofovir-containing haart than non-tenofovir-containing haart. concern about an association of tenofovir with fractures was initially raised by preclinical studies that showed a higher risk of spontaneous fractures and bone abnormalities in rhesus monkeys with simian immunodeficiency virus infection administered supratherapeutic doses of tenofovir (30 mg/kg/day) subcutaneously for one week to 24 months (mean, 14 months) compared with no treatment. 31 these bone effects were associated with elevated alkaline phosphatase levels and decreased serum phosphorus levels. histomorphometric assessment of the tibial diaphyses in tenofovir-treated monkeys revealed increased osteoid seam width, consistent with defective mineralization of new bone, despite reduction or reversal of tibial bone resorption. a further preclinical study reported completely unmineralized secondary osteons in the tibia of a 16-month-old rhesus monkey whose mother had received high doses of tenofovir while pregnant.32 clinical trials evaluating tenofovir have also demonstrated the adverse effect of the drug on bone. in gs-99-903, a clinical registration trial that compared tenofovir/lamivudine/efavirenz (n=299) with stavudine/lamivudine/efavirenz (n=303) in antiretroviral-nave patients, tenofovir-treated patients experienced a significantly greater mean percentage decrease from baseline in lumbar spine bone mineral density at week 144 (2.2% versus 1.0% stavudine, p=0.001) and a trend for greater bone mineral density reduction at the hip (2.8% versus 2.4% stavudine, p=0.06).26 two subsequent clinical trials similarly showed that tenofovir, whether combined with emtricitabine or lamivudine, caused significantly greater bone mineral density reduction than comparator nucleoside reverse transcriptase inhibitor backbones.21,28 however, none of these clinical trials reported a significantly higher frequency of fractures in tenofovir-treated patients despite the tenofovir-associated reduction in bone mineral density. this underscores clinical evidence demonstrating that reduced bone mineral density is just one contributor to fractures and that bone mineral density alone can not serve as the only predictor of fracture. in fact, reduced bone mineral density alone generally imparts less than 25% increased risk of vertebral fractures.33 the effect of decreased bone mineral density on foot fracture risk has yet to be investigated. where fracture data have been reported previously in hiv-infected patients receiving haart, these have dealt primarily with vertebral fractures rather than foot fractures. in fact, in an assessment of patient medical records of approximately 8600 hiv-infected patients (78% male, 70% caucasian, median age 45 years, 46% smokers, 81% of the haart regimens including one protease inhibitor and 22% including tenofovir) at nine us hiv clinics, 55% of 55 fractures observed were vertebral, only one of which occurred with a concurrent foot fracture.14 the other most frequent sites of fracture were the lower extremities (27%, which could have included foot fractures, although these were not specified), upper extremities (6%), and clavicle (4%)., patients who had fractures generally remained on the antiretroviral treatment they had been receiving at the time fracture occurred, and remediation similarly consisted of immobilization of the fracture areas, with institution of calcium, vitamin d, and bisphosphonates if osteoporosis had been detected by bone mineral density measurements. foot fractures believed to be related to tenofovir were previously reported in several hiv-infected patients, aged 3762 years, 1217 months after tenofovir was added to their haart regimens.24,34,35 their regimens also included either ritonavir-boosted atazanavir or lopinavir. in these cases, bone scintigraphy revealed concurrent fissure fractures in multiple body areas, especially the legs, ribs, pelvis, and femur. laboratory work confirmed osteomalacia that was likely due to tenofovir-related proximal renal tubular dysfunction, which was marked by phosphaturia, proteinuria, glycosuria, and calciuria. tenofovir was discontinued, remedial oral 25-hydroxyvitamin d3, neutral sodium-potassium phosphate, and/or calcitriol treatment was initiated, and the condition of the patients resolved and laboratory values and renal function usually normalized within 12 weeks. generalized fractures in 12 of 22 patients who had developed proximal renal tubular dysfunction secondary to tenofovir were also reported by woodward et al.25 in these patients, phosphaturia led to hypophosphatemia, which in turn led to osteomalacia and fracture. in the tenofovir-treated patients in our study, osteomalacia could not be ruled out as a potential cause of, or prodromal condition for, foot fractures because we did not have serum phosphate data, or urinary phosphate, glucose, or protein data. our tenofovir cohort did not present with a greater number of symptoms suggestive of generalized osteomalacia (diffuse body pain and muscle weakness) than did the non-tenofovir group. however, it did have more stress-type and concurrent fractures and higher parathyroid hormone and alkaline phosphatase levels, all of which are often associated with osteomalacia.36 both the tenofovir and non-tenofovir groups in our study had several factors that could have influenced the occurrence of foot fractures. a larger proportion of tenofovir-treated patients took the protease inhibitor lopinavir/ritonavir concurrently. because lopinavir/ritonavir increases tenofovir blood levels by inhibiting the efflux of tenofovir out of renal proximal tubule cells and reduces tenofovir renal clearance, the increased tenofovir blood levels during concurrent use could have potentially increased fracture risk, in view of animal studies linking higher tenofovir concentrations with greater demineralization.31,32 in addition, lopinavir/ritonavir in the absence of coadministered tenofovir has been linked with low bone mineral density and cases of accelerated osteoporosis,37 and with vertebral fractures.38 more of our tenofovir-treated cohort took oral corticosteroids, were chronic cigarette smokers, and had truncal obesity or wasting syndrome, all of which have been implicated in reducing bone mineral density.3942 these factors could have contributed to the higher frequency of osteoporosis or osteopenia in the tenofovir group, and hence greater likelihood of foot bone fragility and fracture. these risk factors were likely partially counterbalanced by the greater frequency of use of calcium supplements, vitamin d, testosterone, and teriparatide, ie, drugs that could increase bone mineral density, in the tenofovir group.4347 it was not clear in some cases when these were started with respect to the timing of a diagnosis of osteopenia or osteoporosis. although fewer patients in the non-tenofovir group had as many of these bone mineral density-reducing factors, more non-tenofovir-treated patients were alcoholics or had cd4 counts<200/mm, both of which can lower bone mineral density.43,46 our study was limited by its small population and its lack of information about the dietary habits and exercise patterns of the patients, both of which could have potentially impacted bone strength, and hence, foot fracture risk. the study involved hiv-infected patients who were diagnosed over a one-year period (20062007) after having received tenofovir on average for about 2.5 years. thus, they were prescribed tenofovir at a time when the nucleoside backbones popularly used in practice were lamivudine/zidovudine, abacavir/lamivudine, and abacavir/lamivudine/zidovudine. it is noteworthy that tenofovir is currently prescribed much more often as a backbone in combination haart regimens. thus, if foot fractures were to be evaluated over the past year in haart-treated patients, the attributability of the fracture to tenofovir use could be debatable because more fractures might only reflect greater prevalence of tenofovir use in current clinical practice. our study had several attributes, including the fact that the patients were well matched for severity of hiv condition, family history of bone abnormalities, and time between hiv diagnosis and foot fracture diagnosis. most of the patients were not elderly, and so the effects of older age on bone fragility were negligible. the same data-gathering tool and questions were used in evaluating patient medical charts. lastly, only males were evaluated because women have a notably higher frequency of low bone mineral density due to smaller body weight and hormonal factors. in conclusion, this small pilot study suggests a greater incidence of foot fractures in hiv-infected patients on tenofovir-containing than non-tenofovir-containing haart. when choosing antiretroviral agents for inclusion in haart regimens, it is important for clinicians to consider the potential for drugs to increase the risk of fracture, especially in hiv-infected patients in whom bone mineral density is already diminished.

in a retrospective case series study, medical records were evaluated for all male patients infected with human immunodeficiency virus (hiv) diagnosed over a one-year period with foot fractures (n=30) confirmed by magnetic resonance imaging at a los angeles outpatient private practice rheumatology clinic. proportionally more patients had received tenofovir prefracture (17 [57% ]) than those who had not (13 [43%]). at fracture diagnosis, these two groups were similar in median age (49 versus 48 years), hiv-1 rna (both 1.7 log10 copies/ml), cd4 count (300 versus 364/mm3), time between hiv diagnosis and foot fracture (both 17 years), family history of degenerative bone disease (24% versus 23%), prevalence of malabsorption syndrome, renal failure, calcium deficiency, or vitamin d deficiency, and concurrent use of bisphosphonates, calcitonin, and diuretics. however, more tenofovir-treated patients had osteoporosis (35% versus 8%), stress-type fractures (53% versus 31%), concurrent fractures (12% versus 0%), wasting syndrome (29% versus 15%), truncal obesity (18% versus 8%), smoked cigarettes (more than one pack/day for more than one year; 35% versus 8%), dual energy x-ray absorptiometry (dexa) t scores<2.4 (denoting osteoporosis) at the femur (24% versus 9%) and spine (47% versus 36%), and had received protease inhibitors (71% versus 46%), non-nucleoside reverse transcriptase inhibitors (24% versus 0%), prednisone (24% versus 0%), testosterone (47% versus 23%), and teriparatide (29% versus 8%). median time from tenofovir initiation until fracture was 2.57 (range 1.175.69) years. in conclusion, more foot fractures were observed in tenofovir-treated patients than in non-tenofovir-treated patients with hiv infection. comorbidities and/or coadministered drugs may have been contributory.

PMC3218713

pubmed-1025

it is found in up to 40% of patients at surgery or autopsy.1) the aortic valve and its adjacent ring are more susceptible to abscess formation and paravalvular extension compared to the mitral valve.1) we report a case of staphylococcal endocarditis involving the tricuspid valve complicated by a para-aortic abscess that ruptured into the aortic sinus diagnosed by trans-thoracic echocardiogram. his medical history was unremarkable, except left ankle trauma three months prior to presentation. on admission, the blood pressure was 100/50 mmhg, pulse rate was 111/min, respiratory rate was 22/min and body temperature was 39.7. auscultation revealed clear breathing sounds and a faint diastolic regurgitant murmur (1-2/6) at the left sternal border. in addition, reddish, painful left ankle edema, suggestive of cellulitis in addition to small erythematous macular lesions suggestive of janeway lesions on the soles were present. electrocardiogram showed sinus tachycardia (107 beats/minute) without st-t segment abnormality. laboratory tests revealed a white blood cell count of 17,000/l with elevated neutrophils (85.4%), a hemoglobin level of 13.2 g/dl, an elevated erythrocyte sedimentation rate (esr) (23 mm/hour), a c-reactive protein 10.48 mg/dl and abnormal liver function with aspartate aminotransferase/alanine aminotransferase of 39/66 iu/1) revealed mild aortic regurgitation, bicuspid aortic valve and an oval echolucent area near the aortic valve adjacent to the right bicuspid aortic valve commissure with direct communication to the aortic sinus. an echolucent cavity was visible on the right side of the aortic valve annulus, and was thought to represent paravalvular ring abscess. a diastolic color flow jet into the abscess cavity indicated a communication with the aortic sinus. examination of the tricuspid valve demonstrated a 1.4 cm mobile vegetation on the septal leaflet of the tricuspid valve associated with trivial tricuspid regurgitation. however, cardiac systolic function was normal with a 63% ejection fraction. transesophageal echocardiography was performed on the fourth hospital day to further investigate the oval echolucent area near the aortic valve, which confirmed a bicuspid aortic valve along with a para-aortic abscess that communicated directly with the aortic sinus (fig. 2). computed tomography scan of the abdomen demonstrated multiple hypodense lesions in the spleen and the left kidney, considered to be abscesses secondary to septic emboli. staphylococcus aureus (s. aureus), sensitive to ciprofloxacin, gentamicin, oxacillin, rifampin, teicoplanin, tetracycline, trimthoprim/sulfamethoxazole, and vancomycin, was isolated from peripheral blood cultures according to susceptibility test performed by the disc diffusion method. ultimately, a diagnosis of acute staphylococcal endocarditis was made according to the duke criteria, which included three positive blood culture results of s. aureus, the presence of vegetation on the tricuspid valve and para-aortic abscess as demonstrated by echocardiogram, in addition to clinical and laboratory features, such as left ankle cellulitis, fever, and janeway lesion. the patient was empirically treated with a combination of nafcillin (1 g/12 h) and gentamicin (60 mg/8 h) before blood culture results were known. over the subsequent 48 hours, the patient's cellulitis improved markedly as evidenced by reducing erythema, swelling, and pain of the left ankle. initially, the patient responded well, but after 7 days of intravenous antibiotic administration, laboratory results showed signs of increasing inflammation. a new rise in leukocytes counts from 9,400/l to 10,000/l, with elevated neutrophils from 73% to 79%, was observed. esr increased from 21 mm/h to 24 mm/h at the time. because the infection site was critical, we replaced intravenous nafcillin with intravenous vancomycin (1 g/12 h) and persisted with gentamicin (60 mg/8 h), with the suspicion of nafcillin resistance. repeat transthoracic echocardiography demonstrated bicuspid aortic valve along with a persistent para-aortic abscess communicating with the aortic sinus. the size of tricuspid valve vegetation reduced from 15 mm to 7 mm after the first 14 days of antibiotic therapy. repeated blood cultures were negative during antibiotic therapy. however, vancomycin therapy was discontinued after 21 days due to leukopenia (leukocyte count of 2,900/l and neutrophil count of 14.4%). antimicrobial therapy was discontinued because the patient showed no signs of active infection, and repeated blood cultures were negative. one week after discontinuing antibiotic therapy, blood analysis demonstrated a normal leukocyte count of 7,600/l, a neutrophil of 66.6% and an esr of 6 mm/h. ultimately, the patient received 4 weeks of antibiotics with various regimens: nafcillin/gentamicin for 1 week followed by vancomycin/gentamicin for 1 week, followed by 2 weeks of vancomycin therapy. the patient made a recovery, as the tricuspid valve vegetation disappeared and the abscess cavity showed no significant change in size on the follow-up echocardiogram performed one month after discharge. staphylococcal tricuspid valve endocarditis with para-aortic abscess in a patient with bicuspid aortic valve is rare. it is quite unusual for coagulase-negative staphylococci to cause endocarditis in a young, otherwise healthy person who was not an intravenous drug user, and who had no other risk factors predisposing to infective endocarditis. perivalvular abscess is an ominous development in patients with endocarditis, because it is associated with valvular and perivalvular destruction, leading to serious complications, such as heart block, pericarditis and acute valvular insufficiency.2) in patients with native valve endocarditis, the risk is increased when the valve is bicuspid. ellis et al.3) described signs suggestive of the presence of perivalvular abscesses on transthoracic echocardiogram, e.g., rocking motion of the prosthetic valve, aneurysm of the sinus of valsalva, increased subvalvular intraventricular septum thickness (13 mm), and thickening of the aortic root wall (10 mm). if any of these abnormalities is seen on transthoracic echocardiogram, or if there are clinical manifestations of abscess, transesophageal echocardiography is indicated. it remains unclear whether detection of root abscess in the disease course of aortic valve endocarditis is an indication for surgery. surgery in patients with active infection and perivalvular abscess carries a high risk of death, and is associated with significant risk of recurrent infection and periprosthetic leak postoperatively.4-8) due to the patients ' preoperative conditions secondary to sepsis, treatment of complex aortic valve endocarditis is a surgical challenge, with a reported mortality rate that ranges from 9% to 23%.9) annular abscesses or intracardiac fistulae increase the technical difficulties and risks associated with surgical treatment.10) the long-term outcome of these patients has not been well defined.7)8) a small number of patients with periannular extension of infection or myocardial abscess may be treated successfully without surgical intervention.11)12) these patients potentially include those who have smaller (< 1 cm) abscesses, and who do not have complications such as heart block, echocardiographic evidence of progression of abscess during therapy, valvular dehiscence or insufficiency. cases of successful medical treatment of perivalvular abscess have been reported,11)13-15) but there have been no published series of consecutive patients and no comparison has been conducted with surgically treated patients. surgical versus conservative treatment in patients with infective endocarditis and paravalvular abscess were associated with similar survival in another study.2) in a retrospective study of 233 cases of perivalvular abscess from 42 french hospitals over a 5-year period, medically treated patients who constituted 9% of the study population, had a survival rate similar to surgically treated patients.8) the findings of these study suggest that the main impetus for surgery is severe heart failure despite medical treatment, and that surgery may be deferred or avoided in patients whose heart failure is well controlled.2)8) in most patients, the abscess led to aortic pseudoaneurysm development secondary to cavitation and drainage into the aorta with control of the infection.6)16) the evolutional process was identical irrespective of the species of the infecting microorganism. such patients should be monitored closely with serial transesophageal echocardiography, which should be repeated every 2, 4, and 8 weeks following completion of antimicrobial therapy. jeang et al.17) report a case of aortic root abscess detected with magnetic resonance imaging and echocardiography, and the patient was successfully treated medically. our patient was treated medically for 4 weeks. for susceptible strains of s. aureus, vancomycin was more rapidly bactericidal than penicillin, nafcillin, and cefazolin.18) in a rabbit model of s. aureus endocarditis, sterilization of vegetations was more rapid with vancomycin.18) combination of vancomycin and gentamicin resulted in more rapid clearing of organisms in animal models,19) and in some in vitro models of endocardial vegetations.20) in our patient, antimicrobial therapy was changed to vancomycin from nafcillin due to increasing inflammatory signs in the laboratory findings, suggestive of nafcillin resistance. although the abscess cavity is still present and showed no significant change in size, the patient has no current signs of infection. infective endocarditis is a serious medical condition, and its management, especially regarding surgical intervention, should be individualized. in summary, we report a case of staphylococcal infective endocarditis involving tricuspid valve complicated by para-aortic abscess in a 15-year-old man with bicuspid aortic valve. the patient received 4 weeks of antibiotics therapy and had a good quality of life at 5-month follow-up without surgical treatment.

paravalvular abscess is a serious complication of infective endocarditis. the aortic valve and its adjacent ring are more susceptible to abscess formation and paravalvular extension than the mitral valve. a 15-years old patient with bicuspid aortic valve presented with staphylococcal tricuspid valve endocarditis complicated by para-aortic abscess that ruptured into the aortic sinus. we report the clinical, laboratory and echocardiographic features and treatment of this patient and conduct a literature review on this subject.

PMC3173671

pubmed-1026

peri-implantitis is inflammation of the peri-implant supporting tissue, which can lead to progressive loss of supporting bone, if untreated. a history of periodontitis, poor oral hygiene, and smoking are considered risk factors for peri-implant diseases. it is of paramount importance to treat periodontitis of the residual dentition prior to implant placement. a higher implant failure rate and elevated number of sites with peri-implant bone loss were documented in periodontally compromised patients who did not adhere to comprehensive supportive periodontal therapy. customized and correctly performed supportive periodontal therapy is essential to enhance the long-term outcome of implant therapy. the outcome of non-surgical periodontal treatment (nspt) of peri-implantitis is unpredictable. although minor beneficial effects of laser therapy on peri-implantitis have been shown, this method requires further evaluation. the diode laser is not an ablative instrument and can directly contact the implant surfaces without inducing melting, cracking, or crater formation. the 810-nm diode laser, when used in accordance with appropriate parameters, does not damage titanium surfaces, which is useful when uncovering submerged implants, and can be used to treat bacterial induced peri-implantitis. the use of laser treatment in periodontal therapy is an emerging therapeutic option, although little reliable evidence suggests that it can effectively treat peri-implantitis. a 45-year-old male presented with pain and swelling at a mandibular implant site (nobel biocare, sw). clinical examination revealed a deep pocket [7-mm pocket depth (pd)] and bleeding on probing [figure 1], with suppuration and gingival inflammatory edema at the implant site. the patient was in good general health, did not take any medications, and was an occasional smoker (4-5 cigarettes/day). clinical examination revealed 7-mm probing depths, circumferentially around a mandibular implant, bleeding on probing, and the presence of exudate and gingival inflammatory edema no occlusal trauma or parafunctional habits were detected. a periapical radiograph demonstrated bone loss of five fixture threads on the most distal mandibular left implant, when compared to the original radiograph [figure 2]. periapical radiography shows bone loss for five fixture threads on the most distal mandibular left implant the patient was eventually scheduled for periodontal surgery to treat the inflammatory lesion, but emergency intervention was indicated to disinfect the area by removing the bacterial biofilm and alleviating pain using an 810-nm diode laser [figure 3]. the patient was treated using an 810-nm diode laser to disinfect the area and facilitate bacterial biofilm removal by mechanical and manual periodontal instrumentation the patient was asked to rinse with undiluted chlorhexidine 0.2% for 1 min. after insertion of the optical fiber parallel to the long axis of the implant 1 mm from the most apical portion of the pocket, the diode insert was moved in an apico-coronal and mesio-distal direction for 30 sec at each inflamed implant site. it was used at a power of 0.5 w in a continuous wave (cw) [equivalent to 1 w in pulsating mode (pw) for 30 s] in duplicate on each site, for a total time of 360 sec with a fluence of 1.96 j/cm. non-surgical periodontal instrumentation was performed with hand instrumentation using a titan curette (roncati implant care, by martin kls) and a piezoelectric ultrasonic device with plastic fused to a metal insert (piezon master 700, ems, pi insert), as needed. finally, a 0.5% chlorhexidine gel was deposited into the sulcus with a disposable syringe and a blunt needle. the area was checked for plaque removal and home care compliance for the first month on a weekly basis and was followed by routine supportive periodontal therapy at 3-month intervals. the adjunctive use of the diode laser was included in the conventional periodontal maintenance every 6 months for the following 3 years. periodontal indices were documented and intraoral periapical radiographs were taken at the 1-year [figure 4], and 2-, 3-, 4-, and 5-year [figures 5 and 6] follow-up recall appointments. periapical radiograph: 1-year post-non-surgical treatment periapical radiograph: 5-year follow-up clinical probing depth: 5-year follow-up satisfactory results were obtained by the application of laser-assisted non-surgical peri-implant therapy. periodontal pocket depth was reduced from 7 to 3 mm with no bleeding upon probing. intraoral periapical radiographs, taken for up to 5 years post-non-surgical treatment, provide evidence of some improvement of the bone level. the reduction of periodontal pockets is probably due to re-epithelialization, with formation of a long junctional epithelial attachment. at the 6 european workshop on periodontology, it was reported that mechanical non-surgical therapy with an adjunct of local antibiotics or laser application was effective longitudinally to reduce bleeding on probing and pds over a period of 6-12 months. however, the outcome is unpredictable due to possible re-infection related to the inability to completely remove bacterial deposits from titanium implant surfaces, thus interfering with new histological bone-to-implant contact. the primary objective of non-surgical treatment for peri-implantitis is to remove bacterial contaminants to allow resolution of the inflammatory lesion. to date, no critical probing depths in the therapy of peri-implant diseases have been defined to guide selection of a non-surgical or surgical approach. laser treatment may serve as an alternative or adjunctive treatment to conventional periodontal mechanical therapy or peri-implantitis. diode lasers have a bactericidal effect due to a localized increase in temperature, which has been verified in vivo using dna probes that detect periodontal pathogens. threaded implants have a different morphology than root surfaces; therefore, debridement instruments might be different. the laser may be a valuable tool to detoxify the implant surface [figure 7], and significant bacterial reduction should lead to a more satisfactory recovery. it is possible to point the diode laser insert toward the wall of the ulcerated pocket epithelium to kill virulent periodontal pathogens. vaporization of granulomatous tissue seems to result in a more favorable effect compared to that of solo instrumentation. threaded implants have a different morphology than root surfaces; therefore, debridement instruments may differ. the laser may facilitate detoxification of the implant surface the diode laser detoxifies root and implant surfaces by inactivating bacterial endotoxins. the thermal effect weakens calculus chemical adhesion to the root and/or implant, facilitating its removal by curette or ultrasonic devices. the diode laser also stimulates fibroblasts and osteoblasts, which, in turn, cause increased production of rna messengers, leading to significant collagen production during periodontal tissue healing. the patient experienced no postoperative discomfort and he was able to comply with home care procedures, such as debridement, after the surgery. in contrast, patients often have post-treatment discomfort, and compliance with home care procedures decreases because the recommended home care protocols for plaque control are painful; this results in impaired healing. important changes were also detected in the patient: bleeding, a marker of inflammation with a high prognostic value, was compared at baseline and at 1 year after laser-assisted periodontal therapy, and was reduced significantly to<20%. absence of bleeding has a negative predictive value. besides laser therapy, the following therapeutic interventions all of these combined may have contributed to healing, complicating isolation of the most effective modality. the laser has been used as an adjunct to many periodontal treatments, but it is not a replacement for conventional non-surgical treatment or proper home care with adequate patient compliance. the absence of attached gingiva may be an etiological factor in the development of peri-implantitis; this issue is controversial. traditional protocols of non-surgical periodontal therapy, in conjunction with the use of an 810-nm diode laser, can be an effective alternative treatment modality for peri-implantitis. other treatment options may successfully enhance resolution of peri-implant soft and hard tissue inflammation, and preserve long-term periodontal health. regardless of the method used, correctly performed supportive periodontal therapy is a key factor in successful implant therapy.

an 810-nm diode laser was used to non-surgically treat a 7-mm pocket around an implant that had five threads of bone loss, bop+, and exudate, and the patient was followed up for 5 years. non-surgical treatment, home care reinforcement, clinical indices records, and radiographic examination were completed in two consecutive 1-h appointments within 24 h. the patient was monitored frequently for the first 3 months. subsequently, maintenance debridement visits were scheduled at 3-month intervals. the patient had a decreased probing pocket depth and a negative bop index compared to initial clinical data, and the results were stable after 1 year. after 5 years of follow-up visits, there appeared to be rebound of the bone level radiographically. within the limits of this case report, conventional non-surgical periodontal therapy with the adjunctive use of an 810-nm diode laser may be a feasible alternative approach for the management of peri-implantitis. the 5-year clinical and radiographic outcomes indicated maintenance of the clinical improvement.

PMC3917217

pubmed-1027

the amyloid- (a) peptide is believed to play a key pathogenic role in alzheimer s disease (ad). in vivo, a is characterized by a distribution of isoforms, mostly varying in length from 38 to 43 residues. the most prominent isoform, a40, typically occurs in a 10:1 ratio to the more amyloidogenic isoform, a42. knowledge of the origin of the a isoform distribution, and its dependence on sequence, environment, and cofactors, is critical to our understanding of the etiology of ad. a is the product of cleavage of app-c99 (c99), the 99 amino acid c-terminal fragment of the amyloid precursor protein (app), by -secretase. c99 consists of a single transmembrane (tm) helix flanked by less structured extra- and intracellular domains. processive cleavage is initiated in the c-terminal tm helical region and proceeds toward the n-terminus. cleavage of c99 has been correlated with a number of factors, including peptide sequence and stability of the tm helix. while the degree of homodimerization of c99 has also been discussed as a potentially important factor in c99 processing, the cleavage of c99 dimers has not yet been definitively demonstrated. environmental influences such as membrane composition, membrane curvature, and the presence of cholesterol may also play critical roles. it has been openly debated whether a quantitative description of c99 homodimerization structure is essential to a complete understanding of the mechanism of cleavage of c99 by -secretase and the genesis of the a isoform distribution. multhaup and co-workers first recognized that modifications in sequence that reduced homodimer affinity impacted cleavage of c99 by -secretase. subsequently, studies of homodimer formation in wt and mutant c99 congeners have provided support for the view that c99 homodimerization is critical to c99 processing by -secretase and a formation. however, it has also been argued that c99 homodimerization is weak and may be largely irrelevant in vivo, suggesting that -secretase acts on c99 monomer only as substrate in the production of a. additionally, while tycko and co-workers suggest that the structure of the tm region of c99 depends on membrane composition, recent work by sanders and co-workers supports the view that at least the backbone structure of c99 is largely independent of membrane lipid composition. in contrast, smith and co-workers suggest that the a product distribution following cleavage of c99 by -secretase may depend on the specific structure assumed by the c99 homodimer, which may depend on sequence and membrane composition. although there is debate over the relevance of c99 homodimer in the processing of c99 to form a, there is little doubt that c99 homodimer is an essential species in the overall ensemble of c99 structures. the earliest proposed structures for the homodimer of the tm region of c99 (figure 1) were right-handed coiled-coils stabilized by favorable interactions at the interpeptide interface facilitated by the gxxxg motif. this motif promotes a right-handed crossing in the -helices by providing a good surface for packing and permitting close helix proximity. in contrast, one recent nmr structure suggests that the structure of gs- c991555 (c991555 plus two non-native amino acids at the n-terminus) consists of a left-handed coiled-coil structure stabilized by interpeptide contacts facilitated by a heptad-repeat motif involving g38 and a42. a more recent nmr structure of c992355 homodimer finds a right-handed coiled-coil stabilized by interpeptide contacts in the c-terminal region. depiction of c991555 dimer in a popc lipid bilayer (left) and in a dpc micelle (right). the phosphocholine group is shaded orange (popc) or yellow (dpc). these contrasting results suggest that a number of fundamental questions related to the structure and processing of c99 in the production of a, including the structure of c99 monomer and homodimer, the sensitivity of monomer and homodimer structure to sequence and membrane, and the relevance of homodimer formation to c99 processing, remain open and require further scrutiny. here we address a number of critical questions regarding the nature of the c99 homodimer strucure and its dependence on membrane or micelle characteristics. what is the structural ensemble of the c99 homodimer in a micelle environment? how well do structures of c99 homodimer in a micelle represent the structural ensemble in a lipid bilayer? to answer these questions, we carried out multiscale simulations of c991555 dimer in popc bilayers and dpc micelles building on our previous successful predictions of the monomer structures. we used coarse-grained (cg) simulations with the martini force field of a broad sampling of the peptide dimer and lipid/surfactant ensemble. our model is benchmarked against the well-studied glycophorin a (gpa) dimer and used to develop novel predictions for the c991555 dimer. following the identification of the predominant structural states through cg simulations, representative conformations in all-atom molecular dynamics simulations were used to refine the atomistic structure and characterize the detailed peptide peptide, peptide the major finding of our work is that the structural ensemble in a bilayer is heterogeneous, consisting of multiple states, whereas in a micelle only one state is predominantly selected. globally the curvature of the bilayer and micelle is different, which has a profound influence on the conformational heterogeneity. more generally, our study demonstrates that the chemical environment imposes a selection on the nature of the app dimer ensemble. the environmental selection of the structure is yet another variable, besides sequence, which can affect the plasticity of app, and hence the product distribution upon cleavage by secretases. initial conditions for the cg parametrization were taken from the experimentally derived structures determined by nmr in dodecylphosphocholine (dpc) micellar environment (pdb 2loh) using the martinize.py script and the martini 2.2 force field for proteins. to build the popc cg systems, two spatially separated c991555 monomers were overlapped with the pre-equilibrated lipid systems taken from the marrink web site (http://md.chem.rug.nl/cgmartini/). all lipid and water residues within 1.5 of the cg peptide were removed. for the dpc cg systems the same dimeric 2loh structure was used. a dimer was embeded in a pre-equilibrated dpc cg micelle box also taken from the marrink web site. the cg bilayer system consisted of a c991555 dimer, 256 popc lipids, 3863 water particles, and 6 cl ions to neutralize the system. the cg micelle system contained c991555 dimers, 54 dpc lipids, 5597 water particles, and 6 cl ions. additional cg simulations were performed using 70 and 108 dpc surfactant molecules (see supporting information). for the cg simulations a total of 50 replicas with 1.5 s of md were performed on each system in order to see convergence in the computed distribution of homodimer structures (see figures s1 and s2). nonbonded interactions were truncated using shift functions (between 0.9 and 1.2 nm for lennard-jones interactions and between 0 and 1.2 nm for electrostatics). the temperature of the systems was set to 303 k using the berendsen weak coupling method with a coupling time of 0.1 ps. the pressure was set to 1 bar using a semi-isotropic coupling for popc and isotropic coupling for dpc using the berendsen algorithm. a cg structure from each of the different states in the popc bilayer and dpc micelle (gly-in, gly-side, and gly-out) was randomly selected and reconstructed into an all-atom representation using pulchra. the structure with its orientation were resolvated in popc lipids or dpc surfactant using the charmm-gui membrane and micelle builder and modeled using the charmm36 all-atom lipid and protein force field and tip3p water model. the bilayer systems consisted of the c991555 dimers reconstructed from cg models, 128 popc lipids, tip3p water molecules extending 15 on each side of the bilayer, and 6 cl ions to neutralize the systems. the micelle systems contained c991555 monomer, 53 dpc molecules, tip3p waters to solvate a box extending 20 from the dpc surfactant and protein, and 6 cl ions to neutralize the system. for simulations in the popc bilayer a total of 100 ns of md were performed on each system (following minimization and a short nvt and npt equilibration with protein backbone fixed). the pressure was set to 1 bar using a semi-isotropic coupling scheme with lateral and perpendicular pressures treated separately with coupling time 0.1 ps using the parrinello the temperature of the system was set to 303 k and regulated using the nos the nonbonded interactions were truncated using shift functions (between 0.9 and 1.2 nm for lennard-jones interactions and between 0 and 1.2 nm for electrostatics). long-range electrostatic interactions were calculated using the particle mesh ewald (pme) method with a fourier grid spacing of 0.12 nm. the linear constraint solver (lincs) method was used to constrain all bond lengths, with a 2 fs integration step. all-atom simulations in a dpc micelle were carried out under the same conditions using an isotropic coupling scheme to control the pressure. the simulations were carried out using gromacs (v4.5.1) and the analyses were performed using the gromacs package, the dssp program, and tailored scripts using python and md analysis libraries. the helanal program was used to calculate the kink angle along the tm helix between residues k28 and v50. c991555 homodimer was simulated using cg molecular dynamics in a popc bilayer and dpc micelle (see figure 2). multiple independent dynamical trajectories were initiated from the experimentally determined left-handed coiled-coil structure in a dpc micelle. all simulated replicas were observed to undergo conversion to a distribution that strongly favors right-handed helical packing (see figure 2). simulated distributions for a cg model of the c991555 homodimer in popc membrane (left panel) and dpc micelle (right panel) projected onto the order parameters 4 g and dgg. 4 g is the dihedral angle formed by g29a-g37a-g37b-g29b, where a and b label the two c991555 monomers, and dgg is the interhelical distance between g33a-g33b. the system sequence is shown below the panels where g29, g33, and g37 are highlighted and the tm helical domain is shaded. the black triangles depict the values of 4 g and dgg obtained from the experimentally derived nmr structure of c992355. the structure of the homodimer is conveniently characterized in terms of an interhelical distance, dgg and a dihedral angle, 4 g that differentiates the handedness of the coiled-coil. the 4 g order parameter is positive for left-handed structures and negative for right-handed structures. structures stabilized by interpeptide interactions facilitated by the gxxxg repeat region are characterized by small values of the dgg parameter. the first experimentally derived solution phase nmr structure of the c991555 homodimer in a micelle is characterized by a left-handed coiled-coil geometry with 4 g=+31 and dgg=20, forming an x-like homodimer configuration with minimal interpeptide contact in the g38xxxa42 region. in contrast, a more recent experimentally derived nmr structure of the shorter c992355 homodimer in a a micelle is characterized by a right-handed coiled-coil geometry with 4 g 25 and dgg 14. the simulated homodimer distribution in popc bilayer and dpc micelle environments are dominated by right-handed coiled-coil conformations. however, the broad distribution of homodimer conformations as a function of dgg (see figure 2) reflects the existence of distinct conformational states, implying considerable heterogeneity in the structural ensemble. structural ensembles of two c991555 monomers in a popc bilayer, derived from 50 independent cg replica simulations (see above), are presented in figures 2 and 4. interestingly, the c991555 homodimer assembled spontaneously on the time scale of a few hundred nanoseconds. this suggests that the sampling achieved with the cg model effectively represents the equilibrium homodimer structural ensemble in this single-component popc lipid bilayer. although there are three characteristic states in the popc bilayer, a significant shift in population between substates is observed in the dpc micelle environment. in particular, while the homodimer in a popc bilayer is predominantly found in the gly-in substate, in the dpc micelle the homodimer is dominanted by gly-side and gly-out conformations. analysis of the dimer ensemble (see figures 2 and 4) clearly shows the existence of multiple conformational state populations. crick identifies the location of a residue relative to the axis between the two helices (figure 3). smaller values (between 0 and 60) identify residues closer to the dimer interface, while larger angles (close to 180) denote residues on opposite sides of the interface. for the competing structural states, we find (1) gly-in configurations with close interpeptide contacts facilitated by exposure of backbone carbonyls in the gxxxg repeat region (small dgg, small crick), (2) gly-out configurations characterized by glycine repeats facing the outside of the homodimer interface (large dgg, large crick), and (3) gly-side configurations characterized by out-of-phase values of crick (intermediate dgg, small/large or large/small crick). similar observations have been made in past computational studies of c99 homodimerization employing simplified models. our results are consistent with those general observations, while providing a more detailed analysis of the homodimer ensemble and its dependence on environment. definition of crick corresponding to the angle between (1) the vector connecting the axis points of the two helices and (2) the vector connecting the c of a given residue to its corresponding -helical axis point. we define crick to be the average of the g33 and g37 dimer crick angles in order to characterize the g33xxxg37 interface. most representative structure is a gly-in state for the popc bilayer (top left) and gly-out state for the dpc micelle (top right). simulated distributions for a cg model of the c991555 homodimer in popc membrane (bottom left) and dpc micelle (bottom right) projected onto the crick angles characterize the relative orientation of peptides within a homodimer. the black triangles depict the values of crick obtained from the experimentally derived nmr structure of c992355. the atomic coordinates of the most representative structures (gly-in, gly-side and gly-out) have been deposited as supporting information. figure 5 shows the distance between residues ak28 and bk28 (kk28) or ak54 and bk54 (kk53) where a and b indicate different monomers. the two distances represent the separation between the interfacial residues of the tm helices, and is a good measure to characterize the global topology of the dimer structure. parallel or ll-like structures are characterized by both smaller kk28 and kk54 distances (5), -like structures show smaller kk28 distances and larger kk54 distances, x-like structures show large kk28 and kk54 distances (15), and y-like structures have small kk54 and large kk28 distances. simulations in popc adopt predominantly ll-or -like conformations consistent with our previous computational predictions of c992355 homodimer in a membrane environment. we predicted a -like right-handed helical dimer structure in agreement with solid state nmr studies with a predominantly gly-in orientation between the helices. in contrast, the dpc micelle simulations show larger populations of y- or x-like structures with a predominantly gly-out orientation between the helices (figure 4). distance between ak28 and bk28 (kk28) and ak54 and bk54 (kk54) in popc bilayer (left) and dpc micelle (right) colored by the most populated 4 g: red, green, and blue correspond to gly-in, gly-side, and gly-out conformations for data of cg simulations. the spot size corresponds to the number of structures for that particular kk28 and kk54 conformation. the black triangles are the values of kk28 and kk54 obtained from the experimentally derived nmr structure of c992355. on the lower section the most representative -like (far left) and ll-like (center left) conformations for the simulations in popc bilayer x-like (center right) and y-like (far right) conformations for the dpc micelle environment are shown in red. the k28 and k55 residues are indicated with orange spheres. results of additional cg simulations performed using 70 and 108 dpc surfactant molecules are shown in figure 6. qualitatively, we see that the x-like strucures are dominant for all micelle sizes. as the number of surfactant molecules is increased, there is a broadening of the distribution of x-like states. these results suggest that the micelle environment suppresses the sampling of gly-in conformations and favors x- and y-like structures, largely independent of the size of the micelle. left: distance between ak28 and bk28 (kk28) and ak54 and bk54 (kk54) colored by the most populated 4 g: red, green, and blue correspond to gly-in, gly-side, and gly-out conformations for data of cg simulations in 70 dpc surfactant molecules. the right panel corresponds to kk28 and kk54 for the c991555 system in 108 dpc surfactant molecules. the spot size corresponds to the number of structures for that particular kk28 and kk54 conformation. we performed all-atom simulations using charmm36 in popc bilayer and dpc micelle environments, starting from representative cg structures from the gly-in, gly-side and gly-out homodimer conformational states. experimental data suggest that the average stability of the tm helix is similar for monomeric peptide and peptide associated as a homodimer. average helicity of each peptide in the micelle and bilayer is shown in figure 7. we also show results for the simulated helicity of c991555 monomer in dpc micelle and popc lipid for comparison, along with experimentally derived helicity values for monomeric c99 in a micelle. the average helicity in the tm domain of the simulated peptide is in good agreement with the experimentally measured helicity, while helicity in the juxtamembrane (jm) domain is somewhat larger in the simulated structures. this could result from differing size of the hydrophobic core in the micelle versus the bilayer, as the higher water accessibility in the micelle is expected to impact the stability of the helix structure, as well as the differing head groups and interfacial environments of the dpc (zwitterionic, simulation) and lmpg (anionic, experiment) micelles. average helicity over the three different states (gly-in, gly-side, and gly-out) calculated from all-atom simulations of c991555 homodimer in a popc bilayer (above) and dpc micelle (below). thin black lines show results for helicity of c991555 monomer in the corresponding micelle or bilayer. the gray shadow shows experimentally determined helicity based on c nmr chemical shift measurements for monomeric c99155 in an lmpg (lysomyristoylphosphatidylglycerol) micelle. structural fluctuations in the kink angle are enhanced and less symmetric in the c991555 homodimer in a dpc micelle relative to the homodimer in a popc bilayer, while fluctuations in homodimeric c991555 are smaller in magnitude than those observed for the c991555 monomer (see figure 8). in particular, in the vgsn region we found more substantial fluctuations in the helicity that can be related to the surface curvature of the micelle environment. our results indicate that a structural kink appears near g37/g38 in the c991555 monomer in a popc bilayer and dpc micelle, as has been proposed for the monomer structure based on experimental results for c99155 in a lpmg micelle. a structural kink is also observed near g37/g38 in the c991555 homodimer in the dpc micelle environment. however, simulations of c991555 in dpc micelles show additional structural kinks in the tm helix. greater kink angles are induced in an attempt to match the hydrophobic length of the tm helix with the hydrophobic thickness of the small dpc micelle. gly-in conformations that destabilize the tm-c domain show a large kink at t43, while gly-out structures that destabilize the tm-n helix show a large kink at g33. measurement of the observed kink angle for each peptide of the all-atom simulations of c991555 homodimer in a popc bilayer (top) and dpc micelle (bottom). for the three different systems, gly-in (dark pink), gly-out (blue) and gly-side (green), the filled curve represents the difference a bkink=akink bkink, where akink and bkink are the kink angles of peptides a and b, respectively. the hinge angle in the c991555 monomer is shown in black for popc bilayer and dpc micelle simulations. densities of the lipid phase of the popc bilayer and dpc micelle were computed using all-atom simulations of the c991555 homodimer (figure 9). superimposed on the density profiles are distributions of key peptide residues. importantly, although the density profiles of the lipophilic phase of the bilayer and surfactant micelle are similar, the solvent distributions in the two environments are dramatically different. in addition, the relative positions of key residues, including the -cleavage site, are significantly shifted relative to the center of the lipophilic phase in the dpc micelle when compared to the popc bilayer. density distribution of the lipid phases (shadow) for the all-atom simulations of the popc bilayer (above) and dpc micelle (below). superimposed are the distributions of c positions of key residues along the z-axis for dimer a (solid lines) and dimer b (dashed lines) of c991555 for gly-in (red), gly-out (blue), and gly-side (green) conformations. the number of waters molecules (nw) within 4 of each amino acid of the dimers are indicated by blue bars. the epr power saturation data derived from experimental measurements is shown for comparison (black dashed line). a recent study involving h/d exchange experiments on the c99 peptide, complemented by molecular dynamics simulations of c992855 in a popc bilayer, provided insight into the stability of helical regions of c99 including the tm helix. considering the hinge at g37/38 to be a flexible divider in the tm helix, the n-terminal region of the tm domain (tm-n helix) showed enhanced h/d exchange relative to the c-terminal portion (tm-c helix). our simulation results for the c991555 homodimer in a dpc micelle, in which a dominant hinge and less stable tm-n domain are observed, are consistent with those experimental and computational results. studies have indicated that membrane protein structure in micelles and membranes can be similar for certain systems. the gpa homodimer has been extensively studied in micelle and bilayer environments, through both experimental and computational approaches, making it an excellent reference system for understanding environmental effects on the c991555 homodimer. homodimerization of gpa in a micelle has been explored using all-atom molecular dynamics simulation, yielding good agreement with known experimental structures. moreover, simulations employing an all-atom model of the gpa homodimer in dpc surfactant micelle and dmpc/dhpc lipid bicelles found the general topology of the homodimer to be similar in both environments. in contrast, other studies have noted a dependence of protein structure and association on the differing structural environments of micelles and bilayers, as well as the particular detergent composition of micelles or lipid composition of membrane bilayers. there is substantial evidence that for a particular membrane system, a careful choice of detergent must be made to create a micellular environment in which the protein conformational ensemble is similar to that in a membrane bilayer. it has been observed that dimerization of gpa can be modulated by detergents, with variations in alkyl chain length and headgroup nature (ionic, zwitterionic, and nonionic) potentially influencing helix stability and helix dimerization. as a result, variations in detergent may impact helix dimerization while having little impact on helix stability. finally, it is known that tm helical structure and stability can show a strong dependence on lipid composition in membrane bilayers. as in the case of c99, dimerization of the gpa tm domain has been proposed to be a consequence of favorable intermolecular interactions facilitated by gxxxg motif repeats. we have simulated the sequence of gpa62101 using the same multiscale simulation approach employed in our study of c99. the gpa62101 sequence includes a tm helical domain and n-terminal juxtamembrane domain, as is the case in c991555. good order parameters for the homodimer structures in gpa (c99) are (1) dihedral angle gt formed by g18a-t26a-t26b-g18b, where a and b label the two gpa62101 monomers, (2) interhelical distance dgg between g22a and g22b, and (3) the crick angle crick of the gxxxg motif. the gt order parameter is positive for left-handed structures and negative for right-handed structures. structures stabilized by interpeptide interactions facilitated by the gxxxg repeat region are characterized by small values of the dgg parameter and small values of gt. experimentally derived nmr structures are found to agree well with the simulation predictions in terms of (gt, dgg). differences of 15 are observed in the comparison of crick angles between experimentally derived and computationally predicted structures. the observed differences may result from inherent limitations in the spatial resolution of both the coarse-grained model employed in our study and experimental data. left: simulated distributions for a cg model of the gpa62101 homodimer in a popc bilayer projected onto the order parameters gt and dgg (top), and onto the crick angles crick (bottom). the panels on the right corresponds to gt and dgg (top) and crick angles (crick) (bottom) for the gpa62101 system in 56 dpc surfactant molecules. triangles represent nmr structures derived from gpa62101 in dpc micelles (1afo, black), gpa7098 in dpc micelles (2kpe, green), and gpa6198 in dmpc/dhpc bicelles (2kpf, red). our simulations results suggest similarities between between the dpc micelle and popc bilayer simulations of gpa62101 and c991555 homodimers, as well as sequence specific effects differentiating the two dimer ensembles. (1) the strucural distribution of c991555 dimer is signficantly more diverse than in the case of the gpa62101 homodimer. (2) in both gpa and c99 homodimers, the structural ensembles are found to be significantly more diverse in the bilayer environment, relative to the micelle, consisting of multiple distinct conformational substates. in the dpc micelle, only one of the substates tends to be represented as it is selectively stabilized by the micelle geometry and surface curvature. it is useful to note that while gpa explores gly-side and gly-out homodimer conformations in a bilayer environment, the distribution is substantially more focused and dominated by right-handed gly-in structures than in the case of c991555 homodimer. the results of this study, showing a clear dependence of c991555 homodimer structure on micelle and bilayer environment, are consistent with this understanding. the earliest predicted structures for the c992355 fragment, containing the tm helical domain, proposed a right-handed coiled-coil structure consistent with the gly-in topology described in this work. a recent nmr structure of the c992355 homodimer in a dpc micelle environment is also a right-handed coiled-coil, although of the gly-out topology. an earlier nmr structure for the c991555 homodimer in a dpc micelle environment led to the proposal of a left-handed coiled-coil of the gly-out topology. however, it was noted the homodimer ensemble may well contain right-handed and left-handed coiled-coil structures. it is expected that both the length and sequence of the c99 fragment are critical to the ultimate homodimer structure. while dimers formed from the wt tm domain alone are almost certainly right-handed coiled-coils in most environments, it is possible that introducing mutations within the tm domain or the addition of the jm domain could lead to a shift in the relative population of one of the various dimer states (gly-in, gly-side, or gly-out) or a change in the handedness of the homodimer. it has been observed that small changes in sequence can strongly impact binding affinities for tm homodimers. our study has focused on the c991555, while the work of the arseniev laboratory is based on gs-c991555, in which two non-native amino acids (gs) have been added to the n-terminus. it is possible that the addition of these residues, not included in our computational study, could impact the structure of the jm domain and also the handedness of the resulting homdimer relative to c991555. in this context, it is important to note that our study focuses on c991555 rather than full-length c99. therefore, our results must be considered to provide insight into, but not fully represent, the properties of the full-length peptide. additional analysis shows good agreement between chemical shifts computed from our simulated homodimer structures and experimentally derived chemical shifts (see figures s3 and s4). however, the experimentally derived noe data provide unambiguous support for a left-handed coiled-coil structure of gs- c991555 homodimer in dpc micelle. this suggests that the chemical shifts are largely determined by the secondary structure of the peptide and local environment and are weak reporters on the nature of the tertiary coiled-coil geometry. the findings of this paper provide a complete and self-consistent framework for organizing the existing experimental and computational results. for structures of the tm domain represented by the c992355 peptide, computational and experimental results suggest that in most membrane and micelle environments the structure is a right-handed coiled coil. the particular homodimer topology will depend on the membrane thickness or micelle size and curvature, with thinner environments (dmpc bilayer) and those with substantial surface curvature (dpc micelle) selecting gly-out topologies, with thicker environments (popc bilayer) selecting gly-in structures. evidence from this study as well as the available nmr structures suggest that the handedness of the coiled-coil structure adopted by c991555 is ultimately primarily determined by (1) a preference of the tm domain of the wt protein to form a right-handed coilded coil, (2) characteristics of the membrane or micelle thickness and surface curvature, and (3) the secondary structure and relative position of the jm domain. in our study of the wt c991555 in popc bilyaer and dpc micelle, we have largely assumed that the jm domain is helical, leading to a preference for a right-handed coiled-coil structure. however, fluctuations in the structure of the jm domain and its orientation relative to the tm domain may lead to a relative stabilization of left-handed coiled-coil strutures. overall, the homodimer ensemble must be considered to consist of left- and right-handed coiled coils, representing gly-in, gly-side, and gly-out topologies. the handedness and topology of the dominant homodimer structure will be determined by the protein sequence and the bilayer or micelle. we find the c991555 homodimer structural ensemble in popc micelles and dpc bilayers consists of multiple conformational states that are structurally distinct and largely characterized by the relative orientation of the peptide helices. a dynamic hinge near g37/g38 is observed to divide the tm helix, with structural fluctuations being greater in the micelle than in the popc bilayer environment. dimerization results in little change in helix stability in the popc bilayer, but a measurable decrease in helix stability is observed in the dpc micelle. although the dimer ensemble in either environment is characterized by multiple conformational states, the dominant structures observed in our simulations in both the dpc micelle and popc bilayer are consistently right-handed coiled-coil structures, supporting the conclusions of earlier experimental and computational studies. the relative importance of particular states is modulated by the c991555 homodimer environment. the gly-in substate (stabilized by interpeptide contacts facilitated by the gxxxg motif repeats) is predominant in a popc bilayer environment, while the gly-out conformation (stabilized by interpeptide contacts consistent with a heptad repeat motif including g38 and a42) is dominant in a dpc surfactant micelle environment. our results suggest the dpc micelle environment suppresses interactions mediated by gxxxg repeats in the tm region, leading to an x-shaped structure that best satisfies the boundaries of the surfactant/solvent interface. in this way, the environment selects a predominant substate through membrane thickness, interfacial curvature, and peptide-lipid interactions. past computational studies of homodimers of the tm domain of c99 have noted similar heterogeneity in the homodimer ensemble. moreover, it has been proposed that the tm domain of c99 may be processed to the sites depending on its dimerzation state and on the orientation of the tm helices in the dimers. our findings support these prior studies suggesting a role for membrane in modulating the formation of specific c99 homodimer structures for processing by secretases, as well as our interpretation of structures derived in diverse micelle environments.

the 99 amino acid c-terminal fragment of amyloid precursor protein (c99), consisting of a single transmembrane (tm) helix, is known to form homodimers. homodimers can be processed by -secretase to produce amyloid- (a) protein, which is implicated in alzheimer s disease (ad). while knowledge of the structure of c99 homodimers is of great importance, experimental nmr studies and simulations have produced varying structural models, including right-handed and left-handed coiled-coils. in order to investigate the structure of this critical protein complex, simulations of the c991555 homodimer in popc membrane bilayer and dpc surfactant micelle environments were performed using a multiscale approach that blends atomistic and coarse-grained models. the c991555 homodimer adopts a dominant right-handed coiled-coil topology consisting of three characteristic structural states in a bilayer, only one of which is dominant in the micelle. our structural study, which provides a self-consistent framework for understanding a number of experiments, shows that the energy landscape of the c99 homodimer supports a variety of slowly interconverting structural states. the relative importance of any given state can be modulated through environmental selection realized by altering the membrane or micelle characteristics.

PMC4105063

pubmed-1028

bone-density depleting disorders including osteoporosis (ops) and osteopenia (opn) are age-related disorders characterized by low bone mineral density (lbmd) and destruction of bone tissue micro-architecture, resulting in susceptibility to the pathologic fracture (1). osteoporosis and opn are commonly expected in postmenopause women over fifty years of age because of hormonal imbalance. bone micro-architecture remodeling is continuous and natural process containing bone resorption and new bone formation. these regular processes also control the calcium homeostasis, and replacement of bone tissue affected by microfractures (2). therefore, ops can cause several major skeletal problems, such as pathologic fracture and thereby put at risk the general health. osteoporotic fractures (vertebral or hip) as pathologic fractures are associated with significant mortality and morbidity. these complications can affect the health-related quality of life (hr-qol). previous studies showed that hr-qol (estimated by the sf-36 questionnaire) was affected two years after vertebral and hip fractures (3). low bone density (lbd) is one of the most challenging worldwide therapeutic problems, particularly in the developed country (2, 4). different therapeutic agents have been recommended for ops and opn that they purpose to prevent the disease progression or reduce the risk of fractures. calcitonin is an antiresorptive agent, which has been confirmed for the treatment of ops since 2 decades ago (5-8). calcitonin (nasal or injection form) via inhibiting the osteoclastic activity can reduce the risk of osteoporotic fracture. previously, the therapeutic effects of calcitonin on ops and lbd were investigated by using bmd (9). this study aimed to evaluate the effect of nasal calcitonin on qol in postmenopause women with lbd. we evaluated postmenopause women who had referred to the general clinic of rheumatology in baqiyatallah university of medical sciences, tehran, iran during a 1-year period between 2009 and 2010. finally, one hundred and fifteen cases met the inclusion criteria: (1) bmd at any site of measurement with a t score<-1 sd which is accepted as an international criterion of lbd (osteopenia) in postmenopause women; (2) no evidence for secondary opn; (3) no sufficient response to the pharmacological doses of vitamin d within the past 6 months. patients were overruled if they had present or previous history of nasal polyps or a nasal septal perforation and previous treatment episode with prednisone or other medication which interfering bone metabolism such as estrogen or progesterone, bisphosphonates, and calcitonin. the presence of secondary opn, other bone disorders or other important medical conditions such as hyperparathyroidism, hyperthyroidism, neoplastic disorders and other were left out based on the patient s history, whole body physical examination, routine laboratory tests, and, if necessary, hormone assessment and additional assessment for suspected patients. the patients received 200 iu nasal calcitonin with 2 word brand names (nasocalcin nasal spray 200 iu, sinadaru, tehran, ir iran and miacalcic 200 iu nasal spray, novartis, uk) once a day along with calcium tablet (1000 mg) and vitamin d (400 iu) for 6 months. the suspected adverse effects were explained for every participant and all patients were visited every 2 months for adverse effect and efficacy of treatment on clinical manifestation. also, bmd was evaluated by a dual-energy x-ray absorptiometry (norland company, usa) at the femoral neck and lumbar spine (l2-l4). bone mineral density was assessed at the end of the study on last visit and compared with the baseline. urine and blood samples were collected for the biochemical bone marker assessment at the first and 6 months after the beginning of the treatment. calcium homeostasis was observed by measuring serum and 24-hour urinary calcium and phosphorus levels, parathormone (pth) serum levels and serum alkaline phosphatase (alp). other laboratory parameters, which were assessed during the treatment, were as follow: cell blood count, serum calcium, serum phosphorus, creatinine (cr), albumin, blood urea nitrogen (bun), electrolyte (na and k) and liver aminotransferases. serum and urine samples were collected on the morning without fasting and avoidance from tobacco. at this clinical survey, a detailed hr-qol questionnaire including the validated persian version of short-form 36 (sf-36) questionnaire was used (10). we used the persian version of the sf-36 questionnaire which was extensively evaluated in both reliability and validity base on persian conditions (10-12). also, the sf-36 has been confirmed under swedish conditions and in several other countries (13-15). moreover, the quantitative variables distribution was assessed using the kolmogorov-smirnov test and then represented as mean sd (standard deviation) and qualitative variables frequency is presented as a percentage. the paired t-test and pearson correlation were used to compare the impact of calcitonin on the quantitative variables. also, the mantel-hanzel and two-tailed wilcoxon tests were used to compare between qualitative variables and nonparametric variables. finally, linear regression model was used to justify the effect of the confounding factors. spss version 16 (illinois, usa) was used to analyze the data and p values 0.05 were considered statistically significant. one hundred and fifteen postmenopause women were included (age range, 47-84 years). all patients completed the two steps of the study (failure to follow: 0%). this difference in bmd of lumbar spine was statistically significant but not significant in femur s bmd. c-telopeptide of type i collagen (ctx; as a bone resorptive marker) over the 6-month treatment was decreased significantly (3.203 2.24 vs. 2.497 1.657, p value<0.001). at the baseline, 55.3% of the patients suffered from low back pain although the frequency of the low back pain during the study changed to 3.5%, 1.8% and 0%, which is statistically significant (p<0.001). the 24-hour urine ca level was increased significantly compared to the baseline (from 216.96 114.68 to 270.87 155.47, p<0.001). the 24-hour urine cr level raised from 0.93 0.35 to 1.08 0.37 that this change was significant. moreover, bun at the baseline was 17.08 4.07 and the amount was significantly increased at the end of the study to 18.17 4.35 (p=0.043). serum levels of pth, ca, ast, alt and alp total were not changed significantly (p value>0.050). also, the changes in femur bmd amount were significantly correlated with weight (p=0.014, r=-0.244) and bmi (p=0.022, r=-0.301). at baseline measurement, the total qol score were 88.05 15.63, and also 6 months after the treatment the sf-36 score was 92.15 13.22. this difference in hr-qol score was statistically significant (p<0.001) (table 2). by using partial correlation, although the probable confounding role of age, age at menopause number of pregnancy, the amount of exercise per day and bmi were adjusted, the difference between baseline and final total score of hr-qol was statistically significant (p<0.001). regarding to the univariate test and by using the multivariate analysis, we adjusted the hr-qol score changes regarding to the role of demographic variables. also, changes in the hr-qol score had a significant correlation only with educational level (p=0.010, f=4.252, power=97.5%); however, other demographic characteristics such as age at menopause, age, bmi, number of pregnancy and the amount of exercise per day had no significant correlation with hr-qol (p>0.050). changes in hr-qol domains over the 6-month treatment period are presented in table 3. changes in hr-qol domains only in general health (gh) and the short form 36 health survey (sf-36) were not statistically significant (0.309 and 0.917, respectively). by using the linear regression model, all of the hr-qol s domains changed significantly compared to the changes in total hr-qol score (p<0.001) and also affected by other domains. table 4 demonstrates the median change in sf-36 score over follow-up for each domain according to its correlation with together and it seems that mental health (mh) was the most effective item, which affected the total sf-36 score change (p<0.001, t=26.13). abbreviations: bp, bodily pain; gh, general health; mh, mental health; pf, physical function; er, emotional role functioning; p, p value; r, correlation coefficient; rp, physical role functioning; sf, social function; vt, vitality. statistically significant. the changes in hr-qol domains score during the study were assessed according to the bmd changes and we found that only t-score of spine s bmd and total t-score s changes were significantly correlated with the hr-qol total score changes (p=0.003 and p=0.028, respectively). by using the multivariate analysis, we adjusted the changes in the score of hr-qol domains regarding to the role of demographic variables and we found that only changes in mh score were significantly correlated with total bmd score changes (p=0.037), bp score was significantly correlated with bmi (p=0.049) and rp score was also significantly correlated with bmi and age at menopause (p=0.009 and p=0.013, respectively). osteoporosis and the decrease in bmd is a major health problem throughout the world and its prevalence is increasing especially in developed countries because of increasing in the community age (16). osteoporosis is the main cause of pathologic hip and vertebral fractures in elderly (17). also, ops and decrease in bone mass can increase mortality and morbidity rate substantially (1, 17, 18). previous study demonstrated that the osteoporotic cases have lower qol due to limitation in physical activity, chronic mild pain and etc. in spite of the comorbidity and fracture, individuals who affected by lower bone density had poorer qol (19). the preventive, analgesic and therapeutic impact of nasal calcitonin on the spinal fracture and therefore back pain in the osteoporosis was declared (20). also, qol improvement (regarding to the improvement in spine bmd) was coordinated by significant reduction in the frequency of low back pain, which is match with previous reports in osteoporotic patients without the obvious bone fracture (21). therefore, it is expected that an effective treatment protocol can improve the hr-qol of these patients. calcitonin is bone resorptive inhibitors, which has approved for treatment of osteoporosis, low bone density and other disorder involving increased bone turnover since 25 years ago. the present study is the first from iran to assess the effectiveness of nasal calcitonin on hr-qol in osteopenic postmenopause women. however, the present study showed a raise in spine bmd more than femoral bmd that this is similar to previous trial studies. also, bmd by dual-energy x-ray absorptiometry (dxa) is a reliable method for tracking the response to treatment in patients with ops. changes in bmd score when appear that the bone density be increased at least 3-5% from the baseline (22). alike confirmed the efficacy of 200 iu daily intranasal calcitonin on improvement of lumbar bmd (7). however, we found that changes in the spine t-score were correlated with changes in the total hr-qol score, especially mh. in addition, patients with higher grades of spinal bone density loss showed lower qol score, recommending that the results of vertebral fracture are related to qol (23). also, regarding to the findings, mh was most effective domain, which significantly influenced the total score of hr-qol. by contract, dennison et al. demonstrated that in osteoporotic women, mh, sf and re are related with total femur bone density (19). also, the mh field is that most of the other areas are affected by confounding factors and it is important to consider all characteristics before interpreting the changes (19). moreover, mh was considered as major domain of hr-qol compared to other domains for predicting the qol worsening in progression of bone density loss (24). moreover, femoral neck bmd changes were significantly correlated with bmi and weight and in the other hand physical activity and somatic-related domain of hr-qol such as bp and rp were correlated with bmi; however, they were not significantly correlated with femoral bmd score changes. according to our findings, previous studies confirmed that exercise provide modest benefits for post-menopaus women with opn such as increasing in bmd and also improved the hr-qol of these patients (25). overall, it can be assumed that mental health-related qol are more likely related with spinal bmd changes and physical health-related qol domains are more likely related with femoral neck bmd changes. in contrast, dennison et al. demonstrated that they have not found any relationships between the lumbar spine bone loss rate and hr-qol in any domain. previously, calcitonin has been certified for treatment of symptomatic ops although the recent studies clarified the efficacy of nasal form of calcitonin (26, 27). in this study bodily pain and physical role functioning (pr) had significant changes over the 6-month treatment period with calcitonin, which these findings are consistent with each other. level of education was identified as an effective factor on the progression of ops and response to the treatment according to the bmd improvement and in this study, educational status was correlated with hr-qol changes (28). education can enhance the patients insight and improve the life style and thus assist to the plan of therapy. also, in the present study, we found that bmd t-score of femoral neck was significantly associated with weight and bmi, which it is relatively supported by the previous studies (23, 28). the limitation of this study was short-term duration of follow-up and we have not observed long-term effects of nasal calcitonin on hr-qol. moreover, we did not have a control group to exclude the role of race or nationality although no patients had past history of psychiatric disorders. finally, to confirm the analgesic role of nasal calcitonin on the back pain and also qol in nonfractured opn, we recommend using a quantitative scale such as visual analogue scale (vas) along with the qol questionnaire. according to the results of this study, it seems intranasal calcitonin can effectively improve qol of women with low bone density via improving in bone density and bmd and also decreasing bone turnover. furthermore, it seems that hr-qol changes were not influenced by demographic or clinical characteristics.

background: physical activity and mental health could be affected by osteoporosis and various therapeutic options such as calcitonin may influence quality of life (qol) of these patients with low bone density (lbd). objectives: this study aimed to evaluate the effect of nasal calcitonin on qol in post menopause women with lbd. patients and methods: this clinical trial study was performed on one hundred and fifteen menopause women with lbd less than 1 sd in bone mineral densitometry (bmd) referred to baqiyatallah hospital in tehran, iran, during 2009-2010. they were assigned to receive 200 iu calcitonin nasal spray along with calcium (1000 mg) and vitamin d (400 iu) for 6 months. quality of life was assessed by short-form 36 (sf-36) questionnaire (persian-validated version). results: the mean age (sd) of the participants was 58.75 8.15 years. intranasal spray of calcitonin increased qol scores significantly (88.05 15.63 vs. 92.15 13.22, p value=0.000). bone mineral density of spine was increased from 0.834 0.11 to 0.12 0.852 and this difference in bmd of lumbar spine was statistically significant (p value: 0.003) but not significant in femur s bmd (p value=0.061). in comparison with bmd indexes, the qol scores especially mental health domain changes had only a significant correlation with the changes of total t score in bmd (p=0.031, coefficient correlation=0.248). conclusions: it seems that nasal spray of calcitonin can effectively improve qol of women with lbd and qol changes were not influenced by clinical or para-clinical alteration. mental health domain must be more considered in further studies as a predicting domain for health-related quality of life (hr-qol) changes.

PMC4584075

pubmed-1029

the objective of root canal treatment is thorough cleaning and shaping of all the pulp spaces to be filled with an inert filling material. a major cause of failure of the root canal treatment is the inability to locate, debride, or adequately fill all canals of the root canal system. a successful root canal treatment depends on the diagnosis, treatment planning, good knowledge of the root canal system, and its frequent variations. there are numerous studies that examine the root and root canal anatomy of different populations using different methods like sectioning, canal sectioning, and tooth clearing techniques, conventional radiography, digital radiographic techniques, contrast medium-enhanced radiography, and computed tomographic scanning. the tooth clearing methods have generally been considered the gold standard for analyzing the root canal anatomy, which involves making the tooth transparent and staining the canals for study, but these ex-vivo methods require the extraction of a tooth. there are case reports of the incidence of second mesiobuccal (mbi) canals ranging between 18 and 96.1%. the incidence of five canals is reported to be 2.25 2.4%, and the incidence of six canals is reported to be 0.31 0.88%. the incidence of a second distobuccal (dbi) canal in the maxillary first molars has been reported to be as low as 1.7 and 1.25%. case reports with more than four root canals have also been reported in three-rooted maxillary first molars [table 1]., reported one maxillary first molar out of 140 samples having three roots and seven canals. kottoor et al., reported the endodontic management of the maxillary first molars with seven and eight canals, respectively. incidence of multiple canals in maxillary first molars this case report discusses the endodontic management of an unusual root canal configuration in a maxillary first molar showing three roots and seven canals. this unusual morphology was confirmed with the help of cone beam computerized tomography (cbct) scans. an 18-year-old male patient reported to the department of conservative dentistry and endodontics, sinhgad dental college and hospital, pune, with the chief complaint of spontaneous pain in the upper left posterior region of the jaw for the past five days. the patient gave a history of intermittent pain for the last two months, which had increased in intensity in the preceding five days. on clinical examination, a deep disto-occlusal carious lesion, which was tender on percussion, with no mobility, was seen in tooth 14. vitality testing of the involved tooth with heated gutta-percha (dentsply maillefer, ballaigues, switzerland) caused an intense lingering pain, whereas, an electronic pulp tester (parkell, usa) gave an early response. a preoperative radiograph revealed disto-occlusal radiolucency approaching the pulp space, with the periodontal ligament space widening in relation to the mesiobuccal root. from the clinical and radiographic examination, a diagnosis of symptomatic irreversible pulpitis with symptomatic apical periodontitis was made and nonsurgical endodontic treatment was recommended. radiographic evaluation of the involved tooth did not indicate any variation in the root canal anatomy. local anesthesia was induced using 1.8 ml of 2% lignocaine and adrenaline (aqua fine injecta pvt. ltd., pune, india). after caries excavation, the distal surface of the tooth was built up with composite resin (matrix, medicept dental prod, uk) to enable optimal isolation. initially, the mb1, db1, and two palatal canals (mesiopalatal (mp) and the distopalatal (dp)) were located. when viewing the floor of the pulp chamber under a dental operating microscope (dom) (moller wedel, germany), three additional root canal orifices (mb2, mb3, and db2) were located and conventional triangular access was modified to a trapezoidal shape, to improve access to the additional canals [figure 1a and b]. the patency of the canal was confirmed with iso #10 k-files (mani, japan). to confirm this unusual morphology, it was decided to perform cbct imaging of the tooth. a sterile cotton pellet was placed in the pulp chamber and cavit g (3 m espe dental products, st paul, mn) was used to seal the access cavity. informed consent was obtained from the patient, and a multislice cbct scan of the maxilla was performed with a tube voltage of 100 kv and a tube current of 8 ma. the involved tooth was focused and the morphology was obtained in the transverse, axial, and sagittal sections, of 0.5 mm thickness. the cbct scan slices revealed seven canals (three mesiobuccal, two palatal, two distobuccal) in the left maxillary first molar [figures 2a and b, 3a and b]. (a) access opening (b) access opening (a) coronal section (b) coronal section (a) apical section (b) apical section the cbct images provided valuable information regarding the canal configuration and confirmed the seven canals that were not clearly seen in the conventional radiograph. at the next appointment, after two weeks, the patient was asymptomatic. the working lengths were determined with the help of an apex locator (root zx, j morita, tokyo, japan), under rubber dam isolation, and intraoral periapical radiographs of the mesiobuccal, distobuccal, and palatal root were taken to confirm the working lengths [figure 4a and b]. cleaning and shaping were performed using nickel-titanium rotary instruments (m2, dentsply vdw, germany) using the crown-down technique. during root canal preparation, final rinsing of the canals was performed using 2% chlorhexidine digluconate (asep rc, stedman anabond, chennai, india) together with passive ultrasonic agitation. the canals were dried with absorbent points (dentsply maillefer, ballaigues, switzerland) and obturation was performed using cold lateral compaction of the gutta-percha (dentsply maillefer, ballaigues, switzerland) and ah plus resin sealer (dentsply detrey, konstanz, germany). a radiograph was taken to establish the quality of the obturation [figure 5a and b]. after completion of root canal treatment, the tooth was restored with a posterior composite filling (matrix, medicept dental products, uk) and the patient was advised to have a full coverage porcelain crown. mb root (a) obturation (b) clinical view of the pulp chamber post obturation before undergoing root canal treatment, prior knowledge of the roots and root canal anatomy of the teeth is required. in the maxillary molars, anatomic variations are not uncommon, with the number of canals, from one to eight. recently, 14 new additional canal types were reported by sert and bayirli, highlighting the complexity of the root canal systems. in this case, it helped to confirm the presence of multiple canals, which were otherwise not able to be identified, except through the microscope. the tenet of as low as reasonably achievable (alara) was considered, but the advantage of using cbct outweighed the risks of additional exposure. a cbct scan and surgical operating microscope confirmed the diagnosis of three roots and seven canals in the left maxillary first molar, namely, mb1, mb2, mb3, db1, db2, mp, and dp. the cbct axial images showed the mesiobuccal root had a sert and bayirli type xv canal configuration. the mb2 and mb3 joined together to exit as one and the db1 and db2 joined to exit as one. in clinical conditions, conventional periapical radiographs and digital radiographs taken in different angulations are an essential part of endodontic treatment for the identification of root and canal configuration. however they are taken in a buccal-lingual direction and give only two-dimensional information about a three-dimensional object. in recent years, advanced techniques like computed axial tomography scanning are being used to evaluate root canal morphology, as a three-dimensional image. it allows the operator to view the tooth roots and their root canal systems at different levels, which helps to identify a larger number of morphological variations than in the conventional radiographs. cbct images are reconstructed using significantly lower radiation doses when compared with the alternative conventional computed tomography scanning. this is because, with cbct scanning, the raw data are acquired in the course of a single sweep of a cone-shaped x-ray source and reciprocal detector around the patient's head. of the various comprehensive maxillary first molar ex-vivo studies in dental literature, of the 140 extracted maxillary first molars evaluated, only one tooth showed seven root canals, which contained three mesiobuccal, three distobuccal, and one palatal canal. the frequency of the mb2 canals in the mesiobuccal root was reported to be 92.85% (based on ex-vivo results), 95.63% (based on clinical results), and 95.45% (based on cbct results), whereas, the corresponding figures for the distobuccal root (db2) were 1.15% (ex-vivo) and 3.75% (clinical), and those for the palatal root (second palatal canal) were 2.05% (ex-vivo), 0.62% (clinical), and 4.55% (cbct). three canals in the mesiobuccal root were reported by various authors [table 1]. additional mesiobuccal canals were commonly found in the age group of 20 to 40 years. in the present case, the use of a dental operating microscope helped in the location and identification of additional canal orifices. as an additional finding, the contralateral maxillary first molar had additional root canals, which were clearly appreciable in the cbct. thorough knowledge of the root canal anatomy is an essential pre-requisite for endodontic success. the knowledge that aberrant canals are more common than earlier assumed is increasingly being proven. the clinician should use increased magnification and advanced diagnostic aids similar to cbct, to ensure identification and location of additional canals.

the main objective of root canal treatment is thorough cleaning and shaping of the entire pulp space and its complete filling with an inert filling material. a major cause of post-treatment disease is the inability to locate, debride or adequately fill all canals of the root canal system. the form, configuration, and number of root canals in the maxillary first molars have been discussed for more than half a century. maxillary first molars commonly present with three roots and three canals, with a second mesiobuccal canal (mb2) also present. with the advent of improved magnification there are reports of multiple root canals in the maxillary first molars. nonsurgical endodontic therapy of a left maxillary first molar with three roots and seven root canals was successfully performed under a dental operating microscope. the diagnosis of multiple root canals was confirmed with the help of cone beam computed tomography (cbct) images.

PMC4213875

pubmed-1030

this project was developed for the second semester of a two-semester, two-credit introductory organic chemistry laboratory course sequence for chemistry and related majors; the project was first implemented in spring 2012 and successfully improved for spring 2013. the course is separate from the pre- or co-requisite organic lecture course and meets twice weekly for 3-h sessions, in sections each led by a graduate teaching assistant (ta). typically, the student: ta ratio is less than 12:1, and the course consists of 5070% second-year students, with the remainder being composed primarily of third-and fourth-year students. over the two years this project has been implemented, 40 students have participated. for many students, the project could also be appropriate for an upper-division undergraduate organic laboratory course. in developing the research module, a primary goal was to introduce students to authentic organic chemistry practice a goal to which student attention was explicitly drawn. this goal could be achieved by requiring students to find, adapt, and optimize procedures directly from the literature to develop and carry out a multistep synthesis. in so doing, a secondary goal of exposure to modern synthetic techniques, including microwave-accelerated synthesis and affinity chromatography, in particular, chromatography is an important part of the everyday life of synthetic organic chemists, but relatively little chromatography is carried out in organic teaching labs. reasons for this omission may include the safety issues of packing and running columns with standard silica gel (inhalation hazard) in pressurized glassware (explosion hazard), as well as the cost of the silica gel and solvent disposal for single-use columns. the use of fluorous affinity chromatography with prepacked columns could make a chromatography process more feasible in teaching labs: the preparation issues are avoided, and the columns can be reused multiple times. moreover, an understanding of affinity chromatography and noncovalent interactions is particularly relevant for students who go on to pursue work in biochemistry and areas of biology where it is a common technique. fluorous chemistry is a rapidly growing subfield of organic chemistry that has also gained attention in the context of green chemistry. this is due in part to the recyclability of many fluorous-tagged reagents and catalysts, as well as the fact that product isolation and purification using fluorous tags is greatly facilitated. the crux of the project reported herein was to synthesize a brightly colored molecule bearing a fluorous tag and then to use that product to explore fluorous solid-phase extraction (fspe) so that the separation process could be easily followed visually and understood conceptually. the project described is, to the best of our knowledge, the first reported implementation of fluorous synthesis and solid-phase extraction chemistry in the undergraduate organic teaching laboratory. in preliminary development, ways were sought to attach a fluorous tag to fluorescein derivatives; a recent fluorescein experiment from this journal has already been successfully adopted in this course. after encountering difficulty early in the development phase for such a project, a fluorous aminoanthraquinone target was selected (scheme 1). the rationale for this selection drew upon the precedent that compounds of type 1a (r=ch2rf, x=f, where rf is perfluoroalkyl) are known to be useful molecules for visualizing fluorous separations, whereas aminoanthraquinones of type 1b (r=alkyl or aryl, x=ots) are known to be easily accessed from a readily available, inexpensive starting material (quinizarin, 2). once the target was selected, a route was devised that would require students to engage in multistep synthesis. after debate on how best to frame the experience for the students, it was ultimately decided to provide them with scheme 2 in its entirety to facilitate their search for literature procedures to attempt directly or to modify to their needs. although explicitly told that they could deviate from the provided scheme if desired, students generally opted to follow the sequence shown. several features of this route are noteworthy:all of the intermediates except the final product are known compounds, facilitating the literature search process;it combines familiar, textbook chemistry with challenging chemistry not typically found in traditional undergraduate laboratory or lecture;the literature procedures that are found as precedents for individual steps require modification for use in the teaching laboratories due to constraints of time, equipment, or reagent safety requiring students to think critically about them and to come up with viable alternatives. all of the intermediates except the final product are known compounds, facilitating the literature search process; it combines familiar, textbook chemistry with challenging chemistry not typically found in traditional undergraduate laboratory or lecture; the literature procedures that are found as precedents for individual steps require modification for use in the teaching laboratories due to constraints of time, equipment, or reagent safety requiring students to think critically about them and to come up with viable alternatives. it was anticipated that such a project design would provide ample opportunity for students to develop their own chemistry and attempt to establish alternative reaction conditions for given transformations, while minimizing the time, logistical, and safety issues that typically accompany more open-ended projects. early in the semester, students began using scifinder scholar, were introduced to the project, and were provided with scheme 2. students were told that they would, on an individual basis, have to submit a proposal before they began. the proposal would contain literature procedures for their reactions as well as their proposed modifications thereof (based on the rules below, vide infra). after several weeks of planning outside of class, students would be given six consecutive lab periods in which to carry out their individual synthesis. in the interim, students would continue to do typical laboratory experiments, as well as inquiry-based mini-projects that served to prepare them for the capstone project. additionally, students were given two lab periods interspersed through the early part of the semester to ease into the project and practice the literature search and independent work process prior to the dedicated block of project time. students were free to explore any chemistry that they had found as precedent, within the following constraints: (1) they would be allowed to leave reactions unattended or heating over extended time periods, if desired, provided that they were properly labeled and that no reflux condenser was required when the laboratory was unoccupied; (2) particular reactions that would require equipment that was unavailable to all students (a parr hydrogenation bottle) and specific reagents (such as bu3snh) were labeled off-limits; (3) their scale would be limited to a few attempts at the use of one gram of perfluorooctyl iodide in the conversion of 4 5 in scheme 2; and (4) their procedures would be vetted by the teaching staff after an inspection for safety considerations. it was anticipated that these few rules would force students to be creative and to think critically about reaction design. at the same time, students would be able to experience a modicum of freedom and thus take ownership of their project. students were informed that another way that the project mirrors the typical practice of organic chemistry research is that the key intermediate, perfluorooctylpropyl amine 7, is commercially available but at high cost. a small amount would be available to them if necessary to use on the final day of the project, so that they could still perform the final synthetic step and explore the fspe technique. rather than diminish their motivation or make them believe that this was an exercise in futility, this served to ease the pressure they felt that they must be able to make it to the end on their own in the time allotted (eight total lab periods). this is fortuitous, because, to date, the long-term objective of students unaided synthesis of this compound has not been achieved. however, we strongly believe that the success of the project described herein is not contingent upon student synthesis of the final target, but, as in many graduate dissertations, the experience gained and growth undergone en route. a secondary goal guiding module development was to produce a module that could be easily modified and adopted; this goal was part of the rationale to constrain the activity in such a way as to minimize the logistical issues perceived to be significant obstacles to the widespread adoption of project-based approaches. it is believed that, with a few modifications, this approach could be useful at other institutions. for example, although students worked on the project individually, the project is also amenable for small groups of 23 students with division of the workload; groups working together would also allow a more systematic approach for the exploration of modified reaction conditions. easily modifiable background documents for various aspects of the project are available for adaptation. for example, if an instructor would simply like to demonstrate fspe, many modifications of this project could be made to illustrate the technique using commercial reagents or shorter synthetic sequences. although some of these compounds are relatively expensive, costs can be kept low by the use of small scales (50 mg) and grouping students. the targeting of strongly colored dye molecules means that only a small amount of product must be obtained to achieve a dramatic visual effect. the current approach made heavy use of a laboratory microwave to give students practice with another modern, rapidly growing technique. indeed, the microwave was another tool that students often thought to employ when dealing with the constraints of a traditional 3-h time block for a laboratory session. fortunately, much of this chemistry was developed outside of the microwave and can also work well in departments without this equipment. if a microwave is available, a student to microwave ratio of about 6:1 is optimal to minimize bottlenecks in the sharing of this equipment resource. although the microwave is equipped to handle multiple samples at a time, if students have proposed different conditions of time and temperature, this can result in a bottleneck. general laboratory safety procedures, including wearing appropriate personal protective equipment, must be followed at all times. all organic chemicals involved in these experiments are considered hazardous, and direct physical contact with them should be avoided. students were required to find the msds sheets of all reagents used and note particular hazards in their laboratory notebooks prior to use of the chemical. use of aibn (as in the conversion of 4 5) produces nitrogen gas during the course of the reaction, and therefore, precautions need to be taken for pressure build-up if this reagent is used under sealed vessel conditions. a research module has been developed and successfully implemented in a second-semester introductory organic teaching laboratory for chemistry majors. key features of the approach were an outlined route to a target that necessarily forced students to think critically about the procedures they planned to use to reach the targeted molecule and to propose modifications to known procedures. the module exposed students to modern chemistry through the use of microwaves and fluorous techniques, and engaged them in the process of organic chemistry as practiced in many laboratories across the world. while full details of the project evaluation and assessment will likely be reported upon additional data collection, the initial response to the project from the majority of students has been positive. although some students resisted the extra work and others struggled with the frustration of failed experiments, students generally appreciated the chance to take ownership of their work, as well as the fact that this represented a departure from canned experiments. this project or a slight modification thereof can be used to introduce students to authentic organic chemistry practice including modern synthetic techniques and should be easily adaptable to other settings.

a multi-session research-like module has been developed for use in the undergraduate organic teaching laboratory curriculum. students are tasked with planning and executing the synthesis of a novel fluorous dye molecule and using it to explore a fluorous affinity chromatography separation technique, which is the first implementation of this technique in a teaching laboratory. key elements of the project include gradually introducing students to the use of the chemical literature to facilitate their searching, as well as deliberate constraints designed to force them to think critically about reaction design and optimization in organic chemistry. the project also introduces students to some advanced laboratory practices such as schlenk techniques, degassing of reaction mixtures, affinity chromatography, and microwave-assisted chemistry. this provides students a teaching laboratory experience that closely mirrors authentic synthetic organic chemistry practice in laboratories throughout the world.

PMC3908737

pubmed-1031

cardiovascular disease (cvd) is the leading cause of death among patients with type 2 diabetes mellitus (t2 dm) even with earlier detection and treatment of t2 dm as has occurred during the past decade. this patient population has a 2- to 3-fold higher risk of cvd relative to their nondiabetic counterparts. yet, the relationship between plasma glucose concentration and cvd in t2 dm remains poorly understood. several in vitro and in vivo studies have documented that hyperglycemia alters cellular biochemistry within the vasculature, ultimately inducing endothelial dysfunction and abnormalities in vascular structure and biology predisposing t2 dm patients to cvd (reviewed in). nonetheless, large randomized clinical studies evaluating the impact of improving glycemic control on cvd outcomes [36] failed to demonstrate an effect of improvement in existing hyperglycemia from hba1c levels>7.0 to 7.0 to reduce cvd outcomes over the duration of the trials. posttrial follow-up and post hoc analyses of some of these trials suggest that early reductions in hba1c may be coupled to modest long-term improvements in cvd outcomes [7, 8]. in addition, epidemiological studies indicate that the risks of vascular complications are strongly associated with glycemic exposure, such that the cvd event rate increases over time as the mean hba1c increases above 7.0% prior to the first event [914]. in aggregate, these studies suggest that the effect of reducing existing hyperglycemia to reduce cvd event rate may require a long time to be expressed and is of moderate impact. apparently, progression of t2 dm, with its multifactorial pathological components of the insulin resistance syndrome, including loss of glycemic control, predisposes to increased incidence of cvd that can not then be easily, quickly, and largely reversed by merely reversing the hyperglycemia. moreover, even in t2 dm subjects with good glycemic control, increased risk of cvd is evident. clearly, more effective approaches outside of managing dysglycemia are required to ameliorate these macrovascular complications of t2 dm. in this regard, several lines of evidence suggest that other mechanisms such as increased vascular sympathetic tone and/or endothelial dysfunction may be strong potentiators of cvd in insulin resistant states [1621]. elevated sympathetic tone contributes significantly to hypertension, cardiac autonomic neuropathy, insulin resistance, dyslipidemia, vascular reactive oxygen species generation, inflammation, and endothelial dysfunction that each in turn contributes to cvd [1621]. a current unmet goal of clinical research and practice in t2 dm is the identification of safe and effective therapies that maintain good glycemic control, preventing progression of disease, while also reducing the long-term cvd risk, independent of their impact upon glycemic control. bromocriptine-qr, a quick release formulation of bromocriptine, a sympatholytic dopamine d2 receptor agonist [22, 23] (approved by the u.s. food and drug administration for the treatment of hyperglycemia in patients with t2 dm in 2009) may offer a therapy with the potential to maintain glycemic control and reduce cvd risk [2428]. once daily, morning administration of bromocriptine-qr has been shown to improve glycemic control when used as either monotherapy or add-on therapy (0.5 to 0.9 hba1c reduction relative to placebo control) in t2 dm subjects with poor glycemic control (hba1c 7.5) [27, 28]. in addition, in a large t2 dm study population (cycloset safety trial (cst); n=3070) comprised of subjects across a wide range of glycemic control status (a1c range: 5.510.5; median [25th75th percentile]: 6.8 [6.27.6 ]) whose hyperlipidemia and hypertension were well controlled and yet with preexisting cvd history (33% of population), intervention with this agent resulted in a 40% hazard risk reduction of a prespecified composite cvd endpoint over a period of one year. available evidence suggests that bromocriptine-qr may work through restoration of the daily morning peak in central circadian dopaminergic neural activities [2932] to reduce the major cvd risk factors of hyperactive sympathetic tone at the vasculature, endothelial dysfunction, and vascular oxidative and nitrosative free radical generation [33, 34], each independently of any effect on fasting plasma glucose or lipid levels. these neuroendocrine aberrations are operative in progression of cvd over the entire continuum of glycemic control in t2 dm patients, including those with good glycemic control, as they are also present in the prediabetic state [3538]. therefore, we hypothesized (1) that even in t2 dm subjects with good glycemic (and lipid and blood pressure) control with standard of care, the cvd event rate may still be high due to the presence of these underlying etiological neuroendocrine pathologies and (2) that such subjects would benefit from administration of bromocriptine-qr to produce a potent and rapid reduction in cvd event rate via its beneficial effects on the above neuroendocrine pathologies, irrespective of such existing good glycemic (lipid and blood pressure) control. however, the antidiabetes and cvd protective effects of bromocriptine-qr in this specific cohort of t2 dm subjects with well-controlled glycemia have never been investigated. hence, to test this hypothesis, we analyzed the data from the cycloset safety trial (cst), which had enrolled subjects across a wide spectrum of glycemic control status ranging from very good to very poor control and afforded the unique opportunity to investigate, for the first time, the effects of bromocriptine-qr on progression of both dysglycemia and cvd in a relatively large population of subjects with well-controlled t2 dm (hba1c 7.0; median [25th75th percentile]: 6.4 [66.7] in contradistinction to cst subjects with hba1c>7.0; median [25th75th percentile]: 7.8 [7.48.5]). the current study population was derived from those subjects within the cst with a baseline hba1c 7.0. of the 3070 subjects randomized 2: 1 to treatment with bromocriptine-qr versus placebo in cst, 1834 subjects (1219 receiving bromocriptine-qr and 615 receiving placebo) had baseline hba1c 7.0. briefly, this was a 12-month, multicenter, placebo-controlled, double-blind, parallel-group safety and efficacy study in outpatient t2 dm subjects recruited from general practice and diabetes clinics across 74 clinical centers in the united states and puerto rico. subjects were between the ages of 30 and 80 years and had a body mass index<43 kg/m and an hba1c 10.0%. subjects with new york heart classifications i and ii congestive heart failure (chf) were allowed to participate, as were subjects with a history of myocardial infarction (mi) or coronary revascularization occurring>6 months before enrollment. subjects were required to have maintained a stable diabetes treatment regimen for 30 days prior to randomization, consisting of either lifestyle interventions of medical nutrition therapy and appropriately prescribed physical activity, oral antihyperglycemic agents (2), or insulin either alone or in combination with 1 oral antihyperglycemic agent. the study drug was titrated by adding 1 tablet (0.8 mg bromocriptine-qr per tablet) per week until a maximum tolerated daily dose between 2 and 6 tablets (1.6 to 4.8 mg/day) was achieved. the study drug was taken once daily with the morning meal, within 2 hours of waking. subjects were required to continue their established antihyperglycemic treatments during the first 3 months of the study. however, the dosages of the oral agents or insulin could be modified as deemed appropriate by the study site investigator. after 3 months, alterations in the diabetes treatment regimen were allowed, if deemed necessary by the study site investigator, as long as these changes did not result in a final regimen that exceeded 2 oral agents or insulin plus 1 oral agent, exclusive of the study drug. the study protocol was approved by site-specific or central institutional review boards and all subjects provided written informed consent to participate in the study before enrollment. this current study and analyses are original and different from any previously reported results from the cycloset safety trial. the same prespecified cvd endpoint of the cst (a composite of major cardiovascular events, defined as a composite of first mi, stroke, coronary revascularization, or hospitalization for angina or chf that occurred after randomization) was also used in this new study and analysis. an independent event adjudication committee consisting of two cardiologists and an endocrinologist, blinded to treatment assignment and medical dictionary for regulatory activities coding of events by the study team, made the final serious adverse event (sae) system organ class (soc) classifications and assignment of an sae as a cvd endpoint. intention-to-treat (itt) and on-treatment (ot) analyses were conducted. itt analysis included all patients receiving at least one dose of the study drug with exposure time being one year or time to event. to account for any possible influence of weighted early termination among bromocriptine-qr versus placebo treated subjects that might artificially impact the itt analysis, an ot analysis restricting exposure time to time on study drug was also conducted. superiority between bromocriptine-qr and placebo for the cvd endpoint was defined as the upper bound of the two-sided 95% confidence limit being<1.0 and the superiority analysis of cvd endpoint was based on the cox proportional-hazards regression, adjusted for baseline covariates including history of stroke, revascularization, and center, with two-sided p values calculated. the cumulative incidence rate of the cvd endpoint was analyzed by log-rank test. the impact of bromocriptine-qr versus placebo on the progression of diabetes was described as the odds of losing glycemic control while on therapy and determined by evaluating the percent of subjects completing 52 weeks of therapy, whose hba1c progressed above 7.0%. the odds of requiring treatment intensification to maintain hba1c 7.0% during the study period of 52 weeks were also analyzed. to eliminate potential confounding arising from intensification of concomitant antidiabetes medications, the analyses were also performed in only those subjects completing 52 weeks without requiring any concomitant antidiabetes treatment intensification. the above analytical approach was also conducted on the entire study population using a last observation carry-forward analysis. statistical analyses of the primary endpoints and safety measures were conducted independently by everest inc. (ontario, canada) using sas software version 8.2 (cary, nc). safety analyses were conducted as previously described for the cst. there were no significant differences in baseline demographics between the bromocriptine-qr and placebo study arms although the hba1c level was not considered as a stratification factor in the cst (table 1(a)). the study population carried multiple risk factors for cvd and was comprised of individuals among whom 74% were hypertensive, 75% were hyperlipidemic, greater than 50% were prior or current smokers, approximately 33% had preexisting cvd who were obese on population average with an average bmi of>32 (table 1(a)). fasting plasma glucose, lipids, and blood pressure were well controlled in both groups. majority of the subjects were receiving cardioprotective medications (see table 1(b) for details). 1834 patients (1219 receiving bromocriptine-qr and 615 receiving placebo) from the cst trial had baseline hba1c 7.0% and were included in this study. in total, 92% of the planned person-year cv outcome ascertainment was observed in this trial (1772 of 1920 possible total person-years), with 77% of bromocriptine-qr subjects and 83% of placebo subjects providing a week 52 plus 30-day follow-up outcome assessment. the number of subjects with hba1c assessment at week 52 was 1203 (750 bromocriptine-qr and 453 placebo). details of subject disposition and delineation of person-year cv outcome ascertainment are shown in figure 1. in the itt analysis, the composite cvd endpoint occurred in 19 bromocriptine-qr-treated (1.6%) and 19 placebo-treated (3.1%) subjects, resulting in a 48% cvd hazard risk reduction (hazard ratio [hr] 0.52, ci 0.280.98) (table 2). the ot analysis revealed a 52% cvd risk reduction (hr: 0.48; ci: 0.240.95) (table 2). figure 2 depicts the kaplan-meier curve of the cumulative incidence rate of the composite cvd endpoint by treatment and demonstrates a significant difference at 1 year (log rank p=0.041). there were no significant changes in plasma lipid levels or heart rate in either treatment group. compared to placebo, the bromocriptine-qr treated group exhibited a mild reduction in blood pressure (change from baseline blood pressure (mean sd; mmhg): 2.81 16.27 systolic and 1.89 9.76 diastolic in the bromocriptine group; 0.54 14.86 systolic and 0.56 9.54 diastolic in the placebo group; between group difference (ci): 1.76 (3.09, 0.42) systolic (p=0.0099) and 1.19 (2.00, 0.38), (p=0.0038) diastolic). among study subjects whose hba1c remained 7.0 during the study period, bromocriptine-qr intervention reduced the fraction of subjects that required intensified concomitant antidiabetes therapy to do so by 47%for the completer population and by 58% for the itt population (see table 3 for details). analyzing all subjects who had a 52-week hba1c measurement, irrespective of changes in concomitant diabetes therapy and adjusting for baseline hba1c, the odds of losing glycemic control (hba1c>7.0% after 52 weeks of treatment) were significantly lower with bromocriptine-qr therapy (or (95% ci): 0.63 (0.470.85), p=0.002). the odds of requiring treatment intensification to maintain hba1c 7.0% over the course of the study were also significantly lower with bromocriptine-qr therapy (or (95% ci): 0.46 (0.310.69), p=0.0002). on repeating the analysis including only those subjects who did not have a change in the intensity of their concomitant diabetes regimen, bromocriptine-qr was still associated with significantly lower odds of losing glycemic control compared with placebo (18% versus 26%, resp.) (or (95% ci): 0.56 (0.390.80), p=0.002). these differences between the treatment groups were unaffected and remained significant (p=0.001) after adjusting for body weight changes during the study. the same results described above were observed using a last observation carry forward analysis among all subjects with a screening hba1c value 7.0% (itt population, n=1834) (see table 3 for details). for the itt population, the between-group difference in change from baseline hba1c (6.3 0.5) was 0.17 (ci 0.23, 0.11; bromocriptine-qr: 0.18, placebo: 0.35; p<0.0001). adverse events (aes) that were most commonly reported (occurring in greater than 5% of subjects in either group) are shown in table 4 and were similar to those previously reported for the cst. among the aes occurring at a higher rate in the bromocriptine-qr group, the between-group difference was significant (p<0.0001) for nausea (31.7% versus 8.0%), dizziness (15.5% versus 8.6%), fatigue (13.9% versus 7%), and vomiting (8.7% versus 3.4%), with the severity reported as being mild-moderate in>90% of all cases in each of these categories. the increased rate of nausea, the most common adverse event reported, was transient and confined to the initial 6-week drug titration period with an average weekly rate of approximately 6% and decreasing to<1% thereafter (see figure 3). hypoglycemic episodes occurred infrequently (5.5% bromocriptine-qr versus 4.2% placebo) with no significant between-group difference in the rate. arthralgia was reduced by 39% in the bromocriptine-qr group (p=0.03). in the bromocriptine-qr treated group 105 subjects (8.6%) reported 149 serious adverse events (sae) while the placebo-treated group had 58 subjects (9.4%) reporting 80 serious adverse events. in the cardiac disorders body system class there were 33 events reported in 28 subjects (2.3%) in the bromocriptine-qr group and 25 events reported in 21 subjects (3.4%) in the placebo group. no other body system classes had sae occurring in greater than 2% of either group. there was no between group difference in change from baseline body weight (bromocriptine-qr: 0.386 versus placebo: 0.366, p=0.97). the findings of this study demonstrated that, in metabolically well-controlled t2 dm subjects (baseline hba1c 7.0%), adding bromocriptine-qr treatment to their baseline established diabetes treatment regimen significantly aided in maintaining good glycemic control, with a lower likelihood of progressing above an hba1c of 7.0% or requiring intensification of treatment over the ensuing year to maintain hba1c 7.0%. furthermore, bromocriptine-qr treatment was also associated with a 48% cvd event rate reduction within the 1-year study duration in this population of t2 dm subjects, with excellent baseline glycemic control (hba1c 6.3 0.5). the study population had multiple cardiometabolic risk factors for cardiovascular disease at baseline (table 1(a)) and the placebo-arm of the study population had a relatively high event rate (3.1%) for the prespecified serious cardiovascular adverse event endpoint while being well controlled pharmacologically for dysglycemia and on population average for dyslipidemia and hypertension as well. these findings suggest that, in this t2 dm subject population demographic, (1) there are biochemical pathological factors beyond hyperglycemia, hyperlipidemia, and high blood pressure predisposing this population to cvd events and (2) there likely are significant mechanisms beyond glycemic control contributing to the observed cvd risk reduction with this therapy. although epidemiological evidence [914] supports an adverse role of poor glucose control on cvd risk, intervention trials have been less conclusive. of the earlier studies, the united kingdom prospective diabetes study (ukpds) demonstrated that intensive glycemic control in individuals with newly diagnosed t2 dm reduced the risk of microvascular complications. further, longer-term follow-up of these individuals for 10 more years after the end of the intervention trial demonstrated continued reductions in microvascular disease risk and statistically significant benefits on both cvd endpoints and total mortality in the intensive therapy arm, despite the mean hba1c between the groups having converged soon after the randomized phase of the trial had concluded. the action to control cardiovascular risk in diabetes (accord) study, the action in diabetes and vascular disease (advance) study, and the veterans affairs diabetes trial (vadt) that were shorter in duration than ukpds enrolled older patients, with more advanced and poorly controlled diabetes, and known cad or at high risk for cvd and found no significant decrease in cvd endpoints with intensive glucose control. however, the evidence from/post hoc analyses of these large trials [810] and the longer-term ukpds follow-up suggests long-lasting benefits of tighter glycemic control in patients that are younger and earlier in the course of their diabetes or with lower hba1c values (at about 7.0) at treatment intensification. in these individuals, maintaining hba1c<7.0% remains a reasonable target and may have important benefits in reducing the future burden of macrovascular and microvascular disease. the bromocriptine-qr effect to slow progression of dysglycemia in these individuals as demonstrated herein may therefore offer cvd benefits over the long-term; however, the rapid response to bromocriptine-qr respecting the reduction in cvd outcomes observed in the present study begs for other mechanisms operative in the manifestation of this effect. moreover, although bromocriptine has been shown to reduce hypertriglyceridemia and elevated blood pressure, these effects can not be responsible for the observed cvd event rate reduction as these parameters were well controlled at baseline and minimally affected by the intervention. prior studies of the neuroendocrine impact of timed bromocriptine administration in insulin resistant animals and humans however may offer insights into a possible mechanism for the observed cvd (and metabolic) response to the therapy as follows. bromocriptine-qr therapy is a circadian-timed administration of a quick-release, high absorbing, and short half-life formulation of bromocriptine. it has been formulated and administered in the morning within 2 hours of waking to provide a discrete and brief daily interval of circulating bromocriptine [2428, 39], thereby providing a timed pulse of increased dopaminergic activity centrally at the time of day that studies suggest is the natural daily peak of central dopaminergic activity in healthy individuals [32, 40]. studies indicate that disturbed circadian rhythmicity of the biological clock (hypothalamic suprachiasmatic nucleus (scn)) and a reduced dopaminergic tone within the central nervous system are associated with the development of insulin resistance, obesity, and diabetes [26, 29, 32, 35, 4147]. a diminution of the daily circadian peak in dopaminergic activity at the scn at the onset of the daily locomotor activity rhythm (e.g., waking from night-time sleep in humans) is coupled to increases in hypothalamic ventromedial and paraventricular nuclei drive for increased sympathetic and hypothalamic-pituitary-adrenal (hpa) axis activities (reviewed in). these increased sympathetic/hpa activities potentiate increases in adipose lipolysis and subsequent plasma free fatty acid levels, increases in hepatic glucose and lipid output and decreases in hepatic glucose storage, and increased peripheral insulin resistance [33, 35], particularly during the postprandial state. when bromocriptine is administered at the appropriate time of day to restore normal scn dopaminergic activity in insulin resistant states, it normalizes such aberrant hypothalamic functions and elevated sympathetic tone and the hpa axis circadian activity. when administered to humans in the early morning upon waking in an effort to restore the normal waking rise in central dopaminergic activity that is diminished in insulin resistant states [32, 35], bromocriptine-qr improves insulin resistance and other metabolic abnormalities [2628, 39, 42]. while the mechanisms by which timed bromocriptine-qr therapy produces the observed effects on cvd outcomes are yet to be fully delineated, available evidence suggests important cvd-protective roles for its modulation of central nervous system and circadian hypothalamic functions to reduce elevated sympathetic nervous system (sns) (and hpa axis) activities (as described above) that directly and indirectly potentiate vascular inflammation, endothelial dysfunction, and arterial stiffening [1618] and that are coupled to increased cvd risk if overactive [16, 48]. such sns influences on adipose and liver potentiate their increased secretion of ffa/lipid and inflammatory cytokines that in turn cause vascular inflammation and reactive oxygen species generation that are damaging to the vasculature [1921]. increases in sns activities can also induce a proinflammatory response in various arms of the immune system itself that can also predispose to vascular damage. additionally, and likely much more importantly, increased sns activity can produce adverse cardiometabolic effects directly upon the vasculature to potentiate vasoconstriction, generation of vascular reactive oxygen and nitrogen species, increased inflammation, endothelial dysfunction, and arteriosclerosis [1618, 50]. furthermore, changes in vascular inflammation and endothelial function (positive or negative) can manifest changes in vascular pathology/physiology quickly [1621, 37, 38]. importantly, circadian timed treatment of spontaneously hypertensive rats (shr) with bromocriptine has demonstrated improvements in metabolic syndrome parameters including elevated sns tone, fatty liver, and hepatic inflammation, as well as reductions in arterial stiffness and endothelial nitric oxide synthase uncoupling, two phenomena commonly observed in patients with t2 dm and strongly linked to progression of macrovascular disease [1921]. others have reported similar hepatic and vascular findings in response to bromocriptine therapy in other animal models [51, 52]. also, beyond normalizing (resetting) hypothalamic control of elevated sympathetic tone and vascular dysfunction, bromocriptine has direct sympatholytic activity due to its neurotransmitter receptor modulation capacity [22, 23, 53]. endothelial dysfunction, vascular inflammation, and elevated sympathetic tone are early pathological events in the progression of cvd and precede the onset of t2 dm [1621, 37, 38]. as such, these pathologies may well have contributed to the 3.1% cvd event rate observed in this study placebo population that was well controlled for hyperglycemia, hyperlipidemia, and high blood pressure with standard of care therapy. that is to say, such t2 dm subjects whose dysglycemia, dyslipidemia, and hypertension are well controlled with standard of care pharmacotherapy still remain in need of therapy for their underlying substantive cvd risk due to these above described neuroendocrine pathologies. therefore, if these pathologies are the targets of this bromocriptine-qr therapy, as available evidence suggests, then the present findings suggest that early intervention with this therapy in the course of t2 dm may potentially provide longer-term benefit of cvd risk reduction. the limitations of this study include the relatively small number of cvd events and the short duration of the trial. other limitations include the lack of mechanistic information relating to bromocriptine-qr impact on sympathetic tone or endothelial dysfunction in the study population. therefore, caution should be exercised when evaluating these cvd findings and their full potential clinical ramifications. the abovementioned mechanisms proposed to be operative in the observed cvd outcome results of this study need to be further investigated in human studies (e.g., impact of bromocriptine-qr on vascular inflammation, endothelial dysfunction, vascular and systemic reactive oxygen species status, and aortic compliance) before definitive conclusions on such mechanisms can be made. it should be appreciated though that the study subjects had multiple risk factors for cvd at baseline and the prespecified cvd endpoint occurred in the placebo arm at a relatively high rate despite well-controlled hyperglycemia, hyperlipidemia, and blood pressure and that the reduction in cvd events with bromocriptine-qr intervention was evident within the short duration of this study in such a population of t2 dm subjects. similarly, in this regard, it should be noted that the incidence rate for the prespecified cvd endpoint among subjects in the cst with baseline hba1c>7.0% was 16/830 (1.9%) and 12/400 (3.0%) in the bromocriptine-qr and placebo arms, respectively, comprising approximately half of the total events in the original cst and yielding a hazard ratio of 0.74 (ci: 0.351.56) for this subset (hba1c>7.0%). although this reduction in cvd events in this subset was not statistically significant likely due to the small n number, these findings suggest an operative impact of this therapy in cvd risk reduction across the continuum of glycemic control status. cvd is the leading cause of death in t2 dm subjects and yet there are currently no antidiabetes medications available with proven cardioprotective benefits. consequently, the cvd outcome findings described herein along with those from other bromocriptine-qr intervention studies of t2 dm subjects [24, 25] suggest that bromocriptine-qr should be considered for further investigation in larger, longer term studies to establish or not the validity of its potential use early in the course of t2 dm as an cardioprotective agent. in conclusion, the findings of this study support that bromocriptine-qr therapy among t2 dm subjects in good glycemic control (hba1c 7.0) reduced progression of dysglycemia and reduces cvd event rate within one year of therapy. reducing cvd remains a major unmet medical need in t2 dm. while reducing hyperglycemia may contribute to such an outcome, the overall effects are modest. other major vascular risk factors such as vascular sympathetic tone and endothelial dysfunction are present early in t2 dm disease progression (e.g., obesity/prediabetes) and represent important therapeutic targets for cvd event rate reduction even in subjects with good glycemic and metabolic control. bromocriptine-qr is a sympatholytic dopamine d2 receptor agonist that appears to reduce these vascular risk factors via the neuroendocrine axis and reduce progression of cvd in t2 dm even in the setting of good glycemic control. the present findings suggest that further larger, longer term studies to assess the value of early intervention with bromocriptine-qr during the chronology of t2 dm to provide unique long-term cardiovascular health benefits are warranted.

background. type 2 diabetes (t2 dm) patients, including those in good glycemic control, have an increased risk of cardiovascular disease (cvd). maintaining good glycemic control may reduce long-term cvd risk. however, other risk factors such as elevated vascular sympathetic tone and/or endothelial dysfunction may be stronger potentiators of cvd. this study evaluated the impact of bromocriptine-qr, a sympatholytic dopamine d2 receptor agonist, on progression of metabolic disease and cvd in t2 dm subjects in good glycemic control (hba1c 7.0%). methods. 1834 subjects (1219 bromocriptine-qr; 615 placebo) with baseline hba1c 7.0% derived from the cycloset safety trial (this trial is registered with clinicaltrials.gov identifier: nct00377676), a 12-month, randomized, multicenter, placebo-controlled, double-blind study in t2 dm, were evaluated. treatment impact upon a prespecified composite cvd endpoint (first myocardial infarction, stroke, coronary revascularization, or hospitalization for angina/congestive heart failure) and the odds of losing glycemic control (hba1c>7.0% after 52 weeks of therapy) were determined. results. bromocriptine-qr reduced the cvd endpoint by 48% (intention-to-treat; hr: 0.52 [0.280.98 ]) and 52% (on-treatment analysis; hr: 0.48 [0.240.95]). bromocriptine-qr also reduced the odds of both losing glycemic control (or: 0.63 (0.470.85), p=0.002) and requiring treatment intensification to maintain hba1c 7.0% (or: 0.46 (0.310.69), p=0.0002). conclusions. bromocriptine-qr therapy slowed the progression of cvd and metabolic disease in t2 dm subjects in good glycemic control.

PMC4427775

pubmed-1032

a 3-year-old girl was admitted to our hospital with unexplained fever and paroxysmal abdominal pain that had persisted for three days. her body temperature at the time of admission was 39.5. physical examination showed abdominal tension, though there was no obvious tenderness and rebound tenderness. the blood platelets count (24010/l) was normal, and the c-reactive protein (> 1.6 mg/dl), the white blood cell count (13.910/l) and eosinophil count (4%, 0.5810/l) were elevated, while hepatic glutamic oxalacetic transaminase (24 u/l) and glutamate pyruvate transaminase (21 u/l) were normal. however, the level of cholinesterase (2,395 the abdominal non-contrast ct obtained on the fifth hospital day revealed diffusely hypodense nodular lesions in the hepatic parenchyma with marked hepatomegaly, retroperitoneal lymphadenopathy and ascites in the pelvic cavity. eight days after admission, an abdominal mri revealed marked hepatomegaly with diffuse high intensity of the homogeneous nodular lesions (2-4 mm diameter) throughout the hepatic parenchyma and retroperitoneal lymphadenopathy. in addition, disseminated miliary nodules of high signal intensity were located on the peritoneum on the t2-weighted images, as well as a group of diffuse, low intensity nodular lesions were seen throughout the hepatic parenchyma on the axial t1-weighted images (fig., a chest ct showed multiple small hyperdense nodules (2-4 mm in diameter) in both lungs (fig. after the small intestinal wall and peritoneal biopsy, histological examination revealed parenchymal tubercles containing several larvae of pentastomids and a large amount of inflammatory cell infiltration surrounding them (fig. at this point, it was revealed by the patient's parents that the patient had consumed snake meat several months prior to her admission. following the diagnosis, she was administered praziquantel (0.5 g, tid, per day) and albendazole (0.75 g, bid, per day) in order to expel the intestinal worms. the patient's temperature began to slowly decrease two days after the start of the therapy, and after 10 days of the therapy the fever had disappeared and the abdominal pain was diminished. on examination, pentastomid worms were observed in a stool (fig. the patient made an uneventful recovery after a half a month of therapy and she was discharged from our hospital. human pentastomiasis is divided into two types: the more common visceral pentastomiasis (which is the main portion of the cases of pentastomiasis) and nasopharyngeal pentastomiasis (1). visceral pentastomiasis is an unusual parasitic zoonosis that is caused by the larval stages (nymphs) of several species of pentastomes (' tongue worms '), and these are parasites that form a unique phylum with characteristics of both arthropods and annelids (2). at present, there are ten known pathogenic species of pentastomid parasites and six known kinds of human pentastomiasis. the latter include armilliferosis, linguatulosis, porocephalosis, raillietiellosis, leiperiosis and sebekiosis (3). the species that affect humans belong to the families linguatulidae, armilliferidae and porocephalidae, and all of which have different geographic distributions. more than 90% of the human cases are caused by the nymphs of only two species, l. serrata and a. armillatus (4). the infection develops in humans when parasite ova are ingested from the respiratory secretions or feces from the final hosts (dogs and other carnivores for linguatula, several species of large snakes for armillifer and porocephalus). in the digestive tract of the human host, the minute four-legged primary larvae hatch and invade the viscera of the digestive tract in the human host (5, 6). the nymphs involve many organs, including the liver, esophagus, stomach, duodenum, jejunum, ileum, colon, appendix, rectum, mesentery, gallbladder, lung, pleura, broad ligament, pancreas, omentum, bladder, adrenal gland, heart (pericardium), lymph nodes, skin, epididymis, eye, brain, inguinal hernia sac, etc; however, the liver is the most common site (7). visceral pentastomiasis causes the majority of asymptomatic infections in humans, but a small number of cases are fatal, and the severity of symptoms is related to the organs that are infected and the degree of infection by the nymph (8). the patients with a heavy infestation showed chronic fever, ascites, abdominal pain, diarrhea, mild anemia, hepatosplenomegaly, eosinophilia in the bone marrow and blood, and multiple polyps in the whole colon. the pathologic features of the liver biopsy are degeneration and necrosis of hepatocytes, along with obvious infiltration of eosinophils. as was demonstrated in this study, praziquantel or mebendazole is a medical treatment for this disease (9). only a few cases of pentastomiasis infections have been reported in humans around the world, and there is limited literature about the imaging features of pentastomiasis infection. we report here a case where the patient had a history of eating snake meat several months prior to her hospital admission, and her main symptoms were a high fever and abdominal pain. an abdominal mri demonstrated diffuse nodules throughout the liver, an enlarged liver, a little ascites, diffuse retroperitoneal lymphadenopathy and disseminated miliary nodules of high signal intensity on the peritoneum. the laparoscopy revealed that the liver was diffusely enlarged, as well as there were diffusely scattered micro-cyst nodules of varying sizes on the surface of the liver and the peritoneum. microscopically, the small intestinal wall and peritoneal biopsy showed several larvae of pentastomids in the cyst nodules. the parasite worms were surrounded by a group of macrophages, inflammatory cells and fibrosis. when liver enlargement and diffuse hepatic hypodense nodular lesion is seen on a t1-weighted image, it is necessary to differentiate pentastomiasis hepatic involvement from other diseases that present with diffuse liver enlargement, high fever and abdominal pain (10, 11) such as diffuse liver metastasis, diffuse hepatocellular carcinoma, lymphoma and diffuse granulomatosis (12). biopsy or autopsy is necessary to determine the cause of the symptoms. in this report we studied the patient with magnetic resonance imaging. due to the spatial resolution of the current t2-weighted mr imagers, the detection of these microcysts and larvae within the microcysts was well accomplished in tandem with the clinical features and epidemiology, which aided in making the differential diagnosis (13). in summary, we have presented a rare case of pentastomiasis infection that involved many organs, including the liver, small intestine, peritoneum, lung and retroperitoneal lymph nodes. the patient's symptoms consisted of high fever, abdominal pain, abdominal tension and anemia. the imaging features of the abdominal mri revealed marked hepatomegaly with diffuse homogeneous nodular lesions throughout the hepatic parenchyma, diffuse retroperitoneal lymphadenopathy and disseminated miliary nodules on the peritoneum. the chest ct showed scattered small nodules in both lungs. when liver enlargement and hepatic disseminated miliary nodules are identified, it is necessary to differentiate pentastomiasis hepatic involvement from other diseases. pentastomiasis infections should be considered in the diagnoses of patients with a history of such abdominal symptoms and who have consumed snake meat, though the definite diagnosis depends on the pathology report.

we report here a case of pentastomiasis infection in a 3-year-old girl who had high fever, abdominal pain, abdominal tension and anemia. ultrasound scanning of the abdomen revealed disseminated hyperechoic nodules in the liver and a small amount of ascites. abdominal mri showed marked hepatomegaly with disseminated miliary nodules of high signal intensity throughout the hepatic parenchyma on t2-weighted images; retroperitoneal lymphadenopathy and disseminated miliary nodules on the peritoneum were also noted. chest ct showed scattered small hyperdense nodules on both sides of the lungs. the laparoscopy demonstrated diffuse white nodules on the liver surface and the peritoneum. after the small intestinal wall and peritoneal biopsy, histological examination revealed parenchymal tubercles containing several larvae of pentastomids and a large amount of inflammatory cell infiltration around them. the pathological diagnosis was parasitic granuloma from pentastomiasis infection.

PMC2893321

pubmed-1033

polymyalgia rheumatica (pmr) and giant cell arteritis (gca) are common inflammatory conditions that almost exclusively affect patients older than 50 years. 1826% of patients with pmr have gca while 2753% of patients with gca have also pmr at the same time. pmr primarily presents with stiffness and pain in the proximal muscle including neck, shoulders, buttocks, and thighs that causes severe disability without suitable treatment. gca is the most common vasculitis in older persons and involves medium to large artery. older age, female sex, and northern european descent are the most important risk factors for both conditions. temporal artery biopsy should be performed in gca cases [1, 2], patients with cranial symptoms, and when either diagnosis is suspected as proposed by the national danish guidelines. glucocorticoids (gc) are the mainstay of treatment in patients with pmr and gca. one of the important complications amongst pmr and gca patients who received gc in the long term (> 3 months) is glucocorticoid-induced osteoporosis (gio) that leads to an increased risk of fracture. this is due to impairment of calcium absorption in the intestine and reabsorption in the tubular system of kidneys. inflammation, reduced mobility, and older age which characterize this group of patients further contribute to an increased risk [2, 4, 5]. according to several studies bisphosphonates, vitamin d, and calcium are effective for preventing gio [2, 4, 610]. the american college of rheumatology suggests use of 12001500 mg/day calcium plus 8001000 u/day vitamin d to prevent gio. furthermore lifestyle modification and regular weight bearing exercise can improve outcomes. to prevent loss of bone mass, all of our patients with pmr and gca were prescribed calcium and vitamin d supplements and depending on the bone density, evaluated with a dxa-scan (dual energy x-ray absorptiometry), received additional treatment with bisphosphonate (if t-score<1). previous studies showed that the level of adherence to osteoporosis preventive medications is poor, leading to increased risk of fracture and hospitalization [1116]. several factors may contribute to nonadherence including concern of potential side effects, inconvenience, cost of medication, or lack of understanding of the benefits of therapy [12, 16, 17]. the aim of the current study is to estimate adherence to oral calcium and vitamin d supplementation as well as bisphosphonate amongst patients with pmr and gca receiving long-term treatment with gc and identify factors associated with nonadherence. in addition we evaluated patients ' adherence when responsible physician referred the patients to a dxa-scan. we used patient interview to measure adherence to prescribed medication in a cross-sectional study. all patients with the diagnosis of pmr and/or gca diagnosed according to the danish national guideline, registered in the department of rheumatology, svendborg hospital, in december 2013 were identified and contacted by phone and were asked if they wanted to participate in the study. they were requested to answer a set of previously defined questions (see adherence interview form) about medication and adherence. all telephone interviews were performed by registered physicians or nurses who the patients knew. for each patient information on gc treatment, calcium, and vitamin d supplements and bisphosphonate was obtained using patients ' records. patients ' records were also evaluated individually for previous laboratory tests, imaging studies including dxa-scan, positron emission tomography, and biopsy of temporal artery to ensure accurate diagnosis and if relevant diagnostic tests were performed. a patient was considered to be adherent if medication was taken as prescribed in the records. finally the patients were asked about the reasons for nonadherence if they had discontinued the medications. the study was approved by the danish data protection agency (file number 2008-58-0035, 14/4017). adherence interview form (1) patient code number:(2) age:(3) diagnose: pmr gca (4) smoking status yes no (5) do you take prednisolone tablet daily: yes no (6) prednisolone dosage:(7) are you prescribed calcium and vitamin d supplements with start of prednisolone: yes no (8) do you always remember to take your calcium, vitamin d supplements? 100% 50100% <50% never (9) if yes, which type of calcium and vitamin d supplements do you take?(10) number of calcium and vitamin d tablets per day:(11) if no, why do n't you take your medication? fear of side effects i do n't take much medication i do n't have more pills side effects (nausea, constipation) i do n't think it is necessary a doctor or nurse have told me not to eat it i can not afford it i do n't know others (12) do you eat dairy products or fish daily: yes no do you take prednisolone tablet daily: are you prescribed calcium and vitamin d supplements with start of prednisolone: do you always remember to take your calcium, vitamin d supplements? 100% 50100% <50% never if yes, which type of calcium and vitamin d supplements do you take? number of calcium and vitamin d tablets per day: if no, why do n't you take your medication? fear of side effects i do n't take much medication i do n't have more pills side effects (nausea, constipation) i do n't think it is necessary a doctor or nurse have told me not to eat it i can not afford it i do n't know others i do n't take much medication i do n't have more pills side effects (nausea, constipation) i do n't think it is necessary a doctor or nurse have told me not to eat it do you eat dairy products or fish daily: (13) do you take vitamin supplements yes no (14) have you previously done dxa-scan: yes no (15) if yes, date/year of previous dxa-scan:(16) do you take prophylactic osteoporosis medication for example fosamax, alendronate, bonviva, aclasta: yes no (17) if yes, name of your prophylactic osteoporosis medication:(18) do you take always your preventive medication: 100% 50100% <50% never (19) why do not you take your preventive medication: fear of side effects i do n't take much medication i do n't have more pills side effects i can not afford it i do n't think it is necessary i do n't know others do you take vitamin supplements have you previously done dxa-scan: if yes, date/year of previous dxa-scan: do you take prophylactic osteoporosis medication for example fosamax, alendronate, bonviva, aclasta: if yes, name of your prophylactic osteoporosis medication: do you take always your preventive medication: 100% 50100% <50% never why do not you take your preventive medication: fear of side effects i do n't take much medication i do n't have more pills side effects i can not afford it i do n't think it is necessary i do n't know others i do n't take much medication i do n't have more pills twelve patients subsequently received an alternative diagnosis, in most cases rheumatoid arthritis, three patients could not be reached on the phone, two did not want to participate in the study, and three were not contacted, because it was clear from the records that they were demented. in total 118 patients were included (figure 1). the mean of prednisolone dosage was 10.5 9.4 mg with a range between 2.5 and 50 mg. 117 patients (99.2%) had prescribed calcium and vitamin d and 88.9% of them were adherent to their prescription. only 2 patients (1.7%) did not take calcium and vitamin d at all, and 10 patients (8.5%) took their medication infrequently, 9 and 1 out of 10 patients took the medication 50100% of the time and less than 50% of the prescribed dose, respectively (figure 2). the reasons for incomplete adherence were forgetfulness in 42.9% of patients, 35.7% of patients could not explain the reason, one patient did not want to eat so many pills, one patient claimed of side effects, and one patient thought prophylactic calcium and vitamin d supplement was unnecessary (figure 3). from the 118 patients 113 (95.7%) were referred to a dxa-scan, of which 103 had been scanned and 10 were awaiting scan results. all patients who were referred for dxa-scan were involved in the study. in 61 patients bisphosphonate the remaining 3.4% of the patients did not take the medication at all (figure 2). glucocorticoid-induced osteoporosis is an important side effect of treatment with gc amongst patients with pmr and gca. the frequency of osteoporosis ranges between 14.9 and 85% in patients. risk of fracture in patients who received long-term gc is about 3350% which depends on daily and cumulative dose. low body mass index, smoking, intake of more than two standard alcoholic drinks per day, and history of hip fracture in parents are related with higher risk for gio. as a result treatment with calcium and vitamin d should be started to prevent bone loss. bisphosphonates are generally indicated in patients receiving long-term gcs. as in any medical treatment, adherence to prescribed medication results of recent studies showed that adherence to osteoporosis preventive medications is relatively poor [1113]. however, there has been some controversy regarding adherence to osteoporosis preventive medications. a cross-sectional study by castelo-branco et al. in spain showed that out of 7888 patients aged 45 or over, who received calcium and vitamin d supplementation, only 31.2% were adherent. fatigue due to long-term therapy was the main reason for nonadherence amongst the patients.. carried out on 9851 postmenopausal women revealed that adherence to treatment with osteoporosis preventive medications was poor. additionally, the authors concluded that the most important reasons of nonadherence are fear of side effects and lack of motivation. on the contrary, recent study by tafaro et al. showed high adherence to osteoporosis preventive medications if therapies less than 30 days were excluded. out of 6930 patients who were included in the study 43.8% were adherent to the treatment. the most frequent reasons of nonadherence were included side effects and misinformation given by the physician. contrary to what we expected this study found that adherence to preventative osteoporosis medications in patients with pmr and gca was high and the most frequent causes for nonadherence were forgetfulness and side effects. one of the reasons of our patients ' high adherence to the osteoporosis preventive medications is patients ' awareness of gcs side effects and osteoporosis. this is due to the fact that all physicians are responsible to inform patients about the side effects of gc treatment. in the same way responsible physicians and nurses are asked to update the patient medical status at each visit and specifically ask whether the patients prescribed osteoporosis preventive medication while they receive gc treatment. when patients pick up their prescribed gc from the drugstore they will also be reminded that they should take calcium and vitamin d. in addition the important patient association, the osteoporosis associations in denmark with 24 local subdivisions, gives useful information about osteoporosis to the patients who are at risk of osteoporosis as well as entire population. this is in line with previous findings [14, 16, 18], suggesting that the deficit in patient awareness is related with low adherence and physicians support is an important factor to achieve better adherence. on the other hand, most of our patients (96%) are referred to carry out dxa-scan which stressed the importance of treatment. another important factor for the high adherence in our patient group could be that pmr/gca can be very painful conditions, where the prescribed prednisolone treatment causes rapid freedom from symptoms. this can underpin confidence in the physician's treatment and why adherence to the additional prophylactic treatment might be higher. the limitation of our study was that there was no way to control patients ' answers as well as medications intake. moreover the accuracy of results was dependent on patients ' memory to report their adherence level retrospectively. we can not rule out information bias, as there will probably be a tendency for the patients to provide what they believe to be socially accepted answers rather than the truth, especially with regard to behavioral aspects and health conditions associated with taboos. in our situation a taboo might be the fact that the patient had not followed the doctor's advice. since the patients were asked the name of the formulations and since the patients in a friendly tone were told that lack of adherence is a common and understandable state, we believe that we have predominantly received correct answers from our patients. we think that our concept of giving thorough information concerning the side effects of gc to the patients at each visit in the clinic followed by a prescription of dxa-scan is advisable for all departments to increase patients ' adherence. we also think that our patient population with well characterized and initially painful diseases were more motivated for prophylaxis than otherwise healthy postmenopausal osteoporotic patients, where the adherence is described to be low [1113]. a possible way for evaluation whether the patients pick up the medicine at the pharmacies might be to check this on the electronic journals medication module, which is possible, but it requires an additional permission from the danish data protection agency as well as from the patient. there is probably little doubt that this would astonish patients much and give them a feeling that we do not trust them, which would make cooperation with the patients difficult in the future. more studies in this field are needed to confirm our results, but we see already a problem in a prospective design, because this can not be done without patients knowing it will be checked, if they collect the medication, thereby inducing a relative risk for another information bias.

objective. to estimate level of adherence to oral calcium and vitamin d supplementation as well as bisphosphonate amongst patients with pmr and gca treated with glucocorticoids. method. a total of 138 patients with the diagnosis of pmr and/or gca registered in our department in december 2013. in this cross-sectional study we interviewed all the patients to measure level of adherence to calcium and vitamin d, as well as bisphosphonates. results. out of the 118 included patients, 88.9% of them were adherent to their prescription. only 2 patients (1.7%) did not take calcium and vitamin d at all and 10 patients (8.5%) took their medication infrequently, 9 and 1 out of 10 patients took the medication 50100% of the time and less than 50% of the prescribed dose, respectively. sixty-one patients received additional treatment with bisphosphonate and 96.6% were adherent to this therapy. the remaining 3.4% of the patients did not take the medication at all. forgetfulness, adverse side effects, and lack of understanding of treatment benefits were the most significant causes for nonadherence to calcium and vitamin d. conclusions. contrary to what we expected this study found that adherence to osteoporosis preventive medication in patients with pmr and gca was high.

PMC4603323

pubmed-1034

ceftriaxone sodium is a long acting, broad-spectrum cephalosporin antibiotic for parenteral use. it exerts in vitro activity against a wide range of gram-negative and gram-positive microorganisms. it is highly stable to most beta-lactamases, both penicillinases and cephalosporinases, of gram-positive and gram-negative bacteria. a thorough literature survey has revealed that hplc method for ceftriaxone sodium with combination of other drugs and individually in dosage forms [215], microbial bioassay methods [16, 17], and spectrophotometric methods in dosage forms [1822] have been reported for analysis of ceftriaxone sodium. costlier and volatile solvents were used as mobile phase solvent system and the time of analysis was more in some reported methods. some spectrophotometric methods are recently described in the literature for analysis of drugs in raw material and finished products such as ceftazidime [2325], cefuroxime, and cefazolin. these spectrophotometric methods involve the use of no toxic organic solvents, which do not contribute to the generation of this kind of waste by the chemicals or industries. in this context therefore, the trend is that the industries look for ways to reduce the impacts of their activities on the environment. so, the principle objective of this study was, therefore, to develop a simple, selective, precise, less time consuming, and economical method with a wide linear range and good sensitivity for assay of ceftriaxone sodium in the powder for injection dosage forms. the parent drug stability guidelines issued by the international conference of harmonization (ich) require that analytical test procedure should indicate stability. therefore, the present study was extended to establish the inherent stability of ceftriaxone sodium under different stress conditions such as, alkaline, acidic, oxidative, and photolytic conditions. thus, this method can be utilized to compare the results for the content analysis of stability samples, since the purpose of stability studies is to monitor possible changes to a product or a material over a time at different storage conditions. spectrophotometric analysis was carried out on a systronics 2201, uv-visible double-beam spectrophotometer with matched 1 cm path-length quartz cells. absorption spectra were recorded on a medium scan speed, setting slit width to be 1 nm. ceftriaxone sodium was obtained as a gift sample from orchid chemicals and pharmaceutical ltd., the other chemicals like sodium hydroxide, hydrochloric acid, and hydrogen peroxide used were of merck-ar grade and double distilled water was used throughout the experiment. a stock solution was prepared by dissolving 100 mg of ceftriaxone sodium pure drug in 100 ml of distilled water to get standard stock solution (1 mg/ml). to a set of 10 ml volumetric flasks, aliquot volumes containing the drug were quantitatively transferred from standard stock solution and made up to the mark with distilled water to obtain final concentrations of 550 g/ml of ceftriaxone sodium. the absorbance was measured at 241 nm and calibration graph was constructed by plotting the absorbance versus the concentration of the drug. the validity of the method was tested regarding linearity, specificity, accuracy, and precision according to ich q2b recommendations. accuracy and precision of the method were evaluated with the help of percent recovery, standard deviation (sd), and percent relative standard deviation (rsd) by using standard addition method. three levels of standard drug (10%, 20%, and 30%) were spiked individually with the 100 mg equivalent of powder for injection dosage form ceftriaxone sodium and analysed in six replicates during the same day (intraday precision) and six consecutive days (interday precision). a linear correlation was found between absorbance at max and various concentrations of ceftriaxone sodium. the linearity graph obeyed beer's law in the range from 5 to 50 g/ml and it was described by regression equation (y=mx+c) and correlation coefficient (r) which were displayed on the graph. molar absorptivity, sandell's sensitivity, standard error on slope, confidence limit of slope (95%), standard error on intercept, confidence limit of intercept (95%), lod, and loq were calculated. for the determination of lod and loq, the method is based on residual standard deviation of regression line and slope. to determine lod and loq, the specific calibration curve was studied using the sample containing analyte in the range of detection limit and quantitation limit. robustness was studied by evaluating the influence of small but deliberate variations in the experimental condition like storing the similar concentration (20 g/ml) of drug solution at two different temperatures (20c and 30c) for 1 h and performing the stability of the sample solution at various time intervals (after 1 h and after 6 h) on the analytical performance. a 2 ml aliquot of standard stock solution of ceftriaxone sodium (1 mg/ml) was taken in four replicates in a volumetric flask (100 ml) and mixed with 10 ml of 0.1 n hcl (acid hydrolysis) or 0.1 n naoh (alkaline hydrolysis) or 5% h2o2 (oxidative degradation) and set aside for 1 h at room temperature. a solution of drug (20 g/ml) was prepared as per the procedure under construction of the calibration graph and was exposed to uv radiation of wavelength 254 nm and of 1.4 flux intensity for 24 h in a uv chamber. for thermal degradation solid drug was kept in an oven at 100c for 24 h. after cooling to room temperature, 20 g/ml concentrated drug solution was prepared as per above said method. finally, absorbance of all the solutions resulted from acid and alkaline hydrolysis, and oxidative degradation, photolytic degradation, and thermal degradation were measured at 241 nm against respective solvent as blank in each case. for the estimation ceftriaxone sodium from injection (by procuring three brands from market), a portion of powder equivalent to 100 g of the drug from each brand was accurately weighed and transferred into 100 ml volumetric flask. the drug was dissolved by adding 70 ml of distilled water and sonicated for 15 min. aliquot containing suitable concentration (20 g/ml) of ceftriaxone sodium was analyzed as described under construction of the calibration graph. the nominal content of the drug in injection for each brand was determined using the corresponding regression equation and results of% rsd of drug content were statistically compared with reported method. aqueous solution of ceftriaxone sodium showed absorbance maximum (max) at 241 nm (figure 2), and at this wavelength distilled water did not show any significant absorbance. least square regression equation of ceftriaxone sodium in aqueous medium has shown that the r value very close to 1 indicated high degree of correlation between two variables, such as absorbance and concentration (figure 3). beer's law was obeyed over the range of 550 g/ml; high values of molar absorptivity and low values of sandell's sensitivity and lod revealed that proposed methods are highly sensitive. lod and loq values for the drug were found and all the parameters of calibraration curve were displayed in table 1. to check accuracy and precision, assays were carried out for six times within a day (intraday precision) and in six consecutive days (interday precision) by adding three different levels of analyte to the formulation.% rsd values were 0.5 (intraday) and 1.18 (interday) indicating high precision of developed method. accuracy of the method was ascertained as mean% recovery between measured actual concentration and taken concentration for ceftriaxone sodium. the values of% recovery, very close to 100%, demonstrate high accuracy of the proposed method (table 2). robustness studies assumed that the small variations in any of the variables did not significantly affect the results (table 3). ceftriaxone sodium sterile formulations were analysed by proposed method and by reported method, which involved the analysis of analyte with 0.1 m sodium hydroxide and absorbance measured at 258.8 nm. results were compared by student's t-test and variance-ratio f-test. calculated t-values and f-values did not exceed tabulated values of 2.776 (t) and 6.39 (f) at 95% confidence level and for four degrees of freedom (table 4) which indicates close similarity between proposed and reported method. ceftriaxone sodium was subjected to various stress conditions like acid, alkaline, hydrogen peroxide induced degradation, and thermal and photolytic condition. analysis was performed by measuring absorbance of ceftriaxone sodium after subjecting it to stressed conditions at max of pure drug. percentage degradation was calculated by the formula:% degradation=(expected concentrationactual concentration)/expected concentration 100, and percentage recovery also was calculated for each case (table 5). results revealed no change in absorbance of drug solution at alkaline hydrolysis, so its percentage recovery is very close to 100% which indicates the drug stability. but there was significant change in absorbance after acid and hydrogen peroxide treatment, confirming that ceftriaxone sodium is susceptible to acid hydrolysis (% degradation of 11.0%) and oxidation (% degradation of 7.95%). analyte undergoes significant degradation under acid hydrolysis and oxidation, whereas it is stable under alkaline treatment. proposed method was validated for linearity, accuracy, precision, and robustness and method was applied to various formulations and results were statistically compared with reference method which showed that there were no significant changes in the result. so, method can be utilized for determination of purity of drug available from various sources without any tedious procedure and also used in analysis of stability study samples.

a simple, selective, and stability indicating spectroscopic method has been selected and validated for the assay of ceftriaxone sodium in the powder for injection dosage forms. proposed method is based on the measurement of absorbance of ceftriaxone sodium in aqueous medium at 241 nm. the method obeys beer's law in the range of 550 g/ml with correlation coefficient of 0.9983. apparent molar absorptivity and sandell's sensitivity were found to be 2.046 103 l mol1 cm1 and 0.02732 g/cm2/0.001 absorbance units. this study indicated that ceftriaxone sodium was degraded in acid medium and also underwent oxidative degradation. percent relative standard deviation associated with all the validation parameters was less than 2, showing compliance with acceptance criteria of q2 (r1), international conference on harmonization (2005) guidelines. then the proposed method was successfully applied to the determination of ceftriaxone sodium in sterile preparation and results were comparable with reported methods.

PMC4897461

pubmed-1035

cardiovascular disease (cvd) is a leading cause of morbidity and mortality in the united states. it kills one american every 38 seconds and accounts for 1 of every 2.9 deaths, more deaths than any other major cause of death. the 2006 overall death rate due to cvd was 262.5, but the rate increases substantially with age. it is estimated that more than 1 in 3 men and around 1 in 4 women aged 75 and over currently live with the condition. although cvd is the leading cause of death, modifiable behavioral risk factors are major contributing or actual cause of this mortality. in both younger and older age groups the five key risk factors for cvd are hypertension, high serum cholesterol, diabetes, body mass index, and smoking. the majority of studies of alcohol intake have found j- or u-shaped risk curves with light to moderate drinkers having a lower risk of atherosclerotic cvd than nondrinkers or heavy drinkers. for physical activity, a dose-response relationship exists between duration and intensity of activity and cvd disease risk, with even relatively low levels of physical activity providing some benefit compared with inactivity. although these lifestyle practices have substantial health benefits and reduce mortality, few studies have examined their impact in combination and on survival beyond age 75. as part of a prospective cohort study of the effect of modifiable lifestyle practices on longevity and successful aging, we explored the association of smoking, alcohol consumption, caffeine intake, physical activity, and body mass index on cvd mortality in a large cohort (over 13,000) of elderly (median age 74 years) men and women followed for 26 years. the leisure world cohort study was established in the early 1980s when 13,978 (8877 female and 5101 male) residents of a california retirement community (leisure world laguna hills) completed a postal health survey. the population and the cohort are mostly caucasian, well educated, upper-middle class, and elderly. the baseline survey asked about demographic information (birth date, sex, marital status, number of children, height, weight); brief medical history (high blood pressure, angina, heart attack, stroke, diabetes, rheumatoid arthritis, fractures after age 40, cancer, gallbladder surgery, glaucoma, cataract surgery); medication use (hypertensive medication, digitalis, nonprescription pain medication); personal habits (cigarette smoking, exercise, alcohol consumption, vitamin supplement use); usual frequencies of consumption of 58 food (or food groups) that are common sources of dietary vitamin a and c; beverage intake (milk, regular coffee, decaffeinated coffee, black or green tea, and soft drinks). based on their reported smoking history we classified participants as never, past, or current smokers. consumption of alcoholic beverages was asked separately for wine (4 oz.), beer (12 oz.), and hard liquor (1 oz.), each equivalent to about 1/2 oz. of alcohol. response choices for average weekday consumption were never drink, less than 1, 1, 2, 3, and 4 or more drinks. total alcohol intake per day was calculated by summing the number of drinks consumed of each type. individuals were then categorized into four groups: 0,<1, 2-3, and 4+ drinks/day. we estimated daily caffeine intake by summing the frequency of consumption of each beverage and chocolate multiplied by its average caffeine content (mg/standard unit) as 115, 3, 50, 50, and 6 for regular coffee, decaffeinated coffee, tea, cola soft drinks, and chocolate, respectively. caffeine intake was categorized as<50, 5099, 100199, 200399, 400+ mg/day. body mass index (weight (kg)/height (m)) was calculated based on self-reported height and weight at baseline and categorized according to federal guidelines: underweight (< 18.5), normal weight (18.524.9), overweight (2529.9), and obese (30 +) [7, 8]. the amount of time spent on physical activities was ascertained by asking, on the average weekday, how much time do you spend in the following activities? active outdoor activities (e.g., swimming, biking, jogging, tennis, vigorous walking), active indoor activities (e.g., exercising, dancing), other outdoor activities (e.g., sightseeing, boating, fishing, golf, gardening, attending sporting events), other indoor activities (e.g., reading, sewing, crafts, board games, pool, attending theater or concerts, performing household chores), watching tv. for each question, the response categories were 0 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3-4 hours, 5-6 hours, 7-8 hours, 9 hours or more per day. the time spent per day in active exercise was calculated by summing the times spent in active outdoor activities and active indoor activities and in other activities by summing the times spent in other outdoor activities and other indoor activities. followup of the cohort is maintained by periodic resurvey and determination of vital status by search of governmental and commercial death indexes and ascertainment of death certificates. to date 55 cohort members have been lost to follow up; search of death indices did not reveal that these individuals were deceased. cause of death was determined from death certificates or by codes provided by the california department of vital statistics. we included as cvd deaths those coded 390459 in international classification of diseases 9 (years 19811998) and i00i99 in international classification of diseases 10 (years 19992007). hazard ratios (hrs) and 95% confidence intervals (cis) were obtained using cox regression analysis. for the cox models, chronological age was used as the fundamental time scale with study entry being the age when the survey was completed and the event of interest being age at cvd death. separate analyses were performed for four age groups (< 70, 7074, 7579, and 80+years) within the two sexes. hrs were calculated for each lifestyle factor adjusted for age (continuous) and then additionally adjusted for the other lifestyle variables plus seven separate histories (no, yes) of hypertension, angina, heart attack, stroke, diabetes, rheumatoid arthritis, and cancer. no adjustment in the p values was made for multiple comparisons. to account for the possibility that recent disease development may have influenced lifestyle practices as well as be related to mortality previous reports present details of the methods and validity of exposure and outcome data [1015]. the institutional review boards of the university of southern california and the university of california, irvine approved the study. after excluding 682 subjects with missing information on the lifestyle factors, we analyzed data on 13,296 subjects (8444 women and 4852 men). at study entry, the participants ranged in age from 44 to 101 years (median: 74 years). by december 31, 2007, the subjects had contributed 180,122 person-years of followup (median: 13.5 years), and 11,929 (7367 women and 4562 men) had died. age at death ranged from 59 to 108 years (median: 87 years). over half of all deaths were due to cvd: 4575 women and 2656 men. differences between males and females were highly statistically significant (p<.001) for all variables except caffeine (p<.01). because of these differences as well as the different patterns of smoking (amount and duration), alcohol (type), activities (type), and body-build between men and women and the fact that women live longer on average than men and for comparison with other studies limited to a single sex, we performed separate analyses for men and women. tables 2 and 3 show the age-adjusted and multivariable-adjusted hrs of cvd mortality for the various lifestyle variables for women and men, respectively. adjustment for potential confounders increased the observed hrs for smoking but had limited effect on the others, generally attenuating the observed hrs. although caffeine intake showed no consistent effect, the other modifiable factors were related to cvd death. current smokers had significantly increased (about 40130%) risk compared with never smokers in all age-sex groups. in women, alcohol consumption (<3 drinks/day) was related to decreased (about 1530%) risk compared with abstainers in all but the oldest age group. in men, 4+ drinks/day was associated with reduced (about 1530%) risk in all but those aged 7074 years. women and men aged 70+years old who participated in active activities, even as little as 1/2 hour/day, had 2040% lower risk of cvd death compared to those who reported no active activities participation in other activities was also associated with reduced risk. however, more time in these activities was needed to show the same reduced risk as for active activities. underweight and obese women in all age groups were at increased risk of cvd death (though not all groups showed statistically significant effects). underweight men also appeared to be at increased risk, though the number of such men was small (n=81). risk was also increased in overweight men aged<75 years compared with their normal weight peers. exclusion of the first five years of followup (including 1826 early deaths) changed the findings slightly. the multivariate-adjusted risk estimates changed by less than 10 percent except for current smokers aged 80+years (women 1.46 to 1.28, men 2.20 to 2.50), underweight women aged 7074 years (1.29 to 1.13), obese women aged 7579 years (1.09 to 1.21), underweight men (aged<70 years, 1.75 to 1.49; aged 7074 years, 2.76 to 1.84; aged 7579 years, 1.48 to 1.72; and aged 80+years, 1.12 to 0.84), obese men aged 80+years (1.40 to 1.91). hrs for active and other activities in men aged 75+years were generally attenuated to 1.0, and all became nonsignificant. our study extends the available literature on the cvd survival benefits of several lifestyle practices to the very old. we confirmed the beneficial effect of not smoking, participating in activities, drinking alcohol, and having a normal body mass index. each of these was associated with reduced cvd death in our elderly men and women, even those aged 80 years and older. we previously reported the effects of several of these lifestyle practices on all-cause mortality in this cohort [5, 6, 8, 15]. although not age stratified, results were similar to those found in the present analysis. alcohol intake showed a small beneficial effect (15% reduction in risk) in both men and women, while a shallow u-shaped association of caffeine intake with mortality was observed in both sexes. the curves for the association of body mass index and all-cause mortality were almost identical for men and women with being underweight increasing risk about 50% and being obese increasing risk 2025%. the indices of physical activities, alcohol and caffeine intake, and smoking used in this study are crude and self-reported and their reliability and validity were not ascertained. although our data on other variables are also self-reported, previous studies in our population and others support the reliability of medical history of major chronic disease [10, 13] and of self-reported height and weight. another limitation is that changes over time in all potential risk factors may affect outcome. additionally, the subjects in our study were mostly white, highly educated, and of middle social-economic class and therefore not representative of the general population. although this may limit the generalizability of our results, it offers the advantage of reduced potential confounding by race, education, social-economic class, and presumed access to health care. additionally, although we adjusted for other risk and potential confounding factors, unrecognized and uncontrolled confounders can not be ruled out in this or any observational study. this cohort has the advantages of population-based prospective design, large sample size, inclusion of men and women, and data on several lifestyle factors and important confounders, including factors previously found to be related to mortality. the long and almost complete followup of the cohort resulted in a large number of outcome events. previous studies have identified lifestyle factors that promote health and increase longevity, including absence of current smoking, drinking a moderate amount of alcohol, participating in moderate exercise, and being of normal body mass index. however, few studies have investigated the combined effect of these lifestyle factors and even fewer have included the very old or, if they did, did not show age-stratified results. in the hale project of european subjects aged 70 to 90 years, adherence to a mediterranean diet (hr=0.71) and healthful lifestyle (moderate alcohol use (hr=0.74), physical activity (hr=0.65), and nonsmoking (hr=0.68)) was associated with a lower rate of cardiovascular mortality. in the nurses ' health study of middle-aged women, those who did not smoke cigarettes, were not overweight, maintained a healthful diet, exercised moderately or vigorously for half an hour a day, and consumed alcohol moderately had an incidence of coronary events that was more than 80 percent lower than that in the rest of the population. in the seneca (survey in europe on nutrition and the elderly: a concerted action) study of those aged 7075 years, a high-quality diet, nonsmoking, and physical activity were positively related to 10-year survival in both men and women. for men, the mortality risk for a low-quality diet was 1.25, for inactivity was 1.36, and for smoking was 2.06. for women, the mortality risk for smoking was 1.76 and for inactivity 1.75, much higher than the risk associated with a low-quality diet 1.26. in the nhanes i epidemiologic followup study, smoking predicted survival in middle-aged (4554 years old) and older (6574 years old) men and middle-aged women; nonrecreational physical activity predicted survival in older men and women; low body mass index was also associated with shorter survival in older men and middle-aged and older women; drinking was associated with shorter survival in older men. experimental, clinical, and epidemiological studies suggest mechanisms that provide a biological basis for causal relations between these behavioral risk factors and lower rates of cvd and death. alcohol increases high-density lipoprotein cholesterol concentrations, decreases platelet aggregation, and affects tissue plasminogen activator and other components of clotting and fibrinolysis. likewise, physical activity reduces blood pressure, increases high-density lipoprotein cholesterol, decreases triglycerides, improves cardiorespiratory fitness, and produces beneficial changes in inflammatory/hemostatic factors. the reason for increased mortality among the underweight elderly is not clear. previous all-cause and cvd mortality studies in the elderly have found persons in the lowest weight category at increased risk of death [20, 21]. being lean, especially in the elderly, may represent a real risk because of nutrient deficiency and physical, functional, and psychological impairment. evidence from epidemiologic studies indicates that the same factors that are associated with increased risk of cvd in middle-aged people are relevant in older adults. although much effort has focused on the pharmacologic management of hypertension and blood lipid levels with proven success, lifestyle can also affect cvd mortality. changing these risk factors in older adults can help reduce cvd risk as it does in middle-aged adults and without side effects, high cost, or medical intervention. together avoidance of smoking, sensible drinking habits, regular physical activity, and maintenance of a healthy body weight may prevent much of the cvd in western populations. with increasing age, the elderly, however, may become limited by comorbid conditions, decreased functional ability, impaired cognition, and emotional instability and therefore need special programs providing increased physical and social activities and balanced and healthful nutrition. of course, the greatest benefit will be achieved by adopting these habits early in life and maintaining them throughout the life course. results in this large elderly cohort with long followup showing a decreased risk of cardiovascular mortality with several lifestyle practices suggest that maintenance of these is an important health promoter in aging populations .

modifiable behavioral risk factors are major contributing causes of death, but whether the effects are maintained in older adults is uncertain. we explored the association of smoking, alcohol consumption, caffeine intake, physical activity, and body mass index on cardiovascular disease (cvd) mortality in 13,296 older adults and calculated risk estimates using cox regression analysis in four age groups (< 70, 7074, 7579, and 80+years). the most important factor was current smoking, which increased risk in all age-sex groups. in women, alcohol consumption (3 drinks/day) was related to decreased (1530%) risk in those<80 years old; in men, 4+ drinks/day was associated with reduced (1530%) risk. active 70+year olds had 2040% lower risk. both underweight and obese women were at increased risk. lifestyle practices impact cvd death rates in older adults, even those aged 80+years. not smoking, moderate alcohol consumption, physical activity, and normal weight are important health promoters in our aging population.

PMC3025386

pubmed-1036

overwhelming evidence proved that the formation and accumulation of advanced glycation end products (ages) progress in a normal aging process and at an accelerated rate under diabetes [1, 2]; an increase in the steady-state levels of highly reactive dicarbonylic compounds may lead to the formation of ages, while an increase in the generation of ages can be partly explained by the process of non-enzymatic glycosylation of proteins. these proteins appear to contribute to diverse cellular functions, such as the specific recognition and degradation of ages-modified proteins. so far, several age-binding proteins have been identified, including age-r1, age-r2, age-r3, rage, and macrophage scavenger receptors type i and type ii. in endothelial cells, ages exert adverse effects on mitochondrial function, with elevated production of reactive oxygen species (ros), and consequently increased oxidative stress leading to cellular dysfunction and even cell death. ages also increase the formation of intracellular ros, no, and nitric oxide synthase (nos) and stimulate ceramides as well as the mapk cascade, which activates different targets including transcription factors through intermediate molecules such as nf-b [46]. therefore preventing the endothelial cell from age-triggered injury may improve diabetes-associated vascular complications. the endogenous opioid peptides, endomorphin 1 (tyr1-pro2-trp3-phe4-nh2, em1) and endomorphin 2 (tyr1-pro2-phe3-phe4-nh2, em2), which were discovered in 1997 by champion et al., have higher affinity and are more selective for the -opiate receptor than other opioid substances. many studies indicated that the endogenous opioid system played roles in the regulation of the cardiovascular system in a variety of species [8, 9], such as rabbits, rats [11, 12], and mice furthermore, jaffe et al. reported that vasodilator responses to endomorphin 1 were mediated by a nitric oxide-dependent mechanism and may act as an endothelium-dependent vasodilator agent in rat however, the precise molecular mechanisms by which ems inhibit age-induced injury in endothelial cells have not yet been thoroughly elucidated. the purpose of this study is to investigate the inhibitory effects and to involve mechanisms of ems on ages induced-oxidative stress and apoptosis in human umbilical vein endothelial cells. endomorphins was synthesized by shanghai hanhong chemical co., ltd (shanghai, china). fetal bovine serum (fbs) no and endothelial nitric oxide synthase (enos) assay kits were obtained from jian-cheng biological engineering institute (nanjing, china). rabbit anti-human p38 (h174) antibody, fitc-conjugated goat anti-rabbit antibody were obtained from bioworld technology, inc. the primers, taq polymerase, dntp, and rnasin were provided by takara bio inc. ages-bsa was produced by incubation of 10 mg/ml bsa with 100 mm glucose in 150 mm phosphate-buffered saline (pbs), ph 7.4 at 37c for 6 weeks. ages-bsa was identified by fluorescence spectrophotometer. before the study, we recruited mothers who assented and gave written consent to contributing 10 cm of umbilical cord postpartum, and were isolated according to a previous reported method with minor modifications. cultured cells were identified as endothelial by their morphology and the presence of von willebrand factor. briefly, the cells were grown in dmem supplemented with 10% fetal bovine serum, penicillin (100 units/ml), and streptomycin (100 mg/ml). culture medium was refreshed every two days. for experiments, cells treated with endomorphins (10 m, 1 m, 0.1 m, or 10 nm) were exposed to these substances for 2 h before treatment with ages-bsa. cells were incubated in 96-well plates at a density of 5 10 cells with 200 l culture medium per well. after cells were incubated according to the aforementioned group, 30 l medium containing 5 mg/ml mtt (sigma, usa) was added to each well. following a 4 h incubation period, 100 l and then, after overnight incubation in darkness, the dissolved mtt crystals were quantified. optical densities were obtained using a test at a wavelength of 570 nm. levels of the nitric oxide (no) derivative nitrite were determined in the conditioned medium of huvec with the griess reaction. after cells were incubated according to the aforementioned grouping, 100 l culture solutions of each well was collected and put into the counterpart well of another plates, then no production in cells was measured by griess method and according to the indication on the no assay kit. after cells were incubated according to the aforementioned grouping, 200 l culture solutions of each well was collected and put into the counterpart well of another plates, then enos and inos expression in cells were measured according to the instructions given in the nos assay kit. each experiment was performed in triplicate. a specific sandwich enzyme-linked immunosorbent (elisa) employing monoclonal antibody was used to determinate the level of et-1; the elisa was performed according to the instructions given in the et-1 elisa kit by ad litteram diagnostic laboratories (usa). after incubation, the cells were washed twice with pbs and the total mrna was extracted by trizol. thereafter, it was reverse-transcripted under following conditions: 37c for 15 min, 85c for 5 sec, and the cdna product was stored at 80c. for the pcr, 3 l of the cdna products of each sample was amplified with taq dna polymerase, using a primer pair specific to human enos, et-1, and -actin in a 25 l reaction volume; the primer sequences and pcr condition were described in table 1. pcr cycle conditions were 95c for 30 sec, 95c for 5 sec, 60c for 30 sec for 50 cycles, with an initial denaturation at 94c for 5 min and a final extension of 5 min at 72c. the resulting data were analyzed by rotor-gene real-time analysis software 6.1. cells were fixed with 4% paraformaldehyde (ph 7.4) for 15 min at 4c and permeabilized with 0.2% triton x-100 for 5 min at room temperature. after being blocked with 5% normal bovine serum for 30 min, cells were incubated with p38 mapk antibody (1: 100 dilution) at 4c overnight followed by fitc-conjugated secondary antibody (1: 50 dilution, 1 h). statistical evaluations were performed using one-way anova followed by tukey's test. values of p<0.05 were considered statistically significant. exposure of huvec to ages-bsa (100 mg/l) for 6 h, 24 h, and 48 h significantly decreased the cells viability significantly compared to that of bsa (100 mg/l, as osmotic control) (p<0.01, figure 1). the cell viability was decreased at 6 h and reached minimal level at 48 h after ages-bsa treatment. whereas pretreatment with em1 and em2 (10 m, 1 m, 0.1 m, 10 nm) significantly increased the cells viability compared to ages-bsa group, the function was obvious at 24 h, 48 h compared to 6 h (p<0.005 versus p<0.05), and high concentration was more obvious than low concentration, which indicated that ems can attenuate the reduction of cell viability by ages-bsa in a time- and concentration-dependent manner (figure 2). as is shown in figure 3, the no production in huvec was 11.06 0.69 m after incubation for 24 h in the control group and was 20.15 2.05 m in the ages-bsa group, which was notably higher than that of control group (p<0.005), while the no production in huvec were 14.24 0.95 m, 14.70 1.72 m, 15.45 1.36 m, 16.06 1.60 m after incubation for 24 h in em1 pretreated group as the concentrations of 10 m, 1 m, 0.1 m, 10 nm, which were notably lower than that of ages-bsa group (p<0.005, 0.05). these results indicated that em1 inhibited the no production in a concentration-dependent manner in huvec stimulated by ages-bsa. the same results were observed in em2 group. in the control group (see figure 4), the secretion of inos was 0.29 0.03 u/ml after incubation for 24 h and was 0.55 0.05 u/ml in ages-bsa treated group, which was significantly increased to the control group (p<0.005). while the inos secretion in em1, em2 pretreated groups were 0.33 0.09 u/ml, 0.36 0.05 u/ml, 0.39 0.03 u/ml, 0.41 0.05 u/ml; 0.32 0.05 u/ml, 0.35 0.03 u/ml, 0.36 0.05 u/ml, 0.38 0.09 u/ml as the concentrations of 10 m, 1 m, 0.1 m, 10 nm, which were significantly decreased to the ages-bsa treated group (p<0.005, 0.05), these results indicated that ems efficiently and concentration-dependently inhibited the inos secretion in huvec. in the control group (see figure 5(a)), the secretion of enos was 2.39 0.09 u/ml after incubated for 24 h, and that of ages-bsa treated group was 0.65 0.17 u/ml in, which was significantly decreased compared to the control group (p<0.005). while the secretions of enos in em1, em2 pretreated groups were 2.30 0.09 u/ml, 2.10 0.09 u/ml, 2.03 0.22 u/ml, 1.91 0.14 u/ml; 2.32 0.43 u/ml, 2.23 0.39 u/ml, 2.18 0.12 u/ml, 2.06 0.16 u/ml as the concentrations of 10 m, 1 m, 0.1 m, 10 nm, which were significantly higher compared to the ages-bsa treated group (p<0.005, 0.05), these results indicate that ems pretreatment abrogated the decrease efficiently, and in a concentration-dependent manner. similar results were observed for the mrna level of enos (figure 5(b)). these results indicate that ems efficiently inhibited the decrease of enos expression and secretion stimulated by ages in huvec. in the control group (figure 6(a)), the secretion of et-1 was 0.76 0.03 ng/ml after incubated for 24 h and was 0.99 0.08 ng/ml in ages-bsa treated group, which was significantly higher than that in the control group (p<0.005). while the et-1 secretions in em1, em2 pretreated groups were 0.85 0.03 ng/ml, 0.87 0.06 ng/ml, 0.88 0.01 ng/ml, 0.89 0.04 ng/ml; 0.76 0.03 ng/ml, 0.78 0.13 ng/ml, 0.81 0.06 ng/ml, 0.85 0.01 ng/ml as the concentrations of 10 m, 1 m, 0.1 m, 10 nm, which were significantly lower than the ages-bsa treated group (p<0.005, 0.05), these results indicated that ems pretreatment abrogated the increase efficiently in a concentration-dependent manner. similar results were observed for the mrna level of et-1 (figure 6(b)). these results indicated that ems efficiently inhibited the et-1 mrna expression and et-1 secretion in huvec. in this study, our investigation tries to ascertain whether ems inhibit the ages-induced dysfunction in endothelial cells through p38 mapk activities. as noted in figures 7(b) and 8(a), the fluorescence intensity of p38 mapk in the nucleus was obviously elevated in ages-treated huvecs relative to that in bsa-treated group (figures 7(a) and 8(b)). however, in ems pretreated groups (figures 7(c)7(f)) and figures 8(c)8(f)), the fluorescence intensity of p38 mapk in the nucleus was similar to bsa group, obviously weaker compared to ages-bsa group. therefore, these results implied that ems inhibited the expression of p38 mapk in the nucleus induced by ages. vascular endothelial cells play an important role in modulating anti-thrombus and maintaining the natural function of vascular by secreting many active substances. ages, high blood glucose, oxide-ldl, and inflammatory factor are the main factors that induce endothelial cells injury [19, 20]. once endothelial cell were damaged, it would result in dysfunction and abnormal secretion of active substances (e.g. no, nos, et-1, and prostacyclin pgi2). no is a strong oxidant and one of the most important mediators in the regulation of endothelial cell functions, which is synthesized by three isoforms of no synthases (nos), that is, enos, inos, and nnos. enos is constitutively expressed and there is particularly continuous no production during physiological conditions. our results suggested that incubation with ages (100 mg/l) for 24 h led to an significantly increase in the no, inos production and a decrease in the secretion and the mrna expression of enos compared to control group in huvecs (figures 35); these effects were strikingly reversed by em1 and em2 pretreatment, these findings were in line with some previous reports [22, 23]. it is well recognized that no produced by enos is described as low output pathway whereas inos generates no in a high output manner which causes cell or organ dysfunction and apoptosis. evidence indicated that nos isoform expression (particularly inos) is altered and no is oversupplied in some pathologic conditions [25, 26]. based on our data, we inferred that ages can alter nos isoform expression by decreasing enos expression and stimulating inos oversupplied in huvecs, resulting in overproduction of no, which was due to enhanced inos expression. ems can enhance nos activity by up-regulating enos expression and decreasing inos production, leading to a health production and bioavailability of no. it is indicated that ems can attenuate the dysfunction of nos induced by ages in huvecs. a large amount of studies reported that ems can regulate nos expression in mammalian cells, such as human bone marrow stromal cells, human macrophages, and mice peritoneal macrophages; however, to our knowledge, there was no report in huvecs. et-1, a member of potent vasoconstrictor polypeptide family, has been characterized as one of the most potent endogenous vasoconstrictors; the balance between no and et-1 is critical for the regulation of vascular tone. our study clearly indicated that em1 and em2 pretreatment down-regulated the mrna expression and the plasma concentration of et-1, which was up-regulated by ages-bsa (figure 6). we think that ems inhibited et-1 expression through increased no production which is synthesised by enos and decreased no production which is synthesised by inos, leading to a balance between et-1 and no, potentially contributing to endothelial function. it was shown earlier that p38 mapk directly phosphorylates c-jun [31, 32]; protein phosphatases and p38 mapk interact in various cell systems and have been implicated in the regulation of diverse cellular responses together. in huvecs, ages induce differentiation accompanied by activation of erk, jnk, and p38 mapk pathways. these datum are consistent with our observation that p38 mapk is activated by ages (100 mg/l); furthermore, our study showed that p38 mapk activation was weakened in ems pretreated groups relative to ages groups. the results indicated that the rescue effect of ems on the ages-induced injury may be mediated, at least in part, by the p38 mapk pathway. it is acknowledged that the research means and methods we used in the study on signal pathway seemed too monospecific, which needs to be demonstrated by various experimental methods and different angles., endomorphins can attenuate the huvec dysfunction of synthesising and secreting no, enos, inos, et-1 induced by ages and may inhibited p38 mapk signal pathway in nucleus stimulated by ages. these findings have partly revealed the molecular mechanism of endomorphins on protecting huvecs from injuries induced by ages and thereby may provide the pharmacologic basis for the treatment of endothelial dysfunction in diabetes.

endomorphins (ems) have a very important bridge-function in cardiovascular, endocrinological, and neurological systems. this study is to investigate the effects of ems on the synthesis and secretion of vasoactive substances induced by advanced glycation end products in primary cultured human umbilical vein endothelial cells (huvecs). firstly, huvecs were stimulated with ages-bovine serum albumin (ages-bsa), bovine serum albumin (bsa), or both ages-bsa and ems together, respectively. then, huvec survival rate was calculated by mtt assay, the levels of no, endothelial nitric oxide synthase (enos), and inducible nitric oxide synthase (inos) were detected by colorimetric analysis, and the contents of endothelin-1 (et-1) were detected by elisa. the mrna levels of enos and et-1 were measured by rt-pcr. the expression of p38 mitogen-activated protein kinase (p38 mapk) was detected by immunofluorescence assay. the results showed that the mrna expression and secretion of enos were significantly enhanced after incubation with ems compared to those with ages-bsa, while the secretion of no and inos, mrna expression, and secretion of et-1 had opposite changes. the fluorescence intensity of p38mapk in nuclear was decreased after pretreatment with ems compared to incubation with ages-bsa. conclusion. the present study suggests that ems have certain protection effect on ages-bsa-induced injury in huvec.

PMC3647545

pubmed-1037

while developed countries have seen increasing incidence rates over the past several decades, developing countries have begun to experience the rising trend of cancer incidence and mortality. breast and cervical cancers are the most common cancers in women and lung cancer is the most common cancer in men in developing countries. developing countries with the highest rates of cancer are mostly in asia and south america, with incidence rates greater than 260.4 per 100,000. africa, a continent that is much slower in its development, only sees about 94.8127.5 cases per 100,000, with relatively higher rates in northern africa. morocco, a country with development and epidemiological transitions growing faster than most other countries in africa, falls into the relatively higher incidence rates within africa. are from developing countries and half of all cases of gastric cancer are in eastern asia. globocan statistics of 2012 show gastric cancer rates as highest in asia and lowest in africa. globocan estimated an age standardized rate of gastric cancer in morocco as 5.1 per 100,000 for males and 3.0 per 100,000 for females. as a reference, the world age standardized rate of gastric cancer is 17.4 per 100,000 in men and 7.5 per 100,000 in women for 2012. in recent years, rates of gastric cancer have been declining in most countries in europe, asia, and north america; however, with limited data from africa it is difficult to make this generalization to african countries as well. impressions from local oncologists in marrakech, morocco, suggest that gastric cancer may be seen more frequently in marrakech than other regions in morocco. thus, this study was conducted to determine the age- and sex-specific and total crude incidence rates of gastric cancer in marrakech and compare them to the rates in casablanca, the largest city with a population-based cancer registry in morocco. this study was conducted at the center hospital university mohammad vi (chu) in marrakech, morocco. this hospital is the largest of the 4 hospitals in marrakech and the only public hospital for diagnosis and treatment of cancer in the city. the hospital serves patients from the city of marrakech (population of 1.063 million in 2012) and its surrounding region, marrakech-tensift-al haouz. a limited number of patients also come from the neighboring regions of souss-massa-dra and tadla-azilal. in 2012, the hospital diagnosed and/or treated 1,573 cancer patients who were covered by government health insurance. a majority of the patients seen at the hospital were from low- and middle-income socioeconomic levels of this community. the smaller portion of the patients who are from upper middle-income and upper socioeconomic levels seek care at the few private clinics and hospitals in marrakech. due to possible long waiting times for histopathologic examination of biopsy and resection specimens in government hospitals in morocco, government health insurance allows patients to have the histopathologic examination done at private pathology laboratories. cities of residence of patients found in the hospital medical records in this study included 47 cities, of which 32 were within either the region surrounding marrakech, the marrakech-tensift-al haouz region, or the nearby regions of souss-massa-dra or tadla-azilal. of these 32 cities, 22 were reported as being from the region surrounding marrakech. from this information and the referral patterns of all cancer patients seen at the hospital, we believe that most patients who come to the hospital in marrakech were from one of these 3 regions; thus, these regions became our study area. we were unable to get a reported residence from the patients collected from private pathology labs, because it is not part of the standard pathology form, and therefore had to assume their referral patterns matched that of the hospitals and patient's residence fell within one of the three regions. the study identified 327 new gastric cancer patients diagnosed and/or treated in chu in the 5-year period (20082012). logbooks and medical records of gastric cancer patients were retrieved and abstracted. a manual search of the oncology records information for age, sex, place of residence, clinical diagnosis, and histopathologic features of the tumor was abstracted. clinical and pathological information including symptoms and signs at presentation, endoscopic and abdominal ct scanning results, histopathologic type of tumor, tumor differentiation, presence of intestinal metaplasia, and any results on h. pylori infection was collected. to supplement the pathology information of the patients identified from the study hospital and identify other patients who were treated at other healthcare facilities the review of the records of gastric cancer patients diagnosed in these laboratories during the period of 20082012 revealed 470 additional gastric cancer patients. information obtained included name, pathology reference number, age, sex, histopathologic type, differentiation, and h. pylori infection (if noted). the population data used for calculating the incidence rates of marrakech was obtained from the 2004 census data. population data for each region, province, and city in morocco was obtained. for each city, percent growth change and natural population increase rates were used to estimate the population in marrakech and the surrounding regions for the years in which data was abstracted from the medical records and pathology reports. the incidence rates of casablanca were obtained from the most recent editions of the population-based cancer registry of the region of grand casablanca for years of 2004, 2005, 2006, and 2007. this registry information is collected and stored within the oncology center at the centre hospital ibn rochd, within a specific data processing department. the casablanca registry data covers cancer patients in all clinics, laboratories, and government hospitals in casablanca. since patient data was gathered from medical records as well as pathology reports from private laboratories, having data twice for one patient was possible. thus, to eliminate duplicates, the pathology reference number used in the laboratories and recorded in the medical records was used to identify and remove duplicated data for one patient. the name of the patient was also used to verify possible duplicate records. to prepare for data analysis, medical records and pathology reports were merged into a final database and a unique study i d was given after stripping the names of patients. after removal of duplicates, we were able to identify 774 patients of gastric cancer in 20082012 of which 447 were found in the reports of 4 large pathology laboratories and 327 from medical records of the hospital. after review of records, 49 patients were excluded because of reported residence outside of the three 3 regions defined as the at-risk population surrounding marrakech or because of histopathologic diagnosis of stomach lymphoma, which was not included in the incidence rates from the casablanca registry (figure 1). to obtain a total 4-year incidence rate for casablanca, the sum of the total number of cases reported for each year in the registry was divided by the sum of the population for each corresponding year. at the time of publication casablanca only had registries for a 4-year period and thus the incidence reported is a 4-year incidence rate. descriptive statistics and incidence rate analyses were completed using sas (version 9.3, sas institute, cary, nc). because the last available census data from morocco was 2004, it was necessary to estimate the population of the 3 regions surrounding marrakech for the study years (20082012). natural population change since the time of the census was determined by applying the annual growth rate to the census data to estimate the population during the study years. additionally, in order to compare rates from marrakech to rates from casablanca, age-adjusted incidence rates were calculated for 8 age categories. the 8 categories, determined by those given in the census information from morocco, were<19, 2024, 2534, 3544, 4554, 5564, 6574, and>75. data from the cancer registry in casablanca had been standardized by using the who world population. therefore, we used the who world (20002025) standard population, adjusted to match the 8 age categories, to calculate age-adjusted incidence rates in marrakech. incidence rate ratios and their corresponding 95% confidence intervals were calculated to determine differences in rates from marrakech to rates from casablanca. for males, the median was 62 with a range of 1994 and, for females, median was 58 and range was 2388. most (79%) patients reported being from a city that was considered an urban city center by the moroccan census information. patients were clinically diagnosed with gastric cancer by both endoscopy and ct scan (table 1). the vast majority (90%) of patients had histopathologic diagnosis of gastric cancer by biopsy; few (15%) were diagnosed by resection, including those that had both biopsy and resection. adenocarcinoma represented 83% of the histological types of gastric cancer; carcinoma and gastric intestinal stromal tumors represented 13% and 3%, respectively (table 2). age-specific incidence rates for all patients, males, and females for marrakech and casablanca are presented in tables 3, 4, and 5, respectively. in nearly all age ranges, rates of gastric cancer in marrakech were higher than the rates in casablanca. the exceptions were all patients, male and female patients under 19 years; all patients aged 2024 years; and all patients aged 4554 years. in males, in nearly all age ranges, the rate was significantly higher in marrakech. however, in females, only the age ranges 4554, 5564, and over 75 had rates that were significantly higher in marrakech. the incidence rates of marrakech for 20082012 and casablanca for the years available from their registry data, 20042007, are presented in table 6. the rates of gastric cancer in marrakech for all patients, males, and females were 5.50, 7.19, and 3.87 per 100,000, respectively. first, age-specific incidence rates of gastric cancer were higher in marrakech in nearly all age groups for both males and females compared to respective rates in casablanca. second, when comparing total incidence rates by sex, males in marrakech had a significantly higher rate than males in casablanca. amongst females, while the rates between the two cities were statistically significant, the difference was not as prominent as that of the males. finally, the majority of the residence of patients found in the medical records was concentrated in the 3 regions surrounding marrakech. with the exception of a few age groups, marrakech had higher age-specific incidence rates of gastric cancer than casablanca. rates appeared higher in casablanca in the under 19 age group, because the casablanca cancer registry included pediatric cancer cases, while the patient records of cancer in marrakech did not. gastric cancer is known to be a cancer of elderly populations, so this does significantly impact the results found. the variation of rates between sexes is not altogether surprising as gastric cancer is more common in males than females. many patients who visit the hospital in marrakech travel many miles across rough geographic terrains and, due to travel costs or gender and cultural norms in morocco, women may simply seek care less often than men. in many developing countries, the presence of gender inequalities combined with factors affecting health behaviors can limit a woman's ability to make the decision to seek care. compared to the nearby country of tunisia, women in morocco sought health care less often, due to geographic obstacles that make traveling difficult. observing that the majority of gastric cancers were from the region of marrakech and the 2 surrounding regions is a reasonable finding because chu in marrakech is the only public cancer hospital serving marrakech and the surrounding regions. while all patients in this study were from 3 regions surrounding marrakech, there is a possibility that other patients from less populated regions might have been missed in this study because of not seeking medical care in marrakech. symptoms of early onset gastric cancer are similar to other nonmalignant gastrointestinal conditions; thus, patients are not likely to travel far to seek care until symptoms become severe. previous studies assessing patterns of gastric cancer reported low rates of the disease in africa compared to rates in other countries, despite widespread infection by h. pylori in africa [4, 15, 16]. however, these same studies also noted limited availability of cancer registries in africa, which limits the ability to generate true incidence and prevalence rates. this study is the first to assess incidence of gastric cancer in marrakech, allowing for comparison within the country to identify rate differences and future investigation of risk factors in relation to geographic locations. previous research from marrakech identified gastric cancer as the most common digestive cancer in the city which helps to verify our results. both studies identified an average age of diagnosis of 59 years; and 6470% of all cases were in males. the significant difference in gastric cancer incidence found between marrakech and casablanca is the first to be reported for these cities. a 25-time higher rate was found in a town in the andes mountains in colombia compared to the rate in a city that is 200 kilometers away on the coast. the difference in rates was attributed to a mismatch in the ancestry of the host and the microbe, which resulted in more carcinogenic gastric lesions in the high rate area. similar differences were reported in chile and guatemala where higher gastric cancer rates were found among higher altitudes. increased gastric cancer risks associated with environment and genotypic variations of the h. pylori strains have been well documented and these factors may explain the variations in gastric cancer rates in populations that have nearly identical infection rates [2022]. inclusion of data from the major cancer hospital and the main private pathology laboratories in marrakech assured the comprehensiveness of data sources. obtaining records from the largest private pathology laboratories andpublic hospital in the city allowed for a wider representation of socioeconomic backgrounds of patients and increased inclusion of the majority of gastric cancer patients in the region. the existence of census information for the population and age and sex strata allowed us to calculate incidence, age-specific, and sex-specific rates for marrakech. availability of a quality population-based cancer registry in casablanca and the opportunity to compare its results to marrakech increased the efficiency of region comparison of rates in this study. lack of information about the residence of the patients from the private pathology laboratories limited our ability to calculate region-specific rates. however, there is no reason to believe that patients from distant regions of morocco would seek histopathologic diagnosis in these laboratories in marrakech. due to possible cultural norms of not seeking medical care or limited availability of health professionals in peripheral regions one of the main focal points of the study was to examine the most recent 5-year period of gastric cancer in marrakech rather than choose a previous matching period with the casablanca cancer registry. the reason was that the new cancer center in marrakech was opened in the 5 years preceding the study and the flow of patients was much larger and inclusive. also, we are not aware of significant changes in the healthcare or exposure factors related to gastric cancer that occurred in marrakech between the 2 data intervals of 20042007 and 20082012. however, this nonoverlapping period might be a limitation of the study. a unique mix of cultural and lifestyle factors and regional differences in morocco present an opportunity for future research into the investigation of risk factors that may contribute to the higher gastric cancer rate in marrakech. previous research has shown that risk factors for gastric cancer could be categorized into (a) h. pylori infection, (b) nitrogen compounds and other chemical carcinogens, (c) high intake of salted, smoked, and cured foods [2, 26], and (d) other social and behavioral factors [25, 2729]. with scarce current data from morocco, these risk factors should be investigated in future studies in marrakech and other parts of morocco to elucidate the risk factors of gastric cancer in this population. in conclusion, a significantly higher rate of gastric cancer was found in marrakech when compared to the rates of casablanca. notably, the difference in incidence in males between marrakech and casablanca was much more distinct than the difference in females. the incidence of the disease in marrakech could be higher than what is reported in this study because of the possible missed patients who did not seek medical care and die without diagnosis or documentation. future studies should further evaluate the possible underestimation of gastric cancer in marrakech and explore the variable rates in other regions of morocco. future studies should also explore the risk factors of the disease including infectious, dietary, and environmental factors and possible regional differences.

gastric cancer is the fifth most common cancer globally with over 70% of new cases occurring in developing countries. in morocco, oncologists in marrakech suspected higher frequency of gastric cancer compared to casablanca, a city 150 kilometers away. this study calculated age-specific, sex-specific, and total incidence rates of gastric cancer in marrakech and was compared to the casablanca population-based cancer registry. using medical records from center hospital university mohammad vi and reports from 4 main private pathology laboratories in marrakech, we identified 774 patients for the period 20082012. comparison of rates showed higher age-specific incidence in marrakech in nearly all age groups for both genders. a higher total incidence in marrakech than in casablanca was found with rates of 5.50 and 3.23 per 100,000, respectively. incidence was significantly higher among males in marrakech than males in casablanca (7.19 and 3.91 per 100,000, resp.) and females in marrakech compared to females in casablanca (3.87 and 2.58 per 100,000, resp.). future studies should address possible underestimation of gastric cancer in marrakech, estimate incidence in other regions of morocco, and investigate possible risk factors to explain the difference in rates.

PMC4631898

pubmed-1038

obesity is a leading risk factor for many adverse health outcomes including type 2 diabetes, hypertension, dyslipidemia, coronary heart disease, and certain types of cancer. the prevalence of adult obesity in the us had doubled from 19761980 to 1999-2000. in 2009 us ranked the highest in adult obesity prevalence among all countries in the organization for economic cooperation and development. the estimated annual medical cost of obesity in the us totaled 147 billion us dollars in 2008. more recent data indicated a slowing down of the trend in adult obesity and even some leveling off in childhood obesity. small but significant declines in the prevalence of obesity among low-income preschoolers aged 25 years were reported in 19 of 43 us states examined in the pediatric nutrition surveillance system from 2008 to 2011. no significant change in the prevalence of adult obesity was found between 20032008 and 2009-2010 in the national health and nutrition examination survey (nhanes). the prevalence of morbid (i.e., grades 2 and 3) obesity was still increasing from 2005 to 2010, but its growth rate had slowed down as indicated in the behavioral risk factor surveillance system (brfss). given the large disease burden of obesity and its high prevalence, it is crucial to continuously monitor the prevalence of obesity in the us. this study provides national estimates of obesity among us adults aged 20 years and older in 2011-2012 and tracks its trends from 1999 to 2012. study sample came from nhanes 1999-2000, 2001-2002, 2003-2004, 2005-2006, 2007-2008, 2009-2010, and 2011-2012 waves. nhanes is a program of studies designed to assess the health and nutritional status of adults and children and represents a multistage probability sample of the us civilian, noninstitutionalized population. participants ' body weight and stature height were measured by digital scale and stadiometer in the nhanes mobile examination center. body mass index (bmi) is defined by weight in kilograms divided by height in meters squared. four prevalence measures were examined: overweight and obesity combined (bmi 25), obesity (bmi 30), grades 2 and 3 obesity combined (bmi 35), and grade 3 obesity (bmi 40). age was adjusted by direct standardization to the year 2000 census population using the age groups 2039 years old, 4059 years old, and 60 years and older. nhanes wave-specific sampling weight, sampling stratum, and primary sampling unit were taken into account in estimating prevalence in the population. prevalence was estimated for both the overall population and subpopulations stratified by gender and race/ethnicity (i.e., non-hispanic white, non-hispanic african american, and hispanic). piecewise logistic regressions were used to test the differential trends in adult obesity before and after 2010. the model has the following setup: (1)logit(yi)=0+1xi+2(xi2010)di+i, di=1{xi2010}. in (1), yi is an indicator variable for overweight and obesity combined (bmi 25), obesity (bmi 30), grades 2 and 3 obesity combined (bmi 35), or grade 3 obesity (bmi 40); xi a continuous variable taking the values of 2000, 2002, 2004, 2006, 2008, 2010, and 2012 for the nhanes waves 1999-2000, 2001-2002, 2003-2004, 2005-2006, 2007-2008, 2009-2010, and 2011-2012, respectively; di an indicator variable for xi 2010; and i the error term. if the estimated coefficient 2 is significantly different from zero (equivalent to the estimated odds ratio e to be significantly different from one), piecewise logistic regressions were performed on the overall sample and on each gender and race/ethnicity group, controlling for age group (i.e., 2039 years old, 4059 years old, and 60 years and older) and accounting for survey design. in total, 5,560 adults aged 20 years and older participated in the nhanes 2011-2012 wave. among them, 57 pregnant women and 322 individuals with missing values in body weight/height measures were excluded from the analyses. nhanes oversamples minorities: 1,364 non-hispanic african americans and 1,037 hispanic were included besides non-hispanic white. table 2 reports the estimated bmi and prevalence measures among us adults aged 20 years and older in 2011-2012. the age-adjusted mean bmi was 28.5 (95% ci: 28.029.0) among men and 28.8 (28.329.3) among women. non-hispanic african american women had the highest mean bmi of 32.3 (31.633.0) among all gender and race/ethnicity subgroups. the age-adjusted prevalence of overweight and obesity combined (bmi 25) was 71.1% (68.0%74.2%) among men and 65.5% (61.8%69.3%) among women, and the age-adjusted prevalence of obesity (bmi 30) was 33.3% (30.5%36.2%) among men and 35.8% (32.3%39.4%) among women. among men, 11.8% (9.7%13.9%) and 4.3% (2.2%6.3%) were classified in grades 2 and 3 obesity combined (bmi 35) and grade 3 obesity (bmi 40), respectively, whereas among women, 16.7% (14.5%8.9%) and 8.0% (6.6%9.5%) were classified in grades 2 and 3 obesity combined and grade 3 obesity, respectively. women had higher prevalence of obesity, grades 2 and 3 obesity combined, and grade 3 obesity than men (although the differences were not always statistically significant) among all race/ethnicity groups. non-hispanic african american women had the highest prevalence of overweight and obesity combined (81.5%), obesity (56.4%), grades 2 and 3 obesity combined (28.7%), and grade 3 obesity (15.8%) among all gender and race/ethnicity groups, which were 29%, 73%, 92%, and 122% higher than among non-hispanic white women, respectively. figure 1 shows the percentage change in prevalence measures among us adults of 20 years and older from 1999-2000 to 2011-2012 with 1999-2000 as the baseline. the age-adjusted prevalence of overweight and obesity combined (bmi 25), obesity (bmi 30), grades 2 and 3 obesity combined (bmi 35), and grade 3 obesity (bmi 40) in 2009-2010 were 7.2%, 17.8%, 17.6%, and 33.0% higher than in 1999-2000. compared to 2009-2010, the prevalence measures slightly decreased in 2011-2012, but the reductions were not statistically significant at p<0.05. figure 2 shows the gender- and race/ethnicity-specific trend in the age-adjusted prevalence of overweight and obesity combined (bmi 25), obesity (bmi 30), grades 2 and 3 obesity combined (bmi 35), and grade 3 obesity (bmi 40) among us adults aged 20 years and older from 1999-2000 to 2011-2012. compared to 2009-2010, most gender- and race/ethnicity-specific prevalence measures remained unchanged or slightly decreased in 2011-2012, except for the prevalence of overweight and obesity combined among non-hispanic white women, the prevalence of obesity among hispanic men, and all 4 prevalence measures among hispanic women which increased by 1.3 to 3.3 percentage points. none of the changes in gender- and race/ethnicity-specific prevalence measures (24 of them in total) between 2009-2010 and 2011-2012 were statistically significant at p<0.05. table 3 reports the statistical tests for trends in obesity over the 14 years of survey cycles from 1999 to 2012 using piecewise logistic regressions. the coefficients are expressed as annualized odds ratios (ors), denoting the estimated increase per year in the odds of a prevalence measure. a majority of the gender- and race/ethnicity-specific prevalence measures seemed to slightly increase over time (as indicated by the estimated e>1). for example, the estimated or for the prevalence of obesity (bmi 30) among hispanic women is 1.03 (1.011.04), approximately equivalent to a yearly increase in obesity prevalence of 0.6 percentage points. nearly all gender- and race/ethnicity-specific prevalence measures appeared to deviate downwards from the increasing trend (as indicated by the estimated e<1) during 20102012, but those changes in trends were not statistically significant at p<0.05. the rate of increase appeared to slow down since the 2000s and most recent data on childhood obesity even indicated some leveling off. using a nationally representative sample, this study estimates the obesity prevalence among us adults aged 20 years and older in 2011-2012 and tracks its trends from 1999 to 2012. the main advantage of nhanes relative to other national health surveillance systems such as the brfss and the national health interview survey (nhis) is the objectively measured body weight and height, which eliminates self-report bias. however, the relatively small sample size of nhanes (about 5,000 in every two-year survey cycle, compared to about 0.4 million a year in brfss) limits the precision for population estimates. unlike brfss or nhis, nhanes moreover, nhanes is a probability sample of the us civilian, noninstitutionalized population, excluding inmates of institutions (e.g., people in penal/mental facilities or homes for the aged, or on active duty in the armed forces). the prevalence measures are based on bmi, a function of weight and height, rather than on body fatness. although bmi has been found to be closely associated with percentage body fat measured by dual x-ray absorptiometry in the nhanes, these two measures are fundamentally different and their levels of agreement could be a function of gender, age, and race/ethnicity. for instance, percentage body fat was found to be more correlated with bmi in women than men. the relation between percentage body fat and bmi in hispanic american women differed from that of african american and european american women. a thorough investigation on the differential relationship between bmi and body fatness across population groups and the long-term trend of obesity prevalence measured by percentage body fat is beyond the scope of this study but warranted in future research. the growth rate of the obesity epidemic among us adults appears to have slowed down in 2000s, but it is still too early to conclude that it has already reached the plateau and begun to level off. both figures 1 and 2 showed some decline in the obesity prevalence measures in 2011-2012 compared to in 2009-2010, but none of the changes were statistically significant. this has also been indicated in the results of piecewise logistic regressions where the null hypotheses on the similarity in trends for prevalence measures before and after 2010 were not rejected. in conclusion, concurrent evidence on the leveling off of the obesity epidemic in the us is thin and the trend is unclear and inconclusive at this time. given the high prevalence of obesity and its profound socioeconomic consequences, close monitoring of the trend is warranted.

aim. to provide national estimates of obesity among us adults aged 20 years and older in 2011-2012 and track its trends from 1999 to 2012. methods. measured weight/height from national health and nutrition examination survey 19992012 waves was used to calculate body mass index (bmi) and prevalence measures. piecewise logistic regressions were conducted to test the differential trends before and after 2010. results. in 2011-2012, the age-adjusted prevalence of overweight and obesity combined (bmi 25) was 71.1% (95% ci: 68.0%74.2%) among men and 65.5% (61.8%69.3%) among women, and the prevalence of obesity (bmi 30) was 33.3% (30.5%36.2%) among men and 35.8% (32.3%39.4%) among women. from 19902000 to 2009-2010, the prevalence of overweight and obesity combined, obesity, grades 2 and 3 obesity combined (bmi 35), and grade 3 obesity (bmi 40) increased by 7.2%, 17.8%, 17.6%, and 33.0%, respectively. compared to 2009-2010, most gender- and race/ethnicity-specific prevalence measures remained unchanged or slightly decreased in 2011-2012. no significant difference in trends among prevalence measures was found before and after 2010. conclusions. concurrent evidence on the leveling off of obesity in the us is thin. given its high prevalence and profound socioeconomic consequences, close monitoring of the trend is warranted.

PMC3913362

pubmed-1039

it has been a decade since the spotlight on preventable medical errors first brought much needed attention to the culture of safety in health care organizations. a culture of safety has been defined as the shared values and patterns of behavior that determine the degree to which all organizational members direct their attention and action towards minimizing patient harm. many healthcare institutions have adopted a culture of safety philosophy as an integral part of their delivery process or service. the perceptions and attitudes of personnel working in an organization about the safety culture are often termed safety climate, and can provide an important indication of the level of its safety culture. patient safety climate is a multidimensional phenomenon, and important microclimates have been identified such as senior management engagement and leadership [5, 6]. previously, researchers have found that there are differences in attitudes and perceptions of safety climate among employees in various work areas and members of different disciplines. for example, singer and colleagues reported that emergency department (ed) personnel, particularly ed nurses, perceived substantially lower levels of safety climate than workers in other areas of the hospital. this group also found that the higher up the person is in the organizational hierarchy, the more safe they perceive the climate to be and that these perceptual differences are damaging to improving patient safety. healthcare-associated infections (hai) are an important patient safety issue. in the past 20 years, the overall incidence of hai has increased by 36%, and the substantial human suffering and financial burden of these infections is staggering. annually, in the united states, approximately 2 million patients develop an hai, and nearly 90,000 of these patients are estimated to die; this ranks hai as the fifth leading cause of death in acute care hospitals. the centers for disease control and prevention because of the staggering costs and associated morbidity and mortality of this largely preventable problem, there has been a major focus on the reduction of hai internationally. the prevention and control of infections in a hospital is a quality-improvement activity that centers on improving the care of patients and protecting the health of staff [11, 12]; therefore, it would seem essential for there to be strong leadership with common goals in tackling these efforts. with a shift toward prevention and surveillance of hai occurrences, the roles and responsibilities of those working in the field of infection prevention and control are expanding, and infection control professionals are now referred to as infection preventionists (ips). ips are responsible for directing interventions that protect patients from hai and working with clinicians, staff, and administrators to improve patient- and systems-level outcomes to reduce hai and other related adverse events. ips vary in educational background, but most have a nursing background [15, 16]. often, quality directors (qds) are also involved in the prevention of hai. the qd role is often more diverse, but the individual should be familiar with the activities of the ips as well as report to or be part of the senior leadership in the hospital. in terms of supporting the hospital infection program, the quality assurance department may be less responsible for continual monitoring and surveillance of hai and more involved in outbreak investigation and exploring root causes [11, 12]. the present study explored whether patient safety climate varied between two different but essential roles in the prevention of infection and across different hospitals: infection preventionists (ips) and quality directors (qds). the aims of this study were to (1) compare the perceptions of two aspects of patient safety climate between ips and qds in the same hospital, (2) identify setting and role characteristics associated with differences in perceptions of patient safety climates, and (3) identify setting characteristics that predict more positive perceptions of patient safety climates. given the differences in responsibility and fit in the hierarchy of hospitals, we hypothesize that ips would perceive a lower climate of patient safety compared to qds. this study was an analysis of two cross-sectional surveys conducted simultaneously in the fall of 2008. both surveys were conducted to obtain preliminary baseline data on different aspects related to the prevention of hai with the ultimate goal of evaluating the california healthcare-associated infection prevention initiative (chaipi). this statewide initiative was designed to reduce hai using technology and educational sessions for ip personnel. additionally, hospitals formed an educational collaboration and shared knowledge, successes, and barriers to reducing hai through webinars and meetings. one survey was conducted by columbia university in partnership with the association for professionals in infection control and epidemiology (apic) and targeted ips; the other survey was conducted by researchers at the university of california berkeley, center for health and public policy studies, who surveyed the qds. the ip and qd of all general acute care california hospitals were eligible to participate in their respective surveys. a list of all hospitals licensed to operate in california was obtained from the california office of statewide health planning and development. specialty hospitals and hospitals in which patients had a mean length of stay of 30 days were excluded. for the ip survey, the eligible hospital list was cross-referenced with apic memberships to identify the ip at each of the hospitals. the ip survey was web based, and respondents were recruited using a modified dillman technique, which included e-mail and mail invitations and reminders, as well as announcements included in regularly scheduled apic communication materials (e.g., newsletters to members). for each qd, a structured, computer-assisted telephone interview was scheduled in advance and conducted with the qd of each hospital. when needed, multiple attempts were made to schedule the interview with each qd. both surveys included the same two measures of patient safety climate, which were adapted from the patient safety climate in healthcare organizations (pscho). the first measure was the senior management engagement scale, which measured the understanding of current safety issues in their facility, taking supportive action when necessary, and appreciating that frontline care providers are often best qualified to solve patient safety issues (e.g., senior management supports a climate that promotes patient safety). the second measure was the leadership on patient safety scale, defined as the senior executives ' ability to articulate values consistent with patient safety and reducing hai (e.g., the senior executives clearly articulate the hospital values relevant to patient safety and hai). both the senior management engagement and leadership on patient safety scales included 5 items and used a 5-point likert scale (1-strongly disagree to 5-strongly agree). the composite scores for each scale were calculated by summing the responses for each item with higher scores indicating a more positive perception of the safety climate. cronbach's alphas for each scale were: senior management engagement =.896 for the ips and =.902 for the qds; leadership on patient safety =.931 for the ips and =.863 for the qds. other data obtained include hospital characteristics (i.e., medical school affiliation, number of beds, and location of hospital urban setting, suburban setting, rural setting), and infection prevention, and control department characteristics (i.e., independent budget of the department, presence of a physician hospital epidemiologist, use of an electronic surveillance system for infection detection, to whom the ip director reports to, ip respondent role, and number of ip fulltime equivalent (fte) staff per 100 beds). descriptive statistics (i.e., frequencies, means, and standard deviations) were computed on all variables. single missing items per case on the senior management engagement or the leadership on patient safety scales were imputed. for the first aim, we examined differences in ip and qd perceptions on both the items and composite patient safety microclimate scales using the wilcoxon signed-rank test. to meet the second aim,, we developed a multivariate ordinary least square regression to examine the association between setting characteristics and perceptions of both patient safety scales for both personnel types. the final models included the hospital and infection prevention and control department characteristics that were associated with the scores in univariate analyses with p 0.1. there were 322 eligible hospitals; 149 hospitals (46.3%) responded to both surveys. additionally, hospitals were removed from specific analyses if there were two or more missing responses and imputation was not possible. therefore, the final sample size for the senior management engagement scale was 129 and 132 for the leadership on patient safety scale. most hospitals were located in an urban setting (42%), followed by suburban (33%) or rural settings (34%). the average bed size of participating facilities was 241 (sd 161, range: 25952). in both the senior management engagement and leadership on patient safety scales, four of five items on each scale were significantly different (table 2). ips perceived the senior management items more positively than the qds (difference in mean scores ranged from 0.2 to 0.3, all p values 0.05). additionally, ips ' perceptions were more positive than the qds on the senior management engagement composite score (21.4 versus 20.4, p<0.01). the qds ' perceptions were more positive than the ips ' on the leadership on patient safety items (difference in mean scores ranged 0.2 to 0.3, all p values 0.05); however, there was no difference on the composite score. none of the hospital and infection prevention and control department setting characteristics were significant predictors of the differences between the ips and qds perceptions of either of the safety microclimates. however, the ip respondents ' that identified themselves as directors of the infection prevention and control department perceived more positive senior management engagement compared to ip nondirectors (mean 21.8, sd=3.8 versus mean 20.5, sd=4.3, p=0.042). no role characteristics were associated with differences in perceptions on the leadership on patient safety scale. an independent budget for the infection prevention and control department was a significant predictor of more positive perceptions of patient safety in all 4 regressions. the presence of a hospital epidemiologist was also a significant predictor among qds of more positive perceptions on the leadership on patient safety scale. the number of hospital beds predicted more positive perceptions among qds on both scales. when entered into multivariate linear regression (table 4), having an independent budget remained the only statistically significant predictor of a high score for both ips and qds on both scales in each of the four regression models. this study examined the perceptions of two important patient safety microclimates from two different hospital personnel roles engaged in patient safety involving the prevention of infections. we found that ips and qds in the same hospital varied in their perceptions across the two patient safety climate scales. our hypothesis that ips would perceive a lower climate of patient safety compared to qds was supported in only one of the microclimates. generally, ips had more positive perceptions of senior management engagement and the qds had more positive perceptions of leadership on patient safety. we also found that having an independent budget for the infection prevention program was the only significant predictor of these microclimates. one reason for the differences in perceptions by personnel may be the measures of the microclimates themselves. for example, the items in the leadership on patient safety scale were more tailored to hais. while ips are generally involved with overall quality and patient safety, their primary role and interest is in prevention and control of infections. this could explain why the ips may have more negative perceptions about the way hospital executives handle improvements in infection prevention and control. this may also be due to the senior management scale being less tailored to infection prevention. although there were no setting characteristics that were significant predictors of differences between ips and qds, ips who were directors of their departments perceived the senior management engagement more positively than ips who were not directors. in a study of personnel in 92 hospitals, singer and colleagues found differences in perceptions of safety climate by both role (i.e., senior management, supervisor, and front line worker) and by discipline (i.e., physician, nurse, other clinician and nonclinician). similar to our findings, these researchers found that senior managers perceived fewer problems with senior management engagement than front line workers. however, another group of researchers found that leadership played a key role in infection prevention and that the most important leaders were not the senior executives traditionally associated with the term leader. they found several examples of hospital epidemiologists, nurses, quality managers, and infection preventionists who played vital roles in their hospital's patient safety activities. finding ways to empower all ips to be leaders in patient safety is likely to be an important factor in reducing infections. another key finding of our study is that budget was an important predictor of more positive perceptions of patient safety climates. having an independent budget for the infection prevention and control department may allow for more autonomy and development of infrastructure to promote patient safety. according to a policy brief by pronovost, efforts are being made at johns hopkins hospital to improve the safety culture by investing resources to monitor the rate-based measures of quality and safety, nearly all of which are required by the centers for medicaid and medicare services (cms), the joint commission, or insurers. these authors noted that fulfilling a commitment to safe and high-quality care is not possible without significant investment in patient safety infrastructure. results from their study confirmed that hospitals with greater financial and organizational resources are more capable of promoting the activities required for patient safety and infection control. as with any research, this study has both strengths and limitations. using well-developed psychometrically tested measures of safety climate is a strength. in terms of internal validity, it is known that the survey mode can make a difference in responses, and in several studies researchers have found that telephone respondents answer questions more positively than do mail respondents [18, 23, 24]. additionally, in a study by christian et al., telephone respondents gave significantly more positive answers than did web respondents for various kinds of scale questions. however, the fact that the qds, who completed the survey via computer-assisted telephone, scored higher on one scale and not the other provides some evidence that it was unlikely that there was bias due to survey method. this was a cross sectional study, and only associations may be examined, not causation. both surveys were conducted in the fall of 2008. at the time the surveys were conducted, california hospitals were preparing for mandatory reporting of hai to the state's health department, and the cms policy on lack of reimbursement for hospital-acquired conditions (including many types of infections) was just being implemented. therefore, these results may not be generalizable to other hospitals outside california. our response rate is typical of multisite surveys of hospital personnel, which often have response rates in the range from 40 to 50 percent. further analyses are needed to examine how these differences in climate impact the processes of care and patient outcomes. although there have been many efforts to curb the increase in hai, it is clear that this preventable issue is slow to improve. this study represents an advance over previous studies on the relationship between safety climate and personnel perceptions by examining those leaders who are essential to the prevention of hais in acute health care settings. it also provides a solid basis for subsequent research on decreasing the gap in perceptions between these two personnel types. given the finding that there are differences in perceptions among essential leaders, this discord could be an inhibition toward achieving the goal of decreased hais. it is essential for those personnel in leadership to work collaboratively in order to not only enhance health care environments but also make it safer for patients. this paper also highlights the importance of independently supporting the infection prevention and control department in order to optimize the safety climate.

background. healthcare-associated infections (hais) are an important patient safety issue, and safety climate is an important organizational factor. this study explores perceptions of infection preventionists (ips) and quality directors (qds) regarding two safety microclimates, senior management engagement (sme) and leadership on patient safety (lops), across california hospitals. methods. this was an analysis of two cross-sectional surveys. we conducted wilcoxon signed-rank test, univariate analyses, and a multivariate ordinary least square regression. results. there were 322 eligible hospitals; 149 hospitals (46.3%) responded to both surveys. the ip response rate was 59%, and the qd response rate was 79.5%. we found ips perceived sme more positively than did qds (21.4 vs. 20.4, p<0.01). no setting characteristics predicted variation in perceptions. presence of an independent budget predicted more positive perceptions of microclimates across personnel types (p<0.01). conclusions. differences in perceptions continue to exist between essential leaders in acute health care settings which could have critical effects on outcomes such as hais. having an independent budget for the infection prevention and control department may enhance the overall safety climate and in turn patient care.

PMC3150187

pubmed-1040

they may present with bilateral aml at an early age in patients who have tuberous sclerosis, vonhippel-lindau syndrome and neurofibromatosis type 1 (phakomatosis). with this in mind, we present a case which was initially diagnosed as a wilms tumor but was finally found to be a renal aml in a child without underlying phakomatosis. a 12-year-girl was referred from another hospital with chief complaints of a lump in the left side of abdomen for the last 5 months. the mass had progressively increased in size over a period of 5 months to involve most of her abdomen and produced significant abdominal distension. an initial evaluation with ultrasonography and contrast-enhanced computed tomography (cect) of abdomen and chest at the referring center showed that it was a left renal mass. subsequently, she was started on chemotherapy for wilms tumor with 3 drugs (vincristine, doxorubicin and actinomycin d). after receiving week 6 of chemotherapy, she presented to us. at the time of presentation to us, she had a huge abdominal lump that was occupying the entire abdomen. the size of the mass had decreased subjectively as per the patient herself by 25% after initiation of chemotherapy. it was found to be having a variegated appearance arising from the lower pole of the left kidney and occupying almost the whole of abdomen. we repeated the cect abdomen and chest which revealed a 21 cm 17 cm 12 cm solid mass with necrosis within it and this was arising from the left kidney [figure 1]. (a and b) contrast-enhanced computed tomography scan images in the axial plane showing a large heterogeneous mass lesion arising from the left side of retroperitoneum replacing the entire left kidney. the mass was displacing the bowel loops, aorta (outlined arrow), and inferior vena cava (arrow) to the opposite side. the right kidney (*) was normal and located in the right renal fossa there was no intravascular extension or lung metastasis. fine-needle aspiration cytology (fnac) was performed, but the aspirate contained only blood. considering the rapid increase in size of the mass and the partial response to chemotherapy and the related necrosis, a repeat fnac was not ordered, and a working diagnosis of wilms tumor was kept. the operative findings confirmed that the mass was arising from the lower pole of the left kidney, and it was occupying the entire abdomen and pushing the peritoneal contents to the right paracolic gutter [figure 2a]. the specimen measured 27 cm 22 cm 18 cm and weighed 5.5 kg [figure 2b]. (a) intra-operative image showing the lump occupying almost the entire abdominal cavity with colon stretched over it and pushed to the right of the patient (b) the excised specimen showing that it arose predominantly from the middle and lower pole of the left kidney postoperative recovery was uneventful. immunohistochemical analysis on the specimen showed negative pattern for wt-1, mic-2, desmin, nse, synaptophysin, s-100 andchromogranin. there was a positive reaction towards hmb45 [figure 3] and trace positivity towards vimentin. she was evaluated and found not to be having any such features, and hence, she has been put on annual follow-up. photomicrograph of the tumor shows features of anangiomyolipoma with a variable mixture of smooth muscle bundles (thin arrow), blood vessels (bold arrow), and adipose tissue (star) (a and b: h and e, 40 and c: h and e, 200). focal immunopositivity for hydroxy beta-methyl butyric acid-45 was also noted (parentheses) (d: hmb 45, 200) the histologic picture resembles a hamartoma, but currently, they are considered as benign neoplasms. there is a 4:1 female predominance and the mean age at presentation is around 40 years. eighty percent of children with tuberous sclerosis develop these lesions by the age of 10 years. in children, the imaging characteristics of renal aml can vary considerably based on the amount and type of histologic elements present. although fat is occasionally found even in wilms tumor, the diagnosis of renal aml is generally straight forward when correlated with other clinical features. had described three cases of pediatric renal aml (age range 1115 years) that posed a diagnostic challenge. in all 3 cases, the misdiagnosis was attributed to the large size of the tumor with poor fat content, in an age group where renal aml is usually not common. renal aml is the only benign renal tumor that can be categorically diagnosed by radiological studies alone. despite this, the imaging in our case did not indicate towards aml because of low-fat content. lipopenic aml comprises only about 5% of all amls, and in this situation, the diagnosis can be difficult to clinch with radiology alone. although 75%80% of the patients present before 5 years of age, the age range is quite wide, and cases have been reported even in adolescence and adults. in fact, in the society of pediatric oncology (siop) 93-01 study, thirty patients out of 962 patients enrolled with wilms tumor were older than 16 years. in the siop study, wilms tumor in children between 6 months to 16 years were diagnosed by means of radiological studies alone. with this background, the diagnosis of wilms tumor was initially considered in our patient. because the size of the mass had decreased on chemotherapy further made us to believe that this mass was in fact a wilms tumor. typical cytological features described in conventional aml are admixture of adipocytes, smooth muscle cells, endothelial cells, foam cells, and giant histiocytes with a backdrop of inflammatory cells. a fnac or needle biopsy before initiating chemotherapy probably would have been helpful in diagnosing it early. tuberous sclerosis complex has been characterized by vogt's triad, comprising mental retardation, adenoma sebaceum, and seizures. renal amls in the setting of tuberous sclerosis may reach giant proportions although there is no consensus on when to term an aml as giant. the largest reported case of bilateral renal aml measured 30 cm 21 cm 13 cm and 30 cm 18 cm 10 cm with a total tumor burden of 7843 g that resulted in respiratory failure. our patient was later evaluated for any markers for phakomatosis but none were found. after reviewing the literature, it is our belief that our case has by far the largest pediatric sporadic aml reported in literature. the largest sporadic renal aml reported till date weighed 7500 g in a 49-year-old lady. management is conservative if the size of the lesion is<4 cm but larger lesions need to be surgically removed. nephron-sparing surgeries are advocated, especially in tuberous sclerosis patients in whom bilateral affliction may occur. in our case, the absence of a pre-operative diagnosis precluded a nephron-sparing approach although in the hindsight, renal preservation would have been a difficult technical proposition considering the size and extent of involvement of the kidney. to conclude, a rare case of giant sporadic pediatric renal aml has been reported that was mistaken for a wilms tumor. this case highlights the importance of obtaining a tissue diagnosis before initiating chemotherapy, especially when the age of the patient is not in the standard age bracket for wilms tumor.

renal angiomyolipoma (aml) is not commonly seen in the pediatric age group other than patients of tuberous sclerosis where in they can have renal amls within the first decade with bilateral in involvement. diagnosis of renal aml can generally be made by the current radiological modalities in the appropriate clinical setting, but it can be mistaken for other tumors when it is large and has low-fat content. herein we report a case of giant renal aml that was initially misdiagnosed as a wilms tumor in a 12-year-old girl.

PMC5264199

pubmed-1041

modification of the efficacy of synaptic transmission, or synaptic plasticity, is widely considered as the basis of activity-dependent neuronal development and learning (feldman and brecht, 2005). a well-characterized form of synaptic plasticity is the potentiation and depression of synaptic transmission occurring at many neuronal structures including primary sensory cortices (see, e.g., frgnac and shulz, 1999; foeller and feldman, 2004). experimental approaches to unveil changes in the strength of connections between two neurons have extensively developed since the 1970ies, based on the theoretical ground proposed by hebb (1949). in chapter 4 (the first stages of perception: growth of the assembly) of his book the organization of behavior, hebb proposes that repeated stimulation of specific receptors will lead slowly to the formation of an assembly of association area cells which can act briefly as a closed system after stimulation has ceased. the formation of a neuronal assembly was proposed to be implemented by a decrease of synaptic resistances induced by the persistence of reverberating activity that is sustained ongoing activity after transient inputs. locally, at the level of a synapse, a period of maintained temporal correlation between pre- and postsynaptic activity would lead to an increase in the efficacy of excitatory synaptic transmission. although hebb's rule became a widely used algorithm in computational models of brain functioning, its straightforward application leads to instability of the system induced by the continuous growth of synaptic efficacies which in turn leads to a saturation of all the plastic elements of the network. this divergence of synaptic weights was solved by theoreticians by using various rules of normalization which require, in addition to hebb's rule, depression of the gain of other competing synapses (stent, 1973; von der malsburg, 1973; sejnowski, 1977a, b). for instance, a model of self-organization was proposed by von der malsburg (1973) to account for the development of orientation selectivity in the visual cortex. based on the hebbian principle, the model introduces a normalization rule where the sum of the synaptic weights of afferent contacts on one neuron remains constant with time. this implies that local increase in synaptic weight is obtained in detriment of all other contacts that were inactive at the same time. this rule bears similarities with the rule proposed by stent (1973) who assumed a selective decrease in the efficacy of synaptic transmission of afferent fibers which were inactive at the time when the postsynaptic neuron was discharging under the influence of other inputs. the algorithms of synaptic plasticity introduced by sejnowski (1977a, b) to model plasticity in the cerebellum, and later by bienenstock et al. (1982) for the primary visual cortex, overcome the problem of the synaptic saturation without introducing an ad hoc normalization rule. they are based on an input/output covariance algorithm where the change in synaptic efficacy is proportional to the covariation of pre- and postsynaptic activities. this covariation corresponds to the product of the differences of the instantaneous pre- and postsynaptic activities from their respective mean values (averaged over a certain period of preceding time). covariance-based algorithms predict that the same synapse can both increase and decrease its synaptic efficacy, thereby allowing the connectivity state of the network to evolve into non-trivial states, i.e., non-diverging stable points that attract the dynamics of the system. correlation-based algorithms of synaptic modification have been extensively studied experimentally in vivo in the developing visual cortex (frgnac et al., 1988, 1992; reiter and stryker, 1988; frgnac and shulz, 1989; bear et al., 1990; debanne et al., 1998; mclean and palmer, 1998), the adult visual cortex (shulz and frgnac, 1992) and the adult auditory cortex (ahissar et al., 1992, 1998; cruikshank and weinberger, 1996). thus, most algorithms used to model synaptic plasticity in the developing or adult cortex include synaptic potentiation and depression rules. they can be mathematically described by a general equation where the modification of synaptic weight as a function of time is proportional to the product of a presynaptic and a postsynaptic term (review in frgnac and shulz, 1994, 1999). in these plasticity algorithms a precise temporal order between pre- and postsynaptic activation onsets is not required. nonetheless, a temporal contiguity between the two events, that is a proximity in time of not more than several tens of milliseconds was required for synaptic potentiation in cortex both in vivo (baranyi and feher, 1981; wigstrm and gustafsson, 1985) and in vitro (frgnac et al., 1994). more recently, a new form of hebbian plasticity has been described in which tight temporal contiguity and order between presynaptic and postsynaptic activities determine the amplitude and the sign of the synaptic change respectively. on theoretical grounds, this plasticity rule called spike-timing-dependent plasticity (stdp) has been proposed to be a major, computationally powerful, mechanism for induction of synaptic plasticity in vivo (gerstner et al., 1996; abbott and nelson, 2000; song et al., 2000; van rossum et al., 2000) and a biologically plausible information storage mechanism in the brain. as we will see later, experimental evidence in vivo for this is still scarce. the induction of synaptic potentiation and depression depends, at least in the quiescent in vitro network, on the relative millisecond-scale timing of presynaptic and postsynaptic action potentials (debanne et al., 1994, 1997; bell et al., 1997; markram et al., 1997; bi and poo, 1998; nishiyama et al., 2000; kobayashi and poo, 2004; wang et al., 2005; fino et al., 2009). in pyramidal cells of layers 23 and 5 of sensory cortices, when an excitatory postsynaptic potential (epsp) generated by the presynaptic action potential precedes by up to a few tens of milliseconds the postsynaptic action potential, potentiation of the synapse is induced. conversely, depression of the synapse is observed when the epsp follows the postsynaptic action potential by short (020 ms) or long (0100 ms) intervals, depending on the synapse being studied (feldman, 2000; sjstrm et al., 2001; froemke and dan, 2002; sjstrm and nelson, 2002). this in vitro demonstrated stdp has been specifically proposed to be important for experience-dependent plasticity at layer 4 to layer 2/3 synapses in vivo (feldman and brecht, 2005). an anti-hebbian form of stdp with similar temporal requirements but inverse order has been described in cerebellum-like structures with comparable cell types (bell et al., 1997; tzounopoulos et al., 2004 in the electrosensory lobe of the electric fish, this anti-hebbian stdp has been proposed to suppress the afferent sensory consequences of an associated motor act, facilitating the detection of unexpected stimuli (review in bell, 1989; bell et al., 1999). despite intensive studies in brain slices and cultured neurons showing that stdp is a robust phenomenon at many cortical synapses, much scarcer evidence is available about how stdp is induced by neuronal activity in the mammalian cortices in vivo (review in dan and poo, 2006; caporale and dan, 2008). since the statistical properties of neuronal activity patterns differ between in vitro and in vivo recording conditions, it is crucial to determine if stdp exhibits similar induction requirements. an increasing number of studies are addressing this question, although only a few have directly observed stdp at the level of synaptic responses (see, e.g., bell et al., 1997; meliza and dan, 2006; cassenaer and laurent, 2007; jacob et al., 2007). one of the main difficulties in assessing stdp in vivo is that the induction protocols are not as uniform as in vitro, rendering the comparison between them hazardous. the pioneering work of levy and steward (1983) defined for the first time the coactivity requirements for synaptic potentiation in the hippocampus of anesthetized rats. the associative induction of long-term potentiation did not require perfect synchronicity of convergent presynaptic elements but unexpectedly, levy and steward observed that the order of the potentiation trains of stimulation was crucial in defining the polarity, potentiation or depression, of the synaptic change. a retrograde interaction between a process initiated within the main dendritic shaft and individual spines was necessary and proposed a retrograde electrical invasion of the spine structure as an appealing possibility (see stuart et al. stdp has been further shown in vivo at the single-cell level in the developing tectum of xenopus tadpoles (zhang et al., 1998). evoked synaptic currents were recorded through whole-cell perforated patch electrodes while the contralateral retina was stimulated electrically at minimal stimulation intensity. by varying the time between the postsynaptic tectal action potential and the retinal input, zhang and collaborators showed synaptic potentiation for inputs that repetitively arrived within 20 ms before the tectal spike and depression for inputs repetitively arriving within 20 ms after the tectal action potential. in the same preparation, visual inputs, instead of electrical stimulation, with particular time relationships with the postsynaptic action potential can induce long-term potentiation and depression compatible with stdp (mu and poo, 2006; see also engert et al., 2002). the functional consequences of such changes in retinotectal connections have been studied by reverse correlation mapping at the level of the visual receptive field (vislay-meltzer et al., 2006). positive or negative stdp protocols combining visual activation in ectopic areas of the visual field (i.e., outside the classical receptive field) and the postsynaptic current activation through the recording patch pipette were applied. these protocols were shown to sculpt receptive fields by enhancing or removing responses arising from the stimulation of conditioned sub-regions of the receptive field. 2003) have shown similar changes in the receptive field structure of primary visual cortex in cat, induced by a combined visual and intracellular stimulation protocol. interestingly, the changes in receptive field structure could be dynamically reversed, although not completely, by 10 min of spiking activity induced by white noise visual stimulation (vislay-meltzer et al., 2006). (2003) showing the reversibility of activity-dependent synaptic changes by a short period of spontaneous activity (mainly bursting activity) and points to the strong lability of plastic changes in vivo compared to the in vitro conditions (see below). the quiescent state of the network in vitro allows the maintenance of an induced synaptic change since no spurious pairings occur. however, if randomized pairings at time intervals encompassing both ltp and ltd windows are imposed in vitro, robust ltd is observed (feldman, 2000). this results since the temporal window (i.e., the integral of the learning curve) of ltd is longer than that of ltp (feldman, 2000; froemke and dan, 2002). consequently, the lability of the changes observed in vivo could result from higher levels of ongoing activity associated to an asymmetric stdp rule. the asymmetry of the learning rule in vivo depends however on the studied system (compare meliza and dan, 2006 and cassenaer and laurent, 2007). in the somatosensory cortex in vivo however, one can not exclude that a smaller asymmetry of the plasticity rule combined to a high level of ongoing activity could have the same overall reversal effect. since the stdp window looks narrower in vivo compared to in vitro (compare feldman, 2000 with jacob et al., 2007), an alternative scenario would be that the temporal windows for ltd and ltp were dynamically adjusted by the ongoing activity. because the level of activity is higher in vivo than in vitro, the system would compensate for the spurious pre-post pairings by decreasing and rendering more symmetric the temporal windows for ltd and ltp., the occurrence of stdp has been indirectly studied by pairing sensory and/or electrical stimulations at time intervals compatible with the stdp rule (schuett et al., 2001; yao and dan, 2001; fu et al., 2002; yao et al., 2004). the sensory stimulations increase the firing probability of neurons within a defined window of time, and thus the pairing of two stimuli favors the imposed spike-timing interactions. in most studies using sensory sensory associations (see also dahmen et al., 2008 for a similar study in a1), the modifications of the neuronal response properties are rather small, particularly at the single-cell level, but the temporal specificity and the sign of the resulting response modifications are in agreement with the direction of response modifications expected from an stdp scenario and support the idea that stdp could mediate experience-dependent modulation of receptive fields in the visual cortex in vivo. (2001) included more than 25,000 pairings between a visual stimulus presented at 7 hz during 3 h and an associated intracortical electrical stimulation. although the changes in the intensity of the voltage sensitive dye signal and the expansion of the cortical area representing the paired visual orientation last for up to 18 h after pairing, that is, much more than shown in any other study, the number of pairings is a hundred times larger than the average number of pairings of other studies and thus precludes a reasonable comparison. stdp has been directly observed in vivo at the level of synaptic responses in the visual cortex (meliza and dan, 2006). whole-cell recordings in the rat primary visual cortex were used to pair visually induced depolarization with spiking of the recorded neuron induced by current injection. depending on the order of the visual input and the postsynaptic action potential, potentiation or depression was observed. here, but also as a general observation of synaptic modification in vivo (see, e.g., jacob et al., 2007), the amplitude of the modifications is smaller and more variable than those observed in cortical slices (froemke and dan, 2002). in the intact brain neurons are submitted to a strong bombardment of input activity that affects the temporal control of presynaptic activity during pairing and in turn, affects stdp induction. thus, the question of stdp incidence in intact sensory cortices in mammals has still to be substantiated. in the in vivo somatosensory cortex of the rat, whisker deprivation results in cortical map modifications, which are concomitant with changes in the relative timing of thalamic and cortical action potentials within the stdp range (allen et al., 2003; celikel et al., this indicates that stdp could be involved in response modifications at the cellular level during experience-driven network reorganizations. indirect evidence for this comes from a combined electrical stimulation of somatosensory afferents and transcranial magnetic stimulation (tms) of the somatosensory cortex in humans (wolters et al., 2005, see also wolters et al., 2003 for a similar study on the motor cortex). evoked potentials induced by the tms were either enhanced or depressed as a function of the order of the paired associative stimulation. in the primary somatosensory cortex of anesthetized adult rats, backward pairings of spontaneous postsynaptic action potentials with subthreshold afferent excitation elicited by whisker deflections lead to depression of responses to the paired whisker with no significant changes to the unpaired whisker (jacob et al., 2007). the experimental protocol was based on mechanical deflections of the whiskers only, and no electrical stimulation of the afferent pathway was used during the pairing (see figure 1a1). since the action potentials of the recorded neuron were not artificially triggered but spontaneously fired by the recorded neuron, it was impossible to program a whisker stimulation that systematically preceded the action potential. consequently, only the depression side of the stdp curve was studied. although still in agreement with the stdp rule, the effect was observed only for time intervals shorter than 17 ms(see an example in figure 1a2), indicating that the range of synaptic delays that drive synaptic depression is narrower in vivo (see also yao and dan, 2001; fu et al., 2002; cassenaer and laurent, 2007; dahmen et al., 2008 for a similar observation) the shortening of the stdp window seems to depend on the developmental stage of the animal, since short windows (< 20 ms) were observed in the adult (yao and dan, 2001; fu et al., 2002; dahmen et al., 2008 and the extracellular backward pairings in jacob et al., 2007, see figure 1a3) whereas longer stdp windows (3550 ms) were observed in younger (intracellular pairings in jacob et al., 2007, see figure 1b3) or developing (meliza and dan, 2006) animals. in the backward pairing (jacob et al., 2007), the trains of whisker deflections were temporally irregular because the pairing was based on the spontaneously emitted action potentials of the recorded neuron. to assess the impact of such irregularities during pairing, several established models of integration of stdp (song and abbott, 2001; froemke and dan, 2002) were used to fit the experimental data. however, no satisfactory fitting was obtained (jacob et al., 2007). to explore the potentiation side of the stdp curve in vivo, whole-cell patch recordings were needed (see figure 1b1). using this technique, a timing-dependent depression of responses specific for the paired whisker was observed but spike-timing-dependent potentiation was more sporadically induced (figures 1b2,b3). thus, spike-timing-dependent depression can be effectively induced in vivo and is therefore a plausible plasticity mechanism in the somatosensory cortex although a refinement of specific plasticity models is still necessary to fully account for the observed response and synaptic changes. (a1) experimental protocol for backward pairing. during control and test (not shown) whisker deflection of the principal and one adjacent whiskers were presented in a pseudorandom sequence at 0.5 hz. the input waveform for each deflection was a 10 ms rostrocaudal movement followed by a 10 ms plateau and a ramp back to the rest position. during pairing, a spontaneously emitted action potential triggered a subthreshold deflection of one whisker with a fixed delay (0, 10, 20, or 30 ms). (a2) significant depression (p< 0.05) of response of a single neuron in the barrel cortex after a backward pairing (red histogram, after pairing) compared to control (green histogram, before pairing). (a3) specific depression for short delays of pairing. the mean response modification for the paired whisker (r=after before/after+before) is plotted against the delay of the pairing. the delay has been corrected to take into account the latency of the cortical response. the depression is significant (t-test,*p< 0.05) only for pairings at a short-delay window (< 17 ms). (b1) experimental protocol for whole-cell induction of stdp in vivo. during control and test (not shown) whisker deflection of the principal and one adjacent whiskers were presented in alternation at 0.5 hz. during pairing, whisker deflection was paired with current injection to elicit postsynaptic spikes at different delays (from 30 to+30 ms). (b2) induction of spike-timing-dependent synaptic depression (left) or potentiation (right) in two representative neurons. whisker deflection induced psp (wpsp) were averaged over 50 trials during baseline (green line) and after pairing (red line). (b3) learning rule for spike-timing-dependent synaptic depression in l2/3 in vivo. mean pairing-induced changes in amplitude of the wpsp (psp=after before/before) as a function of delay between postsynaptic spikes and wpsp onset. as already mentioned, the different experimental protocols applied in vivo to induce stdp are rather heterogeneous in terms of the temporal frequency of the pairing and of the number of associations. in addition, while some studies combined peripheral sensory stimulation with juxtacellular or intracellular current injection to control the postsynaptic spiking discharge, others used combined sensory-sensory stimulation at inter-stimulus intervals compatible with the stdp rule. a comparative analysis is presented in table 1 that shows a list of in vivo experiments with the corresponding characteristics of the pairings as well as the amplitude and duration of the induced effect. a peculiar correlation appears from such comparative study, which is the inverse link between the number of pairings (the table is sorted from the highest to the lowest number of pairings) and the amplitude of the resulting modification in sensory responses [see column change (ltp or ltd), expressed as percentage of baseline, in table 1]. the inverse relation holds for response potentiations and depressions separately as well as for the cumulated effect (not shown in table 1). the interpretation of this relationship is hazardous since there are noticeable experimental differences between the studies, including the age, the cortical area, the recording methods, the temporal frequency of pairings and more importantly, the induction protocols themselves (sensory versus electrical afferent activation). many of the studies showing larger effects induced by a relatively small number of pairings include an intracellular control of the postsynaptic spiking activity whereas on the other hand many of the studies with a high number of pairings and relatively small plastic changes include sensory-sensory stimulation as a way of controlling the temporal correlation of pre and postsynaptic activities. nonetheless, one plausible interpretation is that in vivo spontaneous activity generates spurious coincidences of both signs that dilute the effect of the pairing, and this effect accumulates with the number of pairings. alternatively, homeostatic mechanisms with longer time scales than the stdp rule and saturation of synaptic modifications with several tens of associations (see froemke et al., 2006) can regulate the expression of synaptic plasticity. stdp experiments conducted in intact nervous systems (sorted by the number of pairings). a, auditory stimulus; ap, action potentials; bf, best frequency; csc, compound synaptic current; ep, evoked potentials; epsc, excitatory postsynaptic currents; epsp, excitatory postsynaptic potentials; es, electrical afferent stimulation; ic, intracellular current; lfp, local field potential; moving v, moving oriented light bar; ns, not studied; o, olfactory stimulus; rf, receptive field; sap, spontaneous action potential; scd, spontaneous corollary discharge; t, tactile stimulus; tc, tuning curve; tms, transcranial magnetic stimulation; v, visual stimulus. cumulated effect=ltp ltd.*no significant modifications of response amplitudes were observed.*the percentage change compared to baseline is not provided for the shift of the tc,***the percentage change compared to baseline is not provided.**** trains of 8 pulses at 400 hz repeated eight times at 0.1 hz. developmental synaptic plasticity based on covariance rules in sensory cortices depends on the firing rate of presynaptic neurons. at high firing rates, the synapse is potentiated whereas at low firing rates, the synapse is depressed (see review in bear, 2003; malenka and bear, 2004). conversely, within the framework of the stdp rule, potentiation or depression can be obtained by changing the relative timing between pre- and postsynaptic action potentials with no need for changes in the firing rates. the pairing protocol applied in the somatosensory cortex (jacob et al., 2007) controls the temporal correlation between pre and postsynaptic spikes without inducing significant modifications of the firing rate of the neuron. consequently, the induction of the observed functional plasticity is rate-independent although the level of plasticity itself can be modulated by the temporal frequency of the ongoing activity during pairing (see below). (1992, 1998) where an increase of the functional connectivity between two neurons was induced by increasing the temporal correlation of their activity using a backward pairing similar to the one applied in our study. the temporal frequency of the pairing was shown to influence stdp (sjstrm et al., 2001): at low frequencies, depression dominates, whereas potentiation is induced at high frequencies. in the somatosensory cortex experiments (jacob et al., 2007), the depression induced by short-delay pairings depended on the firing frequency during pairing. it should be noted that the pairing frequency in this protocol was dictated by the spontaneous activity of the recorded neuron and was not arbitrarily chosen by the experimenter. the vulnerable nature of the activity-dependent synaptic modifications in vivo could result from the effect of the ongoing activity irrespective of the sensory driven activity. under this scenario, there should be a dependence of the level of synaptic plasticity on the ongoing activity. indeed, the induced depression of response was maximal for intermediate spontaneous firing rates, with an optimal firing rate at 2.5 hz (see figure 2). below one action potential per second, this decrease of the level of depression for very low frequency pairings has not been observed in vitro, and may result from the fact that at very low frequency of discharge the overall time of the pairing period (400 pairings in jacob et al., 2007) is too long compared to the duration of the effect produced by each individual pair of action potentials. this result suggests that there is an optimal level of ongoing activity for the induction of stdp. then, it can be proposed that in vivo, cortical structures with intermediate (a few action potentials per second) or sparser activities are more prone to show stdp. (a) experiments were performed in the barrel cortex of adult anesthetized rats (see jacob et al. during pairing, a spontaneously emitted action potential triggers a subthreshold deflection of a whisker with a fixed delay (0, 10, 20, or 30 ms). one pairing period contains 400 associations between an action potential and a stimulation of the whisker. (b) the differential change in response (rdiff) defined as the difference between modifications of responses in the paired and the unpaired pathways, is plotted against the mean temporal frequency of the spontaneous action potential discharge during pairing, at short delays (upper plot, 17<delay<7 ms) and longer delays (middle plot, delay<17 ms). a band-pass curve fitted to rdiff for the short-delay pairings (not shown) gives a preferred frequency for the induction of response depression of 2.57 hz. in the lower two scatter plots, relative changes in response (rdiff) are plotted against the delay of the pairing computed as the imposed delay plus the latency between the stimulation and the arrival of the afferent volley to the cortex. the separation of the pairing population was based on the frequency during the pairing with frequencies between 1.5 and 4.5 hz (left plot) leading to depression. stdp may be particularly useful in brain regions in which spike rates are low and information is conveyed in spike-timing information. the range of ongoing and evoked firing rate in awake animals differs in the different cortical areas. extracellular recordings revealed firing rates between 10 and 25 hz in the visual cortex (kasamatsu and adey, 1974; livingstone and hubel, 1981), less than 5 hz in the auditory cortex (edeline et al., 2001) and less than 1 hz in the barrel subfield of the somatosensory cortex (crochet and petersen, 2006). ongoing activity in the network affects postsynaptic membrane properties and can modulate the induction of plasticity and compromise the stability of the synaptic modifications. there are striking differences as well between sensory cortices in the ratio between phasic or tonic patterns of evoked firing. does stdp efficiency correlate with the sparseness of natural activity? in the retinotectal synapses of developing xenopus, where stdp has been extensively demonstrated, the activity is sparser than in the cortex of mammals (the spontaneous firing rate is below 1 hz, the evoked firing rate is between 1 and 2 hz). in the locust olfactory system, stdp has been induced in the synapses formed between the kenyon cells of the mushroom body and cells located in the -lobe (cassenaer and laurent, 2007). here too, the activity of the kenyon cells is extremely sparse: the average spontaneous firing rate is below 0.01 spikes per second and the activity evoked by odor presentation is still below 2 spikes per second (perez-orive et al., 2002; jortner et al., 2007). remarkably, long-term potentiation and depression can be induced in this system after only a few pairs of action potentials. in other terms, is stdp plausible in a natural in vivo condition? in the hippocampus, a prominent activity pattern is that of theta oscillations between 4 and 12 hz (buzski and draguhn, 2004). the phase and frequency of the theta rhythm is under the fine control of at least two independent generators acting together (kocsis et al., 1999). recent intracellular recordings in hippocampus of freely moving rats confirmed that theta rhythms are present at the synaptic level (lee et al., 2006, 2009). single-cell activity includes a few action potentials per cycle constrained to a particular phase. however, the phase of action potentials in the cycle changes as a function of the position and the direction of the animal (o'keefe and recce, 1993). this observation suggests that the timing of the spikes conveys information and constitutes a potential basis for physiological stdp to occur. similarly to the observation in the somatosensory cortex, stdp-like pairings in the ca1 field of the in vivo hippocampus by stimulation of the schaffer pathway and of the contralateral commissural pathway, induced potentiation at 5 hz but not at 1 or 10 hz (dong et al., 2008). it is likely that the occurrence and amplitude of plasticity is tuned by the frequency of the theta rhythm and the phase of the spikes in the theta cycle leads to a selection of the synapses being potentiated or depressed. different rhythms are present at the microscopic and macroscopic level also in the cortex (steriade, 2001; crochet and petersen, 2006; poulet and petersen, 2008) and they might affect the induction of plasticity. non-alert states have been associated with large oscillations at low frequency (15 hz), which reveal a synchronized activity and are reminiscent of the up and down states observed in anesthetized animals. changes in the amplitude of the sensory responses, size of receptive fields, and rate of spontaneous firing are observed in the alert animal compared to the non-alert animal in the visual (wrgtter et al., 1998; eyding et al., 2003; stoelzel et al., 2009), the auditory (edeline et al., 2001) and the somatosensory (chapin and lin, 1984; de kock and sakmann, 2009) cortices. interestingly, the spontaneous firing rate of thalamocortical neurons is lower and at the same time the rate of burst discharges is higher during synchronized non-alert states compared to alert desynchronized states (stoelzel et al., 2009). these patterns of activity characteristic of the non-alert brain should have an impact in stdp induction since for example, cortical stdp induced in vitro at low frequency (sjstrm et al., 2001; sjstrm and nelson, 2002; froemke et al., 2006) and/or by bursts of action potentials (birtoli and ulrich, 2004; froemke et al., 2006) favors synaptic depression, even if one has to keep in mind that these observations were made in layers 23 and 5, that is, in non-thalamo-recipient cortical layers. attention related modulatory signals can change the sparseness of activity in the cortex (vinje and gallant, 2002), increasing the temporal precision of the network activity regime (frgnac et al., 2006), and rendering the system more prone to stdp induction. cortical release of noradrenaline for example, produces a reduction of spontaneous and evoked activity in the visual cortex (ego-stengel et al., 2002). through this powerful inhibitory action, the noradrenergic system might provide a reset signal (dayan and yu, 2006), broadcasted to the whole cortical mantle, leading to an optimized level of activity for the induction of stdp. other neuromodulators can dynamically regulate timing-based plasticity rules by modifying the biophysical properties of dendrites and the efficacy of spike back propagation (tsubokawa and ross, 1997; sandler and ross, 1999). action potentials back propagating into the dendritic tree critically determine the induction of stdp (engelmann et al. 2008), and its amplitude can be modulated by the network state (waters and helmchen, 2004) and dendritic depolarization (sjstrm and husser, 2006), both known to be modulated in turn by ascending neuromodulatory signals. a recent comparative study of corticostriatal plasticity in anesthetized and awake animals (stoetzner et al., 2010) showed that the stdp plasticity rule depends critically on the behavioral state. further in vivo experiments combining stdp induction protocols concomitant with the activation of neuromodulatory ascending systems (for slice and cell culture studies see lin et al., 2007; pawlak and kerr, 2008; zhang et al., 2009) are needed to explore how local rules of synaptic plasticity in general (shulz et al. stdp in particular are regulated by global factors acting on several spatial (dendrites, neurons, network) and temporal (milliseconds to minutes) scales. in conclusion, in vivo experimental evidence for stdp, although not yet compelling, has been recently provided in various species and neural structures. significant variations of the rule (e.g., the temporal length of the stdp window) have been observed and some properties of the induced plasticity, like the duration of the effect, differ from those observed in in vitro preparations. endogenous patterns of ongoing in vivo activity like oscillatory rhythms, burstiness and sparse neural activity might help to counteract the effect of spurious spike coincidences and reduce the vulnerability of plasticity in vivo. in addition, attention related neuromodulatory signals, through the regulation of activity patterns and/or the adaptation of the plasticity rule itself (i.e., metaplasticity, abraham, 2008) might optimize the induction and expression of stdp in the intact brain. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

a computationally rich algorithm of synaptic plasticity has been proposed based on the experimental observation that the sign and amplitude of the change in synaptic weight is dictated by the temporal order and temporal contiguity between pre- and postsynaptic activities. for more than a decade, this spike-timing-dependent plasticity (stdp) has been studied mainly in brain slices of different brain structures and cultured neurons. although not yet compelling, evidences for the stdp rule in the intact brain, including primary sensory cortices, have been provided lastly. from insects to mammals, the presentation of precisely timed sensory inputs drives synaptic and functional plasticity in the intact central nervous system, with similar timing requirements than the in vitro defined stdp rule. the convergent evolution of this plasticity rule in species belonging to so distant phylogenic groups points to the efficiency of stdp, as a mechanism for modifying synaptic weights, as the basis of activity-dependent development, learning and memory. in spite of the ubiquity of stdp phenomena, a number of significant variations of the rule are observed in different structures, neuronal types and even synapses on the same neuron, as well as between in vitro and in vivo conditions. in addition, the state of the neuronal network, its ongoing activity and the activation of ascending neuromodulatory systems in different behavioral conditions have dramatic consequences on the expression of spike-timing-dependent synaptic plasticity, and should be further explored.

PMC3059664

pubmed-1042

multiple anatomical defects are believed to contribute to involutional entropion, and numerous surgical techniques have been described to correct them. the three anatomic factors most consistently described in the literature as requiring attention are lower lid retractor disinsertion, horizontal lid laxity, and orbicularis oculi muscle override [111]. horizontal lid laxity, diminished orbicularis tone, and lower lid retractor disinsertion the anatomic and histologic features of lower eyelid malposition have been described by numerous authors. lower lid anatomy, including the lower lid retractors, was investigated by jones who theorized that laxity of the retractors would allow the inferior border of tarsus to rotate outward. jones also postulated that lower lid retractor laxity was analogous to a levator aponeurosis dehiscence. collin and rathbun histologically studied patients with entropion versus normal eyelids evaluating the lower lid retractors. in the entropion specimens, they found that the lower lid retractors and orbital septum only came to within 3.5 mm of the inferior border of the tarsus versus 1.5 to 2.5 mm in normal lids. additionally, a larger amount of orbital fat was present in the entropion specimens compared to the normal lids indicating a retractor dehiscence. the tarsal plate has been shown to invert in entropion where the lower border rotates superiorly and anteriorly 16 degrees and the upper border rotates inward 63 degrees. in some patients, the junction of the inferior border of the tarsus with the lower lid retractors has an acute angulation as compared to a normal eyelid. with inferior distraction of the eyelid, an abnormal cul-de-sac develops below the inferior tarsal border forming a v shaped appearance (figures 1 and 2). additionally, the presence of a white line representing the retracted edge of the disinserted lower lid retractors under the palpebral conjunctiva may be visible and is referred to as a complete retractor disinsertion. putterman and wesley described patients where lateral tightening was insufficient to correct an ectropion. additionally, when describing ectropion, hawes and dortzbach commented that the lower lid retractor muscle was further from the inferior tarsal border and that there was an increased amount of adipose tissue near the tarsus and capsulopalpebral fascia junction in ectropion patients. horizontal lid laxity is also thought to be important in the development of entropion [20, 21]. as surgical treatments evolved, surgeons found that recurrence of the entropion was more likely if horizontal laxity was not corrected [2224]. danks and rose found addressing horizontal laxity at the time of surgery in addition to advancing the lower lid retractors and eliminating orbicularis oculi muscle override increased the success rate of surgery. they recommended that horizontal lid shortening should be performed in all cases of involutional entropion. lateral canthal tendon lengthening and an abnormal lid traction test (lid distraction test) were found to be statistically significant when comparing ectropion to control lids. the medial canthal tendon was also found to be longer in patients with ectropion compared to the control group, but the difference was not statistically significant. the orbicularis oculi muscle is thought to play a role in involutional entropion by the preseptal orbicularis migrating superiorly over the tarsus, perhaps because of increased connective tissue laxity. in a histologic study, sisler et al. found septal and tarsal atrophy in patients with entropion. in ectropion, they found orbicularis and riolan's muscle ischemia, atrophy, and collagen fragmentation. orbicularis oculi atrophy was also found with light and electron micrography in specimens of lids with ectropion [15, 28]. historically, many studies have reported features associated with entropion as subjective clinical observations. surgical interventions were aimed at addressing each of these features [111, 16, 22, 23, 25]. other studies identified clinical features and compared them to the opposite unaffected lid or against lids with ectropion [2932]. very few studies have been done in a comparative manner in patients with entropion versus age-matched controls. compared patients with entropion versus age-matched controls with hertel exophthalmometry measurements and found that no statistically significant difference existed. benger and musch limited their study to patients over the age of 65 and found that only patients with entropion of greater than 6-week duration had increased horizontal lid laxity compared to the age-matched controls. they found a statistically significant difference in the vertical distraction test of patients with entropion compared to their control group, but the vertical excursion from up to down gaze was not significant. more recently, beigi et al. did a study measuring lower lid excursion, horizontal lower lid laxity, and orbital fat prolapse. however, they used the opposite unaffected eye as a control in patients with unilateral entropion. this study did not find a difference in horizontal laxity or lower lid vertical excursion between the lid with entropion and the nonentropic eyelid. however, orbital fat prolapse was found to be associated with involutional entropion, likely related to lower lid retractor thinning and dehiscence. this study represents an attempt to synthesize the information gleaned by previous studies and develop a comprehensive protocol to assess all the potential mechanisms and related clinical findings of involutional entropion and ectropion. the study was designed to evaluate and compare the clinical eyelid parameters proposed to contribute to entropion and ectropion formation. the findings will be compared with an age-matched control group to best remove any experimental bias. this prospective age-matched, case-control study was conducted from 2009 to 2010 with the institutional review board (irb) approval. the eyes were assigned to the entropion group, ectropion group, opposite lid entropion control group (entropion control), opposite lid ectropion control group (ectropion control), or the age-matched control group. patients were evaluated for the presence or absence of involutional entropion or ectropion. the patient was observed and if the eyelid margin was rolled in toward the eye constantly or intermittently, then involutional entropion was diagnosed. if an eyelid was rolled outward either medially or along its entire length without evidence of anterior lamellar contracture or facial paralysis, involutional ectropion was diagnosed. the patients in each of the five groups were then evaluated for nine clinical parameters as follows. (1) margin to reflex distance 2 (mrd2) measured to the nearest half millimeter with a ruler as the distance between the central corneal light reflex and the lower lid margin; (2) lower lid crease measured to the nearest half millimeter using a ruler from the lower lid margin; (3) presence of a retractor dehiscence; this was deemed present when the junction of the lower lid retractors to the tarsus had a v shape when the lower lid was distracted inferiorly (figure 1); (4) presence of a retractor disinsertion with the finding of a subconjunctival white line in the fornix (figure 1); (5) presence or absence of orbital fat prolapse; this was deemed present if the inferior orbital fat protruded into the fornix and anterior level of the everted tarsus when the lower eyelid was distracted inferiorly (figure 1); (6) lower lid vertical excursion as measured to the nearest half millimeter by the movement of the central lower eyelid margin from up gaze to down gaze; (7) lateral canthal excursion as measured to the nearest half millimeter by the movement of the lateral canthal angle from up gaze to down gaze; (8) lower lid laxity and orbicularis oculi muscle tone with use of the snapback test; this was assessed by observing the time taken for the lower lid margin to return to its resting position after being pulled inferiorly; results were reported on a four-point likert scale defined as follows: (i) normal quick return; (ii) slow return; (iii) return requires one blink; (iv) return requires more than one blink; (9) horizontal lid laxity using inferior distraction of the lid; this was recorded to the nearest half millimeter by measuring the distance between the lid margin and the globe in primary gaze while pulling the lid inferiorly. data was analyzed utilizing parametric and nonparametric tests within spss, version 16.0 (spss, chicago, il). the descriptive statistics of mean, median, range, and standard deviation were calculated for each group. the z test statistic reported for the mann-whitney u test indicates if the two samples being compared come from the same underlying distribution at the p=0.05 significance level. a z score of less than 1.96 indicates that the two samples come from the same underlying distribution. nominal data was analyzed with fisher's exact test as dictated by the expected 2 2 table values. the control group consisted of 26 patients (52 eyes) with a mean age of 75 (range 5689). there were 13 males (mean age 71, range 5989) and 13 females (mean age 79, range 5687) in the control group. the entropion group consisted of twenty-six consecutive patients (30 eyes), 13 male and 13 female, with unilateral (22 patients) or bilateral (4 patients) entropion. the females had a mean age of 79 (range 7085) and the males 72 (range 5384). the ectropion group consisted of 19 patients (30 eyes) with a mean age of 81 (range 5792). the ectropion group consisted of 12 males (21 eyes) (mean age 79, range 5789) and 7 females (9 eyes) (mean age 84, range 7592). a secondary control group was created using the normal eyelid of patients with unilateral disease. these groups were the designated entropion opposite lid control group (entropion control) and ectropion opposite lid control group (ectropion control). one patient with unilateral ectropion had scarring of the opposite lid and was not used in the ectropion control group. table 1 contains a summary of the descriptive statistics for the control, entropion, ectropion, and opposite lid control groups. the statistical results of all the analyzed groups are summarized in table 3, and a summary of the statistically significant results for all groups is shown in table 4. shaped insertion and the parameter of a slowed return on the snapback test were both found to be statistically significant when comparing the entropion and ectropion groups to the control group. additionally, a statistically significant difference was found between the entropion and ectropion groups for both of these measurements. a retractor dehiscence occurred more frequently in entropion and the snapback test was slower in ectropion. the presence of a white line and orbital fat prolapse in the inferior cul-de-sac were statistically significantly different and were more common in the entropion and ectropion groups compared to the control group. lower lid excursion was decreased in the entropion and ectropion groups versus the control group. lower lid distraction was greater and statistically significant in the ectropion and entropion groups compared to the control eyes. however, no statistically significant difference between the entropion and the ectropion groups was found in these four clinical parameters. the lid crease height was found to be statistically significantly greater in the entropion lid group than in the control group. those eyes which did not have a measurable lid crease were excluded from the calculation. no statistical difference was found between the ectropion lid group and the control group or between the entropion and ectropion groups. lateral canthal excursion was diminished and was statistically significant in the entropion group as compared to both the control and the ectropion groups. the difference was not found to be statistically significant between the ectropion group and the control group. in unilaterally affected entropion and ectropion patients, the risk for developing a malposition in the unaffected lid is demonstrated by significant abnormalities when compared to the age-matched control group. while many studies have used the contralateral lid as a control, the contralateral lid in unilaterally affected patients is not a valid normal control because of these abnormalities. this is supported by the fact that mrd2 was the only variable that showed no statistical difference between entropic or ectropic lids and the control lids. retractor dehiscence, presence of a white line, orbital fat prolapse, decreased lower lid excursion, increased lower lid laxity, and increased lower lid distraction are findings associated with both entropion and ectropion. the presence of these features may promote the development of either entropion or ectropion in lids currently not exhibiting clinical changes. eyelids with ectropion have decreased lid elasticity compared to the entropion and control groups as demonstrated with the snapback test. an increased lid distraction test is also found in the ectropion group when compared to the age-matched control group. alterations in the tarsus or ligamentous attachments could be the underlying cause. decreased or misdirected orbicularis oculi muscle function may also play a role in the lid rolling outward. entropic lids have more significant retractor abnormalities than the ectropic lids. in order to develop entropion, a very lax or completely disinserted retractor is necessary, which may explain why entropion is more likely to be unilateral in its presentation. lids with either entropion or ectropion have numerous significant abnormalities and differences compared to age-matched controls. this supports the clinical observation that surgical repair is most successful when multiple anatomical abnormalities are addressed. the more pronounced lower lid retractor dehiscence or disinsertion found in entropion and the poor snapback characteristics in ectropion may explain why involutional entropion and ectropion are rarely seen in opposite eyes of a single patient.

purpose. to analyze the clinical findings associated with involutional entropion and ectropion and compare them to each other and to age-matched controls. methods. prospective, age-matched cohort study involving 30 lids with involutional entropion, 30 lids with involutional ectropion, and 52 age-matched control lids. results. the statistically significant differences associated with both the entropion and ectropion groups compared to the control group were presence of a retractor dehiscence, presence of a white line, occurrence of orbital fat prolapse in the cul-de-sac, decreased lower lid excursion, increased lid laxity by the snapback test, and an increased lower lid distraction. entropion also differed from the control group with an increased lid crease height and decreased lateral canthal excursion. statistically significant differences associated with entropion compared to ectropion were presence of a retractor dehiscence, decreased lateral canthal excursion, and less laxity in the snapback test. conclusion. entropic and ectropic lids demonstrate clinically and statistically significant anatomical and functional differences from normal, age-matched lids. many clinical findings associated with entropion are also present in ectropion. entropion is more likely to develop with a pronounced retractor deficiency. ectropion is more likely to develop with diminished elasticity as measured by the snapback test.

PMC3964688

pubmed-1043

autoimmune hepatitis (aih) is a chronic inflammatory disease characterized by progressive destruction of the hepatic parenchyma. the disease displays female predominance and is considered rare in childhood, although it may occur in very young children. the hallmark of the disease is the presence of circulating autoantibodies, defining two major subtypes: type 1 (aih-1) [3, 4] and type 2 (aih-2). equally striking is the strong genetic susceptibility identified by specific mhc class ii molecules, especially hla-drb1, which discriminates between the two types of aih. brazilian aih-1 patients carry hla-drb113 and/or hla-drb103 whereas aih-2 patients present mainly carry hla-drb107. hypergammaglobulinemia is a diagnostic feature of aih but other immunoglobulins may be altered as well. low iga levels are particularly common in aih-2 and we have observed high ige levels in children with aih-1. elevated serum ige levels have been previously described in acute and chronic liver diseases usually linked to alcohol abuse or viral infection. this phenomenon is traditionally linked to allergy, asthma, and atopy, but elevated ige serum levels in specific autoimmune diseases have been increasingly acknowledged. to date, elevated ige serum levels have been identified in churg strauss vasculitis, sclerosing cholangitis, bullous pemphigus, autoimmune pancreatitis, and grave's disease. ige seems also to play a role in the pathogenesis of rheumatoid arthritis contributing to the immune response against citrullinated proteins. atta et al. also observed specific ige antinuclear antibodies in systemic lupus erythematosus suggesting there is an important contribution to the pathogenesis of the disease. b lymphocyte switching to ige is induced by il4 and its neighbor gene il13, which form, together with il5, a well-studied cytokine gene cluster (5q31.1) controlling th2 type immune responses. il4 is a pleiotropic cytokine essential for ige synthesis by b cells and for t cell differentiation into a th2 phenotype and upregulation of mhc class ii expression. the functions of il13 in immune surveillance and in th2 type immune responses partially overlap with those of il4. in addition to the classic th2 pathway shared with il4, il13 has other important functions. il13, together with il5, is a potent mediator of tissue fibrosis and tissue remodeling, as shown in experimental models of schistosomiasis. a steadily increasing literature indicates that there is an important role for il13 in the development of hepatic fibrosis, signaling through the il13 receptor to induce collagen production by local fibroblasts aih-1 pediatric patients typically exhibit liver fibrosis, including most patients in our study. about 25% of aih patients, despite treatment with corticosteroids, present progressive fibrosis, highlighting the importance of any gene which might be involved in this process. in addition, both il4 and il13 genes harbor functionally relevant polymorphisms [22, 23]. t cell-mediated cytotoxicity is believed to be the central mechanism responsible for hepatic damage, but other cells are involved. typically, cd4 helper t and b cells gather around portal tracts, whereas cd8 cytotoxic t cells have a periportal distribution. in addition to the abundant infiltrating mononuclear cells, plasma cells and eosinophils may also be present. interestingly, a previous study has highlighted the increased production of il4 messenger rna in aih-1 liver biopsies in parallel with the expected increase in inflammatory interferon gamma and other proinflammatory cytokines. these findings led us to try to identify additional factors involved in the autoimmune processes present in this liver disease, which might act either as prognostic disease markers or as novel targets for a therapeutic approach. to this end, we analyzed the major clinical manifestations and biopsies from brazilian children grouped according to the aih type and serum ige levels. we also investigated, in the predominant aih-1 group of patients, functional polymorphisms of the il4, il13, il5, and il4ra (il4 receptor alpha chain) genes involved in ige switching and eosinophil differentiation and maturation that we believe might contribute to overall genetic susceptibility to aih. a total of 141 patients diagnosed as aih, according to the international autoimmune hepatitis group report, were studied. patients were followed at the pediatric hepatology unit of the children's institute, general hospital, faculty of medicine, university of so paulo in so paulo, brazil. clinical, biochemical, and histological features of 74 aih patients (61 with aih-1 and 24 with aih-2) aged 1 to 14 years were evaluated. to increase statistical power for analysis of gene polymorphisms, we included a further 43 children with aih-1 (a total of 117). non-hla matched siblings of bone marrow recipients from the same hospital and with similar social and ethnic background, without any autoimmune and/or other severe disease, were enrolled as healthy controls (hc, n=227). written informed consents were obtained from all participants and/or legal guardians, and the internal review board of the university of so paulo approved the study. laboratory liver tests, including alanine aminotransferase (alt), aspartate aminotransferase (ast), alkaline phosphatase, gamma glutamyl transpeptidase (gt), albumin, -globulins, prothrombin, and total bilirubin, and autoantibody profiles were performed in all patients. radioallergosorbent test (rast) for specific allergen against house dust, animal fur, food, and fungi was assayed by radioimmunoassay using unicap100e (pharmacia&upjohn company llc, mi, usa) system. i. immunoglobulins m, g, a, and e were assayed by nephelometry using a dade behring system nephelometer bn 100 (dade behring diagnostics inc., somerville, nj). serological tests for hepatitis a, b, and c were negative in all patients. clinicians involved in this study ruled out other hepatic diseases such as alpha-1 antitrypsin deficiency and wilson's disease. histological features of liver biopsies were graded semiquantitatively using the brazilian consensus for histopathology of chronic hepatitis. specific monoclonal antibodies for ige, cd3, cd4, cd8, cd20, and cd16 (bd biosciences, san jose, ca, usa) were used for immunohistochemistry. genomic dna was extracted using a dodecyl/hexadecyltrimethylammonium bromide (dtab/ctab) method. rs2243250, rs2070874, il5 rs2069812, and il13 rs20541 polymorphisms were typed by restriction fragment length polymorphism (rflp). il4 rs2070874 and il13 rs20541 typing by rflp is described elsewhere [30, 31]. the primers and restriction enzymes for il4 rs2243250 and il5 rs2069812 were 5cctaaacttgggagaacatggt, 3tcctcctggggaaagataga (avaii) and 5ttcctgctgctcatgaacagaatacgt, 3cattttgatggcttcagtgactcttcc (rsai), respectively. il4 rs2227284 and il4ra rs1805011 polymorphisms were typed by aspcr (allele-specific polymerase chain reaction). primers for il4ra rs1805011 have been described and primers used for il4 rs2227284 were 5ttgggtggacaagtagttggagcg, 5ttgggtggacaagtagttggagct and 3atgtcccatcctgcccaggatag. all statistical analyses were carried out using graphpad prism 5 or spss, v.13 software. the clinical and laboratory parameters were analyzed using student's t-test or fisher's exact test, as well as the mann-whitney test where necessary. the power was estimated for all studied snps and values ranged from 76 to 82%, indicating adequate sample size. in addition, all snps were in hwe and, as expected, haploview analysis confirmed that the three studied il4 snps were in linkage disequilibrium. for the possible genetic associations, or exact fisher's test were applied. unpaired t-test was used to evaluate associations between ige and the genotypes of all studied snps. for regression analysis, variables presenting p value<0.100 in the univariate analysis were included. to identify possible gene-gene interactions, the majority of the aih patients were classified as type 1 (85% versus 15% type 2). the median age of diagnosis was 8.2 and 4.8 years, respectively, for aih-1 and aih-2. in addition, 54% (13/24) of aih-2 patients developed the disease before the age of 5 years, whereas this occurred only in 8/117 (7%) of aih-1 patients (p<0.001). twenty-three (20%) aih-1 and 11 (46%) aih-2 patients (p=0.006) had relatives presenting autoimmune diseases. in addition, median serum alanine aminotransferase values were higher in the aih-2 group (28 versus 18 upper normal limit; see table 1). serum igg, iga, and ige levels were significantly higher in aih-1 in comparison to the aih-2 group of patients (figure 1). high ige levels were observed in 50/91 (55%) of patients with aih-1, but only in 2/17 (12%) of those with aih-2 (p=0.003) (table 1). histopathology showed presence of cirrhosis in the majority of aih-1 patients (57 out of 60) analyzed, usually accompanied by necroinflammatory activity corresponding to a score 3 and a score 4 panacinar necrosis. liver cell rosettes were also present in almost 90% of livers, accompanied by infiltrating eosinophils and/or plasma cells, independently of patients ige serum levels (table 2). importantly, in contrast to increased ige serum levels present in about half of the patients, liver ige was absent in only 4 of the 46 aih-1 patients. finally, most patients exhibited cd8 cytotoxic t cell and nk infiltrating cells, in some cases without detectable cd4 helper t cells (table 3). however, irrespective of serum ige levels, in most patients, moderate to high infiltration levels of cd4 helper t cells usually accompanied by moderately elevated liver nk cells were in fact present. in conclusion and in spite of having analyzed only a subgroup (46/60) of patients, our results clearly show that the well-known infiltrating proinflammatory cell profile coexists side by side with ige, eosinophils, and the plasma cells possibly involved in ige production. the reason for this mixed cell profile is currently unknown. among the studied snps in aih-1, two functionally relevant snps present, respectively, in the il13 gene and in its receptor il4ra disclosed statistically significant increases. the first snp is il13 rs20541 (31 versus 23% of hc; p=0.024, or=1.55) and, moreover, homozygosis for the a allele at il13 rs20541, known to impact upon receptor ligand affinity, was also significantly increased compared to healthy controls (p<0.001, or=4.62). increased frequencies were also found for a allele at il4ra rs1805011 (68% versus 49%; p<0.0001, or=2.15) and homozygosis for a (47% versus 19%; p<0.001, or=3.75) (table 4). the remaining polymorphisms did not show any relevant difference when aih-1 and hc groups were compared (supplementary table 1 in supplementary material available online at http://dx.doi.org/10.1155/2015/679813). finally, we carried out analysis using a logistic regression model, which included allele carriage of the different snps as well as clinical and laboratory parameters. three modes of analysis were tested. in the first mode (mode 1), the results confirmed the findings for both il13 rs20541 (or=9.45 (95% 2.2839.18) p=0.002) and il4ra rs1805011 (or=3.72 (95% 1.787.77) p<0.001). to investigate a possible association of snps with pathogenesis of the disease, a second mode (mode 2) of analysis considered each snp as the dependent variable. the t allele at il5 rs2069812 showed association with treatment suspension (remission by clinical and laboratory standards) (p=0.004) but was a very rare outcome, present only in 7 patients (7/117, 6%) where 5 achieved regression of fibrosis after treatment (grades iv to ii). il5 is directly involved in eosinophil activation and is a key molecule in allergy and eosinophilic inflammation, expressed by cd4 helper t and b cells, mast cells, and eosinophils. finally, ige was considered as the dependent variable in another analysis (mode 3). the presence of the t allele at il4 rs2227284 showed association with high ige levels (or=7.42 (95% ci 1.33 to 41.34), p=0.02) (table 5), an expected result. the genes individually associated with susceptibility to the disease were examined for potential gene-gene interactions. gene-gene interactions considered grouped genotypes for il4ra rs1805011, il4 rs2243250, il4 rs2070874, rs2227284, il13 rs20541, and il5 rs2069812 and the presence of 03 and/or 13 alleles at the hla-drb1 locus. individuals presenting homozygosis for the a allele at il4ra rs1805011 and hla-drb103 and/or 13 allele were at six times greater risk to develop the disease (or=14.00, p<0.001) compared to the risks conferred by the same alleles individually (hla-drb103 and/or 13, or=8.28; il4ra rs1805011, or=3.72). individuals homozygous for the a allele at il13 rs20541, combined with hla-drb113 and/or 03 allele also showed a slightly greater risk to develop the disease (or=8.88, p=0.04). the recurrent presence of plasmocytes and eosinophils in liver biopsies along with the unusual finding of increased circulating ige antibodies in brazilian pediatric patients with aih was the basis for this retrospective study. to further understand if those cells might be disease markers for aih-1, we investigated gene polymorphisms of cytokines involved in plasmocyte and eosinophil maturation and ige production. our hypothesis was that these snps might play an additional role in the development of aih, a disease primarily caused by autoreactive t cells, acting as disease modifiers in synergy with the strongly associated mhc class ii hla-drb113 and 03 alleles in the brazilian admixed population. our cross-sectional analysis of laboratory and clinical parameters aimed to distinguish if the increased levels of circulating ige are markers for the presence of an autoimmune process and therefore present in all patients irrespective of other markers or an indicator of a pathogenic role varying according to disease severity. it is also possible that ige levels are simply an epiphenomenon caused by widespread inflammatory and immune activity. the degree of portal inflammation and, especially, parenchymal lesions and interface necroinflammatory activity were remarkable in aih-1 patients and occurred irrespective of ige serum levels. a major feature in the present series of analysis was the finding of panacinar necrosis in about half of all patients, again regardless of ige serum levels, eosinophil count, or other histology characteristics. in spite of liver-infiltrating eosinophils in about 60% of these patients, eosinophil count in peripheral blood of all patients was in the normal range (data not shown). this observation is in accordance with the observed lack of rast reactivity in the patients. we concluded that despite the high ige serum levels, the laboratory and clinical findings are not indicative of a concomitant allergy or atopy occurring in these children. in addition, eosinophils have a circulating half-life of only a few hours, with rapid removal of tissues by leukocyte extravasation. in tissues, eosinophils are not usually present in livers from healthy or cmv-infected patients, in contrast to liver transplanted patients, where eosinophil count correlates with degree of rejection. in our patients, and arguably due to the widespread inflammation, not only were eosinophils present but also ige was identified in most biopsies analyzed. in addition, plasma cells, t and b lymphocytes, and nk cells were also found in the liver of most patients, confirming the generalized inflammatory process. in aih, t cell-mediated cytotoxicity is believed to be the central mechanism responsible for hepatic damage. in fact, the intriguingly mixed immune profile included also the clearly defined cd8 cytotoxic t cell periportal infiltration responsible for the piecemeal necrosis that is a hallmark of the disease whereas cd4 helper t cell and b cells gathered around portal tracts. of note, in our group of patients, we observed a more modest score in the case of cd4 helper t cell infiltrating cells than described elsewhere. our data are similar to a recent study in adult aih and drug-induced liver injury patients. infiltrating liver cells were profiled and the presence of eosinophils was detected after standard staining in varying percentages in both groups of patients, but tissue ige was not measured. added to the unambiguous detection of eosinophils in the biopsies of our group of pediatric patients, we show that liver ige is present in the vast majority of patients. taken together, beyond the characteristic portal and periportal inflammatory cell profile, the ubiquitous presence of ige deposits, plasma cells, and eosinophils suggests a yet unidentified additional role in the pathogenesis of aih. in rheumatoid arthritis, the involvement of eosinophils has been linked to il-5 and tgf-1, profibrogenic cytokines that contribute to collagen accumulation in tissues. it is possible that, likewise, the excess liver-infiltrating eosinophils take part in the development of the severe fibrosis typical of the disease in young children. on the other hand, il4 and il13 are major cytokines involved in ige synthesis by b cells and exhibit overlapping functions due to the interaction with the type ii receptor composed of the il4r and il13r1 expressed in nonhematopoietic cells and shared by both cytokines. il13 additionally impacts upon tissue eosinophilia, tissue remodeling, and fibrosis, especially in the liver. we observed an association between presence of the il13 codon 110 a allele (coding for glutamine) and susceptibility to aih-1. this variant has been associated with increased ige levels in both atopic and healthy children. association with the functional polymorphism coding for valine in the alpha chain of the il4 receptor was also identified (see multivariate analysis, model 1). chen et al. (2004) have previously shown that the il13 glutamine carrying variant displays increased activity compared to the wild type arginine variant. furthermore, they showed that signal transduction by the variant was further enhanced when the il4 receptor alpha chain carried valine in position 50. the results suggest that the joint presence of these two polymorphisms in aih pediatric patients may indeed impact aih pathology and contribute to disease severity. it is possible that the presence of higher circulating and liver ige reflects an overall stimulus of the immune system that results in enhanced immunoglobulin levels, which could include target-driven autoantibodies. it remains to be seen if any specific autoantigen is recognized by these ige antibodies, but without a defined target this analysis remains difficult to be achieved. the il4 rs2243250, rs2070874, and rs2227284 snps included in this study have been shown to impact il4 transcriptional activity and il4 rs2227284 (g>t), which resides in a putative transcription factor binding site, may act independently to regulate il4 transcription and ige production. furthermore, presence of the t allele at il4 rs2227284 has been associated with higher ige levels in white, african-american, and hispanic asthma patients. in the multivariate analysis (see model 3), the same t allele was significantly associated with serum ige levels strengthening our hypothesis of an additional role for the il4, il13 cytokine pathway in the pathogenesis of aih. in conclusion, in agreement with the recurrent observation of high serum ige levels and presence of eosinophils, plasmocytes, and ige in the liver of aih-1 pediatric patients, we have identified novel associations with polymorphic variants of the il13 gene and the functionally related il4 receptor alpha chain which suggest ige-linked immune responses may be involved in the overall susceptibility to aih-1.

pediatric autoimmune hepatitis (aih) patients present hypergammaglobulinemia, periportal cd8+cytotoxic t cell infiltration, and cirrhosis. autoantibody profile defines aih types 1 and 2 in addition to strong association with hla-drb1. we previously detected increased ige serum levels and sought to compare clinical and histological features according to ige levels in aih (n=74, ages 114 years) patients. additionally, we typed 117 patients and 227 controls for functional polymorphisms of il4, il13, il5, and il4ra genes involved in ige switching and eosinophil maturation that might contribute to overall genetic susceptibility to aih. serum ige levels were high in 55% of aih-1, but only in 12% of aih-2 (p=0.003) patients. liver ige was present in 91.3% of aih-1 patients. the a alleles at both il13 rs20541 and il4ra rs1805011 were associated with aih-1 (p=0.024, or=1.55 and p<0.0001, or=2.15, resp.). furthermore, individuals presenting homozygosis for the a allele at il4ra rs1805011 and hla-drb103 and/or 13 allele had sixfold greater risk to develop the disease (or=14.00, p<0.001). the novel association suggests an additional role for ige-linked immune response genes in the pathogenesis of aih.

PMC4674601

pubmed-1044

both asthma and copd are airway diseases characterized by impaired airflow in the respiratory tract, chronic airway inflammation, as well as symptoms such as coughing, dyspnea, and wheezing. intensive studies focused on the pathogenesis of these conditions implicate, among others, the group of phospholipases a2, which possess enzymatic and nonenzymatic properties. this paper presents general information about phospholipases and details the current knowledge about particular phospholipases a2 involved in asthma and copd in human and animal models. the data regarding interactions between members of this superfamily is summarized, as well as the role of these enzymes in exacerbations of inflammatory diseases.. the main substrates for these enzymes are glycerophospholipids which contain glycerol with a saturated fatty acid in the sn-1 position and an unsaturated fatty acid in the sn-2 position. the phospholipases responsible for hydrolysis of glycerophospholipids are divided into two groups: acylhydrolases and phosphodiesterases. the first group comprises phospholipase a1 (pla1) and a2 (pla2), which hydrolyze the ester bond at the sn-1 and sn-2 positions, respectively. the second group comprises phospholipase c (plc) which cleaves the glycerol-phosphate bond, and phospholipase d (pld), which liberates phosphatidic acid and alcohol (figure 1). the structure, function, and catalytic mechanism of the enzyme determine its place within the phospholipase a2 superfamily, be it secretory pla2 (spla2), cytosolic pla2 (cpla2), ca-independent phospholipase a2 (ipla2), paf acetylhydrolases (paf-ah), or lysosomal pla2 (lpla2). the latest classification, based on genetic structure, divides these enzymes into groups from i to xvi (in each one, the enzyme is represented by a capital letter). table 2 includes information about the mechanism of action and function of particular subgroups of pla2s concerning physiology and pathophysiology. currently about 300 million people worldwide suffer from asthma, and in 2025, this number is expected to grow by another 100 million. asthma is defined according to the gina (global initiative for asthma) as a chronic airway inflammatory disease in which many cells and cellular elements are involved. chronic inflammation is a cause of bronchial hyperresponsiveness, leading to recurrent episodes of wheezing, dyspnea, chest tightness, and coughing, occurring particularly at night or dawn. this is usually accompanied by episodes of diffuse bronchial obstruction of varying severity, which often subside spontaneously or with treatment. according to gold (the global initiative for chronic obstructive lung diseases), copd is characterized by a progressive and poorly reversible airflow limitation caused by both small airway diseases (airway inflammation and destruction) and parenchymal destruction (loss of alveolar attachment and decrease of elastic recall). also, other extrapulmonary effects, such as weight loss, nutritional abnormalities, skeletal muscle dysfunction influence the severity of the disease. apart from the genetic background (hereditary alpha-1 antitrypsin deficiency) cigarette smoke is a crucial environmental factor in copd development; it is responsible for airway inflammation and further oxidant/antioxidant imbalance (oxidative stress) causing amplification of lung inflammation. an analysis of studies concerning the profile of pla2s expression in many experimental systems has revealed ambiguous results. many different inductors used for cells stimulation cause expression of various types of enzymes in the same cells. also, the presence of heterogeneous cells in experimental systems influences the expression of pla2s. mast cells, th2 lymphocytes, and eosinophils are the most important cellular components of asthma. it has been established that primary human lung mast cells constitutively express mrna for the ib, iia, iid, iie, iif, iii, v, x, xiia, and xiib spla2 groups and stimulation with anti-ige antibodies can induce their secretion. hence spla2 proteins are believed to belong to preformed mediators which are stored in mast cells granules. cells stimulation by anti-ige antibodies causes degranulation of mast cells, and spla2 appears in the early phase of allergic reaction. however exogenous hpla2v can activate eosinophils, inducing the liberation of arachidonic acid (aa) and ltc4 production. increased cpla2 phosphorylation and cpla2 activity was observed in eosinophils of asthmatics after allergen challenge. alveolar macrophages and neutrophils play a crucial role in the pathophysiology of copd [13, 14]. human macrophages express cpla2iva, ipla2via, and several spla2s (iia, iid, iie, iif, v, x, and xiia, but not group ib and iii enzymes). neutrophils stimulated in vitro by the tripeptide formyl-met-leu-phe (fmlp) demonstrate mrna and protein expression of spla2v and spla2x, where the spla2v protein is found in azurophilic and specific granules, and spla2x is found only in azurophilic granules. gib, giia, giid, giie, giif, giii, and gxii spla2s are undetectable. cell activation by fmlp or zymosan results in the release of gv but not gx spla2. the balf of patients with copd demonstrates a three- to fivefold higher activity of pla2s in comparison to a control balf but the protein level shows no difference. however, significantly greater levels of this enzyme are found in the balf of smokers compared with nonsmokers. among spla2s, a change of gly80ser in the spla2iid protein may be associated with body weight loss in patients suffering from copd. spla2iid can be also involved in control of inflammation by inhibition of cd4 +, cd8+t cells proliferation and induction of regulatory t cell differentiation. cigarette smoke extract (cse) can induce the production of cytosolic phospholipase a2 in human pulmonary microvascular endothelial cells cpla2 also participates in phosphodiesterase 4 signaling, whose inhibition attenuates neutrophilic inflammation in copd. the increased values of pla2vii in patients with long-standing pulmonary hypertension (severe complication in copd) are related to severe endothelial dysfunction. the spla2v-induced activation of neutrophils in contrast to eosinophils requires the presence and activation of cpla2. the inhibition of cpla2 may be more effective in diseases where neutrophils play a crucial role because they indirectly inhibit also the function of spla2. the proposed mechanism of action of phospholipases a2 (pla2s) in inflammatory diseases includes the liberation of arachidonic acid, generation of lysophospholipids, interaction between enzymes belonging to the a2 superfamily, surfactant degradation, release of cytokines, and the impact on immunological and inflammatory cells (dendritic cells, t-cells, and leukocytes). the enzymatic properties of pla2s refer to their phospholipase, lysophospholipase, transacylase, adiponutrin-like, triglyceride lipase, peroxiredoxin 6, and acyl-ceramide synthase activities. phospholipases a2 play a pivotal role in eicosanoid production because they hydrolyze the ester bond at the sn-2 position of the glycerophospholipid membrane, releasing arachidonic acid (aa) and lysophospholipids. it can act as a signaling molecule that regulates the activity of protein kinase c (pkc) and phospholipase c, influences ca concentration, and acts as an endogenous ligand for ppar receptors [28, 29]. aa is also a precursor of lipid inflammatory mediators (eicosanoids). in cyclooxygenase (cox) pathways, it is transformed to prostaglandins and thromboxane while in lipoxygenase (alox) pathways, it is converted to leukotrienes. these molecules are responsible for bronchial constriction, increased vessel permeability, and inflammatory cell recruitment. aa is also a substrate for resolvins and lipoxins (lxs) which have anti-inflammatory properties. lipoxins can block granulocyte chemotaxis, migration, degranulation, oxidative burst, cytokine-mediated signaling in eosinophils, and secretion of cytokines from bronchial epithelial cells. several independent studies have reported that significantly lower levels of lxs are observed in severe asthmatics compared to patients with nonsevere asthma [32, 33]. resolvins demonstrate endogenous anti-inflammatory, proresolving, antifibrotic, antiangiogenic, anti-infective, and antihyperalgesic activity. among cytosolic phospholipases a2, it has been well documented that cpla2iva (cpla2) plays an important role in eicosanoid production. in patients with inherited cpla2 deficiency (loss-of-function mutations in both cpla2 alleles), a widespread decrease in eicosanoid concentrations has been observed. s111p, r485h, and k651r mutations in pla2g4a gene are thought to play a crucial role in this condition. the functional consequences of localized mutations concerning cpla2 catalytic activity, ca recruitment, and affinity for the phospholipid membrane have been confirmed in vitro and in cell culture. in patients with severe asthma, the microsatellite fragments (t)n and (ca)n in the promoter region of cpla2 gene (pla2g4a) are shorter in comparison to healthy subjects. in addition, asthmatic patients with shorter microsatellite sequences demonstrate greater expression of cpla2 mrna, cpla2 protein, pge2 and 15-hete, but not ltc4. cpla2 participates in intracellular signaling, leading to allergen-induced production of inflammatory cytokines in the pbmc of asthmatics. identified increased expression of three cpla2s, including cpla2, cpla2, and cpla2 in induced sputum cells from subjects with asthma and exercise-induced bronchoconstriction. both cpla2 and cpla2 enzymes also participate in eicosanoids biosynthesis [40, 41]. increased cpla2 expression and subsequent pge2 production are present in the asthma phenotype. the therapeutic decision to inhibit cpla2 in asthmatics may be unclear when considering the role of pge2 in airway inflammation. there is some evidence that pge2 can act as bronchodilator, as well as an inhibitor of both allergen-induced bronchoconstriction and inflammatory mediators production. it should be noticed that pge2 acts through four different types of receptors (ep1, ep2, ep3, and ep4). changes in expression and combination of receptor subtypes actions may affect the action of pge2 giving it proinflammatory or bronchoprotective outcomes [4345]. the pleiotropic properties of pge2 make it difficult to establish the direct impact of pge2 deficiency which appears as a consequence of cpla2 inhibition. moreover, although cpla2 is a major enzyme, it is not the only one providing substrates for eicosanoids synthesis; hence it can not be excluded that other existing pathways can also perform this function. spla2s and arachidonic acid accumulate in the balf of asthmatics after allergen challenge [47, 48]. despite being specific to the sn-2 bond, spla2s play more of a supporting role in aa liberation. only spla2v and spla2x can efficiently interact and hydrolyze phospholipids from the outer surface of the cell membrane. in acute and chronic animal asthma models, a deficit of spla2x diminishes the features of asthma (eosinophilia, airway hyperresponsiveness to methacholine, airway remodeling, eicosanoids, and th2 cytokine production).. showed that the expression of spla2x predominates in the airway epithelium, and both spla2x and spla2iia are the main phospholipases produced by balf cells. only spla2x, not spla2iia, is correlated with asthma features such as lung function, recruitment of neutrophils in asthmatics. spla2x is responsible for production of cysteinyl leukotrienes (cyslts) which are proinflammatory in asthma and can be responsible for observable features of asthma. moreover, the level of prostaglandin e2 (pge2) is also connected with spla2x, which can be explained by the fact that spla2x increases activity of cpla2iv which in turn leads to production of pge2. these results are consistent with earlier studies by the same authors in which gene expression of spla2x and spla2 xii was demonstrated to be elevated in induced sputum cells of patients with asthma. the level of spla2x in induced sputum cells supernatant increased after exercise challenge among asthmatics with exercise-induced bronchoconstriction (eib). they demonstrated that recombinant spla2x caused aa release and rapid onset of cyslt synthesis in human eosinophils. it is possible that in a proinflammatory environment, that the spla2x propeptide is more rapidly converted to an active form that might influence the th1/th2 balance. other spla2s (iia, iid, iie) contain a heparin-binding domain which allows these enzymes to be taken into the cells and further directed to compartments enriched in aa and enzymes responsible for eicosanoid production. in spite of the fact that several studies have confirmed the participation of ipla2 and ipla2 in aa release and eicosanoid production, there is no data indicating that these enzymes play a direct role in asthma. by the induction of ca influx they can influence the translocation and activity of ca-dependent pla2s isoforms. group vii and viii paf-ah hydrolyze the short sn-2 residue of paf (platelet activating factor). as they lack activity against membrane phospholipids with long-chain sn-2 residues, they are unable to release arachidonic acid from membrane phospholipids. they exhibit pro- and anti-inflammatory properties. on the one hand, they inactivate paf the proinflammatory mediator by hydrolyzing it to inactive acetate and lysolipid but on the other hand, they assist in the generation of lysophospholipids and fatty acid hydroperoxides. have established that asthmatics have a decreased level of paf-ah, and that asthma incidence and severity correlate to paf-ah deficiency in the japanese population. also some paf-ah gene polymorphisms (ile198thr and ala379val variants) are known to be a risk factors for developing atopy and asthma. despite positive effects in animal models, administration of human recombinant paf-ah (rpaf-ah) does not reduce both early and late phase of asthmatic response in mild asthmatics challenged with allergens. they are a precursor of platelet activating factor (paf) and lysophosphatidic acid (lpa). lpa is involved in cell adhesion, motility, and survival. in animal models, lysophospholipid receptors are required for proper development and function of the cardiovascular, immune, respiratory, and reproductive systems. lysophosphocholine and polyunsaturated fatty acids, including aa, can activate cpla2 and 5-lipoxygenase by increasing ca and inducing cpla2 phosphorylation, which then leads to ltb4 biosynthesis. lysophospholipid has nonspecific cytotoxic effect that depends on its concentration (critical micelle concentration). at concentration below their unspecific cytotoxic effect lysophospholipids secretory phospholipases degrade phosphatidylcholine (pc), the main component of the surfactant responsible for maintenance of small airway patency. the generation of lysophospholipids and free fatty acids by spla2-mediated pc hydrolysis has been implicated in small airway closure in asthm. spla2 action is enhanced by eosinophilic lysophospholipases that use lysophospholipids as a substrate [6568]. the presence of ipla2 proteins in alveolar macrophages suggests that they might play a role in surfactant degradation. it should be mentioned that some pla2s are involved in antibacterial defense thanks to their ability to hydrolyze the lipids of the bacterial membrane. spla2s iia, v, x, and ib demonstrate bactericidal activity against gram-positive pathogens but the most effective is spla2iia. apart from their enzymatic activity, they can act as extracellular mediators involved in chemotaxis, cytokine production, and induction of cellular signaling pathways. mammalian n-type receptors have been identified for spla2ib and iia, x and m-type receptors for spla2ib, iia, iie, iif, v, and x. n-type like receptors are present in lungs whereas m-type receptors have been identified in lung and myeloid cells. spla2s are stored in intrinsic mast cell granulates and are released after cell activation by ige and non-ige stimuli. after exocytosis, they can act in both autocrine and paracrine manners. by interacting with heparan sulphate proteoglycans and m-type receptors, they can induce pgd2 and ltc4 production and stimulate the subsequent degranulation of mast cells. granata et al. delivered an evidence that spla2s can act as proinflammatory connections between mast cells and macrophages in the airway. they suggest that the activation of macrophages by spla2s leads to production of proinflammatory cytokines which sustain the inflammatory and immune response, chemokines responsible for recruitment of monocytes and neutrophils, as well as destructive lysosomal enzymes, no, pge2, and metalloproteinases connected with airway remodeling. they influence the migration and adhesion of neutrophils as well as the release of elastase [76, 77]. in eosinophils, spla2 ia and iia stimulate -glucuronidase release and cytokine production (il-6, il-8) by aa and lysophospholipid generation, by interaction with membrane peptidoglycans via their heparin-binding site, and through binding with specific m-type or n-type receptors. the functions of spla2s receptors require further studies because there are still some missing or unequivocal information. spla2 and cpla2 interaction is quite well documented [79, 80]. the effect of group iia and v pla2s on h2o2-induced aa release is dependent upon the presence of cpla2 and the activation of pkc and erk1/2 in murine mesangial cells. spla2 activation induces production of bronchoconstrictor cysteinyl leukotrienes and suppresses cpla2 expression and the subsequent production of bronchodilator pge2. recently it has been established that in human eosinophils, spla2 initiates ser(505) phosphorylation of cpla2 and stimulates leukotriene synthesis through involvement of p38 and jnk mapk, cpla2, and 5-lipoxygenase activation, which may be an important process also in airways of asthmatics. also in bone-marrow-derived mast cells, spla2 mediates the selective release of aa by binding m-type receptors and then inducing mapk signaling pathways that lead to cpla2 activation. another aspect of phospholipases and the asthma/copd relationship is the participation of these enzymes in the pathogenetic mechanisms of disease exacerbation caused by bacterial factors. this role relates to increased expression of selective pla2s, modulation of their activity and involvement in cellular signaling. elevated cpla2 expression was found in primary human lung macrophages after lps treatment [15, 83]. lps stimulates expression of cpla2 and cox-2 in macrophages, leading to increased production of aa and pge2. lps treatment was also followed by rapid changes in cpla2 phosphorylation [84, 85]. the lps-phosphorylated form of cpla2 is present in induction of inos and tnf- expression [87, 88] and metalloproteinase production. selective spla2 contributes to lps-intracellular signaling in liver macrophages [84, 90, 91]. in mice with lps-induced lung inflammation, the expression of spla2x remains the same before and after treatment. in this study, increased expression of spla2iid and spla2v has been observed, as well as decreased spla2iie and spla2iif levels in the lungs. in rats, spla2iia was seen to have the highest expression after lps administration. in mspla2x mice with knock-in of human spla2x (hspla2x), allergen-induced inflammatory cell recruitment into airways (eosinophils) the application of specific hspla2x inhibitor (ro 061606) significantly attenuates airway inflammation symptoms, mucous secretion, and hyperresponsiveness. in spla2v knock-out mice, spla2v has been proven to play a role in the development of lung injury and neutrophilic inflammation after bacterial stimulus (lps). in addition, spla2v was seen to be connected with regulation of cell migration and generation of airway hyperresponsiveness after ovalbumin challenge. in a murine allergen-challenged asthma model, administration of rpaf-ah is effective in blocking late-phase pulmonary inflammation. taking into consideration the severe asthma phenotype, the difficulties related to obtain asthma control utilizing currently available treatments and the progressive character of inflammation in patients with copd that increases the morbidity, it seems reasonable to study the differences in pathogenesis of the diseases conditions, especially in relation to possible new therapies and drugs. the superfamily of these enzymes contains approximately 30 members that have similar and isoform-specific properties. the inhibitors of particular pla2s show the positive effect in treatment of inflammatory diseases and they inhibit allergic reaction in vitro. the cpla2 that evolved together with receptors for eicosanoids, present only in vertebrate, seems to play crucial role in course of inflammation. its inhibitors such as efipladib and ecopladib successfully inhibit inflammation in rheumatoid arthritis and osteoporosis. the inhaled form of cpla2 inhibitor, the pla-950, is considered as potential new treatment in asthmatic patients as well as other pla2s can influence the function of cpla2 or have similar effects. the studies and analysis of protein involved in regulation of particular spla2 involved in inflammatory diseases could result in finding new target for drugs. since 1980, it has been known that glucocorticoids (gcs) can inhibit the activity of pla2. the underlying mechanism concerns induction of mrna and protein expression of lipocortin 1 (annexin 1) and the pla2 inhibitory protein [101104]. the structure, function, and mechanism behind the anti-inflammatory action of annexin 1 have been well described elsewhere. glucocorticoids can also suppress the production of spla2iia by blocking mrna synthesis and posttranslational expression in rats. it is questionable whether therapeutic doses of glucocorticoids have sufficient power to satisfactorily inhibit the activity of pla2.. demonstrated that topical gcs at therapeutically relevant concentration (10 m) inhibit the spontaneous activity of cpla2 in the range of 8.617.3% depending on the type of gc. they suggest also that this effect may appear as a consequence of a decreased ability to binding the receptors by gcs present in airway in subtherapeutical doses. although it has been established that treatment with gcs can indirectly inhibit cpla2 and aa-derivates production resistance to gcs in patients with asthma and copd could also be problematic. moreover the gcs have systemic effects and long-term application can cause the side effects. the approach to attack the inflammation process more precisely and downstream (inhibition the eicosanoids production) seems to be rationale. another aspect regarding annexin 1 and pla2s is their cell-specific manner of interactions.. demonstrated that cleavage of annexin 1 causes phosphorylation of cpla2 during mast-cell activation. hence it is not clear whether gcs-induced expression of annexin always leads to inhibition of cpla2 activity. as previous studies indicate that gcs can stimulate expression of cpla2 in amnion fibroblast it can not be excluded that in some specific circumstances gcs may directly induce cpla2 [109, 110]. previous studies confirm the involvement of phospholipases a2 in asthma and copd although there are some gaps relating to the roles of specific enzymes. the diagnostic problems concerning the overlap syndrome that shares the features of asthma and copd demand further studies on the pathogenesis of these diseases. the phospholipases a2 through their involvement in the course of inflammation seem to be important aspects of this investigation. as they demonstrate pro- and anti-inflammatory properties, a detailed analysis of their role should act as a focus for further studies intended to bring new insights into the pathogenesis of the diseases and identify targets for new drugs. data from studies focused on role of pla2s in inflammatory diseases facilitate the understanding of molecular aspects of inflammation. it can be observed that cpla2 plays a main role in eicosanoid production and other pla2s may influence their activity thanks to enzymatic properties or act as regulators of inflammation through their nonenzymatic activity. the pleiotropic properties of single phospholipase and their differential expression in many cells confirm that this is well-organized network of interaction, and further studies focused on this aspect may provide more useful knowledge. a comparison of how this network works in different inflammatory diseases, as well as in healthy subjects may indicate a key molecule, whose activity or presence will be a diagnostic parameter or whose activation or inhibition will have therapeutic value. asthma and copd are heterogeneous diseases and current treatment gives only the possibility to obtain the phenotype of well-controlled diseases. analysis of data regarding the involvement of pla2s in course of diseases arises the concept to use combined therapy rather than the treatment based on inhibition of one of them. the results from preclinical studies of cpla2 inhibitors are promising but clinical trials will give concrete knowledge about the effectiveness and possible side effects.

the increased morbidity, mortality, and ineffective treatment associated with the pathogenesis of chronic inflammatory diseases such as asthma and chronic obstructive pulmonary disease (copd) have generated much research interest. the key role is played by phospholipases from the a2 superfamily: enzymes which are involved in inflammation through participation in pro- and anti-inflammatory mediators production and have an impact on many immunocompetent cells. the 30 members of the a2 superfamily are divided into 7 groups. their role in asthma and copd has been studied in vitro and in vivo (animal models, cell cultures, and patients). this paper contains complete and updated information about the involvement of particular enzymes in the etiology and course of asthma and copd.

PMC3780701

pubmed-1045

signal transducing adaptor proteins are a group of intracellular and transmembrane molecules which are crucial supplementary factors of signaling pathways. they mediate interactions between different molecules and contribute to the formation of signaling complexes. adaptor proteins lack enzymatic activity and interaction domains enable them to connect with other molecules (e.g., proteins, lipids). src-like adaptor protein 1 (slap-1) was cloned in a yeast two-hybrid screen with the cytoplasmic domain of the receptor tyrosine kinase ephrin type-a receptor 2 as decoy [1, 2]. slap proteins are not identical in size; slap-1 (or often quoted as slap) contains 276 amino acids while slap-2 consists of 261 amino acids (figure 1). src protein tyrosine kinases (ptks) are protooncogenes that play a role in cell proliferation, survival, and morphology. unlike src ptks, in addition to the myristoylated amino-terminal and sh domains, slap family members contain unique carboxy-terminal sequences as well. slap-1 has a longer carboxy-tail than slap-2, but the n-terminal is longer in slap-2. myristoylated part of the slap promotes the association with membranes, while isoforms without the myristoylated n-terminal are located in the nucleus (figure 1). human slap is coded by a 64 kb intron of the thyroglobulin gene, on chromosome 8q24.23 in the candidate territory for a recessive demyelinating neuropathy. sequence analysis could not find any mutations suggesting that this gene is not responsible for the disease. sh domains are the most similar parts of the two slap molecules, in which the sequence homology is 59%, while the n-terminals are the most different parts; they have only 19% identity. this isoform contains only 210 amino acids due to the deletion of 50 bp from exon 6, which results an alternative reading frame. although expression of slap-1 and slap-2 mrnas has been most extensively studied in lymphocytes, they are also expressed by numerous human and murine tissues and cell lines [1, 2, 712] (table 1). several proteins have been reported to interact with slap-1 and slap-2 [5, 8, 9, 1315] (figure 2). slaps are involved in a broad range of cellular processes, for example, lymphocyte development, neuronal excitotoxicity and platelet activation. slap molecules may participate in several pathological conditions of the immune system as well. in the present review, we will discuss the role of both slap proteins in different cell types and overview our current understanding regarding their relevance in pathological conditions. tcr consists of a ligand binding heterodimer and the cd3 complex that includes the and heterodimers and the homodimer. the expression of the -chains is about the 10% of the other subunits of the tcr complex. slap-1 may interact with many molecules involved in the tcr signal transduction (zap-70, syk, lat, cd3 -chain, vav, and lck) through the sh2 domain [9, 16]. slap-1 reduces the production of il-2 and the transcription of nfatc1 and ap-1, thereafter functions as a negative regulator of the tcr signaling; both sh2 and sh3 domains are necessary for this effect. however, upon ionomycin or pma activation of lymphocytes, these inhibitory effects are absent suggesting that slap-1 regulates the proximal part of the tcr pathway. slap may associate with the n-terminal of the e3 ubiquitin ligase c-cbl in a tyrosine phosphorylation independent way. the simultaneous expression of slap-1 and c-cbl promotes the ubiquitination and degradation of the -chain, consequently enhancing the recycling and preventing the accumulation of the receptor complexes. by contrast, similarly to slap/lymphocytes, c-cbl/lymphocytes overexpress the -chain due to its abolished degradation. for successful operation, slap-1 requires the phosphorylation of the cytoplasmic domains of the tcr -chains and the activation of lck, but not of zap70. it has been shown that the phosphorylated proportion of the -chains is slightly traceable in lck/lymphocytes [20, 21]. slap colocalizes with early endosomes according to confocal microscopy images (figure 3). it is noteworthy that downregulation of -chain of t-cells has been observed in many pathological conditions including rheumatoid arthritis (ra), systemic lupus erythematosus (sle), human immunodeficiency virus (hiv) infection, and various cancers [2228]. the fate of the early lymphocytes depends on the tcr-mediated signals: both too strong and too week signals through the tcr lead to cell death (during positive and negative selections, resp.). it is expressed at low levels in cd4 cd8 cells and at high levels in cd4+cd8+thymocytes. slap as a regulator of the tcr expression plays a pivotal role in the downregulation of tcr complexes of the developing lymphocytes. moreover, the apoptosis of zap70/cells was inhibited in the absence of slap. it has been reported that the proline rich-sequence (prs) of cd3 act together with slap in the regulation of tcr expression in cd4+cd8+thymocytes. cd3 prs deficient cells were unable to degrade the -chain. in double positive thymocytes, the chains of the tcr complex are constitutively ubiquitinated, but the ubiquitination is absent in mature cells. it has been shown that cd3 prs, lck, c-cbl, and slap are required for the ubiquitination and degradation of the -chains. in the absence of ubiquitination, both the lysosomal sequestration and degradation are failed, and tcr chains are upregulated in cd4+cd8+lymphocytes. in addition, modified tcr complex ubiquitination influences the formation of the immunological synapse and alters the selection of the immature cells. the lack of slap increases the avidity of the tcr which leads to the negative selection of antigen specific cd8+cells. all these data suggest that slap plays a major role in the tcr repertoire configuration. slap is associated with c-cbl in b lymphocytes, leading to bcr recycling (figure 4). slap deficiency increases the bcr levels of immature b cells in hel-specific md4- transgenic mice, which is a frequently used model to study nave b lymphocytes. in this model the upregulated receptor complex levels lead to increased signal transduction. slap deficient mice have an increased number of splenic b cells, but the surface expression of bcr and igm of mature lymphocytes is decreased. furthermore, the activation induced calcium flux is diminished in slap ko b cells. in virtue of the previous data slap regulates the level of bcr s which is essential for the adequate development and function of b cells. slap-2 has a negative regulatory role on the antigen receptor signaling of t and b lymphocytes. the overexpression of slap-1 and slap-2 inhibits the upregulation of cd69 after antigen receptor cross-linking. slap-2 suppresses the antigen binding induced calcium influx in t (jurkat) and b (bjab) cell lines. slap-2 reduces the cd69 expression in jurkat cells (61%) more significantly than in bjab cells (28%). slap-2 is associated with ubiquitin ligase c-cbl similarly to slap-1, deletion of the carboxy-terminal of slap-2 was reported to inhibit this connection. in activated jurkat cells slap-2 binds to c-cbl, zap-70, and cd3 in a phosphorylation independent manner. the coexpression of slap-2 and zap-70 or syk in t-cell lines lead to the degradation of both kinases. thus, slap-2 induces the c-cbl dependent degradation of tyrosine kinases and downregulates cd3 expression. slap-2 is expressed in human monocytes and bone marrow cells [1, 35], but not in csf1 independent monocyte cell lines such as raw264.7. it was shown that slap-2 may bind to both c-fms and c-cbl, and several domains of slap-2 are involved in this interaction (figure 5). the overexpression of slap-2 in murine bone marrow reduced the m-csf-induced tyrosine phosphorylation. slap-2 downregulates the c-fms signaling through a c-cbl dependent internalization and degradation of the csf-1r, providing a negative feedback of the m-csf pathway. in addition, c-fms stimulation induces the phosphorylation of the serine rich n-terminal domain of the slap-2 by a jnk dependent pathway. the activation-induced gm-csfr downregulation is attenuated in slap-1 and slap-2 deficient bone marrow dendritic cells (bm-dc), which is associated with enhanced map/erk and akt pathways upon gm-csf stimulation. the inhibited activation through gm-csfr impairs the bone marrow derived dendritic cell maturation. slap-1 and slap-2 deficient bm-dc cells produce less il-12 and tnf- upon lipopolysaccharide (lps) stimulation and induce significantly less ifn- secretion of t-lymphocytes than the wild type cells. these data suggest that slap proteins are necessary for monocyte and dendritic cell maturation and activation. slap has a prominent role in the regulation of intracellular signal transduction in mast cells. slap-specific small interfering rnas inhibit the effect of dexamethasone on the phosphorylation of plc, lat, syk, and erk. actinomycin d inhibits the transcription of slap following dexamethason treatment, suggesting that the upregulation for slap-1 upon glucocorticoid treatment occurs at the transcriptional level. slap-1 plays a role in the negative regulation of antigen-stimulated mast cells as well. upon antigen stimulation of the rbl-2h3 mast cell line, elevated transcription of the sla gene and upregulation of the slap-1 (but not slap-2) protein were reported. an increased amount of slap-1 was detected after 60 minutes stimulation and it reached the maximum after 2-3 hours. by contrast, after silencing of slap, increased il-3 and mcp-1 production was detected. inhibiting the development and activation of osteoclasts is currently the gold standard therapeutic strategy in this disease. although today several antiosteoporotic drugs are widely used in the clinical practice, the effect of these medications on increasing bone density and strength is moderate. there is an inverse correlation between both slap-1 and slap-2 and the tartrate-resistant acid phosphatase (osteoclastogenesis marker) mrna expression. the level of osteoclast-specific protein mrnas (e.g., catepsin k and mmp-9) are elevated in the slap-1/preosteoclasts. slap-1 has an inhibitory effect on the map kinase pathway which is initiated with the binding of m-csf to its receptor c-fms. this receptor is a tyrosine kinase transmembrane protein which accumulates in lipid rafts where it associates with slap-1. the lack of slap enhances osteoclastogenesis without changing the resorptive function of the individual cells. in addition, slap-1 deficiency increases the apoptosis of the mature polykariotic osteoclasts without altering the viability of the precursors. according to our current understanding, slap-1 has a regulatory effect on osteoclastogenesis and mature cell survival through the m-csf pathway. slap-2 is expressed in human platelets and may associate with syk, c-cbl, and lat. after its activation, slap-2 promotes syk and c-cbl to approach their substrates. slap-2 inhibits glycoprotein vi (gpvi) initiated signal transduction of platelets through the connection with c-cbl. this inhibitory effect on thrombocyte activation is similar to those described previously in lymphocytes [1, 5]. slap may also associate with platelet derived growth factor receptor (pdgfr) in nih3t3 mouse embryonic fibroblast cell line. overexpression of slap in nih3t3 cells inhibits pdgf-induced mitogenesis suggesting that slap is a negative regulator of growth factor initiated signaling. although in embryonic rat telencephalon sections slap-1 mrna is absent in migrating neurons, it is highly and selectively expressed in neurons which have reached their final location. pyramid cells are typically located in the deeper layers of the cortex, and they have connection with the subcortical areas. it is not yet clear whether slap-1 plays a role in the axon guidance during development but apparently has a remarkable expression. western blot analysis and immunolabeling of rat brain extract showed that slap-1 is located in the postsynaptic membrane. slap-1 has an association with ephas and nmdars have a connection with ephbs [44, 45]. ephb may excite the enlistment of ephas and promote the recruitment of slap-1 and nmdars. despite the analogous localization, slap-1 does not affect the baseline activity of nmdars through a src-dependent stimulation of the receptors. slap-1 may have a role in the negative feedback which regulates the number of the nmdars and prevent excitotoxicity. this effect of slap-1 is based on the proteasomal degradation of redundant nmdars in neurons. the described role of slap in neurons seems to be essential for the adequate neuronal functions. rheumatoid arthritis (ra) is a common autoimmune disease that is associated with progressive disability and systemic complications. symmetric synovial inflammation of multiple joints, especially the small joints of the hands and the feet, is characteristic for the disease. the ongoing inflammation leads to cartilage destruction, bone erosions, and subsequent joint deformities. although the current treatment strategy, especially the use of biologicals, improved largely the outcome of the disease, still only a small portion of the patients are in sustained remission and systemic complications (including cardiovascular risk) still represent a significant challenge. tnf- plays an essential role in the pathogenesis of ra through promotion of angiogenesis, suppression of regulatory t-cell activation, and cytokine and chemokine expression. according to the recently published data of our research group, tnf- treatment downregulates the expression of -chain of cd4 t-lymphocytes reversibly and selectively in a dose dependent way. tnf- induces the expression of slap which promotes the proteasomal but not the lysosomal degradation of the -chain. tnf- treatment does not alter the slap mrna level, suggesting that tnf- controls slap activity through mirna mediated posttranscriptional silencing. cd4+t-lymphocytes isolated from ra patients expressed more than 2-fold higher slap levels than the t-cells of healthy donors. tnf- treatment enhances the expression of slap in the cd4+t-lymphocytes of healthy donors and dmard treated ra patients but does not alter the expression of cd4+t-cells isolated from biological dmard (etanercept, certolizumab pegol) treated patients. a spontaneous mutation in zap70 protein uncoupled proximal tcr signal transduction and led to severe symmetrical arthritis in skg mice upon exposure to zymosan. according to recently published data, slap deficiency dramatically reduced both the incidence and severity of zymosan-induced chronic autoimmune arthritis in skg mice. the protective role of slap deficiency was associated with the increased number of regulatory t-cells and decreased amount of th17 cells. slap expression is increased in several cancers including chronic myeloid leukemia (cml), chronic lymphocytic leukemia (cll), and prostate cancer. by contrast, its expression is decreased in acute myeloid leukemia (aml), myeloma, and colon cancer. furthermore, slap is associated with several oncogenic signaling pathways. it was recently reported that the transmembrane protooncogene c-kit is degraded through a slap dependent pathway. slap binds to the wt c-kit and initiates its ubiquitylation and degradation in the proteasome. by contrast, slap does not have a similar regulatory effect on the oncogenic c-kit variant (c-kit d816v). oncogenic c-kit associates with slap and phosphorylates it on three different tyrosines (y120, y258, and y273); the phosphorylated forms of slap do not alter the downstream signaling of the mutant c-kit. these data suggest that slap regulates wt c-kit signaling, but the oncogenic variant escapes from this negative feedback regulation. the fms like tyrosine kinase (flt3) is a receptor tyrosine kinase, which is predominantly expressed in hematopoietic progenitor cells. after ligand stimulation, slap colocalizes with the flt3-itd and targets it for c-cbl dependent ubiquitylation and proteasomal degradation. about 30% of patients with aml have mutation in the flt3 gene and gain of function mutations contribute to the initiation of aml. the expression of slap is increased in patients with acute promyelocytic leukemia (apl) carrying flt3-itd mutation as compared to the flt3-wt. fli-1 is a transcription factor, a member of the e26 transformation-specific (ets) protein family. furthermore, the fli-1 locus is an integration site for the friend murine leukemia virus, which induces erythroleukaemia in responsive mice. slap protein and mrna levels are overexpressed in fli-1 transformed erythroblasts. slap binds to both the phosphorylated and unphosphorylated forms of the erythropoietin receptor (epor). slap expression prevents the epo-induced differentiation, whose effect is associated with the inhibition of stat5 activation and bcl-x upregulation., slap is expressed in colon epithelium, but it is significantly downregulated in colorectal tumors. interestingly, silencing of slap promotes tumor progression, while overexpression inhibits tumor growth and invasiveness. slap promotes the destabilization of the src substrate ephrin type-a receptor 2 (epha2) in the intestinal cells. epha2 plays a critical role in the regulation of several intracellular signal pathways which mediate cell migration, invasion, and angiogenesis. the inhibitory effect of slap appears to be independent from c-cbl but has an association with the ubiquitination factor ube4a and with the ptyr594-epha2. slap proteins are expressed in a variety of cell types which indicates a conserved function of these proteins. both slap-1 and slap-2 have a prominent role in the negative regulation of several membrane bound receptors and receptor tyrosine kinases, thereafter slaps play a central role in the regulation of intracellular signal transduction and cell reactivity. the proper function of slaps is necessary for immunoreceptor repertoire configuration and helps to avoid uncontrolled cell activation, proliferation, and migration. slap molecules are involved in the ubiquitination of proteins, which may lead to proteasomal degradation. selective regulation of slap molecules in different cell types may allow the fine control of cell activation and differentiation. exploring the precise role of slap proteins will contribute to the understanding of many yet unknown physiological regulatory processes. in addition, tissue specific targeting of slap may provide valuable therapeutic approaches in diverse diseases including ra, osteoporosis, immunodeficiency, and different cancers.

although src-like adaptor proteins (slap-1 and slap-2) were mainly studied in lymphocytes, where they act as negative regulators and provide fine control of receptor signaling, recently, several other functions of these proteins were discovered. in addition to the well-characterized immunoregulatory functions, slap proteins appear to have an essential role in the pathogenesis of type i hypersensitivity, osteoporosis, and numerous malignant diseases. both adaptor proteins are expressed in a wide variety of tissues, where they have mostly inhibitory effects on multiple intracellular signaling pathways. in this review, we summarize the diverse effects of slap proteins.

PMC4539169

pubmed-1046

a 50-year-old female occupational therapist with a history of laparoscopic anterior resection 4 years previously for a t1 n0 m0 recto-sigmoid adenocarcinoma was found to have an elevated serum carcinoembryonic antigen (cea) of 415.0 g/l on surveillance blood testing. a computed tomography (ct) scan demonstrated a large mass in the left lobe of the liver involving the left and middle hepatic veins. core biopsies demonstrated moderately differentiated adenocarcinoma, positive for ck20, cea, and cdx2 and negative for ck7, ttf-1, and wt-1, consistent with metastatic colorectal cancer. since the liver lesion was potentially operable, a f-fluorodeoxyglucose-positron emission tomography (pet)/ct scan was arranged to check for occult extra-hepatic metastases. the pet/ct demonstrated a left iliac bone metastasis, retroperitoneal lymphadenopathy and a f-fluorodeoxyglucose (fdg)-avid thyroid nodule, reported as suspicious of malignancy (figure 1). given the presence of extra-hepatic metastases, the patient was treated with 6 months of palliative oxaliplatin and modified de gramont chemotherapy. although the possibility of a primary thyroid cancer was considered, in the context of inoperable metastatic colorectal cancer, further investigation of the thyroid abnormality was not considered appropriate at that time. ct performed upon completion of treatment demonstrated partial response to chemotherapy: reduction of the liver metastasis, resolution of the retroperitoneal lymphadenopathy, and sclerosis of the right iliac bone metastasis. after 3 months, she underwent left hepatectomy and cholecystectomy, followed by radiotherapy to the left ilium 2 months later. after 2 years of follow-up, a ct scan demonstrated progression of the thyroid nodule and serum cea had risen to 2.2 ultrasound-guided fine needle aspiration of the thyroid nodule was graded thy5 with glandular malignant cells, which were negative for ttf1 and positive for cdx2 by immunocytochemistry. this was consistent with metastatic colorectal adenocarcinoma, and, given that other disease sites had not changed over 2 years, the patient was offered a right hemi-thyroidectomy. the patient is under ct and cea surveillance and remains in remission 10 months later with undetectable serum cea levels. although benign and malignant incidentalomas are rare in routine clinical practice,1 some clinicians have claimed that widespread use of whole-body imaging examinations has led to increased detection of thyroid incidentalomas2 two systematic reviews (55,160 and 125,754 subjects), analyzing studies using fdg/pet for various indications and patient populations, identified an incidence of focal fdg-avid thyroid lesions of 1%1.6%.3,4 malignancy was detected in 33%34.8% of those with follow-up data available, of whom 81.3%83% had papillary thyroid cancer (ptc), in keeping with the overall proportion of thyroid cancers that are ptcs. of two studies reporting focal fdg-avid thyroid incidentalomas in patients with known or suspected nonthyroid malignancy, an incidence of 2.0%3.9% was reported, with 34.7%41.7% of these malignant lesions.5,6 in kim et al s study,6 all incidentalomas operated upon were identified as ptcs. there has been a debate over the need to treat all ptcs. despite the threefold increase in the reported incidence of ptc over the last 3 decades,7 the death rate has remained stable.8 this is supported by the studies of active surveillance, which has not been associated with increased morbidity,9 and evidence of a significant burden of clinically occult ptc at autopsy.10 follicular, medullary, and anaplastic thyroid cancers carry worse prognoses and are considered to require intervention unless the patient has a very poor prognosis from the known nonthyroid malignancy. a retrospective study of 47,813 thyroidectomies performed for various indications, identified thyroid metastases in 0.13% of samples.11 similar large data sets are not available for thyroidectomies performed only in patients with a known nonthyroid malignancy. moreover, patients with thyroid metastases will typically have advanced malignancy and not proceed to thyroidectomy, so such data would underestimate the true incidence. in an autopsy series, the incidence was 1.9%24% in patients with known malignancy.12 cohort studies have suggested an association with renal cancer,13 although autopsy series indicate they are most commonly derived from lung, breast, and melanoma.12 this case emphasizes the importance of considering carefully whether or not to intervene when an incidental fdg-avid thyroid nodule is detected in a patient with metastatic cancer. appropriate investigation and management depend on the disease stage, patient s performance status, prognosis, and treatment plan for the known nonthyroid cancer, and whether or not the thyroid abnormality is symptomatic. if there are symptoms, ultrasound and fine needle aspiration for tissue diagnosis is warranted, and multidisciplinary team discussion involving an endocrine surgeon prior to considering further investigation and treatment. for asymptomatic patients, further investigation of fdg-avid thyroid lesions is only appropriate where demonstrating either metastatic disease to the thyroid or a more aggressive thyroid cancer will alter management strategy for that individual patient. the patient in our report had inoperable metastatic disease, so the incidentaloma was not considered likely to affect clinical outcome. however, after the patient underwent potentially curative liver surgery and high-dose radiotherapy, and completed follow-up for 2 years, it became appropriate to further assess the thyroid lesion. one study recruited 43 patients with metastases to the thyroid gland and reported a longer survival (34 vs 25 months) for those undergoing surgery than in subjects treated nonsurgically.14 this was not replicated in another nonrandomized study of 36 patients with metastasis to the thyroid in which 21 patients received surgery versus 15 that did not.11 there was no statistical difference in overall survival despite the worse clinical situation of the nonsurgical cohort. therefore with such weak evidence available, in patients suitable for intervention for their incidentaloma, surgery is generally the treatment of choice for solitary thyroid metastasis and for known thyroid metastasis in patients where other extrathyroid metastases are resectable.13 patients must be counseled regarding the 1%6% risk of surgical complications associated with thyroidectomy, including vocal cord paralysis, hypothyroidism, and hypoparathyroidism.2 in summary, fdg-avid thyroid nodules occur relatively frequently. on finding thyroid incidentalomas in patients with a history of cancer, metastasis should be considered, even though the majority of these lesions will be benign or ptc. incidentalomas must be seen in the context of the prognosis and treatment plan for the known malignancy.

the routine use of 18f-fluorodeoxyglucose-positron emission tomography (pet)/computed tomography scans for staging and assessment of treatment response for cancer has resulted in a large number of thyroid abnormalities being detected as incidental findings (incidentalomas). since most pet/ct scans are performed in the setting of a known nonthyroid malignancy, the need for incidentalomas to be further investigated and managed depends on the stage, prognosis, and current treatment plan for the known malignancy. we present a case describing the management of an incidental f-fluorodeoxyglucose-avid thyroid nodule detected in a patient with known metastatic colorectal cancer. on the basis of this case, we discuss the management of incidental pet-detected thyroid nodules in patients with metastatic cancer. thyroid incidentalomas must be seen in the context of the prognosis and treatment plan for the known malignancy.

PMC4610890

pubmed-1047

myoepithelioma is a benign tumor that can originate from any secretory system throughout the body. in the salivary gland, myoepithelioma is rare, accounting for 1% of all salivary gland tumors. although myoepithelioma of the salivary gland originates most frequently in the parotid gland, myoepithelioma of the accessory parotid gland (apg) is extremely rare, and to date, only 5 cases have been reported in the english literature [2, 3, 4, 5]. because the clinicopathological and mri findings of myoepithelioma of the apg have not yet been fully described, and given the rarity of this condition, we hereby describe the clinicopathological and mri findings of an epithelioid myoepithelioma of the apg that was treated in our hospital. a 31-year-old woman presented with a 5-year history of a slowly enlarging left mid-cheek mass in the pre-parotid region. upon examination, a mobile non-tender and smooth-surfaced mass measuring 20 mm in the greatest dimension was noted in the left pre-parotid region. an unenhanced ct of the neck confirmed a well-circumscribed and homogenous mass measuring 18 10 mm and located anterior to the left main parotid gland and on the surface of the masseter muscle. this lobulated mass demonstrated isointensity and hyperintensity relative to the muscle on t1- and t2-weighted mri images (wis), respectively, and homogeneous enhancement on contrast-enhanced t1-wis (fig. c). a time-signal intensity curve (tic) generated from a dynamic mri study revealed a gradual enhancement pattern (fig. 1d). on t2-wis, the mass periphery was surrounded by hypointensity that was suggestive of a fibrous capsule. the tumor was most likely considered a pleomorphic adenoma (pa), given the clinical presentation and mri findings. the mass and the surrounding salivary tissue were completely separated from the main parotid gland and connected to the parotid duct via a ductule. all facial nerve branches and the parotid duct were successfully preserved, and postoperative complications such as facial paralysis and salivary fistula were not observed. grossly, the tumor was well encapsulated, solid, and lobular (fig. microscopically, the tumor primarily comprised cells with round nuclei and a few cells with oval and slightly spindle-shaped nuclei. the neoplastic cells were arranged in an epithelial and mostly lattice-like structure with hyalinous and mucinous stroma. 2c), cam5.2 (cytokeratin stain), s-100 protein, smooth muscle actin (sma), cytokeratin14, and ae1/ae3 (pan-keratin stain), as well as negativity for carcinoembryonic antigen. based on these results, the final histopathological diagnosis of the tumor was epithelioid myoepithelioma. pa is reportedly the most common subtype of benign apg tumors; in contrast, myoepithelioma represents an extremely rare apg tumor pathology. only 5 cases of myoepithelioma of the apg have been reported in the english literature. kawashima et al. reported a case in a 34-year-old woman, isogai et al. reported a case of plasmacytoid myoepithelioma of the apg in a 47-year-old woman, and sun et al. reported a case in a 41-year-old man and one in a 22-year-old woman; recently, xie et al. described the fifth case in a 65-year-old man who was treated via an endoscopic approach. there have been only a few reports on the imaging findings of myoepithelioma of the parotid gland. according to wang et al., myoepithelioma of the parotid gland is characterized by a well-defined and smooth or lobulated mass with homogeneous or inhomogeneous enhancement on the ct. although mri is a widely used modality for evaluating parotid gland tumors because it provides a greater amount of morphological information than ct does, the mri features of myoepithelioma of the apg have not been previously described. the typical mri findings of pa, in contrast, have been well described to include a lobulated or oval-shaped well-defined encapsulated mass, a mass with a hypointensity on t1-wis and hyperintensity surrounded by a hypointense capsule on t2-wis as well as a gradual tic enhancement pattern in dynamic mri studies. in the present case, the myoepithelioma of the apg was isointense relative to the muscle on t1-wis, hyperintense relative to the muscle on t2-wis, and well enhanced on contrast-enhanced t1-wis. additionally, a tic generated from a gadolinium-enhanced dynamic mri study displayed a gradual enhancement pattern. we preoperatively suspected the mass to be pa because the mri findings were completely consistent with those of pa. as the name indicates, myoepithelioma comprises neoplastic cells exhibiting myoepithelial differentiation; these cells display various morphologic patterns such as spindle, plasmacytoid, epithelioid, and clear types. because of this morphologic diversity, it is usually difficult to definitively diagnose myoepithelioma by fnac before surgery, although das et al. reported a case of a successful preoperative parotid myoepithelioma diagnosis via a cytological examination and immunohistochemistry. the main differential diagnoses of myoepithelioma include pa, adenoid cystic carcinoma, other salivary tumors without obvious ductal differentiation, and mesenchymal tumors. in particular, we should always consider various low-grade malignant tumors when interpreting the fnac results from salivary tumors. a histopathological examination of the resected specimen can yield a definitive diagnosis of myoepithelioma, and immunohistochemical staining plays an important role in the detection of neoplastic myoepithelial cells. such cells are typically positive for cytokeratin, vimentin, s-100 protein, calponin, sma, and glial fibrillary acidic protein, but negative for carcinoembryonic antigen. in our case, the histopathological findings of an epithelial and lattice-like arrangement of neoplastic cells with hyalinous and mucinous stroma were also characteristic components of pa. however, neither cartilaginous myxoid stroma nor a glandular structure was found in our case, and the tumor was entirely encapsulated by connective tissue. additionally, positive immunohistochemical staining of the neoplastic cells for cam5.2, cytokeratin14, ae1/ae3, sma, and calponin indicated that these neoplastic cells possessed both epithelial and myoepithelial characters. complete resection along with the surrounding salivary tissue is recommended for myoepithelioma management in order to avoid tumor recurrence. in conclusion, a mid-cheek mass could easily be suspected as an apg tumor according to the clinical presentation and imaging findings. however, because myoepithelioma is an extremely rare apg tumor subtype and the imaging findings of myoepithelioma resemble those of pa, which is the most common benign apg tumor subtype, we believe that it is nearly impossible to preoperatively distinguish myoepithelioma of the apg from pa of the apg or low-grade malignant tumors, even by using fnac, given that kawashima et al. also misdiagnosed a myoepithelioma of the apg as a suspected adenoid cystic carcinoma (after fnac).

tumors of the accessory parotid gland (apg) are rare, and pleomorphic adenoma (pa) is the most common benign apg tumor subtype. myoepithelioma of the apg is much rarer than pa, and to date, only 5 cases have been sporadically reported in the english literature. we describe the clinicopathological and mri findings of an epithelioid myoepithelioma of the apg that was treated in our hospital. the patient's only clinical symptom was a slow-growing and painless mid-cheek mass. the tumor was suspected to be pa before surgery based on the following mri findings: (1) a well-circumscribed and lobulated contour, (2) isointensity and hyperintensity relative to the muscle on t1- and t2-weighted images (wis), respectively, (3) good enhancement on contrast-enhanced t1-wis, (4) peripheral hypointensity on t2-wis, and (5) a gradual time-signal intensity curve enhancement pattern on gadolinium-enhanced dynamic mri. the tumor was completely resected via a standard parotidectomy approach, and the postoperative pathological examination of the tumor, including immunohistochemistry, confirmed the diagnosis of epithelioid myoepithelioma. as it is hardly possible to distinguish myoepithelioma from pa and low-grade malignant tumors preoperatively, a pathological examination using frozen sections is helpful for surgical strategy-related decisions.

PMC4049025

pubmed-1048

a total of 2,634 fecal and intestinal samples were collected from pigs exhibiting diarrhea from 569 swine farms in all 9 provinces of south korea, during january 1december 31, 2008; age groups of the pigs are defined in the table. all samples were processed as 10% (vol/vol) suspensions with phosphate-buffered saline (pbs; 0.1 m, ph 7.2), and viral rna was extracted from them. subsequently, reverse transcription pcr (rt-pcr) was performed by using 3 primer pairs as described previously (4). to determine complete spike (s) gene sequence, we purified, cloned, and sequenced pcr products on an automated dna sequencer by using t7, sp6 primers, and newly designed s gene specific primers (primer sequences available on request). sequences were analyzed by clustalx version 1.83 program (http://www.clustal.org) and megalign software (dnastar inc., madison, wi, usa), and compared with those of reference strains in genbank. the complete s gene sequence of the pedv variant with a large genomic deletion (strain mf3809/2008/south korea) described here has been deposited in genbank under accession no. the pedv variant with a large deletion in the s gene was found in 3 samples (2 fecal and 1 intestinal) of the suckling pigs with diarrhea at 1 farm in chungnam province. other pigs on the same farm were infected with pedv with the full-length s gene; however, in no instance were both the pedv variant and pedv with the full-length s gene observed in 1 pig. pedv, porcine epidemic diarrhea virus; s gene, spike gene. of the 2,634 samples, 205 (7.8%; 49/569 [8.6%] farms) were positive for pedv: 116 (16.8%) of 692, 12 (2.4%) of 504, 29 (3.6%) of 808, 34 (24.1%) of 141, 1 (16.7%) of 6, and 13 (2.7%) of 483 samples from the 6 age groups tested (table); however, when sf2/sr2 primers were subjected to pcr, a strong and single band of unexpected size (1,000 bp) was found in each pcr product from 3 diarrhea samples of the suckling pigs on 1 farm. exact length of the band was 981 nt, and the band was much shorter than that of intact fragment because of 612-nt deletion at positions 2277723388 (1,593 vs 981 nt for pedv reference strains and pedv variant, respectively; technical appendix figure 1). sequence similarity of the 981-nt fragment of mf3809 was found to be in pedv s gene region in genbank by blast analysis (http://blast.ncbi.nlm.nih.gov/blast.cgi). the complete s gene (3549-nt segment, corresponding to 1182 aa) of mf3809 had high (93.3%98.5% nt, 92.0%98.0% aa) sequence identity to all known pedv strains for which full-length s gene sequences were available in genbank, except that mf3809 has the large deletion in its s gene. phylogenetic analysis confirmed that mf3809 belonged to a cluster containing a pedv reference strain, not a cluster that included any other coronaviruses, and showed the closest genetic relationship with pedv strains from south korea in 2009 (figure). a) relationships between the pedv variant (mf3809/2008/south korea) and other coronaviruses based on the full-length spike gene. pedv, porcene epidemic diarrhea virus; tgev, transmissible gastroenteritis virus; prcv, porcine respiratory coronavirus; ccov, canine coronavirus; fcov, feline coronavirus; hcov, human coronavirus; mi-batcov, miniopterus bat coronavirus; sc-batcov, scotophilus bat coronavirus; hecov, human enteric coronavirus; bcov, bovine coronavirus; phev, porcine hemagglutinating encephalomyelitis virus; eqcov, equine coronavirus; crcov, canine respiratory coronavirus; mucov, murine coronavirus; pi-batcov, pipistrellus bat coronavirus; ro-batcov, rousettus bat coronavirus; sarsr-cov, severe acute respiratory syndrome-related coronavirus; ty-batcov, tylonycteris bat coronavirus; ibv, infectious bronchitis virus; tucov, turkey coronavirus; bwcov, beluga whale coronavirus; bucov, bulbul coronavirus; thcov, thrush coronavirus; muncov, munia coronavirus. b) phylogenetic tree of the entire spike genes of the pedv variant and all known pedv strains available in genbank. the phylogenetic tree was constructed using the neighbor-joining clustering method in mega version 5.22 with a pairwise distance (5). bootstrap values (based on 1,000 replicates) for each node are given if>60%. pedv strains isolated from various countries are marked with colors as follows: europe (black), china (red), japan (olive green), usa (bright magenta) and south korea (blue). besides a large (204-aa) deletion at positions 713916, a 2-aa (d/ni) deletion was identified at positions 163164. we also discovered 2 separate insertions: a 4-aa (qgvn) insertion at positions 5962 and a 1-aa (n) insertion at position 140. a total of 15 separate substitutions were identified, and the number(s) of replaced amino acids ranged from 1 through 5. these sequence variations were similar to those in highly virulent isolates recently reported in china (6) and the united states (3), as well as in south korea. to further characterize the virus, we conducted rt-pcr with respect to the membrane (m) gene using the protocol described previously (7). the complete m gene sequence was determined and then submitted, together with the complete s gene sequence, to genbank under accession no. the entire m gene of mf3809 had 96.6%100% nt (96.0%100% aa) sequence identity to all known pedv strains available in genbank, and phylogenetic analysis showed that mf3809 belonged to a cluster containing pedv reference strain and showed the closest genetic relationship with 2007 korean pedv strains (data not shown). cells and supernatants in every passage were collected separately for rna extraction and used to detect the virus and determine the amount of the viral rna in the medium with real-time rt-pcr (8). the cells and supernatants of the 3 passages were positive for the virus, and the control inoculated with pbs was negative; however, the amount of viral rna in the medium decreased with each passage. whether the positive result was attributed to residual viruses of the initial inoculation or to the decreased propagation of the virus in the cells further studies, such as continuous serial passages and neutralization assays, are needed to determine the final activity of the virus in vero cells. our large-scale study of the incidence of pedv in pigs with diarrhea in south korea found that 7.8% of animals were infected with the virus. moreover, our investigation identified and characterized a new pedv variant with a 612-nt deletion in s gene, corresponding to a 204-aa deletion. the coronavirus s protein plays a pivotal role in regulating interactions with specific host cell receptor glycoproteins to mediate viral entry and stimulate induction of neutralizing antibodies in the natural host (1,2,9). mutations or deletions in the coronavirus s gene affect its pathogenicity and tissue tropism (1012). porcine respiratory coronavirus (prcv), a naturally occurring deletion mutant of transmissible gastroenteritis virus (tgev), is an example of pathogenic change and tropism switching, apparently associated with s gene change. prcv has a 224-aa deletion at positions 21244 in the n terminal region, which is needed for the enteric tropism of tgev and comprises antigenic sites c and b (1315), of s1 compared with tgev. in other words, tgev, a highly enteropathogenic porcine coronavirus, is turned into prcv, a respiratory pathogen with reduced pathogenicity, as a consequence of a large deletion in the s gene. unlike prcv, the pedv variant has a 204-aa deletion at positions 713916 in the c-terminus of s1 and n terminus of s2, destroying 4 n-linked glycosylation sites at positions 728, 745, 783, and 875, as well as 2 neutralizing epitopes, ss2 (753760) and ss6 (769776) (technical appendix figure 2). these amino acid mutations might cause the conformational change of s protein and result in antigenicity/immunogenicity alteration of the pedv variant. further studies should be conducted to analyze extensive genomic sequences and determine biological properties, such as pathogenicity, tissue tropism, and transmissibility of the new pedv variant. summary of amino acid mutations in spike (s) protein of porcine epidemic diarrhea virus (pedv) variant; schematic diagram of the s genes of classical pedv, recent prevalent pedv and the pedv variant; and alignment of amino acid sequences of the entire s proteins of the pedv variant and reference strains.

since 1992, porcine epidemic diarrhea virus (pedv) has been one of the most common porcine diarrhea associated viruses in south korea. we conducted a large-scale investigation of the incidence of pedv in pigs with diarrhea in south korea and consequently identified and characterized a novel pedv variant with a large genomic deletion.

PMC4257805

pubmed-1049

eye movement assessment potentially provides a valuable window into the human central nervous system function and may help to obtain insights into the structure of complex forms of human behavior including attentional control [1, 2]. furthermore, the study of oculomotor control in pathological conditions offers insight into the underlying neural mechanisms. neurodegenerative movement disorders are frequently accompanied by a broad spectrum of oculomotor abnormalities since large parts of the human central nervous system contribute to the function of vision comprising visual areas, oculomotor areas, and associated visual memory structures including eye movement control. a large part of knowledge about these higher oculomotor functions results from electrophysiological investigations in the monkey brain and functional imaging in humans by use of advanced test paradigms which have shown eye movement-related activity in several cortical and subcortical areas [46]. in addition, computer-based neuroimaging such as fiber tracking by means of diffusion tensor imaging has depicted major pathways that are linked to oculomotor control and its changes in neurodegenerative movement disorders such as huntington disease (hd) [7, 8]. oculomotor abnormalities in parkinson's disease (pd) have recently been reported to be associated with higher functional networks revealed by task-free intrinsic functional connectivity neuroimaging techniques. the nature of the contribution of intrinsically interacting large-scale cortical functional networks to eye movements and their key to pathological dysfunction is currently being addressed in neuroimaging research. evidence for the need of intrinsically organized brain activity associated with visual input depends on the almost infinite visual information received by the human eye from the external environment. before guiding the eyes adequately in the orbit, a target of special interest in the visual scene needs to be determined, followed by target selection and by programming the oculomotor system in a coordinated manner to rotate the eye ball until the object is foveated. the entropy, a measure of information, of the visual stream arriving at the human eye is about 10 bits/s whereas only approximately 3,000,000 bits/s are leaving the retina due to the limited number of available axons of the optic nerve and finally less than 10,000 bits/s are believed to be under attentive scrutiny. thus, the investigation of eye movements has been applied as an experimental tool over the past four decades and provides a unique opportunity to understand the functional integrity of brain structures both in the healthy brain and in pathological state. the latter include the broad variety of parkinsonian syndromes and other neurodegenerative conditions such as amyotrophic lateral sclerosis, fronto-temporal lobar degeneration, and alzheimer's disease. pathological conditions are of special interest to ophthalmologists, neurologists, and scientists in order to get insights into potential alterations of the complex oculomotor networks, including fundamental issues of human behavior comprising conflict resolution and free will. retinal structure is divided into the fovea centralis with ultimate vision in its center and the larger periphery (with markedly less visual acuity) so that humans have developed the ability to foveate or refoveate an object of interest in the visual field. rotating the eye ball offers a somewhat more economical strategy to shift or to maintain an object of interest on the fovea than turning the whole head. in general, eye movements are required to compensate small head movements to sustain stability of gaze, to accurately track moving objects in the visual surrounding smoothly, or to rapidly redirect the eye onto a new target rather than scanning the environment. eye movements can be subdivided into two main classes: one class of movements comprises vestibuloocular reflexes, optokinetic nystagmus, fixation, and smooth pursuit eye movements (spem). saquer, meaning jerk) in order to perform conjugated, fast eye movements shifting the eye ball discontinuously in a stepwise manner onto a new target. this review summarizes the fundamental mechanisms of eye movement control, considering healthy and pathological states of the brain. more specifically, we discuss the main features of the oculomotor phenotypes that are specific for different movement disorders and that can serve as model conditions to study how distinct brain areas contribute to eye movement control. in addition, we focus on fixational eye movements as presenting a continuous range from microsaccades to (pathological) square wave jerks (swj). due to the particular role of eye movement alterations for the clinical and neuroscientific work-up of parkinsonian syndromes, we will focus on movement disorders in this synopsis to emphasize the significance in assessing eye movement control to understand the respective pathophysiology. together, our aim is to condense both the oculomotor dysfunctions in patients with neurodegenerative movement disorders and the underlying pathological mechanisms that result in the observed dysfunctional oculomotor behavior. beyond the fact that oculomotor dysfunctions can be important for the purposes of clinical diagnosis, we discuss the potential functions and mechanisms of higher cortical contributions to eye movement control, in particular by reviewing broad pathological spectrum of cognitive control in functional system-related neurodegenerative conditions. during the absence of any (e.g., vestibuloocular) stimulus, healthy subjects are expected to withhold any unwanted considerable gaze shift maintaining the eyeball in its primary position. however, by performing attempted visual fixation of an unmoving target, conjugated small (< 1), jerk-like, involuntary saccades (microsaccades) and slow conjugated drifts are near-instantly observed. for clear vision in the sense of the highest spatial resolution, the perception of an object should be optimized by small saccadic eye movements rather than by holding the image completely steady upon the retina. perfectly fixed images upon the retina cause sensor adaption (fading) due to the property of being designed for the highest motion responsiveness like other sensory systems. thus, in case of attempted fixation of stationary targets, microsaccades play an important role in counteracting visual fading by shifting the image on the retina back and forth in small portions of approximately 0.5 degrees. in addition, larger voluntary saccades or blinks are considered to also effectively overcome visual fading. the generation of microsaccades depends on the target size whereas luminance appears to be of no effect in modulating microsaccades. the dynamics vary during scanning the visual scene, and the frequency of microsaccade production tends to increase with more challenging visual tasks which require increased visual discrimination abilities. the relationship between microsaccade amplitudes with respect to their peak velocities follows the main sequence in an approximately linear manner. microsaccades can be suppressed by precision demanding tasks (e.g., threading a needle) but can not be voluntarily evoked. with respect to their amplitude swj are thought to have the same neural substrate as microsaccades and present as conjugated, rapid eye movements (preferentially in horizontal direction) that intrude accurate fixation. more specifically, both microsaccades and swj continuously shift the eyes away from the target and back onto it in an involuntary manner. in pathological conditions, they mostly present abnormally large and frequent. however, preschool children may present with larger swj (> 1) and less stable gaze holding that rarely also occur in healthy adults but manifest more frequently in the elderly. one diagnostic challenge rises from the large overlap of swj presentation between patients with movement disorders and healthy subjects. patients with neurodegenerative movement disorders frequently develop abnormal swj which frequently interrupt fixation, within the broad spectrum of oculomotor deficits [3, 27]. since swj are believed to present as a continuous spectrum ranging from microsaccades to larger saccadic intrusions, the mechanisms generating swj appear to be similar to those of microsaccades and share a common oculomotor network with the saccadic system. in addition, it is relevant for the characteristics of swj in movement disorders that swj generation appears to be similar in the healthy brain and in pathological state. larger swj probably reflect internal neural noise in the saccadic control loops and in the superior colliculus that forms a major component for the release of saccades by triggering the saccadic pulse generator in the midbrain. the neural noise is hypothesized to initiate a saccade away from the target, resulting in a position error that is counteracted by shifting the gaze back onto the target. the higher this neural noise is (e.g., in movement disorders due to an impaired triggering of the superior colliculus from the basal ganglia), the more prominent swj seem to occur. the cerebellum may contribute to abnormal swj in addition if it is involved in the pathological process in cerebellar diseases and neurodegenerative parkinsonian syndromes other than pd. during impaired stationary fixation such as sustained abnormal eye oscillations (e.g., large swj, pathological nystagmus), patients may report that vision is becoming subjectively blurred. in general, two clinical approaches to abnormal fixation need to be distinguished, on the one hand, the examination of the patient's eye while the eye remains in primary position and on the other hand during the fixation in eccentric gaze holding. in summary, abnormal oscillations of the eyes including pathological nystagmus and markedly large or frequent swj (beyond the aforementioned physiological fixation eye movements) account for a red flag symptom that should prompt further investigations with respect to differential diagnostic procedures. the vast majority of these visual fixation signs are linked to dysfunctions of the central nervous system, in the absence of inaccurate vision, ophthalmologic diseases, or eye muscle affections. abnormalities during fixation can be investigated with frenzel goggles or the ophthalmoscope by asking the patients either to hold their gaze steadily at the primary position or to shift their gaze towards eccentric positions. frenzel goggles inspection of the patient's fixation ability accounts for a sensitive instrument to address fixational dysfunction or nystagmus. unlike the ophthalmoscope, frenzel goggles are equipped with small lights illuminating the patient's eyes and provide high-powered positive magnifying glasses (>+15 diopter) that disable the subject to adequately fixate any target in the visual field. hence, the examiner can detect abnormal swj and particularly pathological nystagmus since the absence of target fixation facilitates the manifestation of nystagmus forms that were attributed to peripheral vestibular impairment. first, stimuli can not be presented under specific conditions such as defined target positions. second, the observations can not be quantitatively characterized that is, metrics of saccadic accuracies, latencies with respect to stimulus onset, or determining peak eye velocities are not possible. the latter parameter is of special interest since peak eye velocity obtained during saccade performance characterizes the main sequence that provides robust metrics to assess pathology in peak eye velocity. to overcome these limitations, computer-based recording techniques are applied to quantify subtle alterations in eye movement control, that is, electrooculography, scleral search coil systems, and videooculography (vog). the past decades have emerged easy manageable computer-based eye trackers with integrated software environment for both stimulus design and automated data analysis for laboratory and portable usage. scleral search coil systems and vog emerge as the most widely used techniques to quantify eye movements, although electrooculography is yet the only device allowing recordings with closed eyes. the vog measurement offers the best compromise between easily tolerable, noninvasive measurement and spatial and temporal resolution but requires advanced calibration techniques to be able to accurately quantify oculomotor performance. in contrast, scleral search coil systems provide optimum spatial and temporal resolution and warrant no calibration approach due to the absolute calibration by default but are invasive since they are based on tightly fixated another reason for vog having become popular is the improved electronic hardware with additional software packages including both stimulus design and eye movement recording analysis features. moreover, modern vog systems provide easier usage and high portability with the possibility to assess human gaze behavior outside a dedicated room and even under dynamic conditions by utilizing an additional head-mounted camera (e.g.,). video-based eye trackers comprising one or two head mounted and adjustable infrared miniature cameras allow online measurements so that the recorded data can be visually inspected in real-time. commonly, the systems operate at about 250 hz temporal sampling frequency which is constrained by spatial resolution of the field of view. basal oculomotor network function (at brainstem/basal ganglia/cerebellar level) is usually tested by visually guided reactive saccades [17, 34, 35]. in this paradigm, subjects are asked to track a randomly jumping target as quickly and as accurately as possible. smooth pursuit eye movements are elicited by requiring the subjects either to track a continuously moving target or to track a sinusoidally oscillating target. in order to assess attentional eye movement control as a correlate of the cognitive (cortical) top-down oculomotor pathway, delayed both conditions aim at investigating the subject's ability to suppress the reflexive urge to shift their gaze towards a new suddenly upcoming target in the visual scene. parkinson's disease (pd) is the second most common neurodegenerative disorder with cardinal motor symptoms comprising hypokinesia, tremor, rigidity, and postural impairment, while a multitude of nonmotor conditions including cognitive decline as part of the disease process has become evident [39, 40]. autopsy-controlled studies by braak and coworkers [4144] indicated that the pathological process of pd can be characterized as a six-stage ascending spreading scheme beginning in the lower brainstem (stages 1-2) towards mesencephalic structures including the basal ganglia (stages 3-4) and finally reaching the cortex (stages 5-6). these findings suggest that pd has a preclinical stage and a symptomatic stage as soon as patients display the aforementioned cardinal motor symptoms defining clinical onset not before stage 3. only a few studies have systematically investigated oculomotor dysfunctions in asymptomatic subjects with gene mutations. whereas saccadic hypometria and the problems in withholding unwanted gaze shifts (hyperreflexivity) are a hallmark of both early pd and symptomatic parkin mutation carriers, presymptomatic parkin mutation carriers revealed undistinguishable oculomotor performance compared to age-matched healthy controls. pd patients presented with a lack of attentional control resulting in the disability to withhold unwanted gaze shifts which appears to manifest even in nondemented pd patients. this can be tested by utilizing tasks such as delayed saccades [9, 37, 46] or antisaccades. pd onset typically incorporates motor symptoms caused by dopaminergic nigrostriatal cell degradation in the basal ganglia which are critical in locomotion including eye movements. the substantia nigra pars reticulata tonically inhibits the superior colliculus (sc) via gaba-ergic projections, whereas pausing the inhibitory sc input provides a prerequisite for saccadic release. the sc is an important visuomotor structure and plays a major role in triggering both voluntary and reflexive saccades. the cerebellum contributes to saccadic control in optimizing saccade trajectory by increasing eye acceleration during saccade onset and controls the movement procedure in order to keep the eye on track. cerebellar pathology in oculomotor function, however, typically can not be observed in pd with very few exceptions (see below). unlike the basal ganglia, the sc remains intact until later stages in the pathological process, and both the sc and the striatum receive cortical input from the frontal eye fields (fef), the supplementary eye fields, and the parietal eye fields. areas in the parietal cortex associated with oculomotor control beyond the parietal eye fields encompass superior and inferior parietal lobe and are a critical interface for attention and multiple sensory integration from visual and somatosensory modalities. the supplementary eye fields contribute to target selection and visual search, and the fef are critical in target selection of competing stimuli mediating their information to the sc and directly to the saccadic generator in the brainstem. the striatum serving as the main input gate of the basal ganglia evaluates incoming and competing information for appropriate execution; however, with the putamen being the most affected area in pd, it remains to be discovered to what extent the pd pathology targets this mechanism. the striatum gains also incoming streams from the dorsolateral prefrontal cortex which contributes to voluntary eye movements in the sense of inhibition control to prevent unwanted reflexive saccades. as a part of the limbic system, the so-called cingulate eye field, located in the anterior cingulate cortex (which is involved in motivation, behavior, and executive control), contributes to saccade generation. guiding voluntary saccades requires several neural mechanisms within the framework of preemptive perception that manifests in activation in the cingulate eye field prior to the release of a saccade. deterioration of dopaminergically mediated pathways in the basal ganglia in pd leads to overactive sc inhibition preventing the sc to trigger the brainstem saccadic generator. this may contribute to saccadic hypometria, as depicted in figure 2, and slowed initiation of voluntary saccades such as reduced number of rapid alternating self-paced saccades where subjects are asked to shift their gaze as fast and as accurately as possible between to stationary targets. in pd, deep brain stimulation of the subthalamic nucleus has undoubtedly positive effects in treatment of motor symptoms, but the improvement of oculomotor performance is still debated. compensatory effects on the functional level of the sc mediated by the substantia nigra pars reticulata have been reported yielding improved saccade initiation and inhibitory control but did not significantly prevent prosaccades during antisaccade condition. one possible explanation of these discrepancies could result from the included patients ' degree of motor impairment. since motor performance worsens in the course of pd, it could be hypothesized that those patients investigated by yugeta et al. presenting with a unified parkinson's disease rating scale iii score in the ranges of 644 (stimulation off state) and 124 (stimulation on state) were less severely affected than those reported by pinkhardt et al. with an updrs iii score in the ranges of 1664 (off) and 562 (on). this may lead to the assumption that the less advanced patient group exhibited more benefits from deep brain stimulation on saccadic performance than those presenting with higher updrs iii scores which is probably associated with cortical involvement. this hypothesis is in line with the findings of macaskill and coworkers who attributed oculomotor dysfunctions in early and noncognitively impaired pd to pure basal ganglia disorder whereas the more widespread cortical involvement later in the course of pd may result in malfunctioning cortical areas involved in saccadic control. proposed a possible task-related modulation within the basal ganglia resulting in oscillatory spike activity that may contribute to both moreover, functional connectivity neuroimaging revealed that connectivity loss in the putamen versus the caudate nucleus follows the same gradient as dopamine depletion, indicating a decoupling of the putamen prior to the caudate nucleus. other imaging studies on functional integration in pd patients [63, 64] indicated widespread functional remapping that likely alters connectivity associated with oculomotor function. the nature of the cortical contribution of large-scale higher function networks to oculomotor control remains a promising issue in future studies. spem provide an optimum strategy of maintained movement adaptation in a highly predictive manner and involve large parts of the brain cortex, comprising primary visual areas like the striate and extrastriate cortex as well as the fef and supplementary eye fields. likewise, the cerebellum is involved in performing pursuit and functions as a major hub after receiving the cortical efferents that are to be integrated in innervating the relays of the ocular motor neurons through the medial vestibular nucleus. the easiest way to elicit spem is to ask a subject to track some continuously moving object in front of one's eyes. in the vog, a quantitative measure of spem performance is the gain value describing the ratio of eye to target velocity. in patients with pd, spem are frequently interrupted or nearly abolished by anticipatory saccades resulting in a reduced pursuit gain, as depicted in figure 3. notably, even in advanced cases, the patients are fairly able to track the target smoothly whereas the episodes of performing spem exclusively shorten with more frequent saccadic intrusions. thus, the genuine spem system appears to be intact which raises the question of whether an executive dysfunction contributes to the characteristic anticipatory saccades during pursuit. for this fundamental issue, pinkhardt et al. suggested that accompanying extradopaminergic processes might cause spem impairment. thus, a lack of inhibitory control which is closely linked to the higher functions located in the dorsolateral prefrontal cortex as well as the striatal projections might explain these observations of dysfunctional spem. the mechanism of swj generation appears to be similar in pd patients and healthy controls, as indicated by otero-millan and coworkers. moreover, it was proposed that the characteristics of swj (such as frequency and amplitude) are linked to the internal neuronal noise level within the sc and the brainstem saccade generator. in pathological states such as pd,, the sc might be triggered by an increase in fef activity that compensates pathological increased inhibition of the sc from the substantia nigra pars reticulata. in summary, pd patients present with a broad spectrum of disturbed oculomotor function comprising saccadic intrusions during spem, impaired inhibition control, and hypometric saccadic gains, while eye velocities used to be normal. notably, these deficits manifest early in the disease course; however, they can be observed in the symptomatic rather than in presymptomatic stages of familial pd cases. in general, as the disease progresses, the oculomotor disturbances develop their full spectrum. the combination of both, the observed oculomotor phenotype and autopsy-controlled findings in pd, may increase our understanding of eye movement control as (i) the oculomotor nuclei in the brainstem appear to be spared by the pd-associated pathological process and (ii) the oculomotor deficits may primarily reflect a lack of attentional control. in the clinical context, the quantitative objective measure of eye movements by means of vog has the potential as a possible technical surrogate marker in pd [6, 67]. msa is a neurodegenerative disease characterized by autonomic and pyramidal dysfunction in addition to a broad spectrum of parkinsonism presentations and cerebellar ataxia. on neuropathological grounds, deterioration of nigrostriatal as well as olivopontocerebellar pathways contributes to the clinical phenotype of msa with the predominant parkinsonian symptoms (msa-p subtype) on the one hand and the predominant cerebellar dysfunction (msa-c subtype) on the other hand. nota bene, altered eye movements in msa underlie both pathomechanisms. in msa-c, patients frequently present with typical cerebellar-type oculomotor signs comprising disturbed spem as well as downbeat, rebound, and gaze-evoked nystagmus. pathological nystagmus in the presence of parkinsonism characterizes a unique identity for differentiating msa from other parkinsonian syndromes. in contrast, it is more difficult to distinguish msa-p from pd because possible cerebellar symptoms mostly remain subtle; however, if present, they provide a red flag for msa since cerebellar signs have not been reported in pd. saccadic hypometria in msa can be observed, with mildly or moderately inaccurate saccade amplitudes. msa patients are principally able to generate normal saccade amplitudes, and peak eye velocities are unaffected in msa compared to controls. reduced vertical eye velocities suggest in almost all cases a diagnosis different than msa or pd. disruptions of spem as consecutive, fine-stepped catch-up saccades emerge predominantly in msa-c, while patients with msa-p can present with a mixed picture of both catch-up saccades and anticipatory saccades. in addition, msa patients present with the disability to withhold unwanted gaze shifts suggesting an impaired executive control although msa patients show cognitive deficits only in the late stages of the disease. this aspect is worth mentioning since msa patients may manifest, like pd patients, an attention deficit that can be discovered by cognitively demanding tasks in vog (e.g., antisaccades, see figure 1). these observations call for further investigations in order to study higher function networks that may contribute to the pathological process in msa resulting in disturbed eye movement control. progressive supranuclear palsy (psp) is characterized by parkinsonism associated with signs like supranuclear gaze palsy, early falls, dysphagia, dysarthria, axially pronounced rigidity, and behavioral/cognitive impairment. psp can be subdivided into different subtypes that are characterized by their clinical course, most probably related to different patterns of pathological tau distribution in the brain. apart from the classical psp (richardson syndrome, psp-rs), recent classifications subdivide clinical phenotypes including psp-parkinsonism (psp-p), pure akinesia, progressive nonfluent aphasia, and corticobasal syndrome (cbs) [72, 73]. the eponymous supranuclear gaze palsy is a central element of all subtypes but is not present in all stages of all subtypes. the subtypes psp-rs and psp-p with the oculomotor hallmark of abnormally reduced vertical peak eye velocity are subsequently discussed. oculomotor features might be diagnostically important as an early feature for psp since definitive biomarkers remain to be defined yet, and subtle early clinical states of psp may be indistinguishable from pd. slowing of saccades, particularly vertically, is caused by midbrain atrophy targeting burst neurons in the rostral interstitial nucleus of the medial longitudinal fasciculus that drives the extraocular eye muscles for vertical saccade generation. moreover, the omnipause neurons are required to suppress their firing while the burst neurons innervate the extraocular eye muscles to drive the saccade. a second inhibitory pathomechanism of the omnipause neurons is suggested to contribute to reduced peak eye velocity due to its interference with the burst neurons. the dopaminergic nigrostriatal pathways and the superior cerebellar peduncle are reported to be involved in the pathological process resulting in prolonged latencies and (mostly subtle) cerebellar oculomotor signs, respectively. study of oculomotor dysfunctions both in psp-rs and in psp-p revealed a similar presentation comprising slowed vertical saccades, saccadic hypometria, prolonged latencies, and impaired pursuit eye movement. in advanced stages, psp patients are fairly disabled to generate large saccade amplitudes, preferentially vertical, as exemplified in figure 4. when vertical saccades become slowed, horizontal saccade velocity remains intact until the pathological process also involves horizontal burst neurons resulting in reduced horizontal peak eye velocities [3, 76]. psp patients also present with disrupted visual fixation when they attempt to fix their eyes upon stationary targets. additionally, they present with more frequent, larger swj (with amplitudes up to 5), slower saccades, and more horizontal swj compared to controls. the phenomenon of considerably higher prevalence of horizontal swj in combination with larger amplitudes may give a clue for psp although microsaccades are observed preferentially in horizontal direction with increasing target size. two further explanations for the presence of abnormally large and frequent swj in psp have been proposed: (i) since horizontal swj rate often increases during the release of vertical saccades, a swj coupling mechanism was suggested to enhance vertical saccade burst and (ii) the decreased peak eye velocity and the resulting prolonged saccade duration may increase the probability that vision fades so that larger and more frequent swj could overcome visual fading in psp [21, 28]. remarkably, spem remain intact even in severely impaired psp patients as long as a target is continuously moving in a predictive manner with low peak velocity and acceleration. this could be demonstrated when patients were asked to track a sinusoidal oscillating spot with low frequency. with increasing stimulus frequency, the ability to perform spem considerably declines due to the disability to perform catch-up saccades to refoveate the target. psp is frequently accompanied by cognitive decline and frontal brain dysfunctions including executive deficits that can be demonstrated in cognitively demanding tasks such as the antisaccade condition in which the psp patients often present with a limited ability to inhibit the visual grasp reflex in a sense of shifting the gaze towards the opposite target direction. in addition, vergence eye movements are reported to be affected early in the psp course and may also be associated with horizontal diplopia in some cases. in summary, pathologically slowed vertical saccades ' peak velocities are the eponymous hallmark of psp. the psp-associated damage involves midbrain structures including the saccadic burst generator in the brainstem that is responsible for the impaired (vertical) eye muscles innervation. moreover, a hallmark of psp is the early appearance of cognitive and behavioral deficits that also manifest in oculomotor function by means of a considerable lack of inhibitory control of saccades (e.g., tested by antisaccades). autosomal dominant huntington's disease (hd) is a progressive neurodegenerative disease, clinically presenting with a hyperkinetic movement disorder (chorea), cognitive decline, and behavioral symptoms. the age of disease onset is predictable by the number of pathologically increased cag repeats. oculomotor deficits in patients with hd and presymptomatic gene carriers are reported to be one of the earliest signs. they present as dysfunction of fixation ability, impaired initiation and inhibition of saccadic eye movements, impaired spem [2, 84], and decreased inhibition control in the sense of erroneously responding to novel stimuli [8587]. moreover, slowed saccades become prominent in both vertical and horizontal directions, latencies have been reported to be increased, and saccadic hypometria can be observed in hd like in other movement disorders. slowing of saccades is likely caused by midbrain atrophy, in particular in the pontine nuclei critical for the saccadic burst; however, the pathophysiology in oculomotor-related midbrain areas is ill-defined, so far. presymptomatic gene carriers show subtle cognitive and motor impairment due to striatal and cortical neuropathological changes that cause increased error rates during inhibition tests such as antisaccades and likely reflect first clinical symptoms. reflexive saccades remain unaffected for a long time whereas both reflexive and voluntary-guided saccade performance decline with disease progression, since the structural connectivity between the frontal cortex and the caudate body seems to be particularly related to the control of voluntary-guided saccades [7, 86]. difficulties in voluntarily initiating saccades in the presence of excessive saccadic intrusions during attempted fixation and a lack of inhibition control in the sense of withholding gaze shifts to new stimuli are apparently contradicting findings; a comprehensive explanation for this phenomenon in hd remains to be identified. the extraocular eye muscles and the attention system. the latter one is apparently involved already in presymptomatic hd. cerebellar signs manifest in many neurodegenerative movement disorders such as msa and in the heterogeneous group of hereditary spinocerebellar ataxia. one prominent feature is cerebellar ataxia with impaired body posture; in addition, patients present with dysarthria, dysmetria, and dysdiadochokinesia. cerebellar dysfunctions in eye movement control frequently manifest in a variety of symptoms including the spectrum of pathological nystagmus, dysmetric saccades, abnormally large swj, postsaccadic drift as a consequence of pulse-step-mismatch, mildly slowed saccades, and a disturbed pursuit in the sense of corrective saccades interrupting spem [3, 16, 28, 37, 50, 88]. these deficits become pronounced in advanced cases, while many patients present with less dominant oculomotor abnormalities in early stages. in order to detect these symptoms, vog is helpful beyond pure visual inspection. oculomotor dysfunctions have been characterized by the genetically defined spinocerebellar ataxia subtypes; for a comprehensive review, see. only a few studies investigated presymptomatic spinocerebellar ataxia gene carriers in contrast to hd. for spinocerebellar ataxia type 2 presymptomatic patients, a relation between cag repeats, estimated time to disease onset, and decreased peak eye velocity has been reported. together, these vog findings in cerebellar dysfunction mirror the cerebellar contribution to the oculomotor system, that is, refinement of saccade guidance, the adaptive strategy to perform perfect smooth pursuit, and the ability to hold the eye in a steady position. to our knowledge, the role of the cerebellum in attentional oculomotor control remains incompletely defined yet and might be a promising issue for future investigations. in the absence of definitive biomarkers, vog holds promise for a complementary noninvasive tool to characterize the oculomotor phenotype of distinct disease entities within the spectrum of neurodegenerative diseases. in the course of neurodegenerative disorders, hence, the resulting clinical condition might be considered as an investigational model for the contribution of functional components to eye movement control. in vivo examination of the oculomotor system offers a valuable window into altered brain function in the pathological state of movement disorders. thus, we can learn about the contribution of different functional systems that may interfere with the way we direct our attention in the visual scene. in addition, oculomotor control covers large portions of the whole brain that appear to be decomposable into two major subdivisions: (i) the oculomotor nuclei responsible for the innervation of the six extraocular eye muscles and (ii) the much more complex network of higher cognitive control that is strongly associated with visual attention. the investigation of eye movements may become important to clinicians in the context of differential diagnostics of movement disorders such as in distinguishing between parkinsonian syndromes or to uncover a possible cerebellar contribution to pathological processes. vog provides a sensitive noninvasive in vivo method to detect alterations in oculomotion function in patients with neurodegenerative movement disorders. malfunctioning oculomotor control appears to have some characteristic feature that can give clues to be attributed uniquely to the subtype of the movement disorder. more specifically, other neurodegenerative types of parkinsonian syndromes can be differentiated from pd early in the course. one should keep in mind that some of the parkinsonian-associated hallmarks such as slowed eye velocities could also manifest in other neurodegenerative (nonmovement) disorders, resulting in the necessity for careful interpretation of vog results in the light of the clinical presentation. particular aspects such as swj or larger intruding eye movements may provide motivation for future investigations (possibly together with functional brain imaging studies [9, 92 ]) to increase our understanding of the functional pathoanatomy of these neurodegenerative conditions. notably, attentional dysfunction in oculomotor control mostly presents early in the course of neurodegenerative movement disorders even while no obvious cognitive deficits exist. this finding prompts the notion that even a subtle pathology of cortical networks may cause a broad variety of oculomotor alterations. to further investigate the complex nature of visual attention and the way we direct or withhold our gaze, it might be safe to assume that we can learn much from pathological conditions related to specific functional systems. this approach offers the possibility to refine our existing models of human oculomotor networks whose functional interaction may be considered an essential framework for higher functions such as visual attention.

the evolution of the fovea centralis, the most central part of the retina and the area of the highest visual accuracy, requires humans to shift their gaze rapidly (saccades) to bring some object of interest within the visual field onto the fovea. in addition, humans are equipped with the ability to rotate the eye ball continuously in a highly predicting manner (smooth pursuit) to hold a moving target steadily upon the retina. the functional deficits in neurodegenerative movement disorders (e.g., parkinsonian syndromes) involve the basal ganglia that are critical in all aspects of movement control. moreover, neocortical structures, the cerebellum, and the midbrain may become affected by the pathological process. a broad spectrum of eye movement alterations may result, comprising smooth pursuit disturbance (e.g., interrupting saccades), saccadic dysfunction (e.g., hypometric saccades), and abnormal attempted fixation (e.g., pathological nystagmus and square wave jerks). on clinical grounds, videooculography is a sensitive noninvasive in vivo technique to classify oculomotion function alterations. eye movements are a valuable window into the integrity of central nervous system structures and their changes in defined neurodegenerative conditions, that is, the oculomotor nuclei in the brainstem together with their directly activating supranuclear centers and the basal ganglia as well as cortical areas of higher cognitive control of attention.

PMC4052189

pubmed-1050

juxtafacet cysts (jfcs) are uncommon intraspinal, extradural lesions that arise from the facet joints. jfcs can be further distinguished as either synovial cysts, if histology confirms the presence of a synovial lining membrane, or alternatively as a ganglion cyst, if no such membrane is present. however, few differences exist between the two in terms of diagnosis and management.1 2 3 4 5 6 7 their pathogenesis remains unclear, with most authors citing excessive joint mobility leading to synovial fluid herniation through joint capsule defects.2 4 7 calcification in the cyst walls is a common finding on imaging for jfcs, appearing as peripheral areas of high attenuation on computed tomography (ct) and peripheral hypointensity on t1- and t2-weighted magnetic resonance imaging (mri).8 9 10 but although calcification of the cyst walls are commonly reported findings,9 10 11 complete calcification of the cyst is exceedingly rare.11 12 13 we present here an unusual case of a jfc presenting as a giant, multilobular, completely calcified mass with significant extraforaminal extension. the patient was a 57-year-old woman who presented with a 2-year history of gradually worsening lower back and left leg pain. she also reported numbness in her left heel and foot and subjective weakness in the left foot. her past medical history was significant for hypothyroidism, hypertension, mild levoscoliosis, rheumatoid arthritis, and scleroderma managed on weekly methotrexate injection. her past surgical history was negative for any previous lumbar surgeries, but the patient had received multiple cervical surgeries resulting in c3c7 fusion. on neurologic exam, the patient was found to have decreased strength in plantarflexion and dorsiflexion of the left lower extremity but was otherwise nonfocal. the patient's imaging was most notable for a large, multilobular mass, measuring 54 31 30 mm, arising from the left l5s1 facet joint that had caused destruction of the joint itself and that showed severe encroachment of the adjoining foramen, with coexisting grade i anterolisthesis of l5 on s1. the lesion was hyperdense on plain radiograph (fig. 1) and on ct imaging (fig. 2a, 2b, and 2c) and appeared hypointense on t1- and t2-weighted mri sequences (fig. preoperative plain film of the lumbar spine showing a large, completely calcified lesion extending out from the l5s1 intervertebral space. (a) axial computed tomography (ct) image taken preoperatively, showing the origin of the lesion from the left l5s1 facet joint. (b) a preoperative midsagittal ct image demonstrating grade 1 anterolisthesis of l5 on s1. (c) a preoperative sagittal ct image demonstrating foraminal stenosis at l5s1 caused by the lesion. (a) t1-weighted magnetic resonance image (mri) of the same lesion, which appears uniformly hypointense. (b) the patient underwent an l5 laminectomy for excision of the mass along with an l5 to s1 fixation and fusion. intraoperatively, the lesion was noted to consist of a pastelike material that was compressing the thecal sac and that extended ventrally out of the foramen. histologic analysis identified the lesion as a mineralized simple pseudocyst, containing mineralized proteinaceous material that did not refract plane polarized light after ethanol fixation (fig. 4a and 4b). (a) hematoxylin and eosin stained sections of the resection reveal dense membranous fibrous connective tissue separating spaces associated with dense calcifications as well as smaller loculated spaces filled with calcium (20 magnification). (b) higher magnification (40) reveals the wall of the spaces to be associated with granular calcifications and no obvious cellular lining. the patient experienced no intraoperative or postoperative complications, and her postoperative hospital course was unremarkable. by postoperative day 2, the patient had recovered full strength in her extremities but still had some residual numbness, and she was discharged to home in stable condition on postoperative day 3. at 2-year follow-up, the patient continued to be free of her lower extremity pain and weakness and had not experienced any subsequent postsurgical complications (fig. 5a and 5b). (a) postoperative plain film (anterior-posterior) showing removal of the mass and placement of fixation hardware. mineralized, extradural lesions of the lumbar spine arising from the facet joint are uncommon causes of spinal pathology. the differential diagnosis consists of several uncommon disorders, including synovial osteochondromatosis,14 tumoral calcinosis,15 tumoral calcium pyrophosphate dehydrate crystal deposition disease (pseudogout),16 and lumbar presentation of ossification of the ligamentum flavum.17 the case we present here represents another potential consideration in that differential diagnosis. completely calcified jfcs are rare, with only a handful of instances existing in the literature. almefty et al presented four patients with multiple-level, bilateral, consistently calcified thoracic spinal cysts.12 these lesions were atypical due to their number, location, and mineralization. kasliwal and deutsch presented on the case of a unilateral lumbar jfc at the l4l5 level.13 similar to our case, the patient presented with radicular symptoms in the setting of a lumbar lesion that appeared hypointense on t1- and t2-weighted mri. it should be noted that calcification of jfcs can result from treatment as well, as mtellus et al noted a case of a cyst undergoing complete calcification after intracystic steroid injection therapy.11 the case presented here was remarkable not just for its mineralization but also for its size. jfcs have typically been recorded to be between 10 and 20 mm in diameter at their widest dimension on imaging.10 18 the case we report here, however, measured 54 mm at its widest dimension, showing significant extension into nearby structures. moreover, although jfcs frequently extend into the spinal canal and cause compression of the thecal sac,2 the majority of the lesion in our case existed outside the spinal canal. this may explain how the cyst grew to be so large before the patient presented for evaluation. it should also be noted that our patient's medical history included rheumatoid arthritis and scleroderma, and systemic inflammatory diseases have been associated with jfcs in the past.1 19 moreover, inflammatory arthritides are known to contribute to the pathogenesis of synovial cysts outside of the spine.20 however, no studies to date have established systemic inflammation as a risk factor for jfc development, and the role of inflammatory joint disease in the pathogenesis jfcs remains unclear. many methods of treating jfcs have been described, including simple laminotomy with cystectomy and the potential addition of a laminectomy, hemilaminectomy, mesial facetectomy, or foraminotomy.3 4 minimally invasive approaches with tubular retractors have also been described.19 21 in terms of treatment of this patient, it was presumed that the symptoms of back pain were secondary to facet dysfunction and that the left-sided plantar flexion weakness was due to foraminal stenosis. due to the size and mineralization of the lesion, it was felt that a complete facetectomy was needed to adequately address the underlying pathology, necessitating a concurrent fusion. our case highlights the significant variation that exists in the size, location, and content of jfcs. although uncommon, jfcs should be considered in the differential diagnosis of lesions arising from the facet joint, even if they appear calcified and noncystic in nature.

study design case report. objective to report the case of one patient who developed a giant, completely calcified, juxtafacet cyst. methods a 57-year-old woman presented with a 2-year history of progressively worsening lower back pain, left leg pain, weakness, and paresthesias. imaging showed a giant, completely calcified mass arising from the left l5s1 facet joint, with coexisting grade i l5 on s1 anterolisthesis. the patient was treated with laminectomy, excision of the mass, and l5s1 fixation and fusion. results the patient had an uncomplicated postoperative course and had complete resolution of her symptoms as of 1-year follow-up. conclusions when presented with a solid-appearing, calcified mass arising from the facet joint, a completely calcified juxtafacet cyst should be considered as part of the differential diagnosis.

PMC4111943

pubmed-1051

hypertrophy of the inferior olivary nucleus (ion) is an interesting phenomenon as it reflects a secondary response to an interruption of afferent connections resulting in increased and abnormally synchronized neuronal activity (best and regehr, 2009; shaikh et al., 2010). herein we report on a patient with hypertrophy of the ion secondary to ponto-mesencephalic hemorrhage and a change in the perception of earth-vertical over time. we address the role of the ion and of the dentate nucleus (dn) in the processing of vestibular input and specifically ask whether over-excitation of the dn secondary to disinhibition of the contralateral ion shifts perceived vertical into the opposite direction than previously observed for dn inhibition (e.g., due to cerebellar stroke; baier et al., 2008). the dn is part of an extensive network among brainstem, cerebellar, thalamic, and cortical areas involved in the integration of graviceptive input (brandt, 2000; angelaki et al the cvp are important for posture since head position relative to gravity is signaled by one component of the vestibular system, the otolith organs. while upright, the internal representation of earth-vertical is accurate in healthy human subjects (howard, 1982). following unilateral or asymmetric bilateral lesions along the cvp, however, this estimate becomes biased as reflected by a tilt in the subjective visual vertical (svv; brandt and dieterich, 1993). in addition to svv tilts, vestibular tone-imbalances may lead to partial or complete ocular tilt reaction (otr; consisting of ocular torsion, head roll, skew deviation) depending on the exact topography of the lesion (brandt, 2000). vestibular input projects from the vestibular nuclei via bilateral ascending pathways through the medial longitudinal fascicle (mlf) to the interstitial nucleus of cajal (inc) and through the inferior cerebellar peduncle to the cerebellar cortex. the nodulus and the ventral uvula receive vestibulo-cerebellar mossy fibers and forward these signals to the deep cerebellar nuclei. cerebellar efferents are relayed back to the vestibular nuclei and the ion (buttner-ennever, 1999) and fed into ascending pathways reaching the posterolateral thalamus and ending in the temporo-peri-sylvian vestibular cortex, where vestibular input converges with other sensory signals (kahane et al. previous studies identified various cerebellar structures that contribute to internal estimates of direction of gravity. these include the nodulus (mossman and halmagyi, 1997), the biventer lobe, and the dn (baier et al., 2008). specifically, lesions of the dn are associated with contraversive otr and contralateral svv deviations (baier et al., 2008). the dn, however, not only receives graviceptive input from the vestibular nuclei but is also interconnected with the ion by the rubro-dentato-olivary tract (guillain mollaret triangle, figure 1; pearce, 2008). however, more recent work suggest that the pathway from the deep cerebellar nuclei through the superior cerebellar peduncle may not synapse to red nucleus neurons (lapresle, 1979), but rather bypasses the red nucleus and directly projects via the central tegmental tract to the inferior olive, resulting in a dentato-olivary pathway (matsuo and ajax, 1979; deuschl et al., 1990; shaikh et al., 2010). schematic illustration of the guillain mollaret triangle projected on a coronal mr-image of the patient, showing the t1-hyperintense subacute ponto-mesencephalic hemorrhage (*). it is also taken into consideration, that the red nucleus may rather be bypassed (lapresle, 1979), resulting in a direct dentato-olivary pathway (dashed line). as a consequence the right central tegmental tract (ctt) is damaged, interrupting the connection between the red nucleus (rn) and the ion. lesions along the central tegmental tract may result in oculopalatal tremor (matsuo and ajax, 1979; deuschl et al., 1990) and hypertrophy of the ipsilateral ion (ruigrok et al., 1990) with its enlarged neurons developing abnormal soma-somatic gap junctions (koeppen et al., 1980; de zeeuw et al., 1998; goyal et al., 2000). ion hypertrophy is not just a histopathological finding but can also be visualized in vivo by mr-imaging (kitajima et al., 1994; previous work suggests that the ion is involved in coordination and timing of movements and motor learning (de zeeuw et al., 1998). here we evaluate whether secondary hypertrophy of the ion leads to contralateral svv tilt indicating hyperactivity of the contralateral dn in line with the current understanding of the guillain mollaret triangle. informed written consent was obtained after a full explanation of the experimental procedure to the patient. the protocol was approved by a local ethics committee and was in accordance with the ethical standards laid down in the 1964 declaration of helsinki for research involving human subjects. svv measurements were obtained on a motor-driven turntable (acutronic, jona, switzerland) at day 16, month 4, and month 38 after symptom onset. to evaluate the svv, the patient was asked to align a luminous arrow (time limit per trial: 15 s; 24 trials per position) along perceived vertical in different whole-body-roll orientations (upright, 45, 90 ear-down) in a random order. the arrow projection started 10 s after the turntable came to a full stop. the arrow starting position deviated randomly between 28 and 72 clockwise (cw) or counter-clockwise (ccw) relative to true earth-vertical. for comparison, svv adjustments (taken at angles between upright and 90 every 15) from a group of healthy normal subjects (n=7) using a similar paradigm were used (tarnutzer et al., 2009). a 65-year-old male patient complaining of acute-onset gait unsteadiness presented with horizontal gaze palsy, impaired upgaze, left trigeminal hypesthesia, and left-sided sensorimotor impairment. brain mri obtained 14 days after symptom onset showed a predominantly right-sided ponto-mesencephalic dorsal hemorrhage, including the medial vestibular nuclei bilaterally, the right superior and lateral vestibular nucleus, the right (and probably also the left) mlf, and the central tegmental tract bilaterally (figures 2a, b). no cerebellar or thalamic structures were damaged. t2-weighted mr-images shows a ponto-mesencephalic high signal hemorrhage (arrow) within the pontine and mesencephalic tegmentum anterior to the forth ventricle the axial (a) and sagittal plane (b) 14 days after symptom onset. follow-up mr after 4 months reveals hypertrophy and prominence of the right ion as illustrated in the axial (c), coronal (d), and sagittal (e) plane images. subjective visual vertical measurements when upright obtained 16 days after symptom onset deviated ipsilaterally (relative to the right ion that later showed hypertrophy) by 3.0 3.0 (mean 1 sd) for clockwise (cw) arrow rotations and by 4.3 3.9 for counter-clockwise (ccw) arrow rotations, whereas in all roll-tilted positions roll under-compensation (svv deviations toward the direction of body-roll) being increased compared to deviations in healthy controls was noted (figure 3). a diagnostic work-up revealed no cause for the hemorrhage and the patient was discharged home. mean (1 sd) svv adjustment errors (trials with cw and ccw arrow rotations analyzed separately) plotted against whole-body-roll in the patient at day 16, month 4, and month 38. for comparison the grand mean (black dots) 2 sd of svv adjustments from seven healthy normal control subjects (data taken from tarnutzer et al. this range covers about 95% of all values and is illustrated by the gray area. at follow-up (month 4) the patient complained of progressive difficulty walking and fixing with the eyes mri showed increased signal and hypertrophy of the right ion (figures 2c e). svv measurements revealed large contralateral (relative to the right ion) deviations when upright being clearly distinct for cw (20.3 10.5) and ccw (10.2 4.5) arrow rotations. for left-ear-down positions, adjustment errors remained in the same range as in the acute stage, while errors were shifted to roll over-compensation (svv deviations away from the direction of body-roll) for right-ear-down roll. the patient returned for regular follow-up visits and 38 months after symptom onset the svv was re-measured. on clinical examination svv in upright position revealed large a large trial-to-trial variability of adjustment errors for both cw (3.8 24.6) and ccw (14.1 14.0) arrow rotations. again svv errors depended on the direction of arrow rotation (figure 3), but now arrow roll adjustments showed under-compensation for both directions. while roll under-compensation for left-ear-down positions were unchanged compared to previous recordings, adjustment errors for right-ear-down positions shifted back from roll over-compensation to roll under-compensation. in this case report we describe for the first time a significant shift in the internal estimate of direction of gravity associated with hypertrophy of the ion. a roll tilt bias in estimated direction of gravity is generally explained by an asymmetric lesion along the ascending bilateral cvp (brandt, 2000). in the acute stage, the svv in this patient deviated rightward, i.e., toward the side of the predominant hemorrhage. thus we assume that the loss of the right vestibular nuclei (known to result in ipsilesional svv deviations; dieterich and brandt, 1993; brandt, 2000) is the main contributor to the svv adjustment errors measured at day 16. however, interruption of the left mlf may also contribute to the svv tilt because mlf-lesions lead to contralateral svv deviations (dieterich and brandt, 1993; brandt, 2000). the shift in svv from an ipsilateral (i.e., rightward) to a contralateral (i.e., leftward) svv deviation observed at month 4 is most likely associated with hypertrophy of the right ion at that stage since the dn is under control of the contralateral ion (pearce, 2008). in the case presented here the predominantly right-sided ponto-mesencephalic hemorrhage interrupted the right central tegmental tract, which most likely explains the hypertrophy of the right-sided ion at follow-up. in the following we provide a hypothetical explanation for the switch from acute ipsilateral (with regards to the side of ion hypertrophy at follow-up) to chronic contralateral svv deviations as a result of the hypertrophy of the ion. we conjecture that the switch in svv tilt is a consequence of removing gaba-mediated inhibitory modulation of the ion neurons provided through the central tegmental tract (best and regehr, 2009). as a consequence synchronized oscillations of large groups of neurons in the ion are then sent to the cerebellar cortex and the deep cerebellar nuclei through climbing fibers (shaikh et al., 2010) and result in a loss of the inhibitory control provided through this pathway (leigh and zee, 2006). this mechanism may lead to an over-excitation of the dn contralateral to the hypertrophic ion and consequently to a tilt toward the side of the over-active dn. over-excitation of the dn leading to a shift in svv toward the side of the stimulated dn is analogous to the reported contralesional svv shifts in case of an inhibition (e.g., by stroke or bleeding) of the dn (baier et al., 2008). the relative improvement of svv errors at month 38 despite the fact that the clinical findings (gait ataxia, vertical torsional pendular nystagmus) persisted and mr-imaging continued to show an increased signal on t2-weighted sequences and hypertrophy of the right ion may indicate distinct mechanisms of adaptation of the involved networks. while the pendular nystagmus is governed by brainstem circuits, estimating direction of gravity is a cognitive task based on multisensory cortical integration, possibly situated within the temporo-peri-sylvian vestibular cortex (kahane et al., 2003). based on the improvement of svv accuracy and the ongoing nystagmus we hypothesize that long-term adaptation has led to a re-weighting of the different sensory input signals used for generating the internal estimate of direction of gravity. thereby the otolith signal might be weighted less and consecutively the internal estimate of direction of gravity is less biased. however, svv measurements at month 38 have to be interpreted with caution, as they varied considerably more from trial-to-trial compared to day 16 and month 4. in summary, this case report further supports the crucial role of the dn in processing vestibular information and how it is modulated by the ion. it suggests that over-excitation of the dn by disinhibition of the ion can result in functional impairment of estimating the direction of gravity. in short, inhibition of the dn (e.g., by an ischemic cerebellar lesion including the dn) leads to svv tilt away from the affected dn (baier et al., 2008) and over-excitation of the dn as reported here leads to svv tilt toward the affected dn. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

interruption of the dentato-olivary projections, interconnecting the dentate nucleus (dn) and the contralateral inferior olivary nucleus (ion), is predicted to interfere with the dn role in estimating direction of gravity. in a patient with pendular nystagmus due to hypertrophy of the ion secondary to predominantly right-sided ponto-mesencephalic hemorrhage, perceived vertical shifted from clockwise to counter-clockwise deviations within 4 months. we hypothesize that synchronized oscillations of ion neurons induce a loss of inhibitory control, leading to hyperactivity of the contralateral dn and, as a result, to perceived vertical roll tilt to the side of the over-active dn.

PMC3350027

pubmed-1052

carbapenem resistant gram-negative bacteria (gnb) such as enterobacteriaceae (cre) (including escherichia coli [crec] and klebsiella pneumoniae [crkp]), pseudomonas aeruginosa (crpa) and acinetobacter baumanni (crab) are important emerging causes of nosocomial blood stream infections and carry significant mortality. urgent threat by the us centers for disease control and prevention (cdc), while the antimicrobial availability task force formed by the infectious diseases society of america had identified crpa and crab of particular importance, because of growing antimicrobial resistance among these isolates and shrinking therapeutic options. indian single center studies overall report a prevalence of carbapenem resistance in up to 12-15% of enterobacteriaceae and 40-60% in a. baumanii and p. aeruginosa. however, there is little data from india about the clinical profile and treatment outcome of infections caused by these organisms. this was a retrospective study performed at a 600 bed tertiary care facility in chennai, india between may 2011 and may 2012. we identified all blood culture results that had yielded a growth of carbapenem-resistant gnb during the study period. blood cultures were performed using bact/alert (biomerieux) culture system, and species ' identification was carried out with vitek-gni card (biomerieux). antibiotic susceptibility was performed using disc diffusion interpretive criteria as per revised clinical and laboratory standards institute performance standards. gram-negative bacteremia was defined as the isolation of gram-negative bacilli in blood culture specimen in at least two bottles of two different culture sets with clinical features compatible with systemic inflammatory response syndrome. clinical parameters analyzed included severity of illness as calculated by acute physiology and chronic health evaluation (apache) ii score on the day of bacteremia onset, presumed source of infection and presence of arterial and venous central catheters or hemodialysis catheters. the source of bacteremia was defined on the basis clinical and microbiologic evaluation using infections criteria proposed by cdc. presence of risk factors such diabetes, recent surgery, organ transplant and immunosuppression were recorded. prior antibiotic usage, dose of colistin and requirement for renal replacement therapy (rrt) after treatment with colistin commenced were also noted. the records of 50 patients with bacteremia caused by crec, crkp, crab, crpa were identified and analyzed. the mean age of patients was 52.3 years and 32 (64%) were male. the most common co-morbid condition was diabetes mellitus (30%), followed by chronic kidney disease (22%). the total mean duration of hospitalization was 24.68 days with a mean of 11.76 days of intensive care unit (icu) care. the mean time to onset of bacteremia was 6.4 days after admission. of the 50 patients, 96% had already received antibiotics, including beta-lactam/beta-lactamase inhibitors (32%) and carbapenems (40%) [table 1]. the mean (standard deviation [sd ]) apache ii score at the onset of bacteremia was 19.64 3.8. thirty-eight percent (n=19) patients had septic shock complicating bacteremia. fourteen episodes (28%) of bacteremia were attributed to ventilator-associated pneumonia (vap), 12 episodes (24%) to the central line related bloodstream infections (clabsi), 10 episodes (20%) were due to intra-abdominal infections (iai) and 9 episodes (18%) to urinary tract infections. the most common causative organism in our study was crkp (44%) followed by crec (26%), while crab and crpa were isolated in 20% and 10% patients respectively [table 2]. observed outcome of patients all patients received a loading dose of colistin with a mean of 5.14 million units intravenously followed by a mean 5.18 million units total daily dose. mean creatinine clearance (calculated estimated glomerular filtration rate [egfr ]) at the initiation of colistin was 52.48 ml/min. six patients (12%) required rrt after initiation of colistin for worsening renal functions; all recovered to normal renal function. the overall survival at 30 days was 40% in our study with lowest survival rates for clabsi (33.3%), with survival rates for vap, iai and urosepsis patients of 35.7%, 40% and 44.4% respectively. overall 30 days survival for crab and crkp bacteraemia were lowest (30% and 31.8% respectively), while survival rates for crpa and crec bacteraemia were 40% and 61.5% respectively. we also found that patients treated with combination therapy had lower mortality (44.8%) compared with colistin monotherapy (66.6%) although this was statistically not significant (p=0.35) [table 3]. carbapenem resistance in gram-negative organisms is increasingly encountered in healthcare-associated infections in india. bacteremic episodes due to these organisms carry a high mortality as shown by previous studies from other countries. in our study, the most common carbapenem resistant gram-negative isolate was crkp (44%) followed by crec (26%) with more than half of all episodes due to pneumonia or clabsi, similar to two previous indian studies presented as abstracts in scientific meetings. our patients had a high apache ii score (19.64 3.8 sd) and had a mean icu stay of 11.76 days, with a mean time of onset of bacteremia after admission of 6.4 days. these results are in concordance with previous studies implicating these organisms as causes of healthcare-associated infections. seriously ill-patients in icus for prolonged periods often require central lines, dialysis catheters, broad spectrum antibiotics, and mechanical ventilation, which make them susceptible to resistant hospital-acquired infections. notably only 40% of our patients had received carbapenems, but virtually all had antibiotic exposure, suggesting that healthcare exposure and overall prior antibiotic exposure may be more important risk factors for developing carbapenem resistant infections rather than prior receipt of carbapenems. colistin has emerged as the cornerstone of therapy for carbapenem-resistant gnb, but the correct dose and frequency of dosing is a subject of on-going study. the mean colistin loading dose in our study was only 5.14 million units followed by mean total daily dose of 5.18 million units intravenously, even with a mean egfr of 52.48 ml/min at colistin initiation. use of low colistin doses may be because of a perceived concern about nephrotoxicity; our study period was also prior to evolution of new colistin dosing recommendations. in our study, six patients (12%) required new onset rrt due to worsening renal functions after colistin initiation but this was fully reversible with dosing adjustments, which was reassuring and similar to other studies. the overall 30 days survival rate in our cohort was only 40%, but it was difficult to assess whether this was due to sepsis itself or due to underlying severe illness and multiple co-morbidities. mortality in our patients was highest when clabsi or vap was the source of bacteremia and when crab and crkp were the causative organisms. better survival rates from the west have been reported, but similar results to ours have been observed in two previous indian abstract presentations. higher colistin doses are associated with higher microbiologic clearance and reduced mortality at 7 days although 28 days mortality did not differ. it is also possible that relatively low dose our patients received may have contributed to mortality. we also observed that patients treated with two drug combinations had a trend towards a higher survival rate than those treated with colistin monotherapy, as observed in other studies also. small study numbers in the two groups and the fact that more severely ill patients may receive combination treatment, may have resulted in the absence of a statistically significant difference. we acknowledge significant limitations in our study: its retrospective nature, relatively small sample size and absence of a control group for comparison. we have shown that carbapenem-resistant gram-negative bacteremia is a serious healthcare-associated infection in critically ill-patients in indian icus with co-morbidities and prior antibiotic exposure; k. pneumoniae is the most common organism at our center. thirty days survival rate is only 40% and even lower for clabsi or vap or when due to a. baumanii or k. pneumoniae. colistin is the cornerstone of therapy and may need to be studied at higher doses to optimize the outcome; nephrotoxicity requiring rrt was seen in 12% of patients only and was reversible in all. combinations of other antibiotics with colistin may result in a lower mortality compared with monothrapy, however this needs needs to be explored through a randomized controlled study

background: growing antimicrobial resistance and limited therapeutic options to treat carbapenem-resistant bacteremia prompted us to evaluate the clinical outcomes associated with healthcare-associated bacteremia. methods:this was a retrospective observational study of carbapenem-resistant gram-negative bacteremia performed at a tertiary care facility in chennai, india between may 2011 and may 2012. results:in our study, patients had mean 11.76 days of intensive care unit (icu) care and mean time to onset of bacteremia was 6.4 days after admission. the commonest organism was klebsiella pneumoniae (44%). patients with combination treatment had lower mortality (44.8%) compared with colistin monotherapy (66.6%); (p=0.35). conclusion: carbapenem resistant bacteremia is a late onset infection in patients with antibiotic exposure in the icu and carries a 30 days mortality of 60%; k. pneumoniae is the most common organism at our center. two drug combinations appear to carry a lower mortality compared with monotherapy.

PMC4238093

pubmed-1053

mass amounts of high-throughput sequenced dna are being produced as a result of metagenomics projects, and new tools are needed to identify the taxonomic content of these environmental samples. currently, biologists have two main goals: (1) classify as many organisms as possible, and (2) assess the genes and functions within the sample. this is especially difficult when the sample contains many uncultivated organisms that have no known reference genome. in addition, the reads obtained from these samples can have short lengths from next-generation technologies, complicating the identification process. such technologies are pivotal in order to sequence as much dna as possible within such a sample in a timely fashion but have a size typically, researchers classify metagenomic reads, or sequenced dna reads, by scoring their alignment to previously sequenced organisms using blast [24]. unfortunately, this underrepresentation has severely restricted the development of an automated system that recognizes sequences from taxa without completely sequenced genomes [5, 6]. in fact, several researchers believe that sequencing error skews our estimates of the abundance of taxa since errors can cause artificial divergence in reads, enough to falsely predict new operational taxonomic units (otus) [5, 7]. recent papers call for ways to infer which species are truly known or unknown from metagenomics samples due to this unwanted variation [5, 7]. huson et al. show that anywhere between 10% and 90% of all reads may fail to produce any hits to known genomes when analyzed with blast, and they develop a last common ancestor (lca) algorithm to assign reads to the most confident taxon (class). in, brady and salzberg also state that they investigate confidence scores for predicting the correctness of the classifier, but they are unable to solve this problem. therefore, a detector is clearly needed for composition-based methods to accept/reject reads based on their known/unknown status. in this paper, we address this detection problem and show that we can use the likelihood scores as confidence scores and can interpolate the scores between different read lengths to obtain a consistent detector of known reads. in this paper, we develop a detector for unknown novel genome reads for use with composition-based methods that can accept/reject reads from novel taxa anywhere in the taxonomic hierarchy. for example, a species-level confidence detector may reject a read but the genus-level detector may accept it. this would indicate that this is a new species within a known genus. to detect these novel genomes, we show that composition-based methods perform better than homology-based methods on the finer resolution of taxonomic levels. the nave bayes classifier (nbc) and phymmbl offer fast and attractive solutions, because they are based on the dna's compositional word-frequency occurrence and are able to give a log-likelihood score or similar that can be used to develop such a detector [8, 9]. nbc and phymm's ease of use, speed of training and testing, combined with its log-likelihood output (or in the case of phymmbl, hybrid scores) make them attractive, simple, yet elegant designs for large-scale metagenomic classification and comparison. in order to design a detector, we partition the available data into three datasets as shown in figure 1. the first is the known dataset, composed of 635 known completed microbial genomes in genbank that were available as of february 2008. then, we use a second dataset consisting of 102 novel genomes, those strains added to genbank from february 2008 to august 2008. this second dataset is used to train the detector to determine whether a read belongs to a known or unknown species/genus. finally, we have a third test unknowns dataset composed of 275 genomes, added to genbank from august 2008 to november 2009. we specifically define the term unknown as a read's taxonomic class does not exist in the training database for the particular taxonomic level/rank being classified. for example, some reads may originate from unknown species/genera but still be known at the phyla level. concept for each dataset in figure 1, and describe their composition in detail in the next section. ultimately, we show that such a detector, in conjunction with composition-based likelihood scores, is able to determine if a read originates from unknown species/genera. in order to accomplish this goal, we start by evaluating the accuracy of nbc, blast, and phymmbl on 102 novel genomes for the species and genus levels (after being trained on the 635 genome training dataset). based on this evaluation, we then design a detector: first by using blast scores followed by using the nbc likelihood scores. we also design a detector for phymmbl using the combination of its phymm-likelihood and blast scores. finally, we compare the performance of the classifier+detectors for the nbc and phymmbl approaches on the test dataset of 275 novel genomes to the blast-based methods: megan, sort-items, and carma. because homology-based methods have never been benchmarked for known/novel detection, we will benchmark these for the first time while also developing and benchmarking composition-based detectors. finally, we demonstrate nbc's, phymmbl's, and sort-item's performance on an experimentally acquired acid mine drainage dataset. the 635 microbes of the known dataset, from, belong to 470 distinct species and 260 distinct genera. 404 strains are the sole member of their species-class while 171 strains are the sole member of their genus in the dataset. this shows that some knowledge will be lacking when it comes to species- and genus-class diversity. while 66 species contain more than one strain, 89 genera contain more than one strain. the microbial strains genome lengths range from 160 k(bp) for candidatus carsonella to 13 mil(bp) for sorangium cellulosum. in order to design the detector, another 102 strains were acquired from genbank and labeled novel and not represented in the known training database. 54 of these 102 novel strains belong to 36 known species while the remaining 48 comprise 46 novel species (with respect to the known database). at the next taxonomic level, 81 of the strains belong to 55 known genera while the remaining 21 comprise 21 novel genera. this is a good known/unknown representation for different levels of the detector because all strains are novel (with respect to the training dataset), approximately 1/2 of the strains ' species classification is unknown, and approximately 1/5 of the strains ' genera classification is unknown. 275 strains were acquired in november 2009 from ncbi, which were all new, completely sequenced microbial genomes, since august 2008. the 275 genomes comprise 156 unique genera, of which 64 are in the known database and 92 are not, and 216 unique species, of which 48 are known and 168 are not. 172 (63%) of the genomes belong to the 64 known genera, and 96 (34%) of the them belong to the 48 known species. strains belong to a diverse set of genera and species; the 275 172=103 (37%) unknown strains belong to 92 novel genera, and 175 96=179 (66%) of the strains belong to 168 novel species. 5 strains from the test set's genera overlap with the unknown genera in 102 genomes used to train the detector. this means that the detector trained on unknown genera that is also represented in 2% of the test set. there is a concern that this overlap may have artificially raised accuracy, but the overlap affects only 2% of the sequences, so we conclude that the artificial increase in performance, if any, is negligible. also, all classifiers have the same training advantage, so it is still a fair comparison. therefore, we do not overtrain our detector on many examples of unknowns that also occur in the test set. it is possible that when designing a detector with a different dataset, some of the unknowns may exist in the novel training data, so this is a realistic dataset. also, there is a good distribution of novel to known strains based on which we would expect 37% of the genomes to be rejected (i.e., declared by the detector to be unknown) at the genus level while 66% to be rejected at the species level. to develop a detector, we compose a roc (receiver operating characteristic) curve using the likelihood scores of the composition-based methods on the training dataset. each score is associated with the binary decision of whether the genome exists in the database or not. the best operating point on the training dataset is determined as the threshold that obtains the best combined sensitivity and specificity, defined by the the maximum point of the summed sensitivity and specificity metrics. draw 100 l-length reads from each of the 737 full genomes (coding and noncoding), where l=500, 100, 25 bp. score the l-length reads (using nbc, phymmbl), where the scores can be interpreted as posterior probabilities of the genomes predicted by the classifiers. construct an roc curve using the algorithm's scores and known/unknown labels. select score threshold corresponding to best operating point for the training data (to be subsequently used on test data). we define the following measures which will be used to compare the methods. detector sensitivity=tp/(tp+fn), where tp is the number of true positives (reads from known taxa correctly identified) and fn is the number of false negatives (reads from known detector specificity=tn/(tn+fp), where tn is the number of true negatives (unknown reads correctly identified as unknown), and fp is the number of false positives (unknown reads labeled as known) number. detector accuracy=total correct decision/total number of reads=(tp+tn)/(tp+fn+fp+tn). classifier accuracy=total correctly classified/totalnumber of reads, where correctly classified means classified correctly into its taxonomic rank. overall classification accuracy=(total detected as known that are also correctly classified)+tn/total number of reads, where the first term can be approximated by (tp+fp)(classifier accuracy). the methods, in addition to nbc, can be accessed via the web. nbc is available for download and online at http://nbc.ece.drexel.edu/. phymmbl is available for download from http://www.cbcb.umd.edu/software/phymm/. sort-items is available for download from http://metagenomics.atc.tcs.com/binning/sort-items/. megan is available for download from http://www-ab.informatik.uni-tuebingen.de/software/megan. to compare several methods for the task of detecting novel genomes, we simulate several scenarios. in the first section, we develop a detector (blast, nbc, and phymmbl) that accepts/rejects reads of unknown species and genera based on each method's score; species/genus levels are informative levels where we would expect to see larger differences between the various methods. also, we narrow our performance comparisons to these levels since many taxa do not have all levels defined (e.g., some taxa have species-, genus-, family- and phyla-level labels but are missing family-, and class-level labels in the genbank taxonomy database). we only develop the detector for phymmbl and nbc, since there are other blast-based detectors, such as megan, carma, and sort-items that perform such a detection task. as a measure of comparison between roc curves in all sections, we assess the area-under-the-curve (auc) metric, a standard measure for detector performance. we then compare the performance of the nbc and phymmbl detectors on a test set and show that they can improve the detector accuracy of the raw method and outperform blast-based methods. we also show the overall classification performance (binning each read into their associated bins) in addition to the unknown class. the poor classifier accuracies on novel genomes leads us to ask how well can classifiers predict unknown taxa. in other words, can blast's bit score or nbc's/phymmbl's score be used to indicate whether a fragment is truly from a new species, genus, and so forth? here, we show the utility of blast's bitscore when accepting/rejecting known/unknown reads. in creating the receiver operating characteristic (roc) curve for blast's bitscore, reads are marked as correct if they are correctly classified. in figure 2, we show blast's ability to accept/reject reads from known/unknown strains for strain, species, and genus levels. we see that each of the optimal operating points is near 100% sensitivity for the three taxonomic levels while the specificities are around 20%, 35%, and 60% for strains, species, and genera, respectively. blast's ability to predict taxonomically known and unknown reads using the bit score/e-value while blast is clearly a good classifier for known organisms within its database, it lacks the ability to reject (declare unknown) novel genomes with both high sensitivity and specificity. we now investigate the feasibility of phymmbl/nbc's score to develop a better detector for known and unknown taxa from using very short-read reads. to develop a detector using the nbc likelihood scores, we vary a threshold and mark reads correct if they are in the database (a looser constraint than being correctly classified). the auc for the 500 bp reads are marginally better than the 25 bp reads, and, interestingly, the genus and species levels perform the same. the roc curves are also constructed for phymmbl for species- and genus-level performance and 500 bp and 25 bp reads. as seen in figure 4, the roc shapes are similar to those of blast's, but with better specificity. the 25 bp species-level specificity for phymmbl is 46% compared to blast's 35%, and the genus-level specificity is 65% compared to blast's 60%. the sensitivity that is sacrificed is only a 1-2% decrease from blast's 99%. while the 500 bp and 25 bp genus-level operating points are the same, the 500 bp read's auc is better than the 25 bp read's auc. for the species level, the 500 bp operating point and auc are better than the 25 bp operating point. one of the obstacles to using the best derived roc operating point is that the threshold changes according to the fragment length. this is an important aspect to address since in any given dataset from next-generation sequencing technology, the read lengths are variable (usually with an average length). to overcome this obstacle and adjust the threshold for each read length, we interpolate between different operating thresholds for the three read lengths previously, the best operating threshold point was chosen for the 500 bp, 100 bp, and 25 bp reads for each of the strains, species, and genus classifications. the best operating point is determined as the point that obtained the combined best sensitivity and specificity, which sum closest to 200% (100% for specificity/sensitivity, resp.). for nbc thresholds for example, using this method on the species level, the nbc log-likelihood best operating thresholds were determined to be 8079, 1445, and 185 for 500 bp, 100 bp, and 25 bp, respectively. a linear interpolation between these points yields a good fit (where the r fit value is 1 3e6 or 1 when rounded). on average for the strain, species, and genus classification, the linear log-likelihood fit is y=16.6x+210, where x is the length of the read and y is the likelihood detector threshold. for phymmbl, we found that the best thresholds for species level were 270.6, 27.4, and 18.5 for 500 bp, 100 bp, and 25 bp reads. even though the phymmbl scores are not truly likelihood scores (since they combines phymm's likelihood score and blast's e-value), the thresholds follow a trend, and we can develop a heuristic interpolation for them. for example, the species-level fit is modeled by y=0.001x 0.0074x 17.75 (where the r fit is again nearly 1). the detectors, developed using the 635 known genomes and the 102 unknown genomes, are used to accept or reject 100 reads from each of the 275 new genomes as known or unknown, respectively. the new 275 genomes are all unknown on the strain level but some have known status on higher levels (as described in the materials and methods section). in addition to evaluating the detectors, we also assess the ability of megan and sort-items to accept/reject taxa via their capability to classify a read at the species/genus level. the sensitivity, specificity, and detector accuracy are calculated for all methods and can be seen in table 1. the detectors ' ability to accept/reject reads from novel species was better than accepting/rejecting reads from novel genera, unlike homology-based lca algorithms that perform better at higher-level taxa. this can be due to the fact that there are more unknown species in the set, and, therefore, if the detector's specificity is high, it will do better on classes with more unknowns. to compare the implementations of nbc+detector and phymmbl+detector against current methods, we downloaded megan version 3.7.2. also, we downloaded the sort-items that was last updated january 7th, 2010 and used tblastx since it requires a protein-blast search. we also benchmarked against webcarma 1.0, run on march 8, 2010. for webcarma, we infered whether a taxon was in the database or not by checking if that taxon showed up in the results file. webcarma only annotated approximately 10,000 of the 27,500 reads resulting in poor genera/species detection and detection accuracy. the results in table 1, which summarize the sensitivity, specificity, and detection-accuracy of nbc and phymmbl detectors, indicate that the performance of the phymmbl detector is better than the nbc detector for 500 bp and 100 bp reads whereas nbc detector is better for the 25 bp reads. we conjecture that nbc is overfitting the operating-point thresholds due to the linear-interpolation heuristic, which interpolates the operating threshold between different-sized read lengths, and a more intelligent interpolation may be needed. on the test data, phymmbl's sensitivities were better than nbc's, but the specificity rates were not as good as nbc's. nonetheless, phymmbl+detector worked better for most of the reads and species/genus levels. it can achieve around 80% sensitivity and 90% specificity for the species level and 50+% sensitivity and 90+% specificity for the genus level. we hypothesize that nbc, because of its dependence on fixed nmer size overfits the data compared to phymmbl, and therefore the thresholds derived on the training dataset do not extend to the test set as well. megan uses an lca algorithm to determine if a read should be assigned to a particular taxonomic level, and sort-items uses additional alignment information. we used the default parameters for the megan and sort-items. in order to do a fair comparison, we used the same blast reports that were generated for the 500 bp phymmbl analysis for megan, and we obtained a tblastx report for sort-items. for the 27,500 reads, 4 reads did not get scored by blast and, therefore, were not even assessed by the methods. if the method assigned a read at the genus/species level, we determined that this read passed its built in detector, regardless of the accuracy of the assignment. in other words, if a read is assigned to the family level, it is considered unknown at the species/genus levels. if a read is assigned to the species level (and, therefore, consequently has most upper-level assignments as well) but is the wrong species and genus, we declare that megan/sort-items detector labels it as known (passed it) at the species-level and genus-level but misclassified it. if method did not assign a read or assigned it above the species/genus levels (e.g., as its family-label), we mark it as rejected for the species/genus level detection. we observe from table 1 that megan has worse specificity for both species and genus levels, than either nbc, or phymmbl-based detectors. for the genus level, megan has the best sensitivity out of all the methods, although its specificity remains low. in order to be able to take the classifier accuracy into consideration in addition to the detector, we define an overall classification accuracy measure as (number of reads correctly classified)+(number of reads correctly rejected)/(total number of reads). the (number of reads correctly classified) can be calculated as (# of reads that pass the detector that are correctly classified). for the species level, megan's detection accuracy, shown in table 2 is worse than the other detection methods. consequently, its accuracy as a detector is about the same or lower than phymmbl's detector. sort-items does not classify below the genus level. as a detector, it has low sensitivity and high specificity, but the sensitivity drastically decreases as the reads get shorter. on the other hand, sort-items has a high positive predictive value for the reads it does pass, and, therefore, it has a high detection accuracy for 500 bp on the genus level, which decreases for shorter reads. unknown genomes were used in the development of the detector as opposed to the 635 known genomes. for nbc+detector and phymmbl+detector, we hypothesize that their performance lowers for genus-level classification compared to the species level because fewer unknown we conjecture that as the database grows and more unknown examples are available, a detector will be more accurate. finally, in table 2, we show how the methods ' classification accuracy (without an unknown class) can be improved with the detector. in this experiment, the classifier method first scores the reads; then, the reads are accepted or rejected using the detector. nbc, blast, and phymmbl all perform 2035% accuracy for the species and genus level, when used in their native form without a detector (we do not benchmark blast+detector, since phymmbl uses blast and performs better than blast). however, when the detector is added, the classifiers ' overall accuracy, defined as the number of reads correctly rejected plus the number of reads identified as known that were correctly classified divided by the total number of reads, significantly improves for both species level and genus-level classification. to calculate megan and sort-items overall classification accuracy, we scored both algorithms ' output as a true positive if it correctly identified the correct genus or species, and we score the output as a true negative if the method only assigned unknown reads to higher than the genus level (in other words, it could not resolve the correct species/genus). for the species level, megan performed worse than classifiers with detectors, as seen in table 2. for the genus level, both methods are better than nbc+detector but is still worse than phymmbl+detector. we conclude that the purely blast-based or composition based algorithms are not as good as the hybrid phymmbl+detector for determining novel species/genera. a question arises; how does the structure of the genomes relate to the novel/known detection. since noncoding regions are much more variable than coding regions, are they more susceptible to errors in the detector methods? we analyzed the 275-genome test set for the composition-based approaches to get an idea of how these different regions perform. we first ran the 27,500 500 bp reads through metagenemark to annotate the coding regions. we have shown that metagenemark has almost 90% accuracy for predicting coding regions for 500 bp fragments. metagenemark did not annotate 766 of the reads, resulting in 2.8% of the 500 bp reads as noncoding. since this is a significant stretch of noncoding dna, we expect to have a small proportion. we then examined the accuracy rates of the detector on the coding/noncoding regions in table 3. we can see that phymmbl has higher accuracy for coding regions than noncoding regions, and nbc is opposite. we hypothesize that since phymmbl partially uses blast, that it is more likely to predict homologous gene regions correctly than noncoding regions. in fact, 32% of noncoding regions failed in the genus-level detection in phymmbl. nbc, on the other hand, which is fully composition based, is more likely to recognize the unique signatures of the noncoding regions and its noncoding genus-level detection accuracy is almost as high as phymmbl's, but its discrimination between known and novel gene regions is not sufficient. while it is important to benchmark methods rigorously on a test set, we can only get a true insight into their usage by examining a real dataset. we, therefore, analyze the soudan acid mine red drainage dataset, which is a sample taken near a borehole of the mine. this is a challenging metagenomics sample because there are 317 k reads, where the average read length in this sample is 100 bp, which some researchers claim are very short reads. in the red soudan mine set, the number of organisms found without the detector was 628/631, using nbc/phymmbl, respectively, out of the 635. this is most likely false, since acid mine drainage is known to be of low complexity. we also found the median number of reads per organism is 214/340 while the mean is 506/503 with standard deviation of+/ 954/545. so, while there is high variance for high-abundance organisms, there is an even spread of hits across the genome training set, highlighting a higher than expected diversity. while the soudan sludge's diversity may be higher than that studied by tyson et al., it is doubtful that it is this high, and this issue highlights the difficulty of analysis on soil and water samples complicated by short reads. therefore, the results in this section should be examined in a critical light, as all of these classifiers performed better for longer reads. the idea is to highlight the advantage of using methods that will filter out unknown taxa accurately, so that we can gain an accurate assessment of known taxa at particular levels. the raw nbc scores found the four most abundant genomes to be (1) flavobacterium johnsoniae with 12,816 reads, (2) trichodesmium erythraeum ims101 with 9641 reads, (3) sorangium cellulosum (so ce56) with 8747 reads, and (4) clostridium beijerinckii with 7300 reads, johnsoniae et al. are not usually found in marine environments while trichodesmium erythraeum ims101 is. while these organisms could come from the soil part of the sludge, it is unlikely that they would survive in such a salty environment. for phymmbl (shown in table 4), the most abundant four genomes are (1) gramella forsetii with 4102 reads, (2) marinobacter aquaeolei with 3885 reads, (3) flavobacterium johnsoniae with 3480 reads, and (4) dinoroseobacter shibae with 3402 reads. phymmbl has identified marine microbes in 1, 2, and 4 that are indeed more likely to be present in the marine sludge. next, the species/genus detectors are evaluated on the dataset. for nbc, only 141 reads out of 317 k passed the species-level detector, and 179 reads passed the genus-level detector. for phymmbl, 794 reads out of the 317 k reads passed the species-level detector while 1053 reads passed the genus-level detector. the detectors may seem too selective because sensitivities of the detectors are suboptimal, as shown in the results section. although as expected, the sensitivity is much higher for the phymmbl detector because it passes more reads. tables 4 and 5 illustrate the distribution of reads that passed the nbc and phymmbl detectors. for nbc, the top hit is marinobacter hydrocarbonoclasticus, which can degrade hydrocarbons and is found in pollution therefore, likely to be present in the sample. the second hit, ruegeria is known to metabolize sulfur and could play an important part in the acid drainage of the mine, therefore, it is also quite likely to be present in the sample. dinoroseobacter shibae is known for its ability to perform aerobic anoxygenic photosynthesis, and since the red sample of the acid mine drainage is near the surface, it is also likely to be present. in, authors found a wide range of metabolisms in the sample, and nbc passed organisms that had a diversity of metabolisms. therefore, we show the power of the detector to discriminate reads that are most likely to be in our database, as opposed to not applying the detector, in which case unknown strains are simply misclassified. phymmbl finds similar organisms but in a different order and since it has higher sensitivity, it is able to find more species/genus reads that pass the detector. the abundant species that are in the top 10 raw reads but did not pass the detector are gramella forsetii, flavobacterium johnsoniae, polaromonas naphthalenivorans, aeromonas salmonicida, and rhizobium leguminosarum. gramella forsetii may be truly present as it is reasonable to find in the sample since it degrades polymeric organic matter, but it is usually found in marine environments, so it is difficult to conclude. flavobacterium johnsoniae and aeromonas salmonicida are fish-born pathogens and could actually be present [25, 26], but this again is hard to conclude. polaromonas naphthalenivorans is likely since it grows on hydrocarbons found in contaminated sediment, so that is a misrejection of the classifier. on the other hand, one hypothesis is that reads that correspond to these bacteria may actually be from closely related but unknown species. another hypothesis is that these reads are from horizontally transferred elements which are responsible for particular metabolisms but actually belong to an unknown species. we also compared against sort-items, since this homology-based method had the best 500 bp classification accuracy for the genus level and was comparable to megan for 100 bp reads. compared to nbc/phymm+detector, the main differences are that it accepts gramella and flavobacterium as a likely genera, although the other detectors reject these. it also finds a likely presence of alkalilimnicola, which is an arsenite oxidizing bacterium and is found commonly in contaminated waters. this intuitively seems likely in the acid mine setting and seems to have an advantage over the other methods. sort-items passes ruegeria, which is known to be in marine-only settings but could be present due to the saline nature. we can see that the phymmbl/nbc+detector methods are more selective in confidently passing reads through the detector than sort-items, and we hypothesize that the composition-based methods, such as nbc and phymmbl, better reject some organisms that are unknown at the genus level. however, it may also be true that the sensitivity of these methods may not be as accurate on a real dataset, as seen with the sort-items discovery of the abundance of alkalilimnicola. all the methods agree that under 1% of the data originates from previously sequenced genera! this agrees with the hypothesis that 90+% of species can not be cultured and, therefore, have not been previously sequenced. this is an amazing result and shows us the difficult problems that metagenomics samples pose. we only examine species/genus classifications in this paper, but we hypothesize that more than 1% can be successfully classified into higher taxonomic levels. we emphasize that this discussion is an exercise in analyzing an extremely challenging dataset that has a diversity of organisms and short 100 bp reads. in this paper, we introduce a novel/known organism detector, an automated approach to determine whether a given organism is previously known or novel. we also rigorously benchmarked all relevant algorithms to assess their performances and to distinguish novel from known reads. being able to discriminate between next-generation sequencing reads that originate from known novel organisms will allow biologists to make new organism discoveries, have higher confidence in those reads that come from previously sequenced species, and discern other domain-level contaminants (such as viral or eukaryotic dna) in the sample. previously developed homology-based methods can be used for such detection, but, as we have shown, those methods are suboptimal, especially at the species level. overall, the phymmbl detector is the best and obtains 85+% accuracy for accepting/rejecting species reads (in novel detection) and 70+% for genus reads. in phymmbl, misclassification of reads that pass the detector causes a 10%/3% drop in overall accuracy for 500 bp reads. for example, for the species-level, the detector accuracy is 86.8%, but it is overall classification accuracy (correctly classifying the known reads plus labeling the unknowns) is 78.6%. this detection classification drop is about 4-5% for megan, but megan has worse detector/classification accuracy to begin with. an impressive factor in sort-items, is that it only drops 0.2% when classifying reads that pass the detector, meaning this method is very confident in correctly classifying any read that passes its detector. this makes sort-items overall accuracy one of the best for the genus level at 500 bp. the next step will be to implement such a detector for upper levels on the tree of life. the end product will then be to supply a probabilistic threshold to users, so that reads that have a likelihood score above this threshold can be confidently labeled as known whereas those whose score falls under this threshold can be confidently labeled as novel. such a detector can give a first pass of all the reads that may belong to the database, and would be useful in determining new species. on the other hand, we can also use this system to determine whether a given taxon is novel at deep branching within the tree of life. once reads are identified to come from novel species, they can then be placed in the phylogenetic tree to determine their position in the tree of life. for example, a read that is on the threshold of detection may just be another allele of a gene within the same species. those with very low scores are more likely to be novel, and then they will have to be aligned and placed in a tree with other sequences to determine lineages. but with the vast amount of information coming from metagenomics datasets (with millions of reads), obtaining a first-pass set of sequences that is a fraction of the original number can significantly reduce computational time of subsequent phylogenetic analysis. this work develops a detector and demonstrates its application to identify known and unknown genomes for composition-based classification methods, and we demonstrate that our detector with a hybrid method outperforms current homology-based methods. effectively, the detector introduces an unknown class and enables classification methods to filter out reads that will not be classified correctly, resulting in improved classification accuracy. in addition to detecting novel genomes, we also propose that the detector can be used to filter out noisy reads that have lowconfidence when scored. we use the previously implemented nave bayes classifier and phymmbl (interpolated markov model plus blast), which assigns a read to the closest match in the database, to design a detector that can detect reads from previously sequenced organisms. we show that nbc and phymmbl scores can be used to determine if a read is from a novel organism in respect to the training database. the overall classification accuracies of composition-based methods are greatly improved when detectors are added to filter out unknown organisms. also, there is only a mild decrease in performance when classifying ultrashort reads as opposed to roche 454 length. we determine that the phymmbl+detector classification performs similarly or better than all the methods. overall, the phymmbl detector obtains 85+% accuracy for accepting/rejecting species reads and 70+% for genus reads and only slightly lower in the overall classification accuracy.

high-throughput sequencing technologies enable metagenome profiling, simultaneous sequencing of multiple microbial species present within an environmental sample. since metagenomic data includes sequence fragments (reads) from organisms that are absent from any database, new algorithms must be developed for the identification and annotation of novel sequence fragments. homology-based techniques have been modified to detect novel species and genera, but, composition-based methods, have not been adapted. we develop a detection technique that can discriminate between known and unknown taxa, which can be used with composition-based methods, as well as a hybrid method. unlike previous studies, we rigorously evaluate all algorithms for their ability to detect novel taxa. first, we show that the integration of a detector with a composition-based method performs significantly better than homology-based methods for the detection of novel species and genera, with best performance at finer taxonomic resolutions. most importantly, we evaluate all the algorithms by introducing an unknown class and show that the modified version of phymmbl has similar or better overall classification performance than the other modified algorithms, especially for the species-level and ultrashort reads. finally, we evaluate the performance of several algorithms on a real acid mine drainage dataset.

PMC3085467

pubmed-1054

an 18-year-old male presented with a complaint of chest discomfort, exertional dyspnea, and an intractable dry cough. chest radiography revealed a mass like lesion in left upper mediastinum and trachea deviated to the right-side. multi detector computed tomography (mdct) revealed a 12 9 15 cm sized heterogenously enhancing mass in anterior mediastinum extending ventrally into the left pectoralis major muscle, and dorsally into the aortic arch, pulmonary artery trunk, and descending aorta, and encroaching the left lung field (fig. 1 and 2) however, the diameters of involved vessels were preserved (not shown), and the trachea and both main bronchi were patent (fig. 2 and 3). transthoracic echocardiography demonstrated minimal pericardial effusion with moderate mitral regurgitation and a left ventricular ejection fraction of 52%. pulmonary function test (pft) findings were within normal limits, and including a peak expiratory flow rate (pefr) of 50% the predicted value. although the patient underwent a fluoroscopy-guided percutaneous needle lung biopsy twice, the type of tumor was not confirmed, and thus, a thoracotomic incisional biopsy was decided upon under general anesthesia. after intravenously injecting 1% propofol and succinylcholine in the supine position, a univent tube was successfully intubated by direct laryngoscopy. anesthetic maintenance was then carried out by the target-controlled infusion of propofol and remifentanil with o2, air, and intermittent intravenous rocuronium. during the first 45 minutes after induction in the supine position, end-tidal carbon dioxide partial pressure (petco2), heart rate (hr) and systolic/diastolic blood pressures were 37-39 mmhg, 109-120 bpm, and 121-181/85-103 mmhg, respectively. even after closing the left main bronchus using a bronchial blocker, pulse oximetry o2 saturation (spo2) was maintained at 97-99%, and central venous pressure (cvp) was maintained at 14-15 mmhg under controlled positive pressure ventilation. he was then placed in the right lateral decubitus for the left thoracotomy approach, and for the first 30 minutes after this positional change, his vital signs remained unchanged. however, spo2 then began to decline, and fiberoptic bronchoscopy demonstrated the left main bronchus was almost totally obstructed, and that the ballooned bronchial blocker had been dislodged into the carina. accordingly, we immediately turned patient supine to relieve the mass effect on the main bronchi. however, hypoxemia was further aggravated up to 65% even after two lung ventilation and increasing the inspiratory oxygen fraction (fio2) to 1.0. nevertheless, blood pressure (112-123/72-77 mmhg) and petco2 (32-36 mmhg) remained in their normal ranges. eventually, the patient was placed in the left lateral decubitus position to detach the mass from the site of obstruction by gravity, and thereafter, spo2 improved from 79% to 93 and then to 97-99%, and cvp simultaneously decreased from 65 to 18-20 mmhg. surgery was then undertaken under a partial (femoro-femoral) cardiopulmonary bypass (cpb) in the right lateral decubitus position. the total bypass time was 150 minutes, and blood pressures and heart rates perioperatively were 89-120/44-50 mmhg and 95-115 bpm, respectively. during bypass, core temperature was maintained at normothermia (36) and petco2 was 36-43 mmhg. a frozen biopsy later confirmed hodgkin's lymphoma. after weaning the patient off cpb, his spo2 was 100%, petco2 42-46 mmhg, and cvp 12-16 mmhg under controlled positive pressure ventilation supplying fio2 1.0. muscle relaxation was reversed using glycopyrrolate and pyridostigmine. after observing full recovery of spontaneous respiration and of extremity muscle power, we extubated the univent tube and transferred the patient to an intensive care unit (icu) with o2 5 l/min administered through a venturi mask. in the icu, no signs of hypoxemia were evident (spo2 98%), and no cardiorespiratory or neurologic abnormalities were found. on postoperative day 2, the patient was moved to a general hospital ward. loss of muscle tone, especially that induced by muscle relaxants, makes airways susceptible to collapse due to external compression by mediastinal masses, and furthermore, the supine position leads to cephalic displacement of the diaphragm and reduces thoracic anteroposterior diameter. in addition, controlled positive pressure ventilation reduces negative intrathroacic pressure, which tend to move the mediastinal mass away from the airway and cardiovascular system. furthermore, in combination, these influences can provoke severe airway obstruction in the supine position under general anesthesia, and thus, the use of muscle relaxants is not recommended under general anesthesia, and accordingly, surgery is best performed under local anesthesia. however, when surgery must be performed under general anesthesia, especially with muscle relaxants, resuscitating methods should be provided to manage cardiorespiratory complications. in addition, a number of resuscitating methods have been introduced, such as, positional changes, tracheobronchial stenting, and rigid bronchoscopy to relieve airway obstructions and cardiopulmonary bypass [6-10]. changing posture is more feasible than any other method, and we recommend before induction that the position which frees the patients from tumor-related cardiorespiratory complications be determined. if this comfortable position is not determined preoperatively, the sitting position is preferable for resuscitation in the presence of an airway obstruction. this position moves the diaphragm caudally and alleviates the pressure of the mediastinal mass on surrounding organs. however, as in our case, the sitting position does not always effectively relieve cardiorespiratory complications during general anesthesia, and as has been previously reported, the lateral decubitus or prone position should then be adopted to enable the nature of the complication to be determined. nevertheless, it is unclear which position is best for clearing an airway obstruction due to a mediastinal mass during general anesthesia. the right lateral decubitus position could either prevent compression of the cardiorespiratory system during induction or relieve hypoxemia and hypotension during general anesthesia, irrespective of whether a tumor in the anterior mediastinum primarily expands toward the left or right side of the chest. however, in another report, the right lateral decubitus position did not solve the hypoxemia or hypotension caused by an anterior mediastinal mass, which was misdiagnosed as a pericardial effusion by preoperative echocardiography. in addition to changing posture, emergency percutaneous cardiopulmonary bypass support or extracorporeal membrane oxygenation (ecmo) support can be applied to an unexpected airway collapse during general anesthesia caused by a mediastinal mass. furthermore, when a patient with a mediastinal mass complains of cardiorespiratory symptoms before induction, it may be advisable to have a prepared cardiopulmonary support system available in the operating room. our case showed a rise in cvp after being positioned in the right lateral decubitus that was sustained even in the sitting position. the right heart and pulmonary artery, which are at lower pressures than the left heart and aorta, are more vulnerable to compression by a mediastinal mass. although the pulmonary trunk was not compressed by preoperative mdct in our case, the positional change might have caused a mass effect on the right heart or pulmonary artery and the observed increase in cvp. however, the maintenance of normal blood pressures suggested a partial obstruction of the pulmonary circulation. furthermore, the airway below the right main bronchus was probably only partially collapsed because petco2 remained in the normal range. when the cross-sectional area of the trachea is compressed by more than 50% of predicted, or pericardial or pleural effusions are visualized by preoperative ct, the patient may be more vulnerable to perioperative complications. furthermore, a peak expiratory flow rate (pefr) by the pulmonary function test (pft) of less than 50% of the predicted value should raise concerns about complications due to a mediastinal mass. in our patient, the preoperative tracheal cross-sectional area was patent, but pefr by pft was 50% of predicted and minimal pericardial effusion was observed by echocardiography. our patient also complained of exertional dyspnea, and thus, we should have expected hypoxemia or hypotension during general anesthesia. in conclusion, positional changes can be used to relieve an unexpected airway obstruction caused by an anterior mediastinal mass. however, before applying this method, it should be considered whether the intended posture is likely to be hazardous or effective. we recommend that when a patient is positioned that the center of the mass should be located in the dependent site of the body.

an 18-year-old male with huge anterior mediastinum mass was scheduled for thoracotomic incisional biopsy under general anesthesia after failed fluoroscopy-guided percutaneous needle biopsy. under propofol and succinylcholine anesthesia, intubation was successfully achieved using a univent tube. however, when we changed the patient's position from supine to right lateral decubitus, oxygen saturation declined. he was then positioned supine, but hypoxemia did not improve. because the tumor expanded toward the left thoracic field, we considered that the left lateral decubitus position might help relieve the mass effect on the main bronchus. his position was changed accordingly and soon after, hypoxemia improved and surgery was undertaken under cardiopulmonary bypass (cpb). the biopsy was successfully performed under cpb without complication.

PMC2946040

pubmed-1055

endometriosis is one of the most common gynecological diseases and is defined as a benign and proliferative chronic disorder characterized by the ectopic presence and growth of functional endometrial tissue, glands and stroma, outside the uterine cavity.14 endometriosis affects ~10% of women in reproductive age and up to 50% of infertile women.48 according to the classification of the american society for reproductive medicine, there are four different stages of endometriosis; stages i and ii represent initial stages, while stages iii and iv are advanced stages.9 the stage of endometriosis is based on the location, amount, depth and size of the endometriotic foci. specific criteria are the extent of the spread of the tissue, the involvement of pelvic structures, the extent of pelvic adhesions and the obstruction of the fallopian tubes.9,10 the stage of endometriosis does not necessarily correspond to the severity of symptoms, and hence a woman in stage i may experience very intense symptoms, while a woman in stages ii iii may have less intense symptoms and signs.9 the pathogenesis of the disease is not fully known, and several theories have been proposed to explain it. the most accepted theory suggests that immune dysfunction and abnormal differentiation of endometriotic tissue may be involved in the development of the disease.3 other possible explanatory hypotheses include genetic, epigenetic or environmental factors.2,3,11,12 moreover, the embryogenetic theory and the potential role of endocrine disruptors are other hypotheses considered to be plausible regarding the pathogenesis of endometriosis.1315 the diagnosis of endometriosis is traditionally based on laparoscopic inspection of the pelvis and should ideally be confirmed by histological examination of the excised lesions.7,16 the most common clinical signs of endometriosis are menstrual irregularities, chronic pelvic pain (cpp), dysmenorrhea, dyspareunia and infertility.4 a significant proportion of women with endometriosis are asymptomatic, and the disease is often diagnosed during laparoscopic investigation due to other pelvic conditions.17,18 three different clinical presentations of endometriosis have been described, peritoneal endometriosis, endometriotic ovarian cysts and deeply infiltrating endometriosis (die).4 die is the most aggressive presentation of endometriosis; it is characterized by an infiltration of>5 mm of endometrial tissue into the retroperitoneal space and accounts for ~20% of the cases.4,19,20 symptoms of endometriosis can often affect psychological and social functioning of patients.21,22 for this reason, endometriosis is considered as a disabling condition that may significantly compromise social relationships, sexuality and mental health.2224 although the impact of endometriosis on mental health and psychological well-being has been investigated in several studies, data published so far are not robust enough to draw firm conclusion. therefore, the aim of this narrative review is to elucidate the impact of anxiety and depression in the management of women with endometriosis. as detailed below, several studies have reported the association between endometriosis and psychological diseases. pope et al25 underlined that endometriosis is related to a wide range of psychiatric symptoms, especially depression, anxiety, psychosocial stress and a poor quality of life. according to recent literature,21,23,2531 depression and anxiety are the most common disorders associated with endometriosis. in this context, a total of 81 women with pelvic pain were studied, of whom 40 had endometriosis and 41 had other gynecological problems. each patient completed six standardized psychometric tests (eysenck personality questionnaire [epq], beck depression inventory [bdi], general health questionnaire, state-trait anxiety inventory [stai], the golombok rust inventory of marital state and the short-form mcgill pain questionnaire) to assess personality, psychopathology, marital state and pain. according to the results of their study, endometriosis patients showed higher psychoticism, introversion and anxiety scores than those of women with other gynecological conditions. in addition, a study by lagan et al30 investigated quality of life, negative emotions, such as anger, anxiety and depression, and possible psychopathological comorbidity in a sample of 166 women with endometriosis. patients completed the following self-report instruments: symptom checklist-90-r, state-trait anger expression inventory-2, self-rating anxiety scale, self-rating depression scale and quality of life index. the results showed that somatization, depression, sensitivity and phobic anxiety are higher in these patients than in women without endometriosis.30 moreover, the same authors found that women with endometriosis are characterized by high levels of anxiety and a significant decline in quality of life. chen et al28 used the taiwan national health insurance research database (nhird) with a longitudinal study design to identify women with endometriosis who were diagnosed with depression or anxiety disorders by board-certified psychiatrists. they found that endometriosis is associated with an elevated risk of developing depression and anxiety disorders.28,29 in full agreement with these data, sepulcri rde and do amaral33 evaluated depressive symptoms, anxiety and quality of life in 104 women with a diagnosis of pelvic endometriosis. the bdi and the hamilton rating scale for depression (ham-d) were used to evaluate depressive symptoms; the spielberger stai and the hamilton rating scale for anxiety (ham-a) to evaluate anxiety symptoms, and the short (26-item) version of the world health organization quality of life assessment-bref (whoqol-bref) to evaluate quality of life. they found that 86.5% presented depressive symptoms and 87.5% presented anxiety and, most important, that psychiatric symptoms were not associated with endometriosis stage.33 in this study, age correlated positively with depressive symptoms, while there was no association between age and anxiety symptoms.25,33 nevertheless, other authors found that only 29% of endometriotic women showed moderate to severe anxiety symptoms, while depression was present in 14.5%.21 these apparently contradictory results may be due at least in part to different methodologies used to identify psychiatric symptoms or to selection biases (in particular, the inclusion of other comorbidities that can severely influence mental health). in addition, endometriotic patients show high levels of alexithymia,31 which further makes it difficult to identify other psychiatric disturbances, due to a severe difficulty in identifying and describing emotions. briefly, the literature confirms a significant incidence of anxiety, depression and psychopathological symptoms among women with endometriosis. these comorbidities could influence the severity of symptoms and the health-related quality of life of affected women.2123,33 the presence of cpp is an important variable to be taken into account when assessing the association between endometriosis and psychological diseases. cpp is defined as a nonmalignant pain perceived in pelvic areas that is constant or recurs over a period of 6 months.34 endometriosis is one of the most common causes of cpp;35,36 indeed, women with endometriosis may suffer from a wide range of pelvic pain such as dysmenorrhea, dyspareunia, nonmenstrual (chronic) pelvic pain, pain at ovulation, dyschezia and dysuria.18,31,35 it is important to underline that pain seems to be independent of the stage of endometriosis, so women with mild endometriosis may have intense pelvic pain while women with more severe endometriosis may suffer less from acute/chronic pain.31,3739 this finding suggests that psychological factors may be involved, which influence pain experience in women with endometriosis.31,37,39 it has been demonstrated that pelvic pain has significant negative effects on women s mental health and quality of life; in particular, women who suffer from pelvic pain report high levels of anxiety and depression, loss of working ability, limitations in social activities and a poor quality of life.3946 several studies have tried to investigate the relationship between endometriosis, pelvic pain and depression or anxiety disorders. lorenatto et al42 compared the prevalence of depression between a group of women with a diagnosis of endometriosis and cpp and a group of women with endometriosis but no cpp. the results of this study show that depression was present in 86% of the women with cpp and in 38% of the women without pain. moreover, the symptoms associated with depression (somatic concerns, work inhibition, dissatisfaction and sadness) were significantly higher in women with pain. according to these data, depression may be the result of the experience of pelvic pain rather than of endometriosis itself. this hypothesis seems to be confirmed by the study performed by souza et al,44 in which 57 patients aged between 25 and 48 years who underwent laparoscopy because of cpp were evaluated for quality of life and depressive symptoms. the whoqol-bref was used to evaluate quality of life while the ham-a and the bdi were used to investigate the presence of anxiety and depressive symptoms. according to their data analysis however, endometriosis in addition to cpp did not have an additional impact upon the quality of life.44 in this regard, roth et al47 compared women suffering from cpp associated with endometriosis with women experiencing cpp due to other medical conditions. participants completed a battery of validated questionnaires assessing demographic status, pain experience and other pain-related symptoms, pain disability, frequency of depressive symptoms, level of affective distress, satisfaction with pain treatment and satisfaction with their marital relationship. interestingly, they did not find significant differences between the two groups for frequency of depressive symptoms and level of affective distress. nevertheless, large cohort analyses37 found that women with endometriosis associated with pelvic pain reported higher levels of anxiety and depression and lower quality of life than women without pain symptoms, and healthy women. although current data do not allow to draw firm conclusions, accumulating evidence suggests that psychopathological diseases might amplify pain symptoms in endometriotic patients31 and, in this way, contribute to create a vicious circle (psychopathological diseases increased cpp worsening of psychopathological diseases; figure 1). summarizing the results of the abovementioned studies (table 1), the experience of cpp should be considered as an important component of having endometriosis and may significantly affect women s quality of life and psychological well-being. more specifically, psychiatric comorbidities associated with endometriosis seem to be an effect of the experience of pelvic pain rather than of endometriosis itself.25,47 the relationship between emotional diseases and perception of pain in women with endometriosis is still unclear. studies on this topic have obtained controversial results; it has not yet been elucidated if depression, anxiety and emotional distress determine an increased perception of pain or if pain causes psychological distress and psychopathological symptoms.31,33,42 however, anxiety and depression could increase pain perception both emotionally and cognitively, determining less tolerance to pain and greater sensitivity to physical sensations in general.33 consequently, further studies are needed to investigate these aspects. treatment of endometriosis can be complex and it is important to take into account several factors such as side effects, the anatomic type of endometriosis, role of previous surgery, infertility and future fertility desires.7,48 the main purpose of treatments should be pain control, improvement of the quality of life, prevention of disease recurrence, fertility preservation and reduction of anatomical damage.48,49 hormonal treatment aims at downregulation of the ovaries, reducing the estrogen stimulation of endometriotic growth.7,4850 the choice of the most appropriate hormonal therapy depends on several factors such as therapeutic effectiveness, tolerability, drug cost, physician s experience and expected patient compliance.48 combined oral contraceptives (cocs), danazol, gestrinone, medroxyprogesterone acetate and gonadotropin-releasing hormone (gnrh) agonists are the most frequently used drugs in the hormonal treatment of endometriosis.49,50 during the last few years, gnrh agonists, which downregulate the pituitary and thereby indirectly the ovaries, have been commonly used as alternatives to gestagens and danazol in order to avoid a high rate of side effects such as weight gain, acne and headache.4952 although the gnrh agonists are effective in reducing endometriosis symptoms, they are often associated with anxiety and depression during treatment.25,49,52,53 for this reason, psychiatric drugs may be considered as adjunctive treatment during endometriosis therapy, even if they can produce side effects and some patients are reluctant to take additional drugs.25,49 there are few studies in the literature about the effects of hormonal treatment for endometriosis on quality of life and psychological functioning of affected women: bergqvist and theorell50 evaluated quality of life and psychiatric comorbidities in a sample of 48 women with endometriosis before, during, and after treatment with nafarelin or medroxyprogesterone acetate, using questionnaires that were both of a general and a more specific nature. they found that there was a significant reduction of symptoms during the study and important factors for quality of life such as sleep disturbances, anxiety and depression symptoms improved significantly after hormonal treatment.50 in partial agreement with the previous study, zhao et al49 investigated the impact of progressive muscle relaxation (pmr) training on anxiety, depression and quality of life of patients with endometriosis undergoing gnrh agonist therapy. the patients were evaluated with stai, hospital anxiety and depression scale depression subtest (hads-d) and sf-36 before and after the pmr intervention. according to the results of this study, pmr training is effective in reducing anxiety and depressive symptoms, which could be associated with gnrh agonist therapy. however, it is important to evaluate previous psychiatric comorbidities that could increase the risk for psychiatric disturbance related to hormonal therapy for endometriosis.25 surgery is the primary treatment for more severe forms of endometriosis, such as die.4,54,55 currently, several gynecological surgeons are attempting to modulate how much their surgery is radical according to fertility desires and future quality of life of the patient. to date, there are few data available in the literature on quality of life and anxiety and depression levels after surgery for endometriosis. a review by deguara et al54 underlined that laparoscopic surgery is associated with improved quality of life and emotional well-being compared to medical therapies. a prospective cohort study by van den broeck et al55 evaluated depression levels, relationship satisfaction and sexual functioning of 203 women who underwent laparoscopic surgery for moderate or severe endometriosis. participating patients completed the bdi, dyadic adjustment scale (das) and the short sexual functioning scale (ssfs) 1 month prior to and 6, 12, 18 and 24 months after the intervention. results showed that radical surgery for endometriosis improved the levels of depression and sexual functioning of the patients.55 these data suggest the importance of psychological factors not only for the severity of symptoms but also in the management of the disease and in the selection of the most appropriate therapy. considering this scenario, we take the opportunity to solicit further studies to clarify the relationship between endometriosis therapies and psychological outcomes, taking into account other endometriosis-associated comorbidities such as infertility.56,57 in particular, it would be interesting to investigate whether a correlation occurs between psychological outcomes and levels of pro-inflammatory cytokines in peritoneal fluid,5860 which are known to play a detrimental role in pain exacerbation61 and may contribute to endometriosis-related infertility.62 endometriosis is a very complex condition and psychological factors have an important role in determining the severity of symptoms and the effectiveness of the treatments. according to recent data, women with endometriosis are at risk for anxiety, depressive symptoms and other psychiatric disorders. since it is still unclear if these comorbidities are a result of endometriosis itself or other factors such as cpp, we solicit further studies about this topic in order to better understand the relationship between endometriosis and psychological diseases. in addition, we take the opportunity to stress the importance of a multidisciplinary approach in the management of women with endometriosis. in this regard, psychological assessment is recommended in order to identify women at risk of developing symptoms of anxiety and depression and provide them an adequate psychological support. the aim should be to reduce as much as possible the impact of endometriosis on quality of life and psychological well-being of these patients.

endometriosis is one of the most common gynecological diseases and affects ~10% of women in reproductive age. the most common clinical signs of endometriosis are menstrual irregularities, chronic pelvic pain (cpp), dysmenorrhea, dyspareunia and infertility. symptoms of endometriosis often affect psychological and social functioning of patients. for this reason, endometriosis is considered as a disabling condition that may significantly compromise social relationships, sexuality and mental health. considering this point, the aim of this narrative review is to elucidate the impact of anxiety and depression in the management of women with endometriosis. psychological factors have an important role in determining the severity of symptoms, and women who suffer from endometriosis report high levels of anxiety, depression and other psychiatric disorders. in addition, endometriosis is one of the most important causes of cpp; women with endometriosis suffer from a wide range of pelvic pain such as dysmenorrhea, dyspareunia, nonmenstrual (chronic) pelvic pain, pain at ovulation, dyschezia and dysuria. several studies have underlined the influence of cpp on quality of life and psychological well-being of women with endometriosis. data suggest that the experience of pelvic pain is an important component of endometriosis and may significantly affect emotive functioning of affected women. it has been demonstrated that high levels of anxiety and depression can amplify the severity of pain. further studies are needed to better understand the relationship between psychological factors and perception of pain. treatment of endometriosis may be hormonal or surgical. surgery is the primary treatment for more severe forms of endometriosis. there are few data in the literature about the influence of psychological factors and psychiatric comorbidities on the effectiveness of treatments. it is important to evaluate the presence of previous psychiatric diseases in order to select the most appropriate treatment for the patient.

PMC5440042

pubmed-1056

in 1978 when the nobel prize in physiology and medicine was awarded jointly to a german, werner arber, and the two americans, daniel nathans and hamilton o. smith, " for the discovery of restriction enzymes and their application to problems of molecular genetics, " public health laboratories in europe were essentially still structured in the same way as when they were originally founded. in the late 1890s robert koch had initiated routine testing of stool specimens to detect human carriers of salmonella typhi. screening for corynebacterium diphtheriae, for streptococcus pyogenes (the causative agent of scarlet fever, then a feared infection) and mycobacterium tuberculosis were other major tasks for public health laboratories, at a time when eradicating pathogens by detecting and isolating human carriers was considered feasible. in the following decades, subtyping, the characterization of microorganisms beyond the species level was restricted to exceptional situations, with results often coming in months after the actual problem had occurred. however, infectious disease challenges are manifold and not of static nature. identifying human carriers the changes in infectious diseases are the result of ongoing changes in human demographics and behaviours, of changes in technology and industry, changes in economic development and land use, increasing and rapid international travel and commerce, ongoing microbial adaptation, and also the consequence of public health measures. addressing infectious diseases unabatedly requires a strong public health infrastructure to detect and rapidly respond to these emerging threats to health. identifying clones of pathogens quickly and reliably is now of crucial importance if public health authorities are to respond effectively to the threat posed by a specific infectious source. one of the most notable benefits resulting from the discovery of restriction enzymes is the ability of the new armoury of molecular methods to characterise and quickly identify bacterial clones. in the last three decades, dna fingerprinting thchniques have become an indispensable tool in the everyday work of public health laboratories; restriction enzymes were the key to this innovation. for the public health laboratory system in austria (total population 8.3 million), the implementation of these new methods has effectuated a complete restructuring, with a switch from geographic allocation of tasks (six laboratories each serving a certain geographic area) to allocating special tasks to the only two remaining laboratories, each offering specialized service to all of the country. in this special article, the author discusses the variegated applications of molecular typing in today's public health laboratories by presenting three case studies to help illustrate preventive management strategies relying on subtyping. these examples originate from the daily routine work of the austrian agency for health and food safety (ages). ages is an independent statutory agency established by the austrian health and food safety act in 2002. the austrian examples presented here are from the years 2010/2011 and are supposed to give an overview of the diverse fields of applications of various dna subtyping methods routinely employed in everyday work. restriction fragment length polymorphism (rflp) analysis is a direct result of the work of w. arber, d. nathans and h.o. dna macrorestriction analysis by pulsed field gel electrophoresis (pfge), which revolutionized precise separation of dna fragments greater than 40 kb, has even become the gold standard for subtyping of food borne pathogens like listeria, salmonella, campylobacter and bacillus cereus. cantor developed this variation of agarose gel electrophoresis in which the orientation of the electric field across the gel is changed periodically (" pulsed ") rather than kept constant as it was in conventional agarose gel electrophoresis. this technology separates large fragments of unsheared microbial chromosomal dna obtained by embedding intact bacteria in agarose gel plugs, enzymatically lysing the cell wall and digesting the cellular proteins. subsequent restriction fragment length polymorphism analysis allows differentiation of clonal isolates from unrelated ones. in april 2010, the austrian reference centre for salmonella noticed a sudden increase in the number of salmonelloses due to a usually rare serotype: while only five human salmonella enterica subsp. enterica serovar mbandaka-infections were documented in the year 2009, 19 such cases were noticed during the two weeks from march 10 to march 31. isolates were subjected to molecular analysis using pfge and isolates from the year 2010 were found to be indistinguishable from each other but clearly different from those received in previous years. epidemiological investigation revealed consumption of raw or insufficiently heated eggs or egg dishes as the highly likely source of infection. because the epidemiologically incriminated eggs were traced to 56 different austrian producers but no increase was noticed in neighbouring countries, like germany or italy, 226 laying hen flocks serving the 56 producers were environmentally sampled. although three months had passed between the beginning of the outbreak and sampling of the farms, faecal dust samples from two laying hen flocks still tested positive for the outbreak strain, as did a specimen from a commercial feed product taken at one of these two farms. from the farm with the positive feed sample, 290 consecutive eggs were tested using pools of five eggs each (testing separated for surface and egg content): salmonella mbandaka was cultured from one of 58 tested pools on egg surface only. the investigation proved that consumable eggs were the vehicle of this outbreak, and that salmonella mbandaka was introduced into the laying hen flocks involved-from 8 of the 9 austrian provinces-via commercial feed. further investigations, with microbiological testing of 226 additional laying hen flocks and tracing their feed supply, finally identified one austrian feed mill as the sole source of the incriminated feed. figure 1 presents the pfge patterns of the outbreak clone using the restriction enzyme xbai in comparison with isolates of sporadic cases gained in previous years; salmonella braenderup h9812, which gives rise to a broad spectrum of precisely defined bands, was used as internal standard. the comparison of pfge patterns from human isolates, food isolates, animal isolates and feed isolates allowed us to identify and confirm the sources of disease. once an epidemiological investigation has identified a potential source, pfge can help confirm that the outbreak strain is found in some stage of food production. this leads to a better understanding of the means of contamination and spread and therefore to better control interventions. however, the time required to complete the procedure (> 1 day), the need for relatively specialized equipment for electrophoresis and the fact that pfge generates band patterns that are difficult to share between laboratories are major disadvantages inherent in this method. the analysis of banding patterns can be time-consuming, and the interpretation of banding patterns is somewhat subjective. as a result, improved methods are being sought, but as yet no single method has been able to replace pfge. ten years ago, gel based rflp analysis using the repetitive insertion sequence is6110 as a probe was still considered the gold standard for typing of mycobacterial strains. however, the technical steps of is6110 rflp were both labor-intensive and lengthy. moreover, sophisticated computer image analysis software was required for fingerprinting in large-scale analysis. therefore, typing of mycobacteria has nearly completely switched from rflp analysis to a polymerase chain reaction-based typing method that relies on the analysis of tandem repeats present in the mycobacterium tuberculosis complex-genome in up to 41 genetic elements. these genetic elements, called mycobacterial interspersed repetitive units (mirus), are scattered throughout the genome, with a variable number of copies of the repeat unit in each locus. miru-variable-number tandem repeats (vntr) analysis generates numerical values that can easily be shared between laboratories .the availability of whole-genome sequences has facilitated the discovery of these vntrs, loci that contain short strings of nucleotides that are repeated a few to many times. this has led to the birth of this new subtyping method, also called multilocus vntr analysis (mlva). results are depicted by numerical codes, giving the number of miru alleles at each locus tested. the following example shows the potential of this molecular subtyping method to disprove an epidemiological connection. the simultaneous occurrence of tuberculosis in cattle and deer in western austria and cases of human tuberculosis in eastern austria were noted in early 2011 and prompted an investigation to elucidate a possible connection. mycobacterium caprae, a recently defined member of the mycobacterium tuberculosis complex, causes tuberculosis among animals and, to a limited extent, in humans in several european countries. while in the ten year period until 2009, there was only one human tuberculosis case with mycobacterium caprae documented in austria (in 2008), in 2010 three such cases were registered for this mandatorily reportable disease. already in fall 2008, the western provinces tyrol and vorarlberg had begun to test all cattle for tuberculosis, after documenting occurrence of mycobacterium caprae in some herds of one of nine tyrolean districts. cattle were supposed to have become infected after grazing on alpine pastures contaminated by diseased deer. in the affected district, the county of reutte, neighbouring the province of vorarlberg, more than 10% of the red deer (cervus elaphus) population was found to be infected with mycobacterium caprae. overstocking and winter feeding (with " unnatural " crowding of deer at few feeding places) the sudden emergence of three human mycobacterium caprae infections in 2010 raised the question as to whether there was an epidemiological link between animal and human illness. figure 2 depicts the geographic origin of the mycobacterium caprae infections in cattle, deer (unpublished ages data) and humans documented in 2010 [16-18]. miru patterns from deer and cattle isolates were indistinguishable from each other, but clearly different from the three patterns of the human isolates. the molecular genetic analysis did not reflect patterns indicative of spread of mycobacterium caprae from the veterinary outbreak in western austria to the human cases in eastern austria. miru-vntr results were substantiated by epidemiological findings: patient a, a 13 year old girl of turkish ancestry living in vienna probably became infected when visiting her grandparents in rural turkey during summer breaks. patient b, a 85-year-old lady from lower austria, probably got infected by her late husband, who had the cattle of his farm culled due to bovine tuberculosis in the early 1960s. patient c, a 70-year-old patient from upper austria probably got infected around 1965, when the cattle of his farm had to be culled by public order because of tuberculosis. molecular typing was not only able to exclude a connection between the recent re-emergence of tuberculosis in cattle and deer with the occurrence of human mycobacterium caprae cases but even to disprove the existence of a human outbreak. ten years ago, a single-endonuclease, amplified fragment length polymorphism analysis method by which the patterns are resolved by standard agarose electrophoresis, was adopted as an international standard by the european working group for legionella infections (ewgli), especially for cases of travel-associated legionellosis. however, while this method allowed relatively reliable screening of isolates within a single laboratory, inter-laboratory comparison of the results still posed a significant hurdle. therefore, ewgli developed a sequence-based typing (sbt) scheme for clinical and environmental isolates of legionella pneumophila, which is presently widely used in europe in the investigation of outbreaks of legionellosis caused by legionella pneumophila. the advantages of using a multilocus sequence typing approach with nonselective housekeeping genes has been well documented for various microorganisms. using the so-called sbt protocol, the sbt database (provided by ewgli in conjunction with the london based health protection agency and the european centre for disease prevention and control in stockholm under http://www.hpa-bioinformatics.org.uk/legionella/legionella_sbt/php/sbt_homepage.php) allows assignment of the seven ordered alleles, flaa, pile, asd, mip, momps, proa, and neua as described by gaia et al. and ratzow et al., and representation as one of presently 1032 sequence types (st). st 81 for instance has the allelic profile, i.e. the ordered string of allele numbers separated by commas, 2,10,3,28,9,4,9. the following example on legionella pneumophila underlines the considerable potential of this molecular typing method to elucidate connections between an environmental source, in this case a hospital drinking water system, and a case of human illness. at the end of july 2010, the austrian reference centre for legionella learned about a case of legionella pneumonia in a 70 year old female patient, who had died on july 26. onset of symptoms had occurred on july 22, admission to hospital c on july 24. a urinary antigen test performed on day 2 of hospitalization was positive for legionella pneumophila. the patient, who also suffered from neoplasm bronchi with brain metastases, had previously been hospitalized in hospital a for chemotherapy from july 6 to 16, and after spending four days at her private home (from july 16 to 20)-in hospital b for -knife intervention (july 20 to 21). in order to identify the environmental source of infection, efforts were made to obtain a patient isolate for comparison with possible future environmental isolates. a blood culture drawn on july 25 (with a negative result reported by the laboratory of hospital c) two blood culture bottles were sent to the national reference laboratory and volumes of 0.1 and 0.5 ml were directly plated onto buffered charcoal yeast extract agar with and without glycine, vancomycin, polymycin b and cycloheximide supplementation (oxoid, cambridge, uk). after incubating for five days, approximately ten colony forming units (cfu) per ml blood culture medium were gained: legionella pneumophila serogroup (sg) 1 (st 81) and legionella pneumophila sg 3 (st 93). double infection is a rare, but not unusual phenomenon, be it in salmonellosis, in tuberculosis or in legionellosis. for the health administrators in charge, an available isolate usually initiates an attempt to identify the source of the patient's infection in order to prevent further fatalities. legionella is often found in warm and cold water systems of buildings; without proof of clonal identity, the mere demonstration of legionella pneumophila in a water system can not be regarded as proof of causal relation with illness. within the incubation period of 2 to 10 days the testing of water samples, drawn from the patient's room in hospitals a and b and at her home, demonstrated legionella contamination in all three facilities. water samples (cold and hot water, mixed) obtained on july 29 from the room occupied by the patient during her stay in hospital a yielded 1 cfu legionella pneumophila sg 1 (st 81)/100 ml from the sample " hand washbasin tap " and 7 cfu legionella pneumophila sg 3 (st 93)/100 ml from the sample " shower ". water samples (again cold and hot water, mixed) obtained on july 29 from the room occupied by the patient during her stay in hospital b yielded 1 cfu legionella pneumophila sg 1 (st 442)/100 ml from the sample " shower ". water samples obtained on august 4 from the patient's home yielded 1-220 cfu legionella pneumophila sg 10/100 ml. sequence based typing revealed that hospital a was the causative reservoir. the financial resources necessary to sanitize this contaminated drinking water system would not have been allocated without microbiological proof of a causal connection with human illness. molecular typing of pathogens causing diseases complements the traditional epidemiological surveillance by providing appropriate discriminatory analyses to foster rapid and early detection of dispersed clusters or outbreaks, and for detection and investigation of transmission chains. it also supports studies to trace-back the source of an outbreak and to identify new risk factors as the strains can be linked more accurately to epidemiological and clinical data. all of this information can be applied towards improving and better targeting existing infectious disease prevention and control measures and thus presents a clear and immense benefit for the public health and public health policies. molecular typing has evolved to become a routine tool in the daily work of public health laboratories. as this holds true not only for austria, but also for many other european member states, extensive work is presently being done to prepare for a molecular infectious diseases surveillance system in the european union. starting with food and waterborne diseases and with tuberculosis, the ecdc in stockholm, sweden, focuses on establishing centralised databases for typing results from pfge and from mlva. in the case of food and waterborne diseases, this will enable the linkage of national sporadic cases or outbreaks across the european member states ' borders and beyond. the system will start with nontyphoidal salmonella, enterohaemorrhagic escherichia coli and listeria monocytogenes and it will be compatible with the global surveillance of food and waterborne diseases-system led by the centers for disease control and prevention in atlanta, georgia (pulsenet international) and the world health organization in geneva, switzerland (global food-borne infections network). to enhance capacity building in the european member states, an mlva implementation project has already been initiated with the aim to support establishment of the methodology in mycobacterium tuberculosis reference laboratories. to enhance the capacity for pfge methodology, a first hands-on workshop took place in june 2011 in order to support listeria monocytogenes molecular typing implementation as a prerequisite for effective surveillance systems so the challenge is now no longer to simply type microorganisms, but to type them in a unified way that allows for data exchange between public health laboratories all over the world. to accomplish that, a significant investment in bioinformatics will be required in order to translate large amounts of metagenomics (gene-based) data into a form that provides useful epidemiologic information. new dna sequencers can determine more than 100 megabases of dna sequences per run, and new sequencing technologies eliminate the bacterial cloning step used in traditional sanger sequencing. instead, they multiply single isolated dna molecules and analyze them with computers capable of massive parallel processing. the emphasis of future dna subtyping developments should be on the use of sequence based metagenomics rather than on the gel based methods still used in many public health laboratories. the end-point of typing techniques will be sequencing a whole genome of a pathogen which has the highest discriminatory power. however,-as illustrated by the examples of molecular typing presented in this manuscript-for epidemiologic purposes for many diseases methods with lower discriminatory power are presently the gold-standard for public health purposes. addressing emerging infectious diseases requires international and interdisciplinary partnerships to assemble an appropriate infrastructure to detect and respond to these threats to health. sequence-based typing methods are offering new perspectives of enhanced resolution and comparability of typing systems for public health applications. as gene sequencing technology develops further and methods of sequence analysis become even more user-friendly, new typing methods will evolve and promote acceptance of routine molecular typing in public health laboratories even more .

using three austrian case studies, the variegated applications of molecular typing in today's public health laboratories are discussed to help illustrate preventive management strategies relying on dna subtyping. dna macrorestriction analysis by pulsed field gel electrophoresis has become the gold standard for subtyping of food borne pathogens like listeria, salmonella, campylobacter and bacillus cereus. using a salmonella mbandaka outbreak from the year 2010 as example, it is shown how the comparison of patterns from human isolates, food isolates, animal isolates and feed isolates can allow to identify and confirm a source of disease. an epidemiological connection between the simultaneous occurrence of tuberculosis in cattle and deer with cases of human tuberculosis due to mycobacterium caprae in 2010 was excluded using mycobacterial interspersed repetitive units variable-number tandem repeats subtyping. also in 2010, multilocus sequence typing with nonselective housekeeping genes, the so-called sequence based typing protocol, was used to elucidate connections between an environmental source (a hospital drinking water system) and a case of legionellosis. during the last decades, molecular typing has evolved to become a routine tool in the daily work of public health laboratories. the challenge is now no longer to simply type microorganisms, but to type them in a way that allows for data exchange between public health laboratories all over the world.

PMC3278599

pubmed-1057

cryptorchidism (undescended testis) is the most common congenital malformation in newborn boys, occurring in approximately 3% of full-term infants. in most cases, the undescended testes seen after birth descend normally within a few months, and only 1% of patients with a persisting cryptorchid condition require medical or surgical treatment. it is well known that undescended testes, if untreated, lead to an increased risk of testicular malignancy, usually seminomas that arise from mutant germ cells. urry et al. reported that azoospermia was evident in 13% of patients with unilateral cryptorchidism; this rate increases to 89% in untreated bilateral cryptorchid patients. intratubular germ cell neoplasia (itgcn) is the most common precursor of testicular malignancy. dieckmann and skakkebaek reported that approximately 50% of patients with itgcn will develop an invasive testicular germ cell tumor within five years, and pourkeramati et al. found that 23.08% of infertile men with intra-abdominal testis had itgcn based on examinations of orchiectomy specimens furthermore, the incidence of itgcn has markedly increased over the past decade, and hence, it is essential that it is promptly and accurately diagnosed in patients with cryptorchidism. in the present retrospective study, we aimed to determine the incidence of itcgn in postpubertal cryptorchidism, and the usefulness of immunohistochemical staining in its diagnosis. in addition, we analyzed the degree of spermatogenesis to evaluate the fertility of these patients. between january 2002 and august 2012, we performed orchiectomy in 31 postpubertal patients (aged 12 years or over) with unilateral cryptorchidism after counseling them about the risk of malignancy, androgenic dysfunction, and male infertility. cryptorchidism was defined as a condition where testis that was not descended into the scrotum. this study was approved by the institutional review board of yonsei university wonju college of medicine (ywmr-12-0-027). one pathologist (m.e.) reviewed all the slides to confirm the pathologic diagnosis. the specimens were evaluated for itgcn using immunohistochemical staining with antibodies against placental-like alkaline phosphatase (plap) and oct 3/4, as it is difficult to recognize itgcn based on hematoxylin-eosin (h&e) staining alone. malignancy was defined cytologically as the presence of atypical germ cells that showed a significant increase in size, were clearly pleomorphic, had hyperchromatic nuclei, and were arranged in layers attached to the basal tubular membrane. none of the cases involved infiltration of the interstitium or showed signs of inflammatory lymphocytic infiltration. to confirm the diagnosis of itgcn, sections from the testis were stained with oct 3/4 and plap antibodies. in order to assess fertility, this involved assessing 100 tubules and recording their heterogeneity by grading them between one and ten using the most advanced germ cell contained in the tubule. a key assumption is that the progressive degeneration of the tubule invariably features the loss of constituent cells in a defined order beginning with the most mature (spermatozoa), followed by the spermatogonia, and then the sertoli cells. all tubules were classed from ten (normal) to one (no germ or sertoli cells), with the midpoint on the scale represented by tubules that contained spermatocytes as the most advanced cell type. the mean patient age at the time of surgery was 34 years (range, 17-74 years). the majority of the patients (21 of 31) presented with an empty scrotum, and the undescended testis was found on subsequent examination. abdominal cryptorchidism was present in four patients, while inguinal retention was found in 27 patients. one patient (3.2%), a 20-year-old man with abdominal cryptorchidism, was confirmed to have itgcn based on immunohistochemical nuclear staining for plap and oct3/4 in the surgical specimen (fig. histological assessment of spermatogenesis revealed that the mean johnsen score was 3.42 (range, 1-9). the most frequent (12 of 31 patients) johnsen score was 2 (no germ cells present). the majority of patients (27 of 31) presented with impaired spermatogenesis with a johnsen score of<5 (no spermatozoa or spermatids, but many spermatocytes present). there were two patients each with a johnsen score of 6 (only a few spermatids present) and 9 (many spermatozoa present but the spermatogenesis is disorganized). several putative risk factors for testicular malignancy have been identified, although there is generally only limited evidence to support their prognostic value. concluded that cryptorchidism is the most widely accepted risk factor for testicular cancer, and is associated with a relative risk of between 3.7 and 7.5 times that among the general population. granados loarca and esau ortega reported that one of the 25 (4%) postpubertal undescended testis patients they assessed had seminoma, and similarly, ben jeddou et al. found that two of 81 patients aged>14 years with undescended testis had malignant disease. in the present study, one of the 34 men with untreated postpubertal undescended testis was diagnosed as having itgcn. interestingly, the overall incidence of itgcn in intersex states was found to be higher than in the normal group (6%, six of 102 cases), and was significantly higher in the pubertal age group. it is important to elucidate the frequency with which itgcn occurs to appropriately monitor the at-risk groups. periodic testicular self-examination, close follow-up by the physician, and periodic testicular ultrasound are mandatory. subtle changes in internal testicular architecture, even in the absence of suspicious palpable findings, may warrant a biopsy. (we attempted to contact the patient who was confirmed to have itgcn to perform physical exam and check paternity but failed.) several immunohistochemical markers have been used to identify malignant germ cells in adult cases of itgcn, the most common of which include plap and oct 3/4. on the basis of multiple findings, it has been hypothesized that itgcn originates early during fetal development. this is illustrated by the presence of a number of markers common to itgcn and immature germ cells, including plap and oct 3/4. plap shows membranous positivity in 90%-100% of seminomas, and oct 4 shows uniform nuclear staining in all seminomas. given the risk of itgcn or malignancy in postpubertal undescended testis, immunohistochemical staining for plap and oct 3/4 was recommended as part of the diagnostic process, and preventive orchiectomy might be needed after informing patients of the consequences of testicular preservation and the likelihood of their removal in the therapeutic process. in other studies, immunohistochemical study underwent in cases with germ cells did not show itgcn on routine h&e staining. however, in our study, every specimens were evaluated for itgcn using immunohistochemical staining for plap and oct 3/4, along with routine h&e staining. ford et al. reported that spermatogenesis is severely impaired in persistently undescended testis. pryor et al. found itgcn in testicular biopsies with low johnson's criteria scores and atrophic germinal epitheliums, and other studies have also shown that itgcn and invasive testicular tumors occur at a high incidence in patients with undescended testis, which are characterized by atrophic germinal epitheliums. in our study, the specimen that was positive for the germ cell tumor markers also showed a low johnsen score, which is consistent with these other studies. oct 3/4 and plap have a high sensitivity and specificity for diagnosing itgcn in adults. however, these proteins are present in a very high proportion of germ cells in the testis of normal neonates and young infants with cryptorchidism. the presence of these markers is generally related to the early stages of fetal germ cell maturation that normally proceeds in the neonate, but requires a longer period in cryptorchid testes due to delayed maturation. therefore, in contrast to the situation in adolescents and adults, these markers can be unreliable for the detection of itgcn in very young children, and thus, care is needed when interpreting the results of oct 3/4 and plap immunohistochemical staining in these patients. first, it was retrospective in nature and was based on a review of medical records. second, there may have been a selection bias, because only patients in a single center were enrolled. third, paternity was not investigated, and therefore, we could only use the johnsen score to assess fertility. we suggest that preventive orchiectomy should be performed in cases of postpubertal cryptorchidism because of its malignant potential and subsequent risk of infertility in some patients. before performing preventive orchiectomy, we should discuss the possibility of androgenic dysfunction and male infertility with the patient. after surgery, the pathologist should perform immunohistochemical staining for plap and oct 3/4, which are frequently expressed in testicular malignancy, because itgcn may be overlooked when using h&e staining alone.

purposeit is well known that testicular germ cell tumors arise with increased frequency in patients with cryptorchidism. in addition, intratubular germ cell neoplasia (itgcn) is a precursor lesion to testicular germ cell tumor. approximately 50% of patients with itgcn will develop an invasive of testicular germ cell tumors within 5 years. therefore, we evaluated that the incidence of itgcn in postpubertal cryptorchidism. materials and methodsbetween january 2002 and august 2012, orchiectomy specimens from 31 postpubertalpatients (aged 12 or over) with cryptorchid testis were reviewed. the specimens were evaluated for itgcn using immunohistochemical stains of placental-like alkaline phosphatase and oct 3/4 with routine hematoxylin-eosin stain. additionally, the degree of spermatogenesis was assessed using the johnsen score. resultsmean age was 34 years (range, 17 to 74 years) at surgery. all patients were diagnosed as unilateral cryptorchidism. one patient (3.2%) of 20-year-old had itgcn in surgical specimen with all positive markers. histological assessment of spermatogenesis showed that mean johnsen score was 3.42 (range, 1 to 9). majority of patients (27 of 31) presented impaired spermatogenesis with low johnsen score lesser than 5. conclusionsconsidering the risk of malignancy and low spermatogenesis, we should perform immunohistochemical stains and discuss preventative orchiectomy for the postpubertal cryptorchidism.

PMC4500808

pubmed-1058

copd is a heterogeneous condition, with pathophysiological abnormalities that vary in severity between patients.1 small airway inflammation is a common feature of copd,2 causing a reduction of the cross-sectional area of the small airway lumen. small airway narrowing and collapse can cause gas trapping on expiration and hyperinflation.3 the presence of hyperinflation is associated with greater dyspnea and reduced exercise tolerance.4 impulse oscillometry (ios) measures respiratory resistance and reactance during tidal breathing using sound waves of different frequencies.5 resistance is the loss of energy arising from friction or turbulence, while reactance is the capacity for energy storage, which is dependent on the elastic properties of the lungs. copd patients typically have increased total airway resistance and a greater negative reactance compared to healthy subjects.6 small airway narrowing and closure during expiration can prevent low-frequency oscillometric signals from traveling to the distal lung.6 these regional choke points within the airway tree are present during expiration but not during inspiration, and cause expiratory flow limitation (efl). dellac et al7 used within-breath analysis to show that the difference between inspiratory and expiratory reactance at 5 hz (known as x5) identifies efl during tidal breathing in copd patients; x5 of 0.28 kpa/l/s has a high specificity and sensitivity for detecting efl. copd patients with higher x5 values have greater dyspnea.6 the aim of this study was to quantify the proportion of copd patients with efl, and to further characterize the clinical characteristics of patients with efl. we also studied whether the presence of efl is stable after 2 years of follow-up. a total of 147 copd patients were recruited (75 from the copdmap cohort) with 45 patients attending for follow-up at 2 years. patients were aged>40 years, with post-bronchodilator forced expiratory volume in 1 second (fev1)/forced vital capacity (fvc) ratio of<0.7, 10 pack-year smoking history, and had no history of asthma. the study was approved by the greater manchester ethics committees (ref: 10/h1003/108) and all patients provided written informed consent. copd patients performed the following procedures at baseline and 2-year visit: st george s respiratory questionnaire (sgrq), copd assessment test (cat), dyspnea visual analog scale (vas), spirometry with reversibility, ios (masterscreen; erich jaeger, hoechberg, germany), plethysmography, diffusing capacity of the lungs for carbon monoxide (dlco), and the 6-minute walk test, as previously described.8 plethysmography, dlco, and spirometry (vmax, carefusion, hoechberg, germany) were performed according to the ats/ers guidelines.911 x5 was calculated as mean inspiratory reactance at 5 hz (x5 in) minus the mean expiratory reactance at 5 hz (x5ex). statistical analysis was performed using unpaired t-tests or mann whitney u tests for comparison between groups at baseline; paired t-test or wilcoxon matched pair tests for within patient comparisons at 2 years; and chi-square tests for categorical data. analysis was performed using prism 5 (graphpad, la jolla, ca, usa); p<0.05 was considered statistically significant. in all, 55 (37.4%) of the 147 copd patients had efl; see table 1 for clinical characteristics. patients with efl were more likely to be current smokers (p=0.01), have worse airflow obstruction (mean 42 versus 59 fev1% predicted; p<0.0001); and have more gas trapping with a higher rv (median 166 versus 121% predicted; p<0.0001) and frc (mean 144 versus 122% predicted; p<0.0003). the efl group had worse sgrq activity and symptom component scores and lower 6-minute walk distance. there were significant differences between groups for all ios measurements; notably, r5r20 was greater in the efl group. x5 was significantly associated with r5r20 (r=0.87, p<0.0001), fev1% predicted (r=0.49, p<0.0001), fev1/fvc (r=0.27, p=0.001), hyperinflation (rv% predicted: r=0.37, p<0.0001; frc% predicted: r=0.33, p=0.0003), cat score (r=0.21, p=0.011), and sgrq total score (r=0.22, p=0.009) including all the sgrq domains (symptoms, impact, and activity). there was no association between x5 and the vas dyspnea scale (r=0.11, p=0.22). a total of 45 patients returned at 2 years. in all, 20 patients had efl at baseline, of which 14 (70%) had efl at 2 years. for the remaining 6 patients without efl at 2 years, the median x5 changed from 0.44 kpa/l/s at baseline to 0.24 kpa/l/s after 2 years (p=0.031). a total of 25 patients did not have efl at baseline; 21 (82%) remained without efl at 2 years. overall, there were no significant changes in x5 values between baseline and 2 years for both the efl and non-efl groups. fev1 decreased in both the groups (mean changes: efl: 66.5 ml/year, p=0.003; non-efl: 71 ml/year, p=0.0005). efl was a common finding in copd patients, being present in over a third of the cohort. efl patients had a lower fev1% predicted and more hyperinflation and gas trapping, with reduced exercise performance. r5r20 is recognized as a measurement of small airway resistance5; efl was associated with greater small airway impairment. this association is compatible with the cause of efl, namely small airway narrowing and collapse. dellac et al7 proposed the x5 threshold value of 0.28 kpa/l/s for efl using results from forced oscillometry data during individual breathing cycles. we used mean data from multiple breathing cycles during ios, which may categorize some patients with efl despite not all cycles reaching the efl threshold. nevertheless, using this method to define efl we identified a subgroup of patients with marked small airway disease, gas trapping, and hyperinflation. furthermore, the identification of efl was reproducible in the majority of cases at the 2-year follow-up. aarli et al6 used ios to measure efl in copd patients, and also found that efl was associated with lower fev1 values and greater hyperinflation. in common with our findings, a significant association with worse health status and symptom scores was also reported. while there were some differences in the patient-reported outcome tools used, the overall interpretation of these two studies is that the presence of efl is associated with a greater symptom burden in copd patients. aarli et al6 reported that copd patients with x5 0.1 kpa/l/s experienced greater dyspnea. the x5 0.1 kpa/l/s threshold value is obviously lower than that used in the current study, and is likely to identify patients with less severe efl. the higher x5 threshold value used in this study identified a group with greater efl that was associated with more severe disease manifestations. it has been reported that x5 is associated with the level of symptoms and duration of hospitalization during copd exacerbations.12 treatment with an inhaled corticosteroid/long-acting beta-agonist combination for 3 months improved x5.13 the identification of small airway disease and efl in copd patients using oscillometry methods may allow individualized targeting of drugs to treat these pathophysiological abnormalities. for example, inhalers with a greater proportion of extra-fine particles14 could be targeted to copd patients with efl. there was limited follow-up at 2 years, and larger cohort studies are needed to build on the observations here about the long-term clinical implications of efl. we show that ios can identify patients with efl, and that efl is associated with more severe airflow obstruction, hyperinflation, and symptoms. we suggest that efl is a treatable trait,15 and may provide an opportunity for therapeutic intervention.

we have used impulse oscillometry to identify copd patients with tidal expiratory flow limitation (efl), which is a measurement related to small airway disease. we report that 37.4% of copd patients had efl; these patients had multiple clinical characteristics of more severe disease including lower forced expiratory volume in 1 second values, greater hyperinflation, reduced exercise performance, and increased small airway impairment. we highlight that efl can be used to identify a subgroup of copd patients with distinct characteristics associated with small airway disease.

PMC5446959

pubmed-1059

immunopathology is associated with the most common life-threatening disorders, including atherosclerosis and related cardiovascular diseases, cancer, and chronic inflammation. a number of diseases, such as lupus erythematosus, rheumatoid arthritis, or hiv infections, are characterized by pronounced immunopathologies; others, such as atherosclerosis and cancer, by less obvious latent pathological changes in the immune system. such changes may represent early events in the disease initiation and development and might therefore be especially interesting for timely diagnostics and for development of preventive treatment. altered macrophage plasticity and polarization can contribute both to the malignancy development and to the tumor vascularization. in that regard, comprehensive analysis of the macrophage population diversity would be necessary for developing adequate therapeutic approaches and monitoring the therapy efficiency. recent studies have revealed many aspects of the complex and important role of macrophages in the pathogenesis of atherosclerosis. formation of the atherosclerotic plaque begins with monocyte activation and transformation into macrophages that reside in the subendothelial area of the blood vessel wall and accumulate lipids in their cytoplasm becoming foam cells. this lipid trapping is performed by means of uncontrolled phagocytosis. at the same time, certain types of macrophages are implicated in tissue repair, and these cells have been found in regressing plaques in mouse models [4, 5]. therefore, different types of macrophages are responsible for the plaque initiation, growth, and, eventually, regression [68]. correspondingly, anti-inflammatory agents are considered as an important component of antiatherosclerotic therapy. here again, the analysis of macrophage phenotypic diversity could improve the understanding of the pathological process and assessment of the therapy efficiency. according to current epidemiological data, atherosclerosis-related diseases and cancer are the two greatest contributors to the overall mortality in the developed countries [10, 11]. given that these diseases are tightly associated with immunopathology, development of comprehensive diagnostic methods and therapeutic approaches to modulate the immune system appears to be of the greatest importance. likewise, no drugs are available to date that allow targeted immune correction in atherosclerosis. it is clear that changes in cytokine expression and phenotypic features of macrophages may reflect the disease progression state. in many pathological conditions, the analysis of different types of cells circulating in the bloodstream can provide valuable information about the disease progression. during the recent years, a number of cell types have been isolated and studied for possible application in diagnostics and drug development. circulating tumor cells (ctcs) can be extracted from patient's blood and used to analyze the expression of relevant genes and surface markers. for instance, successful isolation and molecular characterization have been described for metastatic breast cancer, metastatic colorectal cancer, and lung cancer. this strategy is especially useful in cases of advanced metastatic cancer, where the patients could benefit from a personalized treatment. the analysis of ctcs has a great diagnostic potential but can also help in revealing the possible drug resistance of the tumor and designing the optimal therapy. many current studies are focused on the improvement of ctc-based analyses and their clinical implementation. peripheral blood mononuclear cells (pbmcs) are relatively easily obtainable cells that can be used for monitoring a wide spectrum of conditions and pathologies. the analysis of mrna profiles of isolated pbmcs could be used for evaluation of metabolic changes. pbmcs can also be kept in short-term culture and used for studying cytokine production induced by stimulation. for instance, changes in proinflammatory cytokine production by isolated pbmcs have been described in such conditions as allergies, alterations of immune response, and immunization [1719]. studies on pbmcs have demonstrated that vascular endothelial growth factor (vegf) production was decreased in women with preeclampsia. isolated pbmcs can serve as a relevant system for testing various drugs, especially related to inflammation. recently, the potential of macrophage-based test system for diagnostics and treatment of atherosclerosis has been explored. atherosclerosis progression is usually slow, and the disease often remains asymptomatic until the ischemia of organs and tissues becomes evident. this may happen due to the obstruction of a blood vessel with growing atherosclerotic plaque or the embolism caused by a thrombus formed on a destabilized plaque. therefore, the first manifestations of the disease are often lethal [23, 24]. however, it is hindered by the absence of clinical symptoms and complaints and by the fact that the spectrum of risk factors is very wide, including genetic predisposition, lifestyle and diet patterns, chronic inflammation, and metabolic factors. immunopathology is likely to be one of the mechanisms underlying atherosclerosis development starting from the early stages, and its assessment can therefore have an important diagnostic value.. these cells can eliminate pathogens by phagocytosis, release of reactive oxygen species, production of proinflammatory cytokines, and modulation of the t-cell immune response. macrophages are present in all organs and tissues and represent the first line of immune defence, responsible for removal of foreign agents and pathogens. the pool of macrophages remains constant in every tissue, and the cells are renewed from the population of circulating monocytes, although the results of recent studies suggest that these cells are also capable of self-renewal. it has been known for a long time that changes in the phagocytic activity of macrophages might be dependent on changes in the peripheral blood monocyte population, and alterations of the monocyte pool lead to various pathological conditions. proliferation of promonocytes, which can be stimulated by systemic inflammatory stimuli, leads to the increase of the number of circulating monocytes [29, 30]. monocytes and macrophages, together with their precursors and dendritic cells, form the mononuclear phagocyte system (mps), although the identity of the dendritic cells remains disputed [32, 33]. the development, maintenance, differentiation, and function of mps are regulated mostly by colony-stimulating factor 1 (csf-1) in homeostatic conditions and by granulocyte-macrophage colony-stimulating factor (gm-csf) during inflammation. inflammatory signals and various pathological conditions, including atherosclerosis development, stimulate the inactive circulating monocytes to become activated macrophages that can be distinguished by their phenotypic properties. macrophages can acquire different functional phenotypes influenced by the surrounding microenvironment in a process known as macrophage polarization. reaching consensus on macrophage classification was challenging due to the high variety of activation types, dependence of the results on the particular experimental setup, and differences of macrophage activation profiles between humans and animal models. recently, a group of leading immunologists have summarized the current knowledge on the issue and drawn recommendations for conducting and reporting the experiments involving macrophage polarization. initially, two main classes of macrophages, m1 and m2, have been defined which could be obtained by activation of macrophages by proinflammatory interferon (ifn-) and lipopolysaccharide (lps) or by interleukin-4 (il-4), respectively [3739]. m1 macrophages are characterized by the production of proinflammatory cytokines tumor necrosis factor- (tnf), il-1, il-6, il-12, and proteolytic enzymes, as well as by the expression of fc- receptors on the cell surface [40, 41]. polarization towards the proinflammatory phenotype can be induced in vitro by toll-like receptor (tlr) ligands, including tnf, lipopolysaccharide (lps), and interferon (ifn-) that might also play a role in the pathogenesis of atherosclerosis. it has been demonstrated that m1 macrophages are present in the atherosclerotic plaques where they maintain the local inflammatory process and promote the extracellular matrix degradation contributing to the formation of unstable plaques that can induce thrombus formation and are therefore especially dangerous [4345]. the subpopulation of m2 macrophages was further divided into several subtypes depending on the activation stimuli (figure 1): m2a (activated by il-4), m2b (activated by immune complexes), and m2c (activated by il-10). each of these subtypes is characterized by a distinct pattern of cytokine and surface marker expression which can also vary between the species. it has been proposed therefore to refer to different subtypes of macrophages indicating the activation type (e.g., m(il-4) instead of m2a). m2a macrophages have strong anti-inflammatory properties and can be regarded as tissue-repairing cells. they have poor phagocytic capacity and participate in the formation of extracellular matrix by stimulating production of collagen. they express il-1 receptor antagonist (il-1ra) and secrete ccl18, transforming growth factor (tgf-), and remodelling enzymes. m2b and m2c macrophages express different chemokine receptors, produce il-10, and can modulate inflammation but do not synthesize the extracellular matrix and can therefore be regarded as regulatory macrophages. anti-inflammatory macrophages were also shown to express mannose receptor (cd206), stabilin-1, and decoy receptor il-1rii on the surface [4951]. however, the heterogeneity of this population requires further studies and standardization of the nomenclature. for the sake of simplicity, later in this work, we will refer to the il-4-activated m2a macrophages as m2 phenotype. the production and release of the proinflammatory cytokines, such as il-1 and il-18, are dependent on the macrophage inflammasome status [53, 54]. inflammasome is a caspase-activating complex formed by several proteins, including caspase-1, which is responsible for cytokine maturation. active caspase-1 can also be released from the activated cells and may contribute to the damage of neighbouring cells. in can be induced by danger- and pathogen-associated molecular patterns (damps and pamps) [5659]. importantly, inflammasome is activated in atherosclerosis in response to cholesterol accumulation in the blood vessel wall and formation of cholesterol crystals in foam cells. on the other hand, atherogenesis can be associated with ongoing infections with various pathogens, such as chlamydia pneumonia and helicobacter pylori, which can induce the inflammasome activation [6163]. there might exist other factors that contribute to the inflammasome activation and atherosclerosis progression, including the formation of uric acid crystals and impaired autophagy. therefore, the inflammasome activation and release of proinflammatory cytokines and caspase-1 are relevant for atherosclerosis progression and can be regarded as important markers of the pathological process. development of a reliable monocyte/macrophage-based functional test remains challenging due to several technical problems. the traditional method implies cell adhesion, which leads to monocytes activation and is therefore widely criticized. another method is fluorescence-activated cell sorting (facs), which is fast and accurate but requires labelling of cells with specific antibodies, which can also lead to activation. a pure fraction of monocytes/macrophages can be isolated using magnetic separation. in this method, unspecific activation can also occur due to possible phagocytosis of paramagnetic particles. so far, the only method that can extract nonactivated monocytes is elutriation [66, 67]. it requires, however, special equipment and is impossible to introduce into routine clinical practice. because of these technical problems, recent studies focused on the identification of molecular markers that could substitute for functional tests in diagnostics of immunopathologies. studies of monocyte function include the assessment of their motility, adhesion, phagocytic activity, and low-density protein (ldl) uptake [68, 69]. macrophages can take part in pathological processes via stimulation with circulating soluble activation factors, adhesion to the endothelium, and migration into the tissue where they meet local activation factors. the monocytes ' response to these stimuli depends on their priming in circulation and therefore can have a diagnostic potential. the analysis of macrophage pro- and anti-inflammatory phenotypic classes can provide important information on the disease progression, as has been demonstrated for atherosclerosis. a monocyte/macrophage-based assay has recently been designed to evaluate changes in monocyte response to pro- and anti-inflammatory stimuli and to reveal possible bias of the macrophage polarization towards m1 or m2 phenotype. in this method, a pure population of blood monocytes was isolated using magnetic separation [49, 70] (figure 2). the analysis of macrophage activity was performed by stimulating the cells with lps, proinflammatory stimulus ifn-, and anti-inflammatory stimulus il-4. proinflammatory activity of macrophages was assessed by the levels of secreted tnf and il-1 and anti-inflammatory activity by the levels of ccl18 production and il-1ra expression. inflammasome activation can also be assessed in this experimental system by measuring the il-1 expression at mrna level and comparing the results with the amount of mature il-1 detected by elisa. another evidence of inflammasome activation that can be used as readout is the release of active caspase-1. expression and release of the inflammasome-dependent cytokines tnf and il-8 should also be measured to provide the control of inflammasome activity. further characterization of macrophages can be performed by analyzing such markers as mmr, cd163, tgf-rii, csfr1, tnfri, cd16, cd32, cd64, and stabilin-1, as well as the expression of tlr1, tlr2, and tlr4 at mrna level and on the cell surface. the described experimental system can provide important information on monocyte activation state and possible skew of the monocyte predisposition towards pro- or anti-inflammatory response. apart from altered polarization towards one or the other phenotype, pathological conditions can be associated with other phenotypical alterations of monocytes/macrophage, including phagocytosis, migration, and proliferation. alterations of macrophage phenotype and plasticity associated with atherosclerosis have recently been discussed in a comprehensive review. the described method has been used to analyze activation of monocytes isolated from blood of healthy subjects (n=19), atherosclerosis patients (n=22), and breast cancer patients (n=18). the obtained results demonstrated that production of proinflammatory tnf was significantly lower in atherosclerosis patients and significantly higher in cancer patients in comparison to healthy subjects. on the other hand, production of anti-inflammatory ccl18 was decreased both in atherosclerosis and in cancer patients. to evaluate the diagnostic potential of macrophages ' activation test in asymptomatic atherosclerosis, a study was performed on individuals with predisposition to atherosclerosis (n=21, mean age 63 9 years) and subclinical atherosclerosis (n=21, mean age 62 7 years) in comparison to healthy subjects (n=21, mean age 60 9 years). predisposition to atherosclerosis and subclinical atherosclerosis were detected by measuring the age-adjusted carotid intima media thickness (cimt). the analysis of tnf and ccl18 production by stimulated macrophages revealed dramatic individual differences between the analyzed subjects that may reflect the individuals ' predisposition to immunopathology. macrophages from subjects with subclinical atherosclerosis were characterized by especially low degree of activation in response to stimuli (figure 3). therefore, the ability of macrophages to polarize towards pro- and anti-inflammatory phenotypes was decreased at early stages of atherosclerosis development, although the causative significance of this observation remains unclear. changes of the immune system occur early in many pathological processes, opening the intriguing possibility that patients may benefit from a preventive treatment targeting the underlying immunopathology. enhanced monocyte activation may lead to macrophage polarization towards pro- or anti-inflammatory phenotype leading to chronic inflammation and atherosclerosis or to oncopathologies, respectively. for instance, it has been demonstrated that depolarization of macrophages from the m2 phenotype was associated with tumor regression. to explore the potential of the macrophage activation test for drug development, the macrophage depolarization effects of herbal extracts were studied on cells obtained from healthy subjects. plant extracts with immune-modulating properties are widely used in traditional medicine, but their therapeutic potential for modern clinical practice remains to be investigated. the extracts of the following plants with known anti-inflammatory activity were included into the study: flowers of hawthorn (crataegus sp.), elderberry (sambucus nigra), and calendula (calendula officinalis) and herbs of st. cultured macrophages were exposed to pro- and anti-inflammatory stimuli (ifn- and il-4, resp.), and tnf and ccl18 production was measured after 6 days. tnf secretion by ifn--stimulated macrophages treated with elderberry, calendula, and violet extracts was 1013-fold higher than that of untreated stimulated macrophages. on the other hand, hawthorn and st. john's wort also suppressed the secretion of ccl18 by il-4-stimulated macrophages (figure 4). therefore, st. john's wort and hawthorn extracts appear to be natural agents with immune-modulatory properties that could be used for macrophage depolarization. importantly, natural agents are characterized by relatively good tolerance and minimal side effects and are therefore especially suitable for long-term therapy, which is necessary for successful immune correction. one of the therapeutic strategies for treatment of atherosclerosis is the inhibition of intracellular cholesterol accumulation. it is well established that hypercholesterolemia is a potent risk factor for atherosclerosis development [7476]. however, the accumulating evidence demonstrates that atherogenic potential depends not so much on the total level of cholesterol as on the nature of cholesterol-containing lipoprotein particles that serve as a source of cholesterol storage in the arterial wall. low-density lipoprotein (ldl) and especially its modifications, such as small dense, oxidized, desialylated, or electronegative ldl, play the key role in atherogenesis, and their levels positively correlate with the disease progression [7779]. moreover, modified ldl particles can provoke formation of autoantibodies that initiate the inflammatory response and form highly atherogenic immune complexes with ldl particles. in that regard the ability of blood serum to induce cholesterol accumulation is referred to as serum atherogenicity. it has been previously demonstrated that serum obtained from atherosclerosis patients caused cholesterol accumulation in cultured cells and therefore was highly atherogenic. primary culture of human aorta cells can be a useful system for testing various antiatherosclerotic substances. using this system, atherogenic properties of patient's blood serum can be analyzed before and after drug administration to assess its therapeutic potential [8284]. serum from study participants was added to cultured subendothelial intimal cells derived from uninvolved human aorta at concentration of 10%, and cholesterol accumulation was measured after 24 h using a previously established method. it was demonstrated that blood serum atherogenicity decreased in study subjects treated with a single dose of hawthorn extract. the observed decrease was 73% and 83% after 2 and 4 hours, respectively, in comparison to the baseline (figure 5). these results indicate that hawthorn extract may be regarded as a potent antiatherosclerotic agent. on the other hand, john's wort extract was a potent macrophage depolarizing agent, and hawthorn was demonstrated to reduce the serum atherogenicity. further studies employing macrophage-based cellular test systems will allow identification of novel agents with therapeutic potential. monocyte/macrophage-based test system is a versatile tool to detect immunopathology, including increased monocyte activation and altered polarization of macrophages towards pro- or anti-inflammatory phenotypes. alterations in monocyte activation and imbalance in macrophage polarization can be associated with a variety of pathological conditions, including different types of cancer and atherosclerosis. therefore, the development of immunomodulating therapy might contribute significantly to the improvement of the existing treatment strategies. however, the complexity of the immunopathology requires flexible and reliable methods for diagnostics and monitoring of treatment efficiency. it was proven to be suitable for the analysis of immunopathology in subclinical atherosclerosis and breast cancer. this method can also be applied for studying numerous other pathologies, where monocyte/macrophage activation is implicated, including other types of cancer, chronic inflammation, and autoimmune disorders. given the broad spectrum of cytokines that may be analyzed, the described method can be improved to perform a more detailed study of macrophage activation. the application of monocyte/macrophage activation test for drug research was illustrated by screening a series of medicinal plant extracts for antiatherosclerotic activity. together, these results demonstrate the possibilities of macrophage-based cellular tests for diagnostics and drug research in conditions associated with immunopathology.

several highly prevalent human diseases are associated with immunopathology. alterations in the immune system are found in such life-threatening disorders as cancer and atherosclerosis. monocyte activation followed by macrophage polarization is an important step in normal immune response to pathogens and other relevant stimuli. depending on the nature of the activation signal, macrophages can acquire pro- or anti-inflammatory phenotypes that are characterized by the expression of distinct patterns of secreted cytokines and surface antigens. this process is disturbed in immunopathologies resulting in abnormal monocyte activation and/or bias of macrophage polarization towards one or the other phenotype. such alterations could be used as important diagnostic markers and also as possible targets for the development of immunomodulating therapy. recently developed cellular tests are designed to analyze the phenotype and activity of living cells circulating in patient's bloodstream. monocyte/macrophage activation test is a successful example of cellular test relevant for atherosclerosis and oncopathology. this test demonstrated changes in macrophage activation in subclinical atherosclerosis and breast cancer and could also be used for screening a panel of natural agents with immunomodulatory activity. further development of cellular tests will allow broadening the scope of their clinical implication. such tests may become useful tools for drug research and therapy optimization.

PMC4739459

pubmed-1060

on february 13, 1996, a 7-year-old boy from doihue in administrative region vi was admitted to the hospital clnico fusat of rancagua in the region (figure 1) with a 2-day history of adynamia and dizziness. on admission,, progressive paralysis developed that evolved to respiratory failure; the boy was connected to a mechanical ventilator. cat scan showed diffuse cerebral edema, and the electroencephalogram indicated no electric activity. intracranial hypertension developed, and the patient map of south america showing the geographic position of chile and map of chile presenting the geographic distribution of the administrative regions of the country. a virus was considered the most probable cause, laboratory tests were conducted to determine the presence of the following viruses: herpes, measles, coxsackie, echo, and polio. interviews with relatives and the boy s nanny revealed that bats had been observed in the family s house. the nanny also reported that she had seen a bat flying away from the child s toy box. even though these interviews failed to reveal any direct contact with bats or any history of an animal bite, this epidemiologic information prompted the physicians to suspect rabies. on february 26, 1996, a serum sample and corneal smear were obtained from the patient and sent to the rabies laboratory of the instituto de salud pblica de santiago (isp). a rabies antibody titer of 1:625 was found in the serum specimen by using the indirect fluorescent-antibody (ifa) technique (14). the patient had no history of rabies vaccination to account for the presence of antibodies. the corneal smear was negative for rabies antigen by the direct fluorescent-antibody (dfa) assay (15). on march 4, a second serum sample, the second serum sample was tested simultaneously with the first one by ifa assay, and a titer of 1:15,625 was detected. the saliva sample was negative by dfa assay and suckling mouse inoculation (15,16). the patient died on march 5, 1996, when artificial respiratory support was disconnected. postmortem tissue samples of cerebral cortex, hippocampus, cerebellum, and nuchal skin biopsy were sent to the isp rabies laboratory for diagnosis. rabies postexposure prophylaxis with the suckling mouse brain fuenzalida-palacios vaccine was administered to the victim s mother and to 10 health-care providers who had possible contact with the patient s saliva. the rabies postexposure prophylaxis schedule used was 2 ml of vaccine, subcutaneously, on each of days 1, 2, 3, 4, 5, 6, 21, and 90. blood samples were taken from vaccinees on day 14 after the initial dose of vaccine; ifa assay showed that adequate immune responses had developed. the virus was isolated from the patient s brain tissue by intracerebral inoculation of suckling mice (16). to help identify the possible source of infection, the virus was antigenically and genetically characterized. antigenic characterization of the virus was carried out by using a panel of eight monoclonal antibodies directed against the viral nucleoprotein, provided by the centers for disease control and prevention. these analyses identified a rabies antigenic variant associated with tadarida brasiliensis (free-tailed bat) in chile, which had been designated as antigenic variant 4 (agv4) (9,17). genetic characterization was done by sequencing a 320-bp portion of the rabies virus nucleoprotein gene from nucleotide position 1,157 to 1,476, as compared with the sadb 19 strain (18,19). briefly, genomic viral rna was extracted from infected tissue by using trizol (invitrogen, san diego, ca, formerly gibco-brl inc.) according to the manufacturer s instructions. complementary dna was produced by a reverse transcription polymerase chain reaction with primers 10 g and 304 (19) and was sequenced by using the taq big dye termination cycle sequencing ready reaction kit (applied biosystems, foster city, ca), according to the manufacturer s protocol, on an applied biosystems 377 dna automated sequencer (applied biosystems). this human rabies virus isolate was compared with viruses obtained from domestic animals and insectivorous bats in urban centers in chile from 1977 to 1998 (18). pileup and pretty programs of the wisconsin package, version 10 (genetic computer group, 2000, madison, wi), were used to produce sequence alignments and comparative nucleotide analyses. the programs dnadist (kimura-two parameter), neighbor (neighbor-joining method), and dnapars (parsimony method) from the phylip package, version 3.5 (20), were used in the phylogenetic studies. the bootstrap method, as implemented by the seqboot program from phylip, was followed by the use of dnadist and neighbor for the distance matrix analyses. although five genetic variants of rabies virus are found in chile (18) (figure 2, groups a to e), a reservoir has been identified for only two: t. brasiliensis (figure 2, group d) and lasiurus sp. phylogenetic analyses of the chilean human isolate demonstrated that it segregated in group d. this group represents the genetic variant of rabies virus most frequently isolated throughout the country, formed by viruses from the metropolitan region and regions iv, v, vi, vii, viii, ix, and x (figure 1). the high bootstrap value that supports the inclusion of this virus in group d and the very close genetic relationship it has with the other members of this group (average genetic distance 0.5%) clearly show that t. brasiliensis is the likely reservoir of the rabies virus isolated in this case. neighbor-joining tree comparing the human rabies isolate with representatives of the rabies genetic variants obtained from insectivorous bats and domestic animals in chile (18). bootstrap values obtained from 100 resamplings of the data by using distance matrix (top) and parsimony methods (bottom) are shown at nodes corresponding to the lineages representing the rabies virus variants (a, b, c, d, and e) currently circulating in chile. only bootstrap values duvenhage virus, genbank accession number, european bat lyssavirus, myotis chiloensis, roman numerals indicate the administrative region where the sample was obtained, tadarida brasiliensis, metropolitan region, lasiurus borealis. the absence of a history of an animal bite, the clinical presentation of the disease without the classic signs of hydrophobia or aerophobia, and the absence of any human rabies cases for a period of 24 years in chile were the primary reasons that rabies was not first suspected and a definitive diagnosis was delayed in this case. retrospective studies of human rabies epidemiology have demonstrated that it is not uncommon to observe rabies cases in which there is no history of a bite, mainly in situations involving insectivorous bat rabies variants. for example, of the 17 human rabies cases associated with insectivorous bats reported in the united states from 1980 to 1996, only one had clear documentation of a bite (22). without proper education, patients may not be aware of the risks from a bat bite. moreover, the wound may not be appreciated as a concern because of the limited injury inflicted by the bat's small teeth (23). finally, there may not be an opportunity to obtain a history from a pediatric patient or to discern an exposure that occurs during sleep or other circumstances (24). in cases in which a patient shows clinical signs of central nervous system involvement of unknown or suspected viral origin, health-care providers should be aware of the importance of conducting a thorough medical history to appropriately assess the possibility of rabies. with the important changes in the epidemiologic patterns of rabies in latin america, this disease should be included in the differential diagnosis of neurologic diseases characterized by acute encephalitis and progressive paralysis, even when no previous history of an animal bite exists and even in regions where canine rabies has been eradicated.

the first human rabies case in chile since 1972 occurred in march 1996 in a patient without history of known exposure. antigenic and genetic characterization of the rabies isolate indicated that its reservoir was the insectivorous bat tadarida brasiliensis. this is the first human rabies case caused by an insectivorous bat rabies virus variant reported in latin america.

PMC2730271

pubmed-1061

hiv replication requires the successful orchestration of reverse transcription, nuclear entry, and integration while avoiding various antiviral factors and innate immune sensors during early steps of infection (malim and bieniasz, 2012). recognition of hiv by innate immune sensors induces the production of type i interferons and consequently interferon-stimulated genes (isgs), some of which possess direct antiviral activity against hiv replication (schoggins et al., 2011). along with isgs, cells are also equipped with intrinsic antiviral factors, including restriction factors that constitutively protect the cell from infection (bieniasz, 2004). cyclophilin a (cypa), a host peptidylprolyl isomerase, was the first host factor shown to bind the hiv-1 capsid protein and to be required for the early steps of infection (luban et al., 1993). since the capsid core efficiently protects the genome of pathogenic hiv-1, engages essential host-derived replication factors, and enables evasion of antiviral factors and innate immune sensors, its interaction with cypa is of particular interest (campbell and hope, 2015). to date, cypa has not been associated with specific cellular pathways in human cells, and the nature of cellular factor(s) required for the effects of cypa on hiv-1 infection has remained elusive (hilditch and towers, 2014). in primary cd4 target cells, hiv depends on cypa for maximal replication (de iaco and luban, 2014, franke et al., 1994, saini and potash, 2006, schaller et al., 2011, yoo et al., 1997). use of the cypa inhibitor cyclosporin a (csa) demonstrated that optimal reverse transcription of hiv-1 (braaten et al., 1996) and viral nuclear import (de iaco and luban, 2014) requires cypa in many cell lines, consistent with the ability of lentiviruses to infect non-dividing cells and with the presence of a conserved cypa-binding loop in their capsid (goldstone et al., 2010, lin and emerman, 2006, yamashita and emerman, 2004). cypa also influences hiv-1 integration sites (schaller et al., 2011) and the evasion of cytosolic innate sensors in monocyte-derived macrophages (rasaiyaah et al., 2013). unlike hiv-1, hiv-2 and simian immunodeficiency virus (siv)mac replication is modestly affected by inhibition of cypa in cell lines (billich et al. accordingly, hiv-1 capsid binds cypa with an affinity in the micromolar range, while hiv-2 and the related sivmac capsids bind cypa with a much lower affinity (price et al., 2009, schaller et al. in several cell lines such as hela, hiv-1 does not depend on cypa (sokolskaja et al. 1994), and heterokaryon experiments suggest instead that cypa controls a dominant restriction mechanism specific to hela cells and to capsid mutants a92e and g94d (song and aiken, 2007). mutations conferring a restriction phenotype that would be both associated with cypa and conserved across cell types in single-cycle virus infection assays have remained elusive. additional host factors that regulate the early steps of hiv-1 replication are also associated with capsid. for instance, cpsf6, ranbp2 (nup358), nup153, and rhesus trim5 all bind to the viral capsid (di nunzio et al., 2012, ganser-pornillos et al., 2011,, 2014, price et al., 2012, schaller et al., 2011, stremlau et al tnpo3 is also required for hiv-1 infection and this requirement maps genetically in part to the viral capsid (brass et al., 2008, krishnan et al., 2010). interestingly, the resistance factor mx2 inhibits hiv-1 infection after reverse transcription, and this maps to the interaction between the viral capsid and cypa (goujon et al., 2013, the understanding of the orchestration of the early steps of hiv-1 infection by these factors, particularly at the step of nuclear entry of the viral pre-integration complex, remains incomplete (gaudin et al., 2013). mutations in the viral capsid that alter cypa binding also modulate the effects of these factors on infection, leading to the notion that cypa binding to capsid influences interactions (genetic or biochemical) with these factors (sokolskaja and luban, 2006). however, no essential host factor is known to be required for the effects of cypa on hiv-1 infection. cypa binds to a characteristic proline-containing loop that is present in lentiviruses but absent from other retroviruses (goldstone et al., 2010, lin and emerman, 2006) and affects the isomerization of proline 90 in hiv-1 capsid (bosco et al., 2002). we previously described chimeric mutants of hiv-1 and hiv-2, corresponding to naturally occurring amino acids, with an increased affinity for cypa: p86 ha in hiv-2 (short hivac-2; hiv cypa affinity-enhanced capsid) and v86i-iap91lpa-m96l in hiv-1 (short hivac-1) (lahaye et al., 2013). in monocyte-derived dendritic cells (mddcs), a physiologically relevant cd4 target cell derived from primary blood monocytes, hivac-1 and hivac-2 promote innate sensing of the viral cdna by the cytosolic dna sensor cyclic gmp-amp synthase (cgas) before nuclear import (lahaye et al., 2013). this response requires abrogation of samhd1 using vpx present in hiv-2/sivmac (hrecka et al., 2011, in addition, these mutants show a striking defect in infection of mddcs, downstream of the samhd1 restriction (lahaye et al., 2013). neutralizing type i interferon (ifn) does not rescue infection by hivac-2, suggesting that the inhibition is not secondary to the induction of an antiviral innate immune state. hivac-2 gives rise to normal levels of late reverse transcription (late rt) products, but reduced levels of 2-ltr circles and integrated viral dna, as compared to hiv-2, suggesting a restriction before nuclear import. we surmised that the increased affinity of hivac-2 for cypa rendered the virus intrinsically susceptible to antiviral restriction mediated by cypa at the level of nuclear import. normally, wild-type (wt) hiv would avoid such cypa-mediated resistance, a typical characteristic of restriction factors (malim and bieniasz, 2012). this observation raised the possibility that the underlying restriction mechanism could shed light on the long-sought host factors implicated in the positive effects of cypa in hiv-1 infection. mddcs were susceptible to infection by hiv-1 with vpx, but not to hivac-2 infection (figure s1a). we examined whether the resistance to hivac-2 infection was intrinsic to the virus. upon combined infection with the two viruses, when hivac-2 was present and activated an innate immune response in mddcs as shown by cd86 induction, cells remained susceptible to hiv-1 with vpx (figure s1a). thus, the resistance to hivac-2 infection is unlikely due to the induction of an antiviral state but appears to be intrinsically linked to the capsid. in order to examine the role of cypa in hiv resistance, we treated mddcs with csa at the time of infection. csa modestly increased hiv-2 infectivity and decreased hiv-1 infectivity, consistent with previous reports (manel et al. strikingly, in the case of infection of dcs with hivac-1 and hivac-2, the presence of csa restored infectivity (figures 1a, 1b, s1b, and s1c). next, we reasoned that, if the restriction of hivac viruses was not a consequence of the induction of an antiviral state in immune cells, then it must be conserved. hivac-1 and hivac-2 titers were decreased compared to their wt counterparts following infection of immune-related thp-1 cells and non-immune ghost cells (figures 1c, s1d, and s1e). csa restored infection of hivac-1 and hivac-2 to levels comparable with those of the wt viruses. csa, an immunosuppressive compound, also targets proteins other than cypa. to confirm the role of cypa knockdown of cypa expression in mddcs and thp-1 using short hairpin rna (shrna)-coding lentivectors also restored infectivity of hivac-2 (figures 1e1h). expression of a non-targetable cypa protein together with the shrna reverted the inhibition of hivac-2 infection (figures 1i and s1f s1i). to genetically confirm the role of cypa, we used ppia jurkat cells that are genetically defective for cypa expression (braaten and luban, 2001). as was the case for mddcs and ghost cells, infection of wt jurkat cells by hivac-2 was inhibited, and addition of csa rescued infectivity (figures s1j and s1k). in contrast, infectivity of hivac-2 was similar to hiv-2 in ppia jurkat cells, and csa had no further effect on infectivity. next, we examined whether the cypa restriction was limited to a specific hivac capsid sequence or whether it could be extended to a general family of lentiviral capsid mutants. the distinctive feature of hivac-2 is the rational exchange of proline 86 with a corresponding pair of naturally occurring amino acids histidine-alanine in hiv-1 nl4-3, in order to restore a cypa-binding loop that would presumably fit the catalytic site of cypa more closely (lahaye et al., 2013). we examined an alignment of 4,132 sequences of hiv-1 capsid available at the time in the los alamos national laboratory database and extracted all the existing pairs of amino acids preceding glycine 89-proline 90. we identified six additional amino acid pairs and introduced them into hiv-2 rod9 (figures 2a and 2b). in accordance with hivac-2, these six mutants encapsidated higher amounts of cypa protein in the viral particles (between 20- and 50-fold more, figure s2a), consistent with an increased affinity of these mutated capsids for cypa (lahaye et al., 2013). on ghost cells and mddcs, infectivity was consistently low and rescued by csa, except for one mutant p86aa (figures 2c and s2b). hiv-2 is closely related to sivmac, but their cypa-binding loops differ. to examine whether the cypa restriction was applicable to primate lentiviruses other than hiv, we generated a mutant of sivmac239 encoding for the cypa-binding loop of hivac-2, resulting in virus sivmac239 qpapqq85ihagplpa (figure 2d). we also generated macaque monocyte-derived dendritic cells (odoherty et al. macaque mddcs were readily infected with vsv-g pseudotyped gfp-encoding sivmac239 (figures 2e and 2f). in contrast, infectivity of sivmac239 qpapqq85ihagplpa was inhibited in macaque mddcs, and csa treatment restored gfp expression. thus, cypa restriction of lentiviral infection is conserved in macaque cells and affects a broad family of capsid mutants. to determine whether cypa was sufficient for restriction, we explored the phenotype of second-site mutations in the capsid mutants. the capsid mutant hiv-1 n74d, but not hiv-1 wt, has been previously shown to be sensitive to csa in hela cells (ambrose et al., 2012, yang and aiken, 2007). this suggested that n74 might influence the restriction mediated by cypa on hivac-1 and hivac-2. strikingly, the infectivity of hivac-1 n74d and hivac-2 n73d was largely restored and was insensitive to csa in hela cells, ghost cells, and mddcs (figures 3a3d, s3a, and s3b). importantly, the second-site mutation did not abrogate the increase in cypa recruitment to the hivac-2 n73d capsid (figures 3e and s3c)./n73d constitute second-site mutations in capsids that specifically escape the direct antiviral effect of cypa, suggesting that additional host factors are implicated in the restriction. next, we examined whether host factors that bind the lentiviral capsid or whose activity genetically maps to the capsid would be necessary for the restriction. we focused on thp-1 cells, because ghost cells are already multi-resistant to antibiotic selection, and sufficient knockdown was difficult to achieve for several host factors in mddcs (data not shown). we knocked down mx2, tnpo3, cpsf6, nup153, ranbp2, and trim5 and tested whether this would rescue infection by hivac-1 or hivac-2. knockdowns were confirmed by western blot for mx2, cpsf6, and tnpo3 (figure s4a), and by qpcr for ranbp2, nup153, and trim5 (figure s4b). depletion of tnpo3, cpsf6, nup153, ranbp2, and mx2 reduced hiv-1 and hiv-2 infections, with tnpo3 depletion having the strongest inhibitory effect (figures 4a and s4c). depletion of trim5 did not affect hiv-1 or hiv-2 infection but rescued infection by a n-mlv retroviral vector (bock et al. these effects validated the functional impact of all knockdowns on hiv infection in thp-1 cells. however, there was no rescue of hivac-1 or hivac-2 infection in any of these cases. in mddcs, the levels of late reverse transcription products were similar between wt hiv and hivac viruses (figures 5a and s5a). addition of csa during infection with hivac-2 restored the formation of 2ltr circles and integrated dna (figure 5a). thus, hivac viruses progress normally through reverse transcription and are specifically restricted by cypa at the level of nuclear import. the cypa-mediated restriction at nuclear import suggested to us that a nuclear envelope protein could be involved. we were intrigued by finding that sun2 (unc84b), an inner nuclear membrane protein and member of the linker of nucleoskeleton and cytoskeleton (linc) complex, inhibits hiv infection when it is artificially overexpressed (schoggins et al., 2011). while sun2 was suggested to be an ifn-stimulated gene (schoggins et al., 2011), we found that it is expressed constitutively in thp-1 cells and mddcs and it is not induced by type i ifn, whereas mx1 and mx2 are (figure s5b). to test whether sun2 was required for the cypa restriction, we generated sun2 mouse bone-marrow-derived dcs (bmdcs) (figure s5c) (lei et al. the infectivity of hivac-1 lentivector was reduced compared to hiv-1 wt lentivector, and infectivity could be restored by csa treatment, validating that the cypa-mediated restriction of hivac is conserved in mouse cells (figures 5b, 5c, and s5d). strikingly, in sun2 bmdcs, infectivity of hivac-1 lentivector was largely rescued (figures 5b, 5c, and s5d). furthermore, we found that viral reverse transcription products of hivac-1 lentivector were similar between wt and sun2 cells, while 2ltr circles and integrated viral dna were reduced in wt cells and increased in sun2 cells, in a fashion similar to the one observed with csa treatment of wt cells (figure 5d). thus, sun2 is an essential host factor for the cypa-mediated restriction of hivac capsids at nuclear import. next, we sought to extend the role of sun2 to other activities of cypa in hiv infection. sun2 inhibited the infection of hiv-1 and hiv-2, confirming its antiviral activity when overexpressed (figure 5e) (schoggins et al., 2011). in hela cells, as expected, hiv-1 wt and hiv-1 p90a are independent of cypa, while hiv-1 n74d depends on cypa for infection (figure 5e). overexpression of sun2 inhibited hiv-1 n74d infection, and csa treatment did not reduce infectivity further, indicating that sun2 overexpression functions in the same pathway as cypa in this model (figure 5e). in these cells, which were used for infections, we also observed that sun2 overexpression leads to nuclei that are ruffled and less circular, supporting the notion that an optimal nuclear envelope structure is required for hiv infection through sun2 (figures 5f5h). finally, we examined the contribution of endogenous sun2 to hiv-1 wt and hiv-2 wt infection in primary cd4 targets and thp-1 cells. in mddcs, sun2 knockdown reduced infection by hiv-1 and hiv-2 (figures 6a and 6b). although dendritic cells are physiologically relevant target cells for the immune response to the virus, the bulk of viremia in patients is produced by cd4 t lymphocytes. depletion of sun2 in primary activated human cd4 t cells reduced hiv-1 and hiv-2 infectivity similarly to mddcs (figures 6c and 6d). sun2-depleted cells showed similar viability as compared to control cells (figures s6a and s6b). depletion of sun2 also reduced accumulation of hiv-1 over time using a replication-competent virus (figures 6e, 6f, s6c, and s6d). in contrast to knockout mouse bmdcs, transient depletion of sun2 in human mddcs, cd4 t cells, and thp-1 cells was not sufficient to rescue hivac-1 or hivac-2 infectivity (figures 6c and s6e s6 g). to determine the contribution of sun2 to the role of cypa during hiv-1 wt infection, we used the non-immunosuppressive cypa inhibitor, cbs1, in cd4 t cells (figure s6h). sun2 depletion or inhibition of cypa both reduced hiv-1 and hiv-2 infectivity in cd4 t cells (figures 6c, 6 g, and 6h). importantly, combining cypa inhibition with sun2 depletion did not lead to additive inhibition (figures 6 g and 6h). similar results were obtained in thp-1 cells (figure s6i). while the cypa inhibitor reduced viral rt cdna levels in control cells, this effect of the cypa inhibitor interestingly, cypa inhibition or sun2 depletion did not reduce the level of integrated dna at a detectable level in cd4 t cells (figure s6j). thus, in primary cd4 t cells, sun2 is an essential host factor for the positive effects of cypa on reverse transcription and infectivity. here, we show that cypa mediates a conserved restriction against a family of capsid mutants in hiv-1, hiv-2, and sivmac, and we leverage this phenotype to identify sun2 as an essential host factor in mediating the activities of cypa on hiv-1 wt infection in primary cd4 t cells. the restriction applies to capsid mutants in hiv-1, hiv-2, and sivmac and has been consistently observed in primary cells and cell lines of human, macaque, and mouse origin. the capsid mutant family is exemplified by the hivac-2 mutant, which shows a strikingly enhanced affinity for cypa as compared to hiv-2 and is dependent on cypa for inhibition of infection. hivac-1, an analogous mutant in the cypa-binding loop, is also restricted and dependent on cypa for inhibition, even though the enhanced affinity is less striking (lahaye et al., 2013). importantly, the mutant viruses display normal capsids at the structural level (lahaye et al., 2013) and proceed normally through rt, unlike other cypa-binding mutants such as g89v and p90a (braaten et al., 1996), indicating that inhibition of their infectivity does not result from gross structural defects. as expected, viral mutants with a strong susceptibility to cypa-mediated restriction are rapidly counter-selected in nature: hiv-1 wt escapes this antiviral mechanism and genetic alteration in the virus is required to reveal it, in accordance with the principle of restriction factors (malim and bieniasz, 2012). interestingly, our results show that hiv-2 is slightly restricted by cypa, indicating that it has not acquired a complete resistance to this antiviral mechanism. we propose that the acquisition of the ability of lentiviruses to enter the nucleus of non-dividing cells (goldstone et al., 2010, lin and emerman, 2006) offered an opportunity for co-evolution of a host defense mechanism that inhibits lentiviral nuclear import, which can be revealed by the family of capsid mutants described herein. the combined observations that hivac capsids are inhibited at nuclear import and that the nuclear envelope protein sun2 acts as an antiviral factor in hiv infection when overexpressed prompted us to examine whether sun2 could play a role in the restriction of hivac capsids. even though mouse cells are not natural targets of lentiviruses, the restriction mediated by cypa was conserved and the rescue of hivac infectivity in sun2 knockout cells thus provides a compelling genetic demonstration. prior to this work, hiv-1 capsid mutants a92e and g94d were selected in the presence of csa and became dependent on cypa inhibition for replication (aberham et al. this led to the hypothesis that a cell-type-specific restriction factor inhibits hiv-1 infection after reverse transcription but before nuclear import. however, unlike the hivac capsid mutants, a92e and g94d are generally not dependent on csa in other cell types (de iaco and luban, 2014, qi et al., 2008, yin et al., 1998), and evidence for the existence of a restriction factor is limited to a very narrow range of cell lines (de iaco and luban, 2014, song and aiken, 2007). moreover, it is, so far, not apparent in primary cd4 target cells of the virus (qi et al., 2008). cypa was also suggested to modulate hiv-1 restriction specifically in owl monkey cells (towers et al., 2003), but this was later found to stem from a trim5-cypa fusion protein in this species (nisole et al. in contrast, our results establish a conserved cypa-dependent restriction that is active in primary cd4 target cells, indicating a weakness point in the viral cycle. unexpectedly though, sun2 knockdown in human cells did not rescue hivac capsids, as opposed to knockout murine bmdcs. we envision three possibilities: (1) transient knockdown of sun2 differentially impacts the cypa-dependent restriction in cells as compared to the constitutive knockout that may be developmentally compensated; (2) there are underlying species differences between human and mouse sun2; (3) there are underlying cell-type differences between murine bone-marrow-derived-dcs and human immune cells. we generated crispr/cas9 knockouts of sun2 in thp-1 cells, but observed an unexpected loss of cypa dependency on hiv-1 infection in this experiment, questioning the applicability of this approach (data not shown). it will be important to develop methods to further manipulate sun2 expression in hiv target cells. looking at known capsid-associated factors, we show that depletion of mx2, tnpo3, cpsf6, nup153, ranbp2, or trim5 do not rescue hivac-1 or hivac-2 infectivity. while we can not exclude that the host factor knockdowns were not sufficient, our inability to detect even a partial rescue, when control infections with wild-type virus or mlv were affected, strongly suggests that none of these factors contributed to the cypa-dependent restriction. unexpectedly, mx2 was constitutively expressed in thp-1 cells in the absence of type i ifn, and its depletion reduced hiv-1 and hiv-2 infection in pma-treated cells, suggesting that mx2 may not be antiviral in differentiated myeloid immune cells in the absence of type i ifn. in contrast, the n74d and n73d mutations, which lie in the binding pocket of cpsf6 and nup153 (matreyek et al., 2013, price et al., 2012) did not lead to similar rescue, it is possible that another host factor binds the same capsid region, or that the mutation causes structural consequences further away from the cpsf6 and nup153 binding pocket. it will be interesting to evaluate whether depletion of these factors in the context of sun2 overexpression or depletion differentially impacts infection with hiv-1 wt and capsid mutants. the restriction of hivac capsids at nuclear import and their rescue in sun2 knockout cells is an artificial situation that we leveraged to more broadly understand the natural mechanisms of cypa activities during hiv infection. we provide evidence in two additional models of cypa activities that sun2 is a key host factor. first, we examined hela cells, in which cypa has no effect on hiv-1 wt infectivity but promotes hiv-1 n74d infectivity. accordingly, sun2 overexpression in hela cells cancels the positive effect of cypa on hiv-1 n74d infectivity. optimal sun2 levels are thus required for cypa activity on hiv infection in hela cells. this is unlikely to be a non-specific effect of overexpression, because it was selective for hiv-1 n74d, and sun2 overexpression was previously found to have no impact on several other viruses (schoggins et al., 2011). second, we examined the role of sun2 in mediating the positive effects of cypa on hiv infectivity in primary cd4 t cells and mddcs. using two distinct shrnas targeting sun2, we showed that sun2 is an essential host factor of hiv-1 and hiv-2 infection. furthermore, in cd4 t cells, sun2 depletion was not additive with cypa inhibition of hiv-1 infectivity, and it abrogated the cypa dependence of hiv-1 reverse transcription. interestingly, sun2 depletion had a strong effect on hiv-1 infectivity but little effect on viral late rt products and integrated cdna levels at the time point examined. this suggests the possibility that sun2 may regulate the dynamics of the early steps of replication, integration sites, or viral transcription to impact hiv infectivity, and these possibilities warrant further study. overall, our results show that, while sun2 and cypa can mediate a potent restriction of hivac capsids, hiv-1 wt has evolved to exploit sun2 and cypa instead of being susceptible to their restriction. furthermore, sun2 is required for both hiv-1 and hiv-2 in cd4 cells, indicating that sun2 is an essential hiv-associated factor, including but not limited to cypa activities. the ability of artificial sun2 overexpression to inhibit hiv was previously reported in several transformed cell lines and in mddcs (donahue et al., 2016, schoggins et al., 2011). we now show that endogenous sun2 mediates cypa activities on infection and that endogenous sun2 is essential for infection in relevant primary cd4 t cells. this suggests a non-linear biphasic response (i.e., hormesis) with the endogenous level of sun2 being the optimal level for infection. sun2 levels in various target cells or tissue environments may have been a driving force in selecting an optimal level of cypa affinity in lentiviral capsids. future studies on sun2 in hiv infection will require experimental setups that allow a precise control overexpression levels. in hela cells, sun2 overexpression inhibits hiv-1 infection and simultaneously leads to deformation of nuclei that become ruffled and less circular, pointing to a tempting link between nuclear envelope architecture and hiv infectivity. sun2 does not associate with nuclear pores but connects the nucleoskeleton with the cytoskeleton through nesprins (liu et al. 2006), and it will be important to examine the contribution of these other factors to the effects of cypa during hiv infection. since sun2 is a protein of the inner nuclear membrane of the nuclear envelope, it could potentially interact directly with the nuclear fraction of the viral capsid (chin et al., 2015). the interaction between the capsid and sun2 could alternatively be indirect, such as through nuclear lamins or nesprins. sun2 could thus contribute to viral uncoating in the cytosol, to virus docking on the nuclear pore, to its transport through the nuclear pore, and to its targeting to specific regions of chromatin. all of these possibilities have been shown to depend on binding of the hiv-1 capsid to cypa (campbell and hope, 2015). overall, our results establish that cypa has a conserved ability to restrict lentiviral infection and that sun2 is a key host factor in mediating both positive and negative activities of cypa on infection. this enables us to unravel the detailed molecular mechanisms of cypa and sun2 in the context of hiv infection and extends our understanding of the desirable antiviral defenses that are normally bypassed by hiv-1. the hiv-1 wt construct was nl4-3 vifvprvpuenvnef encoding gfp or tagrfp in nef, and the hiv-2 wt construct was rod9 envnef encoding gfp in nef as previously described (manel et al., 2010). sivmac239 mutants hiv-1 n74d, hiv-1 v86i-iap91lpa-m96l (hivac-1), hivac-1 n73d, hiv-2 n73d, hiv-2 p86 ha (hivac-2), p86ra, p86qa, p86aa, p86am, p86hv, p86pi, hivac-2 n73d, sivmac239 qpapqq85ihagplpa, and pspax2 variant (hivac-1 mutation) were generated by overlapping pcr mutagenesis. in all final constructs, the entire dna fragments originating from the pcr and encompassing the restriction sites used for cloning were fully verified by sequencing. plasmid dna was purified using with the low endotoxin hipure plasmid kit (invitrogen). recombinant plasmid dna did not induce dendritic cell maturation, and viral-producing cells were washed after dna transfection. ghost (ghost x4r5), 293 ft, and hela cells were cultured in dmem, 10% fetal bovine serum (fbs) (gibco), and penicillin-streptomycin (gibco). thp-1 and jurkat cells were cultured in rpmi medium, 10% fbs (gibco), and penicillin-streptomycin (gibco), and thp-1 cells were differentiated with 30 ng/ml (50 nm) of pma for 16 hr. dcs were generated from blood cd14 monocytes using granulocyte macrophage colony-stimulating factor (gm-csf) and interleukin-4 (il-4). viral particles were produced by transfection of 293 ft cells in 6-well plates with 3 g dna and 8 l transit-293 (mirus bio) per well. one day after transfection, media was removed, cells were washed once, and fresh media was added. viral supernatants were harvested 1 day later, filtered at 0.45 m, used fresh or aliquoted, and frozen at 80c. viral titers were measured on ghost cells titration as previously described (manel et al., 2010). rt activity in viral supernatants was measured using the sg-pert assay (pizzato et al., viral supernatants did not induce dendritic cell activation in the absence infection. at day 4 of mddc differentiation (or day 7 for bmdcs), cells were harvested, counted, and resuspended in fresh medium at a concentration of one million per ml with 5 g/ml polybrene, gm-csf, and il-4 (or in bmdcs dc medium); 100 l were aliquoted in round-bottomed 96-well plates, and virus dilutions and treatments were added. 48 hr after infection, cell-culture supernatants were harvested and uv-irradiated to inactivate free virus. for cd4 t cells infection, activated cells were harvested, counted, and resuspended in fresh medium at a concentration of 0.25 million per ml with 8 g/ml protamine. 100 l of cells was aliquoted in round-bottomed 96-well plates, and virus dilutions and treatments were added. hela were infected similarly to ghost cells as previously described (manel et al., 2010) with 8 g/ml protamine. the paired t test or paired repeated measures (rm) anova one-way test were used, unless indicated otherwise in figure legends. in figures, p <0.05, p <0.01, p <0.001, p <0.0001; ns, not significant. b., j .- f.g., and j .- m.p. provided cbs1 .

summaryduring the early phase of replication, hiv reverse transcribes its rna and crosses the nuclear envelope while escaping host antiviral defenses. the host factor cyclophilin a (cypa) is essential for these steps and binds the hiv capsid; however, the mechanism underlying this effect remains elusive. here, we identify related capsid mutants in hiv-1, hiv-2, and sivmac that are restricted by cypa. this antiviral restriction of mutated viruses is conserved across species and prevents nuclear import of the viral cdna. importantly, the inner nuclear envelope protein sun2 is required for the antiviral activity of cypa. we show that wild-type hiv exploits sun2 in primary cd4+t cells as an essential host factor that is required for the positive effects of cypa on reverse transcription and infection. altogether, these results establish essential cypa-dependent functions of sun2 in hiv infection at the nuclear envelope.

PMC4850421

pubmed-1062

upon activation by donor alloantigens, recipient naive t cells can differentiate into a variety of graft-destructive, effector t cell or graft-protective, regulatory t cell (treg) phenotypes. these t-cell commitments are determined largely by the texture of the innate immune milieu in which t-cell activation occurs. a milieu in which transforming growth factor 1 (tgf1) is expressed in the absence of proinflammatory cytokines promotes the commitment of alloactivated t cells into a tissue-protective, forkhead box p3 (foxp3) treg phenotype. in contrast, a milieu in which proinflammatory cytokines are abundant prevents the generation of foxp3 tregs and instead directs t-cell commitment into the tissue-destructive t helper 1 (th1), th2, or th17 phenotypes [1-4]. unfortunately, a robust expression of proinflammatory cytokines is typical for recently engrafted organ transplants. the inflamed state, highly detrimental to the treg induction and immunoregulatory function, is a consequence of innate immune activation in response to the ischemia and reperfusion injury. although conventionally used agents such as corticosteroids are perhaps useful in restricting the early graft inflammation [7-9], their broad immunosuppressive action, including blocking the expression of tgf1, does not facilitate tolerance. hence, we believe that reducing the adverse forms of inflammation but allowing activity of tgf1 and other inhibitory cytokines within a graft may prove to be a key approach for the induction and maintenance of allograft tolerance. we suspect that the creation of an intra- and peri-graft milieu devoid of proinflammatory cytokines will serve to guide the majority of donor-activated t cells into a tgf1-incited, treg tissue-protective phenotype. indeed, our own results and the results of others support this concept [12-15]. therapies that primarily block adverse inflammation, such as alpha1-antitrypsin, anti-interleukin (il)-6, or anti-tumor necrosis factor-alpha, have been successfully utilized by our group in tilting the balance of the allograft response toward tolerance, or in restoring tolerance in the non-obese diabetic (nod) model of type 1 diabetes, even in nod mice with frank diabetes. given the availability of therapies (many of them approved by the us food and drug administration) that are suitable for blocking the adverse forms of inflammation, rapid translation into the clinic seems possible for the treatment of certain immune-inflammatory disorders. we are aware that a pure prevention or a blockade of inflammation may not be sufficient to achieve lasting transplant tolerance in humans. additional lymphocyte-depleting measures are required first of all in order to prevent rejection in pre-sensitized recipients. nonetheless, we believe that favorably tipping the balance of pro- and anti-inflammatory cytokines in the milieu in which non-depleted t cells re-populate will foster t-cell commitment into a tissue-protective mode and promote tolerance. our current efforts at blocking tim4 (t-cell immunoglobulin and mucin domain-containing protein 4), a molecule upregulated by antigen-presenting cells exposed to proinflammatory cytokines and toll-like receptor agonists, have proven equally successful in promoting long-term engraftment in preclinical models of transplantation and autoimmunity, although this method is not yet ready for testing in humans. if confirmed that tim4 blockade leaves t-cell anti-viral responses largely intact, it may be an especially attractive strategy to promote tolerance in patients with chronic viral infections. induction and maintenance of transplant tolerance require that graft-protective foxp3 tregs efficiently and durably restrain the pool of graft-destructive effector t cells after anti-rejection therapy is withdrawn (figure 1). for tolerance to be permanent, the foxp3-dependent treg immunoregulatory phenotype must be stabilized. a stable expression of foxp3, the treg lineage specification transcription factor, is required to maintain treg function and thereby maintain transplant tolerance. loss of foxp3 gene expression, such as that occurring in the inflamed, il-6-rich environments, can destabilize treg molecular phenotype and immunoregulatory function, thereby undermining the maintenance of transplant tolerance. with the loss of immunoregulatory function among these destabilized tregs, rejection occurs as the immunoregulatory restraints upon donor-reactive effector t cells are released. a milieu dominated by anti-inflammatory cytokines or inflammation-dampening agents promotes the commitment of donor-activated t cells into a regulatory t-cell phenotype and thereby fosters transplant tolerance. a milieu dominated by proinflammatory cytokines promotes effector t cell generation and rejection of the allograft. aat, alpha-1-antitrypsin; apc, antigen-presenting cell; il, interleukin; teff, effector t cell (t helper 1 [th1], th2, and th17); tgf1, transforming growth factor 1; tnf, tumor necrosis factor-alpha; treg, regulatory t cell. foxp3 expression in tregs is regulated, in part, by epigenetic modifications of the foxp3 chromosomal locus. the methylation status of cpg-sensitive residues upstream of the transcriptional start site (exon1) is an important regulator of foxp3 expression. methylation of these residues represses foxp3 gene expression while complete demethylation is required for optimal foxp3 gene expression. other epigenetic mechanisms, such as histone methylation and acetylation, also modulate foxp3 stability. of note, therapeutic agents that directly foster maintenance of demethylated foxp3 promote robust expression of foxp3-sensitive genes, immunoregulatory t-cell function, and tolerance. for this purpose, some inhibitors of dna methyltransferases, such as nucleoside analog 5-azacytidine, have been successfully used in experimental studies. perhaps owing to the known toxicity of demethylating agents, formal clinical trials in transplantation that treg infusions have the potential to prolong allograft survival and induce transplant tolerance is widely acknowledged. however, the clinical use of tregs for the adoptive transfer into transplant recipients is hindered by the inherent instability of the foxp3-dependent treg phenotype upon exposure of tregs to inflamed environments. as noted, in the proinflammatory milieu, foxp3 expression is diminished, inhibitory function is compromised, and some tregs even convert to t effector-like phenotypes [22,30-32]. such treg instability has been associated with the activation of dna methyltransferases and the consequent remethylation of cpg residues. it therefore seems intuitive that therapeutic strategies able to maintain foxp3 in a demethylated state may be essential for the effective application of treg therapy in the clinic. while inhibitors of dna methyltransferases and of histone deacetylase are not without toxicity, the addition of safe agents that synergize or supplant these drugs as a means to regulate epigenetic expression of foxp3 should prove extremely valuable in the long-standing quest to induce tolerance. tregs and conventional effector t cells take important cues from their microenvironment, which influences their commitment into regulatory or effector phenotypes. among extracellular stimuli, il-2-triggered expression of stat5 (signal transducer and activator of transcription 5) likely plays a major role in stabilizing tregs. stat5, activated downstream of il-2 receptor complex signaling, binds to the promoter region of the foxp3 gene and thereby activates its transcription. by enhancing transcription of foxp3 we and others have utilized il-2, il-2 anti-il-2 complexes, or il-2.ig either alone or in conjunction with rapamycin and other agents to promote tolerance induction. such therapies have successfully induced transplant tolerance or restored self-tolerance in the nod model of type 1 diabetes. in addition to activating the stat5 pathway and expression of foxp3, il-2 signal, if delivered by a long-lived il-2 anti-il-2 complex or il-2.ig, also causes apoptosis of repeatedly activated effector (but not regulatory) t cells. the fact that calcineurin inhibitors such as cyclosporin negatively impact treg function and activation-related effector t-cell apoptosis may indeed be a result of suppressed il-2 signals. we have previously shown that cyclosporin does prevent tolerance induced by co-stimulation blockade in a cardiac transplant model. rapamycin, on the other hand, did not impede the induction of such achieved tolerance and, as we showed later, does promote the generation of induced tregs. the imbalance of tissue-protective tregs and tissue-destructive th17 cells was recently implicated in the pathogenesis of autoimmunity and certain types of rejection. of note, the commitment of naive t cells to the th17 phenotype (a subset with aggressive cytodestructive properties) is inhibited by il-2, and the expression of stat5 negatively regulates th17 cells. it is therefore reasonable to posit that the activation of the il-2/stat5 pathway promotes tolerance by favorably tilting the balance between th17 cells and tregs toward treg dominance. these strategies have centered upon attempts to delete or at least deplete donor-reactive t cells or alter the early events of t-cell activation such as through co-stimulation blockade. the notion that graft inflammation is the major impediment to transplant tolerance prompts us to further investigate the means of its most efficient therapeutic targeting. it may not be possible to create transplant tolerance unless the inflammatory milieu in which donor-reactive t cells perceive donor antigen is modified. adverse inflammation in the peri-transplant period can guide the majority of donor-activated naive t cells into the graft-protective treg mode. in addition, strategies that foster the expression of treg foxp3 by epigenetic modification may be utilized in conjunction with anti-inflammatory agents to further stabilize tregs and tolerance.

certain forms of inflammation of an allograft are highly detrimental to the induction and maintenance of transplant tolerance as they foster stable commitment to graft-destructive, not graft-protective, forms of t-cell immunity. hence, a reduction in adverse tissue inflammation may prove crucial in facilitating the induction and maintenance of a long-lasting state of transplant tolerance.

PMC3026643

pubmed-1063

faithful dna replication is crucial for genomic maintenance. when replication is perturbed, cells activate stress response networks that connect the detection of replication-blocking lesions with dna damage tolerance (ddt) and repair pathways, chromatin modifications, cell-cycle control, and various other changes in cell physiology, often collectively referred to as the dna damage response (ddr) (jackson and bartek, 2009). failures in these processes are implicated in the etiology of many developmental and neurological disorders and are thought to drive genome instability characteristic of cancer (odriscoll and jeggo, 2008). genome duplication is carried out by the replisome machinery, initially assembled at replication origins (gerbi and bielinsky, 2002). notably, replication initiation critically depends on the loading and activity of the polymerase (pol)/primase complex. this is the fundamental initiator of dna replication in eukaryotic cells, as the replicative dna polymerases can only elongate an existing rna-dna primer produced by this complex. the primase produces short rna fragments (about 712 nt long), which are subsequently subjected to limited extension by pol. these rna-dna primers are then extended by the replicative polymerases pol and pol (aze et al., 2013). pol/primase-mediated processes are not only relevant for origin-dependent replication initiation, but also for origin-independent initiation events, as is the case of lagging strand dna synthesis, and possibly the restart of stalled forks downstream the blocking lesion under conditions of genotoxic stress (branzei and foiani, 2010; heller and marians, 2006). the latter aspect is potentially crucial for efficient ddt and replication, especially in conditions in which fast replication is a requirement, such as at the early stages of development (odriscoll and jeggo, 2008). two distinct modes of ddt, error-prone and error-free ddt, operate in all eukaryotic organisms (sale, 2012). error-prone ddt is mediated by translesion synthesis (tls) polymerases and largely accounts for mutagenesis. error-free ddt uses a recombination-related mechanism known as template switching (ts), in which one newly synthesized strand serves as replication template for the other blocked nascent strand (branzei, 2011; giannattasio et al., 2014). the choice between these ddt modes has profound consequences for genome stability, and to date, several factors have been implicated in ddt pathway choice: pcna post-translational modifications with mono-ubiquitylation, poly-ubiquitylation, and sumoylation (branzei et al., 2008; 2005); genome architectural transitions coupled with early stages of replication (gonzalez-huici et al., 2014); and cell-cycle-specific changes in the abundance or regulation of key ddt factors (karras et al., 2013; waters and walker, 2006). together with pol/primase, a number of structural proteins that tether the replicative minichromosome maintenance (mcm) helicase to the replicative polymerases are loaded at replication origins (aze et al., 2013). ctf4 (and-1 in mammalian cells) functions as such a replisome architectural factor, bridging the mcm helicase and two molecules of pol/primase (gambus et al., 2009; simon et al., it is of note, however, that while pol and primase are essential for cellular proliferation, ctf4 is not. this indicates that even if uncoupled from the replicative helicase, pol/primase supports dna synthesis. besides its roles to maintain normal replisome architecture, ctf4/and-1 is also required for sister chromatid cohesion (hanna et al., 2001; yoshizawa-sugata and masai, 2009). increasing number of reports indicate replication stress at the basis of chromosomal instability, and as an important underlying factor of developmental anomalies (halazonetis et al., 2008; however, the nature of the early chromosome lesions arising following such replication perturbations is largely unknown. moreover, the connections between these replication dysfunctions and the observed chromatin structural alterations similarly triggered by mutations in cohesion factors remain elusive. here we used budding yeast saccharomyces cerevisiae cellular models of specific replication stress and sister chromatid cohesion defects to investigate a possible crosstalk between recombination-mediated ddt and chromatin structure/cohesion. our results indicate that both replicative helicase-coupled re-priming and sister chromatid cohesion are important to facilitate error-free ddt by ts, but they do so via different mechanisms. the results shed light on how highly conserved replication-associated pathways crosstalk to each other and contribute to normal replication fork and chromatin structure, providing mechanistic insights into the molecular basis of human disorders caused by replication dysfunctions. error-free ddt by ts can be molecularly monitored by examining the formation of x-shaped structures composed of sister chromatid junctions (scjs) in the proximity of replication forks using 2d gel electrophoresis (branzei et al., 2008). in this assay, yeast cells are released synchronously and allowed to replicate in media containing the alkylating reagent methyl methanesulfonate (mms). the pattern of replication intermediates at genomic locations of interest is analyzed at different time points during dna replication. previous results showed that ts intermediates form during replication of damaged templates and accumulate when the sgs1-top3-rmi1 complex is defective because of compromised resolution (branzei et al., 2008; liberi et al., 2005; giannattasio et al., replication of damage templates leads to a progressive accumulation of scjs in sgs1 mutant cells (liberi et al., 2005), as well as in sgs1 hypomorphic mutants disrupted only in the helicase domain (onoda et al. deletion of ctf4 causes a g2/m delay associated with slower proliferation (kouprina et al., 1992), but it does not prominently impact on s phase progression when cells are replicating in the presence of mms (figure s1a). notably, we found that the ctf4 mutation reduced the amount of x-shaped scjs in both sgs1 and wild-type (wt) background (figures 1a and s1b), suggesting a supportive role for ctf4 in ts. cells defective in error-free ddt are characterized by a more prominent dependency on tls, showing higher levels of spontaneous mutagenesis and increased damage sensitivity following inactivation of error-prone ddt components (cejka et al., 2001). we found that ctf4 cells have statistically significant increased spontaneous mutagenesis rates (figure 1b). this was largely dependent on rev3 (figure 1b)the catalytic subunit of the tls polymerase pol, accounting for most of the mutagenic events in budding yeast. furthermore, ctf4 and rev3 showed strong additive effects for mms sensitivity (figure s1c), supporting the view that tls-mediated ddt acts as a compensatory mechanism in ctf4 cells. to further characterize the role of ctf4 in ddt, we examined its genetic interactions with classical error-free ddt pathways governed by rad6-rad18 post-replicative repair and rad51 recombinational repair branches. ctf4 mutants showed additive damage sensitivity when combined with rad18 or rad51 (figure s1d). since the rad6-rad18 pathway controls both ts- and tls-mediated ddt, we also examined the genetic interaction of ctf4 with the pcna polyubiquitylation pathway (mediated by rad5, mms2, and ubc13) that specifically affects ts (pfander et al., 2005). however, also in this case, we found an additive effect on damage survival (figure s1e). next, to address the possibility of an effect of ctf4 on ddt by influencing the post-translational modifications of pcna, we analyzed the pattern of sumo- and ubiquitin/polyubiquitin-conjugated pcna species in ctf4 cells. we detected no major changes in pcna modifications both in spontaneous and mms-treated conditions (figure 1c). we conclude that ctf4 facilitates error-free ddt in parallel with canonical post-replicative repair pathways regulated by pcna modifications with sumo and ubiquitin. previous work assigned two main functions to ctf4: an architectural role in the context of the replisome achieved by bridging the pol/primase complex to the mcm replicative helicase (gambus et al., 2009; simon et al., 2014; tanaka et al., 2009)and an additional role in sister chromatid cohesion (hanna et al., a ctf4 deletion mutant shows a mild increase in premature sister chromatid separation in g2/m, accompanied by sporadic chromosome loss and aneuploidy without obvious defects in completing the bulk of dna replication (hanna et al., 2001; it is therefore possible that the ts defect of ctf4 mutants (figure 1a) is an indirect consequence of defective sister chromatid cohesion or, alternatively, a direct result of mcm-uncoupled pol/primase compromised activity. the first hypothesis leads to the proposition that mutants defective in cohesion, but proficient for pol/primase function, would also be defective in formation of ts intermediates composed of scjs. to test this, we analyzed the consequences for ts of impairing sister chromatid cohesion using genetic conditions that result in loosening or opening of the cohesin ring. scc1 is an essential subunit of the cohesin complex that is cleaved at anaphase (uhlmann et al., 1999). using the temperature-sensitive allele, scc1-73, we found that impairment of cohesin function during a single round of replication also caused a defect in ts (figures 2a). similar results were obtained using a gal promoter-driven conditional scc1 allele, gal-scc1, the expression of which is induced by galactose and repressed by glucose (data not shown). next, we asked if pol/primase mutants are different or similar to ctf4 and cohesin mutants with respect to ts. we investigated the contribution of two alleles, pri1-m4, affecting the pri1 subunit of primase (marini et al., 1997), and pol1-1, affecting the catalytic subunit pol1 of pol (lucchini et al., 1988). to mildly interfere with the function of pol/primase without affecting the ability of cells to traverse s phase, cells were grown at the permissive temperature and synchronously released in media containing mms at semi-permissive temperatures that allow completion of dna replication with normal kinetics (data not shown; see below). both pri1-m4 and pol1-1 mutations caused a reduction in the x molecules accumulating in sgs1 (figures 2b and s2a). this phenotype is suggestive of a positive role of pol/primase in error-free ddt by ts, a conclusion also supported by the increased mutagenesis in pol and pri1 mutants previously reported (longhese et al., 1993; considering the phenotypic similarity between ctf4 and both cohesin and pol/primase mutants with regard to ts, we asked if ctf4 contribution to cohesion might take place in the context of the pol/primase complex. to this purpose, we examined the percentage of premature sister chromatid separation, a widely used cohesion readout, in pri1-m4 cells. compared to wt, pri1-m4 cells exhibited a significant increase in premature sister chromatid separation, at a level similar with the one caused by mutations in the non-essential cohesion factors ctf4, chl1, and ctf18 included in the analysis (figure 2c). previously, based on genetic interactions, non-essential cohesion factors were divided in two genetic pathways, having as prominent members ctf4 and chl1 or ctf18 and ctf8, respectively (xu et al., while combination of mutations in the same cohesion pathway generally does not exacerbate the observed cohesion defects associated with single mutations and does not lead to synthetic fitness defects, the opposite is true for combinations of mutations belonging to separate pathways. to further test if the cohesion defects observed with pri1-m4 (figure 2c) are manifested in the context of the pol/primase/ctf4 complex, we combined pri1-m4 with deletion mutations in genes affecting the two non-essential cohesion pathways. supporting the above view that pri1-m4 cohesion defects reflect a role for pol/primase/ctf4 in cohesion, pri1-m4 manifested synthetic fitness defects with ctf18 and ctf8, but not with ctf4 or chl1 (figure s2b; data not shown). altogether, these data demonstrate that interfering with the functionality of the pol/primase/ctf4 and cohesin complexes results in similar defects both in cohesion and error-free ddt by ts, leading to the question of whether cohesion and ts recombination are linked by a causal relationship. sister chromatid cohesion defects reflect impairments in maintaining accurate physical proximity between the newly replicated chromatids. while it is reasonable to assume that by influencing the accessibility of the sister chromatid donor sequence cohesin facilitates sister chromatid recombination (covo et al., 2010; tittel-elmer et al., 2012), to what extent the physical proximity of chromatids impacts on scj formation during the non-canonical recombination mechanism of ts is unknown. to address this, we used a previously described system that artificially re-establishes cohesion in a locus-specific manner. the system relies on the ability of the lactose inhibitor (laci) to bind the lactose operator sequence (laco). in the wt form (tetramer; figure 3a, right), laci is able to form tetramers that bind two different laco sequences present on each chromatid, while a truncated version of the laci protein (dimer; figure 3a, left) is only able to form a dimer and to bind the laco sequences on a single chromatid. therefore, after dna replication, only the tetramer version of laci, and not the dimer, can bind the identical laco sequences placed on both sister chromatids, restoring sister chromatid cohesion locally in cohesion-defective mutants (straight et al., 1996). by using the above assay, we examined whether artificial tethering of the sister chromatids was able to locally rescue the ts defects associated with cohesin mutants. sgs1 and sgs1 scc1-73 cells carrying either the dimer or the tetramer laco/laci system were synchronized at the permissive temperature, and after activation of laci expression, cells were released in media containing mms at the non-permissive temperature for scc1-73 to induce ts defects associated with decreased cohesin function (see figure 2a). next, we examined by 2d gel the pattern of ts intermediates arising at locations proximal to the laco array (figure 2a). we found that, unlike the sgs1 scc1-73 mutant carrying the dimer version of laci, which showed reduced accumulation of ts intermediates (figure 3b, upper panel), the strain with the tetramer version of laci rescued x molecule formation (figure 3b, bottom panel). to verify the specificity of the tethering system, we digested and hybridized the same genomic dna to probe for replication intermediates forming in the proximity of the early origin of replication ars1, located on chromosome iv, which should not be affected by the laci variants binding to laco cassettes on chromosome iii. as expected, the ts defect associated with scc1-73 at ars1 was not alleviated (figure s3). because artificial tethering of the chromatids is able to bypass the absence of a functional cohesin ring in regard to scj formation, these experiments demonstrate that the role exerted by the cohesin complex in ts is structural. to now assess whether, as in scc1-73, the ctf4 defect in ts is also due to increased physical distance between the sister chromatids, we used the same experimental approach, but in the sgs1 ctf4 background. interestingly, artificial cohesion did not restore the formation of x molecules in the sgs1 ctf4 strain (figure 4a), although the laco/laci system efficiently reduced the local cohesion defects on chromosome iii associated with ctf4 (figure 4b). the function of ctf4 in ts revealed by this assay is thus different from the structural one of cohesin (figure 3b). of note, the defect of ctf4 cells resembled the one caused by inactivation of the rad51 recombinase (figure s4a). these results indicate that ctf4 affects key aspects of the ts reaction that can not be substituted by simply restoring the physical proximity of the sister chromatids. taken together, the data suggest that the repair/ts defect of ctf4 mutants is primarily caused by faulty mcm-uncoupled pol/primase activity rather than by defective sister chromatid cohesion. based on the above results, we conclude that, at least in regard to ddt, the roles of cohesin and pol/primase/ctf4 are manifested via two fundamentally distinct mechanisms. supporting this view, deletion of ctf4 resulted in synthetic lethality when combined with scc1-73 even at permissive temperatures (figure s4b) (mclellan et al., 2012). in addition, using a combination of temperature-sensitive alleles of pol/primase mutants and cohesin, we obtained viable pri1-m4 scc1-73 cells that displayed, however, increased mms sensitivity compared to the single mutants (figure s4c). this result highlights once again a differential contribution of cohesin and the pol/primase/ctf4 complex toward ddt. a diverse molecular purpose of pol/primase and cohesin during canonical recombination can also be deduced from their contribution to the donor choice: in cohesin mutants, the inter-sister recombination events decrease in favor of events involving the homologous chromosome (covo et al., 2010; tittel-elmer et al., 2012), whereas ctf4 causes a decrease in both sister- and inter-homologous recombination in conditions of dna damage (ogiwara et al., these results reveal that, despite cohesin and ctf4 mutants showing similar phenotypes in cohesion and ddt, cohesin aids ts by maintaining the proximity of the recombination donor, while the pol/primase/ctf4 complex must affect some fundamental activity or step during recombination-mediated damage bypass. to identify the ts-sensitive step that is defective in pol/primase/ctf4 complex mutants, when re-priming is either affected or uncoupled from the mcm helicase, we combined ctf4 and pri1-m4 with a series of mutations affecting distinct hr-associated processes. we found that ctf4 shows synthetic sickness/lethality with rad52 (kouprina et al., 1992), but not with rad51 (figure 5a) or other rad51 mediators, such as rad55, that assist rad51-mediated strand invasion (data not shown). we also observed a similar pattern of genetic interactions for pri1-m4 (figure s5a). although rad51 and rad52 act together in most recombination events, a significant amount of hr events are detectable in rad51 mutants that are dependent on rad52 (krogh and symington, 2004). in saccharomyces cerevisiae, the major rad51-independent activity of rad52 is represented by strand annealing, which also involves rad59 and rpa (krogh and symington, 2004). notably, ctf4 also showed synthetic fitness defects when combined with rad59 (figure 5b) and the s. cerevisiae rpa largest subunit rfa1 allele, rfa1-t11 (figures 5c; see below). however, no synthetic interactions were observed with rad1 (figure s5b), defective in the process of double-strand break (dsb) repair by single-strand annealing (krogh and symington, 2004). the single-stranded dna-binding complex rpa initially covers ssdna in order to prevent secondary structure formation and to mediate the subsequent binding of rad52 (krogh and symington, 2004). binding of rad52 to stretches of rpa-covered ssdna may promote annealing of such sequences, potentially leading to rearrangements, such as deletions and duplications, especially in the presence of repeat sequences (branzei, 2011). supporting this view, we found a strong increase, of a 1,000-fold magnitude, in spontaneous deletion rates of genomic elements flanked by repeat sequences, in both ctf4 and pri1-m4 mutants with respect to wt (figure 5d). these deletion events were not dependent on rad51; rather, the rad51 mutation itself caused an increase in such deletion events in both wt and ctf4/pri1-m4 backgrounds (figure 5d). to directly test the genetic evidence of an altered amount of ssdna in ctf4 and pri1-m4 mutants, we performed electron microscopy (em) analysis on the replication intermediates extracted from wt, ctf4, and pri1-m4 cells replicating under damaging conditions. pri1-m4 showed a strong increase in the length of the ssdna stretches exposed at the replication fork (figure 6a). in addition to this, we found that although not different for the average length, both ctf4 and pri1-m4 mutants showed a 2-fold increase in the number of internal gaps detected behind replication forks (figure 6b). holliday junction-like structures in which the two newly synthesized strands are paired, in both ctf4 and pri1-m4 (figure 6c). it is of note that such reversed fork structures were absent in wt cells, suggesting that reversed forks are not predominantly induced following genotoxic stress in saccharomyces cerevisiae. this is in line with previous reports on total replication intermediates formed during replication in the presence of uv- or mms-induced damage (lopes et al., 2006), and with the structural analysis of x-shaped structures forming at a specific chromosome locus during replication of damaged templates in wt and sgs1 budding yeast cells (giannattasio et al., 2014) altogether, the results demonstrate a profound alteration in the metabolism of ssdna in pol/primase/ctf4 complex mutants. this likely leads to the subsequent formation of unscheduled reversed forks and recombination structures, having negative effects on both chromatin structure and ddr. this process generates endogenous damage and replication stress, although the molecular nature of the latter remains poorly understood. while various studies outline that intimate links must exist between dna replication and ddt/ddr mechanisms (branzei and foiani, 2010; jackson and bartek, 2009), how relatively mild replication-challenging conditions interfere with other chromosome metabolism processes associated with dna replication remains largely elusive. here we set out to examine how specific replication pathways may crosstalk to each other and affect ddt. remarkably, we found that mild impairment in replication-associated molecular pathways related to re-priming, replisome architecture, and cohesion invariably negatively impinged on template switching (figures 1a and 2b). the defects in error-free ddt were coincident with an increase in mutagenic ddt and other types of genomic rearrangements (figures 1b and 5d), as well as with altered replication fork structures (figure 6). these results provide in vivo support for the primer-driven post-replicative ddt as the most prominent pathway of ddt, at least in budding yeast (becker et al., 2014; branzei, 2011; heller and marians, 2006; lehmann and fuchs, 2006). moreover, as deletion of ctf4 that does not directly impact on primase activity caused a similar phenotype to the one of primase mutants, the present work carries the implication that this re-priming function provides genome stability when carried out in the context of mcm-coupled pol/primase protein complex (figure 7). on the contrary, when re-priming is deregulated, problems are bound to occur. limited re-priming can lead to fork uncoupling and long stretches of ssdna at the fork (figure 6a); these ssdna discontinuities can engage in error-prone annealing events (figure 5d) and cause altered replication fork architecture (figures 6c and 7). deregulated re-priming events can lead to a larger number of internal gaps (figure 6b), some of which may be more easily filled-in via tls-mediated mechanisms (figure 1b) or also engaged by error-prone strand-annealing activities (figures 5d and 7). notably, under conditions of limited or mcm-uncoupled re-priming, we observe an unusual high frequency of fork-reversal events associated with long ssdna stretches at the fork. the ssdna regions may be due to prolonged replication fork uncoupling or exonucleolytic processing of the reversed forks (figure 7). these observations indicate that at least in saccharomyces cerevisiae fork reversal is disfavored or extremely transient when re-priming is working efficiently. the fork reversal phenotype we reported here for ctf4 and pri1-m4 mutants is induced by dna damage. while in primase mutants about 12% of the forks are present in reversed conformation during replication in the presence of mms (figure 6c), following fork stalling induced by hu treatment, we found only 1% reversed forks in primase mutants and no reversed forks in wt and ctf4 mutants (data not shown). this is in contrast with the phenotype of rad53 replication checkpoint mutants in which about 10% of replication forks are in a reversed fork conformation after hu treatment (cotta-ramusino et al., 2005; sogo et al., 2002). accumulation of reversed forks upon checkpoint defects likely reflects local accumulation of torsional stress (bermejo et al., 2011) and not ddt attempts, as only about 1% reversed forks are observed in checkpoint defective cells upon mms treatment (lopes et al., 2006). thus, replication fork reversal is differentially modulated upon challenges to replisome stability or during replication-associated ddt. under specific types of genotoxic stress (ray chaudhuri et al., 2012), or upon impairment of kinetically favored ddt mechanisms (e.g., re-priming), transient fork reversal may become a crucial strategy to promote fork stabilization or to mediate alternate modes of damage-bypass in both s. cerevisiae and higher eukaryotic cells (neelsen and lopes, 2015). while fork reversal may initially function as a fork stabilization mechanism both at stalled and damaged replication forks (atkinson and mcglynn, 2009; neelsen and lopes, 2015), it is of note that unless promptly restarted reversed forks can be processed by multiple nucleases (cotta-ramusino et al., 2005; doksani et al., 2009; neelsen et al., 2013; szakal and branzei, 2013), thus being a potential source of deleterious ssdna discontinuities and dsbs that may trigger, in the long run, genome instability (figure 7). indeed, reduced amounts of pol in saccharomyces cerevisiae induce recombination-associated chromosome deletions and duplications (song et al., 2014). we propose that altered fork structures may be engaged in break-induced replication (bir) type of mechanisms (figure 7), which may function as alternate and likely aberrant modes of ddt, prone to deletions as well as genomic duplications (costantino et al., 2014). notably, in support of the bir notion above, we found that ctf4 and pri1-m4 mutants display synthetic lethality with deletions of rad52 and rad59, generally required for bir, but not with rad51, which is often dispensable for bir (anand et al., 2013). as many replication factors, including ctf4, also facilitate the dna synthesis step of bir (lydeard et al., 2010), it is likely that the bir events induced under such replication stress conditions might be more prone to errors, leading to rearrangements. indeed, inactivating mutations in error-free ddt factors as well as in pol/primase cause an increase in genomic duplications and deletions (figure 5d) (putnam et al., 2010). altogether, these results provide a molecular rationale for why cellular conditions characterized by replication stress are coincidently defective in error-free ddt processes and prone to deleterious bir or other annealing events (figures 1 and 5). these recombination pathways are bound to involve similarly defective replication steps, thus setting the stage for vicious circles in which more replication stress is being created. mild replication dysfunctions of the type we uncovered here in ctf4 and pri1-m4 mutants are likely the culprits not only for genome instability, but also for chromosomal structural and cohesion alterations. indeed, we found that differently from impairments in cohesin, the cohesion and ts defects of pol/primase/ctf4 are in a non-causal relationship. on one hand, improvement of sister chromatid proximity does not rescue the ts defects of ctf4 mutants (figure 4). on the other hand, inability to perform ts is unlikely at the basis of the observed cohesion defects, as mutations in canonical ts factors do not result in similar cohesion defects (warren et al., 2004). we propose that the two phenotypes, defective ddt and cohesion impairment, arise coincidentally, but likely independently, from the same replication condition. in the case of pol/primase/ctf4 mutants, the underlying replication dysfunction relates to deregulated re-priming, and abnormal distribution of ssdna discontinuities. in addition, it is possible that increased replication pausing and altered fork structure in pol/primase/ctf4 complex mutants affects the topology of the replicating dna in manners that negatively impinge on cohesion (liu et al., 2010). the coincident cohesion and ddt defects associated with mutations in the pol/primase/ctf4 complex suggest an intimate relationship between these two biological processes during replication. this hypothesis may also explain that hypomorphic mutations in other replication factors, affecting replication initiation or primer-processing, lead to cohesion defects and reduced tolerance to genotoxic stress (kerzendorfer et al. remarkably, oncogene-induced replication stress, as well as ddr and cohesion dysfunctions associated with neurological and developmental defects, resemble in many respects the replication impairments studied here (halazonetis et al., 2008; neelsen et al., 2013; odriscoll and jeggo, 2008; van der lelij et al., 2010). we propose that aberrant ddt associated with compromised error-free ts and fork rearrangements is a potential underlying common source of lesions in a number of replication disorders. the yeast strains used in this study were mostly derivatives of w303 and detailed genotypes are indicated in table s1. information about growing media, cell cycle arrest, release, and analysis are described in supplemental experimental procedures. forward mutation and spontaneous intra-chromosomal deletion rates were calculated as described in the supplemental experimental procedures. purification of dna intermediates and 2d gel analysis were carried out as previously described (vanoli et al., 2010). each experiment shown was performed independently at least twice with qualitatively identical results. genome preparation and signal quantification methods

summarychromosomal replication is entwined with dna damage tolerance (ddt) and chromatin structure establishment via elusive mechanisms. here we examined how specific replication conditions affecting replisome architecture and repriming impact on ddt. we show that saccharomyces cerevisiae pol/primase/ctf4 mutants, proficient in bulk dna replication, are defective in recombination-mediated damage-bypass by template switching (ts) and have reduced sister chromatid cohesion. the decrease in error-free ddt is accompanied by increased usage of mutagenic ddt, fork reversal, and higher rates of genome rearrangements mediated by faulty strand annealing. notably, the ddt defects of pol/primase/ctf4 mutants are not the consequence of increased sister chromatid distance, but are instead caused by altered single-stranded dna metabolism and abnormal replication fork topology. we propose that error-free ts is driven by timely replicative helicase-coupled re-priming. defects in this event impact on replication fork architecture and sister chromatid proximity, and represent a frequent source of chromosome lesions upon replication dysfunctions.

PMC4352764

pubmed-1064

vitamin d deficiency, a pandemic health problem, is a major cause of rickets in infants and toddlers and of osteopenia in adolescents [16]. the production of vitamin d in the skin depends on sunshine exposure, latitude, skin-covering clothes, the use of sun block, and skin pigmentation. although the mediterranean region generally has a sunny climate, higher rates of hypovitaminosis d are seen in european and mediterranean countries [710]. vitamin d deficiency is especially common in the middle east because of the prevalence of wearing skin-covering clothes and because of staying out of the sun. besides acting as a regulatory hormone in calcium metabolism, noncalciotropic effects of vitamin d such as cellular differentiation and replication in many organs vitamin d is also critical in glucose homeostasis and insulin secretion via its endocrine mechanisms [1214], besides its autocrine and paracrine role in adipocytes [15, 16]. insulin resistance plays a major role in obesity, and as a population gets heavier at younger ages, the age of onset of non-insulin-dependent diabetes mellitus also decreases. regrettably, obesity and adiposity is an emerging trend in the industrialized world it is a result of alimited exercise, a sedentary lifestyle, and replete diets with high-calorie, low-nutrient foods. the literature provides conflicting data as to whether vitamin d deficiency and insufficiency is a risk factor for the development of impaired glucose tolerance in childhood obesity. low 25-hydroxyvitamin d level is found to be associated with insulin resistance in adults, but no relationship was found with parameters of glucose homeostasis and insulin sensitivity in healthy youth. this study was conducted to study the relationship of vitamin d deficiency and insufficiency with insulin resistance in obese children and adolescents and the prevalence of vitamin d deficiency among children living in the metropolitan area of istanbul, turkey. enrolled in the study were 118 obese children (50% males, 50% females; mean age 12 2.2 years) and a control group of 68 healthy nonobese children (48.5% males, 51.5% females; mean age 12.6 1.7 years). they had been admitted to the bezmialem vakif university general pediatrics clinic in the marmara region between january 2011 and january 2012. each participant underwent a detailed physical examination (including evaluation for syndromes and endocrine diseases), as well as a laboratory evaluation. standing height was measured to the nearest 0.1 cm with a harpenden fixed stadiometer. body weight (kg) was measured on a seca balance scale to the nearest 0.1 kg, with each subject dressed in a light t-shirt and shorts. body mass index (bmi) was calculated by dividing weight by height (kg/m). obesity was defined as the bmi>97th percentile, the definition of the international task force of obesity in childhood and population-specific data [21, 22]. children whose obesity was the result of a syndromal problem (prader willi, laurence-moon biedl syndrome, etc.) were excluded, as were those whose obesity had an endocrinal cause such as cushing's syndrome or hypothyroidism. none of the participants was using meneedication or had a history or evidence of current metabolic, cardiovascular, respiratory, or hepatic disease. all blood analyses were performed on fasting samples in both the study and control groups. cholesterol, high-density lipoprotein (hdl), low-density lipoprotein (ldl), and triglycerides were measured by the homogeneus colorimetric enzyme technique (roche, cobas 8000). serum 25-ohd levels were determined by the electrochemiluminescence enzyme immunoassay method (eclia) (advia centaur, usadpc co., usa). glucose was measured by the glucose oxidase technique (siemens advia 1800) and insulin levels were analyzed with direct chemiluminescence technique (siemens centaur, usa). insulin resistance was estimated from fasting plasma measurements using homa-ir (insulin (mu/l) glucose (mmol/l)/22.5). insulin resistance criteria were homa-ir>2.5 for prepubertal children and homa-ir>4.0 for adolescents. vitamin d status was classified as either deficient, insufficient, or sufficient (serum 25-ohd:<10 ng/ml, 1020 ng/ml, and>20 ng/ml, resp.). statistical analysis was performed with pasw statistics, v.13.0. a paired t-test was used to calculate the difference of two parameters in groups; one-way anova was used in the calculation of difference of two parameters in groups with more than two in the same group and between different groups. categorical data were evaluated using the chi-square test; p<0.05 was accepted as statistically significant. the study was approved by the local ethical committee. written informed consent was obtained from parents. age and gender distribution were not statistically different between the two groups (p=0.79 and 0.839, resp.). subjects of the obese group had significantly higher waist circumference sds (0.027), bmi (p<0.001), bmi sds (p>0.001), and bmi percentage (p>0.001) compared with the control group (table 1). table 2 presents the biochemical characteristics of all subjects. compared with the nonobese subjects, obese subjects had higher fasting insulin, homa-ir, serum alt, triglyceride, and total and ldl-cholesterol levels. the 25-ohd levels of obese children were significantly lower than those of the non-obese (p=0.002). hdl-cholesterol levels of the obese subjects were significantly lower than the non-obese ones. the obese group was classified according to 25-ohd levels as vitamin d deficient (10 ng/ml), insufficient (1020 ng/ml), and sufficient (25-ohd>20 ng/dl). the correlation of vitamin d levels with insulin resistance in the obese group was evaluated with homa-ir. the homa-ir levels of the obese subjects who were vitamin d deficient and insufficient did not statistically differ from those with vitamin-d-sufficient ones (p=0.72) (table 3). table 4 presents the correlations among homa-ir with other biochemical parameters in the obese group. homa-ir was not correlated significantly with age and serum 25-ohd levels but significantly correlated with triglyceride and ldl levels. homa-ir correlated significantly with bmi (p<0.001), bmi sds (p<0.01), and bmi percentage (p<0.001). obese children in turn have higher risk of hypovitaminosis d. turkey's vitamin d prophylaxis augmentation program (started in 2005) has resulted in a marked decrease in vitamin d deficiency in healthy children under 1 year of age; yet despite these improvements, most turkish adolescents are still vitamin d deficient. in our study, this finding revealed that obesity could be a risk factor of hypovitaminosis d in turkish children and adolescents. recent studies from different countries have also demonstrated that vitamin d deficiency is common in obese children, possibly due to the low quality of diet. here in turkey, rates of hypovitaminosis d in healthy adolescents were 59.4% and 65% in two different studies [26, 29]. vitamin d plays an important role in glucose homeostasis in the mechanism of insulin release. most of the studies suggested vitamin d deficiency as a risk factor of disturbed glucose homeostasis in adults [3033], but this hypothesis is still controversial in relation to children. it remains unclear if vitamin d deficiency and insufficiency are associated with insulin resistance in obese children and adolescents. insulin resistance was estimated from fasting plasma measurements using homa-ir. in our study, insulin resistance values were higher in obese subjects compared with the healthy, vitamin-d-sufficient, age- and gender-matched children and adolescents. in order to determine the role of 25-hydroxyvitamin d levels in glucose intolerance and insulin resistance in obese children, we compare the homa-ir levels of vitamin-d-sufficient obese children and adolescents with the vitamin-d-deficient and -insufficient obese ones. there were no significant differences in homa-ir levels in obese children and adolescents due to 25-hydroxyvitamin d levels. in correlation analyses, we found that homa-ir depended on the degree of obesity and correlated with serum lipid profile. there was a significant trend towards higher insulin concentrations and insulin resistance in subjects with higher body mass index independent from 25-hydroxyvitamin d levels. recent studies researching the relationship between vitamin d deficiency and insulin resistance in obese children revealed controversial results. in two studies, no relationship was found between low vitamin d status and insulin resistance [34, 35]. on the other hand, the literature mostly supported the hypothesis that low vitamin d status is associated with worse glucose tolerance.. showed that vitamin d deficiency is associated with increased insulin resistance in children. the study by reis et al. showed that low serum vitamin d in adolescents was strongly associated with increased risk for fasting hyperglycemia, hypertension, and metobolic syndrome. in the study conducted by garanty-bogacka et al., fasting insulin levels and homa-ir were found correlated with low vitamin d levels. a limitation of this study is that vitamin d deficiency and insufficiency was defined only by 25-ohd levels. it is 1,25-dihydroxyvitamin d which is active on the vitamin d receptor in the insulin producing cells. it was also, not possible to evaluate other parameters modifying bone health such as subjects ' dietary calcium intake or the responsiveness of the vitamin d receptor. in addition, with the lack of consensus regarding the definition of optimal vitamin d status in children, it is not possible to determine the level of vitamin d which disturbs glucose homeostasis and causes metabolic effects. in conclusion, in our study, insulin resistance correlated mostly with bmi but not with 25-hydroxyvitamin d levels in the obese children and adolescents. we found significant association between the degree of obesity and some biochemical parameters with insulin resistance, but different levels of 25 hydroxyvitamin d status among obese children were not an independent predictor of insulin resistance.

objectives. we aimed to determine the relationship between insulin resistance and serum 25-hydroxyvitamin d (25-ohd) levels in obese children and their nonobese peers. materials and methods. included in the study group were 188 obese children (aged 915 years), and 68 age- and gender-matched healthy children of normal weight as control group. anthropomorphic data were collected on patients and fasting serum glucose, insulin, serum lipids, alanine aminotransaminase (alt) and 25-ohd were measured. the homeostatic model assessment of insulin resistance (homa-ir) was calculated in both groups. results. the levels of 25-ohd in the obese group were significantly lower than those of the nonobese (p=0.002). homa-ir, triglycerides, low-density lipoprotein, and alt levels in the obese group were significantly higher than values of control group (p<0.001 and p=0.002, resp.). in the obese group, vitamin d deficiency, insufficiency, and sufficiency (25-ohd<10 ng/dl,<20,>10 ng/dl;>20 ng/dl, resp.) were not correlated with homa-ir (r: 0.008, p=0.935). homa-ir was negatively correlated with bmi, bmi sds, and bmi%, and triglycerides, low-density lipoprotein, and alt levels (p<0.001). conclusion. the insulin resistance of the obese subjects who were vitamin d deficient and insufficient did not statistically differ from those with vitamin d sufficiency. low 25-hydroxyvitamin d levels were not related with higher insulin resistance in obese children and adolescents. in obese subjects, insulin resistance was affected more from bmi, bmi sds, and bmi% than from 25-hydroxyvitamin d levels.

PMC3623428

pubmed-1065

measurements of nitrogen and sulfur dioxide using passive sampler over 12 months in samsun, turkey, are compared with so2 and no2 concentrations obtained from a co-located chemiluminescence analyzer. the concentrations of sulfur and nitrogen dioxide in the ambient air during the period from november 2009 to september 2010 are analyzed. the highest value for annual no2 and so2 averages of passive sampler was 29.65 g/m and 21.01 g/m for exposures of 2-weeks at an industrial site. the maximum monthly concentration for so2 was observed at the 10 measurement station with 44.19 g/m for august. the maximum monthly concentration for no2 was observed on the 3 measurement station with 42.83 g/m for november. a negative correlation between nitrogen dioxide concentrations and temperature (r=0.5489) was estimated. a positive correlation between nitrogen dioxide measurement with passive sampler and continuous measurement (r=0.6571) was estimated. industrial establishments operating in the samsun industrial zone for years, activities of the mobile power plants opened but then closed down and natural gas combined cycle plant scheduled to be reactivated require detailed studies of the region in terms of air pollution. the readings of the measurements made with uninterrupted system measurement devices at one single location revealed that the limit values of the european union were exceeded seasonally in terms of nitrogen dioxide. however sulfur dioxide values did not exceed national and international legislations in any period (see table 1). national and international ambient air quality standards for so 2 and no 2 (as ppb) in the first instance the passive sampler was developed in america as an on-person air sampler by palmes et al. (1976), it ensures that gas or vapor on the atmosphere is carried by molecular diffusion with a physical process and kept in a membrane. here, the effective power is concentration change between the absorption surface and the air surrounding it and the amount of diffusion occurred is given on 1 fick rule on equation (1) .(1)f=d.dc/dl where; f is the molar flux (g.cm.min), d is the diffusion coefficient (cm/min), c is the concentration (g.cm), and l is the diffusion path (cm). the contaminant concentration kept in the passive sampler depends of the period of atmosphere exposure, quantity of total gas transfer collected in the passive sampler tube, geometric structure of the tube and diffusion coefficient, ambient temperature, ambient humidity, sorbent strength and face velocity. passive sampler is a preferred method since it does not require power supply, has cost-efficient investment, light, simple analysis procedure as well as not requiring calibration, and suitable for simultaneous multipoint measurement of ambient air pollution. passive samplers are extremely useful to assess long-term concentration trends (e.g., yearly) and are small, light, re-usable, and soundless. nitrogen dioxide has an irritant effect on the respiratory organs, and long exposures can increasingly lead to airway disorders, such as chronic bronchitis. the major health impact of sulfur dioxide include effects on breathing, respiratory illness, weakness of lung defenses, increase in the effects of existing respiratory and cardiovascular disease, and death. explanations of effects of pressure, temperature, and wind speed on the samplers for no2 and so2 have been reported ,. diffusive sampling can be used if the average, instead of the real-time, pollutant concentration is adequate for the purpose of monitoring. the measurements took place at an industrial zone located in samsun tekkekoy district, selyeri locality. the area is enclosed in the north by the black sea. the area is also crossed by one of the main samsun and turkey highways, the d010 (figure 1, yellow line). the industrial zone digital map of samsun tekkekoy district, scale 1:50000, is used at the gis-software arcgis (version 9.2, esri, ca, usa). the measurement results were introduced in the esri geographic information system software arcgis and the extension geostatistical analyst was used to obtain distribution maps. the geostatistical analyst, an extension to arcgis, a product of the environmental systems research institute (esri), california, usa, can be applied to analyze the data from air quality monitoring networks and to generate maps of spatial distribution of the monitored air pollutants. for the pilot study, there were 10 samplers available for field sampling and the sampling area was approximately 20 km; therefore; samplers were distributed through background locations only using a systematic grid of 11 km, as can be seen in figure 1. the samplers of site were identified and tracked using a global positioning system (magellan mobile mapper tm6). measurement points and coordinates the passive samplers used for the measurements are from english gradko company and the technical specifications are explained in detail on table 3. the analysis of nitrogen dioxide and sulfur dioxide passive samplers were conducted at gradko s laboratory in england. all air analyses have been all conducted by ukas accredited methods, working to iso 17025. the calibration of sampling tubes was made with gradko environmental laboratory accredited by united kingdom accreditation service (ukas). the concentrations of nitrite ions and hence no2 chemically adsorbed (the grid made of stainless steel impregnated with 20% triethanolamine) are quantitatively determined by uv/visible spectrophotometry (camspec m550 spectrophotometer) with reference to a calibration curve derived from the analysis of standard nitrite solutions (ukas accredited methods) which is measured colorimetrical. likewise, for the sulfur dioxide analysis, the grid made of stainless steel impregnated with potassium hydroxide was extracted and then measured with dionex ic 3000 ion chromatography. determined by an overall m.o.u of 14.081%+/ and a limit of detection of 0.026 g s for sulfur dioxide. determined by an overall m.o.u of 10.907%+/ and a limit of detection of 0.021 g no2 for nitrogen dioxide. properties of passive samplers in order to compare passive samplers with the results of uninterrupted system measurement method operated with chemical optical spectroscopic methods, the data of the measurement station owned by the ministry of environment and forestry was used (station no.3). the station no.3 where the reference method chemiluminescence and uv fluorescence method for automatic measurement of no2 and so2 concentrations and are in use. an automatic ambient so2 analyzer (af22 m, environnement s.a, france) and a ambient no2 analyzer (ac32 m, environnement s.a, france) were used to measure the average concentrations of sulfur dioxide and nitrogen dioxide. the fixed measurement station data was obtained from air quality monitoring network database. the data were compiled as 14-day average data and then compared with the passive sampler readings. the passive samplers were located far from walls and 2.0 m above the ground. while selecting the locations of passive samplers used for the measurements, several particulars were taken into consideration such as; exactly determining the industrial contamination in the region, taking into consideration the impact areas by bearing in mind the dominant wind direction, taking into consideration the impacts of significant point contaminants, preventing the impact of pollution caused by vehicles, minimizing the intervention on parks and of wind, comparing the results with uninterrupted measurement system and ensuring ease and safety of passive sampler installation. the measurement readings obtained for nitrogen dioxide and sulfur dioxide from all measurement stations are given separately on figures 2 and 3, and seasonal variation of sulfur dioxide and nitrogen dioxide for all stations on figures 4 and 5. the highest average concentrations were in winter for nitrogen dioxide and sulphur dioxide (figures 4 and 5). the values of so 2 and no 2 for 1 5 stations. the values of so 2 and no 2 for 6 10 stations. when a digital map of the readings regarding monthly averages of sulfur dioxide measurements between october 2009 and october 2010 was formed by using arcgis software, it was observed that the values obtained in august 2009 were the highest and reached up to 154.49 g/m (figure 6). as for the sulfur dioxide; the overall result observation the digital maps prepared by using arcgis software was that the level of pollution at measurement locations number 1, 2, 3, 4, 5 and 10, in other words on the south-west and north-west of the region, is higher. results of measurement of averaga sulfur dioxide for august 2010 (as the highest mount). according to the measurement readings calculated for nitrogen dioxide, the highest no2 values reached up to 43.27 g/m in november 2009 (figure 7). results of measurement of average nitrogen dioxide for november 2009 (as the highest mount). g/m and 21.01 g/m for so2 (figure 8). dispersion of annual average no 2 and so 2 pollutants in samsun in 20092010. in order to compare the results obtained with passive sampler method with the measurements made with uninterrupted measurement devices, passive samplers were located at the fixed measurement station of ministry of forestry and water works, namely sampling station number 3. the measurement readings were obtained from air quality monitoring network web page as the reference method of chemiluminescence. the arithmetical averages of the 14-day exposure period of the passive samplers were calculated by taking into consideration the daily arithmetical averages of the values. the results of sulfur dioxide and nitrogen dioxide according to two measurement methods so compared are given on figure 8. statistically, regression analysis carried out to show the degree of correlation between the continuous monitor and the diffusion tubes gave different regression coefficients. correlation analysis between passive samplers and the continuous monitor (figure 9) gave a correlation coefficient (r) of value. according to the uninterrupted system and passive sampler methods used at measurement station number 3, there is a low-level relationship in terms of sulfur dioxide measurement methods (r=0.1827) but the relation in terms of nitrogen dioxide measurements is confirmed to be r=0.6571 (figure 9). correlation of passive sampler with continous monitor for so 2 ve no 2. box-plots of yearly concentrations of so2 and no2 measured at the sampling points are given in figure 10. each vertical box covers 50% of the measured values between the lower and highest quartiles. the horizontal line inside the box and the cross represent the median and mean values. no2 can be seen in figure 10 to be associated with significantly higher pollution concentrations than so2. the measurement readings were interpreted according to the data obtained from aramba airport meteorology station which is the closest one to the region. the coordinates of aramba airport meteorology station are 4115'23.92 " n and 3633'23.74 " w, and the distance to the closest measurement locations, namely 6 and 8, is approximately 5.5 kilometers. the measurement data obtained by the station on the measurement dates are given on table 4 and the wind rose is given on figure 11. the wind rose show that the dominant directions of surface wind in caramba during period of measurement is s. at a typical meteorological condition of average wind speed 2.8-3.2 m/s. samsun aramba airport meteorology station inputs (october, 2009-september 2010) values of daily average wind rose between of october 2009 with september 2010 in aramba air port meteorology stations. the correlation between no2 and so2 concentrations and meteorological parameters like air temperature, wind speed, and relative humidity was also calculated for the caramba airport meteorology station. the other parameters (wind speed, wind direction, and relative humidity) is a bad correlation of no2 and so2, which plays an important role in the distance from the meteorology station. therefore, the results of correlation of wind speed, wind direction and relative humidity correlation had not been given in here. the uninterrupted measurement station values and passive sampler readings are compared at the measurement station of the ministry of forestry and water works. a correlation of 69.24% according to this correlation, the annual nitrogen dioxide average is calculated as 42.36 g/m. however, as mentioned on the literature, meteorological parameters have significant impact on the correlation and it was not possible to make meteorological measurements at the measurement location during this study. when the digital map regarding the nitrogen dioxide measurements are reviewed, it is observed that the highest level of pollution is at measurement station of station no.3 and expands around from that location. besides, the nitrogen dioxide values of the measurement point number 5 at yesilyurt port administration vary between 26 to 29 g/m. it is observed that the nitrogen dioxide is intensified at locations 1, 2, 5 and 10 on the west side, starting from measurement station number 3 and expanded towards the black sea from location 5 or towards the inner regions of tekkekoy from location 3. 4. when the passive samplers are compared with uninterrupted measurement results at the measurement location number 3, in terms of sulfur dioxide, a correlation could not be established. since the results obtained from both passive samplers and uninterrupted measurements are significantly low, we should consider the possibility of errors arising from factors having an impact on sulfur dioxide measurements and devices used. the reason for this, the sulfur dioxide concentration effected not only passive sampler measurements but also meteorological parameters. it is observed that the sulfur dioxide distribution heads from south to north-west, towards the black sea from measurement station number 5. this work was financed by a scholarship of the ondokuz mays university for support of scientific research (project no. the author thank to assistant professor aziz iman, assistant professor nevzat beyazt, and serkan cengel for preparing of digital mapping., blacksea agricultural research institute, milangaz, ulusoy maritime high school, tekkeky municipality, and yeilyurt company .

backgroundmeasurements of nitrogen and sulfur dioxide using passive sampler over 12 months in samsun, turkey, are compared with so2 and no2 concentrations obtained from a co-located chemiluminescence analyzer. the concentrations of sulfur and nitrogen dioxide in the ambient air during the period from november 2009 to september 2010 are analyzed. resultsthe highest value for annual no2 and so2 averages of passive sampler was 29.65 g/m3 and 21.01 g/m3 for exposures of 2-weeks at an industrial site. the maximum monthly concentration for so2 was observed at the 10th measurement station with 44.19 g/m3 for august. the maximum monthly concentration for no2 was observed on the 3rd measurement station with 42.83 g/m3 for november. a negative correlation between nitrogen dioxide concentrations and temperature (r2=0.5489) was estimated. a positive correlation between nitrogen dioxide measurement with passive sampler and continuous measurement (r2=0.6571) was estimated.

PMC4132246

pubmed-1066

the human gut harbors trillions of bacteria that contribute to host physiological and immunological functions such as nutrient acquisition, maintenance of the gut immune system, and protection against exogenous pathogens (123). one of the recent notable findings is the contribution of gut microbiota to the development and homeostasis of the immune system (13). the effects of microbiota on the host immune system have been determined by studies in germ-free (gf) animals (45). gf mice showed reduced numbers and size of peyer's patches (5), less lamina propria cd4 t cells (6), reduced levels of the class-switched antibodies iga and igg (78), and they lacked a developed gut-associated lymphoid tissue (910). thus, maturation of the gut immune system generally takes place following the colonization of gut microbiota suggesting a mutual relationship between the immune system and the microbiota. the gut microbiota consists of bacterial components and metabolites, both of which are important for the development and maintenance of the host immune system. resident microbiota contains pathogen-associated molecular patterns (pamps) such as lipopolysaccharide (lps), peptidoglycan, flagellin, and bacterial dna and rna that are recognized by pattern recognition receptors (prrs). prrs are expressed on immune cells, including antigen-presenting cells (apcs), and they play crucial roles in the activation of innate immunity. toll-like receptors (tlrs) (11) and nod-like receptors (nlrs) (12) are the main prrs that recognize bacterial components. while the importance of microbial sensing and activation by the innate immune system has been well recognized, recent work has also uncovered an important role of bacterial metabolites in the gut immune response. short-chain fatty acids (scfas) are the end products of fermentation of dietary fibers by the anaerobic gut microbiota and have been shown to exert multiple beneficial effects on host immune homeostasis (13). for example, butyrate-induced signaling inhibits histone deacetylases (14), increases the size, and enhances the function of the colonic regulatory t cell pool (15). collectively, microbiota-derived molecules, including both bacterial components and metabolites, influence the host immune function. based on the role of gut microbiota in development of the immune system although there is little evidence in this regard so far, several reports have indicated that the microbiota could influence vaccine efficacy and adjuvant activity. vaccines display a protective effect against a broad range of diseases including infection, cancer, and allergy. multiple reports have shown that people in developing countries exhibit reduced responses to oral vaccines. the efficacy of rotavirus (16), poliovirus (1718), and cholera (1920) vaccines in developing countries with poor sanitation is lower than that in industrialized nations. nicaraguan children were shown to have blunted antibody responses to oral cholera vaccine as compared to swedish children (21). similarly, children in poorer regions of north india displayed reduced mucosal immune responses compared to children in other parts of the country (22). furthermore, growing evidence suggests that the gut microbiota, which is known to be different in children from developed and developing countries (23), plays an important role in determining vaccine efficacy. for example, an abundance of stool actinobacteria including bifidobacterium was shown to be positively correlated with higher responses to oral and parenteral vaccines and a larger thymus in bangladeshi infants. conversely, a high abundance of clostridiales, enterobacteriales, and pseudomonadales was associated with neutrophilia and lower vaccine responses (24). furthermore, small intestinal bacterial overgrowth (sibo), which is defined as excessive bacteria in the small intestine and is common in children in developing countries but rare in industrialized settings, contributed to lower antibodies to cholera toxin after immunization (25). since sibo presents malabsorption and systemic symptoms, competition between the host and microbiota for nutrients and defects in the intestinal barrier may cause reduced vaccine responses. indeed, whole blood cells derived from south african infants aged 2 years were shown to be severely hyporesponsive to tlr ligands including lps and secreted lower levels of cytokines and chemokines in response to stimulation of tlrs than the age-matched children from north america, south america, and europe (2627). in summary, factors that affect gut microbial communities, such as malnutrition, poor sanitation, increased antigen exposure, antibiotic treatment, nutritional status, and lack of breast milk antibodies, could influence vaccine efficacy. mice treated with clarithromycin or doxycycline showed reduced antibody induction against the hepatitis b virus surface antigen (hbsag) vaccine. in contrast, mice treated with the same antibiotics exhibited increased antibody responses to live attenuated salmonella enterica serovar typhi (ty21a) vaccine (28). macaques, showing a high level of diversity in the intestinal microbial composition, had improved protection upon challenge with virulent shigella dysenteriae after immunization with live attenuated s. dysenteriae vaccine. in addition, oscillospira and streptococcus were found to be positively and negatively correlated, respectively, with vaccine-specific igg and iga induction and pro tective responses (29). these findings suggest that intes tinal microbial diversity and particular microbiome compositions can influence antibody responses. it has also been suggested that prebiotics (compounds that increase the number of certain commensals) could enhance the efficacy of oral vaccines. prebiotic fructo-oligosaccharide (fos) has been shown to improve the efficacy of a vaccine against salmonella infection. treatment with fos prior to vaccination resulted in improved host responses and enhanced protection against infection (30). another study showed that a prebiotic mixture containing galacto- and fructo-oligosaccharides (gos and fos) enhanced systemic immune responses to influenza vaccine. in addition, the prebiotic mixture increased proportions of certain members of the microbiota, suggesting a role for the specific microbial community in the increased host immune responses (31). since bacteria-derived components have potent immunostimulatory capacity, they constitute a major potential source of adjuvants. for example, lipopolysaccharide (lps), peptidoglycan (pgn), cpg dna, and trehalose dimycolate (tdm) are known to enhance the immune response against co-administered antigens (32). this adjuvant activity is mediated through the activation of tlrs, nlrs, and clrs (c-type lectin receptors) that mediate signals responsible for activation of the host innate immune system (111233). a systems biology approach to study the innate and adaptive response induced by vaccination of humans with non-adjuvanted influenza subunit vaccine (trivalent inactivated vaccine, tiv) revealed that tlr5 levels within three days of receiving the vaccine were positively correlated to the strength of the antibody response against the virus (34). tlr5 is a cell-surface receptor specific for flagellin, the monomeric component of bacterial flagellum used for cell motility, and has not been associated with viral recognition. oh et al. found that knockout mice lacking the tlr5 protein produced significantly lower levels of antibodies after receiving tiv than wild-type mice (35). because tiv does not interact directly with tlr5, the authors turned their focus to the microbiome in order to clarify the role of tlr5 signaling in vaccine efficacy. indeed, gf mice and antibiotic-treated mice showed impaired responses to tiv. furthermore, colonization of gf mice with flagellin-expressing, but not flagellin-lacking, bacteria was sufficient to enhance the vaccine efficacy. results of this study indicate that flagellin from the gut microbiota acts as a natural adjuvant to enhance protective immune responses to the tiv vaccine. cholera toxin (ct), derived from vibrio cholerae, is widely used as a mucosal adjuvant in animal immunology. ct is composed of pentameric b subunits that bind to the cell surface gm1 ganglioside receptor, and a monomeric a catalytic subunit that activates the heterotrimeric guanine nucleotide binding protein gs, which in turn stimulates camp production by adenylate cyclase. this mechanism is thought to be responsible for the adjuvant effect of ct (3637). although the toxicity of ct prevents its clinical application, elucidation of the mechanisms of its potent adjuvant activity may lead to the development of nontoxic and effective mucosal adjuvants for vaccination. we have shown that the mucosal adjuvant activity of ct relies on nod2 signaling induced by endogenous microbiota (38). nasal or oral immunization of gf and antibiotic-treated mice with human serum albumin (hsa)+ct exhibited reduced levels of antigen-specific igg1, recall-stimulated cytokine responses, and reduced follicular helper t (tfh) and plasma cells. furthermore, the effect of the endogenous microbiota on the adjuvant activity of ct was impaired in ripk2 (the adaptor molecule required for nod1 and nod2 signaling)-deficient or nod2 (recognizes peptidoglycan molecules, muramyl dipeptide (mdp))-deficient mice, but not in myd88 (the adaptor molecule required for tlr signaling)-ko or nod1 (recognizes peptidoglycan molecules, diaminopimelic acid (dap))-ko mice. gf mice immunized with a combination of hsa+ct and mdp produced high levels of antigen-specific igg1, suggesting that nod2 signaling promotes the adjuvanticity of ct. furthermore, several members of the mdp-rich endogenous microbiota such as staphylococcus sciuri promoted the adjuvant activity of ct in gf mice in a nod2-dependent manner. this study indicates that the adjuvanticity of ct relies on nod2 signaling triggered by the mdp-rich endogenous microbiota. thus, it can be suggested that environmental factors that affect the composition of the microbiota and stimulatory activity that bacterial components exert on host prrs may be important to determine the capacity of mucosal vaccines to provide protective immunity. it is well known that the efficacy of oral vaccines depends on several factors such as genetic background, prior exposure to antigen via natural infection or vaccination, and nutritional status. current findings suggest that the low responses to oral vaccines could be due to differences in the microbiota composition as a result of genetic, environmental, and nutritional variation. indeed, growing evidence indicates that the microbiota influences vaccine and mucosal adjuvant efficacy (fig. 1). however, investigations of the relationship between the microbiota and the efficacy of vaccines are at an initial stage, and data accumulated so far are limited. therefore, further understanding of the impact of the microbiota on vaccine effectiveness is necessary. detailed analysis of the role of particular species within communities in vaccine responses will provide novel insights into the development of strategies for improved vaccine efficacy.

a symbiotic relationship between humans and the microbiota is critical for the maintenance of our health, including development of the immune system, enhancement of the epithelial barrier, and acquisition of nutrients. recent research has shown that the microbiota impacts immune cell development and differentiation. these findings suggest that the microbiota may also influence adjuvant and vaccine efficacy. indeed, several factors such as malnutrition and poor sanitation, which affect gut microbiota composition, impair the efficacy of vaccines. although there is little evidence that microbiota alters vaccine efficacy, further understanding of human immune system-microbiota interactions may lead to the effective development of adjuvants and vaccines for the treatment of diseases.

PMC5334119

pubmed-1067

a 39-year-old woman, (gravida 7, para 1, [weight 67 kg, height 152 cm ]) at 38 weeks of gestation, was admitted for an elective cesarean section. she had a history of self-limited palpitation, about 3-5 times per day. this palpitation began approximately 10 years ago and usually stopped within a few seconds, without other significant symptoms. during pregnancy, she had experienced new symptoms: episodes of sudden nausea, general weakness, and dizziness after prolonged standing. these symptoms were easily relieved by sitting or squatting. the preoperative blood test, urinalysis, chest x-ray, electrocardiogram (ecg), and echocardiogram were all normal. however, her 24 hour holter monitoring revealed one episode of non-sustained ventricular tachycardia (nsvt). five to six hours before the surgery, she felt the same self-limited palpitation, but no other symptoms were observed. we started our routine monitoring with ecg, noninvasive arterial pressure, and oxygen saturation. supplemental oxygen was administrated by a facial mask with a reservoir bag at the rate of 6 l/min. her vital signs were a heart rate (hr) of 92-95 bpm with normal sinus rhythm, 103-104/63-64 mmhg of blood pressure (bp), and 100% of oxygen saturation (spo2). because she had a history of nsvt, a 20-gauge catheter was inserted, at her left radial artery, for continuous arterial pressure monitoring. after positioning the patient to the right lateral decubitus, 8 mg of 0.5% hyperbaric bupivacaine, mixed with 20 g of fentanyl, was injected with a 25-gauge spinal needle at l4-5 interspace. her vital signs were 92 bpm of hr, 102/63 mmhg of bp and 100% of spo2, immediately after spinal anesthesia. then, the patient was put in a supine position with a left lateral tilt, and was given 50 g of prophylactic phenylephrine intravenously for the prevention of hypotension after the spinal anesthesia. the initial block level, 2 minutes after the introduction of spinal anesthesia, was at t10 checked with cold sense using an alcohol swab. as the block height went higher, the patient showed hypotension of 88/40 mmhg with 95 bpm of hr, and complained of nausea. thus far, 700 ml of ringer's lactated solution had been administrated intravenously. relative hypovolemia, caused by alpha-blocking effect of spinal anesthesia, was the suspected cause of hypotension. therefore, we immediately injected phenylephrine twice (50 g each), and continued hydration with hydroxyethyl starch (voluven, fresenius kabi, germany). her vital signs were stabilized with 96 bpm of hr and 140/74 mmhg of bp, without showing arrhythmia or reflex bradycardia, after phenylephrine administration, as well as her nausea stopped. sensory level to alcohol swab to the t3 was noticed, 10 minutes after the spinal anesthesia. within 10 minutes of the skin incision, a 3.9 kg female was delivered with apgar scores of 9 at both 1 and 5 minutes. her vital signs were 98 bpm of hr with normal sinus rhythm, 128/68 mmhg of bp, and 100% of spo2. one gram of cefazolin (cefamezin, dong-a pharm, korea), mixed with 10 ml of normal saline, was administrated intravenously after a confirmation of a negative antibiotic skin test result. then she suddenly deteriorated with cardiovascular collapse, respiratory arrest, and loss of consciousness. the qrs complex disappeared with only p-waves being observed; eventually asystole occurred. cardio-pulmonary resuscitation (cpr) was started immediately with external cardiac compression, manual ventilation with 100% oxygen with ventilator mask, rapid hydration, and trendelenburg position. after the injection of 1 mg of epinephrine, along with 1 minute of cpr, the ecg showed narrow qrs complexes with irregular r-r interval. however, her systolic pressure remained at 30-40 mmhg, without external cardiac compression. approximately 3 minutes after cpr, the hr recovered up to 80-90 bpm with regular narrow qrs complex and an effective arterial pressure (80-90/70-80 mmhg). the patient gradually recovered her consciousness, spontaneous breathing, and orientation within a few minutes, and was placed horizontally with caution. ephedrine 10 mg was administrated twice, when the systolic pressure was lower than 80 mmhg, followed by continuous infusion of dopamine at the rate of 5 g/kg/min. the total operation time was 80 minutes, in addition, 700 ml of hartmann solution and 500 ml of hydroxyethyl starch (voluven, fresenius kabi, germany) were infused. after the operation, she was transferred to the surgical intensive care unit (sicu) for an intensive cardiovascular monitoring. the postoperative arterial blood gas analysis, complete blood count, electrolyte, and coagulation tests were normal and only serum troponin i was mildly elevated (0.298 ng/ml). also, the ecg and chest image showed no abnormality. after 27 hours of close observation in the sicu, she was transferred to the general ward. in this case, the possible cause of cardiac arrest includes: vasovagal response; ventricular arrhythmia; amniotic fluid embolism (afe); and anaphylaxis after the administration of cefazolin. we believe that the vasovagal response should be the most probable cause of her cardiac arrest. firstly, although the history of nsvt, of course, was one issue for abnormal cardiac activity, it was not the direct cause of cardiac arrest. in addition, the progressively slowing hr, immediately before the cardiac arrest, suggests their supraventricular origin. secondly, unique characteristics of afe, such as disseminated intravascular coagulation, pulmonary edema, and heart failure, were not observed. her postoperative coagulation test, chest radiography, and echocardiography were all within normal limits. also, the patient had a good response to cpr and recovered without complication, while cardiac arrest originated from afe usually has a poor response to cpr, and thus, exhibits a high mortality rate. anaphylaxis is a severe systemic allergic reaction, and is typically presented with multi-organ system involvement. nausea is a common gastrointestinal symptom of anaphylaxis, and acute anaphylactic shock can trigger bezold-jarisch reflex. however, her preoperative allergy skin test (ast) result was negative for cefazolin, and there was no other evidence of anaphylaxis; itchiness, flushing, or swelling of the skin and mucosa, as well as wheezing or stridor in the respiratory system. on the other hand, many factors in this case support vasovagal response, as the cause of sudden cardiac arrest (fig. 1). the patient was a full term woman, and had several vasovagal episodes before the surgery; she was more susceptible for vasovagal response. term pregnant women experience aortocaval compression in the supine position, followed by a decrease in the right atrial filling pressure. in about 8% of the pregnant women, cardiovascular system can not compensate for severe abrupt drops in venous return, and hence, the supine hypotensive syndrome develops. furthermore, term pregnant women present significant decrease in systemic vascular resistance (-25%) by the development of a low resistance vascular bed in the placenta and vasodilation caused by prostacyclin, estrogens, and progesterone. not only an increase in the plasma volume (+ 50%), but also a compensatory sympathetic activation with increased hr (+ 25%), stroke volume (+ 25%), and cardiac output (+ 50%) maintain hemodynamic stability. however, this compensatory sympathetic activity is blocked during neuraxial anesthesia. in cesarean section, due to a lower maternal mortality and complication rate a mid- or high-thoracic level block (t4) is necessary to comfort the patient. therefore, the incidence of hypotension (63%) and severe bradycardia (6.7%) are much higher. introduction of the left lateral tilting position, and a massive pre-hydration before neuraxial anesthesia (10-20 ml/kg of crystalloid solution or 250-500 ml of colloid solution) have reduced the incidence of hypotension and cardiac arrest during a cesarean section. the patient's block level was t3; in this block level, the sympathetic vasomotor tone, arising from t5 to l1, is completely blocked, while the sympathetic cardiac accelerator fibers that are arising from t1-t4 are only partially blocked. when the patient showed nausea and mild hypotension after a spinal anesthesia, judging from the hr, we administrated crystalloid and phenylephrine. it was effective, and she showed stable vital signs, until the beginning of placental expulsion. however, similar to that of the previous reports, this case showed an abrupt onset of severe sinus bradycardia, and cardiac arrest in a patient who was hemodynamically stable, well oxygenated, and comfortable. we suggest an inversion and traction of the uterus, during the placental expulsion, as the triggers of catastrophic vasovagal response. a transient uterine inversion occurred during the placental expulsion, and immediately after that, cardiac arrest occurred. there are some case reports of hemodynamic instability, during the placental expulsion, due to an inversion or traction of the uterus. during a uterine manipulation, stretching of the peritoneal and broad ligaments around the uterus can result in a secondary stretching of infundibulopelvic ligaments; which then can cause vasovagal reflex via the afferent nerve stimulation. in these cases, patient's hemodynamic status improved dramatically, immediately after the reposition of the uterus, which suggests a vasovagal response. our patient's cardiovascular system could not compensate for this vasovagal response, potentiated by a high neuraxial anesthesia with impaired reflex tachycardia and vasoconstriction in blocked segment; eventually leading to a cardiac arrest. acute hemorrhage, during placental expulsion, may have played a role in vasovagal response, which decreased the venous return. however, it does not seem to be the main cause of vasovagal cardiac arrest. the total estimated blood loss of this case was about 500 ml; which is less than the average blood loss during a cesarean section. anxiety and fear make the management of a patient difficult, and can cause vasovagal response. on the other hand, due to the risk of maternal desaturation, neonatal sedation and respiratory problem, our hospital provides intraoperative sedation, after the confirmation of an uneventful childbirth and placental expulsion. alert patients can give us important information by complaining their symptoms that can not be obtained by monitoring vital signs. also, alert patients can experience and remember the moment of childbirth and the first contact between mother and baby. in this case, the patient did not let out her feelings through the operation; she did not seem to be anxious, nervous or restless. however, cesarean section in an unfamiliar environment would have put an extremely heavy burden on the patient, and childbirth may cause huge emotional change. after childbirth, she smiled at her baby being examined by the nurses, and consequently, began to tear. anxiety and emotional change may have played an important role in triggering or exaggerating a vasovagal response. aggressive treatments, during cpr, including intravenous administration of epinephrine, rapid hydration and trendelenburg position, were effective in this case, and no postoperative complications were observed. similar rapid recovery and relatively satisfactory outcomes were reported in the previous cases of vasovagal cardiac arrest. their treatment included early recognition, chest compression, manual ventilation with 100% oxygen, rapid hydration, and administration of atropine, ephedrine, phenylephrine and epinephrine. firstly, a careful history taking regarding fainting or syncope, and proper preoperative evaluations, such as head-up tilt test would have reduced the risk of unprepared vasovagal reaction. secondly, a careful and slow induction of epidural anesthesia would have reduced the risk of high neuraxial anesthesia. thirdly, maintenance of adequate preload with sufficient hydration, before neuraxial anesthesia, and placental expulsion would have prevented sudden decrease in the venous return. fourthly, intravenous administration of ephedrine, rather than phenylephrine, after neuraxial anesthesia induced hypotension would have prevented severe reflex bradycardia, by stimulating both alpha- and beta-adrenergic receptor systems. finally, appropriate intraoperative sedation would have reduced the anxiety of the patient, and possibility of a vasovagal response. vasovagal response is just a reflex, making it difficult to predict; hence, hard to prevent. the hemodynamic collapse during a severe vasovagal response takes place in an instant; in the present case, asystole occurred in less than 5-10 seconds. without constant and careful attention, and appropriate preparation, early recognition and treatment are unlikely to be achieved. fortunately, we continuously monitored the patient's invasive arterial pressure in preparation for ventricular arrhythmias, so that immediate assessment and treatment were possible. however, monitoring of an invasive arterial pressure is not indicated for routine cesarean section, and pain and/or anxiety, during arterial cannulation, can trigger the vasovagal response. thus, the risks and benefits of invasive pressure monitoring should be considered, carefully, before making any clinical decision, based on the individual patient's condition and characteristics of previous vasovagal episodes. in conclusion, we described a patient with severe vasovagal cardiac arrest, during the spinal anesthesia for cesarean section. in korea, this is the first case report of vasovagal cardiac arrest, during a spinal anesthesia for cesarean section. this case illustrates a serious potential risk of vasovagal response superimposed on neuraxial anesthesia, during a cesarean section. vasovagal response should be suspected, among the many potential causes of cardiac arrest during a cesarean section, especially when cardiac arrest occurs during placental expulsion. careful history taking and preoperative evaluation, appropriate preload management, early recognition of vasovagal response by vigilant monitoring, and prompt treatment of hemodynamic collapse, were important lessons we have learned in this case.

the vasovagal response is characterized by an inappropriate combination of bradycardia and paradoxical vasodilation. during a general or neuraxial anesthesia-induced sympathectomy, a sudden vagal activation and/or an acute reduction in sympathetic tone can cause serious vasovagal responses. neuraxial anesthesia for cesarean section may trigger vasovagal response, due to multiple risk factors; high neuraxial block, sudden hemorrhage, aortocarval compression, peritoneal manipulation, and emotional stress. a 39-year-old pregnant woman, at 38 weeks of gestation with episodes of non-sustained ventricular arrhythmia and newly developed vasovagal syncope during pregnancy, was scheduled to undergo a spinal anesthesia for an elective cesarean section. immediately after the placental expulsion, a sudden severe bradycardia, followed by a cardiac arrest occurred. the patient fully recovered after prompt cardiopulmonary resuscitation with chest compression, manual ventilation with oxygen, rapid injection of epinephrine and hydration. this case illustrates a serious potential risk of vasovagal response superimposed on neuraxial anesthesia, during a cesarean section, especially during placental expulsion.

PMC3558656

pubmed-1068

in 1908, george coats described an ocular entity characterized by unilateral retinal vascular abnormalities and retinal exudation usually in boys. coats disease is associated with excessive production of yellowish intraretinal and subretinal exudates and can cause retinal detachment and severe visual loss. proposed the most recent classification with the following stages: stage 1, telangiectasia only; stage 2, telangiectasia and exudation (2a, extrafoveal exudation; 2b, foveal exudation); stage 3, exudative retinal detachment (3a, subtotal; 3b, total); stage 4, total detachment and secondary glaucoma; and stage 5, advanced end-stage disease. multiple modalities have been employed to treat coats disease, including diathermy, laser photocoagulation, cryotherapy, subretinal fluid drainage, scleral buckling surgery, pars plana vitrectomy, and intravitreal anti-vascular endothelial growth factor (vegf) therapy [68]. first reported selective photocoagulation and young coats patients responded quickly to laser treatment. in advanced cases with serous retinal detachment, laser photocoagulation may not be able to reach the vessels, leading to persistence of subretinal fluid and necessitating multiple courses of treatment. eyes with advanced coats disease and total retinal detachment may require pars plana vitrectomy with internal or external drainage of subretinal fluid, laser photocoagulation, and silicone oil tamponade. the purpose of this retrospective study was to assess the effectiveness of endolaser photocoagulation by a two-port pars plana nonvitrectomy approach for treating coats disease with moderate-to-severe serous retinal detachment. medical records of 24 patients (25 eyes) with stage 3 coats disease diagnosed from december 2012 to may 2014 at a single center were reviewed. all of them presented with serous or total retinal detachment that could not be reached by regular laser photocoagulation and thus undertook minimally invasive operations of endolaser photocoagulation. some cases were treated combined with drainage of the subretinal fluid, intravitreal triamcinolone injection or anti-vegf injection. clinical information, including birth history, age, gender, family history, medical history, and systemic and other ocular anomalies, was assessed. all patients routinely underwent indirect ophthalmoscopy. wide-angle retina photography (retcam; clarity medical systems, pleasanton, ca, usa) was performed in patients younger than 5 years and fundus photography (optos 200tx; optos, dunfermline, scotland, uk) was performed in older cooperative patients. two 23- or 25-gauge incisions were made 3 mm posterior to the corneal limbus and the retina was examined. the surgical procedure commenced with the examine of the retinal vessels, followed by laser directly on the entire network of telangiectatic vessels and the injection of viscoelastics afterwards to minimize vitreous traction at the side ports (figs. 1 and 2). telangiectasias were ablated with a 532-nm green endolaser; the power was adjusted according to the retinal reaction to laser spots. 1illustration of the surgical procedure of a 4-year-old boy with stage 3a coats disease (os). 2drainage of subretinal fluid of a 2-year-old boy with stage 3b coats disease (os) illustration of the surgical procedure of a 4-year-old boy with stage 3a coats disease (os). bottom right anti-vascular endothelial growth factor (vegf) injection drainage of subretinal fluid of a 2-year-old boy with stage 3b coats disease (os) additional treatments such as intravitreal triamcinolone or anti-vegf injection and further surgery were performed based on findings of fundus fluorescein angiography, conditions during endolaser photocoagulation, and postoperative outcomes. therapeutic effects were determined according to the patients visual acuity, intraocular pressure, fundus and abnormal vascular changes. all the patients were born at full term or late preterm, with a birth weight above 2,500 g. none had a related family history. the study population comprised 23 boys (95.83 %) and one girl (4.17 %); patient age ranged from 2 to 17 years (mean, 6.21 years). patients were divided into three groups according to the severity of the disease and previous treatment regimens and the data are presented in table 1. table 1patient informationgrouppatienteyegenderage at presentation (years)follow-up duration (months)a1osm3182odm2163odm8144odm17145oum3156osm1177osm568odm549odm31b1osm13182osm9173odm5164osm9165odm2146osm3127odm648osm549odm9310odm6311odm92c1osm4202oum3153osm2114odm445osf63 group a (nine eyes) received laser photocoagulation and/or cryopexy before, however, the treatment above could not stop the vascular abnormalities, thus these patients received the endolaser. group b (11 eyes) was initiated with endolaser treatment regimen due to the presence of serous retinal detachment. patients in group c (five eyes) were in stage 3b, received external drainage of subretinal fluid plus non-vitrectomized vitrectomy. additionally, triamcinolone and anti-vegf were injected according to the condition of abnormal vessels. visual acuity, intraocular pressure, eye position, slit-lamp microscope, indirect ophthalmoscope, and color fundus imaging were followed up (average, 10.08 months, range, 120 months). at the end of the follow-up period, 24 (96 %) eyes had the retina reattached, telangiectasias were resolved, and no severe complications occurred. in groups regular laser therapy under indirect ophthalmoscopy was barely effective on the abnormal vessels with exudative retinal detachment and serous retinal detachment and endolaser could shorten the period of recovery. the average sessions to full treatment of active telangiectasia and retinal reattachment was 4 months (range, 110 months); only one (4.17 %) eye progressed to retinal detachment due to lack of follow-up. each eye received 15 sessions of treatments (average, 1.96 times) (table 2). increased intraocular pressure in one (4.17 %) eye after surgery was controlled with eye drops. table 2patient treatmentsgrouppatientrange of exudation (quadrant)treatments (sessions)a122242332434544621743821923b14122133144154164274184192210411141c142245343442542 seven and 17 eyes required subsequent intravitreal triamcinolone and anti-vegf injections, respectively. these injections were not associated with endophthalmitis or systemically observed complications. among the 17 patients who would cooperate with visual examination, five (29.41 %) had improved visual acuity at the end of the treatment session. because of recurrence of miliary aneurysms, two (22.22 %) eyes in group a and two (18.18 %) eyes in group b had consecutive regular laser ablation at 1 to 6 months (average, 2.25 months) afterward the endolaser treatment. most exudation was absorbed with a flat retina until the last follow-up (fig. the five patients in group c who presented with total retinal detachment, undertook drainage of the subretinal fluid combined with anti-vegf injection, received two-port endolaser ablation and regular laser or other treatments afterwards (fig. 4). among them, one eye developed fibrosis in the peripheral retina 4 months after endolaser treatment, so three-port pars plana vitrectomy was performed and the retina finally reattached after three sessions without obvious telangiectasia and the exudation absorption. 3fundus views of a 2-year-old boy with stage 3a coats disease (od). 4fundus views of a 3-year-old boy with stage 3b coats disease (od). bottom right view at 2 months after supplementary laser fundus views of a 2-year-old boy with stage 3a coats disease (od). right postoperative view at 13 months fundus views of a 3-year-old boy with stage 3b coats disease (od). the overall aims of treatment in mild disease are ablation of abnormal retinal vasculature, preservation of vision, and prevention of retinal detachment. in advanced cases,, we performed the two-port endolaser with the help with noncontact wide-angle viewing system and fluorescein fundus angiography to guarantee the treatment. schefler et al. showed that 50% of the patients with coats disease can retain useful vision with aggressive repetitive diode laser therapy even if the disease is advanced at presentation. the difference in outcomes can be explained by the disease severity: the present study included patients with stage 3 coats disease with local or total exudative retinal detachment. according to our experience, this stage is considered less responsive to laser therapy under indirect ophthalmoscopy and the prognosis is worse than those of stages 1 and 2. further, exudation in the macular area took longer to absorb than peripheral retinal exudation and vision of eyes with macular exudation was not satisfactory in the study. in this study kranias and krebs reported successful management of advanced coats disease with pars plana vitrectomy and air fluid exchange. susskind et al. used ppv, including a modified technique of exocryotherapy applied after fluid air exchange to reduce associated side effects and improve the rehabilitation process of advanced coats disease patients. in the present study, stage 3b coats disease was treated by subretinal fluid drainage, endolaser photocoagulation, and anti-vegf injection. cryotherapy and silicone oil tamponade was not performed to avoid the damage to the eyeball and the need for secondary surgeries. in two cases, endolaser photocoagulation the other patients underwent the procedure 1 week after drainage. to our knowledge, this is the first time the two-port pars plana nonvitrectomy approach for treating coats disease has been reported in the literature. first, it resolves the problem associated with laser ablation in eyes with serous retinal detachment where telangiectasias can not be reached by regular laser ablation. we applied a laser directly to telangiectasia within the retina without targeting the rpe to create thermal injury. second, it is non-vitrectomized and is much less invasive than three-port pars plana vitrectomy. third, when combined with peripheral retinal examination, the procedure could be more thorough and efficient, so the number of treatment sessions could be reduced. to minimize vitreous traction at the side ports, injection of viscoelastics was performed afterwards and turned out to be an effective measure. reported that carefully selected treatment can anatomically stabilize eyes or improve coats disease in 76% of the cases. the present treatment yielded better results: 96% of the eyes showed retinal reattachment and no active telangiectasias. bevacizumab and ranibizumab should be used cautiously in patients with coats disease to avoid vitreoretinal fibrosis and tractional retinal detachment. a taiwanese study showed that cryotherapy combined with intravitreal bevacizumab injection in severe cases of exudative retinal detachment carries the risk of vitreoretinal fibrosis and tractional retinal detachment. in the present study, only one eye developed vitreoretinal fibrosis 4 months after anti-vegf injection, which was in group c and the fibrosis might be connected with the serious disease or the treatments received. extended serial follow-up is important to evaluate the safety of this treatment and usage of anti-vegf injection. endolaser photocoagulation by two-port pars plana nonvitrectomy is a safe and effective approach in treating advanced coats disease with serous retinal detachment this research was supported by the national natural science foundation project of china (81070760, 81271045). all authors certify that they have no financial interests (such as personal or professional relationships, affiliations, knowledge or beliefs) in the subject matter or materials discussed in this manuscript.

backgroundto evaluate the effectiveness of endolaser photocoagulation by a two-port pars plana nonvitrectomy approach for treating coats disease with shallow exudative retinal detachment. methodsthis study included 24 patients (23 boys with an age range of 217 years, and one girl, age 6 years) with stage 3 coats disease (25 eyes) from december 2012 and may 2014 at a single center. all of the 25 eyes were complicated with serous or total retinal detachment and received none-vitrectomized endolaser: two (23- or 25-gauge) incisions were routinely made 3 mm posterior to the corneal limbus and a laser was applied directly on the abnormal blood vessels. additional treatments included subretinal fluid drainage (five eyes), intravitreal triamcinolone injection (seven eyes), and intravitreal anti-vascular endothelial growth factor (vegf) injection (17 eyes). best-corrected visual acuity, intraocular pressure, and fundus and abnormal vascular changes were recorded to determine therapeutic effects. resultstwenty-four out of the 25 treated eyes (96 %) had retina reattached. the number of treatment sessions differed case by case (15 sessions, average 1.96) and the time to full treatment of retinal reattachment was 4 months in average. one patient (4 %) presented with retinal redetachment. five (20 %) eyes received further laser treatment with indirect ophthalmoscope and four eyes (16 %) presented with total retinal detachment at their first visits received consecutive treatments. at the end of the follow-up period (mean, 10.08 months), telangiectasias of 24 (96 %) eyes were resolved and no severe complications occurred. conclusionsendolaser photocoagulation by a two-port pars plana nonvitrectomy approach is an effective treatment for advanced coats disease with serous retinal detachment. the long-term safety of the approach needs further investigation.

PMC4483254

pubmed-1069

lasers have been used in laryngeal surgeries since 1972, when strong and jako first reported the use of carbon dioxide laser (co2) in the human larynx.1 despite initial criticism, endoscopic laser treatments have achieved universal acceptance and been successfully used in endolaryngeal microsurgery (ems).2 most of the laser procedures involve either excision or tissue vaporization, depending on the interaction between the wavelength () and the chromophores of the tissue. for years, the co2 (= 10600 nm) seemed to be the preferred laser for transoral laser microsurgery due to its precise cut,3 given that it is better absorbed by water. however, there are some disadvantages of the co2 device, namely, its straight line beam delivery from surgical microscope, narrow penetration depth to tissue, difficult transportation, and increased cost. these drawbacks favored the study and application of other wavelengths in larynx, such as thulium yag (= 2000 nm), nd: yag (neodimium: yttrium-aluminum-garnet-=1064 nm), diode (= 805-980 nm), pdl (pulsed dye laser-=585 nm) and ktp (potassium titanyl phosphate-=532 nm).3 4 the diode laser has excellent hemostatic properties as a result of high absorption by hemoglobin and particularly by oxyhemoglobin. it is also absorbed by water, but less so than the co2 laser.5 furthermore it is portable, small, relatively inexpensive, and simple to use. it also has stable power output, long lifetime, and low installation and maintenance costs.2 6 moreover, the diode laser is delivered down by a fine glass fiber that allows the surgeon to hold it in a pencil-like holder for accurate manipulation.2 the fiber guidance system tip can be angled, which allows access to areas that are difficult to handle with the co2 laser.7 as a result, the use of diode laser in ems has increased in recent years.8 nonetheless, the ideal parameters of diode laser in ems and long-term results remain unclear. therefore, we conducted a systematic review to clarify the use of diode laser in laryngeal diseases and outcomes shown so far. a systematic search was performed in pubmed, cochrane library, ovid, web of science, and scielo databases. airway or laryngeal surgery or vocal fold and diode laser. we considered all studies relating to human laryngeal pathologies (from superior edge of epiglottis to inferior edge of cricoid cartilage). we only included studies that provided information on patient and lesion characteristics, treatment (diode laser's parameters used in surgery at least two items described among wavelength, fiber diameter, output power, frequency, wave radiation, and contact mode), and outcomes related to the laser surgery performed. outcomes could be cure of the initial pathology, need of complementary operation, recurrence of the lesion, or even complications or adverse/side effects. studies were excluded if they consisted of less than two subjects or case report. finally, studies that described the use of diode laser with non-surgical intent were excluded. we collated data from included studies using an excel (microsoft, redmond, washington) spreadsheet. specifically, data on sample demographics and clinical characteristics, sample size, diode laser parameters used, duration of follow-up, main outcome findings, and complications were extracted from each study. article authors were contacted directly to obtain further information in cases of incomplete reported data. we identified no randomized clinical trial and only two experimental controlled studies (not randomized) were included. our search strategy yielded a total of 284 articles (including duplicates). by screening the titles alone, 234 articles could be excluded, as they were either review articles, obviously not relating to the use of diode laser in larynx, or clearly not eligible for inclusion (for example, studies looking at diode laser in animals). after reading the abstracts, one was removed due to its focus on endobronchial diseases. then, the 13 eligible articles were full-text assessed, but two more were excluded due to failure to meet eligibility criteria (one that did not describe the laser parameters used at one single surgery and another that included patients with lesions outside the larynx). we manually searched reference lists for further relevant articles, but none was eligible (fig. the 11 studies selected for inclusion were published between 2003 and 2014 and originated from 5 different countries. two studies were experimental controlled but not randomized8 9 and another one was a prospective experimental uncontrolled study.7 the other studies comprised of 8 retrospective reviews.2 3 5 6 10 11 12 13 we found no randomized controlled trial or multicenter trials. a total of 357 subjects made up the study population from the 11 included studies. the laryngeal pathologies included were suprastomal granuloma, laryngomalacia, ventricular dysphonia, vocal polyp, glottic web, papillomas, glottic carcinoma, bilateral cord palsy, subglottic cysts, subglottic stenosis, and subglottic hemangioma/lynfangioma. abbreviations: m, months; y, years f=female m=male. intervention included diode laser surgery performed in various combinations of parameters between wavelength, fiber diameter, output power, frequency, wave radiation and contact mode, as illustrated in table 2. the minor fiber diameter described was 300 m and the isolated major one was 1400 m. the output power varied from 3 w to 60 w. all authors with available data opted for the direct contact of the fiber to the tissue as well as the continuous mode of energy. length of follow-up was variable among the studies, ranging from two to 86 months. five of 11 authors (46%) declared to have experienced no complications or side effects by the use of the diode laser. granulation and posterior synechia were described related to treatment of vocal fold paralysis.10 tracheal posterolateral bridge synechia and laser-induced subglottic granuloma related to treatment of subglottic hemangioma/lynfangioma.5 regarding glottic cancer surgeries, no authors reported edema requiring tracheostomy. intraoperatively, thyroid cartilage exposure was described and laser-induced fire occurred due to thermal injury of the laser on the intubation tube. two patients developed cutaneous emphysema that resolved in one day without intervention.12 in the postoperative period, synechia and granuloma formation was reported.7 some rare side effects were infection, foul smelling halitosis (in whom relatively more extended laser surgery was performed), laryngeal stenosis,12 hemorrhage, and fistula formation.7 however, it has some limitations, such as increased cost and difficulty in the management of deep and curved areas. in addition, it has short penetration in tissues (0.10.3 mm on average), which reduces effective sealing of vessels (it coagulates vessels of calibers smaller than 0.5 mm), thus, increasing bleeding during surgery.3 4 the diode laser emits wavelengths that are absorbed predominantly by hemoglobin and melanin (near infrared spectrum). the penetration depth depends on the concentration of these chromophores and, generally, it reaches 0.31.0 mm in diode laser application, which makes it ideal for photocoagulation.4 6 14 in conformity to that, some authors advocate that the diode laser 35w allows thermal coagulation that had been unimaginable with the co2 laser.10 all of these characteristics, according to some authors, confer on diode laser a surgical precision only slightly inferior to the co2 laser one, but with a superior coagulation capability for treating laryngeal vascular lesions.5 compared with other devices, diode laser also appears to be more precise and less invasive. for instance, the cutting precision of the ndyag (1064 nm) is considerably lower, and the instrument also led to greater immediate and deferred inflammatory damage due to thermal diffusion (high penetration capacity of up to 4 mm).3 10 furthermore, the diode laser's beam, in contrast to the carbon dioxide laser, is carried by flexible optic fibers that can be coupled with telescopes permitting access to sites that are difficult to explore with other techniques, such as the subglottic region.5 recently, a co2 laser beam delivered through a flexible hollow tube has become available that delivers the beam close to the target.15 however, the use of diode laser by contact (or extremely close distance) makes it much safer than other laser sources by avoiding damage due to beam scape in an open field.5 as this review shows, the diode laser can be a useful tool for treatment of different laryngeal pathologies, such as suprastomal granuloma, laryngomalacia, ventricular dysphonia, vocal polyp, glottic web, papilloma, glottic carcinoma, bilateral cord palsy, subglottic cyst, subglottic stenosis, subglottic hemangioma and lymphangioma. in this sense, the laser parameters must be set depending on the goal (vaporization, section or coagulation) and the clinical problem. with respect to output power, diameter of fiber and wavelength, the articles selected in this review presented different arrangements for diode laser. this reveals the lack of standardization in setting the best parameters of diode laser for laryngeal surgery. although these parameters may influence collateral tissue damage, the studies are difficult to compare, based on the following concepts of laser's physics. power, given in watts (w), measures the rate that the laser beam transmits. beam energy, measured in joules (j), can be found by multiplying the power (w) by exposure time (in seconds). power density, also called irradiance or spot brightness, determines the rate at which tissue is removed at the surgical site, measured in units of watts per square centimeter (w/cm2). fluence is a key parameter once it combines previously mentioned parameters of power density and dosage, and is measured in units of joules per square centimeter (j/cm2). it is important to understand this to provide minimal damage to tissues adjacent to the incision site, as using a higher pulse power for a shorter period of time results in less tissue damage than using lower power for a longer period of time. tissue damage is dependent upon the tissue absorption coefficient, the wavelength of the laser, power density, and the length of time over which the energy is delivered, which is largely technique dependent.16 these data were not provided by any of the included studies. an additional property that can affect the severity of tissue damage is thermal relaxation time, the time required for tissue to lose 50% of its heat through diffusion.17 one can decrease tissue damage by allowing heated tissue to cool during a procedure. however, it could be accomplished through the use of a pulsed laser, spacing out laser impact, even for a continuous incision, that decreases thermal damage by allowing time for the tissue to cool between impacts.16 in contrast, the authors of studies included in this review opted for the continuous wave radiation, some followed by manual tissue cooling. special attention must be given to laser surgery for the treatment of glottic cancer, once it can be more cost-effective than cold surgery when managing laryngeal tumors, as they allow briefer hospital stays and shorter wound recovery periods.18 the co2 laser surgery was presented as one of the most accepted treatment options of early glottic carcinoma due to its high local control rates, low morbidity, and good postoperative voice quality.19 however, if the surgeon has difficulty in managing laryngeal anterior commissure tumors, he or she is encouraged by some authors to avoid co2 laser microsurgery. alternatively, the 810 nm diode laser has been recently used for the treatment of glottic tumors and may allow better exposure and resection of tumors in the anterior commissure. the first to establish long-term results for glottic cancer treatment were ferri et al, in 2008. however, it seems that diode laser has not been well accepted worldwide for laryngeal surgery, as our review shows a gap of publications between 2008 and 2013. according to that, we speculate that most institutions continued using the co2 laser, due to doctors ' familiarity with its use, capabilities, and limitations.9 16 on the other hand, the 980 nm diode laser is a new technology, and has been reported for the treatment of early glottic tumors and vocal fold polyps since 2013.7 8 9 the main difference between these two diode laser wavelengths is their distinct absorption by the vocal fold, as the 980 nm is slightly more absorbed by water than the 810 nm one. the three studies that used the 980 nm diode laser were among those with a better design in our review. two referred to controlled trials8 9 and the other was an uncontrolled trial.7 these studies showed good efficacy results and low rates of major complications. concerning functional outcomes, as measured by the voice handicap index (vhi), karasu et al showed good results of 980 nm diode laser in treating vocal fold polyps.8 a comparison between diode and co2 laser could be quite useful to highlight the differences and compare the results, especially the functional ones. the ideal comparison to assess both types of lasers would involve a randomized clinical trial with these two techniques, which is nonexistent in the literature. even though the comparison of non-controlled studies of two different techniques can involve bias, in table 4 we show some results of some authoritative works related to the use of co2 laser for larynx surgery in the literature in similar conditions to those with diode laser on our review, so that the reader can grossly compare with table 3.17 20 21 22 23 abbreviations: m, months; y, years. regarding safety issues, five authors reported no complications or side effects by the use of the diode laser, but none of these studies was related to glottic cancer or extensive procedures. the major complications were related to more extensive surgeries and with anterior commissure involvement.7 possibly the most feared complication is the endotracheal tube airway fire, which can be catastrophic or even fatal.24 to avoid that, some authors use reinforced tubes for laser surgery6 while others described the tube being inflated using saline with methylene blue dye, so that a puncture could be immediately diagnosed.7 this review highlights the lack of good evidence for the use of diode laser in laryngeal surgery. furthermore, it is clear that there is wide variation in how it is used around the world. the 980 nm diode laser seems to be a promising laser device, so we would expect that, as experience increases, it will be more extensively used as well as new lasers wavelengths can emerge.8 despite the heterogeneous populations, varied inclusion criteria, and retrospective designs of most the studies considered in this review, they do provide useful information to the surgeon who intends to use diode laser for transoral laser microsurgery. the evidence from recent studies suggests an improvement in diode laser technology (especially the 980 nm wavelength). further long-term multicenter prospective research is needed, although the findings of this review suggest that diode laser is a useful tool that should be considered in laryngeal surgeries.

introduction the diode laser has been frequently used in the management of laryngeal disorders. the portability and functional diversity of this tool make it a reasonable alternative to conventional lasers. however, whether diode laser has been applied in transoral laser microsurgery, the ideal parameters, outcomes, and adverse effects remain unclear. objective the main objective of this systematic review is to provide a reliable evaluation of the use of diode laser in laryngeal diseases, trying to clarify its ideal parameters in the larynx, as well as its outcomes and complications. data synthesis we included eleven studies in the final analysis. from the included articles, we collected data on patient and lesion characteristics, treatment (diode laser's parameters used in surgery), and outcomes related to the laser surgery performed. only two studies were prospective and there were no randomized controlled trials. most of the evidence suggests that the diode laser can be a useful tool for treatment of different pathologies in the larynx. in this sense, the parameters must be set depending on the goal (vaporization, section, or coagulation) and the clinical problem. conclusion: the literature lacks studies on the ideal parameters of the diode laser in laryngeal surgery. the available data indicate that diode laser is a useful tool that should be considered in laryngeal surgeries. thus, large, well-designed studies correlated with diode compared with other lasers are needed to better estimate its effects.

PMC4835333

pubmed-1070

after filling, the absence of infection in the root canal system is a fundamental factor for the prognosis of endodontic treatment. to achieve this goal, the filling material should allow sealing of the root canal at both the tooth apex and the crown. in the constant search for an ideal material, root canal obturation has been performed with gutta-percha points and endodontic sealers, which act as an agent to bond the points to each other and to the root canal walls. thus, the endodontic sealer should present properties that render the root canal system impermeable. grossman9 (1958) described eleven requirements that an endodontic sealer should meet, highlighting that it should provide hermetic sealing and be insoluble in the oral fluids. a frequent concern of dentists is the possibility of exposure of the filling materials to the oral environment. though undesirable, this clinical situation may occur and can dissolve the endodontic sealer, making the root canal obturation permeable to saliva favoring the communication between irritating agents from the oral cavity and the periradicular tissues, via the apical foramen or lateral canals. the required period of exposure to the oral environment to occur such failure has been studied in vitro using different methodologies by swanson and madison24 (1987), torabinejad, et al.26 (1990), magura, et al.17 (1991), khayat, et al.11 (1993), gish, et al.8 (1994), trope, et al.27 (1995), barrieshi, et al.3 (1997), alves, et al.1 (1998), siqueira junior, et al.21 (1999), timpawat, et al.25 (2001) and zucco30 (2001). one aspect that may influence the time required to occur communication of irritating agents between the oral cavity and the periapical tissues is the type of endodontic sealer employed for obturation. this property of different endodontic sealers has been evaluated using several methodologies by leal, et al.14 (1987), madison, et al.15 (1987), madison and wilcox16 (1988), kuga, et al.13 (1990), siqueira junior, et al.19 (1995), hakel, et al.10 (1999), de almeida, et al.5 (2000), valera, et al.28 (2000), timpawat, et al.25 (2001), zucco30 (2001), obankara, et al.4 (2002), barbosa, et al.2 (2003), genoglu, et al.7 (2003), kopper, et al.12 (2003). yet, there are few studies in the literature evaluating the relationship between the sealing ability of endodontic sealers and the time during which the material is left in contact with the oral fluids. siqueira junior, et al.21 (1999), timpawat, et al.25 (2001) and zucco30 (2001), employing different endodontic sealers, achieved results that allow this correlation. most aforementioned studies were in vitro investigations, in which the experimental conditions impair reproduction of the biocharacteristics of the oral cavity. the masticatory activity, thermal cycling, oral microbiota, variations in the salivary flow and food impaction, which may occur if the root canal is left unsealed, constitute situations in the oral environment that are hardly reproduced in the laboratory. in an attempt to complement the existing literature and minimize the limitations of in vitro investigations, the present study comprised an in vivo evaluation of the sealing ability of a resin-based sealer (ah plus) and a zinc oxide-eugenol sealer (endofill) in dogs ' teeth exposed to the oral environment for either 45 or 90 days, testing the hypothesis that the resin-based sealer result in lower leakage than the zinc oxide-eugenol sealer after 90 days. the present study was approved by the research ethics committee of the dental school of the university of passo fundo (cep n. 290/2004). dogs have three lower incisors at each hemiarch (central, intermediate and lateral incisor), with only one canal each. thus, the total study sample was 48 root canals. initially, treatment was performed in the lower right incisors, which were left exposed to the oral environment for 90 days. forty-five days later, the same dogs had their lower left incisors treated and these root canals were left exposed for 45 days. the two afore mentioned experimental procedures, the dogs were submitted to general anesthesia, receiving, initially, an intra-muscular injection of 15ml/kg of ketamine (francotar-virbac do brasil indstria e comrcio ltda., roseira, brazil), 1ml/kg of xylazine hydrochloride (virbaxyl 2%-virbac do brasil indstria e comrcio ltda., so paulo, brazil) and 0.044ml/kg of atropine sulfate (atropina 1% fraga-farmagrcola s.a. following, the dogs received 0.9% sodium chloride (nacl) intravenously (laboratrio jp.-indstria farmacutica s.a. anesthesia was maintained by intravenous application of 5ml/kg of ketamine and 0.33ml/kg of xylazine hydrochloride, at 30-min intervals 12. before onset of the clinical procedures, antisepsis of the soft tissue and teeth was performed with a gauze soaked in iodine alcohol (farmcia escola ulbra, canoas, brazil), and the lower incisors were radiographed. to access the root canal, a coronal opening was performed on the buccal side of teeth using a round diamond bur n. 1012 (metalrgica fava indstria e comrcio ltda., francisco da rocha, brazil) at high-speed and under water cooling. odontometry was conducted by the radiographic technique, establishing the real working length (rwl) at 1 mm short of the radiographic apex. the reference point in all cases was the incisal edge of the tooth being treated. root canal instrumentation was performed with 1 series flexofile files (maillefer instruments sa, ballaigues, switzerland). instrumentation initiated with the file that tightly penetrated to the rwl, finishing up using file n. 40. root canal irrigation was performed alternating between 1% sodium hypochlorite (farmcia escola-ulbra, canoas, brazil) and 17% trisodium edta (farmcia escola-ulbra, canoas, brazil) at ph 7.3, using 1.8 ml of solution per change of instrument. the irrigation procedure always initiated and finished using 1% sodium hypochlorite solution 22. finishing the chemical-mechanical preparation, the root canals were dried using absorbent paper points n. 40 (dentsply indstria e comrcio ltda., root canal obturation was performed by the lateral condensation technique, using primary gutta-percha points (dentsply indstria e comrcio ltda., petrpolis, brazil) and b7 accessory gutta-percha points (tanari-tanariman industrial ltda., manacapuru, brazil) and one of the following endodontic sealers: endofill (dentsply, indstria e comrcio ltda., petrpolis, brazil) or ah plus (dentsply detrey gmbh, konstanz, germany). a stratified randomization determined, previously, the endodontic sealer to be used in each canal. eight charts, one for each unknown dog, were set before the experimental procedures. once the chemical-mechanical preparation of the root canals of one dog was completed, a chart was randomly assigned to that dog. this random assignment was followed until there was only one chart, which was assigned to the last dog submitted to treatment. the experimental period, teeth and endodontic sealer employed in each canal were recorded in the charts. the randomization method contemplated a uniform distribution of the sealers between the groups of teeth (central, intermediate and lateral incisors) at each study period. yet, none of the dogs had all root canals filled with same sealer. therefore, the 4 study groups used 12 root canals (n=12), summarized as follows: a45- root canal sealed with ah plus and exposed to the oral environment for 45 days; a90- root canal sealed with ah plus exposed for 90 days; e45- root canal sealed with endofill exposed for 45 days; and e90- root canal sealed with endofill exposed for 90 days. after completion of lateral condensation, a periapical radiograph was taken to check if the root canal filling was radiographically adequate. the gutta-percha points were sectioned with aid of a plugger (duflex-ss white artigos dentrios ltda., rio de janeiro, brazil) heated over a flame (standar evang indstria e comrcio ltda, so paulo, brazil), removing the excess material from the interior of the pulp chamber. mild pressure was then applied in apical direction (vertical condensation) with a paiva plugger n. 2 (golgran indstria e comrcio de instrumentos odontolgicos ltda., pirituba, brazil). paiva pluggers n. 1 and n. 2, heated over a flame, were used to section the remaining obturation material at the cervical level leaving a 10-mm long obturation material inside the root canal. to achieve this length of remaining material, the bidigital spacer a (maillefer instruments sa, ballaigues, switzerland) was calibrated, with silicone stops, to the dimension of the rwl minus 10 mm. sectioning of the filling material was done when the stop of the bidigital spacer a touched the reference point. a cotton pellet was placed into the pulp chamber, over the root canal treatment, and a temporary seal with glass ionomer cement (vidrion r-ss white artigos dentrios ltda., rio de janeiro, brazil) was applied over it for 24 h. this material was prepared according to the manufacturer's instructions and was placed using a centrix mark iii syringe (centrix incorporated, usa) to fill the entire coronal cavity. after 24 h, the dogs were once again anesthetized with a single intramuscular injection of 15ml/kg of ketamine and 1ml/kg of xylazine hydrochloride, and the coronal sealing was removed with a diamond bur n. 1012 at high-speed, under cooling. after the experimental period, the dogs were submitted to surgical procedures conducted by students of the discipline of experimental anatomy of the medical school of upf, the dogs received an excessive dose of 3% sodium pentobarbital (hypnol, cristalia, produtos qumicos e farmacuticos ltda. important to mention that eight dogs were previously assigned to the surgical procedures in the medical school then the authors got permission from the ethics committee to assign these dogs to this research project. with a handle n. 4 (j.o.n., so paulo, brazil) and blade n. 22 (becton dickinson indstrias cirrgicas ltda., juiz de fora, brazil), the soft tissues in the mandible were dissected until the periosteum was reached. the mandible was sectioned bilaterally using a saw (tdv dental ltda., pomerode, brazil) between the canine and the first premolar, making three jaw blocks, being one anteriorly, used in this study, and two posteriorly, used in other studies, following the same line of investigation. the lower incisors were extracted using, initially, a carbide bur n. 8 (kg sorensen ind. ltda., barueri, brazil), at high-speed under cooling, to remove the buccal bone plate until close the teeth roots. then, a le cron instrument (duflex-ss white artigos dentrios ltda., rio de janeiro, brazil) was employed to completely remove the buccal bone plate., rio de janeiro, brazil) was placed at the proximal aspects of the tooth and, with levering movements, the tooth was displaced from its socket. after extraction the pulp chamber of each tooth was thoroughly irrigated with distilled water (farmcia escola-ulbra, canoas, brazil) using a 5-ml disposable plastic syringe (becton dickinson indstrias cirrgicas ltda., juiz de fora, brazil) and a hypodermic needle 25/4 (ibras indstrias cirrgicas s.a, campinas, brazil). simultaneously to the irrigation procedure, aspiration was performed with a suction canula n. 20 (becton dickinson indstrias cirrgicas ltda, juiz de fora, brazil). when the distilled water flowed back clear from the pulp chamber the irrigation was interrupted and suction was kept for nearly 10 s. the roots were coated with two layers of clear nail varnish (risqu niasi s/a, so paulo, brazil), including the apical foramen, and allowed to dry. indstria de preciso, itapu, brazil) at neutral ph for 96 h and washed under tap water for 1 h. the specimens were rendered transparent using the diaphanization technique described by garberoglio and bassa6 (1983). the transparent teeth were analyzed under stereomicroscopy (gsz, zeiss, germany) with 10x magnification and a measuring ocular. the india ink leakage was measured (in mm), considering each root as a whole. however, only the largest value, divided by the magnification (10), was considered for each specimen. results were statistically analyzed using two-way analysis of variance (anova) and mean differences were analyzed by tukey test for multiple comparisons (sas software version 8.0) at 5% significance level (a=0.05). two teeth, one from group a45 and another from group e90, fractured during the extraction procedure. mean and standard deviation values (mm) of dye penetration for the experimental groups, and the statistical groupings are presented in table 1. mean values followed by different letters are significantly different at the significant level of 5%. two-way anova revealed significant interaction between time and sealer, meaning that there is a combined effect of these two factors in leakage. tukey test for multiple comparisons showed that the mean leakage value of group e90 is significantly higher than the mean values of all other groups. preventing contamination or recontamination of the root canal system after completion of endodontic therapy is still a challenge for the dental professional. in the absence of impermeable sealing of the root canal system, evidences indicate that the endodontic failure is closely related to the constant presence of microorganisms in the root canal and periapical tissues after obturation18,23. such contamination may occur because of the ability of these microscopic organisms to permeate the obturation mass, inducing or maintaining a periapical lesion. the microbial leakage occurs both in apical-cervical and cervical-apical directions; the following situation may occur when there is absence of coronal sealing with consequent exposure of the root canal to the oral fluids, allowing communication of the components of the oral microbiota with the obturation material. the time of exposure to the oral environment, associated to the type of endodontic sealer employed for root canal obturation, are important factors that may interfere with the success of endodontic therapy when the afore mentioned clinical condition occurs. the present study attempted to correlate these two factors (time and type of sealer) at two study periods (45 and 90 days) and two endodontic sealers: a grossman sealer (endofill), which acted as control, since it is the most widely investigated sealer in the history of endodontics, and a resin-based sealer (ah plus), which has demonstrated good outcomes as to its sealing ability5,10,12,30. as in the present investigation, previous in vitro studies also associated the afore mentioned factors21,25,30. despite allowing the control of important variables that may interfere with the outcomes, such studies conducted in laboratory present some limitations, as the fact that they do not allow association of all situations occurring in the oral cavity, such as: chewing activity, thermal cycling, oral microbiota, variations in salivary flow, and food impaction. the present study aimed to minimize the limitations of such studies, simulating the conditions of the oral environment, using dogs as an experimental model. a similar model was used by barbosa, et al.2(2003) and kopper, et al.12(2003). barbosa, et al.2(2003) used histological sections from dog's teeth and evaluated the healing process. this method provides good understanding of the impact of contamination on the tissue surrounding the periapical area of the tooth. however, it does not give a three-dimensional view of the sealing ability, as given by kopper, et al.12(2003). it should be highlighted that, before onset of the clinical procedures, the dogs received atropine sulfate and were intubated. these conditions allowed accomplishment of endodontic therapy without utilization of rubber dam, since the tube prevented interference from breathing and the atropine inhibited the salivary flow. as in the studies of swanson and madison24 (1987), madison, et al.15 (1987), madison and wilcox16 (1988), magura, et al.17 (1991) and kopper, et al.12 (2003), the teeth were rendered transparent via diaphanization to allow for the observation of dye leakage, providing a three-dimensional image of the root canals. this procedure allowed for the quantification of the highest degree of leakage in each root canal. the results of this study confirm the inability of the root canal filling to keep an impermeable sealing after the exposure to the oral environment as soon as 45 days. the two endodontic sealers used in this study were unable to prevent dye leakage, indicating that there was room in the obturation mass for possible microbial leakage to some extent. as shown in table 1, there is no significant differences in mean leakage values between the sealers at 45 days (groups a45 and e45). this finding disagree with those of kopper, et al.12 (2003), who employed a similar experimental model as the present study and observed that ah plus presented a lower mean leakage value compared to the mean value of endofill at 45 days. however, in the kopper, et al.12 (2003) study, the root canals were additional prepared for post, which is not the case of the present study. specimens in group e90 showed the highest mean leakage value. this finding suggests that the oral environment exposure time and the type of endodontic sealer are important factors that, in combination, may interfere with the success of endodontic therapy. analysis of the data reveals that the chances of failure in root canals obturated with gutta-percha and endofill, exposed to the oral environment for 90 days (group e90) are higher than in root canals obturated with gutta-percha and ah plus, submitted to the same clinical conditions (group a90). this observation is in accordance with the findings of zucco30 (2001), who observed, in vitro, a higher sealing ability for the ah plus compared to the endofill, at an experimental period of 90 days. based on the present and previous studies, the endodontic filling materials investigated can not provide an impermeable obturation, as recommended by grossman9 (1958), who described the characteristics of an ideal endodontic sealer. yet, several experimental models have been employed to evaluate the sealing ability of these materials, yielding different resuts29. the experimental model employed provided an adequate insight on the effect of oral conditions on endodontically treated teeth left without coronal sealing for 45 and 90 days. future studies on the periapical tissue response along with the information achieved in this study may contribute for an understanding of the phenomena interfering with the success of endodontic therapy. based on the research protocol and results of the present study, it can be stated that: after 45 days of exposure to the oral environment, the endodontic sealers tested were not able to keep the root canal impermeable and prevent coronal dye leakage. the endodontic sealer, endofill, after 90 days of exposure to the oral environment, presented lower sealing ability compared to the 45-day period and with ah plus at both periods.

this in vivo study evaluated the sealing ability of a resin-based sealer (ah plus) and a zinc oxide-eugenol sealer (endofill) in dogs ' teeth, exposed to the oral environment for 45 and 90 days. forty eight lower incisors from 8 dogs were endodonticaly treated. a stratified randomization determined the sealer use in each root canal. all canals were filled using the lateral condensation technique. the excess filling material at the cervical portion of the root canal was sectioned, leaving a 10-mm obturation length inside the canal. teeth were provisionally sealed with glass ionomer cement for 24 h and the canals were exposed to the oral environment for either 45 or 90 days. therefore, the experimental groups were as follows: a45- ah plus for 45 days; a90- ah plus for 90 days; e45- endofill for 45 days; and e90- endofill for 90 days (n=12). after the experimental period, the dogs were killed and the lower jaw was removed. the incisors were extracted and the roots were covered with two coats of nail varnish. the teeth were immersed in india ink for 96 h and submitted to diaphanization. dye leakage (in mm) was measured using stereomicroscopy (10x magnification). the results were statistically analyzed using two-way anova and tukey test for multiple comparisons (= 0.05). group e90 (2.030.94) showed significantly higher mean leakage value than all other groups (p<0.001). none of the sealers, in both study conditions, were able to prevent dye leakage.

PMC4327170

pubmed-1071

tissue specimens taken from patients during operations or biopsies are usually assessed by the pathologists one or two days after the surgery. however, sometimes pathological results are needed urgently during the operation, while the patient is still on the operation table. in neurosurgical operations the need of a rapid diagnosis during the operation can be met by intraoperative consultation examinations. during surgeries, the use of touch preparation technique, known as touch preparation as an intraoperative consultation examination technique is now well established. a good intraoperative consultation examination technique should preserve good amount of tissue for paraffin embedded sections, and should be accurate and rapid. frozen section is another intraoperative consultation examination technique that needs more tissue and has some freezing artifacts. the architecture of tissues in frozen section closely approximates permanent histology sections, and enables a degree of comfort. touch preparation has been found quite reliable and useful in the determination of surgical resection margins, sentinel lymph nodes, adenomatous goiter, and confirmation of parathyroid tissue. various diagnoses can be well made by an expert pathologist using touch preparation technique, because the cytomorphological features of smears in every malignant or benign lesion are specific. the objective of the present study was to evaluate four years (2007-2011) of using touch preparation technique by shahid beheshti hospital pathologists to examine benefits and possible defects of the technique in determining the diagnosis of central nervous system biopsies taken during operations. the accuracy of the technique was judged against the diagnosis made by final pathological diagnosis. this study aimed at assessing the value of diagnosis made by touch preparation technique in 2007-2011. all of the patients signed the written informed consent to include their data in the study. biopsies taken from lesions were grossly examined, and hemorrhagic and necrotic areas were sampled and prepared for the touch preparation technique. at least two smears were taken from each case by using two clean grease-free glass slides. the smears were fixed with absolute alcohol and were stained with geimsa and papanicolau. after the surgeries, remaining tissues were processed for paraffin-embedded sections, haematoxylin and eosin staining, and microscopic examination. the microscopic examination of paraffin sections, and touch preparation were made blindly by two pathologists. to examine the accuracy of diagnosis by touch preparation technique, the diagnoses obtained by this technique were compared with those obtained by microscopic examination of the smears. the findings were analyzed using statistical package for social sciences (spss version 16). during the study, 139 lesions, which had been sent for intraoperative consultation, were evaluated. the average patients age was 57, and there were 70 males and 69 females. errors in diagnosis were seen in 12% of lesions. the highest correlation (100%) was observed in five types of tumor, and no correct diagnosis was made in case of hydatid cyst. oligodendrogliomas, haemangioblastoma, meningioma, choroid plexus papilloma, craniopharyngioma, megakaryocytic leukemia, and dermoid cyst were diagnosed totally (100%) correct (table 1). the total number of tumor and correct diagnosis in touch preparation technique the accuracy of touch preparation technique for astrocytoma, pituitary adenoma, glioblastoma multiforme, metastatic carcinoma, and giant cell tumor was 81%, 84%, 66%, 66%, 88% and 80%, respectively. glioblastoma multiforme was misdiagnosed twice as metastasic carcinomas, and high grade astrocytoma was misdiagnosed five times as metastasic carcinomas. two cases of astrocytoma grade i was misdiagnosed as metastasic carcinomas, and one case of meduloblastoma was misdiagnosed as meningioma. other misdiagnosed tumors were reported as benign or malignant microscopic results or inflammation (figure 1-6). low grade astrocytoma: mild nuclear pleomorphism, mild to moderate hyperchromasia, absence of mitotic activity and dyscohesive pattern, minimal derivatium in nuclear shapes. left: permanent pathologic slide (hematoxylline eosin x10). glioblastoma multiform. left: permanent pathologic slide (hematoxyllin eosinx10), anaplastic and pleomorphic cells without glial processes and endothelial hyperplasia. meningioma: meningothelial cell proliferation with whorl formation. left: permanent pathologic slide (hematoxyllin eosin x40), indicators show whorl formation. right: touch preparation (papanicolau 400), the indicator shows the whorl formation. pitutary adenoma: diffuse sheet of uniform cells, fibrovascular stroma, and absence of pleomorphic cells. left: permanent pathologic slide (hematoxyllin eosin x40). hydatid cyst: cyst wall shows laminated layers and many scolexes. left: permanent pathologic slide (hematoxyllin eosin x4), the structures are visible. right: touch preparation (papanicolau 100), the structures are not visible thus the diagnosis is hard to be made. schwannoma. left: permanent pathologic slide (hematoxyllin eosin 10); fusiform cells with long nuclei and eosinophilic cytoplasm arranged in hypercellular and hypocellular matrix. right: touch preparation (papanicolau x40); a cluster of schwann cells with elongated nuclei. the present study was a retrospective analysis to determine the accuracy of touch preparation technique in diagnosing the type of tumors encountered during the operation. different authors used various stains such as 1% alcoholic toluidine blue and may-grunwald giemsa. compared to frozen section, in touch preparation technique and a large area of tissue can be examined. besides, touch preparation technique provides enough tissue for intraoperative and subsequent routine paraffin section diagnoses. the two techniques are complementary, but frozen section is a better technique for the tissues, which their consistency is confirmed. unlike permanent histology, the frozen section technique, which has the accuracy rate of about 97%, can be done during the surgery. however, cryostat facility is not available at many centers in iran. touch preparation technique provides more crisp cytologic detail than frozen sections do, and can avoid most of freezing artifacts in brain tumors, high lipid content and soft nature.. the use of frozen section during surgery can give the surgeon the opportunity to avoid the second surgery. due to high predictive value, the touch technique can be used first in the operation room, and frozen section can be saved for cases with inconclusive diagnosis by the touch technique. this study is one of the largest studies of this technique on cns tumors in iran. previous reports indicate that the diagnostic accuracy of cytological smears ranged from 75% to 94%. in the present study the accuracy of touch preparation technique in diagnosing brain lesions was 84%, which is lower than that of other studies that included tumors only. this may be to the inclusion of other types of tumor such as bone tumors in the studies of neurosurgical tumors. the low diagnostic accuracy of touch preparation technique in our study may be related to limited sample size. the diagnostic accuracy of touch preparation technique for high and low grade astrosytoma was 81% (39 out of 48) in our study. when a small biopsy was submitted and typical features of pilocytic astrocytoma were not present, it was difficult to correctly diagnosis, or to grade the tumor. moreover, when vascular proliferation and atypia was interpreted without adequate clinical history, a misdiagnosis of high grade astrocytoma was made. when cellular pleomorphism, giant cells, mitoses necrosis and vascular proliferation were present, the diagnosis of glioblastoma was obvious (figure 1). because of high cellularity, pleomorphism and the round to polygonal appearance of the cells, high grade astrocytomas and glioblastoma are often confused with metastatic carcinoma. anaplastic and pleomorphic cells that have no glial process are the key point in the diagnosis glioblastoma multiforme. meningothelial, transitional and psammomatous meningiomas (three types of meningiomas) usually present no diagnostic difficulty because they exhibit features of non-neoplastic arachnoid cap cells, particularly the tendency to form whorls. the nuclei of many meningiomas (especially the meningothelial types) show two types of intranuclear vacuoles. one type is formed by invagination of cytoplasm into the nucleus and the other by clearing of chromatin material from the center of the nucleus. in addition to whorls, the presence of intranuclear inclusions and calcification is of help in diagnosing meningiomas. chordoid meningiomas were misinterpreted as chordoma and atypical meningioma with metastatic carcinoma. in haemangioblastomas, obtaining good quality smears was difficult. however, all of the cases of meningiomas and 10 out of 11 cases of schwannoma were diagnosed correctly, because of the mentioned diagnostic characteristics (figure 3 and 6). the cellular monomorphism and the absence of a significant reticulin network distinguish pituitary adenomas from non-neoplastic anterior pituitary parenchyma (figure 4). eleven of 13 cases were diagnosed correctly, but two cases were not diagnosed correctly using touch preparation technique. in haemangioblastomas, obtaining good quality smears was difficult. the smears showed thick and dense trabeculae of elongated cells, which led to misinterpretation. all such characteristics helped correct diagnosing of all three cases of haemangioblastomas in our study. hydatid cysts are diagnosed by the presence of scolex and a cyst with a laminated layer (figure 5). touch preparation technique could not the two cases of hydatid cyst in our study. touch preparation technique is a rapid diagnostic method and a good complimentary technique for frozen section. the experience of a pathologist is very important as diagnosis is made on cytology alone without any special stains and in a short time. awareness of the cytomorphological features on smears of various lesions is important. in 64% of cases correct diagnosis could be made on smears alone, and in another 20% after clinical and radiological correlation. touch preparation technique is a very accurate and rapid method of intraoperative diagnosis, especially when combined with frozen section. however, adequate clinical history, neuroimaging details, and the intraoperative impression of the neurosurgeon, if provided, helps the neuropathologists to improve the diagnostic accuracy.

background: the touch preparation technique is an accurate and rapid method, and when used as intraoperative consultation examination technique it preserves a good amount of tissue for paraffin embedded sections. this study aimed at examining the accuracy of the touch preparation technique by comparing its diagnosis with that of final pathological diagnosis made by microscopic examinations. methods: the diagnoses of 139 central nervous system lesions by touch preparation technique and paraffin-embedded sections were compared. results: touch preparation technique diagnosed correctly 118 (84%) of the lesions. however, the technique failed to correctly diagnose 12% of the cases. the highest rate of accurate diagnosis (100%) was observed in five types out of 11 types of tumor examined. however, the technique was not able to diagnose hydatid cysts correctly. conclusion: the findings indicate that touch preparation technique may be useful in diagnosing tumor type during surgical operations. touch preparation technique is very accurate for intraoperative diagnosis. however, adequate clinical history, neuroimaging details, and the intraoperative impressions of the neurosurgeons, if provided, help the pathologists to improve the diagnostic accuracy of the technique.

PMC3470068

pubmed-1072

tai chi (tc), also known as tai chi chuan, is a traditional chinese martial art originally created for self-defense, although today it is considered a low-impact aerobic exercise (zhang et al., 2012). its practice consists of fluid, circular, smooth, and slow movements, with the practitioner in a semi-flexed position of the knees. the practice of this exercise requires precise and slow movements of the joints, the maintenance of postural stability, and balance (chen et al., 2008), but also meditative aspects that are combined with breathing exercises (wang et al., 2014). there are five main styles of tc: yang; wu; chen; hao, and sun. each has its different focus with regard to the movements, but all share the same essential principles of the practice (lan et al., 2013). in investigation studies, the 108-movement yang-style tc has been utilized, as well as simpler and shorter forms of tc of between 8 and 108 movements or other western variants (lan et al., 2013). various published studies have calculated that the expenditure of energy during the practice of tc is between 4.1 and 6.7. metabolic equivalents (met) according to the style of the practice (schneider and leung, 1991; zhuo et al., 1984). lan and collaborators quantified cardiac frequency (cf) and oxygen consumption (vo2) with the practice of tc in adults; mean cf was 58% of the cardiac frequency reserve (cfr) and a maximal vo2 55%. thus, according to these parameters, tc can be considered an aerobic exercise of moderate intensity (cfr, 4059%) (lan et al., 2001). there is recent evidence that supports the therapeutic effects of tc for musculoskeletal, rheumatological, neurological, and geriatric conditions (wang, 2011; 2012). significant improvements have been reported in balance, muscular strength, cardiorespiratory function, joint and muscle flexibility, pain, and even symptoms of depression and anxiety (wang, 2012). in a study that reported the neuromuscular effects of tc in elderly subjects with alterations in equilibrium, significant progresses were demonstrated in neuromuscular control of the knee and in the organization of muscular response during walking, as well as significant improvement with respect to functional equilibrium appraised with different scales (gatts et al., 2007). possible mechanisms include improvement in equilibrium, caregiving, postural control, propioceptive sensitivity, and reduction of the fear of falling (hall et al., 2009; lan et al., 2013). subjects trained in tc additionally present improved vestibular reactions in sensorial tests during postural changes and greater propioceptive accuracy when compared with the controls (fong and ng, 2006; gyllensten et al., 2010). a systematic review and meta-analysis published in 2011 on the effects of tc in osteoarthritis (oa) included six randomized clinical trials (rct) that compared tc with controls and that concluded that tc was superior with respect to pain, functionality, and joint rigidity on comparing the former with conventional exercise programs or those carried out at home (kang et al., 2011). another systematic review, this one published in 2014, on the effects of tc on oa of the knee included six good-quality rct. the authors concluded that tc exhibited effectiveness in diminution of pain and improvement in physical function, although the review emphasized the need for conducting rct with larger sample sizes and longer follow-ups to confirm the efficacy of this intervention (ye et al., 2014). in a recently published systematic review, the effectiveness was evaluated of physical therapy on improvement of equilibrium and reduction in the risk of falls in patients with oa of the knee. the interventions taken into account included tc, strength training, aerobic exercise, and aquatic exercise. the study concluded that tc, strength training exercises, and aerobic training improved balance and diminished the risk of falls in older adults with oa of the knee (mat et al., 2015). in the guidelines from the european league against rheumatism (eular, 2013) for non-pharmacological management knee and hip oa, it is included the recommendation to practice tc in patients with oa, based on a systematic review of 10 good quality rct, where evidence was found of the usefulness of tc in pain reduction, with an effect size of 0.28 up to 1.67 (escalante et al., 2010; fernandes et al., 2013). in 2012, the american college of rheumatology (acr) established a conditioned recommendation on the practice of tc as non-pharmacological treatment of oa of the knee (hochberg et al., 2012). another international association, the osteoarthritis research society international (oarsi), in its guidelines of conservative management of oa, does not establish recommendations with respect to the prescription or use of tc (mcalindon et al., recommendations have not been established for these agencies on the usefulness of tc for other pathologies. with regard to quality of life (qol), there is a systematic review on the effectiveness of tc in chronic pathologies that includes 21 rct and 1,200 patients in a meta-analysis showing positive effects on qol in these types of pathologies, specifically on cardiorespiratory, neurological, and musculoskeletal pathologies (li et al., 2014). the properties of water promote active movement, muscle relaxation, provide greater bodily and postural support, and stimulate strengthening by means of resistance of water, permitting the training of motor and sensory skills in subjects in water (verhagen et al., 2012). this rehabilitation technique is based on the potential benefits of hydrodynamic principles such as bouyancy, resistance, relative density, viscosity, turbulence, and hydrostatic pressure and flow, in addition to providing sensory and physiological effects by means of the water temperature (torres-ronda and del alczar, 2014). hydrotherapy (ht) is a technique that is applied as a complementary treatment in multiple pathologies. evidence exists on the efficacy of this intervention with respect to pain diminution of pain and musculoskeletal function improvement in affectations such as low back pain, rheumatoid arthritis, oa, and fibromyalgia, and in neurological pathologies such as multiple sclerosis (verhagen et al., 2012). in a meta-analysis published by barker and colleagues that included 20 studies on the effectiveness of ht on musculoskeletal conditions, the authors found moderate effects on pain diminution and functionality (barker et al., 2014). the technique and advantages of tc can theoretically be complemented with the benefits of ht. this concept has already been explored and although it is presently found in an experimentation phase, various studies have reported the efficacy of water-based postural exercise programs, suggesting positive effects on coordination and equilibrium on combining these (barker, 2014). when equilibrium training has been conducted on the floor, an individual s performance can be affected by lack of confidence, fear of falling, or joint pain. in an aquatic environment, the viscosity inherent in water serves as postural support, promoting confidence and reduction in fear of falling. the water temperature can be beneficial in pathologies that produce chronic pain, muscle contractions, or spasticity (becker, 2009). novel techniques have been developed that combine the principles of tc and those of other disciplines similar to ht, or even techniques such as ai chi, aquatic exercise, which include tc, qui gong, shiatsu or watsu movements within an aquatic and musicotherapeutic environment. these programs have been tested in rct as measures of the outcomes of pain, functionality, and disability, with significantly better results with respect to the group only engaging in breathing and relaxation exercises outside of the water (castro-snchez et al., 2012). although ai chi is not synonymous with underwater tc, it does include movements of the latter with the potential benefits of ht, specifically in a pool, and variants of the technique have been developed that take advantage of the good aspects of both. teixeira et al. (2011) conducted an rct on the effects of ai chi on equilibrium and fear of falling in older adults. thirty participants at the daycare center of a home for the fragile elderly were randomly assigned to an ai chi class or to a control group where they received customary caregiving. the results suggested that an ai chi program produces improvement in static and dynamic equilibrium in the elderly in comparison with conventional caregiving. the ai chi group maintained the same level of fear of falls, but in the control group, this increased (teixeira et al., 2011). in another rct, with the objective to analyze the effects of an ai chi program on equilibrium in older adults, 54 subjects aged between 60 and 85 yr were included who presented a high risk of falls. these subjects were distributed into two groups: the experimental group that participated in 12 sessions of ai chi, and the control group, the members of which carried out a conventional ht treatment in a pool. equilibrium, joint mobility and pain were evaluated at the beginning and at the end of the intervention. significant improvement in equilibrium in both groups was reported but, on performing the comparison between the groups, the experimental group was significantly better with respect to balance (olabe-snchez and martnez-almagro, 2014). (2009) published an rct in which the authors compared an ai chi technique with another involving floor exercises in persons with fibromyalgia; the authors concluded that there were no global differences between both groups, although there was significant improvement in symptoms and sleep quality in members of the ai chi group (calandre et al., 2009). in a pilot study published by prez-de la cruz and colleagues (2015), the authors analyzed the results of an ai chi program conducted in the water on qol, depression, and pain in patients with fibromyalgia. twenty patients were included, in whom functionality, pain, and qol were measured; the intervention consisted of 20 sessions of the water-based program. the authors reported significant differences in the outcome variables in favor of the experimental group (prez-de la cruz and lambeck, 2015). (2008) reported another rct in which they included 25 patients with chronic cerebrovascular-event sequelae who were assigned to two treatment groups: the experimental group underwent aquatic training, which included a combination of ai chi and halliwick (another aquatic training technique) or a control group, with gymnastic floor exercises. the authors concluded that the aquatic therapy significantly improved equilibrium (noh et al., 2008). tc has demonstrated, in multiple studies, its usefulness on musculoskeletal system pathologies, due to its slow movements that involve the four limbs together with the regulation of breathing, postural control, and balance, and tc is now even recommended in some evidence-based clinical guidelines. ht has been utilized with proven benefits derived from the mechanical properties of water that combine with the effects of the exercise, improving the muscle-skeletal conditions of the subjects. both treatment types involve the physical work of equilibrium, mobility, strength, coordination, and sensory input such as proprioception, with complementary advantages, which theoretically render them as possessing potential synergy in their benefits. in addition to this relaxation and breathing can provide a complete exercise, with low joint impact and strength work at the same time. combined tc and ht have been tested principally in older adults with risk of falls or fragility, and in some neurological or rheumatological pathologies. it is important to know whether tc practiced in water is useful in other chronic pathologies that cause pain and alterations in walking, such as knee or hip oa. for this, it is necessary to develop good-quality rct in those included in conventional tc control groups, conventional ht groups, and in groups with both tc and ht combined, or conventional floor exercises (stretching, strengthening, equilibrium), in order to acquire general evidence that establishes whether there is an advantage on combining both techniques. in addition, it is necessary to carry out rct with adequate samples sizes and greater follow-up to observe potential medium- and long-term benefits and to observe distinct techniques and modalities of tc as well as of ht.

tai chi is a low-impact and moderate intensity exercise that has shown positive effects in patients with musculoskeletal disorders. recently have been developed clinical studies on the benefits of tai chi techniques combined with hydrotherapy. both types of treatment include physical training of balance, mobility, strength, coordination and sensory input that could complement each other. this report aims to present the current evidence about the benefits of the combination of water based tai chi in musculoskeletal diseases in order to establish whether the combined intervention is better than tai chi or hydrotherapy alone.

PMC4492420

pubmed-1073

acute cerebral ischemic reperfusion injury (ciri), a hotspot for clinical research, is a pathophysiologic phenomenon commonly encountered in the field of emergency medicine, especially during the perioperative periods. the brain can store so little energy reserves that it is highly sensitive to ischemia and hypoxia. studies have shown that interrupting the cerebral blood flow for 10 s can lead to loss of consciousness. if cerebral blood flow is blocked for more than 5 min, permanent brain damage is inevitable. phosphocreatine (pcr) has been used as cardioplegic and cardioprotective agents during cardiopulmonary bypass and also ischemic events. in recent years, some reports showed that pcr improved the outcome after stroke and neonatal hypoxic ischemic encephalopathy. there have been no studies done to investigate the effect of pcr during acute ciri. so we designed this research using acute rat ciri model to observe the effect of pcr and investigate its possible mechanism. all experimental procedures were done in accordance with the guide for the care and use of laboratory animals. all surgical procedures have been approved by the committee for experimental animals of centre for disease control and prevention of hubei province. 36 male wistar rats weighing 200220 g were acquired from the experimental animal center of hubei province, wuhan, china. 36 wistar rats were randomly divided into 3 groups: sham-operated group (sham group, n=12), ischemia-reperfusion group (i/r group, n=12), pcr preconditioning group (pcr group, n=12). ciri rat models were produced by electrocauterizing bilateral vertebral arteries and occlusion of bilateral common carotid arteries using atraumatic clasps. the clasps were released 10 min later and followed by a 48-hour reperfusion. in sham group, pcr 150 mgkg was administered intravenously 60 min before the bilateral common carotid arteries were occluded; normal saline was administered intravenously in i/r group simultaneously. core body temperatures were monitored with a rectal probe and maintained between 36.5c~37.5c during the whole procedure. 3 rats from i/r group and 1 from pcr group were excluded within 24 h while the remaining ones were regarded as successful models. after routine he staining, pathological changes of the brain tissue were observed under a light microscopy (400). the level of cell apoptosis was determined with a roche in situ cell-apoptosis-assay kit with nuclei stained in brown particles (shanghai runwell technology co., china). 10 high-power fields (400) were randomly selected, and the number of apoptotic cells was counted for each field. cam activity (mmoll) was measured using rat cam elisa kit (r&d company, us); mda content (nmoll) was detected with mda kit; protein content (mgl) in corresponding tissue was detected with coomassie brilliant blue protein assay kit (both from nanjing jiancheng bio co., china). mda content in the tissue was calculated using the following formula: (1)mda (nmolmgprot1)=mda content (nmoll1)protein content (mgl1) in corresponding tissue5. results were expressed as mean sd. data were statistically evaluated by one-way anova (snk) tests and dunnett's tests, with the level of significance chosen as p<.05. in sham group, the cortical neurons are arranged in neat rows with abundant cytoplasm, and the nuclei are round and basophilic. in i/r group, the cytoplasm is light red with uneven distribution and vacuoles, nuclei are condensed. in pcr group, however, the cell structure is normal. most of the neurons have complete membrane integrity and the nuclei are clear (figure 1). a few tunel-positive cells were observed in the cortex of rats in sham group whereas a large number of tunel-positive cells was observed in the cortex of rats subject to i/r injury; compared with i/r group, the number of tunel positive cells was significantly reduced in the cortex of pcr group (figures 2 and 3). the cam activity of i/r group and pcr group was significantly increased at 48 hours after reperfusion compared with sham group whereas cam activity was significantly decreased in the cortex of pcr group compared with i/r group (figure 4). mda in i/r group and pcr group was significantly increased at 48 hours after reperfusion compared with sham group, but compared with i/r group, mda content was significantly decreased in the cortex of pcr group (figure 5). rapid exhaustion of energy is one of the important etiological factors of ischemia-reperfusion injury [5, 6]. we hypothesized that supplication of an exogenous energy substrate before ischemic reperfusion might be an important logical therapeutic step. pcr is a very important energy substrate, it can go through the blood-brain barrier, even through the cell membrane, to supply energy to cells directly., we have demonstrated that pcr preconditioning attenuated cell apoptosis and the morphological damage during cerebral ischemia-reperfusion in rats. in ischemia-reperfusion injury brain, the cytoplasm is light red with uneven distribution and vacuoles, and nuclei are condensed under light microscopy after reperfusion for 48 h. compared with i/r group, the number of apoptotic cells was significantly decreased and cerebral ischemia-reperfusion injury was alleviated in pcr group. imbalance of neuronal calcium homeostasis and increase in oxygen free radical are important aggravating factors of cerebral ischemic reperfusion injury. energy deficiency causes intracellular calcium overload and an increase in oxygen free radical. to assess the intracellular ca overload and oxygen free radical level, cam activity and cerebral mda content were determined. it combines with ca reversibly, and regulates transmembrane calcium transportation, absorption, and secretion. an increase in activity of cam means an elevation of intracellular ionized ca concentration, hence causing calcium imbalance in the cells. mda is a stable lipid peroxide end product produced during the oxidation of membrane lipid unsaturated fatty acid by oxygen free radical. the central nervous system is rich in unsaturated fatty acids that interact with oxygen free radical during reperfusion after an ischemic event, which generates a large amount of mda. therefore, mda level indirectly reflects the level of oxygen free radical and the degree of lipid peroxidation in the brain tissue. we found that the cam activity was elevated in i/r group compared with sham group, indicating the increase of ca influx, ca overload, and ca balance disturbance. the high mda content in i/r group suggested that oxidative stress occurred and a large amount of lipid peroxide was produced. thus, there were lower incidences of ca reflux, ca overload, and complex pathological changes induced by ca overload. pcr group also had lower mda level, indicating that pcr induced a significant suppression in the generation of free radical and provided an antioxidative protection to the cell and organelle membranes, hence attenuating cellular necrosis and apoptosis. during ischemia-reperfusion we have found that pcr preconditioning decreases cam activity, thus preventing calcium overload, reducing the production of oxygen free radical indirectly. as an atp precursor, pcr releases high-energy phosphate bond to synthesize atp, supplying neurons with energy, reducing the production of lactic acid, and maintaining the function of na-ca exchange. it is suggested that pcr preconditioning ensures sufficient atp supply, keeps ca pump working, and sustains ca balance. it can also inhibit the formation of hypoxanthine, thereby reducing the production of oxygen free radicals. the drawback of clinical application of mechanical preconditioning is the difficulty in predicting the onset of any ischemic event. even if it's predictable, the application of a transient mechanical preconditioning is impractical before cerebral ischemia. therefore, the clinical application of mechanical preconditioning was limited. one of the important etiological factors of ischemia-reperfusion injury is due to the rapid exhaustion of energy [5, 6]. therefore, a supply of an exogenous energy substance during ischemic reperfusion may be an important logical therapeutic step. it acts as an energy reserve, and it is mainly synthesized by the kidneys. the finding of the current study provides a promising method for the treatment of cerebral ischemia-reperfusion injury. future study will be needed to further evaluate the effect of pcr on brain infarct size, neurological score and so forth. the assessment of functional and histological endpoints as well as multiple neurological outcomes will allow better understanding of the pcr's role in brain ischemia. in summary, we demonstrated the protective effect of pcr during cerebral ischemic reperfusion injury. based on the pharmacokinetic characteristics of pcr, we speculate that pcr should be administered preoperatively to hemodynamic unstable patients, such as aortic aneurysm surgical patients, who may develop cerebral ischemia during surgery when the major arteries are clamped. other patients with severe head injury, hemorrhagic shock, cerebral vasospasm, and respiratory and cardiac arrest

phosphocreatine (pcr) is an endogenous compound containing high-energy phosphate bonds. it has been confirmed that pcr is effective in preventing and treating cardiac and renal ischemia-reperfusion injury. in this study, rat cerebral ischemia-reperfusion injury models were constructed. apoptotic cells in the cortex region were measured by tunel method. malondialdehyde (mda) content was detected by chromatometry, and calmodulin (cam) activity was detected by elisa. compared with sham-operated group (sham group), tunel-positive cells, mda, and level of cam activity increased in ischemia-reperfusion group (i/r group) and pcr preconditioning group (pcr group); compared with i/r group, tunel-positive cells, mda content, and level of cam activity decreased in pcr group. this study indicated that pcr can decrease the morphological damage and the neuron apoptosis of the ischemia-reperfusion injury brain through attenuating abnormalities of calcium balance and production of oxygen free radicals.

PMC3026975

pubmed-1074

citing statistics from the american cancer society, harold varmus noted that we have made depressingly little progress in combating cancer. while over the past 50 years dramatic strides have been made against cardiovascular and infectious diseases, age-adjusted mortality in patients with cancer has declined only slightly, with the decrease mostly related to the drop in lung cancer-caused deaths due to aggressive efforts to discourage cigarette smoking. the discovery of the first oncogene in 1976 triggered a wave of discoveries into oncogenes (genes which increase the risk of developing cancer when mutated) and tumor suppressor genes (tsgs, genes which typically appear in pathways controlling cell growth and regulation). in succeeding decades, these insights were exploited by drug discovery researchers, aiming to displace standard chemotherapeutic drugs (empirically discovered cytotoxics) with agents targeting oncogenes (molecular targeted drugs). this approach led to one notable success, novartis ' gleevec for chronic myelogenous leukemia (cml), a disease linked to the philadelphia chromosome, an aberration of chromosomes 9 and 22. overall, however, the new wave of chemotherapeutic research has been described by researchers at the dana-farber cancer institute as neocytotoxics, a reference to their tendency to show unacceptable toxicity at therapeutic doses like the older drugs. this relative lack of success in discovering novel chemotherapeutic drugs prompts the questions of how well we really understand the basic mechanisms underlying cancer and whether there are other avenues of exploration worthy of greater attention. in this review, i focus on the intertwined mechanisms of protein folding and proteostasis and on the balance between production and destruction of proteins in cells. what draws our attention here are two distinct advances: first, the recent clinical successes of velcade (bortemozib), a drug that inhibits the protein destruction pathway, which was approved in 2003 by the food and drug administration (fda) of the us for use in refractory multiple myeloma; and second, the multiplicity of hsp90 inhibitors in phase ii clinical trials (hsp90 is one of the chaperone proteins intimately involved in protein folding mechanisms). based on these developments and a better understanding of protein homeostasis, i aim here to provide information that may lead to a novel perspective on cancer, with a focus on the dynamic state of the proteome as it relates to cancer. this perspective yields intriguing insights into why so little progress has been made in the development of cancer chemotherapies and indicates alternative directions. in particular, this perspective provides a focus on the work of whitesell and lindquist who have proposed, in essence, a novel theory of cancer, asserting that cancer cells acquire a hyper-mutating phenotype and further claiming that control of cancer will best be achieved by modulating cells ' ability to adapt and evolve in response to selection pressures. one can best understand and appreciate this perspective after an overview of basic biochemical and cellular processes. i start with a review of in vitro protein folding, describing the spontaneous process by which a linear chain of amino acids acquires the precise three-dimensional (3d) structure required for the protein's function. next, i describe how this folding occurs in the crowded and chaotic internal environment of the cell: this is not a simple spontaneous process; rather, this process is mediated by a class of proteins, chaperones or heat-shock proteins (hsps), as a mechanism to reduce the likelihood of misfolding and loss of function. the third section describes why protein folding is only one part of the broader mechanism of proteostasis (protein homeostasis) (figure 1), by which proteins in the cell are constantly degraded and created anew, and that degradation is a specific atp-dependent process occurring in the ubiquitin-proteosome system. the first clue to this link between proteostasis and cancer emerged in 1981, when hsps were first linked to cancer by oppermann et al., who found that hsp90 coimmunoprecipitated with the src oncogene protein. another observation linking these proteostasis processes to cancer is that, while most proteins have cellular half-lives of 12 h, many oncogene proteins and tsg proteins have half-lives of a few minutes. of a particular note, p53, which has been nicknamed the guardian of the genome for its role in dna repair and is a protein that is mutated in over 50% of all cancers, has a half-life of only 20 min. p53 is constantly being synthesized, folded, and degraded, and its half-life is extended in response to various cellular stresses. the final section concludes by describing how this understanding that linking protein folding, proteostasis, and cancer may point to future directions in the discovery and development of cancer chemotherapy. the hallmarks of cancer are all phenotypic. yet the standard perspective states cancer is a disease of the genes, which places the focus purely on the genotype. in the perspective presented here, it does not suffice to focus purely on the genotype we must also understand the means by which the phenotype results from the genotype, both in the cases where the genotype is normal and in those cases where the genotype has undergone changes that characteristic of cancer. protein folding and proteostasis are the central mechanisms by which the phenotype emerges from the genotype. in this section, we delve into how protein folding functions in vitro (pathway #1, figure 1), that is, when the genome is pristine and is in a state that does not yet require the cellular apparatus designed to assist folding under stress conditions. with this as background knowledge, we can proceed in following sections to elaborate how protein folding functions in vivo, under stress conditions such as elevated temperature or mutations, and explore how this may relate to cancer. christian anfinsen shared the 1972 nobel prize in chemistry for his work on protein folding. his nobel lecture, studies on the principles that govern the folding of protein chains, succinctly describes conclusions that set the paradigm for in vitro protein folding to this day. a random conformation of a polypeptide chain in an aqueous environment will acquire a specific, unique 3d conformation. with a modest increase in temperature, a protein will lose its original 3d structure but will recover it when the temperature returns to normal. with modest increases in temperature (1c2c), however, this conformation will turn into a random set of conformations, and it may not revert to the original 3d structure because of denaturation (as in cooking an egg). anfinsen studied the protein ribonuclease, with its multiple disulfide bridges, and focused on the reversibility of its heat-induced denaturation. based on these results, he concluded that the primary sequence of a protein completely determines its 3d conformation, and that the process of protein folding was based strictly on thermodynamics. he phrased this the thermodynamic hypothesis: this hypothesis states that the three-dimensional structure of a native protein in its normal physiological milieu (solvent, ph, ionic strength, presence of other components such as metal ions or prosthetic groups, temperature, etc.) is the one in which the gibbs free energy of the whole system is lowest; that is, that the native conformation is determined by the totality of interatomic interactions and hence by the amino acid sequence, in a given environment. from this thermodynamic hypothesis, anfinsen also concluded that the 3d structure would not be significantly altered by mutations of residues on the surface of a protein, or mutations of an inner residue when changed to a residue of comparable size, hydrophobicity, etc. conversely, mutations on inner residues which change the size or hydrophobicity (e.g. an ala glu or an ala ser mutation) had potential to alter the folding from the wild-type 3d structure. even with anfinsen's thermodynamic hypothesis, the kinetics of protein folding, the rate at which this thermodynamic optimum is achieved, remains a puzzle. the number of conformations that should be sampled from a polypeptide chain to find the correct 3d conformation is astronomical, greater than the number of atoms in the universe. the levinthal's paradox is the name given to the puzzling question of how a protein can fold in a few minutes, given the vast number of conformations randomly sampled. whereas anfinsen assumed there must be some types of nucleation events (small subsequences folding into specific 3d structures which seed the formation of the full protein structure), subsequent theoretical and experimental studies on the kinetics of protein folding led to the notion of protein folding funnels (figure 3a). the notion that a folding pathway is funnel-shaped means that a huge number of conformations are initially explored by many paths in parallel (wide top of the funnel), with a steady winnowing out of the least-promising sets of conformations (middle of the funnel) and final selection of the thermodynamic optimum proceeding via a small number of folding pathways (bottom of the funnel). figure 3a illustrates a smooth folding funnel that pertains to small proteins, ones which fold extremely fast in a few microseconds, near the theoretical folding speed limit. the smooth funnel indicates that there are few if any kinetic traps, namely conformations that are stable but will not lead to the final global thermodynamic optimum. figure 3b depicts a rugged landscape, a protein folding funnel with many kinetic traps. as shown in figure 3c, if dependent solely on random motion of molecules, it would take a long time for the rare occurrence that will permit a conformation to jump out of this trap. figure 4 shows a schematic of what such a kinetic trap might look like; one pair of hydrophobic interactions is satisfied in a way that does n't permit the other pair to form. another insight that emerged from recent theoretical studies of protein folding is that the dominant driving force consists of hydrophobic interactions, the tendency for hydrophobic sidechains (val, leu, ile, ala, phe, tyr, trp) to escape an aqueous environment and seclude themselves with similarly hydrophobic sidechains in a hydrophobic interiorhydrophobic collapse. pauling made the spectacular prediction of the alpha-helix, as a regular motif for protein structures a decade before the first experimental structure was elucidated. this was based on the assumption that hydrogen-bonds would form along backbone peptide units spaced three residues apart. by contrast, it is now thought that helices (and other elements of secondary structures) begin to form as a result of constraints imposed by hydrophobic collapse, with hydrogen-bonds rigidifying these helices but their overall effect being secondary to the much stronger hydrophobic forces. an interesting test of anfinsen's hypothesis was done in 1992, when a series of d-amino acids (mirror image of standard l-amino acids) were chemically linked according to the sequence of human immunodeficiency virus (hiv) protease. as expected, this led to a protein that was in every way the mirror image of the native hiv protease: it cleaved mirror image substrates with the same specificity, it bound mirror image inhibitors with the same affinity, achiral physicochemical measurements were the same, and chiral ones were of the opposite sign. this section on protein folding in vitro concludes with the observation that the types of conformations shown in figure 4 are prone to aggregation, as depicted in figure 5. when hydrophobic elements are exposed on the surface of a protein, they may interact with hydrophobic elements of other proteins to escape the aqueous environment. when multiple such surface-exposed hydrophobic elements are present, the potential exists for protein aggregation, forming insoluble aggregates that are often toxic to cells. protein folding in vivo is quite different from that in vitro. for medium- to large-sized proteins it occurs much faster than one might expect, typically in the range of milliseconds to seconds. it takes place in the crowded internal environment of the cell, where many intermolecular interactions could potentially disrupt the normal protein folding pathway. protein folding in vivo is facilitated by chaperones, also known as hsps or stress proteins. hsps were first isolated in 1975 by lindquist et al .. the first speculation about the function of hsps evidently was published in 1986 by pelham in a breathtaking leap of insight. he had found that the heat-shocked nucleoli recovered more rapidly after overexpression of hsp70 in an atp-dependent manner. pelham's model proposes that during heat shock, proteins become partially denatured, exposing hydrophobic regions which then interact to form insoluble aggregates. by binding tightly to hydrophobic surfaces, hsp70 limits such interactions and promotes disaggregation. the term the proportion of proteins that spontaneously fold in the cell is thought to be approximately 10%; the rest rely on chaperoned folding. chaperones are highly conserved, being present in prokaryotes and eukaryotes, and, as i will note below, are important for the folding of the equally conserved oncogenes and tumor suppressor genes. chaperones are ubiquitous and up-regulated in response to a variety of cell stresses, such as heat, mutations, heavy metals, etc. chaperones constitute 1%2% of the total weight of proteins in a cell, and they range in size from the 1530 kda small hsps, to the over 100-kda hsp100/cip family., one can think of them as converting a rugged protein folding funnel into a smooth one, eliminating kinetic traps and speeding up achievement of the thermodynamic optimum. this leads to a profound proposition concerning the role of hsps in cellular evolution, namely that hsps act as a buffer, hiding the natural phenotypic variations present in cells, which are unmasked in response to stress. in this view, hsps expedite the cell ' s ability to evolve in response to stress. for example, hsp70 overexpression has been shown to correlate with certain types of drug resistance, as a response to the stress of drug therapy. hsps act as a buffer in four stages (figure 6): (1) as the nascent polypeptide chain emerges from the ribosome, chaperones protect it from premature folding; (2) the polypeptide chain acquires the approximate overall 3d conformation; (3) the polypeptide chain iteratively folds and re-folds in a confined cage until the final 3d conformation is achieved. in addition, it may make sense to describe a fourth category; and (4) chaperones unfold a misfolded and/or aggregated protein. misfolded proteins that can not be properly folded are marked for degradation, the topic of the next section. (1) in bacteria, a chaperone called the trigger factor (tf) is found proximal to the ribosome and protects the nascent chain from premature folding. in eukaryotes, the homologous factor is the ribosome-associated complex (rac), sometimes in association with nascent chain-associated complex (nac). the protection is a necessary step, as ribosomal synthesis occurs at a rate of about 10 residues/sec, whereas the rate of folding in vitro is 10 residues/microsec. (2) in eukaryotes, as the full protein is released from the ribosome, hsp40 and hsp70 assist in ensuring the overall 3d conformation is approximately achieved. (3) the final stage of folding occurs iteratively, in which the partially-folded protein interacts with a chaperone and is then released. one way this is accomplished is by the pre-folded protein entering the cavity of barrel-shaped complexes termed groes/groel in bacteria and tric/cct in eukaryotes (figure 7). this creates a protected environment in which the protein can properly fold in a way that may be understood conceptually as an anfinsen cage, where the compact environment limits the range of possible extended conformations that may be sampled. another path in this final stage of folding is via interactions with hsp90, a dimeric protein with each monomer containing three regions: an n-terminal atp-binding domain, a linker, and a c-terminal dimerization domain (figure 8). the precise nature of hsp90 interactions with a pre-folded protein has not been resolved. (4) members of the hsp100/cip family of chaperones appear to interact with misfolded and/or aggregated protein, in effect undoing the damage. as part of a broad network of chaperones, they appear to be able to disassemble stable complexes; to unfold highly stable native protein domains; and to help to resolubilize and refold non-native proteins trapped in a high molecular weight aggregate. the function of hsp104 has been described as a molecular crowbar: it functions by prying apart aggregates. hsp104, which has multiple binding sites, can bind multiple components within the same aggregate. the hsp104 domains that contact the aggregate undergo an atp-driven conformational change that separates or further unfolds the misfolded aggregates and then releases them. newly exposed hydrophobic elements, shielded by chaperones such as hsp70 and hsp40, are transiently protected from reaggregation. hsp104 acts iteratively, eventually resulting in the release of hsp70-bound folding intermediates that have a renewed opportunity to proceed to the native state. from the perspective of identifying novel drug targets for cancer, this multiplicity of hsps throughout protein folding provides many opportunities for modulating these stages of folding with therapeutic agents. agents targeting hsp90 have been tested in phase iii clinical trials, whereas hsp70 is still in basic research phase. there are seemingly endless variations on the overall protein-folding processes as outlined above. transporting the protein across membranes may require one pre-folded conformation; final folding then occurs after the protein is in the target organelle (e.g. the endoplasmic reticulum). exemplified by estrogen receptor, final folding occurs only when that protein is in complex with hsp90 and other factors, and its ligand, progesterone (figure 9). hsp90 forms complexes with many distinct factors, probably explaining its ability to assist the folding of a huge variety of proteins, such as p53. the previous sections discussed the processes by which proteins are created, and acquire their functional 3d structure. once it became clear that proteins constantly turn over, with degradation occurring rapidly, specifically, and in an atp-dependent manner, attention focused on the processes of protein degradation. this ultimately led to the isolation of a cell-free system for atp-dependent proteolysis in 1978, now called the ubiquitin-proteasome system (ups), which is responsible for most proteolysis in the cell. attention was drawn to the ups as a cancer drug target by the 2003 approval of the proteosome inhibitor velcade/bortemozib for multiple myeloma. one year later, the discovery of the ups was rewarded by the nobel prize to ciechanover, hershko, and rose; their lectures represent a concise introduction to this system. the proteolytic machinery of the ups is comprised of the proteosome, a 2.5-mda multicomponent system consisting of a barrel-shaped 20s catalytic core particle with a 19s regulatory particle capping both sides of the core particle (figure 10). a protein tagged with a poly-ubiquitin tail is recognized by the proteosome and unfolded near the cap, with proteolysis occurring deeply within the core particle. tagging for protein degradation is accomplished in a series of steps, ultimately resulting in a poly-ubiquitin sequence tag covalently attached to a lysine of the substrate protein. this pathway, summarized in figure 11, involves a series of enzymes: e1 (ubiquitin-activating enzyme), e2 (ubiquitin-conjugating enzyme), and e3 (ubiquitin-protein ligase). step 2 uses the e1-ubiquitin complex, e2, e3, and s (the substrate protein to be tagged for degradation), to form the complex ubi.e2.e3.s. step 4 cleaves this poly-ubiquitinated complex to form the final tagged substrate, recognized by the proteosome. the ups is also becoming recognized as an important component that is involved in biological processes which are related to a variety of disorders with cancer-related phenotypes. one example is von-hippel-lindau (vhl) syndrome, which is a rare autosomal-dominant condition with hemangioblastomas in the kidneys, retina, cerebellum, and spinal cord, resulting from a mutation in the vhl tumor suppressor gene. the mechanism by which vhl gene functions involves the ups, whereby the protein product of this gene interacts with the hypoxia-inducible factor-1 (hif-1) in response to the cell stress of insufficient oxygen (hypoxia). under normal conditions, in the presence of oxygen, hif-1 is synthesized, rapidly converted into a form which is recognized by pvhl (the protein product of the vhl gene), and subjected to ubiquitination and proteosomal degradation, with an overall half-life of 10 min. under hypoxic conditions, hif-1 remains in a form not recognized by pvhl, and hence is not degraded. thus hif-1 is free to promote transcription of genes such as vascular endothelial growth factor (vegf), a feedback signaling factor that promotes vascularization to facilitate the return to normal conditions (figure 12). another point of interest about pvhl degradation is that chaperones can be involved: e.g. chaperone hsp90 is not involved in vhl folding but is essential for its degradation. this is an intriguing example of where chaperones are involved in the degradation process rather than the protein folding process; and, here, degradation of a protein involved in a disease is associated with cancer formation, and links proteostasis with cancer and with chaperones in particular. the ups also plays a key role in regulating cellular levels of p53, with a half-life of only 20 min in normal cells. p53 is the protein which functions as the guardian of the genome, and is mutated in over half of all cancers. in response to dna damage stress such as ultraviolet radiation, p53 levels rise and cells are driven to apoptosis (programmed cell death). p53 acts as a transcription factor that induces the expression of many genes, one of which is mdm2, that codes for a protein mdm2 that shepherds translocation of p53 from the nucleus to the ups for degradation. this feedback loop has a transcriptional delay that ensures a brief burst of elevated p53 levels in response to stress. a final point on the ups is that misfolded proteins are subjected to a higher rate of degradation than are normal proteins, but these recognition processes are incompletely understood. how the cell distinguishes properly-folded proteins from misfolded ones, given its complexity, is an intellectually fascinating puzzle. it is difficult to even imagine all the types of molecular recognition processes that must be involved to maintain a careful balance. we recently have been reminded all cancers arise as a result of changes that have occurred in the dna sequence of the genomes of cancer cells. an alternative, and perhaps an important addition, to this hypothesis would be to consider and focus on the dynamic cellular processes centered on the proteome, and the process of proteostasis outlined above. the links between chaperones and cancer were first identified almost 30 years ago, and the evidence continues to grow, indicating that chaperones and protein homeostasis likely play an important role in cancer formation, and thus, present multiple opportunities for therapeutic intervention. in 1981, shortly after the discovery of oncogenes, researchers observed that hsps co-immunoprecipitated with the src oncogene. the authors concluded it would also seem wise to search for other overlaps between the heat shock response and virus-induced neoplastic transformation a dramatic leap forward occurred in 1994 when whitesell et al. identified the mechanism of geldanamycin-induced reversal of the neoplastic transformation as inhibition of hsp90. many hsp90 inhibitors are now undergoing evaluation in clinical trials. the 2003 approval of the proteosome inhibitor velcade/bortemozib for multiple myeloma further supports the ups as a cancer drug target. is replete with well-known oncogenes and tumor suppressor genes: src, akt, bcr-abl, etc. hsp90 levels often are higher in cancer cells than in normal cells, and hsp expression in breast or gastric cancer is associated with poor prognosis and resistance to chemotherapy or radiotherapy. the connections between the hemangioblastomas of vhl syndrome and hsp90 's involvement in pvhl degradation were mentioned above. other hsps are also suspected to be involved in cancer formation: e.g. down-regulation of hsp70 has been shown to increase apoptosis in cancer cells, while leave normal cells unaffected which raises an intriguing idea of considering hsp70 as a potential cancer-specific target. mdm2, mentioned above as a protein involved in p53 degradation, is one example: inhibitors (nutlins) of the p53/mdm2 interaction were reported in 2004 to shrink tumors in xenograft models. nedd8 is another protein involved in the ups; inhibitors of the enzyme which activates nedd8 were recently found to be effective in suppressing the growth of human tumor xenografts in mice. the homeostatic regulation of p53 illuminates how the dual processes of protein synthesis/folding and protein degradation may be directly connected to neoplastic transformation. the 20-min half-life of p53 in the cell is unusually short and its levels, regulated by proteostasis, rise very quickly in response to stressors even though its mrna levels remain constant. mutations in p53 gene are found in 30%50% of all cancers, and the mutations predominate in a particular class, i.e. point mutations in its dna-binding domain. chaperoned folding of p53 is especially complex, involving a variety of co-chaperones. cancer cells, even those homozygous for mutations in p53, often have high levels of p53, which may facilitate a variety of mutation-induced mechanisms to run amok. in this regard, application of hsp90 inhibitors has been demonstrated to lower p53 levels and induce apoptosis. in 1994, whitesell et al. identified the mechanism of geldanamycin-induced reversal of the neoplastic transformation as inhibition of hsp90. in 1998, taking these two findings together, whitesell and lindquist have proposed a novel theory of cancer, centered on the role of chaperones. hsp90 can conceal inherent genetic variation within populations of cells, allowing polymorphic variants of crucial signaling pathways to accumulate cryptically while the overall normal phenotype is maintained. this buffering capacity of hsp90 funnels complex developmental processes into discrete outcomes despite underlying genotypic variations. under stress, some of the unstable hsp90 clients may become more unstable, increasing the demand for hsp90 to facilitate refolding of its usual clients and that of these new stress-destabilized proteins. new phenotypes can emerge when this buffering capacity of hsp90 is exceeded, exposing previously hidden genetic variations to natural selection. in cancer, hsp90 might function as a buffer of the extensive genetic heterogeneity common to cancer. furthermore, whitesell and lindquist explain hsp90 has a more complex role in facilitating neoplastic transformation than simply inhibiting apoptosis. the dynamic, low-affinity interactions of hsp90 with its client proteins such as hormone receptors, transcription factors and kinases maintain them in a latent but readily activated state. oncogenic mutation of such clients, however, leads to higher requirements for hsp90 function, presumably because of an exaggerated conformational instability of the mutant. molecular targetingusing genetic information that links specific proteins to cancer has led to one spectacular success: novartis ' gleevec is effective against cml, a disease linked to the philadelphia chromosome with a frequency exceeding 95%. approved in 2001 to much justifiable acclaim, gleevec promised to be a harbinger of a new wave of molecularly-targeted therapeutics the magic bullet for cml, designed to inhibit the tyrosine kinase bcr-abl, the oncogene activated via the philadelphia chromosome. even oncology researchers at novartis now conclude that gleevec may be more an outlier than a standard-bearer for the next wave of therapy. gleevec is the great exception; most new chemotherapies could be considered to be neocytotoxics, an unflattering reference to their tendency to show unacceptable toxicity at therapeutic doses (i.e. they have a marginal therapeutic index). chemotherapy for cancer has the highest attrition rate of any therapeutic area: fewer than 10% of drug candidates entering phase i trials are ultimately approved for commercial use. fallout in the clinic is primarily due to drug toxicities, i.e. their inability to achieve an advantageous therapeutic index. if we are to make significant progress against cancer, we need to move beyond developing more neocytotoxics. the standard paradigm often leads to drug candidates that inhibit rapidly dividing cells, which hits both cancer cells and the rapidly dividing cells of the epithelia, leading to the harsh side-effects of chemotherapy. this approach naturally leads to a low therapeutic index and the duration of efficacy is frequently only 612 months, as cancer cells appear to evolve in response to the selection pressure of the drug. whitesell and lindquist clearly recognized the implications of the theory of cancer: such an evolutionary view of the malignant progression problem suggests that definitive control of a cancer will probably be achieved most effectively by altering the key determinants that shape its ability to adapt and evolve. consequently, hsp90 might provide a broader, more effective target for anticancer therapies than single, oncogenically activated but dispensable signaling pathways that are the focus of most current drug-discovery efforts. this is a very provocative suggestion saying that the key to controlling cancer is to modulate a cell's ability to evolve. this is a testable hypothesis, and one that, if true, would significantly alter our approach towards the discovery and development of chemotherapeutic agents. that cancer cells are hyper-evolving may also explain the difficulty in finding chemotherapies whose effectiveness extends beyond 612 months: cancer cells may be evolving away from the selection pressure of a drug. appreciating the role of proteostasis in the cell, including the role of chaperones in facilitating proper protein folding and the role of the ups in protein degradation, yields a novel perspective on cancer, which focuses on the dynamic state of the proteome and the evolving phenotypes of cancer cells. research on this proteostasis network has yielded one approved drug, with many others undergoing clinical evaluation. we may well be in the early days of fully exploiting protein folding and proteostasis to devise better cancer chemotherapeutic agents. there are many outstanding questions in this area, the subjects of much current researches: how do chaperones recognize improperly folded proteins? what is the precise mechanism by which hsp90 inhibition by geldanamycin diminishes p53 levels? (hsp70, from early studies, certainly seems of potential interest.) of all possible intervention points in the proteostasis network, which are best for chemotherapy? which have sites most amenable to inhibition by an orally-available small molecule? which will provide the best therapy with the least toxicity? what are the full implications of the notion of hsps ' buffering evolutionary change? how can this hypothesis be properly evaluated as a theory of the origin of cancer? what is the precise mechanism of the neoplastic transformation, and what roles do chaperones specifically play? understanding protein misfolding and proteostasis should lead to their exploitation in the development of novel and improved cancer chemotherapeutics .

proteins fold into their functional 3-dimensional structures from a linear amino acid sequence. in vitro this process is spontaneous; while in vivo it is orchestrated by a specialized set of proteins, called chaperones. protein folding is an ongoing cellular process, as cellular proteins constantly undergo synthesis and degradation. here emerging links between this process and cancer are reviewed. this perspective both yields insights into the current struggle to develop novel cancer chemotherapeutics and has implications for future chemotherapy discovery.

PMC4013342

pubmed-1075

cellulose, a structural carbohydrate of the plant cell wall, is an abundant and ubiquitous polymer. the use of cellulose for the second generation biofuel production involves the hydrolysis of cellulosic biomass, that is, saccharification, to form simple sugar monomers for the fermentation into bioethanol [13]. cellulases are the group of enzymes involved in the conversion of cellulosic substrates to fermentable sugars. main members of this group include endoglucanase (ec 3.2.1.4), exoglucanase or cellobiohydrolase (ec 3.2.1.91), and -glucosidase (ec 3.2.1.21). the endoglucanase hydrolyzes -1,4 bonds in cellulose molecule, whereas exoglucanase cleaves the ends to release cellobiose, and -glucosidase converts cellobiose to glucose. several cellulase producing fungi such as aspergillus, rhizopus, and trichoderma species [6, 7] and bacteria such as bacillus, clostridium, cellulomonas, thermomonospora, ruminococcus, bacteroides, erwinia, and acetivibrio species [810] have been identified. however, the isolation and characterization of novel cellulose hydrolyzing enzymes from bacteria are still a highly active research area, because bacteria have a higher growth rate than fungi, leading to greater production of enzymes. also, the habitat of bacteria covers different environmental niches, which favors the existence of versatile strains such as thermophiles, psychrophiles, alkaliphiles, and acidophiles. the culturable cellulase producing bacteria have been isolated from the variety of sources such as composting heaps, decaying agricultural wastes, the feces of cow and elephant, gastrointestinal tract of buffalo and horse, soil, and extreme environments like hot-springs. varga and kovler have reported that the feed fibers were not completely converted to animal product in intensive animal farming, and 2070% undigested cellulose was carried out with feces. some studies have explained that the crude fiber degradation in gut is not optimal, and the fiber content of feces is still high, which can be utilized efficiently by microbes present in the feces of the herbivores. rhinoceros are presumed to have an efficient system for cellulose digestion, as its main food wild grass primarily consists of cellulose. in this study, the dung of the pachyderm from kaziranga national park, assam, india, has been used as the source of cellulolytic bacteria. carboxymethylcellulose (cmc) (low viscosity, 50200 cp) was procured from sigma aldrich (st. louis, mo, usa). medium components and congo red (analytical grade) were procured from hi-media pvt. ltd., the dung sample of one-horned indian rhinoceros (rhinoceros unicornis) was collected from its natural habitat, kaziranga national park, assam, india. presterilized spatula and plastic bags were used for sample collection, and before bacterial isolation the samples were stored at 4c in ice box for approximately 12 h. dung sample (0.5 g) was suspended with 50 ml 0.85% (w/v) sterile nacl solution in a 250 ml conical flask, which was shaken at 180 rpm for 1 h at 37c. an aliquot of 100 l of each dilution was spread plated onto bushnell haas medium (bhm) agar plates amended with carboxymethylcellulose (cmc) (ph 7.0) containing (g/l) cmc (10.0), k2hpo4 (1.0), kh2po4 (1.0), mgso47h2o (0.2), nh4no3 (1.0), fecl36h2o (0.05), cacl2 (0.02), and agar (20.0) [19, 20]. the plates were incubated at 37c for 96 h. morphologically dissimilar and discrete colonies were picked from different dilution plates and streaked on separate bhm-cmc plate with grids drawn over it and incubated at 37c for 96 h. the replica plates were also prepared separately for staining. the stain was poured off, and the plates were washed with 1 m nacl. the isolates showing clear zone around the colonies were picked from master plate and further used for the enzyme production in liquid medium. the selected cultures were maintained on nutrient agar slants containing (g/l) peptone (5.0), beef extract (1.0), yeast extract (2.0), nacl (5.0), and agar (20.0). the isolates, selected on the basis of plate staining method, were grown in 50 ml enzyme production medium (at ph 7.0) containing the following components (g/l): cmc (10.0), k2hpo4 (1.0), kh2po4 (1.0), mgso47h2o (0.2), nh4no3 (1.0), fecl36h2o (0.05), cacl2 (0.02), and yeast extract (5.0). this medium is the same as the previously used medium during isolation, with the only difference of addition of yeast extract. 50 ml medium (containing 2% inoculum) was taken in 250 ml erlenmeyer flask and incubated at 37c at 180 rpm for 72 h. after every 6 h, the culture was centrifuged at 12000 g for 20 min at 4c. the cell-free culture broth containing the crude enzyme was used for estimation of cmcase activity. based on the higher cmcase activity (as described later), an isolate ss35 (named after its colony number) was selected for further characterization and identification. the enzyme production by the isolate ss35 was monitored with cell growth at 600 nm using uv-visible spectrophotometer (perkin elmer, model lambda-45). the cmcase activity (u/ml) was measured by estimation of reducing sugars liberated from cmc. the enzyme assay was carried out by incubating the enzyme with cmc for 15 min at 37c. the reaction mixture (100 l) contained 50 l of enzyme and 1.0% (w/v) final concentration of cmc in 50 mm phosphate buffer (ph 7.0). the reducing sugar was estimated by the method of nelson and somogyi [23, 24]. the absorbance was measured at 500 nm using a uv-visible spectrophotometer (perkin elmer, model lambda-45) against a blank with d-glucose as standard. one unit (u) of cellulase activity is defined as the amount of enzyme that liberates 1 mol of reducing sugar (glucose) in 1 min at 37c and ph 7.0. morphological and biochemical properties of the isolate were identified, evaluated, and compared, as described in bergey's manual of systematic bacteriology. the cell morphology of the selected isolate was observed under scanning electron microscope (leo 1430 vp, leo electron microscopy ltd., gram staining, endospore staining, and urease test were done as per standard protocol. the catalase activity was determined adding few drops of 3% (v/v) h2o2 to 5 ml of 18 h grown culture. the nitrate agar slants (m072, himedia) were used to test nitrate reducing property of the isolate ss35. triple sugar iron (tsi) slants (m021i, himedia) containing three sugars, namely, glucose, lactose, and sucrose, were used for acid and h2s production test. acid production after carbohydrate fermentation was detected by the visible change in color from red to yellow. the temperature tolerance test was performed by growing the isolate in nutrient broth and incubating at the temperatures ranging 2050c. 16s rdna and partial gyrase a gene sequencing of bacterial culture were done in xcelris labs limited, ahmedabad, india. the genomic dna of the isolate ss35 was extracted using qiagen dna extraction kit and purified by qiaamp dna purification kit (qiagen) for nucleotide sequence analysis. the universal 16s rdna primer 8f (5 agagtttgatcctggctcag 3) and 1492r (5 acggctaccttgttacgactt 3) were used for amplification of genomic dna by polymerase chain reaction (pcr). the gyra region was amplified using the primers, p-gyra-f (5 cagtcaggaaatgcgtacgtcctt 3) and p-gyra-r (5 caaggtaatgctccaggcattgct 3). the concentration of each primer in 25 l pcr reaction mixture was 10 pmol and 1x pcr master mix (mbi fermentas). the pcr reaction was run for 30 cycles in a thermal cycler (eppendorf), and the thermal profile used for the pcr was as follows: initial denaturation at 95c for 2 min, final denaturation at 94c for 30 s, primer annealing at 52c for 30 s, and extension at 72c for 90 s. full extension of the products was ensured by running a final cycle that included extension for 10 min at 72c. pcr product of 5 l from each tube was mixed with 1 l of 6x gel loading dye, and this mixture was subjected to electrophoresis on 1.2% agarose gel to confirm the targeted pcr amplification. the amplified product was excised from the gel and purified using qiaamp dna purification kit (qiagen). the concentration of the purified dna was determined, and it was subjected to automated dna sequencing on abi 3730xl genetic analyzer (applied biosystems, usa). the cycle sequencing was carried out using bigdye terminator v3.1 cycle sequencing kit following manufacturer's instructions. the cycle sequencing was carried out in a final reaction volume of 20 l using 200 l capacity pcr tube. the cycling protocol was designed for 25 cycles as follows: denaturation at 96c for 10 s, annealing at 52c for 5 s, and extension at 60c for 4 min. after cycling, the extension products were purified and mixed well in 10 l of hi-di formamide. eluted products were placed in a sample plate, heated at 95c for 5 min, chilled, and loaded into autosampler of the instrument. both the ends of the sequences were verified with the chromatogram file, and the resulted consensus sequences were used to carry out basic local alignment search tool (blast) with nr database of ncbi genbank using megablast algorithm. multiple sequence alignment was performed by using clustal w, and evolutionary history was inferred using the neighbor-joining method. the evolutionary distances were computed using the kimura 2-parameters method, and phylogenetic analysis was carried out with mega4. among 36 isolates, 9 cellulose hydrolyzing microorganisms were screened on the basis of plate staining method. the isolates (no. 21, 24, 25, 28, 31, 32, 34, 35, and 36) showed clear zone around colonies after staining the plates with congo red and destaining with 1 m nacl as shown in figure 1. however, plate-screening method is not quantitative because of poor correlation between enzyme activity and colony to clear zone ratio. the colonies showing yellow-colored halo zones were picked from replica plate and further screened on the basis of cmcase production in liquid medium. out of 9 isolates, isolate no. 35 exhibited maximum cmcase activity of 0.079 u/ml (details given in table 1). this value was higher than activity of cmcase produced from some known natural isolates (expressed per ml of cell-free culture broth), for example, cellulomonas sp. (0.0336 u/ml, isolated from coir retting effluents), micrococcus sp. (0.0152 u/ml, isolated from coir retting effluents), bacillus sp. (0.0197 u/ml, isolated from coir retting effluents), brevibacillus sp. jxl (0.02 u/ml, isolated from swine waste), brevibacillus sp. duselg12 (0.02 u/ml, isolated from gold mine), geobacillus sp. duselr7 (0.058 u/ml, isolated from gold mine), geobacillus sp. (0.0113 u/ml, isolated from sugar refinery wastewater), and bacillus subtilis as3 (0.07 u/ml, isolated from cow dung) [3337]. have reported maximum cmcase activity of 0.079 u/ml by bacillus pumilus eb3 produced in a 2 l stirred tank reactor, which was equal to the cmcase activity of the isolate in this study. 35 was revealed to be an efficient cmcase producer species and was designated as ss35. the growth curve of ss35 along with cmcase production profile (figure 2) revealed that the enzyme production was associated with cell growth and reached maximum at late log phase. slight reduction in enzyme production after 48 h could be a consequence of instability of the enzyme at 37c or the activity of proteases present in the crude enzyme solution. the isolate ss35 was found to be rod-shaped cells with a width and length of 0.50.6 m and 1.51.6 m, respectively, as observed under scanning electron microscope (figure 3). the isolate was found to be a gram-positive, spore forming bacterium, and it gave positive test for catalase, nitrate reduction, and starch hydrolysis, whereas negative for urease and hydrogen sulfide production. the absence of black precipitate at the base of the tube indicated that hydrogen sulfide was not produced. the color of tsi agar slant was turned from red to yellow, which indicated that the bacterium was able to ferment the sugars glucose, lactose, and sucrose. the temperature tolerance test revealed that the isolate was able to grow at a wide temperature range 2050c. the phylogenetic tree generated using 16s rdna gene sequences of the isolate ss35 showed that the bacterium has the highest homology with bacillus amyloliquefaciens ab679994.1) (figure 4). the bacterial identification using 16s rdna gene sequence is a widely practiced technique, although with limitations for the members of closely related taxa. to overcome this limitation, several studies have been done, which concluded that some protein-coding genes such as rna polymerase (rpob) gene, rna polymerase sigma factor (rpod) gene, gyrase b (gyrb) gene, and gyrase a (gyra) gene can be used for the identification of closely related taxa, because the genetic variation in protein-coding genes are much higher. chun and bae demonstrated that the gyra sequences, code for dna gyrase subunit a, can be used for accurate identification of bacillus amyloliquefaciens and related taxa including bacillus subtilis, bacillus vallismortis, bacillus mojavensis, bacillus atrophaeus, and bacillus licheniformis. therefore, in this study partial gyra gene sequences have been used for the confirmation of the result obtained from 16s rdna sequence analysis. the phylogenetic analysis using partial gyra gene sequences also revealed that the isolate ss35 has the highest homology with bacillus amyloliquefaciens fzb45 (genbank accession no.: fn662840.1), as shown in figure 5. numbers at nodes of the tree are indications of the levels of bootstrap support based on a neighbor-joining analysis of 1,500 resampled datasets. the 16s rdna and gyra gene sequences of the isolate b. amyloliquefaciens ss35 have been deposited in the ncbi nucleotide sequence database under the accession nos. cellulose hydrolytic bacteria have been isolated from rhinoceros dung, and some potent cellulose degrading bacteria have been identified. among all cellulolytic bacteria, bacterium has been identified as bacillus amyloliquefaciens ss35 on the basis of 16s rdna and partial gyrase a gene sequence analyses. the cmcase production has been observed to be associated with cell growth and has maxima at the late exponential phase of growth. optimization of medium composition and fermentation parameters can further increase the cellulase production from b. amyloliquefaciens ss35. these attributes also make b. amyloliquefaciens ss35 a potential candidate in solid state fermentation for cmcase production using cellulosic biomass.

cellulose hydrolyzing bacteria were isolated from rhinoceros dung and tested for clear zone formation around the colonies on the agar plates containing the medium amended with carboxymethylcellulose as a sole carbon source. isolates were further screened on the basis of carboxymethylcellulase production in liquid medium. out of 36 isolates, isolate no. 35 exhibited maximum enzyme activity of 0.079 u/ml and was selected for further identification by using conventional biochemical tests and phylogenetic analyses. this was a gram-positive, spore forming bacterium with rod-shaped cells. the isolate was identified as bacillus amyloliquefaciens ss35 based on nucleotide homology and phylogenetic analysis using 16s rdna and gyrase a gene sequences.

PMC3676922

pubmed-1076

maintenance of motion following arthroplasty can be hindered by the development of heterotopic ossification (ho), whose causes remain uncertain.1,2,3,4,5 whether the formation of ho following cervical disc arthroplasty is of clinical or functional importance is also unknown. the aims of this study are to investigate the rate of ho at a longer follow-up (mean 3 years), to determine if the presence of ho negatively affects functional outcome and to identify factors that may precipitate the formation of ho following cervical disc arthroplasty. what is the incidence of ho following cervical arthroplasty? does the development of ho negatively influence the clinical outcome in patients receiving arthroplasty? inclusion criteria: patients suffering from radiculopathy, myelopathy or myeloradiculopathy secondary to soft disc hernia and/or mild degree spondylosis operated between october 2004 and december 2006. 1) thirty-nine patients suffering from cervical radiculopathy and/or myelopathy treated with anterior disc replacement (adr) were selected. nine patients were excluded from this analysis because of insufficient outcome data at different time intervals (n=7) or were not available for follow-up (n=2). outcomes and analysis evidence of ho using the mcafee grading system6 (table 1). rom was calculated by using two lines parallel to the prodisc-c keels, or to the endplates of the prestige lp, and measuring the intervening angle in flexion and extension on lateral radiographs. lordosis was assigned a negative value and kyphosis a positive one; the difference between the two values gave the final rom. ct scan on patients with grade two or higher ho to assess localization of ho. a comparison of scores was made between those who developed ho and those who did not using a two-sided student t-test. all images were independently reviewed by both a radiologist and a neurosurgeon not directly involved in the surgical procedures. forty-five disc prostheses (seven prestige-lp and 38 prodisc-c) were implanted in 30 patients (18 males) ranging in age from 2863 years (mean age 40.9). the underlying disease included radiculopathy (n=13), myelopathy (n=4) or myeloradiculopathy (n=13), secondary to soft-disc hernia (n=17), spondylosis (n=8) or a combination of disc hernia and spondylosis (n=5). nineteen patients received one-level disc replacement, seven patients received two-level and four patients received three level disc replacement. the following distribution of prostheses/level was recorded: c34:5; c45:4; c56:23; c67:13 (table 2). the incidence rate of ho using the number of prostheses as the denominator was 42.2% (19 levels in 16 patients, fig. the risk of a patient developing ho after receiving one or more prostheses was 53.3% (16/30). ten patients showed progressive ossification over time: in six patients de novo ho was demonstrated at 2346 months (mean 33.3) postoperatively (figs. 2, 3). among the 16 patients with ho, 15 (93.8%) demonstrated a range of motion 3 (fig. comparison of pre- and postoperative sf-36 and ndi scores revealed functional improvement from baseline to follow-up at 3, 6, 12, 18, 24, and 36 months. there was no significant difference in functional scores between those who did and those who did not develop ho, p>.05 (fig. risks and relative risks by factor related to patient characteristics associated with ho formation were analyzed: males tended to develop ho more than females (twice as likely), though this did not reach statistical significance (table 3). no patients required revision surgery for adjacent segment disease or persisting/recurrent symptoms. patient population and intervention double-level arthroplasty with prodisc-c at c56 and c67. absence of ho at 1 month after surgery (left), presence of grade two ho 1 year postoperatively (middle) and of grade three ho (right) 3 years postoperatively, respectively. note the progression of ho at the c45 disc space at 1 month (left), 12 (middle) and 48 (right) months, respectively, postoperatively (arrow). flexion and extension x-rays (same patient as in fig 3) showing mobile disc prostheses at 48-months follow-up despite the presence of heterotopic ossification. our rate of grade two and three ho (42.2%) is consistent with that previously reported.7 it is higher than in other series8,9 but lower than sola's et al.10 ho is prevalent on the anterolateral surface of vertebral bodies (fig. strengths: this study reports 3 years mean follow-up data, to date the longest available. for all included patients complete follow-up data are available. furthermore, we have shown that a delayed progression, or de novo onset, of ho is possible. limitations: this study was not conducted prospectively and is based on a relatively small albeit consecutive sample size. lack of potential prognostic factors available for analysis and a 77% follow-up rate are further limitations. a longer follow-up is necessary to assess whether arthroplasty can reach the goal of maintaining motion and if development of high-grade ho at the target level infers an increased risk of adjacent segment degeneration. clinical and functional improvement following cervical disc arthroplasty is maintained despite the presence of ho. preventative measures such as prophylactic nonsteroidal medications, local application of bone wax or intentional early range of motion measures were not routinely utilized in our study. while these are interesting factors, axial ct scan showing the presence of laterally sited ho (arrows) at c45 level (a) and at c67 level (b) number of ossified levels and stratification for mcafee ossification grades (ho: heterotopic ossification) differences of pre- and postoperative functional outcome in the two groups disc replacement offers a new interventional option and long-term data on the potential complications to artificial disc replacement compared with fusion are very much needed. this prospective study's contribution to the literature regarding heterotopic ossification (ho) following cervical arthroplasty is appreciated. as the authors note, the causes of ho in disc arthroplasty remain unclear and are probably multifactorial. ho frequency: the authors report a ho rate of 42% following artificial disc replacement in 32 patients, a higher overall rate than is reported in most other studies. ho rates in the may 2008 ebss special edition on cervical arthroplasty were summarized as follows: there were no ho cases reported in two rcts, with follow-up of 24 months in one study and other being a preliminary report with most patients having only 12-months follow-up. ho was, however, common in two case series with one reporting an overall 18% rate or 7% cases when restricted to grades iii or iv. the other series of patients with 1, 2, or 3 level disease reported that 8% of segments had grade i, 39% of segments had grade ii, 10% had ho leading to restricted movement and 9% experienced spontaneous fusion. there are several factors which may partially explain discrepancies in ho rates across studies, aside from differences in length of follow-up. it is possible that increased attention to radiographic detail may go hand in hand with increased reporting. grading the severity of ho is not an exact science. there is some subjectivity which may translate into difficulty in distinguishing between adjacent grades (eg, between grades 2 and 3) and overlap in classification. the grading of ho has so far not been subjected to inter- and intra-observer reliability evaluation and is not known to correlate with any health-related quality of life (hrqol) outcomes measures. study specifications and protocols: use of structured measures and protocols in a prospective study, which are consistently applied to all patients, is important to decrease study bias. while the authors suggest that structured protocols were used, no details were provided. reporting detail about protocols assists in determining the extent to which various factors may or may not have influenced the results. for studies of ho, important protocol details should include whether or not bone waxing was done at the osteotomy site as well as specifics for radiographic measurements and use of antiinflammatory medications. it is unclear whether early initiation of range of motion creates an inflammatory response which contributes to ho formation or if it facilitates functional outcome. strengths: the use of validated outcomes measures (ndi and sf-36) is commendable as is the authors ' acknowledgment of small sample size and a relatively low follow-up rate (77%) as study limitations .

study design: retrospective cohort study. objective: to analyze the presence and clinical relevance of heterotopic ossification (ho) at 3 years mean follow-up. methods: thirty patients suffering from cervical radiculopathy and/or myelopathy treated with anterior disc replacement (adr) were studied. ho was classified using the mcafee grading system. range of motion was measured from flexion and extension x-rays. short-form 36 and neck disability index (ndi) assessed functional outcome. results: forty-five prostheses were implanted in 30 patients with cervical radiculopathy and/or myelopathy, mean age 40.9 years. nineteen patients received 1 level and 11 patients received multilevel disc replacement. the incidence rate of ho was 42.2% (19 levels). segmental range of motion was 3 in 93.8% of patients with ho. there was no significant difference in functional scores between those who did and those who did not develop ho. males tended to develop ho more frequently than females, though this was not statistically significant. the indication for surgery (soft disc hernia or spondylosis) was not associated with the formation of ho. conclusions: functional improvement is maintained despite the presence of ho following cervical disc arthroplasty. indications for arthroplasty should not be halted by the risk of ho. methods evaluation and class of evidence (coe)methodological principle: study design: prospective cohort retrospective cohort case-control case seriesmethods patients at similar point in course of treatment follow-up 85% similarity of treatment protocols for patient groups patients followed for long enough for outcomes to occur control for extraneous risk factors*evidence class: iii*authors must provide a description of robust baseline characteristics, and control for those that are potential prognostic factors.the definiton of the different classes of evidence is available on page 83.

PMC3609005

pubmed-1077

maternal diabetes during pregnancy, also called gestational diabetes mellitus (gdm), is an important risk factor for foetal overgrowth, termed macrosomia, which is influenced by maternal hyperglycemia and endocrine status through placental circulation. in humans, macrosomia has generally been defined as a birth weight greater than or equal to the 90th percentile birth weight for gestational age, that is, infants who weigh>4000 g at delivery, regardless of gestational age or sex [24]. infants born to diabetic mothers are at an increased risk for hypoglycaemia, respiratory distress syndrome, hyperbilirubinemia, and hypertrophic cardiomyopathy. it seems that maternal hyperglycaemia leads to foetal hyperglycaemia, which stimulates foetal pancreatic islet cells and, consequently, induces foetal hyperinsulinaemia. moreover, there exists a correlationship between maternal and foetal plasma cholesterol levels in 5-6-month-old human foetuses [5, 6]. it is noteworthy that several alterations in the metabolism of carbohydrates and lipids, observed in newborn babies of diabetic mothers, also persist postnatally [79]. it is possible that foetal hyperinsulinaemia may be an endogenous teratogen factor during critical periods of foetal development, leading to permanent structural or functional changes and consequent programming of metabolic memory. hyperinsulinemia in utero may affect the induction and activity of various hepatic enzymes associated with fat and carbohydrate metabolism. this phenomenon may be accompanied, in placenta, by modifications in the expression of the transcriptional factors such as sterol regulatory element binding protein-1c (srebp-1c), known to induce expression of genes involved in lipogenesis. in 1995, barker proposed that disproportionate foetal growth induced by foetal malnutrition, which could happen either in the middle or in a later period of the gestation, programmed coronary diseases in adulthood. the in utero programming seems to create a kind of metabolic memory as the physiological abnormalities, observed during the gestational period, are responsible for the induction of diseases associated with the metabolic syndrome such as type 2 diabetes (t2d) and obesity in adulthood. indeed, in human gdm, there exists a correlationship between gdm and 6-month-old foetal plasma cholesterol levels and other abnormal lipid parameters, including high concentrations of triglycerides (tag), apob100, very-low-density lipoprotein (vldl), and low-density lipoprotein (ldl), which often persist in macrosomia. leptin, an adipocyte-derived hormone, by decreasing food intake and increasing energy expenditure, stabilizes body adiposity. a transient increase in leptin during neonatal life, called neonatal leptin surge, has been shown to exert a neurotrophic effect and the development of energy-regulation circuits in mouse hypothalamus. furthermore, experimental premature leptin surge from day 5.5 to day 10.5 of life in mice pups led to decreased hypothalamic leptin sensitivity and accelerated weight gain when pups were fed a high-fat diet. in healthy women, both maternal and foetal leptin concentrations reference reported that leptin levels were always higher in overweight than in normal weight newborns, and plasma leptin level was correlated with birth weight. hence, it is conceivable that foetal leptin plays a role in in utero programming. in utero nutritional environment epigenetic regulation is mediated by methylation and acetylation of histones. as far as foetal nutrition is concerned, it has been reported that dietary methyl-group intake (choline, methionine, and folate) during critical periods of development can alter dna and histone methylation which may result in lifelong changes in gene expression. hence, these epigenetic mechanisms might contribute to the development of macrosomia and its related adulthood pathologies such as obesity and t2d. growth factors might be implicated in gdm and in the pathology of macrosomia via materno-foeto-placental axis. we have conducted a clinical study in which we have determined circulating growth factors and the expressions of their genes in placenta in gdm mothers and their macrosomic babies. we observed that serum concentrations of igf-i, igf-bp3, egf, fgf-2, and pdgf-b were higher in gdm dames and their macrosomic babies as compared to their respective controls. besides, the placental expression of the mrna of growth factors (fgf-2 or pdgf-b) and growth factor receptors, that is, igf-ir, egfr, and pdgfr-beta, was upregulated in gdm women compared to controls. the immune system is composed of two major subdivisions, the innate (phagocytic cells and nk cells) and adaptive immune responses. though the interactions between innate and adaptive immunity are complex, the innate mechanisms control both the initiation and the type of adaptive response (th1/th2). it has been shown that the abnormalities in humoral and cell-mediated immunity in t1d females may persist during pregnancy and, hence, may complicate immune-foetal interaction. though pancreatic autoimmunity does not seem to represent a typical marker of gdm, high prevalence of autoantibodies, such as anti-gad65 and anti-ia2 antibodies, has been observed in gdm subjects. on the contrary, it has been reported that foetal exposure to maternal t2d protects offspring, during the first 2 decades of life, from the development of islet autoimmunity and diabetes in the later life. this is explained by the fact that the immune systems of children receiving autoantibodies from their diabetic mothers are primed during foetal life. such priming is demonstrated by an increase in mhc class ii positive lymphocytes in infants of diabetic mothers compared to controls. with regard to t-cell activation, fully activated t-cells are detected in the cord blood of infants and mothers with t1d, but not in infants from normal mothers. have reported a decrease in t-cell proliferation, associated with a decrease of plasma levels of il-2 in the offspring of diabetic mothers, as compared to those of control mothers. also, in rat model, probably because of their priming, ex vivo t-cell proliferation is significantly lower in diabetic pregnant rats and their macrosomic offspring, as compared to control animals. this phenomenon may trigger a decrease in the number of circulating and thymus homing t-cells. in addition, the number of t- and b-cells in the neonates of diabetic mothers was significantly decreased compared to the neonates of healthy mothers. reported an increase in the number of lymphocytes but a decrease in natural killer (nk) subset in children from gdm mothers. another alteration in lymphocyte subset pattern is observed in gdm mothers, who had high number of cd8 cells, expressing tcr gamma/delta, and low number of cd3 cells, expressing tcr alpha/beta. also, infants born to gdm women had higher cd8 gamma/delta cells than control babies. this immunological imbalance may correlate with a greater risk for developing t1d, later in life. t helper (th) dichotomy in gdm and macrosomia has not yet been well explored. on the basis of production of cytokines, th cells can be classified into two principal populations, th1 and th2 (figure 1). th1 cells support cell-mediated immunity and, as a consequence, promote inflammation, cytotoxicity, and delayed-type hypersensitivity, whereas th2 cells support humoral immunity and downregulate the inflammatory actions of th1 cells. th1 cells secrete il-2, ifn-, and tnf- while th2 cells secrete il-4, il-5, il-6, il-10, and il-13. analysis of t-cell markers in placenta showed an increase in t-cell infiltration that expresses gata3, a marker of th2 phenotype, in placenta of gdm women. concerning experimental models of gdm, we would like to mention that we have developed a model by administrating streptozotocin (stz) to wistar female rats [2, 9]. we confirmed in this model a decrease in th1 cells, as observed in human gdm. furthermore, in gdm rat, the decrease in circulating ifn- was accompanied with an increase in il-10 (th2 marker) levels, as compared to control rats [34, 35]., the shift from the th1 phenotype to the th2, during pregnancy, has been shown to encourage vigorous production of antibodies which not only combat infections during pregnancy, but also offer passive immunity to foetus. a low th1 profile in diabetic pregnant rats, associated with successful pregnancy, may also result from the elevated levels of reproductive hormones like human chorionic gonadotrophin (hcg) hormone, whose administration is known to diminish the production of the th1 cytokines. in rats, the upregulated th1 profile in macrosomic animals may be due to difference in physiological status between gdm dames and their offspring. a study conducted on tunisian women with gdm and their macrosomic babies corroborates these experimental observations. indeed, the comparison of th1/th2 ratio showed an increase in the th2 phenotype in gdm mothers, whereas an increase in th1 phenotype was observed in macrosomic infants. the regulatory t (t-reg) cells represent a specialized population of t-cells (cd4cd25), known for their properties as potent suppressors of inflammatory responses and for their ability to mediate immune tolerance. t-reg cells induce immune tolerance throughout the production of two immunosuppressive cytokines: tgf- and il-10. both in humans and in mice, t-regs cells increase very early in pregnancy, a period which coincides with an intense vascular activity. the importance of t-reg cells in the success of pregnancy was demonstrated by aluvihare et al. who reported that adoptive transfer of t-lymphocytes depleted of t-regs cells into pregnant t-cell-deficient mice led to the rejection of allogeneic foetal units. furthermore, spontaneous abortion cases and patients with recurrent miscarriage are associated with lower systemic t-reg cells compared to normal pregnancies. in kuwaiti women, high number of t-cells expressing the activation-associated hla antigen (cd4hla-dr), memory t-cells, and t-reg cells have been observed during gdm [46, 47]. the frequency of t-reg cells is significantly higher in children born to t1d mothers than in those born to gdm or normal women [48, 49]. indeed, in the case of t1d, the maternal autoimmunity and the transplacental passage of auto-gad antibodies may influence the generation and expansion of foetal t-reg cells, which may suppress the gad65-specific t-cell responses. besides, the t-reg cells of children born to t1d mothers exhibit a more pronounced memory phenotype (increased ccr4 expression and downregulation of cd62l), suggesting an early activation of the foetal immune system, as a consequence of maternal autoimmunity. it seems that the suppressive activity of t-reg cells was significantly reduced in gdm patients when compared to healthy pregnancy. it is noteworthy that obesity-induced insulin resistance is associated with the development of a specialized t-reg population in visceral adipose tissue, called vat resident t-reg. visceral adipose inflammation and insulin resistance have been associated with a dramatic reduction in vat t-reg cells in several animal models of obesity. t-reg cells, by secreting il-10, decrease the inflammatory state of adipose tissue and, thereby, improve insulin resistance. loss-of-function and gain-of-function experiments demonstrated that vat t-reg cells are indispensable to reducing inflammation and increasing insulin sensitivity. hence, the implication of vat resident t-reg cells deserves deep investigations in macrosomia. during t-cell activation, an increase in intracellular free calcium concentrations, [ca]i, is one of the earliest events which is triggered as a result of the hydrolysis of phosphatidylinositol-bisphosphate, catalyzed by the phospholipase c (plc). hence, plc gives rise to inositol trisphosphate, which recruits calcium from endoplasmic reticulum pool, and diacylglycerol which activates the protein kinase c. according to capacitive model of calcium entry, first calcium is released via t-cell receptor (tcr) activation from the endoplasmic reticulum (er) and then it is extruded into the extracellular medium. in turn ionomycin opens calcium channels, leading to calcium influx from extracellular medium and thapsigargin (tg) recruits calcium which belongs to endoplasmic reticulum (er) pool. interestingly, ionomycin-induced increases in [ca]i in t-cells of gdm dames and their macrosomic offspring were greater than those in control rats. in 0% of calcium buffer, tg induces increases in [ca]i exclusively from er pool and no influx occurs in the absence of calcium from the extracellular medium. hence, both in 100% and in 0% calcium media, tg-induced increases in [ca]i in t-cells are higher in gdm dames and macrosomic rats than those in control animals, demonstrating that t-cell calcium signaling is altered in these two pathological situations. tnf- and il-6 represent the main inflammatory cytokines increased in the insulin-resistant states of obesity and t2d [26, 54]. increasing evidence suggests that gdm is a proinflammatory state similarly to t2d. monocyte chemotactic protein-1 (mcp-1) is known to be elevated in inflammatory diseases like arthritis and lupus. the elevation of mcp-1 in the third trimester of gdm suggests an association between inflammation and gdm. besides, it has been suggested that hyperglycaemia and its related oxidative stress are usually associated with increased proinflammatory cytokines production [57, 58]. increased concentrations of tnf- and il-6 might not only diminish insulin sensitivity by suppressing insulin signal transduction, but also interfere with the anti-inflammatory effect of insulin (figure 2) [54, 59]. indeed, insulin exerts its anti-inflammatory effect by decreasing the production of reactive oxygen species (ros) from mononuclear cells and nuclear nf-b translocation. the in vivo administration of insulin not only decreases the severity of t2d, but also diminishes the levels of mcp-1 and c-reactive protein (crp), the two indicators of the inflammatory state. il-6 promotes insulin resistance in liver cells and negatively regulates insulin signaling and glucose metabolism in adipocytes. it has been suggested that the increase in tnf- and il-6 in diabetic conditions might be a result of oxidative stress and inflammatory changes caused by hyperglycaemia. il-6 and tnf- are mainly produced by adipose tissues. indeed, during insulin-resistant state, adipocytes secrete mcp-1 which favors the infiltration of macrophages that, consequently, produce il-6 and tnf- in high quantities (figure 2) [66, 67]. we have reported that tnf- and il-6 are increased in gdm women. during pregnancy, il-6 secretion has been proposed to aggravate insulin resistance and participates in the pathogenesis of gdm. adipocytes secrete a number of molecules, including adiponectin, leptin, and resistin, that modulate peripheral insulin sensitivity. from the immunological point of view, adiponectin exhibits anti-inflammatory properties and leptin polarizes th cytokine production toward a proinflammatory (th1) phenotype (figure 1). since adipocytokines may play an important role in the early defects of t2d, women with gdm represent an ideal population model for studying this interrelationship. depending on studies, elevated, constant, or decreased levels of leptin have been observed in gdm women. hence, in contrast to obesity which leads to an inflammatory th1 state, leptin does not play an important role in gdm, marked with th2 response, probably because of the hormonal status during pregnancy. besides hyperglycaemia, chronic foetal hypoxia, detected in gdm, may also increase the inflammatory burden incurred by the foetus. dietary n-3 pufas have been considered as immunosuppressors and, therefore, are used in the management of a number of inflammatory and autoimmune diseases, including rheumatoid arthritis and multiple sclerosis [75, 76], as these pathologies are characterized by the presence of activated t-cells and inflammatory cytokines either at the site of tissue injury [77, 78] or in blood circulation [79, 80]. fat-1 transgenic mice, known to convert endogenous n-6 pufas to n-3 pufas, were protected from diabetes, because of low concentrations of tnf- and il-1. generally, both in animal models and in humans, n-3 pufas decrease tnf- and il-6 production. n-3 pufas exert their effect on the inflammatory gene expression through the inhibition of intracellular signaling pathways that lead to nf-b activation. n-3 pufas have been shown to suppress mitogen-stimulated proliferation of lymphocytes isolated from lymph nodes, spleen, and lymphatic duct, in mice and human beings [75, 85]. feeding the n-3 pufa-diet corrected intracellular calcium homeostasis in t-cells of diabetic pregnant dames and their macrosomic obese rats. we have assessed the th1/th2 dichotomy by dietary n-3 pufas in diabetic pregnancy and macrosomia. we observed that the n-3 pufas-diet upregulated the th2 profile in gdm rats. in macrosomic offspring, the th1 phenotype is upregulated and an n-3 pufas-diet downregulated this phenomenon. in agreement with our finding, wallace et al. have also observed that feeding fish oil to mice induced a shift in the ifn-/il-4 ratio, by a factor of four, as compared to animals fed the low fat diets. we have investigated the molecular mechanisms by which n-3 pufas-diet controls t-reg cell suppressive capacity. we used docosahexaenoic acid (dha), the end product of -linolenic acid metabolism in animal tissues, and observed that the exposure of t-reg cells to this fatty acid or its in vivo supplementation upregulated tgf- but downregulated il-10 in these cells, suggesting that dha might be orienting the t-reg cell differentiation toward a th3 phenotype. th3 phenotypes that infiltrate decidua are known to prevent abortion and contribute to the success of pregnancy. furthermore, dha diminished the suppressive activity of t-reg cells on effector t-cell proliferation. it is now becoming clear that the interaction of foxp3 with other transcription factors (like naft or runx-1) or histone deacetyltransferase and class ii histone deacetylase is critical for the repression of the transcription of il-2 gene by foxp3. hence, we hypothesized that dha might downregulate t-reg cell activity, by interfering with the critical downstream components of the foxp3-driven suppressor pathway. furthermore, dha reduced the migration of t-reg cells toward chemokines by downregulating the expression of chemokines receptors (ccr-4 and cxcr-4) in these cells. t-reg cell migration and activity have been found to be associated with mitogen-activated protein kinase (mapk), that is, erk1/2, activation. besides erk1/2, the phosphatidylinositol-3-kinase (pi3k) and akt/protein kinase b (hence referred to as akt) play a critical role in the t-cell survival, expansion, and differentiation. erk1/2 and akt phosphorylation controls the expression of p27, an inhibitor of cycline/cyclind kinase 2 that regulates cell cycle. we noticed that dha significantly diminished the mapk phosphorylation in activated t-reg cells, and this phenomenon was associated with an increase of p27 in t-reg cells. hence, dha seems to reinforce the anergic state of t-reg cells. concerning the molecular mechanism of action of n-3 pufas, we have previously shown that dietary n-3 pufas are incorporated into plasma membrane phospholipids. hence, we assume that dietary n-3 pufas may exert their beneficial action by modulating cell signaling. we have recently shown that t-cell activation and t-cell calcium signaling are altered in diabetic pregnancy and macrosomia, and dietary fish oils, particularly eicosapentaenoic acid (epa) and dha, restore these t-cell abnormalities. during cell activation, a modification in the intracellular ph also plays an important role in the cell cycle progression and, hence, dha and epa have been shown to modulate this phenomenon. dietary n-3 pufas, incorporated into plasma membrane, may also give rise to diacylglycerols which, in turn, may modulate cell activation. it has been shown that diacylglycerols, containing epa and dha, modulate pkc activation, calcium signaling, and erk1/erk2 phosphorylation. the incidence of gdm and macrosomia continues to grow worldwide and represents a major public health challenge. except for genetic factors, physical inactivity and high caloric food are the major causing factors for these pathologies. based on clinical studies, the dietary guidelines for americans 2005 report and several international and professional organizations have made recommendations for consumption of at least two meals, containing fish, per week or from 0.250 g to 1 g of epa and dha daily with a 5: 1 ratio of n-6 fatty acid/n-3 fatty acid. there is no doubt concerning the beneficial effects of n-3 pufas in the improvements of hypertriglyceridemia and the reduction of cardiovascular risk. thus, the use of these fatty acids in combination with genuine drugs (lipid-lowering, anti-inflammatory, etc.) represents a new therapeutic strategy in fighting against diabetes and obesity.

th (t helper) cells are differentiated into either th1 or th2 phenotype. it is generally considered that th1 phenotype is proinflammatory, whereas th2 phenotype exerts anti-inflammatory or protective effects. gestational diabetes mellitus (gdm) has been associated with a decreased th1 phenotype, whereas macrosomia is marked with high expression of th1 cytokines. besides, these two pathological situations are marked with high concentrations of inflammatory mediators like tumor necrosis factor- (tnf-) and interleukin-6 (il-6), known to play a pivotal role in insulin resistance. dietary n-3 polyunsaturated fatty acids (n-3 pufas) may exert a beneficial effect by shifting th1/th2 balance to a th2 phenotype and increasing insulin sensitivity. in this paper, we shed light on the role of t-cell malfunction that leads to an inflammatory and pathophysiological state, related to insulin resistance in gdm and macrosomia. we will also discuss the nutritional management of these pathologies by dietary n-3 polyunsaturated fatty acids (pufas).

PMC4897714

pubmed-1078

both non-pharmacological and pharmacological treatments of breast cancer have negative side effects ranging from the kinesiological to psychological domain, depending on the interaction of treatment characteristics with the physio-pathological and psychological conditions of each subject1, 2. upper limb lymphedema is a potential negative consequence of breast cancer surgery and radiation therapy that can appear during the months or even years after treatment ends. a growing body of scientific literature emphasizes the psycho-physical importance of early physical exercise engagement of breast cancer survivors in order to facilitate an early recovery, and to prevent breast cancer recurrence and the onset of all sedentarism-related diseases3. currently, various forms of exercise are prescribed following breast cancer treatment. although walking training, as the most accessible and low cost activity, is the most practised activity, proper exercises for breast cancer survivors should principally aim to correct faulty posture, balance muscle chain lengths, elasticity and strength, improve general physical fitness, prevent lymphedema, reduce mental distress, and activate the immune system4,5,6. in order to achieve all or most of the described aims, it is very important to plan the correct training and if possible to choose a complete discipline. to furnish a wide-ranging healthy intervention, the recently introduced physical fitness discipline of nordic walking appears to be useful for breast cancer survivors. nordic walking is a form of brisk walking, utilizing a walking pole, which actively engages the trunk and upper limbs during walking, increasing their range of motion and increasing total body muscle endurance7,8,9,10, and it has positive effects on cardio-metabolic, postural and balance measures in both healthy and pathological conditions11,12,13. in addition, due to its principal characteristics, it is conceivable to consider nordic walking as an effective discipline against lymphedema14, 15. indeed, during nordic walking practice there is an alternating open and close cycle of the hands, creating a pumping effect, theoretically favouring both lymphatic and blood circulation through upper limb muscle contraction, as reported for the pole walking technique7, 9, 16. as nordic walking and pole walking are not the same discipline, they use different equipment and have a few but substantially different principal characteristics (table 1table 1.nordic walking vs. pole walking characteristicsnordic walkingpole walkingequipment: equipment: light-weight poles come in fixed-length, 2 or 3 sections; poles are adjustable in length and divided into 3 sections; releasable hand strap system that attaches to the handle and is fixed to the pole whilst in use; baskets are interchangeable and useful for preventing poles from sinking into the ground; specially-designed, removable rubber tips and fixed steel tips are angled to assist with push-off; adjustable, locking straps with a different variety of handle types, enable user to maintain contact with grips without causing hand strain; poles are alternately used beside and behind the body in a pushing action; concave, carbide flex tips are designed for optimal performance on a variety of non-paved surfaces; the body s natural gait pattern called the reciprocal gait is accentuated when using nordic walking poles; rubber tips with a flat surface, enable the user to walk indoors or on pavements; to some extent, without losing the natural walking pattern, the stride lengthens, and spinal rotation is the key to achieving walking with attitude. this recruits more muscles but actually often lowers perceived exertion because more muscles are being used. pole walkers use the poles to transfer body weight onto the pole which helps to share the load and provide stability with the principal aim to take some weight off the lower body joints and to cope with tough conditions underfoot; in general, pole walkers are not seeking to gain such forward propulsion or increase stride in the way nordic walkers do and they plant the poles in front of them at a much more upright angle.created and adapted from the contents of jayah faye paleys blog. http://adventurebuddies.net/blog/2010/09/nordic-walking-poles-vs-trekking-poles-whats-the-difference/), it is very important to verify the effectiveness of the nordic walking technique on the upper limb circumferences of breast cancer survivors. taking into account that to maintain natural gait, while the hands are performing the nordic walking characteristic open-close cycle in an alternating manner (fig. 1.hands coordination scheme during nordic walking practice), could be too complex a task for novice nordic walkers with little previous experience of physical exercise, with a consequent delayed beneficial effect on upper limb circumferences, we designed a series of exercises, properly tailored for breast cancer survivors (i.e. the isa method), to enhance the pump effect of the upper limbs and contrasting arthralgia. the aim of this study was to verify the effects of 10 weeks of nordic walking, nordic walking+isa method, walking alone, and walking+isa method on upper limb circumferences and total body water of breast cancer survivors twenty breast cancer survivors (bcs) (mean age, 50.60 3.60 years) were recruited by the department of general surgery specialized in senology of the g. bernabeo hospital (ortona, italy). the inclusion criteria were: age>4055 years; no past or current chemotherapy; no current radiotherapy; current hormonal therapy; cardiovascular and orthopaedic eligibility for nordic walking practice; no endocrine diseases; lymphedema lower than class 2 of the ceap-l classification17; no dieting or use of nutritional supplements; no participation in any exercise programme during the six months prior to the study; and un-employed status. the ethics committee of the g. dannunzio university of chieti-pescara approved this study, and all of the participants gave their written informed consent. after recruitment, the breast cancer survivors were visited by both cardiology and sports medicine specialists to verify their cardiovascular and orthopaedic eligibility for walking and nordic walking practice through medical examination, echocardiography and the maximal stress test. after meeting the medical eligibility criteria, the participants were randomly assigned to one of four different workout groups, which performed nordic walking (nwg), nordic walking+isa method (nw-isag), walking (wg) or walking+isa method (w-isag) workout. before starting 10 weeks of supervised training, both nwg and nw-isag were introduced to nordic walking, through 10 lessons on the nordic walking technique. after the 10 lessons, two nordic walking instructors of the international nordic walking association (i.e. inwa) independently verified the proficiency of each participant. after nwg and nw-isag had completed the 10 lessons of nordic walking technique (t0), all the participants underwent anthropometry and body composition analysis, which were repeated at the end of the study (t1). a resting 12-lead electrocardiogram (stress ecg hd+, cardioline, trento, italy) was recorded after 10 min supine rest. because the majority of participants had never used a treadmill before, the eligibility for aerobic training was assessed through a graded maximal exercise test on a cycle ergometer (cardioline xr50, cardioline, trento, italy), supervised by a sports medicine specialist medical doctor. participants performed a graded maximal exercise test, the astrand protocol using 3-minute steps18, under continuous electrocardiogram monitoring (stress ecg hd+, cardioline, trento, italy), and blood pressure was measured at the end of each step. the test lasted until the doctor saw absolute or relative indications for clinical graded exercise test termination, according to the italian federation of sports medicine guidelines19. a second level anthropometrist of the international society for the advancement of kinanthropometry, following the society s guidelines20, measured weight, stretched stature and the following circumferences of the upper limbs: relaxed arm (the circumference at acromiale-radialemedio point), maximal forearm (the maximal circumference of forearm), mid forearm (the circumference at mid-point between radiale and stylion points) and wrist (the wrist circumference at distal region of the stylion point). a stadiometer with a balance-beam scale (seca 220, seca, hamburg, germany) was used to measure weight and stretched stature; an anthropometric tape (cescorf, porto alegre, brazil) was used to measure circumferences and a segmometer (cescorf, porto alegre, brazil) was used to locate the acromiale-radiale medio point and mid forearm. anthropometric measures were reported to the nearest 0.1 kg and 0.1 cm. body extracellular water of the participants was assessed using a hand-to-foot electrical bioimpedance technique, and a 50-khz frequency bioelectric impedance analyzer (bia 101, akern, pontassieve, italy). the test was performed 3 h after waking, and immediately after voiding, with the participants undressed in the supine position, the upper limbs separated from the trunk, and the lower limbs separated from each other. all the training groups followed the same training schedule with different contents according to group membership. the 70 min of training, including 15 min of warm-up, 45 min of central phase and 10 min of cool down, was performed three time a week for 10 weeks. from the first to the fourth week, the participants trained at 1011 on the borg rating of perceived exertion (rpe) scale21, from the fifth to the eighth week at 1213 rpe, and from the ninth to the tenth week at 1314 rpe. the participants were familiarized with this scale before beginning the training, and also during the first week of training. the borg scale is particularly useful for prescribing and monitoring exercise intensity in this population, as with the same external load it is possible to have a different internal load due to the side effects of pharmacological treatments (e.g. fatigue). exercise trainers checked the exercise intensities of the participants through the talk test22, and checked their compliance with the training sessions. nwg and nw-isag were conducted and supervised by exercise specialists who were also instructors of the italian nordic walking association, and members of the same international association (i.e. inwa). considering the differences between the groups: i) nwg executed the traditional anwi-inwa suggested exercises for warm-up and cool-down, including whole body mobilization exercises during warm-up, and stretching exercises during cool-down23, and nordic walking in the central phase of the training session; ii) wg executed whole body mobilization exercises during warm-up and stretching exercises during cool-down23, 24, and walking in the central phase of the training session; iii) nw-isag executed the isa method during warm-up and both the isa method and stretching exercises during cool-down, and nordic walking in the central phase of the training session; and iv) w-isag executed the isa method during warm-up and both the isa method and stretching exercises during cool-down, and walking in the central phase of the training. during the training period, participants did not practice other forms of exercise and did not have lymphatic drainage. the isa method includes a series of dynamic exercises, propaedeutic for nordic walking, lymphedema and arthralgia, properly tailored for breast cancer survivors. it requires the use of isa balls, foam balls of 6 or 7 cm diameter with different densities, that can be used both alone or with nordic walking poles (fig. this series of exercises has the following objectives: to gently warm-up joints, and to reduce muscular tensions and counteract or prevent upper limb lymphedema. the scheme of execution is the following: the protocol starts with warm-up exercises for the hand and wrist joints, that are executed using only isa balls, followed by multi-joint exercises, actively involving wrists, elbows and shoulders using both nordic walking poles and isa balls applied to them, and by neck exercises, that are executed using only nordic walking poles. the main task performed by participants in the workout with isa balls, was to gently squeeze them, during the forward and the returning phases of each exercise, in order to promote the pumping effect in the upper limbs. after the neck and upper limb exercises, trunk and lower limb exercises were executed using only nordic walking poles. lower limb exercises were executed following a distal to proximal order, from feet to hip joints. isa balls applied to nordic walking poles statistical analysis was performed using the sas 9.2 software (sas institute inc., cary, usa). although non-parametric tests were performed because of the small sample size, some data are presented as means standard deviation in order to better comprehend the results. considering the whole sample, the kruskall-wallis test was used to verify whether the groups differed in basal characteristics. considering each group separately, the mann-whitney test was used to verify whether circumferences of the upper limb, homolateral with surgical intervention for breast cancer, significantly differed from those of the opposite side. the wilcoxon test was used to verify, separately in each group, the significance of changes in the outcome measures at the end of the training period. table 2table 2.anthropometric and hydration differences of the groupsnwgnw-isagwgw-isagage (years)52.6 2.148.4 1.549.2 5.752.2 2.5weight (kg)78.3 12.560.5 7.465.1 10.764.2 5.1tbw (lt)35.8 4.132.8 432.3 3.133.5 1ecw (lt)19.1 3.217.1 1.316.9 1.617.8 2.2ecw/tbw (%) 53 5.852.7 4.252.2 1.553.2 5.4relaxed arm circ. (cm) 34.6 3.3*29.2 2*30.6 2.4*30.6 1.7*max forearm circ. (cm) 33.7 3.1*28.5 1.8*29.9 2.4*29.6 1.5*max forearm circ. 0.516.1 0.7nwg: nordic walking group; nw-isag: nordic walking+isa method group; wg: walking group; w-isag: walking+isa method group; tbw: total body water; ecw: extracellular water; circ.: circumference; max: maximum; homolateral to the surgical intervention for breast cancer; contralateral to the surgical intervention for breast cancer;*p<0.05 shows the homogeneity of the groups, which had the same starting values, except for the relaxed arm circumferences, which were higher in the nwg. as nwg had higher relaxed arm circumference than the other groups, and not only on the side homolateral to the surgical treatment, the observed difference was not due to a different grade of lymphedema but to a difference in the group s characteristic. table 3table 3.analysis of upper limb differences of the groupshomolateral upper limbcontralateral upper limbnwgrelaxed arm circ. (cm)16.1 0.616.1 0.7homolateral upper limb, circumferences taken on the upper limb homolateral to the surgical intervention for breast cancer; contralateral upper limb, circumferences taken on the upper limb contralateral to the surgical intervention for breast cancer; max: maximum; nwg: nordic walking group; nw-isag: nordic walking+isa method group; wg: walking group; w-isag: walking+isa method group; circ., circumference; *p<0.05 shows that all the upper limbs homolateral to the surgical intervention for breast cancer had circumferences greater than those of the contralateral upper limb except the wrist circumferences, which showed no significant difference. the wilcoxon test showed that while wg showed no significant changes in any of the outcome measures, and increased both total body water and mid-forearm circumference, the other groups exhibited significant reductions (table 4table 4.analysis of variables modifications of the groupsnwgt0nwgt1nw-isagt0nw-isagt1wgt0wgt1w-isagt0w-isagt1weight (kg)78.3 12.578.8 11.960.5 7.460.2 6.665.1 10.765.2 11.264.2 5.164.4 5.1tbw (lt)35.8 435.4 3.932.8 4.132.7 3.732.3 3.133.1 3.4*33.5 134.3 1.1ecw (lt)19.1 3.218.5 2.717.1 1.316.8 1*16.9 1.617.2 2.317.8 2.217.4 1.8ecw/tbw (%) 53 5.852.1 4.152.7 4.251.7 4.2*52.2 (cm)34.6 3.334 3.1*29.2 229.1 2*30.6 2.430.6 1.930.6 1.729.7 1.5*max forearm circ. (cm)*24.3 2.323.8 2.3*22.9 2.222.2 2.3*23.1 1.922.8 1.923.5 0.622.5 0.8*mid forearm circ. (cm) 33.7 3.133.8 2.928.5 1.828.2 1.729.9 2.430.1 1.929.6 1.529.5 1.5max forearm circ. (cm)24 2.224 2.522.4 2.122.3 2.322.7 1.723.6 1.522.4 1.121.9 0.8mid forearm circ. (cm)23.2 223.2 2.221 2.321 2.321.7 1.121.8 1.220.7 0.720.3 0.7wrist circ. 1.215.5 0.915.9 0.515.8 0.516.1 0.716.3 0.6nwg: nordic walking group; nw-isag: nordic walking+isa method group; wg: walking group; w-isag: walking+isa method group; tbw: total body water; ecw: extracellular water; circ.: circumference; max: maximum; homolateral to the surgical intervention for breast cancer; contralateral to the surgical intervention for breast cancer;*p<0.05). both nwg and nw-isag showed significantly reduced relaxed arm and maximum and mid-forearm circumferences homolateral to the surgical intervention. nw-isag also showed significant reductions in extracellular water, the extracellular to total body water ratio and the wrist circumference homolateral to the surgical intervention (table 4). in contrast to wg, which showed no significant reductions in arm circumferences, w-isag showed a significant reductions in the extracellular to total body water ratio, relaxed arm circumference, and both maximum and mid-forearm circumferences homolateral to the surgical intervention (table 4). nwg: nordic walking group; nw-isag: nordic walking+isa method group; wg: walking group; w-isag: walking+isa method group; tbw: total body water; ecw: extracellular water; circ.: circumference; max: maximum; homolateral to the surgical intervention for breast cancer; contralateral to the surgical intervention for breast cancer;*p<0.05 homolateral upper limb, circumferences taken on the upper limb homolateral to the surgical intervention for breast cancer; contralateral upper limb, circumferences taken on the upper limb contralateral to the surgical intervention for breast cancer; max: maximum; nwg: nordic walking group; nw-isag: nordic walking+isa method group; wg: walking group; w-isag: walking+isa method group; circ., circumference; *p<0.05 nwg: nordic walking group; nw-isag: nordic walking+isa method group; wg: walking group; w-isag: walking+isa method group; tbw: total body water; ecw: extracellular water; circ.: circumference; max: maximum; homolateral to the surgical intervention for breast cancer; contralateral to the surgical intervention for breast cancer;*p<0.05 taking into account that our pilot study was conducted on a restricted sample and that our results need further confirmation, our study provides interesting preliminary results for optimizing recovery from breast cancer treatment. according to our results, walking training does not seem capable of reducing upper limb circumferences and extracellular body water, so it should not be used alone for the prevention/treatment of upper limb lymphedema. this result should be explained by the fact that there is a lack of active use of the upper limbs, whereas nordic walking actively uses the upper limbs as a propulsive means, one of its main features. indeed, pellegrini et al.26 showed that the muscle activities of the triceps brachii, latissimus dorsii, biceps brachii and anterior deltoideus muscles, were respectively 16-fold, 40-fold and 3-fold lower in walking than in the nordic walking. also, each muscle s activation is characterized by a cyclical pattern, with activation of different intensities, according to the phase of walking. the alternating active use of the upper limb muscles supports lymphatic and blood circulation, benefiting from the gravity effect helping to prevent or reduce upper limb swelling. an important result of the present preliminary study is that by coupling the isa method with walking training, it is possible to compensate for the lack of the upper limb pumping effect, a typical negative characteristic of walking training. indeed, after 10 weeks of training, while wg showed no significant modifications, w-isag exhibited significant reductions in extracellular to total body water ratio, and arm and forearm circumferences. this result could be particularly useful for breast cancer survivors favoring walking training but not nordic walking, and also for those who have to train indoors, using a treadmill, for any reason. in the present study, when the proper nordic walking technique was performed maintaining the natural gait with the hands performing an open and close cycle in an alternating manner, nordic walking alone was able to reduce the upper limb circumferences and extracellular body water. therefore, even in the absence of the isa method, when the proper nordic walking technique is practised for 10 weeks, reductionts can be achieved in the upper limb circumferences homolateral to the breast cancer surgery site. in conclusion, both a larger study and the use of a more accurate technique for quantifying lymphedema furthermore, the present results may only be applicable to people with lymphedema lower than class 2 of the ceap-l classification. however, the addition of the isa method, during both the warm-up and cool down phases, to 10 weeks of walking-based workout could be useful for the management of lymphedema, walking alone seems not to be of benefit. in order to choose a physical exercise having complete efficacy against breast cancer treatment effects on the side of treatment, particular attention should be paid to nordic walking. nordic walking has been reported to achieve balanced postural changes in breast cancer-related treatment postural disorders10, increases in upper extremity strength8, improvements in cardio-metabolic and respiratory measures and has been used in the prevention and treatment of upper limb lymphedema. however, in order to elicit beneficial effects, it is necessary to perform the proper technique and achieve consistency in training.

[ purpose] the aims of this study were to verify the effects on upper limb circumferences and total body extracellular water of 10 weeks of nordic walking (nw) and walking (w), both alone and combined with a series of exercises created for breast cancer survivors, the isa method. [subjects and methods] twenty breast cancer survivors were randomly assigned to 4 different training groups and evaluated for upper limb circumferences, total body and extracellular water. [results] the breast cancer survivors who performed nw, alone and combined with the isa method, and walking combined with the isa method (but not alone) showed significantly reduced arm and forearm circumferences homolateral to the surgical intervention. [conclusion] for breast cancer survivors, nw, alone and combined with the isa method, and walking combined with the isa method should be prescribed to prevent the onset and to treat light forms of upper limb lymphedema because walking training practiced alone had no significant effect on upper limb circumference reduction.

PMC5088125

pubmed-1079

it has been estimated that schwannomas represent only 2-6% of all stromal tumors of the digestive tract. there are many synonyms for neurogenic tumors of the digestive tract, namely schwannoma, neurinoma, neurogenic fibroma, neurofibroma, neurilemoma and plexiform neurofibromatosis. these different names are used with the intent of relating them to the structure from which they originate. because of the differences in the nomenclature used, it remains difficult to precisely establish the correct prevalence of primary tumors of the neural sheath. although there is some controversy regarding the cell origin, classification and correct naming of gastrointestinal tract schwannomas, there is evidence showing that these neoplasms originate from schwann cells in the neurons of the myenteric plexus. primary schwannomas of the colon and rectum, unassociated with systemic neurofibromatosis (von recklinghausen disease), are extremely rare. the objective of the present paper was to present a case of benign primary schwannoma of the sigmoid colon, unassociated with von recklinghausen disease, that was histopathologically confirmed by means of an immunohistochemical panel and was successfully treated by means of videolaparoscopic colectomy. the patient was a 71-year-old woman with complaints of tenesmus and hematochezia for 4 months, associated with weight loss of 4 kg. nine months earlier she had undergone colonoscopy and a sessile polypoid lesion in the sigmoid colon, 0.5 cm in diameter, had been removed. histopathological evaluation at that time had led to the diagnosis of a hyperplastic polyp in the colon. even with endoscopic removal of the polyp she continued to present successive episodes of fresh bleeding when evacuating, and this was associated with rectal pain and tenesmus. with these complaints, she sought the coloproctology service of so francisco university, where she underwent another colonoscopy. this second examination found a reddish polypoid lesion of approximately 3 cm in diameter, located in the sigmoid colon 35 cm from the anal margin. the surface of the mucosa covering the lesion was ulcerated and it presented slight local bleeding when in contact with the apparatus. it was removed by means of loop polypectomy. conventional histopathological examination using the hematoxylin-eosin technique showed that spindle cells were present, arranged in bundles, with dense distribution of nucleus forming palisades in dense fibrillar stroma (fig., an immunohistochemical panel was performed for anti-cd34 antibodies, desmin, cytokeratins (ae1/ae3), ckit, chromogranin and s-100 protein. 2), while the other antibodies presented negative results (table 1). with the aim of evaluating tumor growth potential, positive results were found in fewer than 5% of the fields analyzed (one mitosis in every ten fields at high magnification), thus suggesting that the neoplasm had a low mitotic rate (fig. 3). the results from the histopathological and immunohistochemical examinations allowed the diagnostic conclusion that this was a case of benign schwannoma of the sigmoid colon with a histological pattern of antoni a type, with a low degree of cell proliferation (fig. the surgical margins of the lesion removed were compromised with neoplasia, and therefore it was decided to perform video-assisted colectomy. the patient's postoperative evolution was uneventful and she was discharged from hospital on the fourth postoperative day. histopathological examination on the resected colon confirmed that it presented a residual neoplastic lesion with the same characteristics as presented by the polyp that was removed during colonoscopy. the resected margins obtained after surgical resection were free from involvement and there was no neoplastic involvement in any of the 21 lymph nodes examined. at present, the patient is well, without any recurrence of symptom, and a control colonoscopy examination performed 15 months after the colectomy showed normal results. tumors originating from autonomous nerves of the digestive tract form a distinct but rare subcategory of stromal gastrointestinal tumors, accounting for approximately 1% of all neoplasms affecting the digestive tract. they affect men and women with equal frequency and can appear at any age, but most commonly after the sixth decade of life. when they appear in the digestive tract, the stomach and the small intestine are the segments most frequently involved, accounting for 83 and 12% of such cases, respectively. schwannomas located in the colon and rectum that are unrelated to von recklinghausen disease are extremely rare. although they usually evolve asymptomatically, they may in some cases, as in our patient, present bleeding, rectal pain and tenesmus. it is important to highlight that unspecific rectal pain is often confused with the pain of idiopathic proctalgia fugax, which may cause delay in diagnosing the condition. macroscopically, schwannomas are well-delimited, lobulated tumors that may, in larger cases, present a cystic pattern. from a microscopic point of view, schwannomas are encapsulated neoplasms and two histological growth patterns have been described: antoni a and antoni b. in antoni a type there is dense growth of fusiform cells, compactly arranged in palisades to form verocay bodies. in antoni b, the fusiform cells are more loosely distributed with rounded or elongated nuclei, with a greater quantity of myxoid stroma and xanthomatous histiocytes. these findings also include undifferentiated mesenchymal cells, smooth muscle cells, cells with neural characteristics and cells with mixed differentiation of neural/muscular type. regarding our patient, the result from the histological examination using the hematoxylin-eosin technique suggested a diagnosis of schwannoma of the sigmoid colon with a cell pattern classified as antoni a. before immunohistochemistry techniques came into routine use, schwannomas were wrongly diagnosed as smooth muscle neoplasms such as leiomyomas and leiomyosarcomas. the use of immunohistochemical panels plays a fundamental role in diagnosing schwannomas and in ruling out other neoplasms of mesenchymal origin. authors believed that positive immunostaining for s-100 protein and leu7 antigen indicated a neoplasm originating from schwann cells. strongly positive immunoexpression of s-100 protein and low affinity for cd34, cytokeratins, smooth muscle actin and desmin confirm the possibility of schwannoma in practice. the present case was within these criteria: results identical to these were found from running the immunohistochemical panel that is most commonly proposed. the exact biological behavior of schwannomas is still not fully clear, since only a small number of cases have been published. consequently, determination of malignity becomes a difficult challenge that can not always be resolved using conventional histopathological techniques. many parameters have been studied in relation to tumor behavior and, so far, no single parameter alone allows safe prediction of the degree of malignity. a mitotic activity rate of more than five mitoses per field at high magnification and tumor size greater than 5 cm tend to be associated with a high risk of metastasis or recurrence. we evaluated the number of mitoses by means of the immunohistochemical technique using ki-67 antibodies and found a low rate of cell division, suggesting that this was a low-grade schwannoma. the low mitosis rate, the absence of atypical mitosis figures and the absence of nuclear hyperpigmentation, especially in the necrotic areas found, were also useful for characterizing the benign nature of the lesion. although schwannomas are considered to be benign tumors, their high recurrence risk must not be ignored. in a study on 303 benign schwannoma cases unrelated to von recklinghausen disease, das gupta and brasfield found that 2% of the tumors evolved with distant metastases. this evidence suggests that, despite the skepticism regarding the possibility of malignant transformation of schwannomas initially considered benign, this possibility does exist and must not be ignored. the most aggressive phenotype relates to the size of the tumor and its proliferative activity rate, and this gives rise to greater recurrence, metastases and lower overall survival rates. the best therapeutic option is complete surgical removal with margins free from neoplastic involvement. since the risk of malignant transformation is small, broad lymph node resections are not recommended. for tumors with more aggressive behavior, the same surgical criteria should be used, but greater rigor in postoperative follow-up is recommended. the surgical approach depends on the size and location of the tumor and on its histopathological pattern. minimally invasive surgery using videolaparoscopic access, such as in the present case, may be indicated for tumors located in the proximal colon and rectum. for tumors in the distal rectum, transanal endoscopic resection can be used. the use of radiotherapy or adjuvant chemotherapy still presents conflicting results and is not recommended for routine use. in conclusion, schwannomas of the colon and rectum are tumors that are rarely detected and for which the use of an immunohistochemical panel is important to achieve a definitive histopathological diagnosis. radical surgical removal is the preferred treatment because it allows improvement of overall survival and disease-free survival rates.

schwannomas are neoplasms originating from schwann cells, which are the cells forming nerve sheaths. these neoplasms generally involve peripheral nerves. they rarely affect the gastrointestinal tract and primary colon involvement is extremely rare. the objective of the present paper was to present a case of primary schwannoma of the sigmoid colon, unassociated with von recklinghausen disease, that was histopathologically confirmed by means of an immunohistochemical panel. the patient was a 71-year-old woman who had had rectal bleeding when evacuating, with pain and tenesmus, for 4 months. she underwent colonoscopy, which identified a raised submucous lesion of 2.8 cm in diameter, located in the sigmoid colon, 30 cm from the anal margin. during examination, loop polypectomy with lesion excision was performed. histopathological evaluation showed that this was a tumor of stromal origin. its resection margins were compromised by neoplasia, and colon resection by means of videolaparoscopy was indicated. conventional histopathological examination using the hematoxylin-eosin technique suggested that the neoplasm was of mesenchymal origin. an immunohistochemical panel was run for etiological confirmation, using anti-cd34 antibodies, desmin, cytokeratins (ae1/ae3), ckit, chromogranin and s-100 protein. the panel showed intense immunoexpression of s-100 protein. investigation of the proliferative activity rate using ki-67 antibodies showed that there was a low rate of mitotic activity, thus confirming the diagnosis of primary benign schwannoma of the colon. the patient's postoperative evolution was uneventful and she remains in good health, without signs of tumor recurrence, 15 months after surgical excision.

PMC2988920

pubmed-1080

in the past, advances in technology have caused a decrease in the time spent on physical activities and an increase in the time spent on sedentary behaviors. for instance, viewing television (tv) and spending time on the computer keep both adults and children sedentary for many hours each day [25]. the etiology of obesity is complex and includes biologic, genetic, and behavioral contributors; however, the obesogenic environment that promotes a sedentary lifestyle plays an important role in the obesity epidemic [6, 7]. what is known about the health implications of sedentary behaviors, including weight outcomes and obesity, is summarized in several reviews. based on cross-sectional studies, previous reviews concluded that there were generally positive associations between viewing tv and indicators of overweight [8, 9]. however, recent reviews of prospective studies are inconclusive, partly due to the poor methodological quality of the studies and conflicting results among the studies [1012]. for other obesity-related health outcomes, that is, type 2 diabetes and mortality from all causes, and cardiovascular diseases (cvd), moderate to strong evidence although the research on sedentary behavior has been dominated by studies on its association with physical health, there is increasing research focusing on the association between sedentary behavior and mental health, especially depression [1316]. a recent review showed positive associations between sedentary behaviors and the risk of depression among adults based on seven observational studies, while four intervention studies showed contradictory results. in addition to depression, there are other common mental health measures, including anxiety and general mental health or mental well-being. however, the link between sedentary behavior and general mental health outcomes has received scant attention. among the dutch population, there is a 14% yearly prevalence of self-reported poor mental health (defined by the mental health inventory, mhi-5 60). considering the public health impact of poor mental health, insight into the association with sedentary behavior is relevant. among adults, hamer and colleagues (2010) found that recreational sedentary behavior by adults, defined by tv- and screen-based activity, was associated with poorer mental health scores. however, sedentary behaviors involve domains other than sitting during leisure, such as sitting at work or sitting during transport. among working adults, who represent a major part of the adult population, a significant amount of time is spent at work, and the majority of their total sitting time each day is likely to be at work due to the organization of the work [2, 3]. with respect to the observed associations between tv viewing and mental health, several explanations can be proposed. in addition to possible physiologic mechanisms, there are possible behavioral explanations; for example, extended time spent viewing tv may lead to social isolation which adversely affects mental well-being. another possible explanation is the documented association between tv viewing and unhealthy (snack) food and beverage intake [20, 21]. with respect to the other side of energy balance, it has been hypothesized that tv viewing or other leisure-time sedentary behaviors may be substituted for beneficial physical activity that reduces the risk of depression. thus, tv viewing may be related to poorer mental health through reduced physical activity and obesity [20, 2224]. it is yet unknown whether these associations also hold true for sedentary behaviors in other domains. for instance, for workers, is the relationship between sitting at work and mental health similar to tv viewing? also, it is unknown whether the association between sedentary behavior and mental health is the same for workers and nonworkers. to date, evidence on these associations is lacking despite the relevance to reduce obesity and improve mental health. due to the current lack of knowledge on the relationship between various sedentary behaviors and mental health, the aim of this study was to explore the association between domain-specific sitting with mental health among workers and nonworkers. weight status has shown to be associated with sedentary behaviors [8, 9], as well as with mental health problems [23, 25]; but the role of weight status in this association is yet unknown. therefore, the second aim of the present study was to explore the role of weight status in the relationship between the various sedentary behaviors and mental health. data were derived from the doetinchem cohort study, a dutch, prospective, population-based study among residents from a town (doetinchem) in the netherlands. the data collection began among persons aged 2059 years from 1987 to 1991 as part of the monitoring project on cardiovascular disease risk factors. the cohort is reexamined every five years, and the fifth round (20082012) is ongoing. the measurements of the total study population are completed within a 5-year time frame, and each participant is measured every five years. response rate was 62% in the first round, and varied between 75 and 79% in subsequent rounds. starting with the fifth round, data have been collected about the time spent on sedentary behaviors. since the data collection of the fifth wave is ongoing, only data from the first two years (2008 and 2009) are used in this study. the general aim of the doetinchem cohort study is to study the impact of (changes in) lifestyle behaviors and biological risk factors on health outcomes during ageing. sedentary behavior was assessed by self-reported time spent sitting during a usual week over the past 12 months. the format of the sitting-time questions was similar to the questions about physical activity, which were designed for the european investigation into cancer and nutrition (epic). the participants were asked to report their weekly sitting time (in hours) spent: traveling by motor vehicle (such as train, bus, car, tram, motorbike, motor) during commuting, work, leisure; sitting at work (behind desk, computer, or meeting); sitting during leisure time while reading and/or studying, tv viewing, sitting behind the computer, other sitting activities (talking with friends, playing games, listening to music, etc.). reading and/or studying, sitting behind the computer, other sitting activities (talking with friends, playing games, listening to music, etc.). from these items, three subscores were calculated by totaling the time spent sitting in each category: hours per week sitting during transport either for work or leisure time, hours per week sitting during work, and hours per week sitting during leisure time (either reading or studying, viewing television, computer time, or other sitting activities). sitting time per domain was calculated only in those cases for which all underlying sitting activities were not missing. in all other cases, sitting time for the specific domain was considered as missing. further, the time reported on each sitting activity was maximized at eight hours per day and seven days per week (five days/week for sitting at work) before calculating sitting time per domain. the total time spent sitting during the day was calculated by summing up the time spent sitting in the three domains, that is, transport, at work, and in leisure time. again, total sitting time was calculated only in those cases for which all underlying domains of sitting were not missing. in all other cases, total sitting time mental health was measured by the mental health inventory (mhi-5), a subscale of the rand 36. the mhi-5 is used to measure general mental health during the past month [17, 29] and has been found to be a valid and reliable measure of mental health status [29, 30]. the mhi-5 has five questions about feelings of depression and nervousness to be answered on a six-point scale ranging from all of the time the mental health score ranged from 0 to 100 points, calculated by first reversing the coding of the two positively formulated questions and consequently summing the points of each item 5/25100, with a higher score reflecting better mental health. a dichotomous variable was created using a cutoff point of 60 [29, 31], indicating poor (60) versus good (> 60) mental health. using a single question, the respondents were asked whether they had paid work at the moment of the measurement. they could answer on a seven point scale with answers including yes, as an employee (payroll), yes, self-employed, no, i am housewife/man, no, i am unemployed, no, i am retired, no, i am disabled, and other. for the analyses, those working as an employee and self-employed were considered as a worker, while the remaining respondents, including other, were treated as nonworkers. body weight and height were measured during a physical examination by trained assistants at the municipal health services with participants wearing light indoor clothing, with emptied pockets and no shoes. body weight was assessed with a seca balance scale to the nearest 100 g on a calibrated scale. body height was measured with a stadiometer mounted to the wall while participants stood straight against a wall, with their feet at a 45-degree angle, to an accuracy of 0.5 cm. body mass index was calculated by body weight in kilograms divided by body height in meters squared. subsequently, bmi was categorized as healthy weight (bmi 18.524.9 kg/m), moderately overweight (bmi 2529.9 kg/m), and obese (bmi 30 kg/m). kg/m) (n=3) were excluded from the present analyses. potential confounders of the association between sitting and mental health were assessed by means of self-administered questionnaires. educational level was assessed by the highest schooling achieved and was subsequently classified as low (intermediate secondary school or less), moderate (intermediate vocational or higher secondary education), or high (higher vocational education or university). household composition was assessed by the question: with which persons are you currently living together using six answer categories: not applicable, i live alone, with a partner, with children up to 18 years of age, with children 18 years or older, with my parents or with other adults). a dichotomous variable was created to distinguish participants living alone from participants living with others. perceived general health was measured using a question from the rand 36 [29, 30], which was dichotomized as healthy data on alcohol consumption were categorized as 0 glasses/week, 1-2 (women) or 13 (men) glasses/week, or 2 (women) or 3 (men) glasses/week. an extended version of the physical activity questionnaire designed for the european prospective investigation into cancer and nutrition (epic) was used. this questionnaire included items on time spent on leisure-time activities (walking, bicycling, odd jobs, and gardening) during the summer and then during the winter. for these activities, the lowest amount of time reported during either summer or winter was used in order to cautiously estimate physical activity levels. in addition, the questionnaire included items on sports and occupational activity irrespective of season. all reported sports were provided with a met-value according to ainsworth's updated compendium of physical activities. total time (hours/week) spent on moderately intense (4.06.5 mets) physical activity was calculated by taking the sum of the time reported on bicycling, gardening, sports (4.06.5 mets), and moderately intense activity at work (i.e., walking regularly while carrying heavy objects). time (hours/week) spent on vigorous (6.5 mets) physical activity was calculated by taking the sum of the time reported for sports (6.5 mets). (3.5 hours/week of at least moderate physical activity) or not adhering to the physical activity guideline. data were available for 1588 men and women, aged 41 to 80 years old, examined in 2008-2009. participants with missing values for outcome variables and confounders were excluded from the analyses (n=521). in addition, participants who were underweight (n=3) were excluded, leaving 1064 men and women for the analyses. descriptive characteristics (mean and standard deviation or percentage) for all key variables were calculated for the study population as a whole and stratified by working status. the association between sitting time and mental health was determined using a linear regression analysis with the total or domain-specific time spent sitting as the independent variable and the mental health score as the dependent variable. analyses were stratified by working status. both crude and adjusted analyses were performed. to explore the role of bmi in the association, one included all covariates (i.e., gender, age, education, household composition, perceived health, physical activity, smoking, and alcohol) but excluded bmi (model 1); one included all covariates and bmi (model 2); and included an interaction term between sitting time and bmi (model 3). the same linear regression analyses were then performed but stratified for weight status as defined by the bmi categories (healthy weight, moderate overweight, and obese adults). all analyses were performed using the sas program, version 9.2 (sas-institute, cary, nc, usa). the mean age of the respondents was 59 years; the mean age of workers was 52 years versus 66 years for nonworkers (table 1). the majority perceived their health as at least good, and 88.6% of the respondents were mentally healthy, although this was slightly higher for the working population, 90.1%. the mean bmi was 26.8 kg/m, and 44.8% of the working population and 48.3% of the nonworking population were moderately overweight. approximately 13.5% of workers were obese versus 21.8% of nonworkers (table 1). on average, the total time spent sitting across the domains was 40.9 hours per week with higher sitting times for workers than for nonworkers (47.9 hr/wk versus 34.3 hr/wk among nonworkers). the respondents spent most of their sitting time in leisure with an average of 28.3 weekly hours (25.1 hr/wk for workers, 31.3 hr/wk for nonworkers). tv viewing accounted for the majority of leisure sitting time ranging from 11.6 to 15.0 hours per week. no association was found for sitting during transport or for sitting at work and mental health. for time sitting during transport, there was a significant negative interaction with bmi for the working population (p<0.05) (table 2). among workers, the time spent sitting in leisure, and particularly the time spent viewing tv, was negatively associated with mental health, both with and without adjustment for bmi (0.11, 95% ci (0.21)(0.002) for total leisure time, and 0.18, 95% ci (0.35)(0.01) for tv viewing time, resp.). among the nonworking population, no significant association between total time sitting, or sitting during leisure and mental health was found. however, a significant positive interaction with bmi was apparent for the total time spent sitting and leisure-time sitting (p<0.05). tables 3(a) and 3(b) present the results of the linear regression models for the association between the sitting time variables and mental health stratified by the three weight-status groups for the working (table 3(a)) and nonworking populations (table 3(b)), respectively. among the obese workers, a significant negative association was found for the time spent viewing tv (model 2: 0.43, 95% ci (0.84)(0.02)). adjustment for bmi (model 3) did not change the significant negative association (model 3: 0.42, 95% ci (0.83)(0.01)). there was no association between sitting time and mental health for the healthy weight or moderately overweight workers. analyses among the nonworking population showed that total time sitting (0.16, 95% ci (0.29)(0.02)) and the time spent sitting during leisure (0.17, 95%ci (0.30)(0.03)) and viewing tv (0.34, 95% ci (0.58)(0.11)) were all negatively associated with mental health for healthy-weight persons but not among the moderately overweight or obese persons (table 3(b)). among the moderately overweight and obese nonworkers, no significant associations between sitting time and mental health were observed. the results of this explorative study showed no association between time spent sitting during transport or sitting at work and mental health. only sitting during leisure time and in particular the amount of time viewing tv associations were even more complicated, because both work status and weight status are effect modifiers in these associations. among nonworking persons, the total time spent sitting, the time spent sitting during leisure, and particularly viewing tv, was associated with a poorer mental health in those with a healthy weight only. in workers, the association between viewing tv and poorer mental health was also apparent among the obese workers only. there are some mechanisms that may explain a relationship between sitting and the risk for poor mental health. first, the favorable effects of physical activity on mental health, especially on depression, have been well documented [22, 24, 34]. if sedentary behaviors substitute time spent on physical activity, the favorable mental health effects of physical activity can not occur. the negative association found for overall leisure time and tv viewing with mental health is in line with this mechanism; however, the lack of an association between sitting in general and mental health does not support this explanation. another mechanism refers to the social withdrawal hypothesis, which proposes a positive association between tv viewing time, removal from social interaction, and a subsequent increased risk of depression. the association found in the present study for tv viewing and poorer mental health supports this hypothesis. in addition, the lack of an association for sitting at work and mental health may also support the social withdrawal hypothesis, since most jobs take place within a social context. the finding that the association between sitting and mental health in particular exists for time spent tv viewing might also be explained by the mechanism that tv viewing can be associated with energy-dense snack consumption and snacking behavior, both of which are known to be related to obesity [20, 21]. moreover, as a possible explanation, depressive symptoms have been associated with unhealthy food choices, leading to weight gain and, in the longer term, obesity [36, 37]. thus, the association between tv viewing and poorer mental health among the obese workers may be explained by the related unhealthy food consumption while viewing tv. all in all, considering the findings that in case of significant associations leisure time sitting and especially tv viewing was consistently associated with poorer mental health status, it can be argued that it may be the context of the sitting rather than the length of sitting time that is important in the association with mental health. a notable finding of our study is the role of weight status with a clear association between the time spent viewing tv and poorer mental health among healthy weight nonworkers as well as among obese workers. a possible explanation for the differing associations found by weight status among workers is that obese workers consume more unhealthy food and beverages when viewing tv (compared to the healthy weight and moderate overweight workers), which may make them feel guilty, decrease their self-esteem, and negatively impact their mental well-being. however, it should be emphasized that the current status of knowledge in this field is explorative, and an obvious explanation for the present findings can not be given. instead, more research is necessary to investigate the relationships suggested by this explorative study before elaboration. first, the data on sedentary behaviors were derived by means of self-report, which challenges reliability and validity. as is well known, subjective methods or self-reports are likely to produce biased measures of the behavior of concern, that is, the amount of sedentary behavior. because of the increasing awareness of the role of sedentary behavior, it was decided to measure sitting time in the fifth round of the doetinchem cohort. for the present study, we used sedentary behavior questions that were in line with the structure and format of the physical activity questions. the latter were designed for inclusion in the epic study and appeared to be of satisfactory reproducibility and relative validity. currently, the psychometric characteristics of these sitting questions are unknown, and, until we have better data, future population-based research on sedentary behaviors should develop reliable and valid measurements for various sedentary behaviors. for the present study, we treated the available variables for sitting time rather conservatively, analyzing only respondents with complete data (i.e., no missing values for any variables of sitting time). although the participants were asked to their working status, no further questions on the profession or job roles were included, which can be considered as a limitation of a study. further, the respondents of the doetinchem cohort study may not be fully representative of the dutch population because respondents live in one (rural) town in the netherlands and had a very healthy profile with, for instance, a low prevalence of mental illness, which might also have challenged the power of the analyses. the selection of workers may not be compared to the general dutch working population as the workers in the current study were considerably younger than the nonworkers (who averaged 66 years). this may have resulted in disparate (sedentary) time-spending patterns and health status, simply and solely due to age. however, as the age-adjusted analyses did not show notable differences, we believe the age-related impact on the results is negligible. we examined the associations by linear regression analyses and used a continuous measure for sitting behavior. however, it can be argued that the association between sitting time and mental health is not linear, that is, an increased risk for poorer mental health related to an increase in each weekly sitting hour. instead, using tertiles or another way of categorizing, the amount of sitting time may have shown significant associations given a certain cutoff point for sitting time. in an additional analysis, we examined the associations for categories of tv viewing (< 2 hr/day versus 2 hr/day), but this did not change the conclusions (data not shown). first, it is recommended that longitudinal research be performed to confirm the current findings and examine the direction of the relationship. additionally, it would be more than interesting to test potential behavioral mechanisms. to specify, future research is needed to investigate the mediating role of physical activity, dietary habits, work status, and overweight in the relationship between sedentary behavior and mental health. finally, as mentioned earlier, the development of reliable and valid measurements covering the entire range of sedentary behaviors is strongly recommended. on the other hand, this study is innovative as it explored the associations between various sedentary behaviors in domains where people spend a substantial part of their day and poor mental health. another strength is that we used body weight and height, measured by trained and experienced assistants. in conclusion, the present explorative study confirms the relationship between tv viewing time and poor mental health as suggested in earlier studies, with bmi and working status being effect modifiers, but this association does not hold for spending time in other domains of sitting. further longitudinal research is needed to confirm the results and to determine the causality in the relationship between sedentary behaviors and mental health. in addition, our data suggest that work status and weight status should be taken into account when studying the relationship between sitting and mental health.

objective. to explore the associations between sitting time in various domains and mental health for workers and nonworkers and the role of weight status. design. cross-sectional analyses were performed for 1064 respondents (47% men, mean age 59 years) from the doetinchem cohort study 2008-2009. sedentary behavior was measured by self-reported time spent sitting during transport, leisure time, and at work. mental health was assessed by the mental health inventory (mhi-5). bmi was calculated based on measured body height and weight. results. neither sitting time during transport nor at work was associated with mental health. in the working population, sitting during leisure time, and particularly tv viewing, was associated with poorer mental health. bmi was an effect modifier in this association with significant positive associations for healthy-weight non-workers and obese workers. conclusion. both bmi and working status were effect modifiers in the relation between tv viewing and mental health. more longitudinal research is needed to confirm the results and to gain insight into the causality and the underlying mechanisms for the complex relationships among sedentary behaviors, bmi, working status, and mental health.

PMC3228286

pubmed-1081

it is estimated that about 3% of the world's population has been infected with hcv and 170 million are chronic carriers at risk of developing liver cirrhosis and/or liver cancer. male gender is thought to be one of the critical factors in the progression of hcv infection. besides, the development of hepatic fibrosis is faster in postmenopausal than in premenopausal women. in addition, serum total testosterone is associated with increased risk of both advanced hepatic fibrosis and advanced hepatic inflammatory activity in hcv infected men. however, early menopause associated with lack of svr among women with genotype 1 hepatitis c virus infection. descriptive analytical study included 44 female patients, proven to have chronic hepatitis c infection by polymerase chain reaction (pcr) and 44 control females, age matched to the patients, were selected from healthy blood donors, proven to be negative for hcv on hepatitis c antibody test. patients were recruited from virology center in ismailia fever hospital, a referral center for treatment of hcv in ismailia under the supervision of the ministry of health as part of the national project for combating viral hepatitis. patients were subjected to thorough history taking, clinical examination, and routine workup including complete blood picture (cbc), serum transaminases (ast, alt), total bilirubin, albumin, international normalized ratio (inr), alpha fetoprotein (afp), and hcv quantitative pcr. histopathological examination of histological activity and degree of hepatic fibrosis, of ultrasound guided percutaneous liver biopsy, was performed according to metavir's score. serum estradiol, progesterone, and total testosterone were assessed using immulite 1000 (siemens, immulite, catalog number lke21 for estradiol, lktw1 for total testosterone, and lkpw1 for progesterone), a solid-phase enzyme-labeled, chemiluminescent immunoassay. the light intensity depends on a chemical reaction using a labeled enzyme and a chemiluminescent compound supplied as the enzyme substrate in excess to assure saturation kinetics. patients were classified according to their reproductive status to 22 premenopausal and 22 postmenopausal females in each group (patients and controls). further grouping of female patients according to (1) treatment (combined interferon and ribavirin therapy) response (nonresponders: patients who had detectable hcv rna at weeks 12, 24, and 48; relapsers: patients who had detectable hcv rna 24 weeks after stopping treatment; and responders: patients with sustained virological response (svr) with undetectable hcv rna six months after stopping treatment), (2) viral load (< 600,000 and 600,000), and (3) fibrosis stage (f2 and>females included were nonsmokers, of reproductive age group (i.e., with regular menses, not pregnant or lactating), 18 years, and postmenopausal females (i.e., no menstrual period for 12 consecutive months). chc females having hepatocellular carcinoma (hcc), coinfection with human immunodeficiency virus (hiv), coinfection with hepatitis b virus (hbv), other causes of liver disease (alcoholic, autoimmune, and wilson disease), previous liver transplant, hormone replacement therapy, hormonal contraception, and history of active substance or alcohol consumption were excluded. all regulations adopted by the ethics committee in faculty of medicine, suez canal university, including patient consent were considered and approved. quantitative parametric variables were presented by mean and standard deviation (sd) and compared by student's t-test. the demographic, clinical, biochemical, and histopathological data of the studied subjects are shown in table 1. similar distributions were noted for age, bmi, age at menarche, marital status, reproductive status and the presence of diabetes and/or hypertension in hcv female patients, at reproductive age and menopausal group, and their respective healthy controls. among the baseline laboratory data platelets count and albumin levels were significantly lower (p=0.007 and 0.03, resp.), while inr level was significantly higher (p=0.005) in the menopausal patients compared to the reproductive aged patients. menopausal women had worse indicators of disease severity (fibrosis: p<0.001; activity: p=0.045) and reduced response to treatment (p<0.001) compared to reproductive aged women. hormonal levels in the studied subjects showed that estradiol level is higher in menopausal patients compared to their healthy controls (p<0.001) (table 1). similarly, menopausal hcv infected females have significantly higher level of total testosterone than controls (p<0.001). total testosterone level is lower in reproductive aged hcv infected females than menopausal hcv infected females (p<0.001). progesterone level in hcv infected females of reproductive age group was higher than in menopausal hcv infected females (p=0.0014). the relation between fibrosis and hormonal levels in reproductive aged and menopausal patients is shown in table 2. estradiol level appeared to be higher in the group with fibrosis stage f2 than the group of fibrosis stage>f2 (p=0.005) for reproductive aged patients. in menopausal patients total testosterone and progesterone levels were significantly lower (tt: p=0.002; prg: p=0.023), while estradiol level was significantly higher (p=0.003) in group with fibrosis stage f2 than the group of fibrosis stage>f2. the relation between virological response and hormonal levels in the studied groups is shown in table 3. while the majority of the reproductive aged women responded to hcv therapy, only 13.6% appeared to be nonresponders and 9.1% were relapsers. in menopausal patients, total testosterone and progesterone levels were higher in the nonresponder group than in the responder group (tt: p<0.001; prg: p no t-test was done for reproductive aged patients as there were great differences in numbers of each group, which can not be compared statistically. the study of menopausal patients included one patient who showed relapse in response to treatment with hormonal levels (e2=97.3, tt=29.00, and prg=0.60). table 4 showed that the comparative relationship of hormonal levels and viral load in both groups (reproductive aged and menopausal females) appeared with no statistically significant value in all variables. table 5 showed the correlations between hormonal levels in reproductive aged and menopausal patients and the fibrosis stage, activity grade, and virological response. table 6 showed the relation between estradiol level and fibrosis in reproductive aged and menopausal patients; lower estradiol level was associated with significant increase of fibrosis level in reproductive aged patients between 35 and 50 years and menopausal patients between 47 and 55 years (ra: p=0.037; m: p<0.001). the relation between estradiol level and virological response in reproductive aged and menopausal patients (table 7) showed that estradiol level was significantly lower with nonresponders in menopausal patients between 47 and 55 years (p=0.03). the findings of our study reveal that chc infection is associated with elevated levels of estradiol, total testosterone, and progesterone in both pre- and postmenopausal females when compared to their healthy controls. this may be explained by the impaired metabolism of these hormones as a result of the defective liver function in chronic liver disease patients [913]. menopausal hcv infected women had higher levels of estradiol, total testosterone, and progesterone when compared to their healthy controls (p<0.001,<0.001, and<0.001, resp.). on the other hand reproductive aged women had statistically nonsignificant increased levels of these hormones when compared to their healthy controls (p<0.28,<0.346, and<0.80, resp.). menopausal greek females with hcc females had also higher levels regarding estradiol and testosterone compared to their healthy controls. to our knowledge there were higher significant level of total testosterone and lower significant level of progesterone in menopausal women with chc compared to females of reproductive age with chc, and this was not the case for estradiol level that showed a slight, however, nonsignificant decrease (p=0.093). on the other hand the comparison between the same groups (menopausal and reproductive aged females) in control women showed higher significant levels regarding estradiol and progesterone levels in reproductive age females (p<0.001,<0.001, resp.) and nonsignificant difference in testosterone level between both groups. hcv infection is associated with increased hormonal levels of estradiol, total testosterone, and progesterone in both groups reproductive aged and menopausal women; moreover estradiol and progesterone levels decreased with age, while total testosterone level increased with age in hcv group. in addition, although hormonal levels in reproductive aged group were higher than their healthy controls they are of statistically nonsignificant values and appeared to be minimally affected by hepatitis c, while menopausal group had hormonal levels high enough to be statistically significant in all variables compared to their healthy controls, providing evidence that this group was highly affected by hepatitis c. our study revealed that women of reproductive age had lower disease severity as measured by the liver necroinflammation activity and fibrosis compared to older menopausal women. the high estradiol and progesterone levels and low total testosterone level in the reproductive aged patients may in part have protected against the development of severe liver injury. in contrast, menopausal women exhibited greater disease severity, probably due to the decline in estradiol and progesterone levels and the rise in total testosterone level that occurs with menopause development, supporting the concept that the progression of fibrosis in women is not on the same pace: mild during reproductive age and severe after menopause. 2012 conducted a study on four groups of women divided according to their reproductive stage (fully reproductive, premenopausal, early menopausal, and late menopausal) in addition to four age-matched groups of men serving as controls. according to this study they found that liver fibrosis was advanced in the early menopausal hcv infected women compared to fully reproductive or premenopausal women. in addition, late menopausal women had higher liver fibrosis compared with younger women. the favorable role of estrogens in liver disease has also been suggested by shimizu et al., 2001, and maffei et al., 2004, two case reports, in which different pathological conditions required prolonged estrogen treatment in two young men, one with hepatitis c and the other with nonalcoholic steatohepatitis. in the first case, the addition of estradiol reduced disease activity and maintained viral loads at lower levels than those observed before treatment. in the second case, it reversed hepatic steatosis and insulin resistance [15, 16]. a number of molecular mechanisms could explain the protective role of e2; for example, e2 inhibits the transforming growth factor- (tgf-) b1 expression and hepatic stellate cell (hsc) activation, thereby suppressing the induction of hepatic fibrosis [1517]. in addition, e2 also downregulates tumor necrosis factor (tnf) alpha, interleukin-6 (il-6), and il-1b, mediators contributing to hepatic necroinflammation and the activation of hscs [1820]. moreover, e2 possesses antioxidant, antiapoptotic activities in fibrotic liver and cultured hepatocytes [21, 22] that prevented the accumulation of monocytes-macrophages and inhibits proinflammatory cytokine production, whereas progesterone may counteract the favorable e2 effects [23, 24]. the total testosterone level was significantly higher in menopausal hcv infected females compared to reproductive aged hcv infected females. this finding is in agreement with the recently reported positive correlation between testosterone level and increased risk of both advanced hepatic fibrosis and advanced hepatic inflammatory activity in hcv infected men, in which higher unopposed level of testosterone related to higher severity of the disease and increased risk of hcc in men. potential explanations for the discordant findings of our study and those studies may include differences in underlying target populations, host factors, or difference in viral genotype. our findings of excess testosterone-associated risk in hcv positive females are consistent with the findings of increased liver cancer risk in males who abuse anabolic steroids, in androgen-treated fanconi anemia patients, in women with hyperandrogenemia secondary to polycystic ovarian disease, and in hbv positive taiwanese males with higher serum testosterone level [2931]. to our knowledge no studies addressing the changes in progesterone level have been conducted yet. our study showed that menopausal patients had poorer responses to combined therapy than reproductive aged patients (menopause versus reproductive age: p<0.001). previous studies including genotype 1 (most common genotype in japan and italy) highlighted the same findings [7, 32, 33]. the relationship between hormonal parameters in menopausal women and virological response showed that higher total testosterone and progesterone levels were significantly associated with unfavorable outcomes (p<0.001 and<0.001, resp.). a number of previous studies suggested, however, a potential link to estrogen secretion [32, 33]. 2012, used raloxifene hydrochloride (rlx) (oral selective estrogen receptor modulator) plus soc (standard of care) treatment in postmenopausal women with genotype 1b chronic hepatitis c; the svr rate was significantly higher for rlx plus soc patients (61.3%) than for soc only patients (34.4%) (p=0.0051). these inconsistent results may be explained by the difference in host genetic factors, viral genotype (egypt common genotype 4 versus japan common genotype 1), or ethnicity. impairments in humoral, cellular, and innate immunity in the elderly and modulation of inflammatory factors, such as il-6 and tnf-, at menopause may be another important factor which are responsible for decreasing successful responses to treatment in menopausal patients [7, 35]. our study revealed that there was a statistically nonsignificant difference regarding viral load values between the two groups. besides, the comparative relationship of hormonal levels and viral load appeared to be of statistically nonsignificant value in all variables of both groups (menopausal and reproductive aged females). this finding is supported by one in vitro study that treated human hepatoma-derived cell line (huh-7.5 cells) with e2 and prg and found inhibition of hcv virion production (in case of e2 only) but not hcv rna replication or hcv protein synthesis. on the other hand, to our knowledge, no studies were found addressing its relation to total testosterone level. the present study explored the possible involvement of female sex hormones in the pathogenesis and/or progression of liver disease in hcv infected egyptian females. we observed that lower estradiol level is significantly related to fibrosis severity in chc females, while higher total testosterone and progesterone levels are significantly related to fibrosis severity in chc menopausal females only. besides, higher total testosterone and progesterone levels are related to poorer treatment response in chc menopausal females, while estradiol level is not. additionally, the detected higher hormonal levels did not have significant relation to viral load in both groups. we suggest that screening of progesterone and total testosterone levels should selectively target females with high grade fibrosis. our findings underscore the potential favorable effects of antitestosterone treatment to target hcv infected females. we assume that giving hormone replacement therapy to infected menopausal females would not have a beneficial effect regarding hcv course or treatment response.

chronic hepatitis c (chc) course revealed differences between men and women. male gender and postmenopausal women are thought to be of the critical factors affecting hcv infection progression. the study aimed to assess female sex hormones and their relation to disease severity and treatment in hcv infected females. subjects were divided to 2 groups: 44 chc female patients and 44 controls. both groups were classified to premenopausal and postmenopausal females. serum estradiol (e2), progesterone (prg), and total testosterone (tt) were assessed using chemiluminescent immunoassay. our results showed that menopausal patients had significantly higher levels of estradiol, total testosterone, and progesterone compared to controls (p<0.001). reproductive aged patients had lower level of total testosterone compared to menopausal patients (p<0.001). hcv infected females of reproductive age had higher level of progesterone compared to menopausal hcv infected females (p=0.0014). indicators of disease severity and treatment response were significantly worse in menopausal women compared to reproductive aged women (fibrosis: p<0.001, activity: p=0.045, and treatment: p<0.001). we observed that lower estradiol level may be related to fibrosis severity in chc females. higher total testosterone and progesterone levels may be related to fibrosis severity and poor response to treatment in chc menopausal females only.

PMC4590939

pubmed-1082

when fully activated, the more potent part of the host immune mechanism comes into play, especially when the proper immunogen characterizing a specific antigen expressed by the tumor is delivered at a therapeutic level. mounting evidence from both in-vitro and in-vivo studies at precision biologics and other research groups suggest that this process is represented mainly through a b cell response, producing the needed levels of the specific igg1 that can bring tumor growth under control 2-5. under normal circumstances however, the needed level of tumor antigen expression to induce the proper host response is low. therefore the host attempt to gain control of the situation by the process of tumor surveillance is not an effective mechanism in most circumstances, and progression of disease will be noted. there is no question that the presences of cytotoxic t-cell lymphocytes permeating a neoplastic process have some relevance in helping to achieve a beneficial response. in a recent study from sloan kettering however, in evaluating the presence of til (tumor infiltrating lymphocytes) cells in patients with colorectal carcinoma undergoing surgery for liver metastasis, it was found that the existence of cytoxic cells could be shown to have some benefit, but the presence of t- regulatory foxp3 cd8 cells had a negative outcome in terms of survival 6. similarly, facciabene et al. found that t-regs are potent immunosuppressive cells that help to enhance progression of the malignant lesion thru limiting host immunity and promoting tumor angiogenesis 7. data that is now being accumulated from various clinical trials have failed to support present methods being employed or planned, for delivering cytotoxic cells as a definitive approach to controlling both primary and metastatic lesions. ongoing clinical trials utilizing targeted monoclonal igg1 's directed against immunogenic tumor proteins now appears to offer the best opportunity for controlling if not curing the metastatic malignant process when the naked antibody is delivered in combination with other antitumor agents. the major goal for employing this approach is first to have isolated and characterized those immunogenic proteins characterizing the malignancy and subsequently for developing the monoclonal capable of targeting the immunogen which most often represents a mutated or post translational modification of an existing oncofetal protein. the term tumor infiltrating lymphocytes (til) has been applied to those cells derived from the tumor parenchyma and is believed to represent a host response aimed at helping to control tumor growth. one of the first descriptions characterizing this process was introduced in 1949 when moore 8 published his classic paper describing tumor infiltrating immunocytes, associated with breast cancer. the process defined by the pathologist, was termed medullary cancer of the breast. here, patients with this form of disease were considered fortunate in having a better prognosis with regard to survival based on the presence of the lymphocyte infiltrate. among several of the first group of patients with breast cancer that we had treated at sloan-kettering, this took place several years after moore published his findings with this form of breast cancer and as such the initial impression was that these patients would have, with little question, a favorable outcome in terms of prognosis. within months of surgical resection, each of these node negative patients presented with distant metastasis. in attempting to resolve this issue of host protection by an infiltrative lymphocytic process within the tumor, new questions arose, all with regard to the failure to define an improved survival especially in tumors such as medullary carcinoma. it appeared that much of the information describing prognosis for this tumor type was frequently misleading and that medullary cancer of the breast was in reality a high grade malignancy with poor prognosis. 9 reviewed over 100 cases of this so called disease process, dividing the patients into 4 groups based on the level of lymphocyte infiltration it became apparent early on, that the greater the level of lymphocyte infiltration within the breast tissue, the poorer the prognosis. it was very obvious that the presence of tumor infiltrating lymphocytes did not bode well in terms of controlling the malignant process and did not, as originally described, represent a major attempt by the host to control tumor as it continued to grow. this particular finding continued to remain equivocal until dudley and rosenberg 10, in isolating and culturing infiltrating lymphocytes from tumor specimens, now termed till cells, was able to demonstrate some benefit, but still an insignificant response following the isolation, scaling up, and delivery of large numbers of such til cells to the host presenting with metastatic cancer. while a partial response was seen in a few patients with metastatic melanoma, it did not appear to represent, from a clinical point of view, a major change in altering survival of those patients with metastatic disease. in 2006 11 morgan and dudley further demonstrated that the receptor of t-cells could be transferred to immune cells as a form of gene therapy and again when delivered in combination with chemotherapy and high dose il-2, they could demonstrate an occasional beneficial response. the problem that arose however was that in a similar situation, some patients could be shown to have a partial response independent of the use of til cells, when il-2 was given along with chemotherapy. a number of ongoing studies are still being devised and utilized whereby activated t cells are being employed in melanoma studies. whether any major benefit will be obtained from the data accrued in these studies jamieson has looked into the possibility that infiltrating lymphocytes representing the presence of a high grade inflammatory response in patients with pancreatic cancer does confer some beneficial response. it appears in some instances that the presence of this response does suggest prolongation in survival. whether any specific cell type such as the presence of nk cells is associated with clinical benefit was not apparent 12. a further analysis of the possible mechanisms resulting from activation of a cellular immune response appeared in a study by schietinger et al.13 they reported that bystander killing of cancer required the cooperation of cd4 and cd8 cells. experimental cancers could be eradicated by such t cell combination targeting the tumor stroma as a major factor in bringing the lesion under control. jiang and mann 14 looked further into the phenomenon and possible benefit of immune cells entering into the tumor matrix. they described the activity of such infiltrating cells with regard to tumor lysis and noted rather, that lymphocytes entering tumor parenchyma appeared in many instances to help chaperone tumor cells within the lesion to the lymphatic and vascular systems, thus enabling the tumor cells to metastasize. no antitumor response was noted by these cells in their association with adjacent malignant cells. they therefore categorized infiltration of tumor by lymphocytes in negative terms and regarded this phenomenon as a failure in the host response, attempting to bring existing tumor under control. where it was felt that existing immunocytes in the host demonstrated some degree of impaired function, specific monoclonals were developed that could be used to restore these functions 15. as such immunomodulatory antibodies directed against cytoxic t cell associated antigen 4 (ctla-4/cd52) and programmed cell death ligand 1 (pdl-1/cd274) there have however been a limited number of patients who appear to benefit from such immunomodulatory antibodies. the factors involved here were felt to be possibly being due to an inadequate number of, as well as impaired cytotoxic lymphocyte activity. with this in mind, a more plausible approach appeared to be in directing the immune system to target those immunogenic proteins found on the surface of the tumor; those that characterize the specific tumor system, i.e., colon, pancreas, lung etc. while most foreign cells considered as invaders, such as bacteria and viruses, contain sufficient levels of the target antigen to allow the host immune system to control their presence, when one considers the cancer cell as a potential foreign invader, the level of tumor antigen/immunogen present is too low to allow for effective control. here one needs to define the tumor associated antigen (taa) and present it to the host in sufficient amounts (threshold level) to allow an effective host immune response to occur. a more rational approach leading to an understanding of how host immunity could be properly as well as effectively activated was described by hollinshead 16. during the 1980 's when the hollinshead vaccine was approved for use in treating patients undergoing surgery for advanced neoplastic lesions, the length of survival among those receiving pooled allogeneic antigen preparations was found to more than double over those undergoing surgery alone whereas recipients receiving the vaccine developed enhancement in both their cell and humoral responses, the one factor that appeared most responsible for improved survival, was the ability to produce an adequate and prolonged level of an igg1 antibody directed against the tumor antigen. failure to develop a sustained serum level of the antibody capable of targeting tumor antigen expressed on the cell surface membrane, resulted in recurrence in spite of the presence of an adequate t cell response. the important factor here was that the vaccine was specific for the tumor system being treated and that it was delivered at a threshold level of approximately 700-1000 gm. this preparation was given at antigenic levels more than 20 times that of the immunogenic proteins present within the patient's own tumor system. this in essence precluded the use of the patients own tumor for developing effective personalized vaccines as had been directed by the fda. in a paper by hollinshead, takita and stewart 17, one can easily recognize the improved and sustained survival seen in lung cancer patients who received a tumor antigen preparation. pooled allogeneic protein was delivered in the form of a vaccine plus adjuvant following resection. there were no restrictions in the use of such preparations at the time, since hpv, hepatitis b and c and hiv were not considered major threats in producing and delivering such preparations. results obtained for patients receivng such vaccines in the above study were compared to those having undergone surgery alone and who therefore served as controls 18 (fig.1). on completion of the vaccine trials going into the 1990 's and at the suggestion of the fda, it was felt that the pooled allogeneic vaccines could have some form of viral contamination and as such should not be further utilized for therapy. rather they suggested that the tumor proteins in the vaccine be used to produce monoclonal antibodies and that such antibodies be employed to further define the structure of the pooled proteins by immunoprecipitation and mass spectroscopy. at this particular time, adcc (antibody dependent cell cytotoxicity) was coming into vogue for evaluating the ability of antibodies to induce a form of tumor lysis. such studies were being performed on carbohydrate antibodies such as 17.1a. as a control, one of our monoclonals targeting colon cancer termed 31.1 was utilized. it is readily apparent that a protein antibody such as 31.1 used to define an immunogenic glycoprotein can be far more effective than what one sees with a carbohydrate antibody such as 17.1a (fig.2). considering that colon tumor cells in culture, proliferate at about 6-10% q 6hrs. one would expect from this data that that nothing less than a 30% adcc would give the needed clinical response. when the monoclonal antibody 17.1a, now termed panorex, was utilized in clinical trials for patients with dukes c2 colon cancer, it was not unexpected to find absence of a significant improvement in survival. one would anticipate that a protein derived monoclonal, with an adcc in excess of 50% and delivered at the right therapeutic dose could achieve a long needed clinical response. this became the target of the therapeutic trials at precision biologics knowing that with monoclonals delivered intravenously, the rapid tumor response seen in a matter of hours could be an effective way for treating patients with recurrent cancer having failed chemotherapy 19. animal studies that were performed were planned to demonstrate that the proper igg1 's delivered to nude mice presenting with fully established human colon or pancreatic carcinoma could be brought under control. in all such studies comparing nonspecific iggs to those igg'1 derived from the tumor antigen preparations of hollinshead, the antibodies for potential human trials were chimerized since any adcc response would rely on the delivery by the antibody, of nk cells attached to receptors on the human fc. each of the monoclonals that have been developed by our group for therapeutic use is now in the process of being humanized. in terms of colon and pancreas cancer studies, we are presently in phase iia trials with the chimeric version of the antibody neo 102 targeting an oncofetal protein expressed in both colon and pancreas cancer. each represents an oncofetal status of the expressed protein, wherein at the time of malignant expression of the lesion a mutation has been characterized which represents either a gene mutation or post translational modification within the core peptide of the corresponding oncofetal protein. the monoclonals that target these proteins are effective in both diagnosing the presence of shed antigen representing tumor markers in the serum, are capable of detecting the presence of early as well as late transformation within normal appearing cells, and when delivered intravenously, can hunt, seek and destroy any cell expressing the antigen. a recent publication by arlen et al from our group covers how our monoclonals effect the clinical activity of colon and pancreas cancer and also serve to diagnose the presence of such lesions by elisa and ihc 20. considering that the monoclonals we are employing induce a number of different antitumor responses in addition to adcc and that the effect on tumor can occur within several hrs of administration, it appeared ideal to employ monoclonal antibody therapy in patients with recurrent tumor having failed chemotherapy such as those with metastatic pancreas and colon cancer. we are hoping that as trials progress, that we can show major changes in clinical response when the naked antibody is delivered in combination with chemotherapy and that a possible follow up to the initial antibody approach will be delivery of the antibody conjugated with an alpha emitter and possible addition of immune stimulants to further enhance an overall clinical response. while many different approaches have been investigated in terms of controlling cancer growth including use of those monoclonal antibodies that minimize vascular proliferation or attack epidermal growth factors as well as blocking signaling pathways thru tyrosine kinase inhibitors, we believe that the precision biologic approach using targeted monoclonal therapy is one of the more effective approaches to utilize. when delivered initially as a naked therapeutic monoclonal antibody and later in combination with other antitumor agents, it is felt that this approach can offer the best possibility for achieving a cure, even in the metastatic setting. later on, as we achieve our goals in targeting recurrent tumors with our therapeutic antibodies, the use of peptide vaccines, several which have already been designed, will be introduced to help prevent the high rate of recurrence of malignancy seen after complex operations such as the whipple (pancreatectomy). initial evaluation of 12-20 mer peptides derived from the epitope binding sites on the altered taa from which the monoclonals have been derived; suggest that such epitopes when delivered in the form of a peptide vaccine can turn on the full immune response. further on in the future, we may consider employing polyvalent peptide combinations to possibly prevent the development of a malignant disease process similar to what can achieve by employing antiviral vaccines.

in a recent issue of nature, an article appeared discussing the issue of sizing up a slow assault on cancer (nature 2013;496:14-15). this article attempted to clarify various approaches that the clinician might employ in bringing cancer under control. it also discussed the role of the immune system with regard to its capability for controlling tumor growth. in addition, it covered possible directions that might be taken to improve present responses to immunotherapy based on utilizing t-cell activity directed against the tumor. while there is some validity to the concept that cell mediated immunity is utilized by the host in its attempt to control evolving malignancy, this process actually represents only a minor role taken by the hosts immune system to accomplish what is needed for tumor control. clinical studies at precision biologics have demonstrated that for tumor growth to be effected properly by the hosts immune system, expression of a specific humoral igg1 response directed against immunogenic tumor glycoproteins on the cell surface membrane, constitutes the primary method needed for tumor control. failure to obtain significant levels of the needed igg response almost invariably results in recurrence and progression of disease.

PMC3701812

pubmed-1083

hormones, paracrines, autocrines and other mediators define the permeability of the endothelial barrier, the anti-thrombotic nature of the endothelial cell surface and endothelium-dependent blood pressure regulation (reviewed in current special issue; and in libby 2002; luscher 1990; landmesser and drexler 2007; vierhapper et al. 1990; wojciak-stothard and ridley 2002; palmer et al. endothelial mechanobiology is a young field of research and little is known about mechanics-dependent signaling pathways. this is mainly due to the lack of proper techniques to quantify mechanics in living cells. over the last decade, however, considerable progress has been made in various techniques, such as atomic force microscopy, laser tweezers, optical trap, pipette aspiration and microrheology. experimental science is now equipped with a full tool kit facilitating the investigation of cellular mechanics and its physiological relevance (lee and lim 2007; van vliet et al.. this review will highlight recent advances in the field of endothelial nanomechanics and its impact in endothelial physiology. mechanobiology of the vascular system can be separated into cell mechanics and mechanical stimuli. on the one hand, external forces like fluid shear stress (fss), vessel wall tension, vascular hydrostatic pressure and cell cell contacts determine the mechanical stimuli in the cardiovascular system. these stresses affect endothelial function via mechanotransduction, i.e., activation of mechanosensitive pathways (tzima 2006; ando and yamamoto 2009; shyu 2009; johnson et al. the corresponding mechanosensors exhibit various elements, including mechanosensitive ion channels, adhesion proteins, tyrosine kinase receptors, or caveolae (liu et al. 2013). cell mechanics, on the other hand, describes the dynamics of cell (and tissue) elasticity, measured as mechanical stiffness and its impact on endothelial physiology. in more detail, the four most prominent and mechanically distinct compartments in the endothelium are (1) the glycocalyx, (2) the cell cortex, (3) the cytoplasm and (4) the nucleus (kasas et al. 2005; dahl et al. 2008; oberleithner et al. 2009, 2011; martins et al. 2012; weinbaum et al. 2007). recently, nanomechanics has come into the focus of research as it turned out that the stiffness of the single cellular compartments has a crucial impact on endothelial cell function. to understand the exact meaning of cell mechanics and its impact upon physiological mechanisms, it is important to define the molecular basis of the nanomechanical properties and to characterize their influence on cellular signaling processes. the endothelial glycocalyx (egc) is a thick carbohydrate-rich layer, lining the luminal side of the endothelial surface that consists of proteoglycans and glycoproteins. the proteoglycans are decorated with long carbohydrate side chains, the glycosaminoglycans, among which heparan sulfate is the most prominent in the egc. this mesh serves as a host for specific plasma proteins, soluble proteoglycans and hyaluronic acid. together, they form a dynamic and complex interface between blood and tissue (fig. 1). the total volume of the egc in the human body is about 1.7 l and its thickness varies from a few hundreds of nanometers in capillaries to a few micrometers in arteries (van den berg et al. 2006, 2008). due to its high water content and the loose network, the egc is several times softer than the underlying subcellular structures (oberleithner et al. glycocalyx and cytoskeletal organization of endothelial cells determine the mechanical characteristics of the endothelium cellular nanomechanics. glycocalyx and cytoskeletal organization of endothelial cells determine the mechanical characteristics of the endothelium one hallmark function of the egc is the transmission of biochemical and biomechanical signals from the blood into endothelial cells. different processes are known that alter the nanomechanical properties of the egc. as a polyanionic bio-gel, its volume and mechanics are regulated by the respective electrolyte concentration (wolf and gingell 1983; peters et al. it has been shown that an extracellular sodium concentration in the upper physiological range leads to a compact egc (= collapse; oberleithner et al. in contrast, treatment of endothelial cells with the polyphenol-rich compound ws1442 induces an increase in volume (= swelling) of the egc (peters et al.. the specific mechanisms of collapse and swelling depend on dominant interactions in the system (hydrogen bondings, ionic interactions, hydrophobic/hydrophilic properties, etc.) (quesada-perez et al. 2011). other processes, which modulate the nanomechanics of the egc, are shedding and biosynthesis. both can be induced by biochemical factors like hormones and enzymes (reitsma et al. 2007) or by fss (gouverneur et al. 2006; zeng and tarbell 2014). enzymatic digestion of heparan sulfate as well as treatment of endothelial cells with thrombin, lipopolysaccharides, or tumor necrosis factor compromises the structural integrity of the egc leading to reduced egc volume and stiffness (peters et al. in contrast, the biosynthesis of the egc after enzymatic degradation leads to an increase in volume and a decrease in stiffness, as has been shown in vitro (bai and wang 2012). the egc is the very first layer of the endothelium that comes into contact with blood. thus, alterations of egc nanomechanics lead to a change in the mechanical interaction between blood cells and the egc constituents. it is likely that a collapsed egc can be less deformed by fss and thereby becomes unable to transmit signals into the cell adequately, a condition that can promote cardiovascular disease. additional to their function as fss transmitters, the proteoglycan-associated heparin sulfate residues serve as attachment points for sodium ions and substances like albumin and other blood-borne proteins, hormones and enzymes (siegel et al. 1996; reitsma et al. 2007; quinsey et al. 2004; kato 2002; li et al. 1998; ballinger et al. 2004 for instance, increased plasma sodium concentration leads to a stiffening of the glycocalyx and simultaneously increases cellular sodium uptake (korte et al. 2a) is supposed to stand for a fully-functional endothelium, whereas a shedded or collapsed egc most likely exerts adverse effects on the vascular system. 2b), facilitates edema formation (salmon and satchell 2012; strunden et al. 2010), cell vessel wall interactions (constantinescu et al. 2003; henry and duling 2000; mulivor and lipowsky 2004), loss of fss perception (thi et al. 2004; mochizuki et al. 2003) and endothelial dysfunction (nieuwdorp et al. 2005, 2006; drake-holland and noble 2012). 2c) has been discussed as being a promoter of vascular diseases (peters et al. c acute collapse leads to similar functional changes as described in b but egc nanomechanics are different egc stiffness in endothelial function. c acute collapse leads to similar functional changes as described in b but egc nanomechanics are different crossing the cell membrane, the first significant mechanical compartment inside the cell is, directly underneath the plasma membrane, the cell cortex. due to the three-dimensional cytoskeletal organization, the cell cortex as well as the cytoplasm and the nucleus, can be characterized by their distinct cytoskeleton-dependent nanomechanical properties (oberleithner et al. 2009; kasas et al. 2005; dahl et al. 2008; martins et al. 2012). directly beneath the plasma membrane (50200 nm), actin is organized in form of a dynamic network (fig. 1) (miranda et al. 1974; koning et al. 2008). the cortical web, also known as peripheral actin, is made of cross-linked actin filaments (f-actin) that provide a supportive structure to the plasma membrane and its embedded proteins (pollard and cooper 2009). the organization of the cortical cytoskeleton is highly dynamic as the actin filaments are regulated by a variety of actin binding proteins (dos remedios et al. additionally, actin polymerization is stimulated by cdc42 and rac1, both members of the rho gtpase family. cortactin and other proteins, such as filamin or fascin, stabilize the actin web by cross-linking filaments. destabilization of the cortical actin network due to filament disassembly is induced by cofilin, gelsolin, or rhoa. finally, motor proteins are able to cross-link actin filaments and simultaneously facilitate the force administration to the cortical web (dos remedios et al.. a high rate of actin polymerization and a dense filament organization go along with a relatively stiff cortex, whereas a depolymerization of f-actin results in cortical softening (kasas et al. 2005). filamin a and/or -actinin cross-link actin filaments and subsequently lead to an increased stiffness of the actin web (esue et al. 2009; kasza et al. furthermore, motor proteins (e.g., non-muscle myosin ii) contribute to cortical stiffness as they generate contractile forces within the filament network. by this, motor proteins induce a lateral tension within the cortical network leading to an inward directed tension (paluch et al. there is evidence that nanomechanics of the cell cortex has significant influence on endothelial physiology (hoffman and crocker 2009; paluch et al. in particular, nitric oxide (no) release and barrier function, both hallmarks of endothelial function, appear to be influenced by cortical nanomechanics. in the vascular endothelium, a softening of the cell cortex induces no synthesis and thereby is likely to facilitate vasodilation followed by an increase in tissue perfusion and decrease of blood pressure (oberleithner et al. 2007, 2009; szczygiel et al. 2011). under certain physiological conditions, plasma potassium concentration can increase locally up to 12 mm, e.g., due to muscle or neuronal activity (nordsborg et al. 2003; kofuji and newman 2004), which induces a rapid decrease in cortical stiffness (oberleithner et al. 2009). this softening of the cell cortex is driven by a membrane potential-dependent depolymerization of the submembranous actin web (callies et al. a decrease in cortical stiffness is generally caused by a destabilization of the cortical actin web, which verifies the physiological link of elasticity, actin organization and endothelial function (fels et al. 2012). simultaneously, the activity of the endothelial no synthase (enos) increases (fig. firstly, it has been shown that enos activity is stimulated by an association with g-actin while it is inhibited by an association with f-actin (kondrikov et al. a decrease in cortical stiffness due to f-actin depolymerization may increase the association of enos with g-actin and therefore directly stimulates no release (fels et al. mechanosensitive calcium channels in a flexible membrane are supposed to be readily activated by shear stress and subsequently increase intracellular calcium levels (knudsen and frangos 1997; kuchan and frangos 1994; galan et al. 2011). as enos is activated by the calcium-binding protein calmodulin, a soft cortex is likely to promote no release. since no is a vasodilating gas, softening-induced enos activity will lead to increased tissue perfusion furthermore, blood pressure may decrease in case of systemic softening of the endothelial cortex. fig. softening of the cell cortex, induced by cortical actin depolymerization, decreases membrane abundance of enac and endothelial sodium uptake and increases enos activity and increases endothelial barrier function cortical stiffness influences endothelial function. softening of the cell cortex, induced by cortical actin depolymerization, decreases membrane abundance of enac and endothelial sodium uptake and increases enos activity and increases endothelial barrier function interestingly, these modulations of cortical stiffness and enos activity are independent of the bulk nanomechanics of the endothelial cells (oberleithner et al. 2009; fels et al. 2012). while, under physiological conditions, potassium concentrations may rise to a larger extent only locally, other mediators potentially act more systemically, i.e., on the whole vasculature. the mineralocorticoid hormone aldosterone, as well as the cytokine tumor necrosis factor alpha (tnf), induce transient cortical softening associated with an increase in no release (fels et al. interestingly, sustained exposure to aldosterone or tnf results in an opposite effect, described in detail in the subsequent section. in addition to the regulation of enos activity, other vascular mechanisms such as endothelial permeability are influenced by cortical nanomechanics. since the link between no synthesis and cortical stiffness is the dynamic reorganization of the cortical actin cytoskeleton, it was hypothesized that the stiffness-dependent barrier function is again based on cortical actin dynamics. this hypothesis is verified by the finding that exposure to sphingosine-1-phosphate increases peripheral (cortical) stiffness in pulmonary endothelial cells and thereby increases barrier function. the barrier-enhancing effect is most likely mediated via a signaling cascade including cortactin activation and subsequent actin filament formation in the cell cortex (arce et al. in contrast, thrombin acts as the counterpart in regulation of endothelial permeability as it decreases cortactin in the cortex and at the same time increases permeability (arce et al. stimulation of myosin activity, as a second important determinant of cortical stiffness, leads to an increase in barrier function (dudek et al. hence, it may be concluded that a soft cell cortex indicates a physiological function of the endothelium. in analogy to cortical softening, increased polymerization of cortical actin and concomitant stiffening of the endothelial cell cortex has (patho-)physiological consequences in the control of endothelial permeability and the response to hormone action (hall 1984; birukova et al. endothelial stiffening by the c-reactive protein and the cathelicidin ll-37 peptide is found to have anti-inflammatory effects, possibly due to a decrease in endothelial permeability (kusche-vihrog et al. 2011; byfield et al. these effects contribute to maintaining tissue fluid homeostasis and hence counteract the increased no production and subsequent drop in blood pressure often accompanying acute inflammatory processes and septic shock. 3b), as a cell with a stiff cortex produces reduced amounts of no (oberleithner et al. 2007, 2009; kidoaki and matsuda 2007; fels et al. 2010). the phenomenon increased endothelial cortical stiffness/reduced no release was recently termed stiff endothelial cell syndrome (secs) (lang 2011). diminished no release and thus a shift of endothelial action towards increased vasoconstriction, is also the hallmark of endothelial dysfunction, a clinical predictor for expecting cardiovascular diseases later in life (endemann and schiffrin 2004; schachinger et al. one of the crucial prerequisites leading to an increase in endothelial stiffness and a reduced no production is a rather high plasma aldosterone level, a major risk factor for vasculopathies. upon prolonged treatment (> 20 min) with aldosterone, endothelial cells swell (oberleithner et al. both of these effects are blocked either by the specific epithelial sodium channel (enac) blocker amiloride or by the aldosterone antagonist spironolactone. both prevent a (further) augmentation in endothelial stiffness upon raising extracellular sodium concentrations from 135 to 145 mm in the presence of aldosterone (oberleithner et al. incidentally, these two factors, aldosterone and high sodium, also cause an increase in enac surface expression (kusche-vihrog et al. 2008; korte et al. 2012), indicating a key role of aldosterone in controlling enac activity by increasing the channel s abundance at the endothelial cell surface (alvarez et al. 2002; snyder 2002). enac is widely abundant in various tissues throughout the human body, including epithelia tissues where this sodium channel mediates the rate-limiting step of sodium transport (garty and palmer 1997; golestaneh et al. 2001). in vascular endothelium, enac is different, as the major portion of sodium exits the blood capillary system through a more or less leaky paracellular pathway (mehta and malik 2006). also, the enac expression level is clearly lower as compared to epithelial tissues (kusche-vihrog et al. recently, a direct link between enac expression and no release has been established, suggesting the functional role of enac in the vascular endothelium (jeggle et al. 2013). cells with elevated enac expression exhibit an increase in mechanical cortical stiffness in vitro and ex vivo. taken together, enac determines cortical endothelial stiffness and plays a major role in endothelial (dys)function contributing to the control of vascular tone. the mechanistic basis of the link between enac and endothelial stiffness most likely relies on the direct interaction of enac with f-actin located in the subapical pool underneath the plasma membrane (mazzochi et al. alterations in cortex formation upon changes in the enac surface expression could thus also be ascribed to this interaction, as it might increase actin polymerization in this compartment and hence increase cortical stiffness. the sequence of events, whether enac membrane insertion promotes actin polymerization or vice versa, has not yet been elucidated. in addition to chemical mediators, mechanical stimuli affect actin organization (most likely influencing cortical stiffness) and endothelial function. an in vitro increase in hydrostatic pressure, mimicking blood pressure in vivo, induces actin reorganization and affects endothelial permeability (shin et al. fluid shear stress influences actin reorganization (seebach et al. 2007) and alters the endothelial barrier (tarbell 2010; katoh et al. finally, substrate stiffness was shown to induce actin polymerization, modulating barrier function in a dose-dependent manner; substrate stiffness simulating physiological conditions improves barrier function while stiffer and softer substrates disrupt barrier function (birukova et al. the elasticity of the cell cortex can be seen as a parameter that determines endothelial physiology in a more general way. for instance, aging cells lose their elasticity due to an increased cytoskeletal organization (sokolov et al. 2006; schulze et al. 2010). even basic processes that usually occur in cellular life, such as mitosis, differentiation and development, can be related to changes in cortical stiffness (stewart et al. 2011; patel et al. 2012; kidoaki and matsuda 2007; hoffman and crocker 2009). fountain of youth and guarantees a reasonably low blood pressure and a healthy organism. apparently, the physiological impact of cortical stiffness on physiological mechanisms is highly tissue-specific. in contrast to the endothelium, a soft cortex can even indicate a pathophysiological state of a cell. in ventricular myocytes, for instance, the relationship between elasticity and no release appears to be different. there, an inhibition of myosin by blebbistatin decreases cell stiffness and simultaneous inhibits nos activity (walsh and cole 2013; dedkova et al. furthermore, it has been shown that the metastatic behavior of cancer cells directly correlates with the cell s elasticity. cancer cells with a low elasticity (soft cells) are more likely to spread than stiffer ones (ketene et al. additionally, breast cancer cells induce softening of the endothelium to ease extravasation, leading to facilitated metastasis formation (mierke 2011). while single actin filaments are predominantly found in the cortex, actin stress fibers (bundles of 1030 filaments) span the whole cytoplasm. they also contribute to focal adhesions and thus are involved in the mechanisms of cell motility (pellegrin and mellor 2007; fletcher and mullins 2010; prasain and stevens 2009). microtubules are tube-like polymerized protein (tubulin) filaments facilitating the transport of organelles and vesicles. both microtubules and intermediate filaments determine cytoplasmic (bulk) stiffness (wang 1998; janmey et al. 1991; kasas et al. 2005; herrmann et al. the molecular nature of the contribution of tubulin to cell nanomechanics has been investigated in detail (gardel et al. so far, the microtubule network is supposed to represent a compressive load-bearing component that counteracts the tensile forces generated by the cortical actimyosin web (ingber 2003). the physiological relevance in stiffness-dependent signaling pathways in endothelial cells is, however, still unclear. what is known so far is that microtubule-associated proteins (e.g., map65) directly influence the flexibility of single microtubules, most likely resulting in a change in cellular elasticity (portran et al. furthermore, in the developing organ of corti, the fibroblast growth factor induces a microtubule-dependent decrease in cell stiffness leading to hearing loss (szarama et al. intermediate filaments, of which vimentin is the dominant network-forming member in the endothelium, support the three-dimensional organization of the cell and its organelles (kamei 1994). their mechanical properties as well as their contribution to cell mechanics have been reviewed by herrmann et al. intermediate filaments play a key role in mechanotransduction as mutation or deletion of several intermediate filament proteins leads to cell fragility, heart failure and muscle dystrophies. even leucocyte diapedesis and endothelial nitric oxide release depend on proper intermediate filament formation (herrmann et al. although the role of intermediate filaments in (endothelial) physiology is well documented and the molecular contributions to cell mechanics are known, evidence for a direct link between intermediate filament-dependent mechanics and endothelial function is still missing. data on intermediate filament and microtubule mechanics and its impact on endothelial physiology indicate that several different nanomechanical signaling pathways exist that await future investigation. each individual component of the cellular cytoskeleton described in the previous sections is directly linked to the cell nucleus. plectin (nesprin-3) provides a link to the cytoplasmic network of intermediate filaments (wilhelmsen et al. 2005), whereas nesprin-1/2 mediates binding to microtubules and the actin network (padmakumar et al. nesprins connect cytoskeletal networks with the intranuclear lamin network via sun 1/2 proteins (haque et al. it is therefore conceivable that all of the mechanical stimuli perceived by the cell through actin, microtubule, or intermediate filament networks are integrated on the level of the nuclear lamina. similar to the cortical mechanics, the nucleus of an eukaryotic cell could also be an important contributor to the overall mechanics of the cell. nuclei of several cell types have been shown to be two- to ten-fold stiffer than the respective cytosol (martins et al., the cell nucleus could be envisioned as being a supramolecular shock absorber capable of withstanding considerable stress (dahl et al. a connection between cytoskeleton and the nuclear envelope further strengthens the notion of a direct involvement of the nucleus in mechanosensing and mechanotransduction (maniotis et al. recently, the pioneering work from the laboratory of dennis discher demonstrated that the nucleus can serve as an intracellular mechanostat (swift et al. 2013), a structure that is able to sense and respond to changes in the mechanical properties of the cellular environment by changing its own stiffness (fig. elasticity of the cell nucleus regulates gene expression and endothelial function nuclear elasticity in endothelial function. elasticity of the cell nucleus regulates gene expression and endothelial function in the light of recent advances in the field of nuclear mechanics, it is tempting to speculate that nuclei of endothelial cells could be directly involved in mediating physiological functions in response to mechanical stimuli. nuclei of endothelial cells are particularly large in comparison to those of other cell types. nuclei bulge into the lumina of blood vessels, thus being directly exposed to the shear strain exerted by the blood flow. consequently, any change in nuclear volume and/or stiffness could have a strong influence on blood flow, in particular in vessels of small inner diameters. according to hagen-poisseulle s law thus, a small change in nuclear volume, as shown and quantified in vascular endothelium in response to aldosterone (oberleithner et al. bulging nuclei could be a significant hindrance for blood flow, in particular when the nuclei stiffen at the same time. in addition, nuclei of the cells exposed to shear stress stiffen (fig. apparently, flattening and stiffening of the nuclei could be the consequence of a shape change induced by shear forces. however, the recovery in shape and, at the same time, the maintenance of nuclear stiffness upon release of the shear forces, point towards a more complex nuclear remodeling mechanism. the question, whether the expression of the lamin a network at the nucleoplasmic side a major determinant in the control of the nuclear envelope plasticity (lammerding et al. 2006)is responsible for the nuclear mechanostat function, remains open (swift et al. there is another reason indicating a potential role of lamin a in the regulation of nuclear plasticity. a mutation of lamin a, which results in an irreversible (permanent) anchoring of the mutated product in the nuclear envelope, results in a severe clinical manifestation termed hutchison-gilford progeria syndrome (hgps) (merideth et al. affected individuals undergo drastically accelerated aging and die in their teens of cardiovascular-related diseases such as stroke or myocardial infarction (gerhard-herman et al. 2012). at tissue level, major arteries of hgps patients demonstrate a severe degeneration of the smooth muscle cell layer (stehbens et al. the role of endothelial cells in the development of the syndrome has not been fully assessed to date. however, at the level of individual cell nuclei, the presence of a mutated rigid lamin a network at the inner side of the nuclear envelope has been linked to significant stiffening of such nuclei (philip and dahl 2008). it is therefore tempting to speculate that stiff nuclei cause an overall stiffening of the endothelial cell. this could result in a severe form of the stiff endothelial cell syndrome (lang 2011). in this case, the ability of the endothelial cell of sensing and responding to mechanical stimuli might be disrupted. as a result, the downstream signaling directed towards vascular smooth muscle is expected to be impaired, possibly explaining the degradation of vascular smooth muscle cell layer in hgps. in summary, the question, whether nuclear mechanics follows mechanical alterations evoked from the exterior environment as postulated by the nuclear mechanostat theory (swift et al. 2013) and/or whether any changes in nuclear elasticity could primarily alter endothelial function, will be an exciting area of cell research in the near future. in conclusion, the elastic properties of the four compartments, (1) glycocalyx, (2) cortex, (3) cytoplasm and (4) nucleus, are mainly determined by the composition of the respective structural elements. the dynamic interactions between those elements with cross-linker and motor proteins determine the mechanical properties of the respective region. nanomechanics provides information on the physiological state of the endothelial cell in terms of nitric oxide release and barrier function. a soft cell cortex, combined with a soft, well-hydrated glycocalyx, increases no formation, which is a prerequisite for a functionally intact vasculature. any changes in elasticity at the level of the egc glycocalyx, the cell cortex and the cell nucleus, can have a significant influence on endothelial function in terms of local blood flow, tissue perfusion and, finally, arterial blood pressure.

the mechanical characteristics of endothelial cells reveal four distinct compartments, namely glycocalyx, cell cortex, cytoplasm and nucleus. there is accumulating evidence that endothelial nanomechanics of these individual compartments control vascular physiology. depending on protein composition, filament formation and interaction with cross-linker proteins, these four compartments determine endothelial stiffness. structural organization and mechanical properties directly influence physiological processes such as endothelial barrier function, nitric oxide release and gene expression. this review will focus on endothelial nanomechanics and its impact on vascular function.

PMC3972433

pubmed-1084

the acute phase response represents an evolutionarily conserved mechanism of inflammatory events designed to rapidly react to infections, wounds, and injuries. it can lead to a dramatic increase (up to 1000 fold) in the levels of acute phase proteins (apps) in the circulation and, ultimately, brings about resolution of the inflammatory reaction [1, 2]. serum amyloid a (saa) one of the major apps in humans saa originates from an evolutionarily conserved multigene family ranging from invertebrates (with a wound-healing role in sea cucumbers), vertebrates, to humans, where it represents an accurate and sensitive marker of inflammation. human saa1 and saa2 are the inducible isotypes (addressed jointly as saa1/2, with over 95% sequence identity); saa3, was thought in the past to be a pseudogene, not expressed in humans; however, recently there has been a report of its mammary-associated expression found in milk. there have been three acute phase saa isotypes reported in the mouse saa1, saa2, and saa3, with saa3 being the primarily extrahepatic isoform. saa is a small protein (104 amino acids in length), 11.7 kda in size, lipophilic, and poorly soluble in aqueous solution, originally described as a component of normal serum. saa fragments were found in amyloidosis, and the accumulation of these fibrils can lead to organ failure and ultimately death. murine and human saa have been shown to form hexamers in solution, which can lead to the formation of membrane channels that could be involved in important pathological roles [10, 11]. saa1/2 has a variety of multiple functions in humans, among them it acts as a cytokine and chemokine, induces matrix metalloproteinases, interferes with platelet functions, replaces apo-a1 in high density lipoprotein particles in the circulation during inflammation, binds cholesterol and influences its efflux, and plays a role in host defense [10, 1218]. in physiological concentrations (100200 nm as measured in sera), saa is thought to act in homeostasis of inflammatory events, while at prolonged higher pathological concentrations (above 1000 nm) saa could act in a degradative manner causing injury to tissues and cells during chronic inflammatory conditions. the expression of saa has also been shown in nonhepatic epithelial cells and can play a role in tumorigenesis. its ability to opsonize gram-negative bacteria could contribute to the epithelial defense mechanism against these bacteria. saa is measured routinely in sera or plasma in the veterinary field (especially useful in equine, bovine, porcine, and also bird and fish pathologies) and has proven to be a relevant biomarker and predictor of many diseases in humans (among them cardiovascular diseases). saa was identified as an independent risk predictor of mortality following acute myocardial infarction and indicated to play a causal role in atherogenesis [23, 24]. saa mrna expression has been localized to many different human tissues, including atherosclerotic plaques, where saa protein is thought to play an active pathogenic role. some of the strongest signals in this study were observed in endothelial cells lining the lumen of coronary arteries and in macrophage-derived foam cells. the expression of saa mrna within cultured human primary coronary artery endothelial cells (hcaec) was first reported in 2007 and these cells were also shown to be highly responsive to human recombinant saa1/2, as an inflammatory stimulus, indicating a strong positive feedback onto its own synthesis. however, very little is known about the localization of saa within these cells, whether it is released and could act locally at the extracellular level or saa remains in hcaec and could influence endothelial function in an intracellular manner. so, our objective was to determine the localization of intracellular saa in hcaec and to elucidate possible associations of saa with particular cytoskeletal elements. rabbit anti-saa polyclonal antibodies were a gift from professor ernst malle (institute of molecular biology and biochemistry, medical university of graz, austria). the anti-saa antibodies used for the immunofluorescent staining were raised against synthetic peptides of saa ranging from the indicated amino acid sequences: 2744 (pab 3), 5972 (pab 5), and 6884 (pab 6). for the immunoblot analysis, eight separate anti-saa polyclonal antibodies were used, ranging in consecutive order, as raised against synthetic saa peptides from pab 1 to pab 8. (saa 117, saa 1430, saa 2744, saa 4063, saa 5972, saa 6884, saa 7994, saa 89104, resp.). cells were cultured in egm-2 m medium (lonza, walkesville, usa) containing 5% fetal bovine serum at 37c in a humidified atmosphere and 5% co2. for immunofluorescent staining, hcaec were used through passage 5 of subconfluent (8085% confluency) cell cultures. cells were fixed in 4% paraformaldehyde for 30 min at 37c, then washed in pbs. for actin staining, cells were labelled with phalloidin-fluorescein isothiocyanate (fitc) (2 m in 20% methanol) (sigma, germany). for saa, -tubulin, and vimentin, cells were incubated with rabbit antibodies against saa and/or mouse antibody against vimentin (dako, usa) or -tubulin (sigma, germany) and with the appropriate secondary antibodies conjugated with fitc or tritc (sigma, germany). the von willebrand factor was determined with immunofluorescence microscopy (abcam, cambridge, great britain). for labelling of endomembranes, a lipophilic stain 3,3-dihexyloxacarbocyanin iodide (dio6) was used. it mainly labels endoplasmic reticulum and mitochondria (molecular probes manual). a stock solution of membrane marker vibrant dio6 (0.5 mg dio6/ml ethanol) (invitrogen, molecular probes, leiden, the netherlands) was freshly prepared, and a 0.5% dilution of dio6 in culture medium was added to cells for 3 min. after washing in pbs, the coverslips with cells were embedded with antibleaching medium vectashield containing the nuclear stain diamidinophenylindole dilactate (dapi) (vector laboratories, burlingame, calif, usa) and observed with a fluorescence microscopes (nikon eclipse te 300 and axioimager z1, carl zeiss) supplemented with apotome device for generation of optical sections. in order to determine the colocalization between saa and mt, saa and vim, the pla assay (olink bioscience, uppsala, sweden) was performed according to the manufacturer's protocol. in brief, fixation, permeabilization, blockade, and incubation with primary antibodies were performed as described in the section 2.3. subsequently, the cells were incubated with the secondary mouse plus and rabbit minus antibodies. after hybridization and ligation of the oligonucleotides, the dna was amplified by addition of an amplification mixture. a detection mixture detected the amplicons resulting in red fluorescence signals. in the final step, the nuclei were counterstained with dapi and the cells were mounted with mounting medium (vector laboratories, burlingame, calif, usa). cells were analyzed with a 63x objective on a fluorescent microscope axioimager z1 (carl zeiss) supplemented with apotome device for optical sections generation. human recombinant saa (5.3 g/cm gel) (peprotech ec ltd., after transfer to nitrocellulose membranes (100 v, 250 ma, 35 min), blocking was performed in tbs with 5% milk. as primary antibodies, following washing, secondary incubation was done with antirabbit hrp conjugate (biorad, munich, germany) at 1: 200 dilution with subsequent western blot luminol reagent (santa cruz, calif, usa) and chemiluminescent detection performed following manufacturer's instructions. in order to determine the distribution of saa within hcaec and its colocalization with cytoskeletal elements, endomembranes, and the nucleus, fluorescent labeling of these components was performed in spread nonconfluent cells. to confirm the endothelial nature of these cells, the von willebrand factor was determined (figure 1(a)). labeling of saa together with phalloidin confirmed that the majority of actin filaments were at the cell periphery and clearly separated from the location of saa which is mainly concentrated in the central part of the cells (figure 1(b)). vimentin was organized as a network spreading from the nuclear region toward the cell periphery and was generally distributed in the same cell area as saa. however, double labeling of vimentin and saa revealed a rare colocalization of the two signals and thus gave a very low probability for their codistribution (figure 1(d)) with antivimentin. the labeling of saa in many locations, especially in the cell periphery of hcaec cells, largely fits in with the linear pattern of microtubular labeling providing a high probability for the actual colocalization with this cytoskeletal component (figure 1(c)). the attachment of saa to microtubules is limited to small spots of saa labeling while larger clumps of saa (could be possible multimerization of saa) appear to be nonattached to any of the labeled structures (figure 1(e)). to evaluate the data showing colocalization by double labeling of saa with microtubules and vimentin filaments, we performed the pla method demonstrating close proximity of labeled proteins (maximum distance between proteins that still enables reaction is 30 nm). the strong reaction product confirmed the colocalization of saa and tubulin (figure 1(g)) while a weak reaction product in the case of saa and vimentin (figure 1(h)) makes specific colocalization very improbable. the negative control by omitting primary antibodies gave a completely negative result (data not shown). often the strongest saa staining was observed in the nucleus (figures 2(a) and 2(a ')) and in the area closely surrounding the nucleus where the majority of endomembranes are concentrated (figure 2(c)). to find out if saa colocalizes with endomembranes, especially endoplasmic reticulum, golgi apparatus, or transport vesicles, endomembranes were labeled with a lipophilic stain dio6 that preferentially labels membranes of the endomembrane system and the mitochondrial membranes (figures 2(b) and 2(c)). the double labeling of dio6 with saa did not show any specific colocalization of the two labels making functional connection of saa to endomembranes doubtful. surprisingly, intense labeling of saa was found in tubular protrusions extending from the cells (figure 2(d)). saa was found at the tips of shorter extensions, probably filopodia, and also in longer nanotubes bridging neighboring cells. occasionally, saa labeling was detected in dilatations of nanotubes (white arrows) described as gondolas in our previous work and in extracellular membrane vesicles of cells that were attached to the bottom of the tissue culture dishes, labeled with dio6 (white arrowheads). in order to determine potential multimerization of saa, polyclonal anti-saa antibodies against specific human synthetically derived anti-saa antibodies bound to different multimers of saa following immunoblotting (figure 3), including dimers, trimers, and higher multimers. anti-saa antibodies against saa peptides 1, 4, and 7 gave a similar pattern on the immunoblots, with a strong signal around 20 kd, whereas anti-saa antibodies against saa peptides 3, 5, 6, and 8 gave the strongest monomer band signal, with higher bands appearing also at multimers and potentially indicating conformational epitopes. the cellular localization and potential functions of saa are largely unknown in extrahepatic tissues. to determine the location of saa in endothelial cells, hcaec were double labeled for codistribution of this protein with cytoskeletal elements, endomembranes, and nucleus. there was no apparent colocalization of saa found with either actin filaments and very rare with vimentin (figures 1(b) and 1(d)). however, this paper is the first, to our knowledge, indicating colocalization of saa with microtubules in hcaec (figures 1(c) and 1(e)). the colocalization was further confirmed with the pla method indicating the distance of less than 30 nm for the two proteins (as evaluated and confirmed by the manufacturer) between saa and tubulin. the pla method has recently been determined as comparable to fret (fluorescence resonance energy transfer) method in case of semiquantitative and qualitative analysis. the positive reaction with pla makes it rather unlikely for saa to be located inside any transport vesicles attached to microtubules by motor proteins, because in this case, the distance should largely exceed the maximum value enabling the reaction and even more the vesicle membrane would probably prevent the ligation process required for the reaction product to form. in conclusion, saa seems to be directly attached to microtubules giving this protein a new potential role as a cytosolic protein distinct from the already known secretory version of this protein, which is mainly found in the serum., saa-like protein had been detected using anti-saa antibodies in human placentae. saa localized to the cytoplasm of cells within the mesenchymal stroma (thought to be fibroblasts), to fetal stem vessel endothelium, and to perivascular tissue. saa had been shown to be localized to 10 nm intermediate filaments which form characteristic perinuclear bundles following treatment with vinblastine, which disrupts microtubules in cultured embryonic fibroblasts. saa-like material has also been shown previously to be present intracellularly in cultured human endothelial cells, specifically in huvec. in that study, saa was found to be localized in an irregular filament-like staining pattern in the perinuclear regions of huvec. our results showing colocalization of saa with microtubules (figure 1, antitubulin panels) explain the perinuclear concentration of saa because of the well-known and, in our figures, well-documented concentration of microtubules close to the nucleus. we have previously shown differential mrna expression of saa in hcaec versus huvec, indicating endothelial cell specificity. in our paper (figures 2(a) and 2(a ')), there is a persistent immunofluorescent labeling of saa also observed in the nucleus of hcaec that varied considerably among cells, which could point to an additional role of saa in the regulation of gene expression. a similar nuclear distribution of saa was found in macrophages where an implication for saa-dependent gene regulation was proposed. in this study, saa (or its fragments) was detected proceeding the perinuclear region and further the nucleus. within 60 min, saa was found in the cytoplasm with subsequent localization at the plasma membrane and further extrusion from the cell. this study was the first to follow the path of saa through a particular cell type. both murine acute phase isoforms of saa1.1 and saa2.1 bind well to the plasma membrane, with only saa2.1 taken up by the cell at 37c and later detected in the nucleus. this suggests that the two isoforms have differential localizations and distinct physiological roles in cells. this might very well be the case also in humans, and a more detailed analysis of the saa isotypes and their locations within cells would be prudent in the future. in addition to its putative intracellular functions, saa seems to be involved in intercellular communication based on its location in nanotubes (figure 2(d)). intercellular nanotubes (icns) are recently described thin protrusions that can connect cells which are several cell diameters apart. the discovery of saa localized in nanotubes and their dilatated regions (figure 2, bottom micrograph) previously described as gondolas indicate a possible exchange of saa among cells and the role of this molecule in intercellular communication. numerous extracellular vesicles (microparticles or exosomes) containing saa (possibly arising from the budding of the plasma membrane) also point to the proposed role in intercellular communication. since saa has been implicated in host defense, as having beneficial functions in the protection against microbes [12, 15, 33], we speculate that saa localization could be an important additional prerequisite for this process to occur, especially in epithelial cells. the microtubular association of saa in correlation to the recently found microtubular involvement in bacterial internalization into epithelial cells points to a possible contribution of microtubules bearing saa in the epithelial resistance to bacterial infection. in 2002, two groups almost simultaneously reported on acute phase saa being able to form channels in planar lipid bilayer membranes at physiological concentrations and, thus, play a role in host defense, by placing a severe metabolic strain on bacterial cells [10, 11]. electron microscopy by wang et al. revealed that these channels were formed by saa subunits arranged in hexamers, and circular-dichroism spectrum deconvolution and secondary structure prediction suggested that saa contains ~50% residues in an -helical conformation and below 10% in structure. later studies indicated that these hexamers could be totally dissociated into monomers by urea treatment, with a concerted loss of its -helical structure. we have confirmed that, upon addition of 6 m urea to human recombinant saa, there is an apparent lack of self-multimerization and only monomers are recognized by anti-saa antibodies from human sera on an immunoblot. since the studies by wang et al. were performed on murine saa and little information is available in this regard concerning human saa, the immunoblots we performed (figure 3 and) indicated that similar multimerization was occurring for human saa. no x-ray crystallographic data is currently available for saa, but it appears that the structure and function of this important acute phase protein is modulated in vivo upon binding to apolipoproteins and/or other factors into complexes in the circulation. intracellular associations of saa multimers within eukaryotic cells have been largely unaddressed; however, they could provide important clues to how saa functions within these cells and whether its locations are influenced by these interactions. saa localizes with microtubules in untreated hcaec, but not with actin filaments or vimentin. these data indicate that saa can be attached to microtubules and can possibly be transported between neighboring cells by means of nanotubes or budding vesicles. staining for saa is also found in the nucleus which indicates that saa might have nuclear-specific functions. intra- and intercellular saa could play different roles in the physiological state, depending on the environment where it is located. on the basis of the distribution in endothelial cells, saa can be predicted to contribute also to the antibacterial barrier function of this epithelium.

serum amyloid a (saa) acts as a major acute phase protein and represents a sensitive and accurate marker of inflammation. besides its hepatic origin, as the main source of serum saa, this protein is also produced extrahepatically. the mrna levels of saa become significantly elevated following proinflammatory stimuli, as well as, are induced through their own positive feedback in human primary coronary artery endothelial cells. however, the intracellular functions of saa are so far unknown. colocalization of saa with cytoskeletal filaments has previously been proposed, so we analyzed the colocalization of saa with all three cytoskeletal elements: actin filaments, vimentin filaments, and microtubules. immunofluorescent double-labeling analyses confirmed by pla method revealed a strict colocalization of saa with microtubules and a very infrequent attachment to vimentin while the distribution of actin filaments appeared clearly separated from saa staining. also, no significant colocalization was found between saa and endomembranes labeled with the fluorescent lipid stain dio6. however, saa appears to be located also unbound in the cytosol, as well as inside the nucleus and within nanotubes extending from the cells or bridging neighboring cells. these different locations of saa in endothelial cells strongly indicate multiple potential functions of this protein.

PMC3205747

pubmed-1085

the world health organization states that primary school children population is the most vulnerable group to acquire infection diseases such as parasites while their development is related to the environmental contamination as well as to the quality of consumed food. from an epidemiological, socioeconomical, and ecological point of view, the county populations possess favourable conditions that allowed children to acquire intestinal infections with a greater frequency. particularly, in famaill city, in the province of tucumn, argentina, there is little information related with epidemiologic data on children parasitoses. for that reason, the present work deals with the study of parasite-related infections detected in primary school students from the institution no. the aim of this work was to assess the prevalence of intestinal parasites in the former population in order to obtain accurate epidemiological data that can be used to program prevention schemes in this particular age group. for the cohort study, a group of 149 children from kindergarten and primary level of the school no. 124, famaill city, tucumn, was selected and monitored through the summery station. famaill, located 30 km in the south of tucumn capital district, has 32.000 habitants. the famaill district is situated in the central area of the province, limited at the north with the lules district, at the east with the leales district, at the south with the monteros district, and at the west with the taf del valle district. the personal affiliation (name, sex, and age) of each student was registered. a serial stool specimen was requested from each person, and the anal swab method for enterobius vermicularis eggs was used. each student was provided with two bottles containing 5% formalin, and an informative-explicative meeting for children, parents, and teachers was conducted prior to the sampling process. after collecting the stool samples, they were analysed at the lab station by direct smear and through the concentration method described by melvin and brooke. the diagnostic elements were visualized with and without staining by lugol or carbol fuchsine by optic microscopy. formalin-preserved stool samples and the modified ziehl-neelsen carbol-fuchsine staining of formalin-ether concentrates were used from the recovery and identification of cryptosporidium spp. diagnosis the stool samples were subjected to the koga agar plate method. from the total 149 children selected for this study, 70 were females (47%) and the rest males (53%). the studies were adjusted to the conditions of the universal declaration of human rights (1948), ethical standards instituted by the nuremberg code (1947), the helsinki declaration (1964), and subsequent amendments regulated by the national law no. no significant differences were found on regard of age and sex of the infected population. 13 endoparasite species were diagnosed but among them the protozoa were more frequently found than the helminths. blastocystis hominis (54.4%), entamoeba coli (35.6%), and giardia lamblia (24.8%) were the most prevalent protozoa. among helminths, enterobius vermicularis (27.5%) and ascaris lumbricoides (20.8%) were the most frequent (table 1). only 20 children (13.4% of the total population studied) did not present any parasite; in 36 children (24.2%) it was found only one parasite species while 62.4% of the total population was infected by two or more parasite species (table 2). it is important to remark that in all cases, the sanitary and social conditions of the studied children habitats were highly inappropriate and most deficient. it was found that more four-five (86.6%) of the students, aged 4.7 to 14, in the considered school were infected by intestinal parasites. this data is coincident with the data shown by previous works dealing with intestinal parasites in similar populations in tucumn [5, 6] but the prevalence is higher than the prevalence of these infections in other argentinean provinces [7, 8]. compared to other south american countries the prevalence detected in this study can also be considered high as mercado et al. in chile and cabrera et al. in peru described a 55.8% and 77.8% of intestinal parasite prevalence, respectively. among the protozoa, blastocystis hominis was the most prevalent parasite, this concurred with most of the epidemiological studies made in many other countries and it points out that this parasite is an emergent pathogen with the highest prevalence. milano et al. determined an endoparasite prevalence of 73.5% in 113 infants (between 0 and 14 years) from north east argentine (nea) urban area. in that work, blastocystis hominis (59.0%) and enterobius vermicularis (47.0%) were the more frequent protozoa and helminths, respectively. menghi et al. studied the prevalence of intestinal parasitoses by protozoans and helminths in an aboriginal community from salta, argentine. they found that the more frequent protozoa were blastocystis hominis (58.9%), entamoeba coli (51.8%), giardia lamblia (27.7%) and entamoeba histolytica/e. dispar (24.1%). in our study, we determined similar prevalence levels of blastocystis hominis (54.4%) and giardia lamblia (24.8%). a minor incidence of entamoeba coli (35.6%) in school children from famaill city was found, and under our work conditions we were unable to identify others species of this protozoan. have evaluated the prevalence of blastocystis hominis (18.93% 5.93%) and its clinical relevance in 162 preschool children living in bolivar city, venezuela. in the half of the studied children this protozoan was the only parasite. giardia lamblia was identified with a frequency of 39.13%, and they have concluded that blastocystis hominis was a relatively frequent intestinal parasite among the preschool children evaluated. in addition, the results obtained by wang et al. showed that blastocystis hominis in humans from huainan area (703 stool specimens examined) have a very low prevalence (3.70%), which was not related to gender and living circumstances, but they observed statistically significant association between presence of diarrhoea and infection. among helminths, the occurrence of ascaris lumbricoides and enterobius vermicularis was important. our results (27.5%) and those of milano et al. (47.0%) fully indicated that the prevalence rate of enterobius vermicularis infections was very high compared to other countries. our present data shows that the prevalence was much higher than that reported in western and southern islands of the republic of korea by park et al. (18.1%); in some rural communities of ogun state-nigeria (0.3%) by agbolade et al., and in cape town, south africa (0.6%) by adams et al.. the risk of e. vermicularis infection among school children can increase by inadequate personal hygiene, the biting nails habit, and not washing hands before meals. surprisingly, only one case of hookworm was detected, although historically famaill was considered an important area of hookworm prevalence (9.2%). in our work, there was found a lower frequency than in previous works [11, 18], where hookworms (58.0%), hymenolepis nana (31.2%), and strongyloides stercoralis (24.1%) were reported as the most frequent helminths. detected of 1.8% strongyloides stercoralis infection, in school children, while in this study we found this helminth with a frequency of 2.7%. in addition, taranto et al. studying the clinical and parasitological status of a wichi aboriginal community living in the suburbs of tartagal, northern salta, argentina, determined that the most frequent helminths were strongyloides stercoralis (50.5%). special techniques [4, 21] are required for detection of strongyloides infection and, for this reason, in past researches, the fecal levels have often been undervalued or ignored. according to pawlowski all regions cited in this paragraph might be considered endemic areas for strongyloides stercoralis infection because the prevalence rate was determined between 1 and 5%. our results indicated that the overall prevalence rate of pinworm infections was rather low and the multiple infections were outstanding because of high frequency (62.4%). it has been showed before that the main source of infection for protozoa is the ingested water. the high prevalence of this kind of parasites suggests that further studies must be done about the water quality in this community to accurate determination of the infection source of these parasites. this study showed intestinal parasitosis as critical problem of public health in children from areas where the lack of adequate sanitation conditions and unsuitable supply of water today coexist. intestinal parasitosis is a social problem with important consequences as poor school performance and impaired quality of life. this is one of few studies for determining parasitic prevalence in primary school children of north west argentine (noa) region. because of this, it is very important and we propose that regular screening and treatment programs should be started. in addition, health education on personal hygiene is required and the uneducated women should be aided with specific programs. a multispectral government action is needed.

prevalence of intestinal parasites was investigated in rural primary school children in famaill city, tucumn province, argentina. stool specimens from 149 school children were collected. the prevalence rate of intestinal parasite infections was 86.6%. no significant differences were observed in the distribution by age or by sex. blastocystis hominis was the most commonly found protozoan parasite (54.4%), followed by entamoeba coli (35.6%), giardia lamblia (24.8%), and others (16.7%). enterobius vermicularis was the most prevalent intestinal helminth (27.5%), followed by ascaris lumbricoides (20.8%), trichuris trichiura (12.8%), and others (5.4%). most of the patients had polyparasitism (62.4%), and protozoan infections prevailed over helminthic infections. these results show high rates of parasitism in the school children of famaill, which would be associated with socioeconomic factors and poor environmental sanitation conditions in this area.

PMC3658839

pubmed-1086

critical care practice is beginning to look toward more specific cellular, biochemical, and genetic interventions in order to make a significant impact on patient outcomes. in addition to the extensive cellular, biochemical, and genetic body of research in process today, the science of epigenetics has become a more frequent focus within the critical care literature over the past 5+years. though epigenetics may appear to be relatively new to us in the critical care discipline, it has actually been studied for over 70 years and was first described by conrad waddington in 1942 as the branch of biology which studies the casual interactions between genes and their products, which bring the phenotype into being [1, 2]. in simpler terms, epigenetics is the study of changes in the function of genes that do not involve changes in the dna sequence. it is the study of how the same sequence of dna can produce significantly different phenotypes as a result of differing biochemical changes that alter gene availability for protein production [1, 3]. what makes this even more fascinating than a nature versus nurture discussion is that there are a small number of known genes in which specific biochemical modifications can impact the phenotype of offspring and are thus inheritable yet do not alter base pair sequencing of dna. a classic example of this is seen on chromosome 15 in angelman and prader-willi syndromes where dna methylation is involved in genomic imprinting of parental germ line cells, impacting the phenotype of the offspring depending upon whether the affected chromosome is paternal or maternal in origin [46]. children with prader-willi syndrome inherit an affected paternal chromosome 15, resulting in short stature, poor muscle tone, and hypogonadism; many of these children also have learning disabilities. children who inherit an affected maternal chromosome 15 may develop angelman syndrome, which is associated with developmental delays, ataxia; they also may have epilepsy and microcephaly. of even more importance to critical care, epigenetic changes of somatic cells can be propagated to progeny of those cells within an individual, impacting phenotypic expression during the course of critical illness. for example, epigenetic changes altering the effectiveness of immune cells to respond to pathogens could persist in new immune cells which inherited the epigenetic changes. these prior epigenetic changes could thus have a direct effect on an individual's ability to respond to sepsis in the future. interest in critical care has focused on dna methylation, histone modification, and microrna (mirna). decreased gene expression may result from downregulation of genes (the transcription of rna from specific gene sequences is inhibited or arrested). increased gene expression may result from upregulation of genes (increased transcription of rna from targeted genes). however, for genes which provide a messenger rna (mrna) template for protein production, additional factors can influence the amount of protein produced from mrna; for example, how often each mrna is used for transcription and how quickly the mrna is degraded can influence the amount of protein produced. more specifically, dna methylation (as the result of enzymes known as dna methylases) is the attachment of methyl groups (ch3) to cytosine bases within a dna sequence; demethylation is removal of these methyl groups. as the quantity and pattern of dna methylation increases, gene transcription into messenger rna (mrna) decreases; demethylation can increase gene transcription. methylation patterns in dna can be transmitted to daughter cells during mitosis or transmitted to offspring as a result of meiosis [1, 7, 8]. furthermore, since dna is an extremely long molecule, it must be coiled and folded in order to fit into a nucleus (figure 1). histones are the nuclear proteins that direct the winding and coiling of dna into nucleosomes and then chromatin. histone proteins have extremely long tails which are susceptible to methylation, acetylation, ubiquitination, phosphorylation, and so forth at multiple locations. when histone tails are modified (histone modification), they alter the way in which dna will coil around a histone octamer (four histones with dna coiled around them to form a nucleosome). the nucleosomes continue to fold and coil into chromatin, and multiple chromatin coils create a chromosome. in addition to gene sequence availability being limited by dna methylation, how tightly chromatin is condensed will also impact the availability of gene sequences to interact with transcription proteins in order for mrna to be transcribed and then translated into proteins [8, 9]. noncoding rnas are also involved in modifying phenotype through various mechanisms, such as posttranscriptional and transcriptional interference pathways, in which they may alter chromatin and/or dna methylation processes to further stabilize gene silencing. roles for mirnas in central nervous system injury and in acute lung injury have been postulated, although experimental evidence in critical care subjects is lacking. the extent of dna methylation, histone modification, and microrna activity may impact the function of genes without any alterations in the dna sequence. when gene expression is altered, the potential for significant phenotypical alterations to pathology, disease progression, and short- and long-term outcomes exists. within critical care, research regarding the influence of genetics is in its early stages, and investigators are just beginning to look toward the science of epigenetics for explanations for patient and population differences in susceptibility to illness, clinical course, and outcomes. in the following sections, epigenetic regulation, in which gene expression is altered and may significantly impact critical illness outcomes, can occur through direct methylation of dna cytosine bases resulting in downregulation of genes. alternatively, demethylation might upregulate expression of genes. an example of downregulation through methylation in acute illness has been associated with the pathological processes associated with acute kidney injury (aki). aki is a common complication in critical care patients, with an incidence greater than 510%, contributing to an increase in morbidity and mortality. previous animal studies have suggested that altered expression of the klk1 gene, which results in the transcription/translation of the serine protease kallikrein, may be related to aki. kallikrein is involved in the biochemical reaction in the kidney to produce kallidin, which pharmaceutically appears to have vasodilator and natriuretic properties in animals. additionally, increased concentrations of kallikrein have been shown to be protective in animals, diminishing renal cell death by apoptosis and inflammation. kang and colleagues prospectively compared hospitalized patients with established or incipient (early) aki from ischemia, nephrotoxins, sepsis, and other causes to healthy nonhospitalized and icu patient controls. in particular they were looking for the increased methylation of the promoter region of the klk1 gene. the promoter region of a gene is a dna sequence where the enzyme rna polymerase binds to start mrna transcription from the gene; the degree and pattern of methylation of promoters can regulate gene expression. kang and colleagues hypothesized that gene silencing by methylation of the klk1 gene promoter and thus the subsequent decrease of urine kallikrein may be associated with established aki. contrary to their expected findings, they found that established aki patients, compared to controls, had significantly greater dna methylation of klk1 as expected but also had significantly higher levels of urine excreted kallikrein, which was not expected. interestingly, the established aki patients also had significantly lower average systolic blood pressure, increased heart rate, and increased epinephrine concentrations. epinephrine is known to increase kallikrein concentrations in the urine, most likely as part of the systemic regulation of hemodynamic instability in acute illness. two significant contributions to the state of epigenetic science in acute illness can be derived from the work of kang et al.. first, it further advances our understanding of how epigenetic modification may be trumped by other regulatory mechanisms. second, this study provides an expanded perspective of the complexity of system regulation, highlighting the fact that even at the genetic level focusing on a single targeted therapy solution may need to give way to other more novel therapeutic approaches. another type of epigenetic mechanism, histone acetylation, is now a potential therapeutic target in critical illness. as previously discussed, dna is more or less accessible for transcription depending upon how it is wound around histones in the nucleus. acetylation of histones occurs when acetyl groups are added to specific amino acids (lysines) comprising the histones. inhibitors of histone acetylation have been examined in animal models of hemorrhagic shock and lps-induced sepsis; inhibiting histone acetylation reduces immune responsiveness during the acute episode, and has been associated with better outcomes. caution is warranted because not all cells respond similarly to pharmacologic agents targeted to histone modification, and acetylation inhibitors affect cellular proteins in addition to histones. although histone modifiers are currently being explored as therapeutic agents, there is additional reason for caution because of emerging evidence about the sequella of histone modifications on immunity following sepsis. patients who survive sepsis have profound and long lasting immunosuppression which can impede appropriate response to pathogens; 5- and 8-year survival is shorter compared to age-matched people who have not had severe sepsis. evidence is accumulating that this consequence of critical illness is associated with epigenetic changes in immune cells. in a recent review of epigenetic mechanisms after sepsis, carson iv and colleagues provided several possible examples. direct suppression of proinflammatory activity by epigenetic mechanisms has been hypothesized as cause for lipopolysaccharide (lps, a major component of gram-negative bacterial cell walls) tolerance. for example, in macrophages exposed to lps (either in the laboratory or in a patient experiencing sepsis), an initial brisk proinflammatory response is followed by histone modifications to promoter regions of interleukin i beta and tumor necrosis factor alpha; these histone modifications reduce subsequent macrophage response to lps resulting in immunosuppression. this has been demonstrated in animal models as well as in monocytes sampled from critically ill patients. mirna is highly expressed in central nervous system tissues, and research suggests that they play a role in neurodevelopment and neural plasticity. temporal alterations in expression of mirnas localized at areas of central nervous system injury have been demonstrated in rodent models of spinal cord injury, traumatic brain injury, and brain ischemia [13, 14], although studies examining mirna in human trauma victims have not yet been reported. likely targets of these mirnas have been identified by computational analysis and computer modeling based on sequence homology and include genes involved in inflammation and in neural signaling as well as other genes previously identified as important in response to specific central nervous system injuries. madathil and colleagues propose that in the response to acute cns injury, some mirnas might have a neuroprotective effect while others might have a neurotoxic effect. thus, the epigenetic regulation mediated by mirnas in the cns is complex, and the effects in patients with cns trauma or cerebrovascular accident will likely be difficult to be definitively determined. mirnas contribute to differentiation and regulation of the immune system and have been implicated in chronic pulmonary diseases with an inflammatory component, including asthma, chronic obstructive pulmonary disease, and cystic fibrosis. there has been recent speculation that mirnas might also be involved in acute lung injury (ali), including acute respiratory distress syndrome (ards, the most severe manifestation of ali). rodent models of ali/ards, which initiate acute injury by administration of lps, have provided some support for the involvement of mirnas in the pathogenesis of ali, but human data are not available. better understanding of the positive and negative effects of mirnas on the course of critical illness would be beneficial in at least two ways. first, it would help to elucidate mechanisms underlying pathogenesis and protective response; this could identify potential targets for pharmacotherapeutic or nonpharmacotherapeutic interventions. second, in the future mirnas could themselves be targets for intervention, with a goal of enhancing regulatory effects related to protective responses and suppressing regulatory effects associated with pathogenesis. warren and colleagues investigated whether epigenetic data could improve on standard severity of illness scoring in trauma patients. both acute physiology, age, and chronic health evaluation (apache) and injury severity score (iss) are well-validated tools which are widely used in clinical practice to score severity of illness [17, 18]. building on the idea that gene expression changes early in trauma and critical illness might be prognostic of events occurring later in the hospital course, gene expression data could provide a snapshot predictive of likely outcome. in order to examine this concept, warren and colleagues first developed a reference gene expression profile from the leukocytes of 10 healthy adults to calculate a reference score for each of 54,000 plus gene probe sets. genomic response on the same gene probe sets of critically ill adult subjects within the first 12 hours of blunt trauma was compared to the healthy reference values by calculating difference from reference for each gene and then summing the differences, resulting in a difference from reference (dfr) score for each subject. they found that dfr scores, calculated early in the course of trauma, were positively associated with important clinical outcomes such as time on ventilator and length of stay. since warren and colleagues examined a single time point 12 hours after trauma, this study does not provide information about the magnitude of genetic expression changes over time nor when the optimal time to measure might be. a second group of investigators refined this approach by retrospectively identifying 63 genes whose expression varied in trauma subjects over the course of 28 days of hospitalization and were significantly different between those with complicated and uncomplicated recovery. of the 63 genes, two-thirds they found that a newly developed commercial multiplex system to rapidly quantify rna (nanostring dfr, nanostring technologies, seattle, wa) was a better predictor of complicated outcome (versus intermediate or uncomplicated outcome) than standard microarrays, apache, or iss score. cuenca and colleagues noted that current technologies are limited by the time required for processing samples; additional research into rapid technologies will be necessary. they further suggest that their data support a role for therapeutic agents that target adaptive immunity and gene expression data as indicators of likely response to biological response modifiers. interestingly, temporal gene expression patterns in dendritic cells of 10 patients over the first four days following trauma identified upregulation of genes involved in antigen presentation. however, the gene expression in dendritic cells was not associated with severity of illness scores. the differential expression of genes between subsets of cells (such as leukocytes and dendritic cells) and temporal changes in expression within a cell subset complicates the ability to develop predictive epigenetic measures of severity and outcomes. analogous to the left shift in a white blood cell differential count, it may be essential to examine multiple genetics expression profiles from multiple cell types simultaneously to fully understand response. important predictive patterns may emerge from such an approach, although technical considerations preclude this approach in the clinical setting at present. stratification by genetic risk profile could inform when to initiate targeted therapy, who is most likely to benefit, and whether patients are responding to prescribed therapies. this information will be most useful if it can be assessed early in the course of critical illness. however, the specific epigenetic mechanisms underlying the changes in gene expression were not elucidated in the above studies [16, 19, 20]. the state of the science in understanding the role of epigenetic regulation as it relates to the pathology of critical illness, clinical course, and outcomes is evolving rapidly yet still well within its infancy. available research exists primarily within the lab, animal, and preclinical realm and thus has yet to be translated to the direct care of the critically ill person. epigenetic tools and methodologies continue to evolve and improve, bringing the possibility of real time data to the point of care for therapeutic intervention closer to reality. better identification and understanding of the role of epigenetic modifications that are associated with the complex regulatory and disregulatory processes of the disease state is essential and it is apparent that our approach to therapeutically target epigenetic modifications to improve outcomes may only be a single component of even more complex novel therapies to come.

epigenetics is the study of alterations in the function of genes that do not involve changes in the dna sequence. within the critical care literature, it is a relatively new and exciting avenue of research in describing pathology, clinical course, and developing targeted therapies to improve outcomes. in this paper, we highlight current research relative to critical care that is focused within the major epigenetic mechanisms of dna methylation, histone modification, microrna regulation, and composite epigenetic scoring. within this emerging body of research it is quite clear that the novel therapies of the future will require clinicians to understand and navigate an even more complex and multivariate relationship between genetic, epigenetic, and biochemical mechanisms in conjunction with clinical presentation and course in order to significantly improve outcomes within the acute and critically ill population.

PMC3723097

pubmed-1087

high prices allow pharmaceutical companies not only to recoup their development costs but also to turn healthy profits that satisfy their investors and fund research on other drugs in their pipelines. through patents and other market exclusivities, the federal government grants drug makers limited monopolies on their products with the understanding that eventually drugs will lose this protection and will go down in price. so, what is a policymaker to do when the price of an off-patent drug goes up instead? this question is hardly hypothetical. in august 2015, turing pharmaceuticals acquired the marketing rights to daraprim (pyrimethamine), a drug used to treat parasitic infections like malaria and toxoplasmosis. within one month, turing announced that it would raise the price per tablet of daraprim from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\rm{\$ 13.50\ to\ \$ 750}$\end{document}a 5500 per cent price hike for a drug that has been on the market for over 60 years and off patent since the 1970s. facing bad press, social media backlash, and even the outrage of presidential candidates turing pledged it would roll back its price increase before settling on only minor adjustments to its original pricing strategy. turing pharmaceuticals is not alone in trying to purchase the rights to old drugs and squeeze higher revenues out of them a strategy that detractors label drug profiteering. since 2013 similar moves by other companies have inflated the prices of drugs that treat not only rare diseases like toxoplasmosis but also common conditions like heart failure and growing threats like multidrug-resistant tuberculosis. these price increases are of national concern since the profits that they generate could well be at the expense of public health and the general welfare. yet recent scrutiny from lawmakers and the public has not necessarily changed the calculus for drugmakers considering turing-like tactics. fundamentally, off-patent drugs can be extremely lucrative for companies that purchase the rights to manufacture and market them. these companies stand to make substantial returns on relatively small investments, especially if they can charge high prices for the drugs that they acquire. indeed, since they are legally obliged to act in the interest of their shareholders, corporations are likely to raise the prices of off-patent drugs to the full extent the market will bear. to continue with the turing example, the company has the power to set a high price for daraprim because the drug's limited patient population, the absence of competing manufacturers, and a lack of therapeutic alternatives have all created an effective monopoly. however, considering all of these forces, it is unclear that turing engaged in anticompetitive behavior to obtain its market position. thus, federal and state governments might not be able to use antitrust law to challenge turing or companies like it. instead, governments may need to use unconventional approaches to encourage potential competitors and to rein in the prices of off-patent drugs. in this note, i focus on policy solutions that have attracted less media attention, like expanded compounding, over those that have already been discussed at length elsewhere, like drug reimportation from canada. first, however, i outline the extent of the high-cost off-patent drug problem, drawing special attention to the negative impact of high drug costs on public health outcomes and public spending, and i discuss some of the problem's underlying causes. old, off-patent drugs are becoming increasingly expensive. rising prices for off-patent drugs have come in two forms: (i) increased rates for single-source drugs that is, drugs with only one manufacturer driven by savvy investors who spot opportunities to earn monopoly profits; and (ii) spikes in the price of multisource generic drugs due to manufacturer mergers and manufacturing disruptions. both types of price increases have been alarmingly large often tenfold or more but i focus in this note on the case of single-source drugs that have recently changed hands. canadian company valeant pharmaceuticals purchased two drugs commonly used to treat cardiovascular conditions isuprel (isoprenaline) and nitropress (sodium nitroprusside)and raised their prices by up to 500 per cent, seemingly overnight. rodelis therapeutics bought cycloserine, a drug used to treat multidrug-resistant tuberculosis, from an affiliate of nonprofit purdue university and raised the price of a course of treatment from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\rm{\$ 500\ to\ \$ 10,800}$\end{document}the most substantial hike yet. what turing, valeant, rodelis, and others share is the view that many off-patent drugs are undervalued assets, at least relative to prices that insurers and patients with no therapeutic alternatives are willing to pay. by this logic the original owners of these off-patent drugs underpriced their products because they lacked the profit motive to charge more, as in the case of purdue and cycloserine, or they neglected them in favor of more lucrative drugs in their product portfolio, as in the case of glaxosmithkline, the long-time manufacturer of daraprim. however, this economic argument in favor of higher prices disregards the negative effects of high drug prices on health outcomes and on public spending through programs like medicare and medicaid. like many off-patent drugs, daraprim, nitropress, and cycloserine are considered these drugs allow for timely responses to infectious disease outbreaks and enable modern intensive care. high costs can saddle society with a heavy disease burden due to reduced medication adherence that is, fewer patients starting or sticking to a course of necessary prescribed medication. thus, keeping off-patent drug costs low can often be considered a public health imperative. arguably the rationale that would support low prices for off-patent drugs also supports lower prices for expensive innovator drugs with clear public health benefits for example, the hepatitis c treatment sovaldi (sofosbuvir). up to five million americans suffer from a chronic hepatitis c infection, which is the leading cause for liver cancer and liver transplantation in the united states. as of january 2016, the average wholesale price for sovaldi is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\rm{\$ 1200\ per\ pill}$\end{document }, or \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\rm{\$ 100,800}$\end{document} for a 12-week course of treatment. to date private insurers and government payers have covered sovaldi, but the cost of treatment has been a significant strain on their budgets. between january and march 2014 alone, medicaid in the state of massachusetts spent \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\rm{\$ 23.3\ million}$\end{document} on sovaldi. in an attempt to contain costs, payers now cover treatment with sovaldi only for patients with advanced liver disease. from the perspective of both public health and public spending, the high price of sovaldi has led to suboptimal outcomes. however, from the perspective of the free market, sovaldi's status as an innovator drug justifies its high price. as i discuss in the remainder of this note, off-patent drugs are just as affected as innovator drugs by this tension between legitimate public and private interests. the high cost of off-patent drugs is, at its heart, about shortages: most commonly, a shortage of patients to take these drugs and/or a shortage of drugmakers to make them. as a treatment for a parasitic disease of tropical origin, daraprim is the archetypal example of a drug with a limited patient population in the united states. although it is estimated that 22.5 per cent of adults in the usa carry the parasite toxoplasma gondii, most of these carriers rarely get ill. however, individuals who are immunocompromised due to comorbid hiv infection, immunosuppression following an organ transplant, or chemotherapy, for example can experience recurring bouts of disease with severe symptoms like seizures and confusion. toxoplasmosis being a rare disease does not ipso facto make treatments for the disease unprofitable. indeed, over the past decade pharmaceutical companies have profited massively from the key difference here is that treatment with daraprim lasts just six weeks, which limits the potential value of its sales relative to orphan drugs that must be taken for life. in 2010, sales of daraprim totaled just \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\rm{\$ 667,000\ from\ \$ 12,700}$\end{document} prescriptions. by contrast, many orphan drugs cost hundreds of thousands of dollars per patient per year. given this disparity, the market is unlikely to prioritize the development of therapeutic alternatives to daraprim. generic competition is similarly unlikely. in principle, the newly high price of daraprim would encourage generic drugmakers to produce substantially cheaper bioequivalent competitors. in practice, however, several barriers to entry keep generic competitors out of the market despite favorable price signals eg the limited patient population and treatment duration relative to other drugs that could be produced, as discussed above, and restricted distribution tactics that hinder the regulatory approval of generics. makers of single-source drugs like daraprim will continue to possess de facto monopolies on the manufacture and sale of these drugs until at least one competitor is granted approval to sell a generic alternative. in most cases, the assumption is that more than one generic competitor will enter the market and prices will drop precipitously as a result, even though consolidation in the generic drug industry has cut down the number of potential players. the reality, however, is that sometimes no generic competitors enter the market and the prices never drop. daraprim remains without a generic competitor in 2016, about four decades after the patent on pyrimethamine expired, and its price is higher than ever. off-patent single-source drugs like daraprim are ripe for price jumps precisely because they lack competitors. whoever owns the rights to one of these drugs has all the power to set its price until the government encourages competitors to emerge or asserts the public interest in regulating seemingly legal monopoly profits. in this section, i evaluate two kinds of policy solutions that the government could employ to rein in the cost of off-patent single-source drugs: explicit price controls and moves to promote competition. the list of policy prescriptions here is by no means an exhaustive one, and i focus only on specific aspects of these policies that i think have received comparatively little attention from scholars and the media. explicit price controls for off-patent drugs are a natural response to the high cost of off-patent drugs, though they are rarely discussed in the united states. price controls in the usa have a complicated history, especially in response to perceived price gouging. the federal government last tried imposing widespread price controls to reduce inflation in the early 1970s. then, congress passed the economic stabilization act of 1970, which authorized the president to freeze prices and wages temporarily in an attempt to stabilize them. president nixon exercised this authority with mixed results; initial progress against inflation eventually led to meat and fuel shortages. opponents of pharmaceutical price controls could point to this historical example to claim that capping prescription drug prices (and thus, spending) would lead to shortages of vital drugs and could even cause the expensive drug development pipeline to run dry. as a counterpoint to this argument, even switzerland home to pharmaceutical giants like novartis and roche sets maximum allowable prices on drugs for sale within its borders. indeed, unlike in the united states, the governments of many other oecd countries make frequent use of government fiat and negotiating power to drive down the cost of prescription drugs branded and generic, patented and off patent alike. their methods are too diverse to enumerate in full, but here i compare and contrast three tactics with those employed by the us government. the first, reference pricing, is a widespread method of calculating a country's drug reimbursement rates as some function of (i) that drug's prices in several peer nations and/or (ii) the average price of therapeutically comparable drugs in that country itself. approach (ii) is actually very similar to how medicaid computes federal upper limits to reimbursement, so reference pricing could be practical in america. the second, value-based pricing, relates drug prices to quality-adjusted life years (qalys), a metric of disease burden that captures improved health due to treatment. norway's use of cost-per-qaly to pick one of many therapeutically comparable drugs has translated into major savings, like paying 71 per cent less than medicare for the same osteoporosis treatment. by statute, however, medicare explicitly can not consider cost-per-qaly when calculating its reimbursements. the third, the imposition of profit controls, requires market intervention by the government at a scale and scope well beyond the american norm. the united kingdom limits drugmaker profits by capping its annual spending on pharmaceuticals and requiring drugmakers to foot the bill or cut drug prices going forward if spending exceeds this cap. admittedly, state-run and state-funded healthcare systems like those in norway and the uk facilitate extensive government regulation of prescription drug prices, and neither country has a pharmaceutical lobby as active as the united states. one could argue more generally that high drug prices in america subsidize low prices elsewhere. indeed, a department of commerce report from 2004 concluded that american consumers would benefit most from the elimination of pharmaceutical price controls abroad, not the imposition of price controls at home. still, the role of the center for medicare and medicaid services (cms) as the dominant payer for american healthcare should give it substantial leverage in dealing with pharmaceutical companies. if medicare eventually were allowed to negotiate drug prices with drug makers as several lawmakers have proposed being able to reference lower prices for the same drugs in peer countries could strengthen medicare's negotiating position nevertheless many scholars have argued that medicare's ability to negotiate drug prices would be fundamentally impaired by its inability to walk away from many negotiations. medicare part d is required to cover all or substantially all drugs in six protected classes that tend to be among the most expensive. if negotiations or fiat can not lower off-patent drug prices, perhaps government encouragement of market forces could have the same effect. the fda could begin to address the lack of market competition for expensive off-patent drugs by maintaining a list of single-source off-patent drugs, much like the list it currently maintains of drugs in short supply. companies who apply to produce these drugs could be rewarded with expedited processing of their applications and fee waivers, though such incentives may require congressional authorization and others may be needed as well. importantly, these actions could not be taken in response to the cost of the drug alone, as the fda explicitly can not consider costs when approving a drug or its generic competitors. is that limited access tantamount to a shortage, and would the expedited approval of generic competition constitute appropriate relief? the fda recognizes the importance of a steady supply of many medicines; it requires that manufacturers promptly notify the agency if they intend to stop producing prescription products that are life supporting, life sustaining, or intended for use in the prevention or treatment of a debilitating disease or condition. the fda can alleviate resulting drug shortages by taking actions like reimporting drugs, or expediting the approval of new drug suppliers. especially with congressional authorization, the fda might be able to exercise its shortage power to expedite generic competition for single-source off-patent drugs especially since public health experts consider many of these drugs to be essential medicines. that said, the fda might be able to increase drug supply without congressional involvement by encouraging the expansion of compounding pharmacies, though this policy option is not without controversy. in october 2015, imprimis pharmaceuticals (in conjunction with the payer express scripts) announced it would sell a daraprim competitor for less than \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\rm{\$ 1\ per\ tablet}$\end{document }, or far less than the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\rm{\$ 750}$\end{document} that turing demands. imprimis is a compounding pharmacy, which means that it fills doctor-prescribed, patient-specific formulations of mixtures of drugs. though compounding was originally intended for patients with needs unmet by the market, custom-compounded versions of off-patent drugs may be viable alternatives to their expensive commercial counterparts, especially if the patient population is small. but compounded substitutes alone compounding pharmacies are limited in what they can provide relative to traditional dispensaries. by statute, compounders may not produce drug products that are essentially copies of a commercially available drug product. in the case of imprimis's daraprim competitor, this limitation is actually an asset. the compounded tablet contains not just pyrimethamine but also a form of folic acid called leucovorin that reduces pyrimethamine's adverse side effects. of course, not all drugs have such natural synergistic partners, so in general it may be difficult to work around the ban on copies. additionally, compounded drugs are not fda-approved, nor are their manufacturing processes necessarily fda-regulated so over-reliance on compounding may expose the public to very real risks of contamination and adulteration. in response to recent scandals, congress established standards and safeguards for compounding to protect consumers health and safety. under the drug quality and security act, outsourcing facility that the fda inspects regularly to ensure that compounding occurs under the supervision of a licensed pharmacist according to current good manufacturing practices (cgmp). though certification as an outsourcing facility does not guarantee that a compounder's drugs are safe, it does help consumers, physicians, and payers pass judgment on the quality and trustworthiness of compounders. in the face of market failures that have discouraged drugmakers from producing generic competitors to off-patent drugs that serve small patient populations, expanded compounding by certified compounders could expand access to drugs very quickly and practically. many of the same active pharmaceutical ingredients in off-patent drugs are available for compounders to purchase in bulk. with its \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\rm{\$ 1\ per\ dose}$\end{document} daraprim competitor, imprimis has demonstrated that compounding can be cost-effective and that payers are willing to cover compounded drugs if their value proposition is clear. the fda should continue to allow arrangements like the one between imprimis and express scripts that could increase drug access while decreasing costs. however, out of an abundance of caution, the rigor of the fda's inspections should scale up with the number of patients to which a compounder provides drugs. since the daraprim saga began in september 2015, the high prices of pharmaceuticals in general, and of off-patent drugs in particular, have become political issues and topics of everyday conversation in the united states. the media and the public have been quick to condemn turing and its leadership for what they see as rampant corporate greed, but they have been slower to accept that the public interests and private incentives that exist in tension in the turing story are both legitimate. the american economy is set up to reward players who best exploit market opportunities, and in some sense turing simply fulfilled its obligations to its shareholders by raising the price of undervalued daraprim. that said, policymaking clearly has a role to play to ensure that private profits do not come at unbearable costs to public health and the general welfare. this note discussed how the federal government might rein in high drug prices, through explicit price controls that restrain the market or through pro-competitive policies that use the market to expand the supply of off-patent drugs that are currently single-sourced. some of the questions and considerations raised here may apply not only to small molecule drugs but also more broadly to increasingly prevalent biologic treatments and their generic biosimilars. however, policymakers choose to reconcile high drug costs with public health and public spending concerns, their decisions over the next decade could transform how we make, take, and pay for all drugs on or off patent.

in august 2015, turing pharmaceuticals acquired the marketing rights to daraprim (pyrimethamine), a drug used to treat parasitic infections like malaria and toxoplasmosis. soon after, turing caused an uproar when it announced that it would raise the price per tablet of daraprim from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\rm{\$ 13.50\ to\ \$ 750}$\end{document }, a 5500% price hike for a drug that has been on the market for over 60 years and off patent since the 1970s. old, off-patent drugs are becoming increasingly expensive; daraprim is the archetypal example. turing had the power to set a high price for daraprim because the drug's limited patient population, the absence of competing manufacturers, and a lack of therapeutic alternatives all created an effective monopoly. similar forces have driven up the prices of other off-patent drugs that treat diseases as diverse as heart failure and multi-drug-resistant tuberculosis. thus, policymakers will have to consider how the high cost of off-patent drugs impacts public health as well as public spending. in this note i outline the extent of the high-cost off-patent drug problem, drawing special attention to the problem's negative effects on both health outcomes and government budgets. after discussing some of the problem's underlying causes, i present several solutions to the problem that policymakers could consider, with a focus on proposals like reference pricing and expanded compounding that have received relatively little media attention.

PMC5033427

pubmed-1088

nearly three decades have passed since the first successful clinical lung transplant was performed and has become the preferred treatment option for a variety of end-stage pulmonary parenchymal or pulmonary vascular disorders. due to the shortage of available organs as well as the advancement of disease in most transplant candidates, a full array of preoperative tests is needed in order to consider these patients appropriate applicants. as part of the preoperative workup of these patients, investigation of cardiac function with echocardiography and catheterization has been long considered the norm, yet predictors of outcome from these tests are not well defined. the risk posed by cardiac dysfunction must be assessed individually based on severity of disease, presence of end-organ damage, and ease of control with standard therapies. patients with moderate or severe ventricular systolic dysfunction are typically excluded from lung transplantation; however, there is a paucity of data regarding the prognostic significance of abnormal left ventricular diastolic function or elevated pulmonary pressures. the study was approved by the university of california, los angeles (ucla) institutional review board. all patients who underwent a bilateral or unilateral lung transplant at ucla medical center from 2002 to 2009 were analyzed (394 patients) by chart review in order to evaluate the prognostic significance of preoperative markers of diastolic function, including invasively measured pulmonary capillary wedge pressure (pcwp) and echocardiographic variables of diastolic dysfunction. diastolic dysfunction was assessed by traditional echocardiographic variables of abnormal diastolic function, including a>e and a>e. criteria for lv diastolic dysfunction were obtained from the 2009 ase guidelines. exclusion criteria included any patients undergoing re-transplant, patients with lack of presurgical echocardiographic or catheterization data performed at ucla, and patients with systolic left ventricular function less than 40% were excluded. we identified 111 patients who had pretransplant echocardiographic as well as catheterization data performed at ucla medical center. echocardiographic information was rereviewed by a blinded cardiologist (ja) to ensure the accuracy of the reports. additionally, pulmonary artery pressures from preoperative catheterizations were analyzed to assess adverse clinical events posttransplant. for comparing time until each clinical endpoint between groups, p values were computed utilizing cox proportional hazards models. for comparing differences between the nondiastolic dysfunction and diastolic dysfunction groups, p values were calculated using the t-test for quantitative variables or chi-square test for categorical predictors. if the sample size was too small for the chi-square approximation to be accurate, fisher's exact test was used instead. the kruskal-wallis test was used for subgroup analysis of primary lung pathology due to the skewed distribution of these variables. if a significant effect was observed, follow-up pairwise wilcoxon rank sum tests with dunn-sidak adjusted p values were used to test for specific differences between groups. all statistical analyses and plots were performed using r (version 2.13.1) and ibm spss (version 19). subjects ranged from 22 to 70 years of age (62 male and 49 female) and were transplanted for a variety of disease processes including forty-three cases of idiopathic pulmonary fibrosis, twenty-two of chronic obstructive pulmonary disease, twelve of scleroderma, eight of sarcoidosis, eight of usual interstitial pneumonia, eight of isolated pulmonary hypertension, four of cystic fibrosis, four of various rare etiologies, and two of alpha-1 antitrypsin deficiency cases. in all, 29 (26.1%) patients met criteria for diastolic dysfunction. kaplan-meier curves were constructed, which did not show statistically significant differences of survival between diastolic dysfunction and normal diastolic function groups for all investigated endpoints (figure 1). comparative boxplots were constructed which showed no difference in mortality between each subtype of diastolic dysfunction (figures 2 and 4). catheterization data was reviewed and based upon this information, 20 (19.8%) patients were categorized into mildly elevated pcwp (1620 mmhg) and 9 (8.9%) patients with moderate/severely elevated pcwp (> 20 mmhg) (table 2). mildly and moderately/severely elevated pretransplant pcwps were not associated with adverse clinical events posttransplant (p=0.30) (figure 3). additionally, catheterization profile data between diastolic and nondiastolic dysfunctions did not reveal any statistically significant variables between the two groups, including systolic pulmonary artery pressures (spap) (p=0.77), diastolic pulmonary artery pressures (dpap) (p=0.68), mean pulmonary artery pressures (mpap) (p=0.84), mean pcwp (p=0.17), cardiac output (p=0.23), cardiac index (p=0.21), and left ventricular ejection fraction (p=0.99) (table 3). lastly, a subgroup analysis of primary lung pathology did reveal did not reveal any mortality difference between groups (p=0.176) (table 4) (figure 5). based upon kruskal-wallis test with dunn-sidak adjusted pairwise comparisons, pulmonary artery pressures were elevated and statistically significant in the pulmonary artery hypertension group in comparison with other groups. additionally, mean pcwp was statistically lower in the chronic obstruction pulmonary disease group when compared to other groups (p=0.05). over the last twenty years, there has been a steady growth in the number of lung transplant operations performed worldwide with concurrent improvement in both short-and long-term outcomes. various studies have shown some utility in the preoperative workup of certain variables that may exclude certain candidates from lung transplant. strong negative predictors of one year survival include use of extracorporeal membrane oxygenation, renal failure, age, total bilirubin>2.0 mg/dl, cardiac index<2 l/min, steroid dependence, smoking, and body mass index [46]. however, pre-existing coronary artery disease has been shown to have acceptable early and medium-term outcomes. overall, many guidelines have been developed to help risk-stratify candidacy of potential transplant recipients; however, there has been a lack of data regarding short- and long-term outcomes of left ventricular diastolic dysfunction as well as elevated pcwp. given the scarcity of organs as well as the fact that nearly 20% of lung transplant recipients die within the first year of transplantation, we may be failing to identify those at high risk for severe early complications., the mitral inflow velocity profile is used to characterize left ventricular (lv) filling dynamics. the e velocity (e) represents the early mitral inflow velocity and is influenced by the relative pressures between the left atrium (la) and lv, which, in turn, are dependent on multiple variables including la pressure, lv compliance, and the rate of lv relaxation. the a velocity (a) represents the atrial contractile component of mitral filling and is primarily influenced by lv compliance and la contractility. in a less compliant heart, a greater proportion of this blood is pushed into the ventricles during atrial systole. in this scenario, the emphasis of ventricular filling during late diastole increases the (a) component of the e/a ratio causing a reversal of the ratio, hence an indication of diastolic dysfunction. left atrial volume has also been described as an excellent biomarker of the chronicity of diastolic dysfunction and of cardiovascular disease risk. parameters of diastolic function such as early diastolic velocities measured as e prime (e), the e to late diastolic filling (a) ratio (e/a), and the transmitral to mitral annular early diastolic velocity ratio (e/e) have all been shown to predict mortality and cardiovascular events [13, 14]. the early diastolic velocity of the mitral valve annulus (e) reflects the rate of myocardial relaxation. when combined with measurement of the early transmitral flow velocity (e), the resultant ratio (e/e) correlates well with mean left ventricular end-diastolic pressure, hence a marker for la pressure. left ventricular diastolic dysfunction is a relatively common finding seen on doppler echocardiography; while multiple studies demonstrate abnormal diastolic function assessment to be associated with increased cardiovascular comorbidity, it can hold varying prognostic significance depending on underlying cardiac ventricular function. it has been shown that mortality is higher in hospitalized patients with depressed left ventricular ejection fractions of less than 39%. additionally, diastolic dysfunction has been recognized as a strong predictor of mortality in acute myocardial infarction and congestive heart failure [1720]. however, isolated diastolic dysfunction has significant clinical implications as well. there is much heterogeneity regarding the prognosis of patients with diastolic dysfunction, with mortality ranging from 1.3% to 17.5%. multiple studies have shown prognostic significance of doppler indexes of left ventricular diastolic dysfunction where patterns of abnormal relaxation increase the risk of cardiovascular events [2225]. in one study among 3,107 patients undergoing cardiac catheterization, the small subgroup (1.7%) with diastolic dysfunction, defined as those with high lv end-diastolic pressure and no systolic dysfunction, coronary heart disease or lv dilation had a high risk of future cardiac morbid events. this association between echocardiographic markers of abnormal relaxation and decreased survival, even in those with no history of chf, suggests that echocardiography may help identify those who are predisposed to adverse outcomes. given that many lung transplant candidates are excluded with systolic depression, further evaluation of isolated diastolic dysfunction may help identify those at high risk for complications. there has been much investigation into doppler echocardiography and comparison with swan-ganz catheterization measurements. studies have shown that hemodynamic data acquired by echocardiography, including estimation of right atrial, pulmonary artery systolic, and pcwps; cardiac output; and pulmonary vascular resistance, correlate to those of invasive catheterization values [27, 28]. although correlation is good, estimation of systolic pulmonary artery pressure by echocardiography is frequently inaccurate in patients with advanced lung disease and leads to considerable over-diagnosis of pulmonary hypertension [29, 30]. in addition, technical limitations of the echocardiogram in this patient population often preclude estimating pulmonary artery systolic pressure. although echocardiography can help estimate preoperative variables for lung transplant candidates, it should be used in conjunction with invasive catheterization rather than replacing it as the sole cardiac assessment modality. ben-dor and associates have shown that the prevalence of significant coronary artery disease (cad) among lung transplant candidates may be low but can not be accurately predicted by risk factors. the presence of preoperative mild or moderate cad has been shown not to result in increased perioperative morbidity or mortality or significantly affect the short-term or long-term survival in comparison with recipients without cad. transplantation remains the only therapeutic option for selected patients with advanced pulmonary arterial hypertension (pah) who continue to deteriorate despite optimal medical therapy. given the current shortage of donor organ availability worldwide, there is a need for inclusion of more discriminatory markers of pah prognosis in donor-lung allocation scores to identify patients at risk and optimize survival to transplantation. have demonstrated that increased preoperative pah is an independent risk factor for the development of grade 3 primary graft dysfunction within the first 48 hours after transplant. additional studies have also shown this correlation between elevated pah and primary graft dysfunction [3639]. the relatively high early (30 days and 3 months) mortality in pah lung transplant recipients in part reflects primary graft dysfunction, a syndrome characterized by noncardiogenic pulmonary edema, hypoxemia, and diffuse alveolar damage within the first 72 hours following lung transplant [37, 4042]. because most pah patients are receiving chronic warfarin further, following single lung transplant, allograft blood flow is increased in patients with a preoperative diagnosis of pah compared with emphysema [34, 43]. hence, estimation of pah variables is a critical component in the lung transplant workup. despite these previous studies, our data reveals no end-point difference between patients with normal, mildly elevated, and moderate-severely elevated pah. although no statistically significant difference is found, there is indeed a unfavorable trend with regard to mortality in pulmonary hypertension patients. given the small power in this subgroup analysis, further analysis of this patient population is necessary to access its clinical impact. the objectives of therapy for left ventricular diastolic dysfunction include improvement of preload and afterload hemodynamics. ace inhibitors and angiotensin inhibitors may provide some additional benefit given their reduction in both pre- and afterload as well as interstitial fibrosis. additionally, heart rate control is also imperative given its prolongation of left ventricular filling to counterbalance the resistance of inflow due to the stiffened ventricle. this is a retrospective single-center review and has inherent limitations associated with all retrospective studies. the lung transplant patients are also highly selected in accordance with our selection protocol. as a result, there may have been a selection bias as the study does not include recipients and experience from other centers. in summary, there are many different factors that need to be accounted for when deciding to evaluate and list patients for lung transplantation. a team approach incorporating the surgeon, pulmonologist, and cardiologist is necessary to ensure optimum outcomes in this difficult and challenging group of patients. pretransplant recipient variables significantly influence early and late survival following lung transplantation, suggesting that some patients face a higher than average risk of mortality during the first year after transplant, as well as severely diminished longer-term survival, that challenges the goals of equitable organs allocation. further investigation regarding transplant variables are needed to help develop better guidelines, which will ultimately help with optimal utilization of these scarce organs. the present study demonstrates that prelung transplant invasive and echocardiographic findings of elevated pulmonary pressures, and abnormal left ventricular diastolic function are not predictive of adverse posttransplant clinical events.

background. orthotopic lung transplantation is now widely performed in patients with advanced lung disease. patients with moderate or severe ventricular systolic dysfunction are typically excluded from lung transplantation; however, there is a paucity of data regarding the prognostic significance of abnormal left ventricular diastolic function and elevated pretransplant pulmonary pressures. methods. we reviewed the characteristics of 111 patients who underwent bilateral and unilateral lung transplants from 200 to 2009 in order to evaluate the prognostic significance of preoperative markers of diastolic function, including invasively measured pulmonary capillary wedge pressure (pcwp) and echocardiographic variables of diastolic dysfunction including mitral a>e and a>e. results. out of 111 patients, 62 were male (56%) and average age was 54.0 10.5 years. traditional echocardiographic doppler variables of abnormal diastolic function, including a>e and a>e, did not predict adverse events (p=0.49). mildly elevated pretransplant pcwp (1620 mmhg) and moderately/severely elevated pcwp (> 20 mmhg) were not associated with adverse clinical events after transplant (p=0.30). additionally, all clinical endpoints did not show any statistical significance between the two groups. conclusions. pre-lung transplant invasive and echocardiographic findings of elevated pulmonary pressures and abnormal left ventricular diastolic function are not predictive of adverse posttransplant clinical events.

PMC3791796

pubmed-1089

diabetes mellitus is strongly associated with cardiovascular disease morbidity and mortality, accelerating the vascular aging process and in particular the pathogenesis of atherosclerosis. diabetic nephropathy is a highly important cause of morbidity and mortality in patients with type 1 and type 2 diabetes mellitus, either directly and as a risk factor for cardiovascular disease.1 in particular, diabetic kidney disease occurs in 20% to 40% of patients with diabetes mellitus and is the leading cause of chronic kidney disease and end-stage renal disease.2 recent evidence shows that an early multipharmacological approach is able to slow the progression of diabetic nephropathy to end stage renal disease (esrd), the disease rarely stops and slightly regresses just in few selected and optimally treated patients.3 in this context, there is a strong need for new agents able to significantly modify the patient disease history. the aim of this review is to evaluate the potential role of glycosaminoglycans (and in particular sulodexide) as antiproteinuric and kidney protective drugs. glycosaminoglycans (gags) are long unbranched mucopolysaccharides consisting of a repeating disaccharide unit. apart from hyaluronan, which is uniquely synthesized without a protein core and is spun out by enzymes at cell surfaces directly into the extracellular space, the other gags are usually added to protein cores in the golgi apparatus to yield proteoglycans.4 it has been proposed that hemodynamic alterations and structural changes in glomerular basement membrane glycosaminoglycans may play a role in the pathogenesis of proteinuria. the glomerular filtration barrier consists of fenestrated glomerular endothelium, podocyte foot processes/slit diaphragms, and intervening glomerular basement membrane. its characterization as both a size- and charge-selective barrier emerged from studies conducted decades ago. the charge selectivity phenomenon is receiving renewed attention now that the identities and mechanisms of synthesis of relevant molecules are known.5 attention has focused on glomerular basement membrane heparan sulfate proteoglycans, long considered primary charge barrier components, even if recent in vivo manipulations of glomerular heparan sulfate proteoglycans redefined (but not excluded) their role or their anionic charge in glomerular filtration.6 in fact an experimental model of non-diabetic mice, knock-out for the ext1 gene encoding a subunit of heparan sulfate co-polymerase, develops a proteinuria that is less impressive than that expected from the available knowledge on renal physiology.7 however, a relatively large body of evidence supports the notion that glomerular capillary wall and mesangial alterations in diabetic nephropathy involve pathobiochemical alterations of glycoproteins in these structures. evidence in experimental animals rendered diabetic reveals that the administration of heparin and other anionic glycoproteins can effectively prevent the biochemical alterations that promote albuminuria.8 moreover, in renal biopsies of different human primary proteinuric diseases, pronounced tubulointerstitial heparan sulfate proteoglycans alteration are evident and strongly related to the inflammatory processes.9 moreover, gags strongly influence thickness, integrity and permselectivity of the endothelial glycocalyx, a luminal layer composed of several proteoglycans and a special class of heavily glycosylated glycoproteins. glycocalyx composition is strongly alterated in diabetes patients, who typically show early sign of renal damage. the recent demonstration that angiopoietin-1 also modifies basal kidney-microvessel permeselectivity acting on the glomerular glycocalyx further supports the key role of this glycocalyx and glycocalyx composition on glomerular function.10 angiotensin ii receptor blockers are renin angiotensin system (ras) modulators with known antiproteinuric activity.11 angiotensin ii inhibits heparan sulfate synthesis, while heparins modulate angiotensin ii signaling in glomerular cells, inhibiting aldosterone synthesis and lowering proteinuria in diabetes patients (but less in other forms of proteinuric renal diseases).12 in this context, heparinoids have been considered as potentially useful antiproteinuric drugs that could have synergistic effects with ras modulator.13 sulodexide is a highly purified mixture of gags composed of a fast-moving heparin fraction (80%) and dermatan sulfate (20%), with a low molecular weight, a high oral bioavailability, and antithrombotic and profibrinolytic activity.14 it also appears to be a promising treatment for diabetic proteinuria partially resistant to ras blocking agents.15 sulodexide concentrates in renal parenchyma for a long time after administration.16 from preliminary trials it has been supposed that sulodexide reduces albuminuria acting in vivo as a heparinase inhibitor that reaches the glomerular capillary wall and prevents heparan sulfate degradation, thus allowing reconstruction of heparan sulfate content and restoration of glomerular basement membrane ionic permselectivity.17 recent in vitro experiments on umbelical human veins demostrated that sulodexide supplementation restores the glycocalyx structure and barrier properties by increasing the trans-endothelial albumin leakage induced by hyperglycemic conditions.18 the antiproteinuric effect appears to be mainly related to the basal proteinuria and consequently to the duration of treatment.19 moreover, at least a part of the renal histological degradation observed in diabetes is related to inflammatory processes. sulodexide seems to have powerful antinflammatory activity in experimental models.20 in a model of cultured human umbilical endothelial cells exposed to high glucose concentration, sulodexide suppresses cellular inflammation and prevents glucose cytotoxicity:21 sulodexide is able to reverse the glucose-related cell release of free oxygen radicals, monocyte chemotactic protein-1 (mcp-1) and interleukin-6 (il-6), and the inactivation of cell-repairing mechanism enabling the exposition to glucose. moreover, in rats with streptozocin-induced diabetes, sulodexide exerts direct endothelial protective effects.22 a large number of studies, mainly carried out in type 1 and 2 diabetes patients, have strongly suggested the potential role of sulodexide as an antiproteinuric agent (table 1). the majority of these studies, however, were small, had an open design, were of short duration, and involved inhomogeneous patient categories. however, at least 15 out of 16 studies, involving 594 patients, reported a significant antiproteinuric effect of sulodexide. it remains to be clarified if sulodexide could exert an additive antiproteinuric effect in patients treated with fully dosed angiotensin-converting enzyme inhibitor (acei) or an angiotensin receptor blocker (arb). in a pilot study, return to normoalbuminuria or a decrease in albumine: creatinine ratio (acr) of at least 50% from the baseline value was achieved in 25.3% of patients with persistent albuminuria in spite of being treated with the maximum recommended dose of an acei or an arb.23 interestingly, a very favorable trend for an increased rate of therapeutic success was obtained in the sulodexide group receiving the daily dose of 200 mg (33.3% versus 15.4% of patients receiving placebo; p=0.075), which was the more effective dose also in the largest published study.24 in particular, this trial clearly showed for the first time that sulodexide, 200 mg/day for 4 months, was able to significantly decrease albuminuria (both versus placebo and baseline) independently of the concomitant administration of acei, but at an unspecified daily dosage. the decrease in the albumin excretion rate at the end of treatment was 40% and 46% versus baseline in patients receiving or not receiving acei, respectively (p<0.05). to the best of our knowledge only one trial has tested the effect of endovenous sulodexide administration on renal disease other than that caused by diabetes.25 in this trial the researchers enrolled patients with bioptic diagnosis of different glomerulonephritis, and observed after 1 month of treatment that overall 85% of patients experienced a significant reduction in proteinuria, which was significantly more impressive in patients with mesangiocapillary than in those with membrano- and mesangioproliferative glomerulonephritis. moreover, the decline of proteinuria was more relevant in gag(+) patients with important proximal tubular necrosis and moderate to severe myofibroblast infiltrates than in gag() patients with mild interstitial involvement.26 on the basis of the above-cited preclinical and clinical evidence, the use of sulodexide has also been suggested by experts for the treatment of serious chronic kidney diseases (ckd) other than those caused by diabetes. the most interesting is probably the management of the membranoproliferative glomerulonephritis type ii (or dense deposit disease), a rare and serious renal genetic disease which affect 2 to 3 people per million and leads to renal failure within 10 years in 50% of affected children, with a worse prognosis after kidney transplantation than other genetic glomerulonephritis.27 however new trials have to be carried out to confirm these preliminary results and hypotheses. it is well known that diabetes patients are more likely to develop vein insufficiency and their related sequelae. the antithrombotic effects of sulodexide in patients affected by deep vein thrombosis28,29 and venous leg ulcers30,31 have been adequately investigated in different clinical trials. however, there is some evidence that sulodexide could also reduce the arterial disease risk, which is usually very high in diabetes patients with ckd,32 through a large number of pharmacological actions (table 2). two different meta-analyses of the available clinical trials have show that sulodexide treatment improves the pain-free walking distance in patients affected by peripheral occlusive artery disease.33,34 this effect could be related to different sulodexide activities. first, the sulodexide-treated patients have higher peak flow and rest flow in the lower limbs.35 moreover, sulodexide treatment improves the patient s lipid and hemorrheological profile.36 in particular, sulo-dexide improves the typical lipid components of metabolic syndrome, which is a predictor of both ckd worsening and cardiovascular disease risk in ckd patients.37 recent data also support a significant anti-inflammatory action of sulodexide in the endothelial cells and a protective effect of the drug against glucose cytotoxicity. the experiments were performed on in vitro cultured human umbilical endo-thelial cells kept for 7 days in standard medium or in the same medium but supplemented with glucose. sulodexide inhibited the intracellular generation of free radicals in a dose-dependent manner (by up to 32%), as well as monocyte chemotactic protein-1 (mcp-1) (by up to 60%) and il-6 (by up to 69%). cells cultured in a medium with glucose generated more free radicals (+ 20%) and released more mcp-1 (+ 113%) and il-6 (+ 26%). cell monolayers treated with glucose had a decreased ability to heal after mechanical injury (28%). all these glucose effects were reversed when cells were exposed to sulodexide simultaneously.19 in the long term, it is also possible that sulodexide exerts anti-atheromasic effects. in experimental models, sulodexide protects endothelium from external injuries as demonstrated by a reduced number of desquamated endothelial cells.38 sulodexide could then stop the earliest phase of atherosclerosis, at the level of endothelial dysfunction, improving endothelium-dependent relaxation in small arteries.39 in a more advanced atherosclerosis phase, sulodexide inhibits neointimal proliferation after vascular injury of the carotid artery, as shown in an experimental model of restenosis after balloon angioplasty.40 furthermore, in vitro heparin and heparinoids inhibit the proliferation of the vascular smooth muscle cells.41 this antiproliferative effect has also been supposed to be valid in humans, but only preliminary data are available.42 it has also been shown in humans that sulodexide treatment could also improve some clinical parameters in patients with vascular dementia.43 consequently it has also been used to prevent ischemic cerebral damage in patients with antphospholipid antibodies.44 finally, different gags have been reported to be of benefit to the ischemic myocardium by preserving contractile function and reducing tissue injury. in a rabbit model, sulodexide also attenuated myocardial ischemia/reperfusion injury and the deposition of c-reactive protein in areas of infarction without affecting hemostasis.45 the prognostic value of most of these observations has yet to be demonstrated, but they appear to be interesting working hypotheses, especially in patients with either ckd and preclinical signs of cardiovascular diseases. preclinical and clinical evidence directly or indirectly support the hypothesis that new, adequately designed, long-term studies need to be carried out to investigate the potential role of sulodexide for proteinuric ckd management in diabetes patients, in particular to understand which kind of patients could obtain the most clinical advantage from this therapeutic approach. presently, there is a clear lack of preventive and therapeutic tools for proteinuric syndromes, and each new active compound needs to be evaluated, in order to widen the therapeutic arsenal against ckd. considering the previously reported large spectrum of its pharmacological properties, sulodexide seems to be able to play an important role in the treatment of these patients because of its actions not only at the renal level, but also on the whole vessel tree, which is usually severely affected in diabetes patients with ckd. in conclusion, a relatively large body of literature supports the antiproteinuric and nephroprotective effects of gags and sulodexide; however more basic clinical research is needed to understand which factors influence the drug s efficacy and, consequently, which patients could therefore benefit most from this treatment.

a relatively large body of evidence supports the notion that glomerular capillary wall and mesangial alterations in diabetic nephropathy involve biochemical alterations of glycoproteins in these structures. evidence in experimental animals rendered diabetic reveals that the administration of heparin and other anionic glycoproteins can effectively prevent the biochemical alterations that promote albuminuria. moreover, angiotensin ii inhibits heparan sulfate synthesis, while heparins modulate angiotensin ii signaling in glomerular cells, inhibiting aldosterone synthesis and lowering proteinuria in diabetes patients. sulodexide, a mixture of heparin and dermatan sulfate, appears to be a promising treatment for diabetic proteinuria partially resistant to renin angiotensin system blocking agents. sulodexide prevents heparan sulfate degradation, thus allowing reconstruction of heparan sulfate content and restoration of glomerular basement membrane ionic permselectivity. the antiproteinuric effect appears to be mainly related to the basal proteinuria and consequently to the duration of treatment in a relatively large number of small clinical trials. on the other hand, several sulodexide pharmacodynamic properties could improve the prognosis of chronic kidney disease patients, also independently from its antiproteinuric effect. however, sulodexide development as an antiproteinuric drug needs to be continued, in order to define which kind of patients could better respond to this treatment.

PMC3108767

pubmed-1090

cervical and shoulder dysfunction in office workers is usually due to the work environment, including job and sociopsychological risk factors1. the resulting pain and functional impairment affect the muscles, skeleton, ligaments, cartilage, and nervous system, and result in musculoskeletal dysfunction2. shoulder pain and functional disorders are related to abnormal motion and the position of the scapula when it is stabilized3. cervical pain leads to impaired function, decreased occupational performance, and quality of life dissatisfaction including social and economic loss4. weakness of the lower trapezius has a negative effect on scapular movement, with an increase in shoulder joint weakness, because the lower trapezius is the primary muscle maintaining the appropriate posture and alignment of the shoulder joint5, 6. therapeutic interventions for shoulder pain include hyperthermia, cryotherapy, transcutaneous electrical nerve stimulation, strengthening exercises8, and stabilization exercises9. most of these interventions can relieve pain but are inefficient at preventing the recurrence of pain and maintaining normal function3. the stability of the shoulder joint is important; however, the stability and strength of the muscle are more important because the shoulder is very mobile3. postural stabilization is the state of maintaining a balanced body position, with the muscle and skeleton in a specific space, and the ability to maintain the center of mass10. exercise stabilizes the scapula through active movements of the muscles surrounding the scapula, and maintains the effective length and tension of upper arm movement11. rehabilitative ultrasound images (rusi) evaluate muscle mass, structure, and composition. it is easy to control and accurately visualizes muscle structure and movement12. in this study, a stability exercise was prescribed for normal scapular location and muscle balance in order to determine the effect on scapular stability and rusi, and to provide basic information for the rehabilitation of patients with shoulder pain. a total of 38 office workers receiving physical therapy at seoul h hospital, who voluntarily agreed to active participation, were included in this study. the stability exercise for the shoulder was performed two times per week, at 40 min per session, for a total of 6 weeks. the general characteristics of the subjects in the stability exercise group were as follows: 19 office workers (6 males and 13 females), mean age 36.2 5.5 years, mean height 168.0 8.1 cm, and mean weight 57.8 11.3 kg. on the other hand, the subjects in the manual therapy group had the following characteristics: 19 office workers (6 males and 13 females), mean age 35.8 4.1 years, mean height 167.2 7.3 cm, and mean weight 60.2 14.2 kg. the present study was approved by the sahmyook university institutional review board (syuirb2015-014). the objective of the study and its requirements were explained to the subjects, and all participants provided written consent, in accordance with the ethical principles of the declaration of helsinki. the scapular exercise for the shoulder joint was designed to correct the abnormal location of the scapula3. the exercise involved the upper trapezius, levator scapulae, suboccipital, sternocleidomastoid, and pectoralis major and minor muscles (all in a shortened state) in lengthening and stretching, with 10 sets of 10-s sessions. the following exercises were performed: isometric contraction in the supine position, retracting the subject s chin for deep cervical flexor enhancement; closed chain knee push-up for the serratus anterior; cow position and cat position for 10 sets of 10 s each to increase mobility of thoracic and cervical musculature; prone row and modified prone cobra, as suggested by arlotta et al.13, to deactivate the upper trapezius and maximize lower trapezius activation; cow position, cat position, modified cat position, dead bug position, and plank, at 10 sets of 10 s each for cervical, thoracic, and shoulder movement. the manual therapy program consisted of 23 min of soft tissue mobilization of the upper trapezius, levator scapulae, suboccipital, sternocleidomastoid, pectoralis major and minor, deep cervical flexor, serratus anterior, rhomboid, and middle and lower trapezius muscles, with prone thoracic mobilization, prone selected thoracic mobilization, cervical mobilization, and thoracic mobilization. the forward head horizontal distance (fhhd) for cervical stability was measured with the exbody somatometric system (pa-2010sm; steps system inc., the subjects were measured from the side in a natural position while wearing shorts and shirts; a marker was placed on the tragus and acromion process, and the forward head position was evaluated by measuring the distance between the tragus and acromion process. to assess changes in the rounded shoulder posture (rsp), the length was measured to 1/20 mm by using a vernier caliper. with the supine method, this was used to measure the length of the pectoralis major; however, it has good reliability (intraclass correlation coefficient, 0.88) with or without symptoms in the shoulder related to the effect of the scapular location on the shoulder joint14. an upper limb closed chain exercise test was used for the stability of the upper limb (sul)15. in the performance of the closed chain exercise test, the starting position, which had a width of 90 cm, was marked on the floor, and both hands of the subjects were placed on the marker dots in order to form a push-up position. to reduce changes in position, placement of one hand over the other was counted as one, performed for 15 s, and the number was counted. between test performances, the subjects were allowed a 1-min break; measurements were performed two times, and the mean value was used16. in this study, a portable rusi device (ugeo h60; samsung medison, seoul, korea) was used to examine the structural properties of muscles. ultrasound examination was performed at 612 mhz in two-dimensional b-mode linearity, at t8 level, r=0.77 (muscle thickness) for the lower trapezius structural examination17; an average of two repetitions was used to measure values. the spss 18.0 program (spss inc. the shapiro-wilk test was used to determine the distribution of the general properties and outcome measures of the subjects. the paired t-test was used to compare the pretest and posttest results of fhhd, rsp, sul, and rusi within each group, and the independent t-test was performed to compare the two groups before and after training in the scapular stability exercise group, the fhhd was 9.5 cm before the training and 7.8 cm after the training, which was statistically significant (p<0.001). the right-side rsp showed a statistically significant decrease of 0.6 mm (p<0.001). the left-side rsp showed a statistically significant decrease of 0.5 mm (p<0.001). the sul showed a statistically significant increase of 4.3 (p<0.001). in the manual therapy group, the right-side rsp showed a statistically significant decrease of 0.1 mm (p<0.001). the left-side rsp showed a statistically significant decrease of 0.1 mm (p<0.001). the scapular stability exercise group showed greater improvements than the manual therapy group in fhhd, left and right rsp, sul, and left and right lower trapezius in rusi (table 1table 1.comparison of shoulder stability and rusi within and between groups (n=38)parametersvalueschange valuessseg (n=19)mtg (n=19)sseg (n=19)mtg (n= 9)beforeafterbeforeafterbefore-afterbefore-afterfhhd (cm)9.5 2.47.8 1.98.4 2.38.2 2.31.7 0.80.2 0.2rt rsp (mm)10.9 1.910.3 1.89.7 2.09.5 2.00.6 0.30.1 0.1lt rsp (mm)10.5 2.09.9 1.89.2 2.19.0 2.10.5 0.30.1 0.1sul (numb)9.5 3.213.7 2.88.8 3.59.3 3.74.3 1.20.5 0.5rusi in rt lt (mm)3.6 0.93.9 0.93.3 1.23.4 1.20.3 0.20.1 0.1rusi in lt lt (mm)3.4 0.83.7 0.83.1 1.13.2 1.10.3 0.20.1 p<0.05,** p<0.001: significant difference within the group, p<0.05, p<0.001: significant difference between groups; sseg: scapular stability exercise group; mtg: manual therapy group; fhhd: forward head horizontal distance; rsp: rounded shoulder posture; sul: stability of the upper limb; rusi: rehabilitative ultrasound images; lt: lower trapezius; lt: left; rt: right). p<0.05,** p<0.001: significant difference within the group, p<0.05, p<0.001: significant difference between groups; sseg: scapular stability exercise group; mtg: manual therapy group; fhhd: forward head horizontal distance; rsp: rounded shoulder posture; sul: stability of the upper limb; rusi: rehabilitative ultrasound images; lt: lower trapezius; lt: left; rt: right postural cervical pain decreases muscle endurance, and increases muscle fatigue and functional impairment18; thus, working in an upright sitting position affects muscle length and tension to maintain low muscle activation19. in this study, the fhhd was 9.5 cm before the training and 7.8 cm after the training, a decrease of 1.7 cm that was statistically significant (p<0.001), in the scapular stability exercise group. in the manual therapy group, the fhhd was 8.4 cm before the training and 8.2 cm after the training, a decrease of 0.2 cm (p<0.05). the scapular stability exercise group showed greater improvement than the manual therapy group in the fhhd. if the forward head position is severe, the distance between the tragus and acromion process increases; if the distance decreases, deep cervical flexor activation increases, and sternocleidomastoid and anterior scalene muscle activation decreases, thereby stabilizing the cervical position. in the forward head position and round shoulder position, the upper trapezius and pectoralis major and minor have increased activity, inducing scapular and thoracoscapular position change, which causes abnormal cervical alignment and decreased shoulder stability20. the upper, middle, and lower trapezius, and serratus anterior muscles are involved in shoulder joint stabilizing motion21. therefore, in this study, isometric contraction was applied to enhance the upper, middle, and lower trapezius and serratus anterior strength in shoulder stabilizing exercises. as a result, the right-side rsp was significantly decreased by 0.6 mm (p<0.001), and the left-side rsp was significantly decreased by 0.5 mm (p<0.001). the sul was 9.5 before the training and 13.7 after the training, a statistically significant increase of 4.36 (p<0.001), in the scapular stability exercise group. the scapular stability exercise group showed greater improvements than the manual therapy group in the sul and left and right rsp. these results are considered to be due to the prone row and modified prone cobra, which were performed to minimize the upper trapezius activity and maximize the lower trapezius activity. according to rusi, if lower trapezius muscle activation increases, then the muscle bulk changes22. day and uhl22 applied repetitive arm raises on 14 normal subjects in their 20s, and found considerable differences in the thickness of the lower trapezius (p<0.01). in this study, the right-side lower trapezius in rusi was significantly increased by 0.3 mm (p<0.001), and the left-side lower trapezius was significantly increased by 0.3 mm (p<0.001) in the scapular stability exercise group. the scapular stability exercise group showed greater improvement than the manual therapy group in the left and right lower trapezius in rusi. the increases in muscle thickness in the scapular stability exercise group indicate increases in muscle mass and strength. this study provides basic material to aid in the development and promotion of individualized stability exercises, which can be applied in the work environment to improve shoulder stability in office workers. a limitation of this study is the generalization of the results because the results are based on a selected group of participants office workers with shoulder pain.

[ purpose] to examine the clinical effectiveness of scapular stability exercise on shoulder stability and rehabilitative ultrasound images in office workers. [subjects and methods] thirty-eight subjects were randomly divided into a scapular stability exercise group (n=19) and a manual therapy group (n=19). subjects in the scapular stability exercise group performed a scapular stability exercise designed to correct the abnormal location of the scapula, at 40 minutes per session, two times per week, for 6 weeks. forward head horizontal distance, rounded shoulder posture, stability of the upper limb for the shoulder, and rehabilitative ultrasound images were evaluated before and after 6 weeks. [results] after the intervention, both groups showed significantly decreased forward head horizontal distance and rounded shoulder posture, with significantly improved stability of the upper limb and rehabilitative ultrasound images. forward head horizontal distance, rounded shoulder posture, stability of the upper limb, and rehabilitative ultrasound images showed greater improvements in the shoulder stability exercise group than in the manual therapy group. [conclusion] scapular stability exercise can improve shoulder stability and the thickness of the lower trapezius in rehabilitative ultrasound images of office workers, and could be useful in clinical rehabilitation.

PMC5140788

pubmed-1091

pre-eclampsia (pe) is a pregnancy associated disorder known by hypertension and proteinuria. the etiology of pe is not fully understood and a great number of mechanisms are proposed as the disease pathophysiology; however, the only definite cure of this syndrome is delivery. it is a general consensus on the role of disruption between vascular generation and anti-angiogenic responses in creating pe. in addition, immune mal-adaptation hypothesis suggests that pe is the result of an inappropriate regulation of the normally t helper 2 deviated response during the pregnancy. in this way recent reports suggest that pe is associated with a th1 predominant profile while activation of the immune system leads to alteration in cytokine profile and defect in the acquisition of invasive phenotype by trophoblasts in pe patients. the first 2 stages of disease cause dysfunction in uteroplacental perfusion and oxidative stress while the 3 stage of pe is due to the release of inflammatory and angiogenic factors, which could lead to maternal endothelial damage and systemic inflammatory response. cytokines, growth factors, and adhesion molecules have been proposed as important mediators for successful placentation as well as endothelial function. over past decades, multiple analyses of cytokines provided substantial insight into the key players of the maternal immune system involved in pe. tumor necrosis factor- (tnf-) is an inflammatory cytokine produced by human uterine and placental cells at the early and late stages of gestation and promotes the regulation of trophoblast growth and invasion. furthermore, tnf- could inhibit deeply integration and invasion of trophoblasts in maternal endometrium, which leads to pe. interleukin-15 (il-15), which is also a proinflammatory cytokine, has profound effects on natural killer (nk) cells and their cytotoxicity activation. regarding to the role of nk cells in the pathogenesis of pe, il-15 could be a key player in development of disease. interleukin-10 (il-10) as an anti-inflammatory cytokine is produced by some subpopulations of t lymphocytes, monocytes, macrophages, and cytotrophoblasts. production of this cytokine is considered to play an important role in maternal immune tolerance of the fetus in normal pregnancy. in this study, we compared the serum levels of tnf-, il-15, and il-10 in iranian pe women with normotensive ones. the study was a case-control study, in which serum samples of 84 pregnant women were studied. 44 pe (cases) and 40 normotensive (controls) pregnant women were enrolled in this study. these 2 groups were selected among the women admitted to a university associated hospital of tehran university of medical sciences. pe patients were diagnosed by hypertension (blood pressure 140/90 mm hg) and proteinuria (at least 2+on dips teak examination or 300 mg/24 h on at least 2 occasions 6 h apart) after the 20 week of gestation. the pe women were under the supervision and treatment of obstetrics and gynecology specialist during pregnancy. the normotensive control group consisted of healthy women with uncomplicated pregnancy who referred for normal routine check-up examinations to a university associated hospital. pregnant women with pre-gestational diabetes mellitus and chronic hypertension were excluded from the study. 5 ml of venous blood sample were taken from both groups before beginning of the active phase of labor. serum levels of tnf- and il-10 were measured using a sandwich elisa test due to manufacturer's instruction (bender medsystems, austria). the levels of il-15 were assayed by using il-15 sandwich elisa kit (r&d systems, minneapolis, mn). in above mentioned elisa kits routine procedures were done in this order; coating the plate with capture antibody, blocking the plate, adding standards, and unknown samples, washing, adding the biotin conjugated specific antibody, washing, applying enzyme-linked streptavidin, and finally adding chemical substrate. optical density of color chemicals that produced in the wells of the plate were read and the concentrations of cytokines were measured according to plots. the serums that their cytokine levels were beyond the upper limit of the kit were diluted for assessment. for all mentioned cytokines, standard curves were plotted and the concentrations were calculated according the manufacturer's instruction. student's t-test was used for comparison between serum levels of two groups. p value there was no statistically significant difference related to age and gestational age at the time of sampling between two groups; however, there were higher systolic and diastolic pressures in pe group compared to normotensive one (p values: 0.01 and 0.03 respectively for systolic and diastolic blood pressures). the women with pe showed significantly higher serum concentrations of tnf- and il-15 (p values: 0.001 and 0.01 respectively) relative to the control group. in comparison, levels of il-10 in the serum of normotensive pregnant women were significantly higher than pe patients (p value=0.01). clinical characteristics of the preeclamptic and normotensive women serum levels of tumor necrosis factor- in preeclamptic (pe) and normal subjects. each bar represented 44 pe and 40 normotensive pregnant women serum levels of interleukin-15 in preeclamptic (pe) and normal subjects. each bar represented 44 pe and 40 normotensive pregnant women serum levels of interleukin-10 in preeclamptic (pe) and normal subjects. results of this study demonstrated that in women having pe, compared to women with a normal pregnancy, inflammatory th1-type responses are increased; while anti-inflammatory responses are decreased. the higher levels of pro-inflammatory cytokines (tnf- and il-15) and lower levels of il-10 in the pe group suggest an increased inflammatory status in pe during last months. sharma et al. and xie et al., in agree with our results, found that the level of inflammatory cytokines such as tnf- increased significantly in preeclamptic patients compared with health controls. furthermore, laskowska et al. in consistent with us, indicated that tnf- increased in pe patients and suggested this cytokine may be play a role in pathogenesis and consequences of pe. in general, these studies demonstrated that tnf- is a potent pro-inflammatory cytokine, its primary biological activity includes inflammation and it may contribute to the abnormal placental invasion. however, afshari et al. and jonsson et al. observed no significant changes of tnf- in pe women compared to normal pregnant women.. showed upraised serum levels of il-15 in pe cases compared to normotensive ones. in line with this finding, el-baradie et al. in their study indicated that serum levels of il-15 and il-16 were elevated in pe relative to normotensive pregnant women. in contrast lu et al. represented not elevated levels of il-15 in pe subjects compared to normal women. in normal pregnancy, it seems that in pe th1-type cytokines such as tnf- and ifn- induce trophoblastic apoptosis, inhibit differentiation and invasion of trophoblast, and finally, may be involved in the incomplete invasion of trophoblast to spiral arteries; pathologic processes that are integral parts of pe. our findings showed higher levels of il-10, which is an anti-inflammatory cytokine in sera of normal pregnant women. in concordance with our results, sharma et al. showed that il-10 was decreased significantly in pe patients compared to normal pregnant women. inversely, bakheit et al. and xie et al. found higher serum levels of il-10 in pe women and jonsson et al. observed no significant difference in il-10 levels between normotensive and pe women. these contradictory results of various studies could be related to sampling in different stages of pregnancy. pe as an inflammatory process starts from the first steps of placentation; however, this inflammatory grade lasts until parturition. consequently, upraised levels of pro-inflammatory cytokines in our study may be the perquisite of pe. recognition of early detectable inflammatory markers could be a great help to predict and observe pe patients more accurately.

background: pre-eclampsia (pe) is a pregnancy associated disorder characterized by hyper-tension and proteinuria. the first 2 stages of pe cause dysfunction in uteroplacental perfusion and oxidative stress while the third stage of pe is due to the release of inflammatory and angiogenic factors, which could lead to maternal endothelial damage and systemic inflammatory response. in this study, we compared the serum levels of tumor necrosis factor- (tnf-), interleukin-15 (il-15), and interleukin-10 (il-10) in pe and normotensive women. materials and methods: serum samples of 84 pregnant women (44 pe and 40 normotensive) were evaluated for tnf-, il-15 and il-10 by sandwich elisa assay. results:the women with pe showed significantly higher serum levels of tnf- and il-15 (p=0.001 and 0.01 respectively) in comparison with normotensive pregnant women. conversely, the serum levels of il-10 in normotensive women were significantly higher compared to pe patients (p=0.01). conclusion: the results of this study demonstrated that inflammatory t helper 1-type responses are increased in pe women compared to normotensive pregnant women.

PMC3917129

pubmed-1092

it is estimated that 6~8% of the children, and 4% of the adult have immunoglobulin (ig) e-mediated hypersensitivity to food ag. the prevalence of food allergy has increased rapidly across the world in last few decades. research in the area of food allergy has advanced rapidly in recent years. however, the etiology and pathogenesis of food allergy are not fully understood. symptoms of food allergy vary from slightly abdominal discomfort to life-threatening anaphylactic shock reactions. food allergy reactions involve not only the intestinal tract, but other body systems as well, such as the skin, airway and cardiovascular system. the gastrointestinal tract has been described as the body's largest immunologic organ. a single epithelial layer lines the gastrointestinal tract and receives multiple daily exposures to a variety of proteins from foods and microorganisms. although antigen in the intestine exposures are complicated and frequent, the result of these exposures is tolerance or development of allergy when proteins do not luminal digested completely. m cells in peyer's patches can take up particulate antigens and deliver them to dendritic cells. soluble antigens are thought to cross the epithelium through transcellular or paracellular routes directly leading to t cell or macrophage encounters. the timing of initial exposure to a food allergen also likely influences the development of tolerance. oral antigen dose also seems important in determining which of two distinct effector mechanisms mediates the development of tolerance. in animal models, high doses of antigen lead to lymphocyte anergy or clonal deletion .. haptens are low molecular weight chemicals (usually less than 500 daltons), which are low reactive organic molecules that can bind to proteins and peptides, rendering them allergenic. allergic reactions to chemical haptens occur, in the overwhelming majority of cases, as an inflammatory skin reaction to direct contact with the hapten. the key feature of food allergy is a th2-predominant allergen-specific immune response, with the production of ige antibodies specific for the food allergen. the t cells of t-helper (th)2 phenotype are known to be involved in the development of allergic disease. th1 cells release type 1 cytokines such as interferon (ifn)-, while the major cytokines secreted by th2 cells are interleukin (il)-4, il-5, and il-13. these cytokines play an important role in the production of antigen-specific ige and in mucus secretion, muscle contractility, and eosinophilia. thus, the activation of th2 cells is a critical step in the immune mechanisms of food allergy. yet it still remains unclear what are the initial steps of intestinal sensitization in human beings. the hygiene hypothesis postulates that limited exposure to bacterial and viral pathogens during early childhood results in an insufficient stimulation of t helper (th)1 cells, which in turn can not counterbalance the expansion of th2 cells and results in a predisposition to allergy. while yielded conflicting results also raising the possibility that this model may be something of an over simplification. immunologic adjuvants are often included in vaccines to stimulate the immune system's response to the target antigens. cholera toxins, freund's adjuvant, etc are necessary in developing allergic animal models. there is a causal relationship between the increasing environmental pollution and the fast increasing of allergic diseases. the exogenic and endogenic noxious agents contributing to the total environmental load are primarily acting through immunotoxic, sensitizing and neurotoxic mechanisms in animal experiments and in humans. beside classic allergic-triggering factors, toxic environmental agents (formaldehyde, industrial and traffic smog, wood preservatives, microbial toxins, additive-rich food, nicotine, alcohol, pesticides, solvents, amalgam-heavy metals) are increasingly incriminated as causal factors for the complex symptomatology. studies showed that the intestinal mucosal barrier permeability is essential to prevent antigen uptake, while there are conflicting results concerning allergic diseases in inflammatory bowel diseases (ibds), some studies suggest an increase of atopic diseases, whereas others have noted no difference from control populations. one explanation for the obviously increase in atopic disease in developed countries over the last 50 years has been the hygiene hypothesis; a reduced exposure to pathogenic microorganisms. hapten exposure via other surfaces such as the skin and airways might also be important in promoting atopic disease. the hapten-atopy hypothesis was put forward that oral and cutaneous exposure to chemicals generally and to haptens in particular, may have also contributed to the increased prevalence of atopic disease. consistent with this hypothesis it is apparent that over 40 years, with the huge increase in atopic diseases, there has also been an increase in dietary hapten exposure through processed food, formula milk and oral antibiotic and drug uses. local lymph node activation and increased total serum ige levels are suggested to be predictive parameters of airway hypersensitivity caused by low molecular weight (lmw) chemicals. studies showed that increased total serum ige after topical sensitization is associated with immediate-type specific airway reactivity after inhalation challenge in bn rats and thus may be a valuable parameter in testing for respiratory sensitization potential of lmw compounds. other studies compared rates of atopic dermatitis between patients with allergic contact dermatitis arising out of individual fragrance chemicals with known oral/cutaneous exposure against exclusively cutaneous exposure. their results showed that patients allergic to individual fragrances with dietary exposure have reduced rates of atopic dermatitis. this may indicate that patients with atopic dermatitis have heightened oral tolerance to dietary haptens, in contrast to the known close association of atopic dermatitis with food-protein allergy. interactions with foreign proteins/haptens in the gastrointestinal (gi) tract have a tolerogenic influence on interaction elsewhere such as in the skin. so they speculate that hapten exposure through the gi tract in the form of formula milk, antibiotics and food additives, through the skin in the form of skin care products and through respiratory tract in the form of airborne chemicals, will be potential to hamper any epithelial tolerance mechanisms to self-proteins and peptides, which may predispose to atopy/protein allergy while at the same time the haptens may induce self-tolerance. trinitrobenzene sulfonic acid (tnbs) is a chemical hapten that binds to tissue proteins and is capable of stimulating cell-mediated immunity. as a strong experimental sensitizer, tnbs was used in vitro in induction of allergic contact dermatitis, tnbs is a classical skin contactant which can induce delayed hypersensitivity reactions when applied to the skin because it haptenates body proteins with trinitrophenyl (tnp) groups and renders such self-protein immunogenic to the immune system. while, when tnbs is introduced into the colon of susceptible mice via intra-rectal instillation, it induces t cell-mediated immune response in the colonic mucosa, in this case leading to a massive mucosal inflammation characterized by the dense infiltration of t cells and macrophages throughout the entire wall of the large bowel, tnbs-colitis is regarded as thl t cell-mediated inflammation. another study showed that intratracheal (it) inoculation of 2,4,6-trinitrobenzene sulfonic acid (tnbs) led to maximal ear swelling 24 hr after challenge on the ear with 2,4,6-trinitrochlorobenzene (tncb) in carrier. the possibility was speculated that the alveolar macrophages in the lung possess a similar capability for antigen presentation of hapten in the induction of allergic contact dermatitis as does the langerhans cell. while it is still not clear whether tnbs as a representative hapten can combine the food proteins and play an important role in the inducing of food allergy, further research is needed to reveal the underlying mechanism. the intact protein antigens absorption into the intestinal tissue is regarded to be a prerequisite in the development of intestinal sensitization. most food allergens are water soluble glycoproteins with molecular weight from 10-75 kd and stable proteins that are resistant to the intestinal digestive effects, and may be absorbed in a relatively intact form to be able to trigger an immune response. examples are ovalbumin (ova) and milk casein protein. as a model food antigen chemical haptens, in contrast with food proteins, are low molecular weight (usually<500 d) and have the ability to bind with proteins or peptides, rendering them antigenicity. with the increases of atopic diseases, dietary hapten exposure has distinctly increased in different ways, such as processed food, oral antibiotic, formula milk and drug use. contact dermatitis to chemical haptens may occur when direct contact with the haptens, while there are rarely studies about the reactions to haptens on other epithelial surfaces being reported. cutaneous hapten exposure may also be important in the development of atopic dermatitis, one possible mechanism by which haptens interfere with protein tolerance is through their known ability to covalently bind to peptides and proteins and thus alter their immunogenic profiles. thus, this modifications may cause atopic diseases, and most of the data are form experimental studies on contact allergy. if haptens do bind to skin proteins, then it may possibly be expected that these chemicals would also bind similarly to food proteins. it is still unknown about how hapten exposure on different epithelial surfaces such as the intestine, and the role of hapten in the pathogenesis of food allergy. further experimental studies about the effect of hapten on oral tolerance to food proteins are needed .

there has been a significant increase in the prevalence of allergic diseases especially over the past 2 to 3 decades. however, the etiology and pathogenesis of food allergy are not fully understood. in recent years, with the huge increase in atopic disease, there has also been an increase in dietary hapten exposure. allergic reactions to chemical haptens occur, in the overwhelming majority of cases, as an inflammatory reaction in the skin to direct contact with haptens. while reactions to haptens on other epithelial surfaces have only rarely been investigated; it is still not clear whether haptens can combine the food antigens and play a role in the induction of food allergen-related inflammation in the intestine. further research is needed to reveal the underlying mechanism.

PMC3336897

pubmed-1093

be that as it may, 5% of all cases of syncope are usually of cardiac origins and are thus known as cardiac syncope. pulmonary embolism is a relatively rare cause of cardiac syncope, which may explain why it is frequently ignored.1 the variability of presentation sets the patient and clinician up for potentially missing the diagnosis. presentation with abrupt onset of pleuritic chest pain, shortness of breath, and hypoxia is rarely the case. studies of patients who die unexpectedly of pulmonary embolism reveal that they complained of nagging symptoms often for weeks before death related to pulmonary embolism. forty percent of these patients had been seen by a physician in the weeks prior to their death.2 when syncope is the presenting symptom of pulmonary embolism, it should raise the clinical suspicion for a massive clot burden or saddle embolism requiring prompt treatment. a 52-year-old man was referred to our hospital because of two episodes of syncope within a fortnight. he had suffered from pleuritic chest pain and dry coughs for the previous two weeks, and antibiotics prescribed for pneumonia by an internist failed to prevent the exacerbation of the symptoms. the internist subsequently referred the patient to a cardiologist, who subjected him to an exercise stress test (to rule out coronary artery disease), during which he developed non-sustained ventricular tachycardia. the following day, he suffered a one-minute syncope while talking a walk in his yard. he was, therefore, once more referred to our hospital by the internist to evaluate ventricular tachycardia as a cause of syncope. when the patient arrived at our hospital, he had anxiety and had a respiratory rate of 30/min, pulse rate of 120/min, and supine blood pressure of 100/60 mmhg. additionally, the patient s lungs were clear and his heart sound and lower limb were normal. chest x-ray revealed mild cardiomegaly, dilated right descending pulmonary artery, and oligemia in the right lung (figure 1). on echocardiography, the left ventricle was normal; however, the right heart was dilated and trabeculated and there was also right ventricular dysfunction. the patient denied any history of deep vein thrombosis and mentioned only a six-hour car travel more than three weeks earlier. his family history for venous thromboembolism was weakly positive and one of his nephews had a history of pulmonary thromboembolism. at this point, lung ct angiography was performed to rule out pulmonary embolism as the main cause of acute right ventricular enlargement. the ct angiography demonstrated bilateral pulmonary artery thrombosis from the first division of the right and left pulmonary arteries to the distal ones (figures 2&3). with a diagnosis of pulmonary embolism, the patient underwent thrombolytic therapy with recombinant tissue plasminogen activator (r-tpa) 100 mg over a 90-minute period, which brought about immediate improvement in the patient s condition. the following day, his symptoms improved dramatically, his respiratory rate decreased, his o2 saturation rose from 85% to 98%, and his blood pressure remained stable in different positions. ct angiography showed improved right ventricular function and decreased right ventricular size and pulmonary arteries (figures 4&5). the diagnosis of acute pulmonary embolism is amongst the most challenging problems encountered in clinical practice. despite the awareness amongst physicians of the risks associated with a delay in the diagnosis of pulmonary embolism, it was not initially considered in this case because of the following reasons: firstly, syncope is an uncommon presentation of pulmonary embolism, occurring in only 14% of patients. the most common symptoms are dyspnea (82%), pleuritic chest pain (49%), and cough (20%).3 secondly, the patient had no history of deep vein thrombosis. the exact number of the symptoms and signs of deep vein thrombosis in patients with a diagnosis of pulmonary embolism is not clear, but one study reported deep vein thrombosis in 62% of patients with pulmonary embolism.4 and thirdly, our patient had severe right ventricular enlargement with severe trabeculations. the occurrence of non-sustained ventricular tachycardia in the exercise test gave rise to other diagnoses, including arrhythmogenic right ventricular dysplasia, which justifies the syncope and right ventricular dilation. although arrhythmogenic right ventricular dysplasia is more common in younger patients, we considered it as one possible diagnosis because of the patient s having developed non-sustained ventricular tachycardia during the exercise test and his dilated right ventricle with trabeculations.5 the patient experienced three episodes of presyncope in the ccu, but his rhythm during these episodes was sinus bradycardia. we concluded that ventricular tachycardia was not the mechanism of syncope/presyncope and performed ct angiography to confirm pulmonary embolism as the culprit for the syncope. the patient had a weak family history of pulmonary embolism, hinting at the presence of hypercoagulable states such as activated protein c (apc) resistance, factor v leiden, anti thrombin iii deficiency, and protein c and s deficiency. for the evaluation of hypercoagulable states, family history remains the most rapid and cost-effective method of identifying a predisposition to venous thrombosis.6 whereas management with anticoagulants alone is typically sufficient for low-risk patients, more aggressive treatments such as thrombolysis, embolectomy, and inferior vena cava (ivc) filters are recommended for higher-risk patients. thrombolytic therapy should be considered in all patients with massive pulmonary embolism and hypotension associated with deep vein thrombosis in the popliteal area or higher.7 the main indications for thrombolytic therapy include ongoing hypoxia, respiratory distress, pulmonary hypertension, and right heart failure because thrombolytic therapy often achieves an impressive and almost an immediate clinical benefit in these clinical settings.8 the patient s right ventricular failure and progressive course prompted us to candidate him for thrombolysis. the other option in management would have been embolectomy, which is performed either with a catheter or during open heart surgery. embolectomy via open surgery is reported to have improved the survival rate to 89% in twenty-nine emergent pulmonary embolism cases.9 although interventional catheter-based catheter fragmentation and suction embolectomy are also available for pulmonary embolectomy in some institutions, open surgical embolectomy is indicated in patients who have contraindications to thrombolytic therapy, persistence of thrombi in the right heart or pulmonary arteries after pulmonary embolism, or severe hemodynamic compromise with cardiovascular collapse. early surgical treatment must also be considered in patients whose course deteriorates in spite of aggressive medical therapy depending on the series. the overall mortality rate after pulmonary embolectomy varies from 16% to 46%, with a mean mortality rate of 26%. these findings suggest that earlier surgical intervention may result in improved survival.10 we can conclude that surgical embolectomy is warranted in patients with severe hemodynamic instability on the basis of clinical impression, after other causes of hemodynamic collapse have been ruled out. an experimental catheter embolectomy used in cardiac catheterization appears promising.11 ivc filters are an appropriate option for patients with high bleeding risks. the insertion rate of ivc filters has increased in recent years; this increase, however, has occurred without proven improved safety and efficiency.12 another important point in the management of this patient was the optimal duration of anticoagulation. despite the fact that the patient had a weak family history of hypercoagulable states, a proper course of action required his management as a case of idiopathic venous thromboemboli and with an indefinite duration of oral anticoagulant (warfarin) therapy.13

a pulmonary embolus clogs the artery that provides blood supply to a part of the lung. the embolus not only prevents the exchange of oxygen and carbon dioxide but also decreases blood supply to the lung tissue itself, potentially causing the tissue to die (infarct). a 52-year-old man presented with syncope and anxiety. he had sinus tachycardia and dilated right ventricle with trabeculations. a differential diagnosis of arrhythmogenic right ventricular dysplasia and pulmonary embolism prompted ct angiography, which revealed a bilateral massive pulmonary embolism. the patient was treated successfully with thrombolytic drugs.

PMC3466862

pubmed-1094

vitamin d is a fat-soluble vitamin with hormonal functions, and concentrations of serum 25-hydroxyvitamin d (s-25(oh)d) are largely determined by ultraviolet light exposure, dietary intake, and supplementation. however, recent evidence from various research reports has suggested a role in the progression of chronic diseases such as diabetes mellitus and cardiovascular diseases but with inconsistent results [2, 3]. vitamin d deficiency is an important public health problem worldwide, and although the middle east receives ample sunshine, people living in this region (15 to 36n) have high prevalence of hypovitaminosis d across all age groups [5, 6]. this has been attributed to several factors including limited exposure to sunlight, low dietary intake of vitamin d2, dark skin color, clothing, and religious practices that restrict sunlight exposure [6, 7]. the high prevalence of diabetes and obesity in the united arab emirates (uae) has motivated concern about hypovitaminosis d, since several studies have reported increased vitamin d deficiency in persons with obesity and type 2 diabetes mellitus (t2d) compared to healthy controls [5, 8]. most studies have focused on vitamin d status and the incidence of diabetes, while few have evaluated the relationships between vitamin d status and various pathophysiological and metabolic parameters in patients with t2d. although some epidemiological studies have shown s-25(oh)d to be associated with insulin sensitivity and glucose tolerance, the relationships between vitamin d status and metabolic parameters in various ethnic groups are not well known, a situation that leaves ample scope for further investigation into the relationship between vitamin d status and clinical variables in patients with obesity and t2d. information about vitamin d status in adults in the middle east with obesity and t2d is scarce. furthermore, the relationship between hypovitaminosis d and different metabolic parameters has not been studied in depth. to our knowledge no studies have been published about the population residing in the uae with obesity and t2d. the present study was designed to determine vitamin d status and search for possible associations between serum vitamin d concentration and metabolic parameters in persons with obesity and t2d in this country. this cross-sectional study was done at rashid center for diabetes and research, a tertiary diabetes care facility in ajman, uae. the uae is situated in the northern hemisphere between 22 and 26.5 north of the equator. a total of 2101 patients registered from december 2010 to december 2013 were reviewed based on the inclusion and exclusion criteria, and 309 men and women were randomly selected for data analysis. the inclusion criteria were uae nationality, age between 30 and 60, diagnosis of t2d, and body mass index (bmi) 30 kg/m. participants were excluded if they were diagnosed with type 1 diabetes and had a history or evidence of parathyroid or calcium related diseases, history or evidence of endocrine diseases including hyperthyroidism, hypothyroidism, adrenal disease, and pituitary disease, or history of major renal, liver, heart, blood, or neurological disease, as judged by the investigating physicians. all patients gave their written informed consent acknowledging the use of their data for the study as approved by the regional ethics committee of the ministry of health, uae. all patients were examined by a physician at their first visit to the center, and demographic data, medical history, presence of comorbidities, and medications used were recorded as part of standard clinical practice in the health care information system. a standard pretested questionnaire was completed by a subgroup of 154 participants assisted by a study staff member, in order to record information about outdoor exposure to sunlight, use of sunscreens, clothing, skin color (fitzpatrick scale), and intake of food sources rich in dietary vitamin d2. anthropometric measurements (height, weight, waist circumference (wc), and body composition) were also recorded. body weight and height were measured with an electronic balance and stadiometer (seca, hamburg, germany, capacity: max 250 kg, range: 110 cm/43 ins to 200 cm/79 ins) and recorded to the nearest 0.1 kg or 0.1 cm. body composition was determined by bioelectric impedance with an inbody-230 analyzer (biospace, dogok-dong, south korea). systolic and diastolic blood pressure were measured in the right arm while the participant was seated and after he or she had rested for at least 10 min. a fasting (12 hours) venous blood sample (8 ml) was collected and used to determine glycemic profile (fasting blood glucose (fbg), hba1c, and c-peptide), cardiometabolic parameters (serum cholesterol, triglycerides (tg), high-density lipoprotein cholesterol (hdl-c), low-density lipoprotein cholesterol (ldl-c), apolipoprotein a (apo a), apolipoprotein b (apo b), c-reactive protein (crp)), markers of calcium homeostasis (serum 25(oh)d, calcium, phosphorus, parathyroid hormone (pth), and alkaline phosphatase (alp)), and serum creatinine. all values were measured with a roche cobas 6000 analyzer (mannheim, germany). serum 25(oh)d was measured with an immunochemiluminescence method in a diasorin liaison analyzer (saluggia, italy). the analyzing laboratory participated in the vitamin d external quality assessment scheme (deqas). all parameters were measured at the same time or close to the date of s-25(oh)d determination. vitamin d status was recorded based on serum concentration of 25(oh)d as severely deficient (< 25 nmol/l), deficient (< 50 nmol/l), insufficient (< 75 normal distribution of all the data sets was confirmed by histogram plots, and the results were presented as the mean standard deviation. pearson's correlation coefficient was calculated to identify bivariate associations between s-25(oh)d and other covariates. additionally, the participants were classified into subgroups based on gender, medication use, glycemic profile, and fat mass to determine the strength of the relationships of metabolic markers with s-25(oh)d. we also stratified our sample into subgroups based on s-25(oh)d status for comparison with one-way anova, and the bonferroni method was used for post hoc comparisons. to evaluate predictors of 25(oh)d status we used regression analyses with age, bmi, wc, fat mass, ldl-c, total cholesterol, and tg. the criterion for statistical significance (two-tailed tests) was p 0.05. table 1 shows the participants ' responses to the questionnaire on factors affecting vitamin d status, that is, lifestyle, dietary intake, and vitamin d supplementation. seventy-nine percent of the participants had a skin score of 4 and 5, that is, brown to dark brown skin characterized by easy tanning. the dietary intake of foods rich in vitamin d2 and vitamin d3 supplementation are also shown. sixty-eight percent of the participants were on oral antidiabetic drugs only, whereas the rest were on both insulin and oral antidiabetic drugs. figure 1 illustrates s-25(oh)d status in participants with obesity and t2d and the distribution in men and women of the categories of vitamin d status according to cut-off values. (< 50 nmol/l) in 83.2% of the participants, and only 4.5% of them had a normal s-25(oh)d status (> 75 nmol/l) was higher in women than in men (p<0.05). the clinical characteristics of our participants and the associations of s-25(oh)d with different metabolic parameters are shown in table 2. the mean levels of fbg, hba1c, ldl-c, and crp were higher than the recommended target, and hdl-c levels were lower (ada guidelines). serum 25(oh)d was positively associated with age and negatively associated with weight, bmi, wc, and fat mass, whereas no association was evident with lean body mass. in addition, s-25(oh)d was positively associated with calcium and inversely related to pth and alp (p<0.01). the lipid profile and apo b level were associated with s-25(oh)d, but no significant association was observed between s-25(oh)d and blood pressure, glycemic profile, crp, creatinine, or apo a. we divided the participants into subgroups based on glycemic control (hba1c<7%, 7% to 9%, and>9%), gender, duration of diabetes (< 5, 5 to 10, 10 to 15,>15 years), and medication use (oral antidiabetics only versus insulin therapy plus oral antidiabetics) to search for further associations between these variables and vitamin d status. however, there were no significant differences between the quartiles, and no associations were found with glycemic profile (data not shown). the association between s-25(oh)d and hdl-c, ldl-c, total cholesterol, and tg was stronger in males (r=0.21, 0.36, 0.33, and 0.29, resp.) than in females (r=0.12, 0.09, 0.09, and 0.11, resp.), whereas the association with apo b was stronger in females (r=0.21 in women versus 0.06 in men). in addition, we found a significant association between s-25(oh)d and ldl-c (r=0.21), cholesterol (r=0.22), and tg (r=0.18) (p<0.01) in the subgroup of patients on oral antidiabetic medication only. table 3 compares the results for different metabolic variables across three categories of vitamin d status according to cut-off values for s-25(oh)d. there were no significant differences between these subgroups in any of the variables in the glycemic profile. the values for the cardiometabolic variables, that is, ldl-c, cholesterol, tg, apo b, and crp, decreased steadily in subgroup with 25-nmol/l higher s-25(oh)d. as s-25(oh)d status improved, calcium levels increased, whereas pth and alp levels decreased. linear regression analysis identified pth (= 1.67, p<0.001), calcium (= 45.6, p<0.001), and alp (= 0.21, p<0.001) as factors associated with serum vitamin d status. the main finding in this cross-sectional study is the very high prevalence (83.2%) of vitamin d deficiency (< 50 nmol/l), with a mean s-25(oh)d of 33.8 20.3 this was similar to the mean s-25(oh)d value reported for patients in saudi arabia with diabetes and obesity (35.5 30.6 nmol/l, 39.18 18.72 nmol/l) [5, 11]. however, our observed mean was far lower than the value reported for japanese patients with diabetes (42 17.7 nmol/l) and a sample of patients in the usa (57.15 the discrepancy between our results and the findings in other ethnic groups may reflect ethnic differences, lifestyle factors, and differences in the dietary intake of fortified foods. our results confirm and augment the body of evidence that vitamin d deficiency is alarmingly high among people in the uae with diabetes and obesity. in the present study there was no significant difference in vitamin d status between males and females (35.1 19.2 nmol/l versus 33.3 20.7 nmol/l), a finding consistent with an earlier study of people in saudi arabia with diabetes and obesity. nevertheless, severe vitamin d deficiency (< 25 nmol/l) was more frequent in females than the males (45.6% versus 37.3%). the higher percentage of severe deficiency may be attributable to differences between study populations in lifestyle factors, cultural practices, and fat mass [14, 15]. vitamin d is a nutrient that is derived from dietary sources, and up to 80% is produced by synthesis in the skin under the influence of ultraviolet-b radiation from sunlight. in the present study the low levels of s-25(oh)d may be a result of restricted exposure to direct sunlight, insufficient vitamin d intake, or both. forty-two percent of our participants were exposed to direct sunlight for less than 5 min/day, and they often avoided exposure in the afternoons due to high temperatures. about one-fourth (24.2%) wore a sunscreen before going outdoors, and all participants wore their traditional attire (an abaya for females and a kandoora for males) outdoors, which reduced the surface area exposed to direct sunlight. the black clothing (abaya) worn by female participants blocks 100% of ultraviolet-b radiation. moreover, darker skin produces less vitamin d than lighter shades of skin, and 79% of our participants had brown to dark brown skin. although the consumption of milk, yoghurt, and cheese was fairly high with 64% consuming these items 1 or 2 times per day, it is not known whether milk sold in the uae is adequately fortified with vitamin d. studies from the usa and canada show that fortified milk did not contain the amount of vitamin d claimed on the label. our participants consumed considerable amounts of fish but not the oily sea fishes that are rich in vitamin d3. hence, we assume that the frequency of consumption of foods rich in vitamin d2 may be insufficient to contribute to the daily recommended dietary allowance of 600 iu/day. some of our participants also reported consuming cod liver oil (17.6%) and vitamin d supplements (24.2%), but the average dose was 400 iu vitamin d3/day. our results indicate a positive relationship between s-25(oh)d and age, as supported by similar evidence in the middle east region [5, 6]. this relationship may be partly elicited by multivitamin supplementation in elderly patients in clinical practice, which may have contributed to increased s-25(oh)d in this age group. it is well established that obesity is associated with vitamin d deficiency, and our data confirm previous reports of a negative association between s-25(oh)d and bmi, fat mass, and wc [15, 21]. low levels of s-25(oh)d have been attributed to sequestration of vitamin d by the adipose tissue, dilution of ingested or cutaneously synthesized vitamin d in the enlarged fat mass, reduced release of vitamin d into the systemic circulation, and low exposure to direct sunlight due to reduced physical activity [15, 24]. serum levels of 25(oh)d correlated negatively with wc after adjustment for confounders such as bmi, fat mass, and age. as suggested by cheng et al. in 2010, the vitamin d system is known to be altered in persons with obesity, and this may have implications for the development of both obesity itself and its comorbidities. our study adds to the evidence that serum vitamin d status is not associated with the glycemic profile in emiratis with obesity and t2d. however, the association of serum 25(oh)d with c-peptide (r=0.17) and homa-ir (r=0.16) was significant (p<0.01) in the subgroup of participants who were using oral medications, whereas no association was observed with duration of t2d. previous studies have reported inconclusive results regarding the association between vitamin d status and hba1c [5, 8, 25], and the lack of a clear trend among different studies suggests that ethnicity may have an effect on this relationship. however, a randomized clinical trial to study the effect of vitamin d3 supplementation in patients with t2d found no effect on glycemic profile. our results confirmed the association between 25(oh)d, pth, and calcium that has been described in the literature. our findings also indicate that there are a negative relationship between s-25(oh)d and ldl-c, cholesterol, tg, and apo b and a positive relationship with hdl-c. similar associations with lipid profile parameters were found in 108 patients from iran with t2d. moreover, vitamin d was inversely related to atherogenic dyslipidemia in some studies but not in others. a review of 22 cross-sectional studies showed a positive association between vitamin d and hdl-c resulting in a favorable ratio of ldl-c (or cholesterol) to hdl-c [2729]. there was also consensus between studies on the negative relationship between vitamin d and tg. although there is no general agreement among interventional studies regarding the effects of 25(oh)d on lipid levels, it has been suggested that vitamin d can modify the lipid profile via both direct and indirect effects. vitamin d may decrease serum tg through a regulatory action that increases the activity of lipoprotein lipase in persons with obesity. in vitro studies have found that pth decreases lipolysis (by increasing the level of cystolic calcium) and increases the expression of fatty acid synthesis [32, 33]. calcium influences lipid levels by interfering with fatty acid absorption via the formation of insoluble calcium fatty complexes in the gut; this results in an increase in the conversion of cholesterol to bile acids. a strong association between s-25(oh)d and apo b was also observed in our study, as in an earlier report in normal adults. the association of s-25(oh)d with cardiometabolic parameters in our study population also appeared to be influenced by other factors such as the duration of diabetes (12.0 7.5 years) and bmi (36.9 6.0 kg/m). two particular strengths of our study are that we selected a fairly large sample and included individuals who comprised a homogenous emirati population of people with obesity and t2d who share a similar lifestyle. a potential limitation of this study was that the information on dietary intake was obtained from self-reports, which should be considered with due caution. the main finding of this cross-sectional study is the very high prevalence of vitamin d deficiency in our sample of the emirati population with obesity and t2d. serum concentrations of 25(oh)d were not associated with any particular characteristics of the glycemic profile but were strongly associated with bmi, wc, and fat mass, markers of calcium homeostasis and cardiometabolic parameter. although our study design was cross-sectional and no inferences should be drawn regarding causality effects, our findings, together with previous research in other settings, suggest that an adequate vitamin d status may help prevent the development of cardiometabolic disease-related processes.

aim. to report vitamin d status and its impact on metabolic parameters in people in the united arab emirates with obesity and type 2 diabetes (t2d). methodology. this cross-sectional study included 309 individuals with obesity and t2d who were randomly selected based on study criteria. serum concentrations of 25-hydroxy vitamin d (s-25(oh)d), calcium, phosphorus, parathyroid hormone, alkaline phosphatase, glycemic profile, and cardiometabolic parameters were assessed in fasting blood samples, and anthropometric measurements were recorded. results. vitamin d deficiency (s-25(oh)d<50 nmol/l) was observed in 83.2% of the participants, with a mean s-25(oh)d of 33.8 20.3 nmol/l. serum 25(oh)d correlated negatively (p<0.01) with body mass index, fat mass, waist circumference, parathyroid hormone, alkaline phosphatase, triglycerides, ldl-cholesterol, and apolipoprotein b and positively (p<0.01) with age and calcium concentration. waist circumference was the main predictor of s-25(oh)d status. there was no significant association between serum 25(oh)d and glycemic profile. conclusion. there is an overwhelming prevalence of vitamin d deficiency in our sample of the emirati population with obesity and t2d. association of s-25(oh)d with body mass index, waist circumference, fat mass, markers of calcium homeostasis and cardiometabolic parameters suggests a role of vitamin d in the development of cardiometabolic disease-related process.

PMC4211253

pubmed-1095

the core symptoms of adhd are inattention, hyperactivity, and impulsivity. in most descriptions of adhd in the 1980s and the early 1990s, it seemed that hyperactivity had to be present in every case as a striking symptom, but with growing knowledge of adhd it became evident that not all patients-in particular girls-present hyperactivity. since 1994, with the fourth edition of the diagnostic and statistical manual of mental disorders (dsm iv) three types of adhd have been differentiated: combined type (6 or more symptoms of hyperactivity/impulsivity as well as of inattention); inattentive type (6 or more symptoms of inattention); hyperactive/impulsive type (6 or more symptoms of hyperactivity/impulsivity). after puberty, hyperactivity often changes to inactivity; therefore, adhd often is not accepted as a diagnosis in adults. adults with adhd seem to have a problem with willpower: activity can be overexerted, but if a task is not attractive to the person, this results in a lack of effort. or, inattention can change to hyperfocussing, when the person is attracted by a task. with adults, differing patterns of comorbidity and symptom heterogeneity pose new conceptual, diagnostic, and treatment challenges. while core symptoms are often overt problems in children, in adults subtler executive dysfunction appears. even though the growing consensus is that adhd is a disorder of executive functions (ef), the details of the ef/adhd connection remain unclear and may be far more complex in adults. in table i examples are given for the changes of the 18 dsm-iv symptoms from childhood to adulthood. the 6-question adult self-report scale -v1.1 (asrs-v 1.1) screener (http://www.hcp.med.harvard.edu/ncs/fpdir/adhd) is a subset of the who's 18-question adult self- report scale-v1.1 (asrs-v1.1) symptom checklist. four or more checkmarks in the darkly shaded areas may indicate that the symptoms are consistent with adult adhd (figure 1). wender developed a set of characteristics to specify both childhood criteria and current adhd symptoms. he pointed out affective lability, which is not mentioned in dsm-iv, as a frequent symptom in adult adhd. the prevalence of adhd in children according to dsm-iv criteria varies from 2.4% to 19.8%. the largest follow-up study, which investigated 197 chinese children after 15 years, showed a rate of persistence of 70%: generally, the degree of prevalence (1% to 6% in adults) depends on the view of the reporter in the initial assessment. most instruments consist of some form of self-report, and in adulthood it is often not possible to ask information of parents or persons with a close relationship to the patient. patients with adhd are often not aware of their symptoms, or do not report the severity of symptoms. neurochemical, neurophysiological, and radiological attributes were noted, proving, in particular, abnormalities in the dopaminergic and noradrenergic system. genetic investigations showed increased evidence that genetic components were present in most cases of adhd, which is now seen as the psychiatric disease with the highest heritability. neuroimaging studies with magnetic resonance imaging (mri), photon-emission tomography (pet), and single photon-emission computed tomography (spect) suggest involvement of striatal structures in adhd. molecular genetic studies described an involvement of a polymorphism of the dopamine transporter (dat) 1 gene in adhd (eg, a higher rate of homozygosity of the 10-repeat allele in the 3 ' untranslated region of exon 15 of the dat gene on chromosome 5p15.3). with regard to the suspected striatal impairment in adhd and the known effect of methylphenidate on the dat mainly localized in this section of the brain, since the end of the 1990s dat has been investigated in patients with adhd. this is carried out by using radioactive marked ligands which are known to bind effectively with the dat system. a group of investigators from boston used altropane marked with iodine-123; our group from munich and philadelphia used the cocaine derivative trodat-1 marked with technetium 99 m. both studies showed a clearly higher availability of dat in the striatum of adult patients with adhd compared with the normal healthy controls. while dat availability was found to be raised to 17% in the investigations using trodat-1 compared with the control collective (figure 2), the group using altropane demonstrated a rise of 70% in 6 patients; this percentage was reduced to around 30% in a larger group of 19 patients on continuation of the altropane study (spencer t, personal communication). meanwhile, a rise in dat availability was also detected in the basal ganglia of children with adhd by means of an [i] n-(3-iodopropen-2-yl)-2-carbo-methoxy-3-(4-chlorphenyl) tropane (ipt)-spect investigation, following initial results with n--fluoropropyl-2 -carboxymethoxy-3 -{4-iodophenyl} tropane (fp-cit). interestingly, a rise in the dat could not, be detected in a spect investigation with -cit26; this could be due to the extremely slow kinetics of -cit (measurement 1 day after application) or another specificity of this radiotracer, which also binds with serotonin transporters and possibly holds other substructures of dat compared with altropane, fp-cit, ipt, or trodat-1. our own initial results revealed that the dat was raised not. only in the hyperactive-impulsive and combined type, but also in the inattentive type of adhd (figure 3). it, may be deduced from a neurochemical view that with an increase in dat, which transports dopamine back from the synaptic cleft, less dopamine is available in the synaptic cleft of dopamine-dependent neurons. the results obtained by our group showed not, only the impairment of dat but also reported for the first, time in vivo and intraindividually in patients with adhd, that impaired metabolism can be improved with methylphenidate: on administration of 5 mg 3 times daily it was seen that there was a clear reduction in dat availability in all patients after a period of 4 weeks (figure 2). with this very low dose, most of these patients demonstrated a lower concentration of dat than did the control group. in a study involving six children with adhd, an ipt-spect investigation confirmed a marked reduction in dat density under administration of methylphenidate. regarding normal healthy individuals, other authors were able to show evidence of a similar reduction in dat under methylphenidate in a pet investigation with [c-ll] cocaine. in conclusion, the spect investigations on dat confirmed the supposition that with adhd an impairment is present mainly in the dopaminergic system. our initial results show that, nonresponders to methylphenidate do not reveal raised dat in striatum prior to therapy, whereas the responders seem to have a high dat availability (figure 4). it should be noted, for possible diagnostic applications of spect, that the dat concentration decreases with increase of age and that nicotine may influence dat availability. the lowering of dat with increasing age may be an explanation for our observation, that most, adults need lower doses of methylphenidate compared with children and adolescents. nicotine seems to have a similar effect on the dat as do stimulants (figure 3). investigating potential reasons for the lower elevation in the trodat-1 study compared with the altropane study, we found a subgroup of patients with relatively little increase in dat despite severe clinical impairments; further questioning of these patients revealed that all of them were cigarette smokers. comparison of 11 smoking nonmedicated patients with adhd with sex- and agematched nonsmoking drug-naive adults with adhd showed significantly higher dat density in the nonsmoking patients, despite higher adhd scores for the smokers. this finding suggests that nicotine may act, directly on dat in the same manner as stimulants. in a self-trial, dat availability was reduced by over 50% 5 hours after intake of 20 mg methylphenidate in a slow-release formulation; wearing a nicotine skin patch, equaling 10 to 20 cigarettes daily, for 5 hours. in the same subject 3 months later, an effect similar to that of methylphenidate was seen (figure 5), confirming the view that the lowering of dat after use of nicotine is not a sign of a neurochemical adaptation associated with chronic exposure to nicotine. further evidence comes from the reevaluation of a woman with adhd, who was smoking 15 cigarettes per day at, the time of first investigation with trodat-1, showing no remarkable elevation of dat; 4 weeks of intake of 3x5 mg methylphenidate led to a marked reduction similar to the other patients in this group. one year later, the patient stopped the nicotine and methylphenidate intake; 2 years after the first investigation she returned with increased complaints of adhd. at this time she underwent another trodat-1 spect scan, presenting with a 19% elevation compared with the first scan with nicotine and a 61% elevation compared with the second scan with nicotine and methylphenidate (figure 6). this finding is in accordance with the opinion that, the effect, of nicotine on dat does not result, in a persistent, loss of dat. in this context, it is of interest that an investigation with [i]-cit spect showed no altered striatal uptake in smokers versus controls, a potential parallel to the above mentioned findings of no dat elevation in adhd with this method. most patients need multimodal therapy: psychoeducation concerning the special aspects of adhd is essential. many patients have problems with their self-esteem due to a misunderstanding of the symptoms and a childhood with parents suffering from adhd-especially impulsivity-and they need additional psychotherapy. treatment with stimulants is the drug therapy of first choice and is approved in the usa for adults (dmethylphenidate and amphetamines); stimulants for adult adhd are as effective as in children. an investigation performed in the year 2000 in germany showed that only 0.024 of the adults registered in the public health system-that is 90% of the adult, population-was treated with methylphenidate in germany at, this time (figure 7). that is about one out of 40 000 and includes all kinds of treatments, including for narcolepsy and other psychiatric diseases. in the treatment, of adults with adhd we start with a daily dose of 5 mg, reaching 15 mg methylphenidate after 14 days of treatment. titration up to 40 mg follows, if the patient needs more than the initial end point of the 15 mg dose. but more than 70% of our patients did not tolerate doses above 30 mg without having marked side effects. with higher doses, they also described a state resembling the impairments they experienced before the treatment. most, of them had a good stabilization with a combination of methylphenidate in a dose up to 20 mg and additional antidepressants. with all patients when methylphenidate has no positive effect on depressive or other comorbid symptoms, we start an additional medication after 4 weeks of treatment. some patients do not tolerate methylphenidate well; they feel more depressed after starting the methylphenidate medication, but they are not as inattentive as before the beginning of therapy; in this situation we change from methylphenidate to amphetamines; some patients have more benefits from this kind of stimulants acting in dual ways. when selecting the additional medication it, is important to regard the comorbid disorder. we experienced good clinical response with the following medication: depression: venlafaxine 18.75-150 mg/d depression combined with severe distraction: amisulpride 25-100 mg/d ocd: sertraline 50-100 mg/d borderline syndrome: venlafaxine 37.5 mg -150 mg/d slight autistic symptoms: fluoxetine 10-20 mg/d the use of tricyclic antidepressants is problematic, as the long-term effect is not as good as that of treatment with new antidepressants. this substance does not influence the dopamine in the striatum, but in the prefrontal cortex, where dopamine transport is mediated by norepinephrine transporter.

the persistence of attention deficit hyperactivity disorder (adhd) into adolescence and adulthood has now been accepted as a clinical entity. the rate of prevalence among adults is assumed to be from 2% to 4%. with increasing age, a symptom change has to be considered; disturbance of attention becomes more prominent, whereas hyperactivity often diminishes or changes to inactivity. neuroimaging studies show a high striatal dopamine transporter (dat) availability in most adults with adhd; this can be reduced by stimulants. nicotine seems to have a stimulant-like action on the dat. in most adults with adhd, therapy has to be multimodal, combining psychotherapy and medication. methylphenidate is the first-line drug in adult adhd; further options are amphetamine and noradrenaline reuptake inhibitors. nonresponders to methylphenidate seem to have no elevated dat availability prior to therapy. combination with other psychiatric disorders occurs frequently in adults with adhd; in these patients additional pharmacological treatment with special regard to the comorbid disease is recommended.

PMC3181750

pubmed-1096

esophageal cancer is the 7th most common cancer in iran and it also is among the ten most common cancers in the world. iran is a well-known region with a high prevalence for this cancer, mostly from the north and north east of the country. in the national report of the registered cancer cases in iran in 2007, esophageal cancer with an incidence rate (asr) of 6.4% stood for the 7th most common cancer. esophageal cancer is the 7th leading cause of cancer related death in iran and has the 7th highest disability-adjusted life years (dalys) among all cancers in iranian population which had been estimated to be about 15920 years in year 2002. its prevalence is increasing as the population is getting old; its highest incidence rate is around the age of 60-80 .however, according to a report by yavari and et al. iran s highest incidence was between the age of 50 and 70 based on their studied population. its prognosis is usually undesirable and median survival after esophagectomy for patients with localized tumor is 15-18 months, and 5-year survival rate is 20-25%. the risk of esophageal cancer increases with constant exposure to stimulants, hot beverages, alcohol and smoking. it has a higher incidence rate in society with a low economical state, severe malnutrition, low vitamin, fruit and vegetable intake and also high consumption of alcohol and cigarettes in various studies conducted in china, relative risk of patients with a family history of esophageal cancer was around 2.9% of cases. its prevention is based on early diagnosis, special attention to modifiable risk factors, particularly tobacco, alcohol and fast food consumption. the symptoms of esophageal cancer usually appear 3 to 4 months prior to diagnosis and such symptoms vary depending on initial involved segment of esophagus. dysphagia is seen in more than 90% of cases while a weight loss over 5% of body weight occurs in 5% and its presence is associated with a worse prognosis. less common symptoms such as hoarseness, cough and progressive lesions with invasion to other organs result in symptoms such as hematemesis, hemoptysis, dyspnea and cough secondary to bronchoesophageal and tracheoesophageal fistula. considering most studies on statistic for epidemiologic indexes in esophageal cancer are implemented in other parts of the world, we aim this study which is to determine epidemiologic index of esophageal cancer patients provides better information on epidemiological characteristic of such cases and also a reliable base for future complementary studies. this is a cross-sectional prospective study based on medical history and other collected data from 238 esophageal cancer patients referred to omid hospital between 2001 and 2010. no distant metastases, 2. a karnofski score of 70 and over for the performance status. at the beginning of study, informed consent was obtained from patients for neoadjuvant chemoradiation treatment. the collected data included age, sex, race, occupation, residential location, addiction history, alcohol and smoking habits, dysphagia grading (i, ii, iii, iv, v), weight loss, nausea and vomiting, lack of appetite and paraclinic tests: cbc, liver function tests, sonography or ct scan of abdomen, barium swallow and also anatomic location of tumor, lesion type in endoscopy, lesion length and also type and grade of tumor pathology. twenty two point three percent of patients were younger than 50 years and 77.7% were older. 63% were fars, 13% were turkmen and 24% were from other ethnic groups. regarding the occupation, 30% were farmers, 45% were housewives and 25% had other jobs; they came mostly (72.3%) from the rural areas. twenty percent (33.3% of males and 8.5% of females) had a history of smoking, 22.3% (31.5 of males and 14.6% of females) were addicted and 1.3% of patients had alcohol consumption (table 1). the most common anatomical site was the middle (53.4%), lower (44.5%) and upper (2.1%) segment of esophagus (table 2). considering clinical signs and symptoms, most patients (93.7%) complained about dysphagia over an average duration of 3.4 months. also 24%, 53% and 23% of patients had grade i and ii, iii, iv and v dysphagia, respectively (table 3). amongst patients whom their clinical symptoms were registered completely, 84% had weight loss i.e. 21% (1-5 kg), 17% (5-10 kg) and 16% more than 10 kg. nausea was recorded in 39% and vomiting in 27.7%. before treatment, anemia, leukopenia and thrombocytopenia were detected in 39%, 2.1% and 0.6% of cases, respectively (table 3). barium swallow results were abnormal in 65.5% and normal in 6.4%; it was not performed in 28.1% of cases. at the beginning of the study, all patients had an abdominal sonography with no metastases. on endoscopy, 51.3% of lesions were polypoid, vegetative and fungoid while in 48.7% were ulcerative, ulcerovegetative and infiltrative. the mean lesion length according to endoscopy and barium swallow was 5.7 cm; the tumor length was less than 5 cm in 52.5% and more in 47.5% (table 2). the most common pathology was squamous cell carcinoma with 99.1% prevalence. according to tumor grading, 34.2% were well differentiated, 51.3% were moderately differentiated and 14.5% were poorly differentiated (table 3). in this prospective cross sectional study, epidemiologic status of esophageal cancer was evaluated in a specific area i.e. the northeast of iran and cases were selected from patients who were referred to omid hospital for undergoing neoadjuvant chemoradiation treatment. the goal and reason for selecting this study group was to ensure that their data are usually precisely registered in the form of a protocol. the reported data in this study included: age, sex, race, location, smoking and addiction history. prevalent clinical symptoms including dysphagia (and its grade), weight loss, anemia, nausea and vomiting. many esophageal cancer reports belong to regions of the world where this type of cancer is considered prevalent. the incidence rate in the northern china, iran, and russia and around the caspian sea is 100 per 100,000 populations. the mean age of the patients was 59 years in our study. in recent report from cdc in iran the mean age at the time of diagnosis in u.s. is 69 years, whereas in our study the mean age was 10 years lower. considering that these patients were candidates for preoperative chemoradiation protocol; this difference is partially related to bias in patient selection. in another study the mean age of 190 esophageal cancer patients chosen for chemoradiation protocol, was 65 years. the effect of race on the incidence rate has been investigated in several studies. in cumings study which was performed on 1801 esophageal cancer (scc) patients in u.s, the incidence rate was 5 and 1.3 in 100,000 in both white and black population respectively. however, adenocarcinoma had a higher incidence rate amongst the whites (8 vs. 3.3 in 100,000). despite considerable distance between our center and golestan province, various studies have revealed that residents who are living around the caspian sea are at a greater risk for developing this type of cancer. possible reasons include a diet deficient in fruits, vegetables and animal proteins as well as dry and thick bread which consists of silica fibers; hot tea, smoking, drugs and burnt opium. smoking, drug and alcohol consumption are the main factors causing this type of cancer in western countries. however, few studies have shown no significant correlation between such factors and esophageal cancer. in the current study 19.7% of affected cases were smokers and 22.3% were drug abuser. study in babolsar, a northern city of iran, 19.3% had a positive smoking history but only 7.9% were addicts. smoking tobacco and drinking of alcohol fortunately in iran due to religious beliefs alcohol consumption is not popular, but smoking and drug abuse are most probably important factors. as reported by heeying kimm and et al. in korean men, alcohol and smoking are indecency associated with increased risk of esophageal cancer but they do not interact synergistically. considering the characteristics of developed tumors, it should be noted that adenocarcinoma has a very small portion in comparison to scc in esophageal tumors in our country. the incidence rate of adenocarcinoma has increased over the past two decades in western countries and at the moment it is more common than scc, for example only 40% of esophageal cancers in u.s. are scc. however in some regions of the world with a high incidence rate for this type of cancer, scc is more prevalent than adenocarcinoma. in developed countries where adenocarcinoma has drastically increased, this cancer is associated with reflux and obesity [13, 14]. amongst our 238 cases, other studies in iran have also confirmed the predominance of scc over adenocarcinoma. according to a study reported by farhoudi et al. 86.3% and 7.3% of cases showed scc and adenocarcinoma respectively. also considering that the current study was performed on patients who had undergone surgery after chemoradiotherapy, only cases with mediastinal esophagus involvement were investigated. in 53.4% of patients, tumors were localized in the middle third of esophagus and 43.3% in the lower third as described by hajian studies. in farhoudi study in mashhad the lower third was also considered as the most common site. in the current study, the lesion types considered as effective factors of prognosis and they were polipoid, vegetative and fungoid in 51.3% as well as ulcerative, ulcerovegetative and infiltrative in 48.7% of cases. in summary, scc comprised more than 99% of all esophageal cancers in our patients and this was also the prominent type in northeast of iran. in our patients ,

backgroundesophageal cancer is the 7th most common cancer in iran. the northern part of the country shows the highest incidence for this malignancy. in this study we present some epidemiological and clinicopathological characteristics of patients with esophageal carcinoma in this region. methodsin a cross sectional study, 238 esophageal cancer patients were enrolled in a prospective study of neoadjuvant chemo-radiation treatment in a 4-year period (2006- 2009). in an oncology clinic their epidemiologic characteristics and clinicopathological findings were registered in a preplanned file. data consisted of age, sex, race, occupation, residential location, smoking, addiction history, signs and symptoms, blood biochemistry profile, imaging and endoscopic findings. the data were analyzed with the spss software. resultsthe mean age of the patients was (55% female) 59 years. they were mostly fars (63%) and turkmen (13%). seventy two percent were residents of rural area, 20% were smokers and 22.3% were opium addict and its analogues. only 1.3% of patients consumed alcohol. the most common presenting symptom was dysphagia (93.7%), mainly grade iii dysphagia (53%). location of tumor in esophagus was in the middle third in 53.4% and lower segment in 44.5%.sixty five percent of the patients had an abnormal esophagogram. on endoscopic evaluation the most common types of tumors were polypoid, vegetative and fungoid, respectively. mean tumor length was 5.7 cm. the most common histology type was squamus cell carcinoma (99.1%) which was moderately differentiated in 51.3% of these patients. no significant relationship was found between the grade of dysphagia with the macroscopic type and the pathologic grade of the tumor in this study. conclusionsquamous cell carcinoma comprised more than 99% of all esophageal cancers in our patients and this histological type is the prominent type in the northeast of iran. middle esophageal segment is the major site for this type of cancer which unfortunately most patients present with grade iii. dysphasia reflects the advanced stage of the disease.

PMC4551295

pubmed-1097

a small percentage of intracranial meningiomas appear to have a malignant potential [13]. these rare histological subtypes characterized as malignant (grade iii) and atypical (grade ii) exhibit aggressive clinical behavior and are less studied than the classic benign (grade i) tumors [2, 4]. objective of this study was to evaluate the incidence of atypical and malignant meningiomas and estimate their effect on recurrence, morbidity, and mortality. the postoperative behavior of the meningioma was followed and an effort was made to assess whether tumor's location, histopathological subtype, and the extent of surgical resection were predictive factors for recurrence. from 1992 to 2007, thirty-two patients with grade ii or iii meningioma, were treated surgically by the staff of the neurosurgical department of thessaloniki g. papanikolaou hospital. this study is a part of an observational retrospective study that comprised 353 patients with intracranial meningiomas who were operated at our department that period. hospitalization files, medical charts, and neuroradiological images obtained for the patients with meningioma, were analyzed with respect to clinical, operative, and laboratory pathological data. postoperative follow-up examinations, carried out by the department's neurosurgeons were also used for this study. the endpoint for recurrence was given by a computerized tomography scan (ct) or magnetic resonance image (mri), showing a meningioma at a location contiguous with the previous surgery. the patients were brought in for follow-up examinations and neuroimaging controls at 3 and 6 months after surgery and then every year. they were evaluated via clinical examination or when that was not possible, by telephone interview. living patients interviewed by telephone described their symptoms referable to brain tumor. for deceased, relatives supplied information and reported if death had occurred due to the tumor or by unrelated causes. the karnofsky scale was used to evaluate the patients ' outcome after the operation. tumors were divided into types based on world health organization criteria, with grade i subtypes characterized as meningothelial, fibrous, psammomatous, transitional, stroviloid, epithelioid, angiomatous microcytic, secretory, chordoid. grade ii meningiomas are mentioned as atypical and grade iii as malignant. for evaluating resection, this scale divides the extent of resection into 5 grades: grade i: complete removal;grade ii: complete removal with coagulation of dural attachment; grade iii: complete removal, without coagulation of dural attachment or resection of involved sinus or hyperostotic bone;grade iv: subtotal resection;grade v: decompression biopsy. grade i: complete removal; grade ii: complete removal with coagulation of dural attachment; grade iii: complete removal, without coagulation of dural attachment or resection of involved sinus or hyperostotic bone; grade iv: subtotal resection; grade v: decompression biopsy. for patients with resection grades iv and v, endpoint for recurrence was enlargement of the remaining tumor, shown on mri or ct. the spss system (version 15.0.1) was used for statistical analysis of the experiment's results data. meningiomas of histological grading ii and iii accounted for 8.8% of all tumors in our series (table 1). the average patient's age was 49 5 years at the time of surgery and the mean follow-up time was 4.3 years. follow-up control for patients with nonbenign meningiomas revealed that grade iii meningiomas recurred at a rate of 75% and grade ii meningiomas at a rate of 41.6% (table 1). survival rates for three, five, and ten years for these subtypes were much lower than the rest of the meningioma patients (table 2). three-year survival rate was 66.6% for atypical meningiomas, 33.3% for malignant meningiomas, and 86.3% for patients with grade five-year survival rate was 58.3% for atypical and 8.3% for malignant meningiomas, while for benign cases it raised to 74.3%. finally, ten-year survival rate was 33.3% for atypical and 0% for malignant meningiomas. on the contrary, six patients with malignant meningioma and two with atypical meningioma experienced tumor-related death. patients with grade ii resection (complete resection with coagulation of the dura) presented recurrence at 49% and grade iii (complete resection of tumor, without coagulation of the dura or removal of affected sinus or bone) patients recurred at a percentage of 67%, while 100% of grade iv and v patients developed tumor enlargement. the extent of surgical tumor removal was significantly associated with recurrence (p<0.001). atypical and malignant meningiomas appeared to be more complex in resection than grade i tumors. v in the simpson scale, while the rate of nontotal tumor resection for the rest was 23.8%. more commonly, parasagittal (25%), convexity (18%), and tentorium (15%) tumors appeared in our series. metastases appeared at the parotid gland, the thoracic spinal cord, and a different site of the brain. the majority (72%) of recurrences were observed within two years from surgery and 96% within five years from surgery. according to some studies, malignant meningiomas comprise between 4.7 and 7.2% of meningiomas, whereas atypical meningiomas account for 1.0 to 2.8% [1, 3, 4]. the most known factor associated with their appearance is cranial irradiation [1, 68]. though meningiomas are considered to be benign tumors, recurrence is observed frequently, with rates that vary between series [4, 8, 9]. the best accepted factor for prediction of recurrence is the 1957 simpson grading system for completeness of resection, which evaluated invasion of the venous sinuses, tumor nodules in adjacent dura, and infiltration of unresected bone by meningothelial cells as chief causes for recurrence. the recurrence rates that simpson refers to were 9% for grade i, 16% for grade ii, 29% for grade iii, 39% for grade iv, and 100% for grade v, respectively. these are peritumoral brain edema [2, 10], increase of neovascularization, cellular pleomorphism, nuclear atypia, the presence of macronuclei, atypical mitoses, necrosis, and brain invasion [8, 12]. in our series, recurrence was observed at a rate of 41.6% for grade ii tumors. for grade iii meningiomas, recurrence rate was 75%. besides the histological aggressive features we also found that recurrence was significantly associated with resection extent, according to simpson grading system. tumor location was not significantly related with meningioma reappearance, with the exception of certain locations whereas total resection was impossible. the rate of recurrence diminishes with time from operation. within 5 years from surgery, 96% of tumor reappearances three patients (37.5%) of the patients with malignant meningiomas developed a metastasis (parotid gland, thoracic spinal cord, and a different site of the brain). this shows that there is a high tendency of these tumors to develop metastases. the role of radiotherapy is well established in the treatment of atypical and malignant meningiomas [1, 1316]. patients with these types of tumor are sent for radiotherapy postoperatively, if total resection is not possible. this is more frequent at tumor locations with difficult or high-risk access, where the surgeon tends to be less aggressive. conventional external beam radiation is being used for years and stereotactic radiosurgery is reported for unresectable tumors [3, 17]. in addition to that, lower recurrence rates were observed in patients undergoing immediate postoperative radiation. another study supports that any tumor remnant radiologically demonstrated on postoperative imaging should be treated with radiosurgery and that postoperative radiotherapy after a first-time resection should be reserved for tumor remnants too large for radiosurgery and for which a second-stage operation is not planned. in our study, five patients with grades ii and iii meningiomas were sent for stereotactic radiotherapy after incomplete tumor resection. further regression of the tumor was reported (by the treating radiotherapists) in three of them. another important issue to be cleared is whether meningiomas sometimes progress histopathologically to a higher grade and develop aggressiveness after they are operated. some series have shown that up to 2% of all benign meningiomas transform into malignant. this is supported by other studies also [3, 7], but other writers reject it. in our series, we had one patient with grade i meningioma which progressed to grade ii according to the histopathological result of the second resection. atypical and malignant meningiomas appear to be distinct entities with poor prognosis, despite the surgical intervention. radical tumor excision is the most effective treatment, as it determines the patient outcome, and it should always be applied. in cases of subtotal resection, radiotherapy should be applied, as it seems to delay tumor's reappearance.

aim. to evaluate the frequency of atypical and malignant meningiomas and analyze recurrence rate; to study the morbidity and mortality of these tumors compared to benign meningiomas. methods. during 19922007, 16 patients with malignant and 16 patients with atypical meningioma were operated in neurosurgery department of thessaloniki's papanikolaou hospital. we analyzed tumor histology, location, and extent of surgical resection with respect to tumor reappearance and patients ' outcome and compared the behavior of benign versus nonbenign meningiomas. results. malignant meningiomas accounted for 4.4% (16 patients) and atypical meningiomas for another 4.4% of the series of patients (353) who were operated for intracranial meningioma at our department that period. malignant meningiomas recurred at a rate of 75% and atypical meningiomas recurred at a rate of 41.6%. there was a significant association of the histological classification (benign, atypical, and malignant) with recurrence (p<0.01). the recurrence rate after complete resection was 13.8%. the recurrence rate for incomplete resection was 46.7%. extent of tumor removal was significant to recurrence (p<0.001) for benign as well for atypical and malignant meningiomas. tumor location (p>0.05) was not significant to recurrence. conclusions. atypical and malignant meningiomas appeared at a rate of 8.8% of our series of intracranial meningiomas. they showed a significant predisposition to recur. these rare subtypes have higher morbidity and mortality rates than benign meningiomas. recurrence depends primarily on the extent of surgical removal and on the histological characterization of the tumor as atypical or malignant.

PMC4475582

pubmed-1098

amniotic band syndrome has many synonyms such as, congenital constriction rings, amniotic bands, limb body wall complex, adam complex this syndrome comprises a variety of anatomical abnormalities among newborns, and is associated with intrauterine struggling by the fetus in the uterus, thereby leading to deformations, malformations, or ruptures. amniotic band syndrome occurs in around 1:1,200 to 1:1,500 live newborns, but lack of correct diagnosis certainly underestimates the real occurrence rate. the clinical manifestations of amniotic band syndrome are extremely variable, and their extent may range from a single abnormality, like a constriction ring, to multiple abnormalities. almost all cases are sporadic, even though some rare evidences of familial cases have been described. limb constrictions occur most frequently, ranging in severity from deformity of the distal part of the limb to partial or total amputation. craniofacial abnormalities are the most serious type, because of the importance of the organs involved. visceral abnormalities are a rare form of the syndrome, among which gastroschisis is the most frequent type. generally the diagnosis is made by means of two-dimensional ultrasonography (2dus) at the end of the first or the beginning of the second trimester of pregnancy. three-dimensional ultrasonography (3dus) in rendering mode allows reconstruction of the surface of the fetus, thus, enabling spatial analysis. in cases of fetal malformation, only three case reports describing the use of 3dus for diagnosing amniotic band syndrome exist in the literature. in two of them, 3dus was used at the end of the first and the beginning of the second trimester, and only one case was in the third trimester. we present a case of amniotic band syndrome diagnosed in the 34 week, in which 3dus enabled clear analysis of this malformation, as well as better understanding and better family counseling. her prenatal care had begun late, and she had only undergone one ultrasound examination, in the 20 week, that had not shown any fetal abnormalities. all the prenatal laboratory tests were normal, and the patient said that she had not been making any personal use of medicines or using any illicit drugs, and that there were no cases of malformations or chronic diseases like arterial hypertension and diabetes mellitus among members of her family. 2dus showed normal fetal growth, with a weight prediction of 2.242 g, amniotic fluid index (afi) of 140, and anterior placenta. there was an accessory lobe on the left lateral posterior wall, and a membrane (amniotic band) was present between this lobe and the main placental mass. morphological analysis showed two bands adhering to the right forearm of the fetus, but with normal movements of this limb and its fingers [figure 1]. 3dus was performed using a multifrequency volumetric transducer (accuvix v20; samsung medison, seoul, korea) and clearly showed the spatial relationship between the bands and the body of the fetus, thus proving that the bands had really adhered to the forearm, but without strangling it [figure 2]. the 3d image allowed the parents to gain a better understanding of the condition and enabled better counseling toward a good prognosis for the fetus. the pregnant woman had her delivery scheduled as a caesarian section in the 38 week, and the postnatal phenotypic examination confirmed the diagnosis of amniotic band syndrome without injury to the forearm of the fetus. the newborn underwent surgery to remove the bands on the third day of life and was subsequently discharged in a good general condition. two-dimensional ultrasonography shows adherence of two amniotic bands to the right forearm of the fetus (white arrows). (a) and (b) three-dimensional ultrasonography in rendering mode, shows amniotic bands adhering to the right forearm of the fetus (white arrows), without constriction rings. two theories have been formulated in attempts to explain the pathogenesis of amniotic band syndrome. the streeter theory, which was accepted for a long time, takes the view that imperfect local embryonic development would indicate the abnormalities observed. the theory put forward by torpin in 1965 is the one that is most accepted. this author took the view that the problem begins because of rupturing of the amniotic sac, thereby separating the chorion and amnion, such that some of the amniotic liquid goes out into the chorionic cavity. the fibrotic strings formed from the chorion would prevent normal development of some anatomical parts of the fetus, thus resulting in different kinds of abnormalities. according to higginbottom et al., three mechanisms would explain the role of the bands in originating the malformations: a) interruption of the normal morphogenesis, for example, at the time of the facial fusion process; b) deformation due to compression of parts of the fetus (oligohidramnios) or interlacing of an anatomical part of the fetus by a band; or c) injury to a part of the fetus that had already formed, like in the cases with constriction rings around the limbs. one of the possible causes of an amniotic lesion is maternal abdominal trauma; other, less likely causes might be drug use or ammonites. some cases of amniotic band syndrome in patients that underwent amniocentesis on the beginning of the 2 trimester and chorionic villus sample have been described. rare descriptions of intrafamilial repetitions of constriction rings or congenital limb amputation give rise to the assumption that a genetic contribution could occur in some cases. in our case, the patient did not have any antecedents, so we could assume that this case had a sporadic origin. the late diagnosis was a consequence of prenatal care that had begun late and of an ultrasound scan performed in the 20 week that did not show any fetal abnormalities. 3dus enabled spatial analysis on the fetus proving that the bands had adhered to the surface of the right forearm of the fetus. moreover, 3dus provides proof that the prognosis for the fetus is good when it does not show any strangling of the limb, and it allows better understanding and better parent counseling. described a case of amniotic band syndrome diagnosed in the 14 week by 3dus, which was associated with severe fetus malformations, and in which the parents decided to terminate the pregnancy. likewise, hata et al. described two cases of this syndrome diagnosed in the 13 and 14 weeks, in which 3dus made it possible to conduct analysis on the spatial relationship between the bands and the fetus, as well as enabling counseling for the parents. the case of amniotic band syndrome with the latest diagnosis by 3dus (and the only one in the third trimester until now) was described by paladini et al. these authors described a case in the 28 week, similar to ours, but in their case a constriction ring was observed on the forearm of the fetus and was confirmed after birth. in summary, this is the second case description of late diagnosis of amniotic band syndrome by 3dus. this method was shown to be important for proving that the bands had adhered to the limb of the fetus and showing that the prognosis is good when no constriction ring is demonstrated. in addition, 3dus allowed better understanding of the pathology, better counseling for the parents, and a good prognosis for the newborn.

amniotic band syndrome is characterized by a build-up of bands and strings of fibrous tissue that adhere to the fetus and can compress parts of the fetus, thus causing malformations and even limb amputation while the fetus is still in the uterus. the clinical manifestations are extremely variable and their extent may range from a single abnormality, like a constriction ring, to multiple abnormalities. such abnormalities are generally diagnosed at the end of the first or the beginning of the second trimester using two-dimensional ultrasonography (2dus). three-dimensional ultrasonography (3dus) in rendering mode allows spatial analysis of the fetus and amniotic band, thus enabling better comprehension of this pathological condition and better counseling for the parents. there has not previously been any evidence to show that 3dus would be useful in cases of late diagnosis (third trimester) of amniotic band syndrome. in the present case, a primigravid woman underwent her second obstetric ultrasound scan in the 34th week, from which we observed two bands in contact with the right forearm, but with normal movement of this limb and its fingers. 3dus made it possible to see the spatial relationship of these bands to the fetal body, thereby confirming their adherence to the limb. after the birth, the prenatal diagnosis of amniotic band syndrome without limb constriction was confirmed. a surgical procedure was carried out on the third day after birth to excise the bands, and the newborn was then discharged in a good general condition.

PMC3352605

pubmed-1099

amyotrophic lateral sclerosis/parkinsonism-dementia complex (als/pdc) is a rare disorder endemic to guam island and the kii peninsula of japan. it shows a unique combination of parkinsonism, amyotrophy, and dementia, and the form of dementia, which shows a phenotype similar to alzheimer's disease (ad), is becoming predominant in the kii peninsula. although kii als/pdc shows several unique clinical features, including severe atrophy of the frontal and temporal lobes on magnetic resonance imaging (mri), decreased cerebral blood flow in the frontal and temporal lobes on single-photon emission computed tomography (spect), pigmentary retinopathy, and decreased cardiac i-meta-iodobenzylguanidine uptake, a postmortem examination is required for a definitive diagnosis. since biomarkers for als/pdc have not yet been identified, we analyzed cerebrospinal fluid (csf) biomarkers for kii als/pdc to discriminate it from other neurodegenerative disorders. we collected csf samples from 12 patients with kii als/pdc (6 men, 6 women, mean age 67.9 3.7 years, mean illness duration 5.63 years), nine patients with ad (2 men, 7 women, mean age 61.1 8.7 years, mean illness duration 1.92 years), 11 patients with als (8 men, 3 women, mean age 60.6 12.6 years, mean illness duration 1.1 years), nine patients with parkinson's disease (pd; 7 men, 2 women, mean age 71.3 2.2 years, mean illness duration 4.42 years), and five disease control patients (c; 4 men, 1 woman, mean age 36.2 20.3 years). all of the patients with kii als/pdc were natives of hohara village, which is an area of high als/pdc prevalence on the kii peninsula. we collected csf samples over 10 years; therefore, the period between csf collection and analysis was not standardized. the diagnosis of kii als was made according to the airlie house criteria, since the clinical symptoms of kii als are essentially the same as those of classical als. the diagnosis of kii pdc was made by a unique combination of levodopa-unresponsive parkinsonism and dementia, which are frequently accompanied by amyotrophy of the extremities and/or pyramidal tract signs. mini-mental state examination (mmse) was used for the evaluation of dementia and cut-off point was 23 (data not shown). the frontal lobes and/or temporal lobes of als/pdc patients showed atrophy on mri and/or a decrease of cerebral blood flow on spect. csf samples were immediately centrifuged at 1000 g for 15 min and stored at 80c with polypropylene tube. the total tau (t-tau), phosphorylated tau (p-tau), and amyloid beta (a) concentrations were measured with an enzyme-linked immunosorbent assay (elisa) kit using a monoclonal antibody specific for t-tau, p-tau, and a142 (innotest htau ag, phosphor tau(181p), and -amyloid (142), innogenetics, ghent, belgium). elisa assays were carried out using several samples from each group on the same plate in a randomized manner and were repeated using randomized samples in the same manner in plural times. a factorial anova was performed with csf-t-tau, csf-p-tau, and csf-a42, as dependent variables, with the diagnostic category (ad, als, c, kii als/pdc, and pd) using jmp 9.0. the ethics committee of mie university graduate school of medicine approved this study and the declaration of helsinki was followed. csf-a42, csf-t-tau, and csf-p-tau were compared between ad, als, c, kii als/pdc, and pd. the concentrations of csf-t-tau and csf-p-tau were significantly higher in ad (t-tau; 378.0 41.76 pg/ml; p<0.001, p-tau; 42.4 6.78 pg/ml; p<0.028) than in the other groups. however, the concentrations of csf-t-tau and csf-p-tau did not differ significantly between kii als/pdc, als, c, and pd (figures 1(a) and 1(b)). the concentration of csf-a42 was significantly reduced in ad (402.2 56.6 pg/ml; p<0.03) compared to als and c and relatively reduced in kii als/pdc (465.4 53.69 pg/ml; p<0.018) compared to als. most of the als/pdc patients had csf concentration values that fell below the cutoff based on c (figure 1(c)). the ratios of csf-p-tau to csf-a42 were significantly increased in ad (0.125 0.02) compared with kii als/pdc (0.043 0.02; p<0.008), als (0.035 0.019; p<0.003), pd (0.025 0.02; p<0.002), and c (0.027 0.09; p the concentrations of csf-t-tau, csf-p-tau, or csf-a42 were not related to the clinical parameters (age, sex, illness duration, or dementia) in the kii als/pdc patients. the number of c samples was small and the average age of control patients was low. generally, csf tau level gradually increase according to age and csf a is not affected by age. csf tau level of c samples was relatively low, but it was not significant. thus, the csf values of c were not comparable to those of other groups. nevertheless, the optimal cut-off values that discriminate c from ad were similar to those in previous reports [6, 7] in which a larger number of control samples were analyzed. csf tau level of kii als/pdc samples did not increase, although the average age of kii als/pdc group was older than that of ad group. the present study showed that csf-t-tau and csf-p-tau concentrations from patients with kii als/pdc were not increased compared to those in the other disease groups, and a42 concentration in the csf was relatively decreased. the ratio of csf-p-tau to csf-a42 segregates kii als/pdc from ad. because als/pdc is associated with tau pathology in the absence of amyloid plaques, the expectation was that als/pdc patients would not show the alzheimer's disease (ad) profile of decreased a42 but might show increased t-tau and/or p-tau in the csf. in general, decreased csf-a42 indicates plaque pathology, and increased csf-t-tau and csf-p-tau indicate axonal degeneration and tangle pathology, respectively. recently, the average age of onset of kii als/pdc is increasing and a deposition is conspicuous in autopsied patients. therefore, decreased csf-a42 may reflect a pathology in the most recent patients. we analyzed the precise tau isoform of over 10 patients with autopsy-proven als/pdc recently and identified a 3r+4r type, 4r>3r type, and a 4r predominant type. the glial tau pathology is particularly related to the 4r isoform, and we consider kii als/pdc to be a 4r-dominant tauopathy (unpublished data). noguchi et al. examined the concentrations of csf-t-tau, csf-p-tau, and csf-a42 in patients with progressive supranuclear palsy (psp) and corticobasal degeneration (cbd); the concentrations of csf-t-tau and csf-p-tau did not significantly differ between psp, cbd, and controls, and the concentration of csf-a42 was significantly lower in psp and cbd than in controls. the authors speculated that the absence of an increase of csf-t-tau and csf-p-tau concentrations might reflect 4r tau predominance and a reduction of csf-a42 might suggest deposition or mismetabolism of a. taken together, csf biomarkers of kii als/pdc might have similar properties to those of 4r tauopathy, psp, and cbd; however the relationship between tau isoform and csf tau level remains to be resolved. finally, the present findings, in which csf-t-tau and csf-p-tau concentrations were not increased and csf-a42 concentration was relatively decreased, suggest that csf analysis may be useful to differentiate als/pdc from ad, als, and pd. nevertheless there is a major limitation of the interpretation of the data. the size of each group is small, the age of the control group is much younger, and there were two populations in the ad group regarding the levels tau, p-tau, and a/p-tau. further study using groups with larger size of subjects is needed to confirm the proposed utility of the csf biomarkers.

objective. amyotrophic lateral sclerosis/parkinsonism-dementia complex is classified as one of the tauopathies. methods. the total tau, phosphorylated tau, and amyloid 42 levels were assayed in cerebrospinal fluid from patients with kii amyotrophic lateral sclerosis/parkinsonism-dementia complex (n=12), alzheimer's disease (n=9), parkinson's disease (n=9), amyotrophic lateral sclerosis (n=11), and controls (n=5) using specific enzyme-linked immunosorbent assay methods. results. total tau and phosphorylated tau did not increase and amyloid 42 was relatively reduced in kii amyotrophic lateral sclerosis/parkinsonism-dementia complex. relatively reduced amyloid 42 might discriminate kii amyotrophic lateral sclerosis/parkinsonism-dementia complex from amyotrophic lateral sclerosis and parkinson's disease, and the ratios of phosphorylated-tau to amyloid 42 could discriminate kii amyotrophic lateral sclerosis/parkinsonism-dementia complex from alzheimer's disease. conclusions. cerebrospinal fluid analysis may be useful to differentiate amyotrophic lateral sclerosis/parkinsonism-dementia complex from alzheimer's disease, amyotrophic lateral sclerosis, and parkinson's disease.

PMC4437332

pubmed-1100

sinus histiocytosis with massive lymphadenopathy known as rosai-dorfman disease (rdd) was first described in 1965 and identified as a distinct clinicopathologic entity in 196915). rdd is a rare histiocytic proliferative disorder of unknown etiology usually characterized by painless bilateral cervical lymphadenopathy3). the common clinical findings are fever, lymph node enlargement, leukocytosis, neutrophila, elevation of erythrocyte sedimentation rate (esr), hypergammaglobulinemia and weight loss. rdd is potentially systemic disease and may affect extranodal sites up to 43% of all rdd patients3). skeletal involvement as a sole manifestation of rdd is extremely rare, occurring in fewer than 2% of all rdd patients and arise most frequently in long bones such as tibia, femur, humerus, clavicle and bones of the hands2). we present a rare case of thoracic vertebrae compression fracture due to extranodal rdd without lymphadenopathy. a 15-year-old man presented with intermittent midthoracic back pain for about 6 months after slip down during basketball. he had no other symptoms such as fever, chills, malaise and lymph node enlargement. results of routine hematologic and biochemical laboratory tests include esr and c-reactive protein (crp) showed within reference ranges. a plain radiological examination of thoracic spine revealed collapse of t6 vertebrae with thoracic kyphosis and osteolytic lesion of t12 vertebra body(fig. 1a). magnetic resonance (mr) image of thoracic spine demonstrated collapse of t6 vertebrae with mild cord compression. the lesions involving t6 and t12 vertebral body showed slightly high signal intensity in t2-weighted mr images (fig. 1b-d) and homogenous enhancement in t1-weighted mr images after the administration of gadolinium(fig. 1e-g). preoperative computed tomography (ct) scan showed near complete collapse of t6 vertebra body and osteolytic lesion of t12 vertebra. 2) increased tracer activity was shown at the t6, t12 vertebra and epiphysis in whole body bone scan(fig. 1h) the patient underwent a total laminectomy of t6, left-sided facetectomy at t6/7, removal of bone tumor, anterior reconstruction with mesh and pedicle screw fixation at t5 and t7 for pathologic confirmation and stabilization. he was discharged from hospital at postoperative 5 days without complications and additional medications except some pain killers. histopathologic study of the lesion revealed fibro-osseous tissue showing focal infiltration of large histiocytes representing emperipolesis. these histiocytes were positive for cd68 and s-100, but negative for cd1a in immunochemistry study, that is compatible for rdd(fig. 3). a follow-up ct scan of thoracolumbar spine at one year after operation presented good status of bone fusion on t6 vertebra and bone formation of t12 vertebra body compared with preoperative ct scan that could be considered self-regression (fig. the present case is a rare example of compression fracture caused by isolated extranodal rdd involved the thoracic spine without lymphadenopathy. rdd typically affects the bilateral cervical lymph nodes causing painless lymphadenopathy characterized by fever, lymph node enlargement, leukocytosis, neutrophila, elevation of esr, hypergammaglobulinemia and weight loss. most patients with rdd are in their second or third decade of life and there is predominant in males and african-americans3). the etiology of rdd remains unknown; however it is implied that dysfunction of the immune system and an autoimmune process or viral infection such as epsteine-barr virus and human herpes virus type 6 might be the causative factors in some former studies7,9,10). in general, the common extranodal sites include skin, upper respiratory tract, and bone3). skeletal involvement as a sole manifestation of rdd is extremely rare, occurring in fewer than 2% of all rdd patients and usually occurs in the long bones such as tibia, femur, humerus, clavicle and bones of the hands or skull, and is multiple. some cases that involved spine were reported in former studies. some cases of rdd with intraspinal involvement in the form of intradural or epidural mass lesions causing neurologic deficit due to spinal cord compression1,8,16), and vertebra body involvement4,5,14) were reported. compression fracture due to spinal involvement of rdd had not been reported to the best our knowledge. rdd is a rare diagnosis with a variety of imaging manifestations13), so usually requires histology for diagnosis. skeletal lesions of rdd are typically intramedullary osteolytic with either poorly or sharply defined margins and are rarely sclerotic, that can be confused radiographically with langerhans cell histiocytosis (lch), eosinophilic granuloma or other lymphocyte proliferative diseases3,11). the lesion presents low or isosignal intensity on t1- and t2-weighted mr images and intense homogenous enhancement with contrast in most cases, but mr images can be various1). spinal rosai-dorfman disease similarly tends to be confused with meningioma when presenting as dural disease or as metastatic disease of another cause when presenting as vertebral body disease13). the differential diagnosis of a primary bone rosai-dorfman disease includes more common lesions, such as bacterial osteomyelitis, fungal infections such as histoplasmosis and langerhans cell histiocytosis. special studies such as histochemistry, immunohistochemistry, and microbiologic cultures can be very useful to reach the correct diagnosis. both histiocytes of rdd and lch are positive for cd68 and s100 in immunochemistry but histiocytes of rdd are negative for cd1a. rdd has a typical finding in histopathologic studies, that is emperioplesis; a phenomenon of phagocytosis of intact lymphocytes, plasma cells, erythrocytes or neutrophils. previous studies for treatment of rdd concluded that most patients with rdd do not require specific therapy and can expect spontaneous regression6,12). if the vital organ is compressed or other life threatening manifestations are existed due to direct nodal or extranodal involvement, surgical debulking and/or radiotherapy can be considered12). other treatment modalities such as chemotherapy including methotrexate and 6-mercaptopurin, high-dose alphainterferon, steroid or antiviral drugs had been attempted for treatment of rdd. standardized guidelines for surgical treatment have not yet been established nor have the indications for a surgical approach. the performed operative technique was not different from that used to treat thoracic vertebrae fractures. for this case, it is widely accepted that the goal of surgery for thoracic compression fractures is decompression of the neural elements, correction of spinal deformities, and fusion with stabilization. we identified bone formation of t12 vertebra body in the follow-up ct scan of thoracolumbar spine at one year after operation, that could be considered to be resolved spontaneously. skeletal involvement of rdd is unusual and sole manifestation of spine vertebra is extremely rare. if the young adult or adolescent have compression of vertebra body, rdd can be considered as our case. because of its rarity, various clinical manifestations and radiologic findings, it was difficult to differentiate from other disease such as langerhans cell histiocytosis or eosinophilic granuloma on radiologic study alone, so pathologic confirmation was needed. as some former reports did, we could identify that rdd generally has benign clinical course and can be resolved itself.

sinus histiocytosis with massive lymphadenopathy known as rosai-dorfman disease is characterized by painless bilateral cervical lymphadenopathy. extranodal manifestations are uncommon and spinal involvement is rare. a 15-year-old man presented with intermittent midthoracic back pain only. he had no specific findings on neurologic examinations, hematologic and biochemical laboratory tests. radiological examination of thoracic spine revealed collapse of t6 vertebrae with thoracic kyphosis and osteolytic lesion of t12 vertebra body. he underwent a removal of bone tumor, anterior reconstruction with mesh and pedicle screw fixation via posterior approach for pathologic confirmation and stabilization. histopathologic study of the lesion revealed focal infiltration of large histiocytes showing emperipolesis. immunochemistry stain of histiocytes was positive for cd68 and s-100 but negative for cd1a. this report presents a rare case and literature review of extranodal rosai-dorfman disease in thoracic spine.

PMC4206961